EA044599B1 - ADENOVIRUS ARMED WITH A BISPECIFIC T-CELL ACTIVator - Google Patents

Description

The present invention relates to a modified adenovirus, in particular enadenotucirev (EnAd), an armed FAP-bispecific T-cell activator, a composition, such as a pharmaceutical composition containing said adenovirus, the use of said virus and viral compositions, in particular, in the treatment, in particular , in the treatment of cancer. The present invention also covers methods for producing said virus and the DNA encoding it. The present invention also includes novel sequences listed in the sequence listing in combination with the technical description herein, for example, wherein the exemplary virus is replaced by, for example, an alternative cassette variant or an alternative variant of the virus listed in the sequence listing.

Field of technology

Cancer is still a significant social burden for society, resulting in difficulties and suffering for patients and their loved ones, as well as in the high financial costs of treatment, care and support for patients.

The stroma around cancer cells represents a physical defense, that is, it can serve as a trap for immune cells sent to fight the tumor. In addition, the stroma shields the hypoxic tumor microenvironment, which is permissive and optimized for tumor growth. According to some theories, cells in the stroma are the source of energy in the tumor.

An essential component of tumor stroma are fibroblasts, modified in a distorted manner so that they promote cancer. Other cells infiltrating the stroma are tumor-associated macrophages (TAMs), represented by type 2 macrophages (M2), which can promote tumor growth by secreting cytokines and chemokines such as IL-10, which suppress immune responses.

In particular, targeting the tumor stroma is difficult because the cells that make up its environment are natural immune or connective tissue cells that are found throughout the body. Accordingly, targeting therapeutic agents to these cells can lead to serious off-target effects.

Thus, there is a need for an improved method of delivering a bispecific T cell activator directly to tumor cells where it can provide maximum beneficial therapeutic effect, particularly delivery to tumor cells surrounded by stromal fibroblasts.

Both WO 2018/041838 and WO 2018/041827, incorporated herein by reference, disclose certain adenoviruses encoding a bispecific T cell activator. However, it would be useful to increase the activity of the bispecific T cell activator encoded in the virus by incorporating activating cytokines. Incorporation of two cytokines colocalized with a bispecific T cell activator can be achieved without much difficulty. However, when the three cytokines colocalize with the bispecific T-cell activator, the nature of these genes begins to influence the expression of the bispecific T-cell activator. The present inventors have produced the 4-transgene virus NG-615 shown in FIG. 1. However, the expression of bispecific T cell activator was decreased. Surprisingly, the NG-641 virus, where two cytokines are altered (compared to NG-615), has good activity, including good expression of bispecific T-cell activator. Accordingly, these four transgenes together appeared to be compatible with colocalization in the virus.

The present invention relates to a virus containing these four transgenes colocalized between the fiber protein, L5 and E4 regions.

Brief description of the invention

The following paragraphs provide a brief description of the present invention.

1. Adenovirus containing the sequence of formula (I):

5'ITR-B ₁ -B _A -B ₂ -Bx-B _B -B _Y -B3-3'ITR(I) where: B ₁ is a bond or contains: E1A, E1B or E1A-E1B;

B _A contains-E2B-L1-L2-L3-E2A-L4;

B2 is a bond or contains: E3;

B _X is a DNA link or sequence containing: a restriction site, one or more transgenes; or both the first and the second; BB contains L5;

BY contains a transgene cassette containing four transgenes, the genes encoding FAP bispecific activator of T cells, CXCL10, CXCL9 and IFN;

B ₃ is a bond or contains: E4.

2. The adenovirus of claim 1, wherein said FAP-encoded bispecific T-cell activator contains an anti-CD3 sequence set forth in SEQ ID NO: 5, or a sequence at least 95% identical to that specified, for example, SEQ ID NO: 5.

3. Adenovirus according to paragraph 1 or 2, characterized in that the specified FAP-bispecific active

- 1 044599 T cell torus contains the anti-FAP sequence presented in SEQ ID NO: 9, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO: 9

4. The adenovirus of claim 1, wherein said FAP-encoded bispecific T-cell activator contains a sequence selected from SEQ ID NO: 75, SEQ ID NO: 76, or a sequence at least 95% identical to any of these sequences .

5. An adenovirus according to any one of paragraphs 1-4, characterized in that the specified transgene cassette encodes CXCL10 presented in SEQ ID NO: 100, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO: 100.

6. An adenovirus according to any one of paragraphs 1-5, characterized in that the specified transgene cassette encodes CXCL9 presented in SEQ ID NO: 99, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO: 99.

7. An adenovirus according to any one of paragraphs 1-6, characterized in that the specified transgene cassette encodes IFN-α (IFNa), presented in SEQ ID NO: 98, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO: 98.

8. Adenovirus according to any of paragraphs 1-7, characterized in that said transgenes are functionally linked.

9. Adenovirus according to any of paragraphs 1-8, characterized in that these transgenes are separated by 3 different highly effective self-cleaving peptides.

10. Adenovirus according to claim 9, characterized in that said self-cleaving peptides are independently selected from E2A, F2A, P2A and T2A.

11. An adenovirus according to any one of claims 1-10, characterized by the following relative order of transgenes from L5 to E4: FAP-bispecific T-cell activator, CXCL10, CXCL9 and IFN-α, for example, as shown for NG-641 in FIG. 1.

12. An adenovirus according to any of paragraphs 1-11, characterized in that said transgene cassette contains a polynucleotide sequence presented in SEQ ID NO: 95, or a polynucleotide encoding the same amino acid sequence, in particular, SEQ ID NO: 95.

13. The adenovirus according to any one of paragraphs 1-12, characterized in that said adenovirus contains SEQ ID NO: 84.

14. An adenovirus according to any of paragraphs 1-13, characterized in that said adenovirus is replication-competent.

15. Adenovirus according to any of paragraphs 1-14, characterized in that said adenovirus is oncolytic.

16. Adenovirus according to any of paragraphs 1-15, characterized in that said virus contains hexon and fiber protein from Ad11.

17. A pharmaceutical composition containing an adenovirus according to any of paragraphs 1-16 and an excipient, diluent or carrier.

18. An adenovirus according to any of paragraphs 1 to 16, or a pharmaceutical composition according to paragraph 17, for use in treatment, for example, for use in the treatment of cancer.

19. A method of treating a patient, including administering an adenovirus according to any of paragraphs 1-16 or a pharmaceutical composition according to paragraph 17.

20. Use of an adenovirus according to any of paragraphs 1-16 or a pharmaceutical composition according to paragraph 17 for the production of a medicament for the treatment of cancer.

In one embodiment, the one or more bispecific T cell activator of the present invention does not contain a transmembrane domain and thus is not expressed on the surface of cancer cells, but instead contains a signal sequence to facilitate release of the bispecific T cell activator molecule from the cancer cell, infected with a virus.

In one embodiment, said transgene cassette is under the control of an endogenous promoter, such as a major late promoter.

The present inventors have discovered that arming an adenovirus with a bispecific T cell activator molecule provides the advantage of allowing the bispecific antibody fragment molecule to exploit the ability of the adenovirus to selectively infect cancer cells, thereby allowing targeted delivery of the bispecific T cell activator to tumor cells.

Advantageously, bispecific T cell activator molecules are small in size and can be produced in mammalian cells. After a single infection with adenoviruses according to the present description, bispecific T-cell activator molecules are synthesized by tumor cells, secreted and can act locally, spreading beyond the immediate zone of influence of the virus. This accordingly allows the bispecific T cell activator to spread beyond the immediate site of infection, but at the same time limits the spread of the virus too far beyond the infected site of tumor cells, this

- 2 044599 minimizes the risk of unwanted off-target effects.

In one embodiment, said adenovirus is EnAd. EnAd has been shown to have enhanced oncolytic activity compared to other adenoviral platforms, such as those based on Ad5. EnAd has also been shown to be highly selective for human epithelial carcinoma cells such as colon, lung, bladder and kidney cancer cells. This makes EnAd an ideal carrier for the delivery of bispecific T-cell activator molecules, since T cells can be activated by the bispecific T-cell activator molecule to attack target cells while EnAd simultaneously infects and lyses cancer cells. This results in a bidirectional attack on the tumor, producing a synergistic oncolytic effect.

In one embodiment, said anti-CD3 component of the bispecific T cell activator is selective for an antigen selected from CD3ε, CD3y and CD3δ, in particular CD3ε.

FAP is a tumor stroma antigen. Advantageously, stromal cells (untransformed cells) expressing these antigens are not subject to the selection process for resistance mutations at the same level as transformed cells. Accordingly, targeting these cells for anticancer therapy is easier because they are not a moving target. In addition, the types of receptors found on stromal cells are often similar across cancer types. Thus, targeting FAP is expected to be effective in several cancer types.

Favorably, FAP is upregulated on tumor-associated fibroblasts. Fibroblasts are a vital component of solid carcinomas, supporting growth, invasion, and recovery after interventions. As a rule, they represent 40-60% of cells in common carcinomas. Favorably, fibroblasts are genetically stable cells that are less likely to escape therapy than cancer cells. Activated fibroblasts are also relatively similar in different tumor types. Accordingly, by activating T cells to target and kill FAP-expressing tumor-associated fibroblasts, the adenoviruses herein may help reduce the spectrum of immunosuppressive pathways, such as those mediated by IL-10, TGF-β, and IDO.

In one embodiment, BX is not a link.

In one embodiment, said adenovirus is chimeric. In one embodiment, said adenovirus is oncolytic. In one embodiment, said adenovirus is chimeric and oncolytic. In one embodiment, said adenovirus is capable of replication. In one embodiment, said adenovirus is chimeric, oncolytic, and capable of replication. In one embodiment, said adenovirus is replication competent. According to another embodiment, said adenovirus is chimeric, oncolytic and replication competent. In one embodiment, said adenovirus is replication defective, i.e. represents a vector.

In one embodiment, the BX comprises a transgene or transgene cassette, in particular a transgene cassette encoding a bispecific T cell activator. In one embodiment, said additional transgene is under the control of an exogenous promoter, such as the CMV.I promoter

The use of an exogenous promoter may be advantageous in some embodiments because it may robustly and constitutively express an antibody or fragment that may be particularly suitable for use in some situations, such as a highly invasive cancer in a patient. Advantageously, the use of a constitutive exogenous promoter results in continuous transcription of the transgene, which may be desirable in certain situations.

According to one embodiment, said transgene cassette contains a Kozak sequence, for example, at the beginning of the coding sequence, in particular at the L5 end of the transgene cassette.

According to one embodiment, said transgene cassette further comprises a polyadenylation sequence, for example, at the end of the sequence, in particular at the end of the E4 region transgene cassette.

In one embodiment, said transgene cassette has the structure shown in FIG. 1, for example, like the NG-641 virus.

In one embodiment, said bispecific T cell activator molecule has a short half-life, for example, 48 hours or less.

In one embodiment, said adenovirus contains only one bispecific T cell activator.

- 3 044599

According to another embodiment, said adenovirus contains two bispecific T cell activators.

In one embodiment, said FAP bispecific T cell activator comprises a VH domain comprising an amino acid sequence as set forth in SEQ ID

NO: 11, or an amino acid sequence at least 95% identical to that shown.

In one embodiment, said FAP bispecific T cell activator comprises a VL domain comprising the amino acid sequence set forth in SEQ ID NO: 10, or an amino acid sequence at least 95% identical to that set forth.

In one embodiment, the anti-FAP portion of the bispecific T cell activator comprises a VH domain containing the amino acid sequence set forth in SEQ ID NO: 6, or an amino acid sequence at least 95% identical to that.

