EA045357B1 - PROHEMOSTATIC PROTEINS FOR THE TREATMENT OF BLEEDING - Google Patents

Description

Technical field

The present invention relates to the field of medical treatment. In particular, the present invention relates to the field of treating, preventing or alleviating bleeding complications resulting from an altered hemostatic response.

State of the art

Millions of patients around the world need anti-clotting drugs (anticoagulants) to prevent stroke due to atrial fibrillation or to prevent and treat vein thrombosis. The mainstay of prevention has traditionally been coumarin-based oral anticoagulants that are vitamin K antagonists (VKAs), such as warfarin, acenocoumarol and phenprocoumon, which block the synthesis of vitamin K-dependent clotting factors. Other anticoagulants include target-specific anticoagulants such as like dabigatran, which inhibit the enzyme thrombin, which is a serine protease that converts soluble fibrinogen into insoluble fibrin filaments. Effective reversal of the anticoagulant effect using a so-called antidote is a prerequisite for the safe use of the drug. This is especially important given that, in the Netherlands alone, each year more than 10,000 patients treated with anticoagulants suffer severe bleeding episodes, including up to 2,000 deaths (Adriaansen H., et al.: Samenvatting Medische Jaarverslagen van de Federatie van Nederlandse Trombosediensten, 2011; 1-44).

Currently available anticoagulant-antidote pairs to prevent excessive anticoagulant effects are heparin-protamine and warfarin-vitamin K. Prothrombin complex concentrates (PCC, PCC) containing vitamin K-dependent coagulation factors II, IX, X (three-factor PCC) or II , VII, IX, X (four-factor PCC), and varying amounts of proteins C and S are administered to reverse warfarin-associated effects (see, e.g., Frumkin, Ann Emerg Med, 2013, 62: 616-626). Fresh frozen plasma and recombinant factor VIIa (rfVIIa) are also used as nonspecific antidotes in patients with major trauma or severe bleeding treated with low molecular weight heparin (Lauritzen et al., 2005. Blood 106: Abstract 2149, 607A-608A). Also described are protamine fragments (US Patent No. 6,624,141) and small synthetic peptides (US Patent No. 6,200,955) as antidotes to heparin or low molecular weight heparin, as well as thrombin muteins (US Patent No. 6,060,300) as antidotes to thrombin inhibitors. Prothrombin intermediates and derivatives have been reported as antidotes to hirudin and other thrombin inhibitors (US Patent Nos. 5,817,309 and 6,086,871). Despite the lack of reliable clinical data, dabigatran-associated severe bleeding is usually treated with a non-specific reversal agent, activated prothrombin complex concentrate (APCC) (Siegal et al., 2014. Blood 123: 1152-1158).

Recently developed direct factor Xa (FXa) inhibitors (DFXI), such as rivaroxaban, apixaban and edoxaban, are anticoagulants and may largely replace classical vitamin K inhibitors in the near future due to their rapid therapeutic action, ease of administration and lack of monitoring. due to weaker drug-food interactions and predictable pharmacokinetics. Direct factor Xa inhibitors are small molecule inhibitors that have been specifically designed to bind strongly to factor Xa and block its activity. Blood coagulation factor Xa is an important serine protease that is normally present in the circulating blood as an inactive ~60 kDa precursor (zymogen) of coagulation factor X (FX), but after damage to the vessel it transforms into the form of an active protease as a result of a complex sequence of protein activation steps , which is collectively called the blood coagulation cascade. Central to this system is the formation of a cofactor-protease complex known as the prothrombinase complex, which consists of coagulation factor Xa associated with cofactor factor Va (FVa), which assembles only on the negatively charged phospholipid membrane and converts inactive prothrombin into the active serine protease thrombin .

The main drawback of the use of direct factor Xa inhibitors (DFXI) is the lack of a strategy to specifically and adequately reverse their effect to prevent and control the potential life-threatening bleeding complications associated with their use in anticoagulant therapy.

Because direct factor Xa inhibitors bind both free factor Xa and prothrombinase-bound factor Xa (European Medicines Agency, 2008, Committee for Medicinal Products for Human Use (CHMP) evaluation report on Xarelto), procedure No. EMEA/N/C/000944. Document number: EMEA/543519/2008), to effectively restore hemostasis, it is necessary either to completely replace the circulating blood coagulation factor FXa, or to effectively remove inhibitory compounds from the blood.

Currently, there are no specific management strategies to prevent and control the potential life-threatening bleeding complications associated with available DFXI therapy. Along with life-saving and surgical therapies, nonspecific reversal therapy using 3-factor and 4-factor PCC may be considered based on limited evidence (Siegal et al., 2014. Blood 123: 1152-1158; Levi et al., 2014. J Thrombosis Haemostatis, published online May 8, 2014; doi: 10.1111/jth. 12599). A reversal strategy specific for direct factor Xa inhibitor bleeding is being developed that is based on a catalytically inactive form of recombinant FXa (andexanet alfa) that serves as a decoy for direct factor Xa inhibitors, binding and retaining circulating direct factor Xa inhibitors, thereby providing the ability of endogenous coagulation factor Xa to normally participate in blood coagulation (Lu et al., 2013. Nature Medicine 19: 446). A disadvantage of this approach is the need to administer high doses of andexanet alfa due to the fact that stoichiometric concentrations are required to achieve inhibition (400 mg IV bolus in phase III trials; Portola news release, March 19, 2014). In addition, because the half-life of direct factor Xa inhibitors depends in part on renal clearance, the amount of factor FXa decoy required to capture all circulating inhibitory molecules may be even higher in renal failure. This reversal strategy does not provide a rapid and direct procoagulant response because the response is dependent on the production of free endogenous coagulation factor Xa.

There is currently no adequate direct intervention strategy available to prevent and control the potential life-threatening bleeding complications associated with DFXI anticoagulation therapy.

The present invention solves this problem by providing, as an adequate treatment strategy for preventing and stopping potential life-threatening bleeding complications associated with anticoagulant therapy with DFXI, a recombinant protein containing or consisting of a mammalian, preferably primate, coagulation factor Xa polypeptide. preferably human, wherein said polypeptide contains a change in a region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and sp-320 of SEQ ID NO: 1, preferably between Glu-297 and Asp-320 of SEQ ID NO: 1, more preferably between Val-305 and Asp-320 of SEQ ID NO: 1, and most preferably between His-311 and Asp-320 or between His-311 and Tyr-319 of SEQ ID NO: 1, wherein said change is an insertion and/or substitution and/or deletion of at least one amino acid residue, preferably insertion of at least one amino acid residue. For purposes of clarity, the numbering of amino acid residues is based on the amino acid sequence of human coagulation factor X shown in SEQ ID NO: 1.

It was found that the catalytically active human blood coagulation factor Xa with an altered amino acid composition in the region between Gly and Asp, corresponding to Gly-289 and Asp-320 of the sequence SEQ ID NO: 1, participates in the coagulation cascade as a procoagulant and due to this, this factor has lower sensitivity to coagulation factor Xa inhibitors than blood coagulation factor Xa without the specified change in amino acid composition. The present invention provides a procoagulant antidote that is independent of the production of free, endogenous coagulation factor Xa and provides a direct reversal strategy to prevent and arrest potential life-threatening complications associated with anticoagulant therapy with DFXI.

The amino acid sequence of human coagulation factor X is given as SEQ ID NO: 1 and can be found in the GENBANK® database under accession number AAH46125.1 at <http://www.ncbi.nlm.nih.gov/protein/AAH46125.1 >. The numbering of amino acid residues in this sequence is based on the sequence of human coagulation factor X (FX). The coagulation factor X of the sequence shown in SEQ ID NO: 1 is a precursor containing a preproleader sequence (amino acid residues 1 to 40 of SEQ ID NO: 1), followed by sequences corresponding to the coagulation factor X light chain ( amino acid residues 41 to 179 of SEQ ID NO: 1), the triplet RKR (amino acid residues 180 to 182 of SEQ ID NO: 1), which is removed during secretion of coagulation factor X, and the heavy chain of coagulation factor X (amino acid residues 183 to 488 of SEQ ID NO: 1), containing an activation peptide (AP) (amino acid residues 183 to 234 of SEQ ID NO: 1) and a catalytic domain with serine protease activity (amino acid residues 235 to 488 of SEQ ID NO: 1) NO: 1).

Maturation of human coagulation factor X involves, among other things, proteolytic cleavage and post-translational modification in the Golgi apparatus. The mature FX protein is a two-chain molecule consisting of a heavy and a light chain that are linked by a disulfide bond (Uprichard et al., 2002. Blood Reviews 16: 97-110). Mature human coagulation factor X is activated by cleavage of the peptide bond on the heavy chain between Arg234 and IIe-235 of SEQ ID NO: 1, resulting in the coagulation factor heavy chain

- 2 045357 blood X a 52-residue activation peptide is released. The resulting light chain and shortened heavy chain linked by a disulfide bond constitute the activated FXa polypeptide.

The amino acid sequence of the human coagulation factor Xa light chain is presented in SEQ ID NO: 2. The amino acid sequence of the human coagulation factor Xa heavy chain is presented in SEQ ID NO: 3.

The term recombinant as used herein refers to a protein that is produced using recombinant DNA technologies known to those skilled in the art. Recombinant coagulation factor X or FXa polypeptide is also referred to as rFX (pFX) or rFXa (pFXa). In a preferred embodiment, the recombinant protein is not identical to the native protein, for example due to differences in amino acid composition and/or due to differences in post-translational modification such as glycosylation.

The term change as used herein refers to the insertion and/or substitution and/or deletion of at least one amino acid residue. In a preferred embodiment, said change is the insertion of at least one amino acid.

The expression recombinant protein containing a blood coagulation factor Xa polypeptide as used herein covers a protein that contains a recombinant protein of coagulation factor Xa, preferably originating from a mammal, more preferably a primate, and most preferably a human. This expression includes, for example, a recombinant mammalian precursor protein, such as human coagulation factor X, which upon processing and/or activation is converted into a recombinant mammalian coagulation factor rFXa polypeptide. Accordingly, in a preferred embodiment, the protein of the present invention is a recombinant mammalian, preferably primate, more preferably human, blood coagulation factor X, comprising an insertion and/or substitution and/or deletion, preferably an insertion, of at least one amino acid residue in the region of amino acid residues, corresponding region of amino acid residues between Gly-289 and Asp320 of SEQ ID NO: 1, preferably between Glu-297 and Asp-320 of SEQ ID NO:1, more preferably between Val-305 and Asp-320 of SEQ ID NO:1 and most preferably between His-311 and Asp-320 the sequences are SEQ ID NO: 1. Additionally, the expression covers a protein that contains one or more additional amino acid sequences in addition to the rFXa coagulation factor polypeptide, for example amino acid sequences that form a tag, for example a FLAG tag, described in EP0150126, and/or one or more identifying peptides.

Accordingly, in one embodiment, the recombinant protein comprising a coagulation factor Xa polypeptide of the present invention is a coagulation factor X polypeptide, wherein said polypeptide comprises a change in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320, preferably between His-311 and Asp-320 sequences SEQ ID NO: 1; wherein said change is the insertion of at least one amino acid residue.

The term factor X (FX) as used herein refers to the inactive precursor protein of factor X. One skilled in the art will recognize that factor X is also referred to as pre-FX protein. Herein, coagulation factor X comprises a coagulation factor Xa polypeptide.

The term mature factor X as used herein refers to the inactive factor X protein, which consists of a light and a heavy chain that are linked by a disulfide bond. This FX protein is also called factor X preproprotein (FX preproprotein) or factor X zymogen (FX zymogen). Herein, mature coagulation factor X comprises a coagulation factor Xa polypeptide.

In a preferred embodiment, the protein of the present invention comprises or is a mammalian coagulation factor Xa polypeptide, preferably a trait, more preferably a human or humanized coagulation factor Xa polypeptide, comprising an insertion and/or substitution and/or deletion, preferably an insertion of at least one amino acid residue in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1.

The term humanized as used herein refers to the replacement or humanization of preferentially external amino acid residues of a protein of one species with amino acid residues that are present in the human homologue of that protein, such that the proteins of the former species will be non-immunogenic or less immunogenic when administered to a human. Substitution of external residues in a preferred embodiment has little or no effect on the internal domains, or interdomain contacts between the light and heavy chains. The protein of the present invention is of non-human origin, preferably of mammalian origin, more preferably of animal origin, and is preferably humanized to reduce the immunogenicity of the protein in the human body.