In one embodiment, the anti-CD3 portion of the FAP bispecific T cell activator comprises a VL domain containing the amino acid sequence set forth in SEQ ID NO: 7, or an amino acid sequence at least 95% identical to that.

In one embodiment, the adenovirus of the present invention comprises the sequence set forth in SEQ ID NO: 34 or 35, or a polynucleotide encoding the same scFv amino acid sequence, in particular SEQ ID NO: 34.

In one embodiment, the adenovirus of the present invention comprises the sequence set forth in SEQ ID NO: 68, SEQ ID NO: 69, or a polynucleotide sequence encoding the same amino acid sequence.

In one embodiment, the adenovirus of the present invention comprises the sequence set forth in SEQ ID NO: 90, or a polynucleotide encoding the same amino acid sequence.

In one embodiment, the adenovirus of the present invention comprises the sequence set forth in SEQ ID NO: 91 or a polynucleotide encoding the same amino acid sequence.

In one embodiment, the adenovirus of the present invention comprises the sequence set forth in SEQ ID NO: 92, or a polynucleotide encoding the same amino acid sequence.

One skilled in the art is aware of the redundancy of DNA code, and accordingly, the present invention covers EnAd or Ad11 encoding a bispecific T cell activator with an amino acid as described herein.

A C-terminal His affinity tag (such as a decahistidine or hexahistidine tag) is suitable for purifying bispecific T cell activator or adenovirus. However, it is optional and may be omitted, for example, from the final product. One skilled in the art will recognize that other affinity tags other than deca-His can be used and likewise can be eliminated without interfering with the biological function of the bispecific T cell activator or adenovirus.

Accordingly, in one embodiment, said bispecific T cell activator comprises an amino acid sequence as set forth in SEQ ID NO: 1 or 2, but excludes a His affinity tag at the C-terminus of the sequence, such as SEQ ID NO: 61 or 62.

The exclusion of the decahistidine affinity tag also applies to all other sequences as described herein containing the specified decahistidine affinity tag, i.e. the present invention includes the same amino acid or DNA sequences lacking the C-terminal His tag.

In one aspect, a composition is provided comprising an adenovirus as described herein, as well as a diluent or carrier.

In one aspect, there is provided a method of treating a patient, comprising administering a therapeutically effective amount of an adenovirus or composition as described herein.

In one embodiment, the method is used to treat cancer, for example epithelial cancer, in particular a solid tumor.

According to one embodiment, a method of treatment is provided, comprising administering a virus according to the present invention in combination with a checkpoint inhibitor (such as a PD-1 or PDL1 inhibitor), particularly wherein said checkpoint inhibitor is encoded in the virus.

According to one embodiment, a method of treatment is provided comprising administering a virus according to the present invention that is NOT in combination with a checkpoint inhibitor (e.g., one listed herein such as a PD-1 or PDL1 inhibitor), particularly characterized in that that the specified checkpoint inhibitor is not encoded in the virus.

Bispecific T cell activators encoded by the virus of the present invention have the ability to potentiate the cytotoxicity of the virus.

Surprisingly, the bispecific T cell activators encoded by the virus of the present invention can activate CD4+ cells and/or CD8+ cells, for example, even cells in the tumor suppressive environment, including T cells in the fluid environment of the tumor, such as ascites .

Advantageously, the bispecific T cell activators encoded by the virus of the present invention can activate cytotoxic T cells, for example even T cells in a suppressive tumor environment, including T cells in a fluid tumor environment such as ascites.

Even more surprisingly, the bispecific T cell activators encoded by the virus of the present invention are capable of stimulating (activating) T cell proliferation.

Viruses encoding the bispecific T cell activator of the present invention appear to be able to bypass, overcome or reverse the immunosuppressive tumor microenvironment.

In one embodiment, T cell activation results in up-regulation of a T cell marker, such as CD25.

Detailed Description of the Invention

An immune cell as described herein is a cell that plays a functional role in the immune system, including but not limited to macrophages, neutrophils, dendritic cells, NK cells, lymphocytes such as T lymphocytes (in particular, T cells and NKT cells).

An antigen binding site as used herein refers to a portion of a molecule that contains a pair of variable regions, particularly a cognate pair, that specifically interacts with a target antigen.

Specifically as used herein, refers to a binding site that recognizes only the antigen for which it is specific, or a binding site that has a significantly higher binding affinity for the antigen for which it is specific compared to the affinity for antigens for which it is not specific, for example, 5, 6, 7, 8, 9, 10 times higher binding affinity. Affinity can be measured using techniques such as BIAcore.

A bispecific antibody molecule as used herein refers to a molecule with two antigen binding domains that can bind the same or different antigens. Bispecific T cell activator is a subclass of bispecific antibody molecules.

Bispecific T cell activator herein refers to a bispecific T cell activator, particularly one comprising an anti-CD3 binding domain and an additional binding domain, in this case an anti-FAP binding domain. Typically the binding domains are in the scFv form. A schematic representation of a bispecific T cell activator is shown in FIG. 12.

Accordingly, a bispecific T cell activator herein refers to a class of artificial bispecific monoclonal antibodies containing 2 different antibody scFvs or amino acid sequences from 4 different genes on a single peptide chain of approximately 55 kDa. One of these scFvs is specific for an immune cell, for example a T cell antigen such as the CD3 receptor expressed on the surface of T cells. Another scFv, in the current state of the art, typically binds to a tumor cell via a tumor-specific molecule. Accordingly, bispecific T cell activators are capable of forming an association between T cells and tumor cells due to their specificity for antigen on the T cell and antigen on the tumor cell. This leads to T cell activation and triggers T cells to exert their cytotoxic effects on tumor cells independent of MHC I or co-stimulatory molecules.

In one embodiment, said T cell activator has a structure of the format: VL1-linker1-VH1-linker2-VH2-linker3-VL2, for example, comprising linkers independently selected from linker sequences as described herein.

In one embodiment, the bispecific T cell activator linker has a length ranging from 10 to 30 amino acids, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30, for example, as a linker as described herein.

Stroma or stromal antigen as used herein refers to an antigenic therapeutic target in the stroma, including those expressed in the molecular structure of the stromal matrix, such as connective tissue molecules or molecules associated with said matrix, or antigens associated with cellular components of the stroma, e.g. on fibroblasts, tumor-associated macrophages, dendritic cells, NK cells and/or T cells infiltrating the stroma. Examples of stromal antigens include, but are not limited to, FAP,

- 5 044599

TGF-β, TREM1, IGFBP7, FSP-1, fibroblast-associated antigen, NG2, endosialin (CD248), platelet-derived growth factor receptor-α (pTGF-α), platelet-derived growth factor receptor-β (pTGF-β), and vimentin. Typically, stromal antigens are not expressed on cancer cells, i.e. they are expressed only on stromal cells.

Fibroblast targeting can be achieved by using a fibroblast activation protein (FAP) antigen, in particular a FAP-specific antibody that does not bind CD26 (see US 2012/0258119, incorporated herein by reference).

FAP was initially identified as a serine protease on reactive stromal fibroblasts. Subsequent molecular cloning revealed that FAP is identical to seprase, a 170-kDa membrane-associated gelatinase expressed by melanoma cell lines. The full-length cDNA encoded a 760 amino acid (AA) type H transmembrane protease, highly homologous to dipeptidyl peptidase IV (DPPIV) with 52% amino acid identity throughout the sequence and almost 70% identity in the catalytic domain. US 5,587,299, incorporated herein by reference, describes nucleic acid molecules encoding FAP and their use.

FAP is known as a multifunctional protein that exerts its biological functions in a cell-dependent manner through a combination of protease activity and the ability to form complexes with other cell surface molecules. Overexpression of FAP in epithelial and fibroblast cell lines promotes malignant behavior, suggesting a clinical situation where cellular FAP expression levels correlate with worse clinical outcome.

Through paracrine signaling molecules, cancer cells activate stromal fibroblasts and induce the expression of FAP, which in turn influences cancer cell proliferation, invasion and migration. Recent studies have demonstrated that TGF-β is the dominant factor promoting FAP protein expression (Chen, H et al/ (2009) Exp and Molec Pathology, doi: 10.1016/j.yexmp. 2009.09.001). FAP is highly expressed on reactive stromal fibroblasts in 90% of human epithelial carcinomas, including breast, lung, colon, and rectal carcinomas; and ovaries (Garin-Chesa, P et al (1990) PNAS USA 87: 7236-7239). Recently, Chen et al. showed that FAPa affects the invasion, proliferation and migration of HO-8910PM ovarian cancer cells (Chen, H et al. (2009) Exp and Molec Pathology, doi: 10.1016/j.yexmp. 2009.09.001).

Targeting FAP can be achieved by binding the specified antigen and sterically blocking its interaction with biologically relevant molecules. In an alternative or additional embodiment, the FAP molecule cross-links with another FAP molecule or with another molecule, for example, with T cells. This cross-linking increases the visibility of FAP-carrying cells to the immune system, which can then be activated to neutralize or destroy them.

The adenovirus according to the present description has the ability to infect tumor cells and, in particular, is selected to preferentially infect tumor cells. Infection with an oncolytic virus results in death and lysis of the cancer cell with the release of newly generated viral particles. The included transgenes, such as bispecific T cell activator and cytokine, are synthesized in the cells and actively secreted by the tumor cells before they die. Also, some molecules are released during cell lysis.

Antibody molecules, such as bispecific T cell activator, with a short half-life may be particularly suitable for use according to the present invention, as this minimizes off-target effects, since the body quickly clears these molecules if they become systemically available.

Accordingly, the adenovirus in accordance with the present invention is characterized by at least two or three mechanisms of attack on the tumor, including indirect mechanisms that destroy the tumor stroma.

A transgene as used herein refers to a gene that has been inserted into the genomic sequence, being a gene that is not naturally occurring in the virus (exogenous) or is not normally found at that particular location in the virus. Examples of transgenes are known in the art and are described herein. A transgene herein also includes a functional gene fragment that is a portion of said gene that, when inserted, is suitable to perform the function or most of the function of the full-length gene.

The transgene and coding sequence are used interchangeably herein in the context of insertion into the viral genome unless the context indicates otherwise. A coding sequence as used herein means, for example, a DNA sequence encoding a functional RNA, peptide, polypeptide or protein. Typically, the coding sequence is a cDNA for a transgene that encodes a functional RNA, peptide, polypeptide or protein of interest. Functional RNAs, peptides, polypeptide and proteins of interest are described below.

Obviously, the genome of the virus contains DNA coding sequences. Endogenous (naturally occurring) genes in the genomic sequence of a virus are not considered a transgene in the context of the present invention unless they have been modified using recombinant techniques to be located in a non-natural location or environment.

In one embodiment, a transgene as used herein refers to a DNA segment containing a gene or cDNA sequence isolated from one organism and introduced into another organism, i.e. virus according to this description. In one embodiment, the non-natural DNA segment may retain the ability to produce functional RNA, peptide, polypeptide or protein.

Accordingly, in one embodiment, the inserted transgene encodes a human or humanized protein, polypeptide, or peptide.

Functionally linked herein refers to transgenes associated with the necessary regulatory elements to ensure the functionality of said genes, i.e. allowing for the expression of these genes using cellular mechanisms after the virus enters the cell.

According to one or more embodiments, said cassette has the structure shown in one or more of the drawings or examples.

A transgene cassette as used herein refers to a DNA sequence encoding one or more transgenes in the form of one or more coding sequences, and one or more regulatory elements.

The transgene cassette may encode one or more monocistronic and/or polycistronic mRNA sequences.

In one embodiment, the transgene or transgene cassette encodes a monocistronic or polycistronic mRNA, and, for example, the cassette is suitable for insertion into the adenoviral genome at a location that is under the control of an endogenous promoter or an exogenous promoter, or a combination thereof.

Monocistronic mRNA as used herein refers to an mRNA molecule encoding one functional RNA or one functional peptide, polypeptide or protein.

In one embodiment, said transgene cassette encodes a monocistronic mRNA.

In one embodiment, said transgene cassette, in the context of a cassette encoding a monocistronic mRNA, means a segment of DNA optionally containing an exogenous promoter (which is a regulatory sequence that determines where and when the transgene is active) or a splice site (which is a regulatory sequence that determines when the mRNA molecule will be cleaved by the spliceosome), and a coding sequence (i.e., transgene), usually derived from the cDNA of the protein of interest; optionally containing a poly(A) signal sequence and a termination sequence.

In one embodiment, said transgene cassette may encode one or more polycistronic mRNA sequences.

Polycistronic mRNA as used herein refers to an mRNA molecule encoding two or more functional RNAs, or two or more functional peptides or proteins, or a combination thereof. In one embodiment, said transgene cassette encodes a polycistronic mRNA.

In one embodiment, the transgene cassette, in the context of a cassette encoding a polycistronic mRNA, includes a segment of DNA optionally containing an exogenous promoter (which is a regulatory sequence that determines where and when the transgene is active) or a splice site (which is a regulatory sequence that determines when the mRNA molecule will be cleaved by the spliceosome), and two or more coding sequences (i.e., transgenes), typically derived from the cDNA of the protein or peptide of interest, for example, where each coding sequence is separated by either an IRES or a 2A peptide. The specified cassette may optionally contain, after the last coding sequence to be transcribed, a poly(A) sequence and a termination sequence.

In one embodiment, said transgene cassette encodes a monocistronic mRNA followed by a polycistronic mRNA. In another embodiment, said transgene cassette comprises a polycistronic mRNA followed by a monocistronic mRNA.

In one embodiment, said adenovirus is a human adenovirus. Adenovirus, serotype, or adenoviral serotype as used herein refers to any adenovirus, which may belong to any of the more than 50 currently known adenoviral serotypes, which are classified into subgroups A through F, and also includes any as yet unidentified or unclassified adenoviral serotypes. See, for example, sources: Strauss, Adenovirus infections in humans, in The Adenoviruses, Ginsberg, ea., Plenum Press,

New York, NY, pp. 451-596 (1984), and Shenk, Adenoviridae: The Viruses and Their Replication, in:

Fields Virology, Vol.2, Fourth Edition, Knipe, 35ea., Lippincott Williams & Wilkins, pp. 2265-2267 (2001), according to table. 1.

Table 1

Subgroup Adenoviral serotype A 12, 18, 31 IN 3, 7, 11, 14, 16, 21, 34, 35,51 WITH 1, 2, 5, 6 D 8-10, 13, 15, 17, 19, 20, 22-30, 32, 33, 36-39, 42-49, 50 E 4 F 40.41

In one embodiment, the adenoviruses described herein are subgroup B viruses, namely Ad11, particularly Ad11p (Slobitski strain) and derivatives thereof, such as EnAd.

Adenoviruses are classified into groups/serotypes based on their capsid, such as hexon and/or fiber protein.

In one embodiment, the adenovirus described herein is not a group A, C, D, E, or F virus. The viruses described herein do not contain adenoviral death protein.

In one embodiment, the adenovirus described herein is chimeric. If the adenovirus is chimeric, the characteristics of the outer capsid are used to determine the serotype. Chimeric as used herein refers to a virus that contains DNA from at least two different viral serotypes, including different serotypes within the same group.

In one embodiment, said oncolytic virus comprises fiber, hexon and penton proteins of the same serotype, for example Ad11, in particular Ad11p, for example found at positions 30812-31789, 18254-21100 and 13682-15367 of the latter's genomic sequence, where said nucleotide positions correspond to Genbank ID 217307399 (accession number: GC689208).

In one embodiment, said adenovirus is enadenotucir (also known as EnAd and, formerly, EnAd). Enadenotucirev herein refers to a chimeric adenovirus with the sequence SEQ ID NO: 28. It is a replication-competent oncolytic chimeric adenovirus that has improved therapeutic properties compared to wild-type adenoviruses (see WO 2005/118825). EnAd contains a chimeric E2B region that contains DNA from Ad11p and Ad3, and deletions in E3/E4. These structural changes in Enadenotucirev result in a genome that is approximately 3.5 kb. smaller than the Ad11p genome, which provides additional space for transgene insertion. Almost the entire E3 region and part of the E4 region in EnAd are deleted. Accordingly, there is significant space in its genome to accommodate additional genetic material while maintaining viability. In addition, because EnAd is a subgroup B adenovirus, pre-existing immunity to it is less common in humans than, for example, to Ad5. Other examples of chimeric oncolytic viruses with the Ad11 fiber protein, penton and hexon include OvAd1 and OvAd2 (see WO 2008/080003, incorporated by reference). Accordingly, in one embodiment, the adenovirus involved is OvAd1 or OvAd2.

Presumably, EnAd preferentially infects tumor cells, replicates rapidly in these cells and causes cell lysis. This, in turn, can lead to inflammatory immune responses, thus further stimulating the body's fight against cancer. It is believed that the effectiveness of EnAd is due in part to the rapid replication of the virus in vivo.

Advantageously, arming a virus with DNA encoding certain proteins, such as bispecific T-cell activator, that can be expressed in a cancer cell may allow the body's own defenses to be more effectively deployed to combat tumor cells, for example by increasing the visibility of said cells to immune system or by delivering the therapeutic gene/protein preferentially to the target tumor cells.

It is important that expression of the transgenes does not adversely affect replication or other beneficial properties of the virus. Accordingly, said gene or genes must be inserted in a location that does not impair replication competence and other beneficial properties of the virus. In addition, the genome of adenoviruses is densely packed and, accordingly, it may be difficult to find a suitable site for insertion of transgenes. This also limits the size of transgenes that can be accommodated.

- 8 044599

Oncolytic adenovirus as used herein means an adenovirus that preferentially kills cancer cells rather than non-cancerous cells. According to one embodiment, said oncolytic virus is apoptotic, i.e. it accelerates programmed cell death.

In one embodiment, said oncolytic virus is cytolytic. The cytolytic activity of oncolytic adenoviruses as described herein can be determined in representative tumor cell lines and the data converted to a potency measurement, for example, with an adenovirus belonging to subgroup C, such as Ad5, used as a standard (i.e., with an assigned potency equal to 1). A suitable method for determining cytolytic activity is represented by the MTS assay (see Example 4, FIG. 2 of WO 2005/118825, incorporated herein by reference).

According to one embodiment, said oncolytic virus is necrolytic, i.e. it causes or accelerates cell necrosis or immunogenic cell death. In one embodiment, necrolytic cell death is preferred because it triggers immune responses in the patient (host).

Unless the context indicates otherwise, adenovirus as used herein refers to a replication-competent virus (such as a replication-competent virus) as well as replication-defective viral vectors.

Replication-competent herein refers to a replication-competent virus or a virus whose replication depends on a factor in cancer cells, for example, a stimulatory regulation factor such as p53 or the like.

In one embodiment, said virus is replication competent. Replicatively competent in the context of the present description refers to a virus that has all the necessary mechanisms for replication in cells in vitro and in vivo, i.e. without the help of a packaging cell line. A viral vector, for example, with a deletion in the E1 region, capable of replication in a complementary packaging cell line, is not a replication-competent virus in this context.

Viral vectors are replication defective and require a packaging cell to provide the complementary gene to allow replication to occur.

Adenoviral genome (adenovirus genome) as used herein means a DNA sequence encoding structural proteins and elements related to the function/life cycle of an adenovirus.

All human adenovirus genomes studied to date have the same general organization, i.e. genes encoding specific functions are located at the same position in the viral genome (herein referred to as structural elements). Each end of the viral genome contains a short sequence known as an inverted terminal repeat (or ITR), which is essential for viral replication. The viral genome contains five early transcription units (E1A, E1B, E2, E3 and E4), three delayed early units (IX, IVa2 and late E2) and one late (core late) unit, which are processed to produce five families of late mRNAs (L1 -L5). Proteins encoded by early genes are primarily involved in replication and modulation of the host cell response to infection, whereas late genes encode viral structural proteins. The designations for early genes begin with the symbol E, and those for late genes begin with the symbol L.

The genome of adenoviruses is densely packed, i.e. contains a small amount of non-coding sequences, and, accordingly, it may be difficult to find a suitable site for insertion of transgenes.

In one embodiment, an oncolytic or partial oncolytic virus according to the present invention may be the result of a deletion in the E4 and/or E3 region, for example, a partial deletion of the E4 region or a complete deletion of the E3 region, or, alternatively, a partial deletion of the E4 region (e.g. , E4orf4) and complete deletion of the E3 region, for example, as in the example sequences provided herein.

In one embodiment, said oncolytic virus is EnAd or an active derivative thereof that retains the essential beneficial properties of the virus. EnAd is described in WO 2005/118825 (incorporated herein by reference), and the complete sequence of the virus is set forth herein as SEQ ID NO: 28. The E2B chimeric region is disclosed herein as SEQ ID NO: 60.

Advantageously, the adenoviruses of the present disclosure exhibit viral activity profiles, eg, replication and/or infectivity, similar to EnAd following infection of various colon cancer cell lines in vitro.

Structural elements of adenoviruses

Since the structure of adenoviruses is generally similar, the elements described below are discussed in relation to the structural elements and within the framework of commonly used nomenclature for their designation known to the person skilled in the art. When an element is mentioned herein, the authors mean the DNA sequence encoding the specified element, or the DNA sequence encoding the same structural protein of the element in an adenovirus. The latter is due to the redundancy of the DNA code. It may be necessary to take into account the codon usage preferences of viruses to obtain optimized results.

Any adenovirus-derived structural element used in the viruses herein may contain or be composed of natural sequence, or may be at least 95% similar over a specified region, such as 96, 97, 98, 99, or 100 %. The original sequence can be modified to exclude 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% of the genetic material. One skilled in the art will know that changes must not be made to damage the reading frames of the virus, thereby disrupting the expression of structural proteins.

In one embodiment, the specified element is a full-length sequence, i.e. full length gene.

In one embodiment, the given element is smaller than the full-size element and retains the same or similar functionality as the full-size sequence.

In one embodiment, for a given element, optional in the constructs herein, the DNA sequence may be less than full length and non-functional.

Structural genes, encoding structural or functional adenovirus proteins, are usually connected by non-coding regions of DNA. Accordingly, there is some flexibility as to where the genomic sequence of the structural element of interest (in particular, its non-coding regions) can be cut to insert a transgene into viruses according to the present description. Accordingly, for purposes of the present invention, an element will be considered a referenced structural element provided that it is fit for purpose and does not encode extraneous material. Accordingly, as appropriate, the gene will be associated with suitable non-coding regions, for example, as in the natural structure of the virus.

Accordingly, in one embodiment, the insertion of, for example, DNA encoding a restriction site and/or transgene occurs in a non-coding region of the genomic viral DNA, for example, in an intron or intergenic sequence. However, some non-coding regions of the adenovirus may have a function, for example in alternative splicing, transcriptional regulation or translational regulation, and this may need to be taken into account.