- 3 045357

In a preferred embodiment, the non-human protein of the present invention comprises a humanized coagulation factor Xa polypeptide of a mammal, more preferably a primate, since the risk of antigenic response upon administration to a human is expected to be lower than for a protein of the present invention containing a non-humanized factor polypeptide blood clotting Ha.

In the context of humanized proteins, attention should be paid to the humanization method used for antibodies. This method uses available sequence information on human antibody variable domains contained in Kabat et al. (1987) Sequences of Proteins of Immunological Interest, 4th ed., Bethesda, Md., National Institutes of Health, updates to this database and other available databases (both nucleic acids and proteins) in the United States and other countries. Non-limiting examples of methods used to produce humanized antibodies include EP 519596, US Patent No. 6,797,492 and those described in Padlan et al., 1991. Mol Immunol 28: 489-498. For additional examples of methods for humanizing non-human proteins, see Sarkar et al., 2012, Journal of Lipids, Article ID 610937, pp. 1-13, where paraoxanase 1 was successfully humanized by altering the surface of the enzyme to mimic the sequence person.

The term coagulation factor Xa polypeptide refers to the catalytically active form of coagulation factor X. This coagulation factor Xa polypeptide is formed by the cleavage of the activation peptide from the heavy chain of mature coagulation factor X. The coagulation factor Xa polypeptide activates prothrombin, and thereby , stimulates blood clotting. In the context of the present invention, a protein is a coagulation factor Xa polypeptide if it is a procoagulant serine protease, and if the complete amino acid sequence of the protein contains stretches of consecutive amino acid residues or individual amino acid residues that correspond to stretches of consecutive amino acid residues or individual amino acid residues conserved among the factors blood clotting X in different species, as shown in Fig. 8. For example, a procoagulant serine protease is contemplated that contains stretches of consecutive amino acid residues that correspond to amino acid residues Cys-246 to Ala-250, Phe-260 to Leu-266, and/or Asp413 to His-423 of SEQ ID NO: 1, is a polypeptide of blood coagulation factor Xa. Said coagulation factor Xa polypeptide is preferably obtained by topical and/or topical application of the recombinant protein of the present invention. Methods for determining whether a protein is a serine protease are known in the art and include sequence comparison and the use of protease detection kits such as those manufactured by SigmaAldrich.

The term mammalian coagulation factor Xa polypeptide as used herein refers to a coagulation factor Xa polypeptide that is present endogenously in a mammal, preferably a primate, more preferably a human.

The term clotting inhibitor as used herein refers to an anticoagulant. The term coagulation inhibitor includes (i) agents such as heparin that stimulate antithrombin activity, (ii) coumarin-based oral anticoagulants that are vitamin K antagonists such as warfarin, acenocoumarol and phenprocoumon, and (iii) direct factor X inhibitors (DFXIs). , but is not limited to the above.

The term DFXI as used herein refers to direct factor Xa inhibitors, for example, oral direct FXa inhibitors. DFXIs are small molecule inhibitors that bind to coagulation factor Xa and block its activity. Group DFXI includes, but is not limited to, the following compounds: rivaroxaban (5-chloro-N-[[(5S)-2-oxo-3-[4(3-oxo-4-morpholinyl)phenyl]-5-oxazolidinyl]methyl ]-2-thiophenecarboxamide), apixaban (1-(4methoxyphenyl)-7-oxo-6-[4-(2-oxopiperidin-1-yl)phenyl]-4,5,6,7-tetrahydro-1H-pyrazolo[ 3,4c]pyridin-3-carboxamide), edoxaban (N'-(5-chloropyridin-2-yl)-N-[(1S,2R,4S)-4-(dimethylcarbamoyl)-2[(5-methyl- 6,7-dihydro-4H-[1,3]thiazolo[5,4-c]pyridin-2-carbonyl)amino]cyclohexyl]oxamide; 4methylbenzenesulfonic acid), betrixaban (N-(5-chloropyridin-2-yl) -2-[[4-(N,Ndimethylcarbamidoyl)benzoyl]amino]-5-methoxybenzamide), darexaban N-[2-[[4-(hexahydro-4-methyl1H-1,4-diazepin-1-yl)benzoyl ]amino]-3-hydroxyphenyl]-4-methoxybenzamide), otamixaban(methyl (2R,3R)-2-[(3-carbamidoylphenyl)methyl]-3-[[4-(1-oxidopyridin-1-ium-4yl )benzoyl]amino]butanoate), eribaxaban (2R,4R)-1-N-(4-chlorophenyl)-2-N-[2-fluoro-4-(2-oxopyridin-1yl)phenyl]-4-methoxypyrrolidine -1,2-dicarboxamide), letaxaban (1-[1-[(2S)-3-(6-chloronaphthalene-2yl)sulfonyl-2-hydroxypropanoyl]piperidin-4-yl]-1,3-diazinan-2- he, LY517717 (N-[2-[4-(1methylpiperidin-4-yl)piperazin-1-yl]-2-oxo-1-phenylethyl]-1H-indole-6-carboxamide) and 813893 (Ncyclohexyl-N- [2-[(4-methyl-1,3-thiazol-2-yl)amino]-2-oxoethyl]furan-2-carboxamide). Terms

DOAC (direct oral anticoagulant) and DFXI are used interchangeably in this text.

The term homologous as used herein refers to the amino acid sequence identity between two amino acid sequences, expressed as a percentage of the total length of the two amino acid sequences. Sequence identity is determined by comparing the identity of individual amino acid residues in an amino acid sequence with the corresponding amino acid residues in another amino acid sequence.

The term region as used herein refers to a stretch of consecutive amino acid residues limited by two amino acid residues. The numbering of amino acid residues used in this text is based on the amino acid sequence SEQ ID NO: 1.

The term insertion or insertion as used herein refers to the addition of amino acid residues to a specific region of a native coagulation factor Xa polypeptide that results in an increase in the number of amino acid residues in that region compared to the number of amino acid residues in that region in a native coagulation factor FXa polypeptide.

The term substitution or replaced as used herein refers to the substitution of one or more amino acid residues in a specific region or site of a coagulation factor Xa polypeptide, resulting in a change in the amino acid sequence, but not the number of amino acid residues in the specified region. A substitution results from the removal of an amino acid residue followed by the insertion of another amino acid residue at the same position.

The term deletion or deleted as used herein refers to the deletion of one or more amino acid residues in a specific region or site of a coagulation factor Xa polypeptide, resulting in a decrease in the number of amino acid residues in that region of the polypeptide.

The term native coagulation factor Xa polypeptide as used herein refers to an endogenous coagulation factor Xa polypeptide that is naturally present in an animal, preferably a mammal, more preferably a primate, more preferably a human.

The term amino acid composition as used herein refers to the amino acid sequence and length of a stretch of consecutive amino acid residues, where the length is determined by the number of amino acid residues in that stretch.

Insertion, substitution and/or deletion, preferably the insertion of one or more amino acid residues, can be accomplished using recombinant DNA technologies that are well known to those skilled in the art. For example, one skilled in the art may employ synthetic DNA, PCR, and molecular cloning technologies to produce recombinant DNA constructs having a DNA sequence that encodes a protein of the present invention. Suitable tools and methods are described in Green, Sambrook, Molecular Cloning: A Laboratory Manual, CSHL Press, 2012.

The expression corresponding to the region of amino acid residues between, for example, with respect to the region of amino acid residues corresponding to the region of amino acid residues between His311 and Asp-320 of the sequence SEQ ID NO: 1 herein means that the residue number of the conserved His and Asp residues of another blood clotting factor The Xa corresponding to His-311 and Asp-320 of SEQ ID NO: 1 may be different from the residue number assigned to the specified His and Asp residue in SEQ ID NO: 1 (see FIG. 8). Differences in amino acid residue numbers may be due, for example, to differences in the method of numbering amino acid residues. Also, differences in amino acid residue numbers may be due to differences between the length of the coagulation factor Xa polypeptide and the length of the human coagulation factor Xa polypeptide, as shown in FIG. 8. Also, the amino acid residues Gly289, Glu-297, Val-305 and Tyr-319, sequence SEQ ID NO: 1, are conserved among coagulation factor Xa polypeptides of various types (see Figs. 1 and 8). Accordingly, amino acid residues can be identified that correspond to said amino acid residues in another coagulation factor Xa polypeptide. Accordingly, one skilled in the art will understand that the numbering of amino acid residues used herein is not limiting of the present invention and is used for purposes of clarity only.

One skilled in the art will know how to identify a region of amino acid residues that corresponds to a region of amino acid residues between the specified conserved amino acid residues of SEQ ID NO: 1 that delimit the region described herein. If amino acid residues 289-322 of SEQ ID NO: 1 are aligned with the corresponding amino acid residues in the coagulation factor Xa polypeptides of various species, it will be seen that amino acid residues at positions 289, 297, 305, 311, 313, 314, 318, 319, Sequences 320 and 322 of SEQ ID NO:1 are conserved, although not identical, in coagulation factor Xa polypeptides of various species, especially mammals, with Asp-322 of SEQ ID NO:1 being a highly conserved catalytic residue (Asp-102 in numbering for chymotrypsinogen; Bode et al., 1989. EMBO Journal 8: 3467-3475; Messier et al., 1996. Blood Coagulation and Fibrinolysis 7: 5-14 and figures 1 and 8).

- 5 045357

Due to the highly conserved nature of the amino acid residues in and around positions Gly-289 and Asp320 of SEQ ID NO: 1, or in and around the positions of the corresponding Gly and Asp residues of non-human coagulation factors Xa, one of ordinary skill in the art can identify a region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of SEQ ID NO: 1. The same general principle is valid for other amino acid residues that limit the region described herein. In other words, the conserved nature of specific amino acid residues is an unambiguous indication to the skilled person as to which amino acid residues form that region.

One skilled in the art will understand that the present invention relates to the amino acid composition of the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320, most preferably between His-311 and Asp-320 of the sequence SEQ ID NO: 1. Accordingly, one skilled in the art will understand that the amino acid sequence of the remaining protein of the present invention may vary, provided that the protein remains a procoagulant FXa polypeptide with reduced sensitivity to direct factor Xa inhibitors or that such a polypeptide is converted by activation. Thus, the remainder of the protein of the present invention may vary as, for example, coagulation factor X or coagulation factor Xa polypeptides vary in different species.

The number of amino acid residues in the region corresponding to the region between Gly-289 and Asp320, preferably between His-311 and Asp-320 of the sequence SEQ ID NO: 1 is conserved among blood coagulation factor X proteins of various species, in particular among species belonging to the mammalian group or to a group of primates. This region is also present in the FX zymogen protein and FXa polypeptide. Therefore, the number of amino acid residues is also conserved in the FX zymogen protein and FXa polypeptide and in the corresponding regions of the FX zymogen protein and FXa polypeptide. The specified conservative number of amino acid residues in the region of amino acid residues corresponding to the region between Gly-289 and Asp-320 of SEQ ID NO: 1 is thirty, not including Gly-289 and Asp-320. The specified conserved number of amino acid residues in the region of amino acid residues corresponding to the region between His-311 and Asp-320 of SEQ ID NO: 1 is eight, not including His-311 and Asp-320.

It has been found that insertion and/or substitution and/or deletion, preferably insertion, of at least one amino acid residue in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320, preferably between His-311 and Asp-320 sequence SEQ ID NO: 1 in the protein of the present invention produces a catalytically active coagulation factor Xa with reduced sensitivity to inhibition by direct factor Xa inhibitors.

Tyr-319 of human FXa has been shown to be the coordinating residue for DFXI (Roehrig et al. 2005. J Med Chem 48: 5900-5908; Pinto et al. 2007. J Med Chem 50: 5339-5356), and Asp -322 of SEQ ID NO: 1 is present in the catalytic site with serine protease activity (Messier et al., 1996. Blood Coagulation and Fibrinolysis 7: 5-14). Without being limited by theory, it is possible that the proximity of the altered amino acid residue, such as the insertion of at least one amino acid residue in the region between Gly-289 and Asp-320, to the DFXI coordinating residue Tyr-319 of SEQ ID NO: 1, or the corresponding tyrosine , and/or proximity to the catalytic domain is responsible for the reduced sensitivity to DFXI. It appears that in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp320 of the sequence SEQ ID NO: 1, in the protein according to the present invention, the number of amino acid residues and the amino acid sequence can be changed in such a way that it leads to the formation of a catalytically active coagulation factor Xa blood with reduced sensitivity to direct factor Xa inhibitors.