The sites identified herein associated with the L5 region (e.g., between the L5 and E4 region) are suitable to accommodate various DNA sequences encoding complex entities such as RNA interference, cytokines, single-stranded or multimeric proteins such as antibodies, e.g. bispecific T-cell activator.

Gene as used herein refers to coding sequences and, optionally, any non-coding sequences associated therewith, such as introns and associated exons. In one embodiment, the gene contains or consists only of essential structural components, such as a coding region.

Below is a description of the specific structural elements of adenoviruses.

Inverted terminal repeat (ITR) sequences are present in all known adenoviruses; they are so named because of their symmetry, and represent the origin of replication of the viral chromosome. Another property of these sequences is their ability to form a hairpin.

5'ITR as used herein refers to a partial or complete ITR sequence at the 5'end of an adenovirus that retains the function of said ITR when inserted into the adenovirus at a suitable location. In one embodiment, the 5'ITR contains or consists of a sequence comprising approximately 1 bp. 138 bp each of SEQ ID NO: 28, or a sequence that is 90, 95, 96, 97, 98 or 99% identical to the specified sequence throughout its entire length, particularly including approximately 1 bp of sequence. 138 bp each from SEQ ID NO: 28.

3'ITR as used herein refers to a partial or complete ITR sequence at the 3'end of an adenovirus that retains the function of said ITR when inserted into the adenovirus at a suitable location. In one embodiment, the 3'ITR comprises or consists of a sequence comprising approximately bp 32,189. 32326 p.o. of SEQ ID NO: 28, or a sequence that is 90, 95, 96, 97, 98, or 99% identical to the specified sequence throughout its entire length, particularly including the sequence from approximately bp 32,189. 32326 p.o. from SEQ ID NO: 28.

B1 as used herein refers to a DNA sequence encoding: part or all of the E1A region of an adenovirus, part or all of the E1B region of an adenovirus; and, independently, part or all of the E1A and E1B regions of the adenovirus.

If B1 is a linkage, the E1A and E1B sequences are eliminated from the virus. According to

- 10 044599 one embodiment B ₁ is a link and, accordingly, the virus is a vector.

In one embodiment, B ₁ further comprises a transgene. It is known in the art that a transgene can be placed in the E1 region, which can be inserted in a disruptive manner into the E1 region (i.e., in the middle of the sequence), or the E1 region can be deleted partially or completely to provide more space to accommodate the genetic material.

E1A as used herein refers to a DNA sequence encoding part or all of the E1A region of an adenovirus. The latter here refers to the E1A polypeptide/protein. The sequence may be mutated such that the protein encoded by the E1A gene contains conservative or non-conservative amino acid changes such that it has: the same function as the wild-type protein (ie the corresponding unmutated protein); enhanced function compared to the wild type protein; reduced function, eg, no function, compared to the wild type protein; or has a new function compared to the wild type protein; or characterized by a combination of the above, as appropriate.

E1B as used herein refers to a DNA sequence encoding part or all of an adenovirus E1B region (i.e., a polypeptide or protein), it may be mutated such that the protein encoded by the E1B gene/region contains conservative or non-conservative amino acid changes, such that it has: the same function as the wild-type protein (ie the corresponding unmutated protein); enhanced function compared to the wild type protein; reduced function, eg, no function, compared to the wild type protein; or has a new function compared to the wild type protein; or characterized by a combination of the above, as appropriate.

Accordingly, B1 may be modified or unmodified relative to the wild-type E1 region, such as wild-type E1A and/or E1B. One skilled in the art can readily identify whether E1A and/or E1B are present or (partially) deleted or mutated.

Wild type as used herein refers to a known adenovirus. A known adenovirus is an adenovirus that has been identified and named, whether or not a sequence is available.

In one embodiment, B ₁ has a 139 bp sequence. 3932 bp each from SEQ ID NO: 28.

In _A , as used herein, refers to the DNA sequence coding for the E2B-L1-L2L3-E2A-L4 regions, including any non-coding sequences, as applicable. Typically the sequence does not contain a transgene. In one embodiment, the sequence is substantially similar or identical to the continuous sequence of a known adenovirus, for example, the serotype presented in table. 1, in particular a group B virus such as Ad3, Ad7, Ad11, Ad14, Ad16, Ad21, Ad34, Ad35, Ad51 or combinations thereof, for example Ad3, Ad11 or combinations thereof. In one embodiment, E2B-L1-L2-L3-E2A-L4 refers to the content of the specified elements and other structural elements associated with the specified region, for example, B _A typically includes the coding sequence for the IV2a protein, for example, as follows: IV2A IV2a- E2B-L1-L2-L3-E2A-L4.

In one embodiment, the E2B region is chimeric, i.e. contains DNA sequences from two or more different adenovirus serotypes, for example from Ad3 and Ad11, for example from Ad11p. In one embodiment, the E2B region has a 5068 bp sequence. 10355 p.o. from SEQ ID NO: 28 or a sequence that is 95%, 96%, 97%, 98% or 99% identical to that indicated throughout its entire length.

In one embodiment, E2B in component B _A contains the sequences set forth in SEQ ID NO: 60 (which corresponds to SEQ ID NO: 3 disclosed in WO 2005/118825).

In one embodiment, B _A has a 3933 bp sequence. 27184 p.o. from SEQ ID NO: 28.

E3 as used herein refers to a DNA sequence encoding part or all of an adenovirus E3 region (i.e., protein/polypeptide), it may be mutated such that the protein encoded by the E3 gene contains conservative or non-conservative amino acid changes, thus that it has the same function as the wild-type protein (the corresponding unmutated protein); enhanced function compared to the wild type protein; reduced function, eg, no function compared to the wild-type protein, or has a new function compared to the wild-type protein; or characterized by a combination of the above, as appropriate.

In one embodiment, the E3 region is derived from the adenoviral serotype shown in Table. 1, or combinations thereof, in particular serotype group B, for example Ad3, Ad7, Ad11 (in particular Ad11p), Ad14, Ad16, Ad21, Ad34, Ad35, Ad51 or combinations thereof, for example Ad3, Ad11 (in particular - 11 044599 ties, Ad11 p) or combinations thereof.

In one embodiment, the E3 region is partially deleted, for example, deleted at 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5 %.

In one embodiment, B2 is a linkage and there is no DNA encoding the E3 region.

In one embodiment, the DNA encoding the E3 region may be replaced or interrupted by a transgene. As used herein, the E3 region replaced by a transgene includes partial or complete replacement of the E3 region by a transgene.

In one embodiment, region B ₂ contains a 27,185 bp sequence. 28165 p.o. from SEQ ID NO: 28.

In one embodiment, B ₂ consists of a 27,185 bp sequence. 28165 p.o. from SEQ ID NO: 28.

BX as used herein refers to the DNA sequence in the vicinity of the 5' end of the L5 gene in B _B . Proximate or proximal to the 5' end of the L5 gene as used herein refers to adjacent to the 5' end of the L5 gene or a non-coding region known to be associated with it, i.e. adjacent or adjacent to the 5' end of the L5 gene or a non-coding region known to be associated with it. Alternatively, a nearby or proximal location may refer to a location close to the L5 gene, such that there are no coding sequences between the B _X region and the 5' end of the L5 gene.

Accordingly, in one embodiment, BX is attached directly to the base of L5, which corresponds, for example, to the beginning of the coding sequence of the L5 gene.

Accordingly, in one embodiment, BX is attached directly to the base of L5, which corresponds, for example, to the beginning of a non-coding sequence, or is attached directly to a non-coding region naturally associated with L5. A non-coding region naturally associated with L5, as used herein, refers to the portion of all non-coding regions that is part of or adjacent to the L5 gene, but is not part of another gene.

In one embodiment, BX comprises the sequence of SEQ ID NO: 29. The sequence is an artificial non-coding sequence into which a DNA sequence, for example, containing a transgene (or transgene cassette), a restriction site, or a combination thereof, can be inserted. This sequence is preferred because it acts as a buffer allowing some flexibility regarding the exact location of the transgene while minimizing disruptive effects on virus stability and viability.

The insertion fragment or fragments may be located anywhere within SEQ ID NO: 29, starting at the 5' end, 3' end, or at any point between 1 bp. and 201 bp In one embodiment, B _X contains SEQ ID NO: 29 with the DNA sequence inserted between 27 bp. and 28 bp, or in the place corresponding to the provisions between 28192 bp. and 28193 bp from SEQ ID NO: 28.

In one embodiment, said insertion fragment is an insertion fragment with a restriction site. In one embodiment, said restriction site insertion fragment comprises one or two restriction sites. In one embodiment, said restriction site is a 19 bp restriction site insertion fragment containing 2 restriction sites. In one embodiment, the restriction site insertion fragment is a 9 bp restriction site insertion fragment containing 1 restriction site. In one embodiment, said restriction site insertion fragment comprises one or two restriction sites and at least one transgene, for example one or two transgenes. In one embodiment, said restriction site is a 19 bp restriction site insertion fragment containing 2 restriction sites and at least one transgene, for example one or two transgenes. In one embodiment, said restriction site insertion fragment is a 9 bp restriction site insertion fragment containing 1 restriction site and at least one transgene, for example one, two or three transgenes, for example one or two. In one embodiment, two restriction sites are located within one or more, for example, two transgenes (eg, in a transgene cassette). According to one implementation option, if the BX contains two restriction sites, the specified restriction sites are different from each other. In one embodiment, the one or more restriction sites in the BX are not naturally occurring in the particular adenoviral genome into which they were inserted. In one embodiment, the one or more restriction sites in BX are different from other restriction sites located elsewhere in the adenoviral genome, for example, different from naturally occurring restriction sites and/or restriction sites introduced into other parts of the genome, for example, restriction site introduced in BY. Accordingly, according to

- 12 044599 In one embodiment, the specified site or specified restriction sites allow DNA to be cut at a site in a specific manner.

The DNA sequence referred to by BY herein refers to the DNA sequence in the vicinity of the 3' end of the L5 B _B gene. Location adjacent or proximal to the 3' end of the L5 gene as used herein refers to: adjacent to the 3' end of the L5 gene or a non-coding region known to be associated with it, i.e. those. adjacent to or adjacent to the 3' end of the L5 gene or a non-coding region known to be associated with it (i.e., the entire non-coding sequence endogenous to L5, or part thereof). Alternatively, a nearby or proximal location may refer to a location close to the L5 gene, such that there are no coding sequences between the BY region and the 3' end of the L5 gene.

Accordingly, in one embodiment, BY is attached directly to the base L5, which corresponds to the end of the coding sequence.

Accordingly, in one embodiment, the BY is attached directly to the base of L5, which corresponds to the end of the non-coding sequence, or is attached directly to the non-coding region naturally associated with L5.

Knownly and naturally are used interchangeably in this document. In one embodiment, BY comprises the sequence of SEQ ID NO: 30. The sequence is a non-coding sequence into which a DNA sequence, eg, containing a transgene (or transgene cassette), a restriction site, or a combination thereof, can be inserted. This sequence is preferred because it acts as a buffer allowing some flexibility regarding the exact location of the transgene while minimizing disruptive effects on virus stability and viability.

The insertion fragment or fragments may be located anywhere within SEQ ID NO: 30, starting at the 5' end, 3' end, or at any point between 1 bp. and 35 bp, for example, between base pairs 1/2, 2/3, 3/4, 4/5, 5/6, 6/7, 7/8, 8/9, 9/10, 10/ 11, 11/12, 12/13, 13/14, 14/15, 15/16, 16/17, 17/18, 18/19, 19/20, 20/21, 21/22, 22/23, 23/24, 24/25, 25/26, 26/27, 27/28, 28/29, 29/30, 30/31, 31/32, 32/33, 33/34 or 34/35.