The change is selected from insertion, substitution and/or deletion, and is preferably an insertion, more preferably an insertion in combination with a change in at least one amino acid in the region between Gly-289 and Asp-320 of SEQ ID NO: 1 .

Particularly preferred is a protein according to the present invention in which the insert contains 1-50, preferably 1-20 amino acid residues. An insertion in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320, preferably between His-311 and Asp-320, of the sequence SEQ ID NO: 1 in the protein of the present invention contains or consists of from 1 to 50, preferably from 1 to 20 amino acid residues. Preferably, the insert comprises or consists of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid residues, giving a total of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, 21, 22, 23, 24, 25, 26, 27 or 28, respectively, amino acids between His-311 and Asp-320. Particularly preferred is an insertion of at least 5 amino acid residues, such as an insertion of 9, 12 or 13 amino acid residues. One skilled in the art will appreciate that amino acid residues can be inserted at any position within the region of amino acid residues, respectively

- 6 045357 the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1. The amino acid residue suitable for insertion is selected from the group of twenty amino acid residues listed in table. 1. One skilled in the art will appreciate that these inserted amino acid residues may be subject to post-translational chemical changes in vivo or in vitro. As stated above herein, one skilled in the art will be able to use DNA synthesis, PCR and molecular cloning technologies to produce recombinant DNA constructs, the DNA sequence of which encodes a protein of the present invention containing an insertion of 1 to 50 amino acid residues in the region of amino acid residues corresponding to the region between Gly-289 and Asp-320 sequence SEQ ID NO: 1.

The insertion in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1 in the protein according to the present invention is preferably located between Thr-315 and Lys-316, between Lys-316 and Glu-317 , between Glu-317 and Thr-318 and/or between Thr-318 and Tyr-319 of SEQ ID NO: 1 or between two amino acid residues corresponding to these amino acid residues in a non-human coagulation factor Xa polypeptide.

Particularly preferred is the protein of the present invention in which the substitution contains 1-30, preferably 1-8, more preferably 6 or 7 amino acid residues. The replacement of amino acid residues in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1, in a protein according to the present invention preferably contains, or consists of, from 1 to 30 amino acid residues in the region, the corresponding region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1. In a preferred embodiment, said substitution contains, or consists of, 1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acid residues. In a preferred embodiment, conserved amino acid residues, such as, for example, Glu-297, Val-305 and/or His-311, shown in SEQ ID No: 1, are not replaced. Particularly preferred is the replacement of 6 or 7 amino acid residues.

In a preferred embodiment, the amino acid residue present in the region corresponding to the region of amino acid residues between Gly-289 and Asp-320 of SEQ ID NO: 1 of the protein according to the present invention is replaced by any of the amino acid residues listed in table. 1, preferably an amino acid from the same group in accordance with the side chain polarity and side chain charge columns in the table. 1. In a preferred embodiment, one or more of Asn312, Arg-313, Phe-314, Thr-315, Lys-316, Glu-317, Thr-318 and Tyr-319 of the sequence SEQ ID NO: 1 or corresponding amino acid residues in non-human protein according to the present invention is replaced by any of the amino acid residues given in table. 1. Asn312 of SEQ ID NO: 1 is preferably replaced by a Thr or Lys residue. Arg-313 is preferably replaced by an amino acid residue with basic polarity and a positively charged side chain (see Table 1), more preferably a Lys residue. The Thr-315 amino acid residue is preferably replaced by a polar amino acid residue with a neutral side chain, more preferably a Val residue. Lys-316 of SEQ ID NO: 1 is preferably replaced by a Pro residue. Glu-317 of SEQ ID NO: 1 is preferably replaced by a Val residue. Thr-318 is preferably replaced by a polar amino acid residue with a neutral side chain, more preferably a Ser or Ala residue.

The replacement of amino acid residues in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1 in the protein according to the present invention preferably contains, or consists of at least two amino acid residues. The present invention provides for any combination of at least two amino acid residues, for example, replacing Asn-312 of SEQ ID NO: 1 and Lys-316 of SEQ ID NO: 1 with a Pro residue and an Ala residue, respectively, or replacing Asn312, Arg-313, Thr-315, Lys-316, Glu-317, Thr-318 and Tyr-319 sequence SEQ ID NO: 1 one of the amino acid residues listed in table. 1. Particularly preferred is the protein of the present invention containing the substitution (i) Asn-312, (ii) Arg-313, (iii) Thr-315, (iv) Lys-316, (v) Glu-317 and (vi) Thr-318 sequence SEQ ID NO: 1 at (i) a Thr or Pro residue, (ii) a Lys residue, (iii) a Val residue, (iv) a Pro residue, (v) a Val residue, and (vi) a Ser or Ala residue, respectively.

One skilled in the art will appreciate that when amino acid residues are replaced in the region of amino acid residues corresponding to the region between Gly-289 and Asp-320 of SEQ ID NO: 1 of the non-human protein of the present invention, only those amino acid residues that were previously not yet present in the preferred protein of the present invention. One skilled in the art will understand that the above reference to SEQ ID NO: 1 is made solely as an example of substitution of amino acid residues in the specified region of amino acid residues. Thanks to this, he will know which amino acid residues or residues he can replace with another amino acid residue or residues in a non-human

- 7 045357 Chinese blood clotting factor Xa.

The protein of the present invention may further comprise a deletion of at least one amino acid residue in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO:1. Particularly preferred is a protein of the present invention containing a deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 10, 15, 20 or 30 amino acid residues.

A preferred protein of the present invention contains a combination of insertion and substitution or a combination of insertion, substitution and/or deletion. Insertions and deletions may be present independently of each other and it is possible that, for example, an insertion of 5 amino acid residues and a deletion of 5 amino acid residues are present at different amino acid positions in the amino acid residue region corresponding to the amino acid residue region between Gly-289 and Asp-320 of SEQ ID NO:1, and the total number of amino acid residues in blood coagulation factor X does not change. One skilled in the art will understand that an insertion or deletion changes the numbering of amino acid residues in a protein. From the point of view of convenience in assessing where the change is located and what the change is, one skilled in the art can make several alignments of the amino acid sequences of the various coagulation factor X proteins, as shown in FIG. 8. Based on these alignments, the specialist will be able to determine which amino acid residues have changed. One skilled in the art may use conserved amino acid residues, such as Glu-297, Val-305 and/or His-311, as markers to assess the number of amino acid residue that has been changed.

Particularly preferred is the protein of the present invention in which the insertion contains 1-50, preferably 1-20, amino acid residues, and in which the substitution contains 1-7, preferably 6 amino acid residues. Said preferred protein contains an insertion of 1 to 50, preferably 1 to 20 amino acid residues in combination with a substitution of 1 to 8, preferably 6 or 7 amino acid residues in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1

A more preferred protein of the present invention contains an insertion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid residues and substitution of at least 1, 2, 3, 4, 5, 6 or 7 amino acid residues in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1, which means that an insertion of at least 1-20 amino acid residues is combined with a substitution of at least 1, 2, 3, 4, 5, 6 or 7 amino acid residues. The present invention relates to all possible combinations of the above insertions and substitutions. Particularly preferred is a protein containing an insertion of 12-13 amino acid residues and a substitution of 6 amino acid residues in the region of amino acid residues corresponding to the region of amino acid residues between Gly-289 and Asp-320 of the sequence SEQ ID NO: 1.

In the most preferred embodiment, the protein of the present invention contains a region of amino acid residues having the amino acid sequence of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 10 and SEQ ID NO: 11 between the amino acid residues corresponding amino acid residues His-311 and Asp-320 of the sequence SEQ ID NO: 1.

In addition, changes in Arg-366, Glu-369, Phe-396, Asp-413, Ala-414, Cys-415, Gln-416, Ser-419, Val437, Ser-438, Trp-439, Gly-440, Glu-441, Gly-442, Cys-443, Gly-450, lle-451 and Tyr-452 of SEQ ID NO:1 likely lead to the formation of a DFXI-insensitive protein. Without limitation by theory, Arg-366, Glu-369, Phe-396, Asp-413, Ala-414, Cys-415, Gln-416, Ser-419, Val-437, Ser-438, Trp-439, Gly -440, Glu-441, Gly-442, Cys-443, Gly-450, lle-451 and Tyr-452 of SEQ ID NO: 1 are likely to be direct factor Xa inhibitor coordinating residues. Literature data indirectly support this view, as they demonstrate that at least some of these residues are involved in DFXI binding (Roehrig et al., 2005. J Med Chem 48: 5900-5908; Pinto et al., 2007. J Med Chem 50: 5339-5356). The protein according to the present invention preferably contains a substitution or deletion of an amino acid residue corresponding to Arg-366, Glu-369, Phe-396, Asp-413, Ala-414, Cys-415, Gln-416, Ser-419, Val-437 , Ser-438, Trp-439, Gly440, Glu-441, Gly-442, Cys-443, Gly-450, lle-451 or Tyr-452 sequence SEQ ID NO:1. Amino acid residues Arg-366, Glu-369, Phe-396, Asp-413, Ala-414, Cys-415, Gln-416, Ser-419, Val-437, Ser438, Trp-439, Gly-440, Glu- 441, Gly-442, Cys-443, Gly-450, lle-451 and/or Tyr-452 of SEQ ID NO:1 of SEQ ID NO:1, or the corresponding amino acid residues in a related protein are preferably replaced by any one amino acid residue given in table. 1. Also, the protein according to the present invention preferably contains the insertion of at least one amino acid residue, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20 amino acid residues in the region of amino acid residues corresponding to the region between amino acid residues located at a distance of 15 amino acid residues towards the N-terminus and 15 amino acid residues towards the C-terminus from Arg-366, Glu-369, Phe-396, Asp-413, Ala-414, Cys-415, Gln-416, Ser-419, Val-437, Ser-438, Trp-439, Gly-440, Glu-441, Gly-442, Cys443, Gly-450, IIe-451 and/or Tyr-452. Specified change Phe-396, Arg-366, Glu-369, Asp-413, Ala-414,

- 8 045357

Cys-415, Gln-416, Ser-419, Val-437, Ser-438, Trp-439, Gly-440, Glu-441, Gly-442, Cys-443, Gly-450, IIe-451 and/or Tyr-452 sequence SEQ ID NO:1. In a preferred embodiment, said insertion in the region specified in this paragraph is combined with a change in the region between Gly-289 and Asp-320 of SEQ ID NO: 1 defined above.

The present invention also covers proteins that are substantially homologous to and biologically equivalent to the protein of the present invention. Preferably, the protein of the present invention has an amino acid sequence that is more than 60%, preferably more than 70%, more preferably more than 80%, and most preferably more than 90% homologous to the sequence of SEQ ID NO: 1, or thereof a catalytically activated form, wherein said protein is catalytically active (procoagulant) or becomes catalytically active after processing/activation, and has reduced sensitivity to direct factor Xa inhibitors (DFXI), preferably a DFXI selected from the group consisting of rivaroxaban, apixaban, edoxaban and betrixaban. One skilled in the art will know how the coagulation factor X pre-proprotein or pro-protein is converted to its catalytically active form. The UniProt database accession number P00742 provides an overview of the processing of human coagulation factor X to form activated human coagulation factor Xa. Accordingly, a specialist will be able to determine which amino acid residues are present or absent in blood clotting factor Xa.

The term reduced sensitivity to direct factor Xa inhibitors (DFXI) in the context of the present invention refers to the concentration of DFXI required to provide 50% maximum inhibition (Ki), which is higher for the polypeptide of the present invention than for native coagulation factor Xa, and in Preferably, said native blood coagulation factor Xa is isolated from blood plasma or obtained recombinantly. In a preferred embodiment, the Ki of direct factor Xa inhibitor (DFXI) is measured by preincubating the protein of the present invention with 0.001 to 100 μM DFXI, followed by an experiment that measures catalytic activity against Spectrozyme Xa (Sekisui Diagnostics; Stamford, CT, USA) on the conversion of peptidyl substrate. In a preferred embodiment, the Ki of the protein of the present invention is increased by more than 2-fold, more preferably increased by 50 to 100-fold, and most preferably increased by more than 100-fold compared to the Ki of said native coagulation factor Xa without changing at least one amino acid residue in the region of amino acid residues corresponding to the region of amino acid residues between Gly-298 and Asp-320 of the sequence SEQ ID NO: 1.

Surprisingly, it has been found that the protein of the present invention has an increased binding affinity for coagulation factor FVa, the coagulation partner of coagulation factor Xa in the prothrombinase complex, compared to the binding affinity of native coagulation factor Xa for coagulation factor FVa. The binding affinity of the human or humanized protein of the present invention for FVa is at least twice as high as the binding affinity of native human FXa for FVa.

Assay methods for determining binding affinity are known in the art, for example, based on the use of a radiolabeled binding partner (such as FVa or FXa). The amount of radiation emitted after binding can be used to calculate binding affinity. Non-radioactive techniques such as surface plasmon resonance and dual polarization interferometry can also be used to measure binding affinity from concentration-based assays as well as association and dissociation kinetics and, in the latter case, post-binding conformational changes. Recently, a microscale thermophoresis (MST) method without immobilization has been developed, which allows the determination of binding affinity between two proteins (Wienken et al., 2010. Nature Communications 1: 100). In a preferred embodiment, the affinity of the FVa-FXa coagulation factor complex is determined by the kinetics of prothrombin or the conversion of prothrombin derivatives (prethrombin-1, prethrombin-2) (Bos et al., 2009. Blood 114: 686-692), measured by fluorescence intensity/anisotropy ( Bos et al, 2012. J Biol Chem 287: 26342-51) or by isometric titration calorimetry (ITC).

The present invention also provides a nucleic acid molecule comprising a DNA sequence that encodes a protein of the present invention. One skilled in the art will understand how to obtain a DNA sequence that encodes the amino acid sequence of a protein according to the present invention, and how to obtain and isolate a nucleic acid molecule containing said DNA sequence using generally known recombinant DNA technologies. In a preferred embodiment, the sequence of the nucleic acid molecule is codon optimized for expression in a host cell according to the present invention. In this case, codons are used that promote high levels of expression in a particular host cell.

The present invention also provides an expression vector containing a molecule

- 9 045357 nucleic acid according to the present invention.

In a preferred embodiment, the nucleic acid molecules are inserted into an expression vector using recombinant DNA techniques known to those skilled in the art. Expression vectors in the context of the present invention refer to the expression of a protein according to the present invention in a host cell. Preferably, these expression vectors are replicated in the host cell, either as episomes or as part of chromosomal DNA. Further, when expressing a protein in eukaryotic cells, the expression vector preferably contains (i) a strong promoter/enhancer such as the cytomegalovirus (CMV) promoter or the SV40 promoter, (ii) an optimal translation initiation sequence such as a ribosome binding site and a start codon, preferably a KOZAK consensus sequence, and (iii) a transcription termination sequence including a poly(A) signal sequence. Suitable expression vectors include plasmids and viral vectors such as adenoviruses, adeno-associated viruses and retroviruses. One skilled in the art will appreciate that the expression vector used depends on the host cell used to express the recombinant protein. Preferably, the expression vector of the present invention is suitable for expressing a nucleic acid molecule of the present invention in a prokaryotic cell, including a bacterial cell, or, more preferably, in a eukaryotic host cell, such as a yeast cell and a mammalian cell. Particularly preferred is the expression vector for expression in mammalian cells, pCMV4.

Alternatively, the nucleic acid molecule of the present invention may be inserted into the genome of a host cell. Said insertion is preferably located at a locus or region that allows expression of the nucleic acid molecule of the present invention in a host cell.

The present invention also provides a host cell containing a nucleic acid molecule according to the present invention. In a preferred embodiment, the present invention provides a host cell expressing a nucleic acid molecule of the present invention, thereby producing a protein of the present invention. The protein is produced either within the host cell or, preferably, secreted from the host cell.

Suitable host cells for use in the present invention include prokaryotic and eukaryotic cells, such as bacterial cells, yeast cells, insect cells, animal cells, mammalian cells, mouse cells, rat cells, sheep cells, monkey cells and human cells. Examples of suitable eukaryotic cells include, but are not limited to: HEK 293 cells, CHO and BHK-21 hamster cell lines, NIH3T3, NSO and C127 mouse host cells, COS and Vero monkey host cells. and human host cells HeLa, PER.C6, U-937 and Hep G2. Suitable cells can be obtained from publicly available sources such as the American Type Culture Collection (ATCC) and Life Technologies. A number of transfection techniques are known in the field, see, for example, Graham et al., 1973. Virology 52: 456, Green et al., 2012. Molecular Cloning: A Laboratory Manual, CSHL Press, Davis et al., Basic Methods in Molecular Biology, 1986, Elsevier and Chu et al., 1981. Gene 13: 197. Preferably, those skilled in the art use the techniques described in these references to introduce one or more endogenous nucleic acid molecules into suitable host cells.

A particularly preferred host cell for producing the protein of the present invention is the HEK293 cell.

The present invention also provides a pharmaceutical composition comprising a protein of the present invention or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient. Preferably, the pharmaceutical composition of the present invention contains one or more diluents, excipients, salts, buffers, stabilizers, solubilizers and other materials known in the art. As those skilled in the art know, the characteristics of the carrier will depend on the route of administration. To reduce the potential risk of thrombosis when administering serine protease FXa, the pharmaceutical composition of the present invention preferably contains a protein of the present invention that is inactivated upon administration to a subject.

The term subject refers to a group of mammals, preferably humans.

The term pharmaceutical composition in the context of the present invention refers to the combination of a protein according to the present invention with a carrier, inert or active, which makes the composition suitable for therapeutic use in vivo or ex vivo.

The term pharmaceutically acceptable as used herein refers to a non-toxic material that is compatible with the physical and chemical characteristics of the protein of the present invention and does not reduce the effectiveness of the biological action of the protein.

The pharmaceutical composition according to the present invention can be adapted for administration of the composition by the enteral route, in which the composition is absorbed through the digestive system.

- 10 045357 tract, for example, by oral ingestion or rectal administration. These compositions are preferably encapsulated, for example using liposomes, to prevent proteolytic degradation.

The pharmaceutical composition according to the present invention is preferably applied topically, for example, on or in a wound or in a blood vessel, preferably an artery, which supplies blood to the wound area. Said local administration is topical administration, for example, in the form of a cream, foam, gel, lotion or ointment, or parenteral administration, for example, by injection or infusion, to obtain a local or systemic therapeutic effect. Topical administration of the protein according to the present invention to obtain a local effect reduces the risk of possible systemic thrombus formation.

The pharmaceutical composition according to the present invention, preferably containing blood coagulation factor X or mature blood coagulation factor X, which contains an altered coagulation factor Xa polypeptide, is preferably administered systemically, preferably by the parenteral route. Systemic administration of inactive preproprotein or inactive proprotein results in the formation of an active prothrombinase complex, which consists of coagulation factor Xa bound to FVa on negatively charged phospholipid membranes, where it converts inactive prothrombin into the active serine protease thrombin.

The pharmaceutical composition according to the present invention is preferably adapted for parenteral administration, in which the composition is administered intravenously, intra-arterially, subcutaneously and/or intramuscularly. Parenteral administration involves administering the pharmaceutical composition of the present invention by injection or infusion into body tissue or body fluid, preferably using a syringe, needle or catheter. Alternatively, the means of parenteral administration may be high pressure administration without the use of needles. For injectable compositions (eg, compositions for intravenous administration), the carrier may be an aqueous or oily solution, dispersion, emulsion and/or suspension. Preferably, the carrier is an aqueous solution, preferably distilled sterile water, saline, buffered saline or other pharmaceutically acceptable injection excipient.

Preferably, the pharmaceutical composition of the present invention is used in various therapeutic applications. For example, the pharmaceutical composition can be used as a bypass agent in the treatment or relief of disorders in which normal blood clotting is impaired, such as hemophilia A and B, including in groups of patients with inhibitory hemophilia A or factor X deficiency.

The present invention also provides a protein of the present invention or a pharmaceutical composition of the present invention for use in a method of reversing all or part of the anticoagulant effect of a blood clotting inhibitor in a subject.

The term anticoagulant effect refers to the therapeutic effect, such as preventing blood clotting, that results from the action of blood clotting inhibitors.

The present invention also provides the use of the protein of the present invention for the manufacture of a medicament for completely or partially reversing the anticoagulant effect of a blood clotting inhibitor in a subject.

In a preferred embodiment, the coagulation inhibitor is a direct factor Xa inhibitor (DFXI), more preferably a direct FXa inhibitor selected from the group consisting of rivaroxaban (5-chloro-N-[[(5S)-2-oxo-3-[4 -(3-oxo-4-morpholinyl)phenyl]-5-oxazolidinyl]methyl]-2thiophenecarboxamide), apixaban (1 -(4-methoxyphenyl)-7-oxo-6-[4-(2-oxopiperidin-1 -yl )phenyl] 4,5,6,7-tetrahydro-1H-pyrazolo[3,4-c]pyridin-3-carboxamide), edoxaban U'-(5-chloropyridin-2-yl)N-[(1S,2R ,4S)-4-(dimethylkαrbαmoyl)-2-[(5-methyl-6,7-dihydro-4H-[1,3]thiαzolo[5,4-c]niridin-2carbonyl)amino]cyclohexyl]oxamide, 4 -methylbenzenesulfonic acid) and/or betrixaban (N-(5chloropyridin-2-yl)-2-[[4-(N,N-dimethylcarbamidoyl)benzoyl]amino]-5-methoxybenzamide).

The present invention further provides a method of completely or partially reversing the anticoagulant effect of a coagulation inhibitor in a subject, the method comprising administering to the subject a therapeutically effective amount of a protein of the present invention or a pharmaceutical composition of the present invention. In a preferred embodiment, the method of the present invention is used to prevent or alleviate bleeding complications that are associated with anticoagulant therapy.

The term "therapeutically effective amount" as used herein means that the amount of active ingredient contained in the pharmaceutical composition for administration is sufficient to achieve the intended purpose, such as, in this case, completely or partially reversing the anticoagulant effect of the blood clotting inhibitor. In a preferred embodiment, the amount of active ingredient, i.e. protein of the present invention in the pharmaceutical composition of the present invention ranges from about 50 mg to about 600 mg. In a preferred embodiment, the pharmaceutical composition according to the present

- 11 045357 the invention is administered only once, twice or three times, preferably only once, to a subject in need of complete or partial reversal of the anticoagulant effect of the clotting inhibitor.

For purposes of clarity and accuracy of description, features are described herein as part of the same or different embodiments; however, it is intended that the scope of the present invention may include embodiments containing combinations of all or some of the described features.

SEQ ID NO: 1 (human coagulation factor X protein) mgrplhlvll saslagllll geslfirreq annilarvtr ansfleemkk ghlerecmee tcsyeearev fedsdktnef wnkykdgdqc etspcqnqgk ckdglgeytc tclegfegkn

121 celftrklcs Idngdcdqfc heeqnsvvcs cargytladn gkaciptgpy pcgkqtlerr

181 krsvaqatss sgeapdsitw kpydaadldp tenpfdlldf nqtqpergdn nltrivggqe

241 ckdgecpwqa llineenegf cggtilsefy iltaahclyq akrfkvrvgd rnteqeegge

301 avhevevvik hnrftketyd fdiavlrlkt pitfrmnvap aclperdwae stlmtqktgi

361 vsgfgrthek grqstrlkml evpyvdrnsc klsssfiitq nmfcagydtk qedacqgdsg

421 gphvtrfkdt yfvtgivswg egcarkgkyg iytkvtaflk widrsmktrg Ipkakshape

481 vitssplk

SEQ ID NO: 2 (human factor Xa light chain) ansfleemkk ghlerecmee tcsyeearev fedsdktnef wnkykdgdqc etspcqnqgk

161 ckdglgeytc tclegfegkn celftrklcs Idngdcdqfc heeqnsvvcs cargytladn

121 gkaciptgpy pcgkqtler 139

SEQ ID No: 3 (human coagulation factor Xa heavy chain) ivggqeckdg ecpwqallin eenegfcggt ilsefyilta ahclyqakrf kvrvgdrnte