E4 as used herein refers to a DNA sequence encoding part or all of an adenovirus E4 region (i.e., a polypeptide/protein region) that may be mutated such that the protein encoded by the E4 gene contains conservative or non-conservative amino acid changes, and has the same function as the wild-type protein (the corresponding unmutated protein); enhanced function compared to the wild type protein; reduced function, eg, no function, compared to the wild type protein; or has a new function compared to the wild type protein; or characterized by a combination of the above, as appropriate. In one embodiment, E4orf4 is deleted in the E4 region.

In one embodiment, the E4 region is partially deleted, for example, deleted by 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 %. In one embodiment, the E4 region has a 32,188 bp sequence. 29380 p.o. from SEQ ID NO: 28.

In one embodiment, B ₃ is a link, i.e. differs in that E4 is missing.

In one embodiment, B ₃ has a sequence comprising bp 32,188. 29380 p.o. from SEQ ID NO: 28.

In this document, numerical ranges include endpoints.

One skilled in the art will appreciate that the elements of the formulas herein, such as Formula (I), are continuous and may include non-coding DNA sequences as well as genes and DNA coding sequences (structural features) referred to herein. In one or more embodiments, the claims herein are intended to describe a naturally occurring sequence in the adenoviral genome. In this context, it will be clear to one skilled in the art that the formula refers to the basic elements characterizing the corresponding section of the genome, and is not intended to be an exhaustive description of the genomic DNA segment.

Each of E1A, E1B, E3 and E4 herein independently refers to wild-type forms and their equivalents, mutated or partially deleted forms of each region as described herein, in particular the wild-type sequence from a known adenovirus.

An insertion fragment as used herein refers to a DNA sequence that is inserted at either the 5' end, the 3' end, or a specified reference segment of the DNA sequence in such a way that it interrupts the reference sequence. The latter is a reference sequence used as a reference point relative to which the insertion fragment is localized. As used herein, insertion fragments are typically located at SEQ ID NO: 29 or SEQ ID NO: 30. The insertion fragment may be a restriction site insertion fragment, a transgene cassette, or both.

If the sequence is interrupted, the virus still contains the original sequence, but it is usually represented by two fragments with an insertion fragment located between them.

In one embodiment, said transgene or transgene cassette does not contain a non-biased transposon, such as the TN7 transposon or a portion thereof. The Tn7 transposon herein refers to a non-biased insertion transposon as described in WO 2006/060314.

In one embodiment, one or more restriction sites in BX and BY are independently selected from a restriction site specific to the enzyme described herein, e.g., NotI, FseI, AsiSI, SgfI, and SbfI, e.g., all restriction sites inserted are different, e.g. , NotI-specific sites and FseI-specific sites are localized in BX, and SgfI and SbfI sites are localized in BY.

As described above, in one embodiment, the BX and/or BY region does not contain a restriction site. Advantageously, viruses and constructs according to the present description can be obtained without restriction sites, for example, using synthetic techniques. These techniques provide significant flexibility when creating viruses and constructs. In addition, the authors of the present invention have found that the properties of these viruses and constructs are not weakened when obtained using synthetic techniques.

Other regulatory sequences.

A gene expression regulator (or regulator/regulatory element) as used herein refers to a genetic feature, such as a promoter, enhancer, or splice acceptor sequence, that plays a role in gene expression, typically by initiating or enhancing transcription or translation.

A splice acceptor sequence, splice acceptor, or splice site as used herein refers to a regulatory sequence that determines when an mRNA molecule is recognized by the small nuclear ribonucleoproteins of the spliceosome complex. Once assembled, the spliceosome catalyzes splicing between the splice acceptor site of the mRNA molecule and the splice donor 5' site to produce a mature mRNA molecule that can be translated to produce a single polypeptide or protein.

According to the present invention, splice acceptor sequences of different sizes can be used, which can be described as short splice acceptors (small), splice acceptors (medium) and branched splice acceptors (large).

SSA as used herein means a short splice acceptor, typically containing only a splice site, for example 4 base pairs. SA as used herein means a splice acceptor, typically comprising a short splice acceptor and a polypyrimidine tract, for example, 16 bp in length. bSA as used herein means a branched splice acceptor, typically comprising a short splice acceptor, a polypyrimidine tract and a branch point, for example, 26 base pairs.

In one embodiment, the splice acceptors SA and bSA used in the constructs herein are shown in SEQ ID NOs: 45 and 46, respectively. In one embodiment, an SSA is used in a cassette according to the present invention and has the nucleotide sequence CAGG.

According to one embodiment, said SA is used in a cassette. In one embodiment, said bSA is used in a cassette.

In one embodiment, said splice site is immediately preceded (ie, located in the 5' to 3' direction) by a Kozak consensus sequence. In one embodiment, said splice site and said Kozak sequence are separated by 100 base pairs or less. In one embodiment, said Kozak sequence has the nucleotide sequence of SEQ ID NO: 47.

Typically, if a coding sequence is under the control of an endogenous or exogenous promoter (eg, an endogenous promoter), it is immediately preceded by a Kozak sequence. The start of the coding region is indicated by a start codon (AUG), for example, in the context of the sequence (gcc)gccRccAUGg [SEQ ID NO: 48], the start of coding sequences is indicated by bases in bold. Lowercase letters indicate common bases in the indicated position (which, however, can vary), and uppercase letters indicate highly conserved bases, i.e. the AUGG sequence is constant or changes rarely, if at all; R indicates that a purine (adenine or guanine) is commonly observed at the position indicated, and the sequence in parentheses (gcc) is of undetermined significance. Accordingly, in one embodiment, the AUG start codon is included in the Kozak sequence.

The sequence of the internal DNA ribosome entry site herein refers to

- 14 044599 to the DNA sequence encoding the sequence of the internal ribosome entry site (IRES). IRES as used herein means a nucleotide sequence that allows for initiation of translation of a messenger RNA (mRNA) sequence, including initiation starting within the specified mRNA sequence. This is particularly useful when said cassette encodes a polycistronic mRNA. The use of an IRES results in a polycistronic mRNA that is translated into several individual proteins or peptides. In one embodiment, said DNA internal ribosome entry site sequence has the nucleotide sequence of SEQ ID NO: 49. In one embodiment, a particular IRES is used only once in a genome. This may provide benefits in terms of genome stability.

Highly efficient self-cleaving peptide 2A or peptide 2A herein refers to a peptide that is efficiently cleaved after translation. Suitable 2A peptides include P2A, F2A, E2A and T2A. The present inventors note that when a specific DNA sequence encoding a given 2A peptide is used once, the same specific DNA sequence may not be used again. However, the redundancy of the DNA code can be used to obtain a DNA sequence that is translated into the same 2A peptide. The use of 2A peptides is particularly useful if said cassette encodes a polycistronic mRNA. The use of 2A peptides results in the translation of a single polypeptide chain, which is modified after translation to produce several individual proteins or peptides.

In one embodiment, the P2A encoded peptide used has the amino acid sequence set forth in SEQ ID NO: 50. In one embodiment, the F2A encoded peptide used has the amino acid sequence set forth in SEQ ID NO: 51. In one embodiment, the E2A encoded peptide used has the sequence amino acids set forth in SEQ ID NO: 52. In one embodiment, the encoded T2A peptide used has the amino acid sequence set forth in SEQ ID NO: 53.

In one embodiment, the mRNA or each mRNA encoded by the transgene(s) comprises a polyadenylation signal sequence, for example, typically at the end of the mRNA sequence, for example, as set forth in SEQ ID NO: 54. Accordingly, one embodiment of said transgene or transgene cassette includes at least one sequence encoding a polyadenylation signal sequence.

A poly(A), polyadenylation signal, or polyadenylation sequence as used herein means a DNA sequence typically containing an AATAAAA site that, after transcription, can be recognized by a multiprotein complex that cleaves and poly(A)denylates the growing mRNA molecule.

In one embodiment, said polyadenylation sequence has the nucleotide sequence of SEQ ID NO: 54.

In one embodiment, the construct does not contain a polyadenylation sequence. In one embodiment, the gene expression regulator is a splice acceptor sequence.

Adenoviruses herein advantageously express and release antibody forms (such as bispecific T cell activator) and other proteins, such as cytokines encoded by the transgene they contain, into the culture supernatant in vitro or into the stroma of tumor tissue in vivo. Leader sequences may help the encoded protein/polypeptide or peptide exit the cancer cell. Accordingly, in one embodiment, said encoded protein comprises a leader sequence. A leader sequence herein refers to a polynucleotide sequence located between a promoter sequence and a coding region that can regulate gene expression at the transcriptional or translational level.

In one embodiment, the adenovirus of the present invention comprises a transgene that is a reporter gene encoding, for example, an imaging agent, including bioluminescent, fluorescent imaging agents (including activated fluorescent imaging agents), such as luciferase, GFP or eGFP, or red fluorescent protein.

A reporter gene or reporter sequence as used herein means a gene or DNA sequence that produces a product that is readily detectable in eukaryotic cells and can be used as a marker to determine the activity of another gene with which its DNA has been closely linked or combined. Reporter genes impart characteristics to the cells or organisms that express them that can be easily identified and measured, or are selectable markers. Reporter genes are often used as an indicator of whether a particular gene has been accepted or expressed by a population of cells or organisms. Examples of common reporter genes include, but are not limited to:

LacZ, luciferase, GFP, eGFP, neomycin phosphotransferase, chloramphenicol acetyltransferase, sodium iodide symporter (NIS), nitroreductase (e.g. NfsA, NfsB), intracellular metalloproteins,

HSV1-tk or estrogen receptor.

In one embodiment, said genetic material (specifically, a transgene) does not encode or express a reporter gene, such as an imaging agent, luciferase, GFP, or eGFP.

Viruses of the present invention can be screened for specific tumor type preference by examining their lytic potential in a panel of tumor cells, e.g., colon tumor cell lines, including HT-29, DLD-1, LS174T, LS1034, SW403, HCT116 , SW48 and Colo320DM. Any available colon tumor cell lines are equally suitable for such evaluation.

Prostate cell lines include DU145 and PC-3 cells. Pancreatic cell lines include Panc-1 cells. Breast tumor cell lines include the MDA231 cell line, and ovarian cell lines include the OVCAR-3 cell line. Hematopoietic cell lines include, but are not limited to, Raji and Daudi B lymphoid cells, K562 erythroblast cells, U937 myeloid cells, and HSB2 T lymphoid cells. Other available tumor cell lines are equally suitable.

The present invention also covers new sequences as described herein. In one embodiment, the virus is any of the sequences described herein.

Compositions.

The present invention also covers a pharmaceutical composition containing a virus as described herein.

One embodiment provides a liquid parenteral formulation, for example, for infusion or injection, of a replication-competent oncolytic virus in accordance with the present invention, characterized in that the formulation provides a dose ranging from 1x10 ¹⁰ to 1x10 ¹⁴ viral particles per dose volume.

Parenteral formulation means a formulation designed for delivery other than the gastrointestinal tract. Typical routes of parenteral delivery include injection, implantation, or infusion. In one embodiment, the composition is provided in bolus delivery form.

According to one embodiment, the parenteral composition is presented in the form of an injection. The injection includes intravenous, subcutaneous, intratumoral or intramuscular injection. Injection as used herein means the introduction of fluid into the body through a syringe. In one embodiment, the method described herein does not involve intratumoral injection.