161 qeeggeavhe vevvikhnrf tketydfdia vlrlktpitf rmnvapaclp erdwaestlm

121 tqktgivsgf grthekgrqs trlkmlevpy vdrnscklss sfiitqnmfc agydtkqeda

181 cqgdsggphv trfkdtyfvt givswgegca rkgkygiytk vtaflkwidr smktrglpka

241 kshapevits splk

SEQ ID NO: 4 tkfvppnyyyvhqnfdrvay

SEQ ID NO: 5 kkfvppkksqefyekfdlvsy

SEQ ID NO: 6 (human coagulation factor X gene; bp 1-1473) atggcgcacgtccgaggcttgcagctgcctggctgcctggccctggctgccctgtgtagccttgtgcacagccagcatgtgttcctg gctcctcagcaagcacggtcgctgctccagcgggtccggcgagccaattcctttctt gaagagatgaagaaaggacacctcgaa agagagtgcatggaagagacctgctcatacgaagaggcccgcgaggtctttgaggacagcgacaagacgaatgaattctgga ataaatacaaagatggcgaccagtgtgagaccagtccttgccagaaccagggcaaatgtaaagacggcctcggggaatacac ctgcacctgtttagaaggatt cgaaggcaaaaactgtgaattattcacacggaagctctgcagcctggacaacggggactgtgac cagttctgccacgaggaacagaactctgtggtgtgctcctgcgcccgcgggtacaccctggctgacaacggcaaggcctgcatt cccacagggccctacccctgtgggaaacagaccctggaacgcaggaagaggtcagtgg cccaggccaccagcagcagcg gggaggcccctgacagcatcacatggaagccatatgatgcagccgacctggaccccaccgagaaccccttcgacctgcttgac ttcaaccagacgcagcctgagaggggcgacaacaacctcacgcgtatcgtgggaggccaggaatgcaaggacggggagtgt ccctggcaggccctgctcatcaatga ggaaaacgaggtttctgtggtggaactattctgagcgagttctacatcctaacggcagc ccactgtctctaccaagccaagagattcaaggtgagggtaggtgaccggaacacggagcaggaggagggcggtgaggcggt gcacgaggtggaggtggtcatcaagcacaaccggttcacaaaggaacctatgacttcgacatcgcc gtgctccggctcaaga cccccatcaccttccgcatgaacgtggcgcctgcctgcctccccgagcgtgactgggccgagtccacgctgatgacgcagaag acggggattgtgagcggcttcgggcgcacccacgagaagggccggcagtccaccaggctcaagatgctggaggtgccctacg tggaccgcaacagctgcaagctg tccagcagcttcatcatcacccagaacatgttctgtgccggctacgacaccaagcaggag gatgcctgccagggggacagcgggggcccgcacgtcacccgcttcaaggacacctacttcgtgacaggcatcgtcagctggg gagagggctgtgcccgtaaggggaagtacgggatctacaccaaggtcaccgccttcctcaag tggatcgacaggtccatgaaa accaggggcttgcccaaggccaagagccatgccccggaggtcataacgtcctctccattgaaa

- 12 045357

SEQ ID NO: 7 (modified human factor X type A DNA sequence; 11509 bp)

Atggcgcacgtccgaggcttgcagctgcctggctgcctggccctggctgccctgtgtagccttgtgcacagccagcatgtgttcctg gctcctcagcaagcacggtcgctgctccagcgggtccggcgagccaattcctttcttgaagagatgaagaaaggacacctcgaa agagagtgcatggaagagacctg ctcatacgaagaggcccgcgaggtctttgaggacagcgacaagacgaatgaattctgga ataaatacaaagatggcgaccagtgtgagaccagtccttgccagaaccagggcaaatgtaaagacggcctcggggaatacac ctgcacctgtttagaaggattcgaaggcaaaaactgtgaa.ttattcacacggaagctctgcagcc tggacaacggggactgtga ccagttctgccacgaggaacagaactctgtggtgtgctcctgcgcccgcgggtacaccctggctgacaacggcaaggcctgcat tcccacagggccctacccctgtgggaaacagaccctggaacgcaggaagaggtcagtggcccaggccaccagcagcagcg gggaggcccctgacagcatcacatgg aagccatatgatgcagccgacctggaccccaccgagaaccccttcgacctgcttgac ttcaaccagacgcagcctgagaggggcgacaacaacctcacgcgtatcgtggaggccaggaatgcaaggacggggagtgt ccctggcaggccctgctcatcaatgaggaaaacgagggtttctgtggtggaactattctgagcgag ttctacatcctaacggcagc ccactgtctctaccaagccaagagattcaaggtgagggtaggtgaccggaacacggagcaggaggagggcggtgaggcggt qcacqaqqtqqaqqtqqtcatcaaqcacaccaaqttcqtqccccctaactactattacqtccaccaqaattttqaccqqqt gcjcctatgactt cgacatcgccgtgctccggctcaagacccccatcaccttccgcatgaacgtggcgcctgcctgcctccccgag cgtgactgggccgagtccacgctgatgacgcagaagacggggattgtgagcggcttcgggcgcacccacgagaagggccgg cagtccaccaggctcaagatgctggaggtgccctacgtggaccgcaacagct gcaagctgtccagcagcttcatcatcacccag aacatgttctgtgccggctacgacaccaagcaggaggatgcctgccagggggacagcgggggcccgcacgtcacccgcttca aggacacctacttcgtgacaggcatcgtcagctggggagaggggctgtgcccgtaaggggaagtacgggatctacaccaaggtc accgcc ttcctcaagtggatcgacaggtccatgaaaaccaggggcttgcccaaggccaagagccatgccccggaggtcataa cgtcctctccattgaaa

SEQ ID NO: 8 (DNA sequence of modified human factor X type B; 11512 bp) atggcgcacgtccgaggcttgcagctgcctggctgcctggccctggctgccctgtgtagccttgtgcacagccagcatgtgttcctg gctcctcagcaagcacggtcgctgctccagcgggtccggcgagccaattcctttct tgaagagatgaagaaaggacacctcgaa agagagtgcatggaagagacctgctcatacgaagaggcccgcgaggtctttgaggacagcgacaagacgaatgaattctgga ataaatacaaagatggcgaccagtgtgagaccagtccttgccagaaccagggcaaatgtaaagacggcctcggggaatacac ctgcacctgtttagaagg attcgaaggcaaaaactgtgaattattcacacggaagctctgcagcctggacaacggggactgtgac cagttctgccacgaggaacagaactctgtggtgtgctcctgcgcccgcgggtacaccctggctgacaacggcaaggcctgcatt cccacagggccctacccctgtgggaaacagaccctggaacgcaggaagaggtcagt ggcccaggccaccagcagcagcg gggaggcccctgacagcatcacatggaagccatatgatgcagccgacctggaccccaccgagaaccccttcgacctgcttgac ttcaaccagacgcagcctgagaggggcgacaacaacctcacgcgtatcgtgggaggccaggaatgcaaggacggggagtgt ccctggcaggccctgctcatcaat gaggaaaacgaggtttctgtggtggaactattctgagcgagttctacatcctaacggcagc ccactgtctctaccaagccaagagattcaaggtgagggtaggtgaccggaacacggagcaggaggagggcggtgaggcggt qcacQaqqtqqaqqtqqtcatcaaQcacaagaaattcgtgccccctaagaaa agccaggagttctacgaaaagtttgac ctqqtctcctatqacttcqacatcqccqtqctccqqctcaaqacccccatcaccttccqcatqaacqtqqcqcctqcctqcctccc cgagcgtgactgggccgagtccacgctgatgacgcagaagacggggattgtgagcggcttcgggcgcaccaccac gagaaggg ccggcagtccaccaggctcaagatgctggaggtgccctacgtggaccgcaacagctgcaagctgtccagcagcttcatcatcac ccagaacatgttctgtgccggctacgacaccaagcaggaggatgcctgccagggggacagcgggggcccgcacgtcacccg cttcaaggacacctacttcgtgacaggcatcgt cagctggggagagggctgtgcccgtaaggggaagtacgggatctacacca aggtcaccgccttcctcaagtggatcgacaggtccatgaaaaccaggggcttgcccaaggccaagagccatgccccggaggt cataacgtcctctccattgaaa

SEQ ID NO: 9 kkfvppkksqefyekfdlaay

SEQ ID NO: 10 kkfvppnyyyvhqnfdlaay

SEQ ID NO: 11 kkfvppqkaykfdlaay

- 13 045357

Description of the figures

Fig. 1. Structure of blood coagulation factor Xa. A: Schematic structure of the γcarboxyglutamate ('GLA'), EGF-1-2 ('EGF') and serine protease ('SP') domains of coagulation factor Xa. B: Crystal structure of human FXa serine protease (pdb 2W26). Shown is the catalytic triad His-276, Asp-322, Ser-419, residues of the contact region with rivaroxaban/apixaban Tgu-319 and Phe-396, the position of residues 316-317 (in circles) and residues Gly-289, Glu-297, Val -305, and His-311. C: Alignment of region 311-322 in plasma FX factors of various species with conserved residues shown (highlighted), contact region residue Tyr-319, and catalytic residue Asp-322. * denotes coagulation factor X from venom with an insertion in the region corresponding to the region between Gly-289 and Asp-320 of SEQ ID NO: 1.

Fig. 2. Inhibition of the chromogenic activity of the FXa factor by direct FXa inhibitors. A: conversion of peptidyl substrate (SpecFXa, 250 μM) of recombinant human factor Xa (hFXa, 2 nM, circles) or factor Xa from P. textilis venom (vptFXa, 10 nM, triangles) in the presence of increasing concentrations (1 nM - 10µM) rivaroxaban ('riva', filled icons) or apixaban ('api', unfilled icons). Substrate conversion is plotted as % of incubations in the absence of inhibitor. B,C: Thrombin generation in factor X-deficient plasma was initiated with 0.5 nM human factor Xa (hFXa, panel B) or snake venom factor Xa (vptFXa, panel C) in the absence (gray line/gray bar) or presence of 0.4 µM rivaroxaban ('riva', black line/black bar) or 2 µM apixaban ('api', dashed line/white bar). Thrombin generation was assessed using a fluorogenic substrate, and the insets show peak thrombin concentrations in different incubations.

Fig. 3. (A) - fluorescent Western blot of recombinant FX (200 ng) obtained from HEK293 cell lines that stably express recombinant human FX (r-hFX, lanes 1, 5), modified human FX-A (mod A, lane 2, 6), or modified human FX-B (mod B, lanes 3, 7), before (lanes 1,2, 3) or after (lanes 5, 6, 7) incubation with the RW-X activator. The heavy chain of endogenous human plasma FXa migrates at ∼29 KDa (lane 9). The relative mass (KDa) of protein markers is shown (lanes 4, 8). (B) - Recombinant FX in conditioned media from HEK293 cell lines stably expressing human recombinant FX (black bar), or modified FX-A (white bar), or modified human FX-B (gray bar) was measured using FX-specific ELISA. Each individual bar represents one stable cell line with the highest achieved expression of the FX variant.

Fig. 4. Activation of a macromolecular substrate. Conversion of thrombin (1.4 µM) in the presence of 50 µM PCPS, 20 nM FV (FV810, recombinant FV, truncated in the B domain) and 0.1 nM modified human coagulation factor Xa type A (m-hFXa A), type B (m- hFXa B), recombinant (r-hFXa) or plasma-derived (pd-hFXa) FXa. Substrate conversion is plotted in nM/min/nM enzyme and data are the mean of two independent experiments ± standard deviation.

Fig. 5. Inhibition of chimeric FXa type A by direct factor Xa inhibitors. Conversion of peptidyl substrate (SpecFXa, 250 μM) of RW-X-activated modified human factor Xa type A (m-hFXa A, 1 nM) versus recombinant human factor Xa (r-hFXa, 3 nM) prepared from plasma human blood coagulation factor Xa (pd-FXa, 2 nM) and FXa from P. textilis venom (vptFXa, 1 nM). Conversion rates were determined in the presence of 0.001 - 100 μM rivaroxaban (Fig. A) or apixaban (Fig. B). Data are shown as the average of two independent experiments, with the exception of r-hFXa (n=1).

Fig. 6. Inhibition of modified human FX-A by direct factor Xa inhibitors. Conversion of peptidyl substrate (SpecFXa, 250 μM) by RVV-X-activated modified human FX-A (m-hFXa A, 1 nM) and modified human FX-B (m-hFXa B, 7 nM, compared with RW-X activated recombinant human coagulation factor Xa (r-hFXa, 6 nM).Conversion rates were determined by 0.001 100 μM rivaroxaban (Fig. A) and apixaban (Fig. B).Data are the average of two independent experiments.

Fig. 7. Inhibition of modified human FX-A or modified human FX-B by direct factor Xa inhibitors in the presence of cofactor Va and phospholipids. Conversion of peptidyl substrate (SpecFXa, 250 μM) by RVV-X-activated modified human FX-A (m-hFXa A, 2 nM) and activated modified human FX-B (mhFXa B, 4 nM) compared to RW-X-activated recombinant human coagulation factor Xa (r-hFXa, 3 nM), in the presence of 50 μM PCPS and 30 nM FV (FV810, recombinant, truncated at B-domain B). Conversion rates were determined in the presence of 0.001 - 100 μM rivaroxaban (Fig. A) or apixaban (Fig. B). Data represent the average of two independent experiments.

- 14 045357

Fig. 8. Multiple alignment of coagulation factor X proteins of different species. The amino acid sequence of human blood coagulation factor X (Genbank accession no.: AAH46125.1) (HUM) is compared with the amino acid sequences of blood coagulation factor X of M. musculus ((Genbank accession no.: AAC36345.1) (MUS), blood coagulation factor XX tropicalis (Genbank Accesion No.: NP_001015728) (Xtr), coagulation factor X D. rerio (Genbank accession no.: AAM88343.1) (Dre), coagulation factor X T. rubripes (Genbank accession no.: NP_001027783. 1) (Tru), coagulation factor X isoform 1 P. textilis (UniprotKB accession no.: Q1L659) (Pte1), coagulation factor X isoform 2 P. textilis (UniprotKB accession no.: Q1L658) (Pte2), coagulation factor blood X of P. textilis (precursor of the catalytic subunit of pseutarin C; Genbank accession no.: AAP86642.1) (Pte3) and blood coagulation factor X of N. scutatus (UniprotKB accession no. P82807.2) (Nsc). and underlining indicate Gly-289, Asp320, Tyr-319, Glu-297, Val-305 and His-311 sequences of SEQ ID NO: 1. This figure shows that the region of amino acid residues corresponding to the region between Gly-289 and Asp-320 sequences of SEQ ID NO: 1 differ among the coagulation factor X proteins of different species. Amino acid residues conserved across species are shown in the consensus sequence.

Fig. 9. Amino acid composition of endogenous hFX and chimeric FX variants. Residues Histidine91 and Tyrosine99 of the domain having serine protease activity (chymotrypsin numbering; correspond to His 311 and Tyrosine 319, respectively, of the FX factor represented by the sequence SEQ ID NO:1) endogenous human (hFX) when aligned with chimeric FX type A (c- FX A, middle; sequence between His 311 and Asp 320 corresponds to SEQ ID NO:9), type B (c-FX B; sequence between His 311 and Asp 320 corresponds to SEQ ID NO:10), and type C (c- FX C; the sequence between His 311 and Asp 320 corresponds to SEQ ID NO:11).

Fig. 10. FXa study: A: Coomassie staining of 5 μg of FXa variants on 4-12% Bis-Tris gels. from left to right: factor Xa from plasma (pd-FXa), r-hFXa, chimeric factor Xa types A, B and C (- A, - B, - C). B: prothrombin conversion (1.4 µM) in the presence of 50 µM PCPS (75% phosphatidylcholine, 25% phosphatidylserine) and 20 nM FV (FV810, recombinant, B-domain truncated, FV) and 0.1 nM pd-FXa, r-hFXa, c-FXa - A, c-FXa - B and c-FXa - C. Values shown represent the average of two independent experiments.

Fig. 11. Inhibition of FXa variants by direct oral anticoagulants. Normalized conversion of prothrombin under the influence of 1 nM pd-FXa (triangles), r-hFXa (circles), chimeric FXa -A (squares), -B (diamonds) and -C (crosses) was assessed in the presence of 0.001 - 100 µM apixaban (left , icons with fill) or edoxaban (right, icons without fill). Inhibition constants (determined using the Graphpad Prism 6 software package) of apixaban for pd-FXa: 2 nM, rhFXa: 4 nM, c-FXa - A: 130 nM, - B: 760 nM - C: 1270 nM and edoxaban for r-hFXa : 0.5 nM, c-FXa - A: 3 nM, - B: 140 nM - C: 270 nM.

Fig. 12. Profiles of FXa factor-initiated thrombin (TG) generation for FXa variants. Formation of thrombin in plasma in the absence (A) and presence (B) of the direct oral anticoagulant apixaban (2 μM). Initiation of thrombin generation by pd-FXa, r-hFXa, c-FXa - A, cFXa - B and c-FXa - C variants in FX-deficient plasma. Curves represent the average of at least 3 independent experiments.

Fig. 13. Profile of tissue factor (TF)-triggered thrombin generation for r-hFX and cFX - S. A: plasma thrombin generation at low TF levels (2 pM) in the absence and presence of 2 µM direct oral anticoagulant apixaban (Apixa) per 1 unit r-hFX, r-hFX plus apixaban, c-FXa - C or c-FXa - C plus apixaban. One unit of r-hFX (7 μg/ml) or c-FXa - C (16 μg/ml) was determined in a prothrombin time-based coagulation assay using normal human plasma for comparison. Curves represent the average of at least 3 independent experiments. B: thrombin formation in plasma at high TF levels (20 pM).

Fig. 14. Profile of tissue factor (TF)-initiated thrombin generation for - r-hFX and cFX - C. (Top graph): thrombin formation in plasma at low TF levels (2pM) in the absence (dashed line) and in the presence of 200 nM (light gray ), 600 nM (dark gray) 2000 nM (black) direct oral anticoagulant edoxaban per unit r-hFX (7 μg/(ml). (Bottom graph): plasma thrombin formation at low TF levels (2pM) with close concentrations of edoxaban per 1 unit of c-FXa - C (16 μg/ml) Curves represent the average of 2 independent experiments.

- 15 045357

Table 1

Amino acid 3-letter designation [114] 1-letter designation ¹¹¹⁴¹ Side chain polarity ¹¹¹⁴¹ Side chain charge (pH 7.4) ¹¹¹⁴¹ Hydrophobicity index ¹¹¹⁵¹ Absorbance Amax (nm) [114] ε at Amax (x10' ³ M' ¹ CM' ¹ ) [116] Alanin Ala A non-polar neutral 1.8 Arginine Arg R polar, basic positive -4.5 Asparagine Asn N polar neutral -3.5 Aspartic acid Asp D polar, acidic negative -3.5 Cysteine Cys C non-polar neutral 2.5 250 0.3 Glutamic acid Glu E polar, acidic negative -3.5 Glutamine Gin Q polar neutral -3.5 Glycine Gly G non-polar neutral -0.4 G istidin His H polar, basic positive(10%) negative(90%) -3.2 211 5.9 Isoleucine lie 1 non-polar neutral 4.5 Leucine Leu L non-polar neutral 3.8 Lysine Lys TO polar, basic positive -3.9 Methionine Met M non-polar neutral 1.9 Phenylalanine Phe F non-polar neutral 2.8 257,200,188 0.2, 9.3, 00.0 Proline Pro P non-polar neutral -1.6 Serin Ser s polar neutral -0.8 Threonine Thr T polar neutral -0.7 Tryptophan Trp w non-polar neutral -0.9 280.219 5.6, 47.0 Tyrosine Tyr Y polar neutral -1.3 274,222,193 1.4, 8.0, 48.0 Valin Vai V non-polar neutral 2.4

Examples

Example 1.

Materials and methods.

Rivaroxaban and apixaban were obtained from Alsachim (Illkirsch, France) and dissolved in DMSO (~30 mg/ml). Peptidyl substrate methoxycarbonylcyclohexylglycylglycylarginine-p-nitroanilide (Spec-Xa) was obtained from Sekisui Diagnostics (Stamford, CT, USA). All tissue culture reagents were from Life Technologies (Carlsbad, CA), with the exception of insulin-transferrine selenite sodium (ITS, which was obtained from Roche (Basel, Switzerland). Small unilamellar phospholipid vesicles (PCPS), consisting of 75% (vol/vol/ v/v L-phosphatidylcholine from chicken eggs and 25% (v/v) L-phosphatidylserine from porcine brain (Avanti Polar Lipids, Alabaster, AL) were prepared and tested as previously described (Higgins et al., 1983. J Biol Chem 258: 6503-6508) Human plasma without FX was obtained from Diagnostica Stago (Paris, France).All functional studies were performed in HEPES buffered saline (20 mM Hepes, 0.15 M NaCl, pH 7.5), containing 5 mM CaCl ₂ and 0.1% polyethylene glycol 8000 (assay buffer) Mammalian expression vector pCMV4 (Andersson et al., 1989. J Biol Chem. 264: 8222-8229) containing recombinant human FX (r- hFX) was a gift from Rodney M. Camire (Camire et al., 2000. Biochemistry 39: 14322-14329) The pcDNA3 vector was obtained from Invitrogen and the PACE cDNA was a gift from the Genetics Institute, Boston, MA. A vector containing furin, a precursor protein convertase, is described in US Patent No. 5,460,950.

Recombinant human factor V (FV) was prepared, purified and characterized as described previously (Bos et al., 2009. Blood 114: 686-692). Recombinant snake P. textilis FXa (vpt-FXa) was prepared, purified, and characterized as previously described (Verhoef et al., Toxin Reviews (2013) (doi:10.3109/15569543.2013.844712). Human factor Xa derived from plasma (pd-hFXa), DAPA, human prothrombin, and monoclonal mouse IgG anti-human factor X (AHX-5050) were obtained from Haematologic Technologies (Essex Junction, Vermont, USA) Paired anti-FX antigen antibodies for ELISA were obtained from Cedarlane ( Burlington, Canada) RW-X activator was obtained from Diagnostica Stago (Paris, France), or Haematologic Technologies. Apal restriction endonuclease was obtained from New England Biolabs (Ipswich, MA, USA). T4 DNA ligase was obtained from Roche (Roche Applied Science, Indianapolis, Indiana, USA).

The DNA sequence encoding the modified human FX-A is provided as SEQ ID NO: 7. The DNA sequence encoding the modified human FX-B is provided as SEQ ID NO: 8. The nucleotide sequence encoding SEQ ID NO: 4 (to obtain the modified FX -A human) or SEQ ID NO: 5 (to produce modified human FX-B) containing Apal recognition sites at the ends were synthesized in Genscript (Piscataway, New Jersey, USA), subcloned into the pCMV4 vector for expression in mammals using Apal and T4 DNA ligase and sequenced to confirm the match. Modified human FX-A and modified human FX-B were also designated mod-hFX-A and mod-hFX-B, respectively. Stable HEK293 cell lines expressing r-hFX or modified hFX were generated as

- 16 045357 described previously (Larson et al., 1998. Biochemistry 37, 5029-5038). HEK293 cells were cotransfected with pCMV4 and pcDNA-PACE vectors using Lipofectamine 2000 according to the manufacturer's instructions. Expression of FX by transfected cells was assessed using a modified one-step clotting assay using FX-free human plasma. Transfected cells with the highest expression levels were transferred to T175 culture flasks and grown for 24 h in expression medium (DMEM-F12 culture medium without phenol red, containing: penicillin/streptomycin/fungisone, 2 mM L-glutamine, 10 μg/ml ITS, 100 mcg/ml geneticin 418 sulfate and 6 mcg/ml vitamin K). Post-growth media were collected, centrifuged at 10,000 g to remove cell pellets, concentrated using a 10 kDa band-limited filter (Millipore, Darmstadt, Germany), washed with HEPES buffered saline, and stored in 50% glycerol at -20°C. WITH. FX antigen levels in glycerol storage solutions were assessed by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's instructions using collected human plasma as a reference standard, assuming a plasma FX concentration of 10 μg/mL.

Expression medium was added for 24 hours to stable cell lines expressing either rhFX, modified human FX-A, or modified human FX-B. An aliquot of the culture medium was incubated with RW-X (10 ng/μl; Haematologic Technologies) for 120 minutes at 37°C. Modified human FX-A or modified human FX-B, upon activation, is also referred to as m-hFXa A or m-hFXa B, respectively. Assuming that all FXa variants have similar substrate affinities, the concentration of FXa in the medium was sequentially determined by the conversion of peptidyl substrate (Spec-Xa, 250 μM) using known concentrations of pd-hFXa as a standard. Steady-state initial rates of macromolecular substrate degradation were determined at intervals at 25°C as described previously (Camire, 2002. J Biol Chem 277: 37863-70). Briefly, activation reaction curves for prothrombin were obtained by incubating PCPS (50 μM), DAPA (10 μM), and prothrombin (1.4 μM) with recombinant human FV-810 (B domain truncated, continuously active) and these reactions were initiated using either 0.1 nM pdhFXa, r-hFXa, m-hFXa B, or 0.033 nM m-hFXa A. Prothrombin conversion rates were measured as previously described (Krishnaswamy et al., 1997. Biochemistry 36, 3319-3330).