According to one embodiment, the parenteral composition is presented in the form of an infusion.

Infusion as used herein means the administration of fluids at a slower rate by drip, infusion pump, syringe pump, or equivalent device. In one embodiment, the infusion is administered over a period ranging from 1.5 minutes to 120 minutes, such as approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 65, 80, 85, 90, 95, 100, 105, 110 or 115 minutes.

According to one embodiment, the volume of one dose of the specified composition is less than 100 ml, for example 30 ml, for example, administered using a syringe pump. In one embodiment, the volume of one dose of said composition is less than 10 ml, for example, 9, 8, 7, 6, 5, 4, 3, 2 or 1 ml. According to one embodiment, the volume of one dose of the specified composition is less than 1 ml, for example, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2 or 0. 1 ml.

In one embodiment, the injection is administered slowly, for example, over a period of 1.5 to 30 minutes.

In one embodiment, the composition is intended for intravenous (IV) administration. This route is particularly effective for the delivery of oncolytic virus, as it allows rapid access to most organs and tissues, and is particularly suitable for the treatment of metastases, for example, advanced metastases, in particular those localized in highly vascularized areas such as the liver and lungs .

Therapeutic compositions are generally sterile and stable under the conditions of receipt and storage. The composition may be formulated into a solution, microemulsion, liposome or other parenteral formulation suitable for administration to humans, and may be formulated into a pre-fillable device such as a syringe or vial, particularly containing a single dose.

Said composition typically contains a pharmaceutically acceptable diluent or carrier, for example a non-toxic isotonic carrier, compatible with said virus, in which said virus is stable for the required period of time.

Said carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyhydric alcohol (eg, glycerin, propylene glycol and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a dispersant or surfactant such as lecithin or a nonionic surfactant such as polysorbate 80 or 40. In dispersions, the presence of a surfactant can help maintain the desired particle size. Examples of isotonic agents include sugars, polyhydric alcohols such as mannitol, sorbitol or sodium chloride in the composition.

In one embodiment, the parenteral formulations used may contain any one or more of the following: a buffer, for example, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, a phosphate buffer and/or Tris buffer, a sugar, for example, dextrose, mannose, sucrose or similar sugars, salt such as sodium chloride, magnesium chloride or potassium chloride, detergent such as a nonionic surfactant such as Briji, PS-80, PS-40 or similar surfactants. The composition may also contain a preservative, such as EDTA or ethanol, or a combination of EDTA and ethanol, which is expected to prevent possible degradation in one or more ways.

In one embodiment, the composition contains a purified oncolytic virus according to the present invention, for example, from 1x10 ¹⁰ to 1x10 ¹⁴ viral particles per dose, for example, from 1x10 ¹⁰ to 1x10 ¹² viral particles per dose. According to one embodiment, the concentration of virus in the composition is in the range of 2x10 ⁸ to 2x10 ¹⁴ ppm/ml, for example, 2x10 ¹² ppm/ml.

According to one embodiment, the parenteral composition contains glycerol.

In one embodiment, the formulation comprises an oncolytic adenovirus as described herein, HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), glycerol, and a buffer.

According to one embodiment, said parenteral formulation consists of a virus as described herein, HEPES, for example, 5 mM, glycerol, for example, 5-20% (by volume), hydrochloric acid, for example, to adjust the pH value to the range of 7-8; and water for injections.

In one embodiment, 0.7 ml of the virus according to the present invention at a concentration of 2x10 ¹² v.p./ml is introduced into the composition in 5 mm HEPES, 20% glycerol with a final pH value of 7.8.

A detailed discussion of pharmaceutically acceptable carriers is provided in Remington's Pharmaceutical Sciences (Mack Publishing Company, N.J. 1991).

According to one embodiment, the specified composition is represented by a composition for local administration, including for inhalation.

Suitable inhalable formulations include inhalable powders, metered aerosols containing propellant gases, or inhalable solutions not containing propellant gases. Inhalable powders in accordance with the present invention typically contain the virus as described herein with a physiologically acceptable excipient.

These inhalable powders may include monosaccharides (eg, glucose or arabinose), disaccharides (eg, lactose, sucrose, maltose), oligo- and polysaccharides (eg, dextrans), polyhydric alcohols (eg, sorbitol, mannitol, xylitol), salts (eg , sodium chloride, calcium carbonate) or mixtures of the above. Where appropriate, mono- or disaccharides are used, lactose or glucose is used, in particular, but not exclusively, in the form of their hydrates.

The particle size for lung deposition should be less than 10 µm, for example 1-9 µm, for example 0.1 to 5 µm, in particular 1 to 5 µm. The size of the particles carrying the virus is of paramount importance and, accordingly, in one embodiment, said virus in accordance with the present invention can be adsorbed or absorbed onto a particle, such as a lactose particle of a given size.

Propellant gases that can be used to produce respirable aerosols are known in the art. Suitable propellant gases are selected from hydrocarbons such as npropane, n-butane or isobutane, and halocarbons such as chlorinated and/or fluorinated derivatives of methane, ethane, propane, butane, cyclopropane or cyclobutane. The abovementioned propellant gases can be used alone or in the form of mixtures of the above.

In particular, suitable propellant gases are halogenated alkane derivatives selected from TG 11, TG 12, TG 134a and TG227. Particularly suitable of the above-mentioned halogenated hydrocarbons are TG134a (1,1,1,2-tetrafluoroethane) and TG227 (1,1,1,2,3,3,3heptafluoropropane), as well as mixtures thereof.

Propellant-containing respirable aerosols may also contain other ingredients such as co-solvents, stabilizers, surface active agents (surfactants), antioxidants, lubricants and pH adjusters. All ingredients listed

- 17 044599 are known in the art.

The propellant-containing inhalable aerosols according to the present invention may contain up to 5% by weight of active substance. Aerosols in accordance with the present invention contain, for example, from 0.002 to 5% by weight, from 0.01 to 3% by weight, from 0.015 to 2% by weight, from 0.1 to 2% by weight, from 0.5 up to 2% by weight or from 0.5 to 1% by weight of the active ingredient.

Alternatively, local administration to the lung may also be accomplished by administering a liquid solution or suspension formulation, for example using a device such as a nebulizer, for example a nebulizer connected to a compressor (for example, a Pari LC-Jet Plus(R) nebulizer connected with the Pari Master(R) compressor manufactured by Pari Respiratory Equipment, Inc., Richmond, Virginia).

The virus according to the present invention can be delivered dispersed in a solvent, for example, in the form of a solution or suspension, for example, already described above for parenteral formulations. It may be suspended in a suitable physiological solution, for example, saline or other pharmacologically acceptable solvent or buffered solution. Buffered solutions known in the art may contain from 0.05 mg to 0.15 mg disodium edetate, from 8.0 mg to 9.0 mg NaCl, from 0.15 mg to 0.25 mg polysorbate, from 0 .25 mg to 0.30 mg anhydrous citric acid and 0.45 mg to 0.55 mg sodium citrate per ml of water to achieve a pH value of approximately 4.0-5.0.

Therapeutic compositions in suspensions or solutions may also contain one or more excipients. Excipients are well known in the art and include buffers (eg, citrate buffer, phosphate buffer, acetate buffer and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (eg, serum albumin), EDTA, sodium chloride , liposomes, mannitol, sorbitol and glycerin. Solutions or suspensions can be encapsulated in liposomes or biodegradable microspheres. The composition is typically presented in an essentially sterile form obtained using sterile manufacturing methods.

These methods may include preparing and sterilizing by filtration the buffered solvent/solution used to prepare the formulation, aseptically preparing a suspension of said antibody in a sterile buffered solvent solution, and dispensing the formulation into sterile vessels using methods known to those skilled in the art.

The nebulizable formulation of the present invention may be presented, for example, in single dose units (eg, sealed plastic containers or vials) packaged in foil envelopes. Each vial contains a dose unit volume of diluent/buffer solution, e.g. 2 ml.

Treatment.

According to a further aspect, the present invention covers a virus or composition with a virus as described herein for use in treatment, in particular for the treatment of cancer.

In one embodiment, the treatment method is for use in the treatment of a tumor, in particular a solid tumor.

Tumor as used herein refers to an abnormal mass of tissue resulting from excessive cell division that is uncontrolled and progressive, and is also called a neoplasm. Tumors can be benign (non-cancerous) or malignant. The tumor covers all forms of cancer and metastases.

In one embodiment, said tumor is a solid tumor. A solid tumor can be localized or metastatic.

According to one embodiment, said tumor is of epithelial origin.

In one embodiment, the tumor is a malignancy such as colorectal cancer, hepatoma, prostate cancer, pancreatic cancer, breast cancer, ovarian cancer, thyroid cancer, kidney cancer, bladder cancer, head cancer, and neck or lung cancer.

In one embodiment, the tumor is a malignant neoplasm of the colon or rectum.

Malignancy as used herein means cancer cells.

In one embodiment, said oncolytic adenovirus is used to treat or prevent metastasis.

In one embodiment, the method or composition herein is used to treat drug-resistant cancer.

In one embodiment, the virus is administered in combination with additional cancer treatment or therapy.

In one embodiment, a virus or composition of the present invention is provided for use in the preparation of a medicament for the treatment of cancer, such as the cancer described above.

- 18 044599

According to a further aspect, there is provided a method of treating cancer, comprising administering a therapeutically effective amount of a virus or composition in accordance with the present invention to a patient in need thereof, eg, a human patient.

In one embodiment, the oncolytic virus or composition herein is administered in combination with another therapy.

In combination herein includes the administration of said oncolytic virus before, simultaneously and/or after cancer treatment or therapy.

Cancer therapy includes surgery, radiation therapy, targeted therapy and/or chemotherapy.

Treatment of cancer as used herein refers to treatment with a therapeutic compound or biological agent, eg, an antibody, for treating cancer and/or supporting therapy for cancer.

In one embodiment, the cancer treatment is selected from any other anticancer therapy, including a chemotherapeutic agent, a targeted anticancer agent, radiation therapy, radioactive isotope therapy, or any combination thereof.

In one embodiment, a virus as described herein, such as an oncolytic adenovirus, can be used as a pretreatment before therapy such as surgery (neoadjuvant therapy), to shrink a tumor, to treat metastasis, and/or to prevent metastasis or further metastasis. This oncolytic adenovirus can be used after therapy, such as surgery (adjuvant therapy), to treat metastasis and/or prevent metastasis or further metastasis.

Concurrently herein refers to administering additional cancer treatment at or about the same time as administration of the oncolytic adenovirus formulation. Said treatment may be included in the same formulation or administered as a separate formulation.

In one embodiment, the virus is administered in combination with the administration of a chemotherapeutic agent.

Chemotherapeutic agent herein refers to specific antineoplastic chemical agents or drugs that selectively act in a destructive manner on malignant cells and tissues, such as alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors and other antineoplastic agents. Other examples of chemotherapy include doxorubicin, 5-fluorouracil (5-FU), paclitaxel, capecitabine, irinotecan, and platinum drugs such as cisplatin and oxaliplatin. The preferred dose may be selected by the attending physician based on the nature of the cancer being treated.

In one embodiment, said therapeutic agent is ganciclovir, which may help control immune responses and/or tumor vascularization.

In one embodiment, one or more of the therapies used in the method of the present invention are metronomic, that is, they are continuous or frequently administered treatments with low doses of anticancer drugs, often taken concurrently with other therapies.