Recombinant FX and modified human FX-A and modified human FX-B (200 ng) were activated with RVV-X (0.5 U/ml) for 60 min at 37°C and electrophoresed under reducing conditions (30 mM dithiothreitol ) using 4–12% gradient precast gels and MES buffer system (Life Technologies), and transferred to a nitrocellulose membrane using the Trans-Blot Turbo Transfer System (Bio-Rad Laboratories, Hercules, CA, USA). The membrane was treated with anti-FX heavy chain antibodies and protein tracks were visualized using Dyelight-800 fluorescent anti-mouse antibody (Thermo Scientific, Rockford, IL, USA). hFXa (200 ng) obtained from plasma was used as a standard.

Thrombin generation was carried out using adapted protocols described previously (Hemker et al., 2003. Pathophysiol Haemost Thromb, 33: 4-15). Briefly, FX-free plasma was mixed with corn trypsin inhibitor (70 μg/ml), buffer (25 mM HEPES, 175 mM NaCl, 5 mg/ml BSA, pH 7.5) and PCPS (20 μM) and incubated for 10 min. at 37°C in a 96-well microplate. Thrombin formation was initiated by adding pd-hFXa (0.5 nM) or vpt-FXa (0.5 nM) preincubated with rivaroxaban (0.4 μM) or apixaban (0.2 μM) containing FluCa and immediately transferred mixed with plasma. The final reaction volume was 120 μL, of which 64 μL was plasma without FX. Thrombin generation was determined every 20 s for 30 min and corrected with a calibrator using software (Thrombinoscope, version 5.0). The average endogenous thrombin potential (the area under the thrombin generation curve) was calculated from at least two independent experiments. The calibrator and fluorescent substrate (FluCa) were purchased from Thrombinoscope (Maastricht, The Netherlands).

Conversion of the peptidyl substrate (Spec-Xa, final concentration 250 μM) for each FXa variant was carried out in the absence and presence of the direct FXa inhibitors rivaroxaban and apixaban (final concentration 0.001 μM - 100 μM) at ambient temperature. Stock solutions of pd-hFXa (2 nM final concentration) or vpt-FXa (10 nM final concentration) without calcium were diluted in assay buffer and incubated in a 96-well microplate in the presence of assay buffer or inhibitor for 2 min. Substrate conversion was initiated using Spec-Xa and absorbance was measured for 10 min at 405 nM on a SpectraMax M2e plate reader equipped with Softmax Pro software (Molecular Devices, Sunnyvale, CA, USA). To assess the sensitivity to DFXI of each recombinant FX variant, glycerol stock solutions (5-40 μl) of r-hFX, modified human FX-A, and modified human FX-B were diluted in assay buffer and incubated with RW-X (0 .5 U/ml) for 60 min at 37°C. Activated stock solutions were serially diluted with assay buffer, incubated for 2 min in a 96-well microplate in the presence of assay buffer or inhibitor, and substrate conversion was determined as previously described. The relative concentrations of rhFX, m-hFXa A and m-hFXa B were estimated from the rate of substrate conversion in the absence of inhibitor using known concentrations of pd-hFXa as a standard.

Results.

(Vpt)-FXa, derived from the venom of the snake P. textilis, is resistant to inhibition by the direct factor Xa inhibitors DFXI.

Biochemical characterization of purified recombinant FXa (vptFXa) derived from the venom of the snake P. textilis revealed that this protease, unlike FXa of all other species currently known, is resistant to inhibition by the direct anticoagulants rivaroxaban and apixaban, which were designed to block reversibly active site FXa. Consistent with previous observations, the Ki of human FXa (hFXa) inhibition was approximately 1 nM (Perzborn, 2005. J Thromb Haemost, 3, 514-521), and vptFXa inhibition was at least 1000-fold reduced (Figure 2A) . These observations were confirmed in a plasma system simulating fibrin formation in vivo, demonstrating that physiological concentrations of FXa inhibitors had little or no effect on thrombin generation initiated by vptFXa, while a significant reduction was observed in the presence of hFXa (Figure 2B,C). .

Chimeric FXa of human and snake venom P. textilis.

A structural element discovered that is not only restricted to vptFXa but also present in FX from the venom of the Australian snake Notechis scutatus constitutes an altered amino acid composition at a position near the active site of hFXa (Fig. 1C). Given its location, we hypothesized that this unique helix may modulate the interaction not only with rivaroxaban and/or apixaban, but also with FVa, since the reported FVa binding site is C-terminal in this helix (Lee et al., 2011. J Thromb Haemost 9: 2123-2126). To test this hypothesis, we generated two protein-coding DNA constructs designated SEQ ID NO: 7 and 8. The mod-hFX-A chimera, designated SEQ ID NO: 7, contains the corresponding N. scutatus DNA sequence (indicated in bold and underlined), and the mod-hFX-B chimera designated SEQ ID NO: 8 contains the corresponding portion of the P. textilis sequence (indicated in bold and underlined).

Using these DNA constructs, we generated HEK293 cell lines that stably produced both chimeric proteins and sequentially determined the expression levels of modified human FX in HEK293 cells by culturing the cells in expression medium for 24 hours. Western blot analysis revealed expression of full-length FX for both chimeric variants was similar to the expression of natural FX (Fig. 3A). Incubation with the Russell's viper venom activator (RVV-X) resulted in proteolytic activation of approximately 30% of the FX zymogen in FXa, manifested by the appearance of a heavy chain track of ~29 kDa. The heavy chain of both modified human FXa-A and modified human FXa-B moved as a slightly larger protein, consistent with the introduction of a snake sequence that is 12 or 13 residues longer than the human FXa sequence, respectively. Analysis of FX antigen levels in the growth medium showed that while mod-hFX-A expression was reduced approximately 7-fold, mod-hFX-B expression was close to that of native human FX (Fig. 3B). Low levels of FX antigen mod-hFX-A correlated with the same low levels of FX activity that we observed using a modified coagulation activity assay. This indicates that mod-hFX-A protein expression is close to optimal compared to the expression of other FX variants and its FX function is not impaired.

To test FX zymogen activity, we converted rFX and modified human FX-A and modified human FX-B to FXa using Russell's viper venom FX activator (RVVX). Both modified human FXa-A and modified human FXa-B demonstrated protease activity upon activation of RVV-X, as determined by conversion of the low-molecular-weight peptidyl substrate SpectroZyme Xa, which is specific for FXa. In addition, prothrombin conversion rates in the presence of the human FVa cofactor were similar to those in the presence of human FXa (both pd-hFXa and r-hFXa) (Fig. 4). Taken together, these observations suggest that snake sequence insertions do not cause significant changes in the enzymatic properties of human FX

Inhibition of FXa chimeras by direct factor Xa inhibitors. To estimate the inhibition constant (Ki) of rivaroxaban and apixaban for modified human FX-A activated by RW-X, the activated recombinant protein was preincubated with 0.001 to 100 μM inhibitor and then studied its catalytic activity against SpectroZyme Xa. Although incubation with 0.5 μM rivaroxaban resulted in complete inhibition of r-hFXa and pd-hFXa, mod-hFXa-A remained fully active under these conditions (Fig. 5A). Moreover, this chimeric variant showed partial chromogenic activity after incubation with 100 μM rivaroxaban, as did P. textilis snake FXa. These data indicate that the Ki upon mod-hFXa-A inhibition is at least 100-fold higher than the human FXa constant. We observed a similar decrease in sensitivity to inhibition by apixaban (Fig. 5B).

- 18 045357

Evaluation of the inhibition of mod-hFXa-B by rivaroxaban and apixaban showed that Ki is close to the value of this constant for mod-hFXa-A (Fig. 6A and 6B). Thus, reduced sensitivity to inhibition by apixaban and rivaroxaban has been demonstrated. Finally, inhibition of chimeric FXa variants by direct Factor Xa inhibitors was unaffected in the presence of the FVa cofactor and negatively charged phospholipid vesicles, suggesting that both the free protease and the protease bound in the FVa-FXa-lipid complex are equally resistant to inhibition by rivaroxaban and apixaban (Fig. 7A, B).

Example 2.

Materials and methods.

Unless otherwise noted, the materials and methods used in this Example were the same or similar to those in Example 1.

Recombinant FX expression constructs: DNA encoding chimeric FX-A (c-FX A), chimeric FX-B (c-FX B), and chimeric FX-C (c-FX C) were synthesized at Genscript (Piscataway, NJ, USA) was subcloned into the pCMV4 vector for mammalian expression using Apal and T4 DNA ligase and sequenced for verification. Stable HEK293 cell lines expressing recombinant human FX or recombinant chimeric FX were generated as previously described (Larson et al., 1998. Biochemistry 37, 5029-5038). HEK293 cells were simultaneously transfected with pCMV4 and pcDNA-PACE vectors using Lipofectamine2000 according to the manufacturer's instructions.

Purification of chimeric FX(a): Recombinant chimeric products FXA, B and C were prepared, purified and assayed according to the previously described procedure (Camire et al., 2000), except that the immunoaffinity purification was replaced by calcium gradient purification of FX Sepharose column POROS HQ20. Typical yield of fully γ-carboxylated recombinant FX was 0.9 mg/L growth medium. Purified recombinant chimeric FX was activated with RW-X (0.1 U/mg FX), isolated by gel filtration on a Sephacryl S200 HR column (Vt 460 ml) and stored at -20°C in HBS containing 50% v/v. glycerin. Purified products were visualized by Coomassie staining.

Macromolecular substrate activation: Steady-state initial rates of macromolecular substrate cleavage reaction were determined intermittently at 25°C as previously described (Camire, 2002). Briefly, prothrombin activation curves were obtained by incubating PCPS (50 μM), DAPA (10 μM), and prothrombin (1.4 μM) with recombinant human FV-810 (20 nM, B domain truncated, constitutively active FV), and the reaction was initiated using 0.1 nM pd-hFXa, r-hFXa, c-FXa A, c-FXa B, or c-FXa C. Prothrombin conversion rates were measured as described previously (Krishnaswamy et al., 1997). Prothrombin conversion was examined in the absence or presence of the direct FXa inhibitors edoxaban (CAS registration number 912273-65-5; manufactured by Daiichi Sankyo, marketed as Savaysa) and apixaban (final concentration 0.001 μM - 100 μM) to determine the DOAC sensitivity of each recombinant FXa variant.

Thrombin Generation Assays: The thrombin generation protocol was adapted from a previously described protocol (Hemker et al., 2003). Briefly, thrombin generation curves were generated by adding tissue factor (TF, final concentration 2 or 20 pM), corn trypsin inhibitor (70 μg/ml), phospholipid preparation PCPS (20 μM), and 1 U ( prothrombin coagulation activity at a certain time) r-hFX (7 μg/ml) or chimeric FX-C (16 μg/ml). Thrombin generation was initiated by adding substrate buffer (Fluca) to the plasma. Thrombin generation curves in the presence of FXa were obtained by adding corn trypsin inhibitor (70 μg/ml), assay buffer, and PCPS (20 μM) to FX-free plasma. Thrombin generation was initiated by adding FXa premixed with rivaroxaban or apixaban, calcium-free assay buffer, and Fluca buffer. The final reaction volume was 120 μL, of which 64 μL was plasma without FX. Thrombin generation was determined every 20 seconds for 30 minutes and corrected with a calibrator using Thrombinoscope software. Latency time, mean endogenous thrombin potential (area under the thrombin generation curve), retention time, and peak thrombin generation were calculated from at least 3 independent experiments.

Results.

The insertion of residues 9–13 in the serine protease domains of the P. textilis snake, the FXa isoform of the P. textilis and N. scutatis snakes, prompted the construction of chimeric human-snake FX. We generated three DNA constructs encoding proteins incorporating each of these insertions into human FXa (Fig. 9). Using these DNA constructs, HEK293 cell lines were generated that stably produce one of normal recombinant human FX (r-hFX) and three types of chimeric FX (c-FX A, c-FX B, and c-FX C). Expression levels of recombinant human FX and chimeric FX in HEK293 cells were determined by growing the cells in expression medium for 24 h, after which the clotting activity of the medium was assessed using a modified one-step plasma RT clotting assay without FX. Recombinant γ-carboxylated FX was purified from placenta growth media.