Oncolytic adenoviruses of subgroup B, in particular Ad11 and its derived viruses such as EnAd, may have particularly synergistic characteristics when used with chemotherapeutic agents, since their mechanism of action appears to be largely independent of apoptosis, and they ensure the killing of cancer cells mainly through the necrolytic mechanism.

Additionally, the immunosuppression that occurs with chemotherapy may allow the oncolytic virus to function more effectively.

A therapeutic dose as used herein refers to an amount of a virus, such as an oncolytic adenovirus, that is suitable to achieve the intended therapeutic effect when administered in a suitable treatment regimen, for example, ameliorating a symptom or condition of a disease. A dose may be considered a therapeutic dose for the treatment of cancer or metastasis if the number of viral particles can be sufficient to provide the following: tumor or metastatic growth is slowed or stopped, or a decrease in tumor or metastasis is detected, and/or the patient's life expectancy is increased. Suitable therapeutic dosages are typically selected based on a balance of therapeutic benefit and acceptable toxicity, for example, such that side effects and toxicity are acceptable in light of the benefit achieved by the therapy.

In one embodiment, the virus or therapeutic construct of the present invention (including a formulation containing it) is administered weekly, for example, for 1 week, a dose is administered on days 1, 3, 5, followed by one dose each subsequent day. week.

In one embodiment, a virus or therapeutic construct in accordance with

- 19 044599 of the present invention (including containing his or her composition) is administered every two weeks or every three weeks, for example, for 1 week on days 1, 3, 5, and also administered on the corresponding days 1, 3, 5 on 2 or 3 weeks. The specified dosage regimen can be repeated as many times as required.

In one embodiment, the virus or therapeutic construct of the present invention (including a formulation containing him or her) is administered monthly.

In one embodiment, the viruses and constructs described herein are produced using recombinant techniques. One skilled in the art will understand that the genome of an armed adenovirus can be obtained by other technical methods, including by whole genome synthesis or a plasmid containing part or all of the genome. One skilled in the art will appreciate that in the case of genome synthesis, the insertion region may not contain restriction site nucleotides, since the latter are artifacts of gene insertion using cloning techniques.

The present invention also covers an adenovirus of formula (I) or a subformula thereof, which is or can be obtained by insertion of a transgene or transgene cassette.

Is/is, as used herein, means containing.

For purposes of this specification, the term containing is to be construed as inclusive.

It is intended that embodiments of the present invention including certain features/elements also extend to alternative implementations consisting or consisting essentially of the relevant elements/features.

In technically appropriate cases, embodiments of the present invention can be combined.

Technical sources such as patents and applications are incorporated herein by reference.

Any embodiments specifically and expressly set forth herein may form the basis of a disclaimer, alone or in combination with one or more additional embodiments.

The present invention claims benefit from GB 1713765.4, WO 2018/041838 and WO 2018/041827, incorporated herein by reference. These documents may be used to correct errors in the present specification, in particular errors in the sequence listing.

The present invention is further described, for illustrative purposes only, in the following examples with reference to the accompanying drawings, in which:

Brief description of drawings

Fig. 1. Schematic representation of transgenic cassettes NG-615, NG-640 and NG-641.

Fig. 2. Replication of the viral genome in lung, breast and bladder carcinoma cell lines.

Cell lines A549 (A), MDA-MB-453 (B), and RT4 (C) were treated with NG-617, NG-615, NG-640, NG-641, or enadenotucirev virus particles for up to 7 days. The amount of viral genome detected using qPCR was assessed on days 2, 3, 4 and 7 after treatment.

Fig. 3. Virus-mediated oncolysis of lung carcinoma cells.

A549 cells were treated with NG-617, NG-615, NG-640, NG-641, or enadenotucirev virus particles for up to 4 days. Cell viability throughout the entire culture volume was assessed using the xCelligence system (A). For each virus treatment, the time point at which 50% killing was observed (KT50) was determined (B).

Fig. 4. Transgenic expression of NG-615 in lung and bladder carcinoma cells. A549 (left panels) and RT4 cells (right panels) were treated with NG-615 or enadenotucirev virus particles or left uninfected for up to 7 days. The secretion of Flt3 ligand (A), MIP1a (B) and IFN-α (C) in cell supernatants was assessed using ELISA. Transgene expression was not detected in EN-treated or untreated control cells (data not shown).

Fig. 5. Transgenic expression of NG-641 in lung and bladder carcinoma cells. A549 (left panels) and RT4 (right panels) cells were treated with NG-641 or Enadenotucirev virus particles or left uninfected for up to 7 days. Cell supernatants were assessed for secretion of CXCL9 (A), CXCL10 (B), or IFN-α (C) using ELISA. Transgene expression was not detected in EN-treated or untreated control cells (data not shown).

Fig. 6. Expression of functional transgenes in lung carcinoma cells.

A549 cells were treated with NG-615, NG-641, or enadenotucirev virus particles for up to 4 days. On day 4 after treatment, the level of functional transgenes produced by IFN-α (A) or MIP1α (B) was assessed using cellular reporter assays.

Fig. 7. Expression of functional FAP-bispecific T cell activators in lung carcinoma cells. A549 cells were treated with NG-615, NG-641, or enadenotucirev virus particles for up to 4 days. On days 2 (A), 3 (B) and 4 (C) after treatment, the level of expression of functional FAP-bispecific activator of T cells in cell supernatants was assessed by measuring the activation of Jurkat T cells when co-cultured with cells of the FAP-expressing fibroblast line ,MRC-5.

Fig. 8A. Transgene-encoded IFN-α in the supernatant from NG-641-infected A549 cells induces SEAP production by Jurkat Dual reporter cells. Jurkat-Dual reporter cells were treated with supernatant from A549 cancer cells, either uninfected (UIC) or infected with enadenotucir (EnAd) or NG-641, and the level of the reporter, secreted embryonic alkaline phosphatase (SEAP), was measured.

Fig. 8B. Transgene-encoded CXCL9/10 in the supernatant from NG-641-infected A549 cells activates the GPCR pathway in PathHunter β-Arrestin assay cells. PathHunter β-Arrestin cells were treated with supernatant from A549 cancer cell line, either uninfected (UIC) or infected with enadenotucir (EnAd) or NG-641, and CXCL9/10-specific induction of the G protein-coupled receptor (GPCR) pathway was detected using luminescence.

Fig. 9. Transgene-encoded CXCL9/10 in the supernatant from NG-641-infected A549 cells induces down-regulation of CXCR3 on the surface of activated T cells.

Anti-CD3/CD28-activated human T cells were treated with supernatant from A549 cancer cell line, either uninfected (UIC) or infected with endenotucyrev (EnAd) or NG-641, and CXCL9/10 transgene-induced down-regulation of CXCR3 was measured using flow cytometry.

Fig. 10. Activation of endogenous tumor-infiltrating T cells in ex vivo cultures of primary human tumor specimens inoculated with EnAd, NG-615, NG-617, NG-640 or NG-641, anti-CD3/28 or uninfected (UIC)

The levels of transgenic viral products IFN-α and Flt3L are shown in A), and the levels of IFN-γ, TNF-α, IL-17A, granzyme B and IL-13 are shown in B).

Fig. 11. Activation of surface marker expression and intracellular cytokines in endogenous tumor-infiltrating T cells in ex vivo cultures of a primary NSCLC tumor sample treated with EnAd, NG-617, NG-640 or NG-641, or uninfected (UIC). Levels of CD4 and CD8 T cells expressing CD25, CD69 and CD107a are shown in A and B, respectively. Levels of intracellular IFN-γ and TNF-α expressed by CD4 and CD8 T cells are shown in C and D, respectively.

Fig. 12. Schematic representation of a bispecific T cell activator antibody according to the present disclosure, with or without an optional decahistidine affinity tag. Ig SP: signal peptide; 10His: decahistidine affinity tag; L: GS linker; V _L : light chain variable domain; VH heavy chain variable domain.

Fig. 13 (A) - dot blot reflecting the quantitative determination of recombinant bispecific T-cell activators. (B) is a graph showing the results of the FAP ELISA.

Fig. 14 is a graph showing the expression levels of CD69 (A) and CD25 (B) for cocultured T cells, alone or with NHDF cells, in the presence of FAP bispecific T cell activator and control bispecific T cell activator, measured using flow cytometry. (C) graph showing IFN-γ expression levels for cocultured T cells, alone or with NHDF cells, in the presence of FAP bispecific T cell activator and control bispecific T cell activator, measured using intracellular cytokine staining

Fig. 15(A) is a graph showing the results of an LDH assay showing the cytotoxicity of NHDF cells that were co-cultured with T cells and FAP bispecific T cell activator or control bispecific T cell activator. (B) is a graph showing the results of an LDH assay showing the cytotoxicity of BTC100 cells co-cultured with T cells and FAP bispecific T cell activator, bispecific T cell activator or control bispecific T cell activator. (C) Images of NHDF cells after coculture with T cells and FAP bispecific T cell activator or control bispecific T cell activator.

Fig. 16 is a graph showing the % of cells expressing EpCAM and FAP in multiple cells and multiple cell lines.

Fig. 17 (A) is a graph showing the dose response in NHDF for FAP bispecific T cell activator as the concentration of bispecific T cell activator increases. Graph (B) and (C) showing the results of the LDH assay showing the cytotoxicity of DLD cells co-cultured with T cells and EpCAM bispecific T-cell activator or control bispecific T-cell activator.

Fig. 18(A) is a graph showing FAP expression in CHO cells determined using FAP antibody or isotype control antibody and analyzed using flow cytometry. (B) is a graph showing the results of an LDH assay showing the cytotoxicity of CHO or CHO-FAP cells cocultured with T cells and FAP bispecific T cell activator or control bispecific T cell activator.

Fig. 19 is a graph showing T cell activation (based on CD69 and CD25 expression levels) by CHO or CHO-FAP cells analyzed using flow cytometry.

Fig. 20(A) is a graph depicting the ability of FAP bispecific T cell activator to activate CD4+ or CD8+ T cells (based on CD69 and CD25 expression levels) analyzed using flow cytometry. (B) is a graph showing the results of an LDH assay showing the cytotoxicity of NHDF cells cocultured with CD4+ or CD8+ T cells and FAP bispecific T cell activator or control bispecific T cell activator.

Fig. 21 (A) is a graph showing the number of CD3+ T cells from ascites cultured with control bispecific T cell activator or FAP bispecific T cell activator. (B) graph showing the expression levels of CD25 by T cells from ascites cultured with control bispecific T cell activator or FAP bispecific T cell activator. (C) is a graph showing the number of FAP+ cells from ascites cultured with control bispecific T cell activator or FAP bispecific T cell activator. (C) graph showing the number of FAP+ cells from ascites cultured with control bispecific T cell activator or FAP bispecific T cell activator.

Fig. 22 (A) is a graph showing the quantification of the number of detected viral genomes per cell for NG-601, NG-602, NG-603, NG-604, NG-605, NG606 and EnAd. (B) graphs showing the oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, or EnAd as assessed by infection of A549 cells.

Fig. 23 are graphs showing T cell activation (based on CD69 and CD25 expression levels) of NG-601, NG-602, NG-605 and NG-606 when co-cultured with CHO-FAP, analyzed using flow cytometry.

Fig. 24 are graphs showing the results of experiments to determine the amount of bispecific T cell activator FAP produced by NG-605 and NG-606.

Fig. 25 - microscopic images of Ad293 cells infected with NG-607, NG-608, NG-609 and NG-610.