- 19 045357 body stages of ion exchange chromatography. Fractions of FX solutions were sequentially activated with the FX activator from Russell's viper venom, isolated by gel filtration and characterized by SDS-PAGE. The heavy chain of purified factor Xa isolated from plasma moved as a 50/50 mixture with FXa-α and FXa-β of ~34-31 kDa. Although autoproteolytic cleavage of the C-terminal region of FXaα (residues 436–447) results in the β form of FXa, both isoforms are functionally similar with respect to prothrombinase complex formation, prothrombin activation, antithrombin recognition, and peptidyl substrate conversion (Pryzdial and Kessler, 1996).

The purified products r-hFXa and chimeric FXa-B and -C moved primarily as FXa-β, while chimeric FXa-A moved as a 50/50 mixture of α and β FXa (Fig. 10A). Kinetics of macromolecular substrate activation by r-hFXa and chimeric FXa (A/B/C) in negatively charged phospholipid vesicles (PCPS) in the presence of the cofactor FVa demonstrated that all chimeric variants are incorporated into the prothrombinase complex. However, the rate of catalysis of the chimeric variants FXaA, -B and -C in , respectively, is 8.2-, 6.8- and 2.3 times lower compared to recombinant human FXa. Moreover, recombinantly produced human FXa showed a slight decrease in catalytic efficiency compared to plasma-derived FXa (Fig. 10B).

To determine the inhibition constant (Ki) of DOACs (apixaban, edoxaban) for chimeric FXa (A/B/C), the kinetics of prothrombin activation in the presence of 0.001-100 μM DOAC was studied. Although plasma-derived FXa and recombinant human FXa were completely inhibited by near-equimolar concentrations of DOAC, all chimeric FXa variants were able to convert prothrombin at significantly higher concentrations of FXa inhibitors (apixaban Ki: 130-1270 nM, edoxaban Ki: 3-270 nM) (Fig. 11). Given that chimeric FXa variants contain similarly located inserts of varying lengths and different amino acid compositions, the authors hypothesized that the reduced sensitivity to different DOACs is a direct consequence of the location of these inserts in close proximity to the DOAC-coordinating Tyr99 residue and/or the active site.

To evaluate the potential of chimeric FXa to restore thrombin generation in plasma spiked with direct oral anticoagulants, a thrombin generation (TG) assay was performed. Thrombin generation in FX-free human plasma initiated by FXa (5nM) showed a normal TG profile for the c-FXa C variant, and near normal profiles for the cFXa A and B variants A and B (FIG. 12A). Although apixaban (2 μM) significantly increased the lag time and decreased peak thrombin generation in the pd-FXa- and r-hFXa-triggered thrombin generation assay, these parameters were not altered in the presence of chimeric FXa variants (Figure 12B) ( Table 2). These results indicate that chimeric FXa variants are able to restore hemostasis in plasma containing direct oral anticoagulants. In addition, the zymogenic form of chimeric FX-C is also able to support thrombin generation in FX-free plasma. Initiation of coagulation with low concentrations of tissue factor (TF, 2 pM) resulted in a robust TG curve for chimeric FX-C, unaffected by apixaban, unlike the TG for r-hFX (Fig. 13). At low TF concentrations, chimeric FX-C exhibits a short lag in TG onset and time to peak, in addition, chimeric FX-C has a higher endogenous thrombin potential (ETP) and a higher peak thrombin generation (Table 3). However, these values normalize at high TF concentrations (20 pM) (Fig. 13) (Table 3). Based on observations made in the FXa-triggered thrombin generation study, we expect that zymogenic forms of the chimeric FX A and B variants also support tissue factor-triggered thrombin generation in plasma spiked with direct oral anticoagulants. Fig. 14 in combination with table. 4 provide further evidence of the effect of chimeric FXa variants on the restoration of hemostasis in plasma containing direct oral anticoagulant inhibitors. In summary, these results demonstrate that chimeric FX(a) is able to restore hemostasis in plasma containing DOAC inhibitors, both in the zymogenic form and in the protease form.

table 2

Effect of apixaban on the parameters of thrombin formation initiated by FXa pd-FXa r-hFXa c-FXa-A c-FXa-B c-FXa-C

Delay time blocking, sec 299 293 61 12 3 Peak appearance time delay, sec 515 467 120 thirty 7

- 20 045357

Peak thrombin formation, % of the experiment without apixaban 26 33 78 85 99 Area under the curve, % of experience without apixaban 67 76 89 92 101

Values shown indicate thrombin generation values obtained in the presence of apixaban adjusted for thrombin generation values obtained in the absence of apixaban.

Table 3

Summary of Thrombin Generation Experiments Triggered by Low and High Concentrations of TF

Low r-hFXa r-hFXa + c-FXa-C c-FXa-C + apixaban concentration apixaban

TF, 2 p/m

Delay time, sec 132 ±5 696 ±162 185 ± 12 186 ±6 Peak appearance time, sec 324 ±6 no peak 480 ± 24 492 ± 23 Thrombin peak nM 61 ±4 8±4 78 ± 1 72 ±4 ETP, nM 567 ± 61 no ETP 830 ±131 756 ± 38

High TF concentration, 20 p/M r-hFXa r-hFXa + apixaban c-FXa-C c-FXa-C + apixaban Delay time, sec 48 ± 1 138 ± 12 72 ±2 78 ±2 Peak appearance time, sec 114 ± 6 804 ± 36 138 ±6 144 ±9 Thrombin peak nM 338 ±8 32 ±4 334 ± 15 321 ± 15 ETP, nM 973 ± 18 694 ± 67 1027± 19 1012 ±33

- 21 045357

Table 4

Effect of edoxaban on TF-initiated TG parameters for r-hFX and c-FX-C r-hFX

Ed oxaban, nM control 50 100 200 400 600 1000 2000 Delay time, sec 115 247 297 397 538 679 874 1180 Remaining ETP 100 % 99.3 87.1 No ETP No ETP No ETP No ETP No ETP Peak height, % 100 % 41.2 30.8 23.1 15.9 13.0 10.1 7.1 Peak appearance time, sec c-FX-C 265 618 756 1290 1890 1932 2472 2562 Ed oxaban, nM control 50 100 200 400 600 1000 2000 Delay time, sec 188 161 161 12 182 197 212 232 Remaining ETP 100 % 87.9 92.5 88.3 92.7 96.8 92.7 82.0 Peak height, % 100 % 109.3 112.3 101.0 94.6 88.7 77.5 65.3 Appearance time 433 382 388 418 448 483 538 578

peak duration, sec

Values shown indicate experimental TG values obtained in the presence of increasing concentrations of edoxaban.

Claims (16)

CLAIM 1. A recombinant protein comprising a mammalian coagulation factor Xa polypeptide, wherein said polypeptide has an alteration or deletion of an amino acid residue corresponding to amino acid residue Phe-396 of SEQ ID NO:1, wherein said altered protein is catalytically active and has reduced sensitivity to inhibition by a direct factor inhibitor Xa compared to unchanged factor Xa polypeptide. 2. The protein according to claim 1, characterized in that the change or deletion of the amino acid residue corresponding to the amino acid residue Phe-396 is combined with the insertion of 1-20 amino acid residues in the region corresponding to the region of amino acid residues between His-311 and Asp-320 of the sequence SEQ ID NO: 1. 3. The protein according to claim 2, additionally containing a replacement of 1 to 8 amino acid residues in the region of amino acid residues between His-311 and Asp-320 of the sequence SEQ ID NO: 1. 4. The protein according to claim 2 or 3, characterized in that the region of amino acid residues corresponding to the region of amino acid residues between His-311 and Asp-320 of the sequence SEQ ID NO: 1 has the amino acid sequence SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11. 5. A nucleic acid molecule containing a DNA sequence that encodes a recombinant protein according to any one of claims. 1-4. 6. An expression vector containing a nucleic acid molecule according to claim 5. 7. A host cell containing the nucleic acid molecule of claim 5 or the expression vector of claim 6. 8. A pharmaceutical composition containing a protein according to any one of claims 1 to 4 and a pharmaceutically acceptable carrier for the treatment of bleeding. 9. The use of a protein according to any one of claims 1-4 for the treatment or prevention of complications in the form of bleeding associated with anticoagulant therapy using a direct factor Xa inhibitor. - 22 045357 10. Use of a protein according to any one of claims 1 to 4 for the preparation of a medicament for complete or partial reversal of bleeding complications associated with the use of a direct factor Xa inhibitor in a subject. 11. Use according to claim 9 or 10, characterized in that the direct factor Xa inhibitor is rivaroxaban (5-chloro-M-[[(5 S)-2-okco-3 - [4-(3-oxo-4 -morpholinyl)phenyl]-5-oxazolidinyl]methyl]2-thiophenecarboxamide), apixaban (1-(4-methoxyphenyl)-7-oxo-6-[4-(2-oxopiperidin-1-yl)phenyl]4,5 ,6,7-tetrahydro-1H-pyrazolo[3,4-c]pyridine-3-carboxamide), edoxaban (N'-(5-chloropyridin-2-yl)-N[(1 S,2R,4S)- 4-(dimethylcarbamoyl)-2-[(5 -methyl-6,7-dihydro-4H-[1,3]thiazolo[5,4-c]pyridin-2carbonyl)amino]cyclohexyl]oxamide, 4-methylbenzenesulfonic acid) and/or betrixaban (N-(5chloropyridin-2-yl)-2-[[4-(N,N-dimethylcarbamidoyl)benzoyl]amino]-5-methoxybenzamide). 12. The use of a pharmaceutical composition according to claim 8 for the treatment or prevention of complications in the form of bleeding associated with anticoagulant therapy using a direct factor Xa inhibitor. 13. Use of the pharmaceutical composition according to claim 8 for the preparation of a medicament for the complete or partial reversal of bleeding complications associated with the use of a direct factor Xa inhibitor in a subject. 14. Use according to claim 12 or 13, characterized in that the direct factor Xa inhibitor is rivaroxaban (5-chloro-A [(5 S)-2-okco-3 - [4-(3-oxo-4-morpholinyl )phenyl]-5-oxazolidinyl] methyl] 2-thiophenecarboxamide), apixaban (1-(4-methoxyphenyl)-7-oxo-6-[4-(2-oxopiperidin-1-yl)phenyl]4,5,6 ,7-tetrahydro-1H-pyrazolo[3,4-c]pyridine-3-carboxamide), edoxaban (N'-(5-chloropyridin-2-yl)-N[(1 S,2R,4S)-4- (dimethylcarbamoyl)-2-[(5-methyl-6,7-dihydro-4H-[1,3]thiazolo[5,4-c]pyridine-2carbonyl)amino]cyclohexyl]oxamide, 4-methylbenzenesulfonic acid) or betrixaban (N-(5chloropyridin-2-yl)-2-[[4-(N,N-dimethylcarbamidoyl)benzoyl]amino]-5-methoxybenzamide). 15. A method of completely or partially reversing the anticoagulant effect of a direct factor Xa inhibitor in a subject, said method comprising administering to said subject a therapeutically effective amount of a protein according to any one of claims 1 to 4 or a pharmaceutical composition according to claim 8. 16. The method according to claim 15, characterized in that the direct factor Xa inhibitor is rivaroxaban (5 -χλορ-Ν-[[(5 S)-2-okco-3- [4-(3-oxo-4-morpholinyl )phenyl]-5-oxazolidinyl]methyl]-2-thiophenecarboxamide), apixaban (1-(4-methoxyphenyl)-7-oxo-6-[4-(2-oxopiperidin-1-yl)phenyl]-4,5 ,6,7tetrahydro-1H-pyrazolo[3,4-c]pyridine-3-carboxamide), edoxaban (N'-(5-chloropyridin-2-yl)-N[(1 S,2R,4S)-4- (dimethylcarbamoyl)-2-[(5-methyl-6,7-dihydro-4H-[1,3]thiazolo[5,4-c]pyridine-2carbonyl)amino]cyclohexyl]oxamide, 4-methylbenzenesulfonic acid) or betrixaban (N-(5chloropyridin-2-yl)-2-[[4-(N,N-dimethylcarbamidoyl)benzoyl]amino]-5-methoxybenzamide).