Fig. 26 (A) is a graph showing the killing ability of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells, analyzed using XCELLigence. (B) graph showing the killing abilities of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells, analyzed using the LDH assay.

Fig. 27 - graphs showing T cell activation (based on CD69 and CD25 expression levels) of NG-603, NG-604, NG-605, NG-606 when co-cultured with NHDF, SKOV and T cells, analyzed using flow cytometry .

Fig. 28 (A) is a graph showing T cell activation (based on CD69 and CD25 expression levels) of NG-603, NG-604, NG-605, NG-606 when cultured together with NHDF and SKOV cells or with SKOV alone , analyzed using flow cytometry. (B) graph showing the cytotoxicity of NHDF cells infected with NG-605 and NG-606 analyzed using the LDH assay.

Fig. 29 - still frames from time-lapse video of NHDF cell lysis by recombinant FAP bispecific T cell activator, EnAd, NG-603 or NG-605.

Fig. 30 - still frames from time-lapse video recording of lysis of NHDF NG-607, NG-608, NG-609 or NG-610 cells.

Fig. 31 is a graph showing the cytotoxicity of DLD cells infected with EnAd, NG-601, NG602, NG-603 and NG-604 in the presence of T cells or in the absence of T cells, analyzed using the LDH assay.

Fig. 32 (A) is a graph showing the expression levels of CD25 on CD3+ T cells in ascites samples infected with viruses according to the present description. (B) graph showing the number of FAP+ cells in ascites samples infected with viruses as described herein.

Fig. 33 is a graph showing the number of CD3+ T cells in ascites samples obtained from a patient with cancer and infected with viruses according to the present description.

Fig. 34 is a graph showing CD25 expression levels on CD3+ T cells in ascites samples obtained from a cancer patient and infected with the viruses described herein.

Fig. 35 is a graph showing the number of FAP+ cells in ascites samples obtained from a cancer patient and infected with viruses according to the present description.

Fig. 36 - comparison of activation of cytokine production by T cells by recombinant FAP protein bispecific T cell activator in the presence of human fibroblasts and with polyclonal activation by anti-CD3/CD28 antibody-coated microbeads. (A) IFN-γ levels measured using ELISA. (B) Cytokine levels measured using a microbead chip cytokine assay.

Fig. 37 - FAP-targeted bispecific T-cell activator induces T-cell degranulation and FAP+ cell-specific cytotoxicity. (A) - degranulation of T cells in culture with NHDF cells (5:1) and (B) supernatants containing bispecific T cell activator. Degranulation was assessed by externalization of CD107a after 6 hours of culture with CD107-specific antibody and measured using flow cytometry. Anti-CD3/CD28 Dynabeads were used as a positive control. (C) - cytotoxicity of NHDF cells after 24 hours of co-culture with T cells (1:5) and 10-fold serial dilutions of supernatants containing bispecific T-cell activator. Cytotoxicity was assessed by the release of LDH into culture supernatants. (D) NHDF lysis upon LDH release (left) and CD25 induction on T cells (right) were assessed after 24 hours of coculture with PBMC-derived T cells (1:5) from six healthy donors and containing bispecific T activator cells with supernatants.

Fig. 38 - EnAd, a FAP-expressing bispecific activator of T cells, provides selective killing of FAP+ fibroblasts and reduces the level of TGF-b in samples of peritoneal ascites (A, B) Number of FAP+ fibroblasts (A) and EpCAM ⁺ tumor cells (B) after 72 hours of cultivation with PBMC-derived T cells and EnAd or recombinant viruses. Ascites cells were first isolated from ascites from three patients and expanded ex vivo. Cell numbers were measured 72 h postinfection using flow cytometry. (C) Induction of CD25 marker activation on PBMC-derived CD3 cells in (A) was measured 72 hours postinfection. (D) TGF-b levels were measured using an ELISA using the supernatants collected in step (A).

Fig. 39 - activation of endogenous tumor-associated T cells and associated killing of FAP+ cells in biopsy samples of malignant ascites from a patient by the FAP protein (bispecific activator of T cells) and EnAd-FAP (bispecific activator of T cells) viruses. (A) T cell activation measured by CD25 expression. (B) - residual number of FAP+ cells measured using flow cytometry.

Fig. 40 - Effect of PD-L1 blocking antibodies on bispecific T cell activator-mediated T cell activation in a patient sample (A) PD1 expression by endogenous T cells and PDL1 on FAP+ cells after their initial isolation from peritoneal ascites was assessed using flow cytometry . (B) A total crude population of cells from peritoneal ascites was incubated in 50% fluid from the same exudate in the presence of free bispecific T-cell activator, EnAd, or recombinant virus, in the presence or absence of a PD-L1-directed blocking antibody. After 2 days, the total cell population was collected and the number of CD25 + T cells was quantified using flow cytometry. (C) - the amount of interferon gamma in culture supernatants from (B, D) was measured using ELISA. (D) - The number of residual FAP+ cells in (B) was measured using flow cytometry.

Fig. 41 - EnAds expressing bispecific T cell activator activate and redirect T cells from patient biopsy specimens to lyse NHDF fibroblasts. (A) PD-1 expression by endogenous T cells after isolation from healthy donor samples or malignant cancer exudate biopsies, PD-1 expression was measured using flow cytometry. (B) Proportion of CD3+ cells in the crude PBMC cell population and cancer biopsy samples measured using flow cytometry. (C) Interferon gamma levels measured using ELISA in culture supernatants collected from (B) 120 hours after treatment. (D) The viability of NHDF fibroblasts was monitored in real time for 130 hours using the xCELLigence cytotoxicity assay in coculture with PBMCs or a total cell population of cancer biopsies (1:5) and a bispecific T-cell activator-containing supernatant.

Fig. 42 - Effect of immunosuppressive ascites fluid samples on FAP-coated bispecific T-cell activator and anti-CD3/CD28 bead-mediated T cell activation of PBMCs. (A) PBMC T cells activated with anti-CD3/Cd28 coated Dynabeads. (B) - PBMC T cells activated with control bispecific T cell activator or FAP bispecific T cell activator in the presence of NHDF cells. NS: normal serum, A: peritoneal ascites.

Fig. 43 - FAP-expressing bispecific T-cell activator EnAd polarizes CD11b ⁺ macrophages in patient ascites toward a more inflammatory phenotype (A) The total crude population of cells from an ascites sample was incubated in 50% ascites fluid in the presence of free bispecific T-cell activator or expressing bispecific T-cell activator T cell virus. Interferon gamma treatment was used as a positive control. In 3 days

- 23 044599 collected the total cell population and measured the induction of CD25 marker activation on CD3+ cells using flow cytometry. (B) Interferon gamma levels in culture supernatants from (A) were measured using an ELISA. (C) After 3 days, expression levels of CD68, CD86, CD206, and CD163 on CD11b+ cells in (A) were measured using flow cytometry. Representative flow cytometric spectra based on triplicates are shown along with the full data set.

Fig. 44 - characterization of the architecture and cellular composition of a solid prostate tumor. Levels of IFN-g in tissue section culture medium measured using ELISA are shown. Culture supernatants from malignant and benign tissue sections were collected at the indicated time points; and IL-2 levels in malignant and benign tissue culture media measured using ELISA.

Fig. 45 is a schematic representation of a transgene cassette.

Fig. 46 is a graph showing the detected number of viral genomes per cell in NG-611, NG-612 and NG-617 treated tumor cells.

Fig. 47 shows the percentage of T cells expressing CD69 (a), CD25 (b), HLA-DR (c), CD40L (d), or CD107a cell surface (e) after coculture with EpCam-expressing SKOV cells and collected supernatants from A549 cells via 24 h, 48 h, or 72 h after treatment with NG-611 virus particles compared with NG-612, EN-treated, or untreated control supernatants.

Fig. 48 - percentage of T cells expressing CD69 (a), CD25 (b) HLA-DR (c), CD40L (d) or CD107a cell surface (e) after co-culture with FAP-expressing MRC-5 cells and collected cell supernatants A549 at 24 h, 48 h, or 72 h after treatment with NG-612 virus particles compared with NG-611-, enadenotucirev-treated, or untreated control supernatants.

Fig. 49 - percentage of MRC-5 cells that express EpCAM and FAP.

Fig. 50 - expression of IFN-γ in the supernatants of co-cultures of T cells with SKOV cells (A) or MRC-5 cells (B), incubated with collected supernatants from A549 cells 24 hours, 48 hours or 72 hours after treatment with NG-viral particles 611, NG-612 or enadenotucir, or with untreated control supernatants.

Fig. 51 - antitumor efficacy and immune activation by viruses expressing bispecific T-cell activator in vivo. (a) Tumor volume in mice treated with saline, EN, or NG-611. (b) ratio of CD8 to CD4 T cells in NG611-treated tumors compared with EN-treated or untreated controls.

Fig. 52 is a graph showing the number of detected viral genomes per cell in NG-612 and NG-615 treated tumor cells

Fig. 53 - expression of IFN-α, MIP1a and Flt3 L in the cell supernatant from NG-615-treated and supernatant from EN-treated and untreated control tumor cells.

Fig. 54 - number of T cells expressing CD69 (a), CD25 (b) HLA-DR (c), CD40L (d) or CD107a cell surface (e)) after co-culture with FAP-expressing MRC-5 cells and collected supernatants from A549 cells 24 h, 48 h, or 72 h after treatment with NG-615 virus particles compared with NG-612-, enadenotucir-treated, or untreated control supernatants.

Fig. 55 - expression of IFN-γ in supernatants of co-cultures of T cells with MRC-5 cells incubated with collected supernatants from A549 cells 24 hours, 48 hours or 72 hours after treatment with NG-612, NG-615 or enadenotucirev viral particles, or with untreated control supernatants.

- 24 044599

Sequences SEQ ID NO: 1 Bispecific anti-FAP T cell activator DNA coding sequence with N-terminal signal sequence and C-terminal decahistidine affinity tag SEQ ID NO: 2 Amino acid sequence of bispecific T cell activator against FAP with N-terminal signal sequence and C-terminal decahistidine affinity tag SEQ ID NO: 3: Encoding a control (anti-FHA) bispecific T-cell activator DNA sequence with an N-terminal signal sequence and a C-terminal decahistidine affinity tag

SEQ ID NO: 4: Amino acid sequence of control (anti-FHA) bispecific T-cell activator with N-terminal signal

- 25 044599 sequence and C-terminal decahistidine affinity tag

SEQ ID NO: 5: Amino acid sequence of ScFv anti-CD3 antibody SEQ ID NO: 6: VH antibodies against CD3 SEQ ID NO: 7: VL anti-CD3 antibodies SEQ ID NO:8: Anti-CD3 antibody ScFv linker sequence SEQ ID NO:9: ScFv antibodies against FAP SEQ ID NO: 10: VL domain of anti-FAP antibody SEQ ID NO: 11: Anti-FAP antibody VH domain SEQ ID NO: 12: anti-FAP antibody linker sequence and antibody vs EpCAM SEQ ID NO: 13: The leader sequence of the bispecific activator T-

cells

SEQ ID NO: 14: Control bispecific T cell activator (versus FHA) SEQ ID NO: 15: Benchmark (vs. FHA) ScFv SEQ ID NO: 16: Benchmark (vs. FHA) VL SEQ ID NO: 17: Benchmark (vs. FHA) VH SEQ ID NO: 18: Control linker sequence (anti-FHA) ScFv SEQ ID NO: 19: Decahistidine tag sequence SEQ ID NO: 20: FAP bispecific T cell activator-P2A-PPP (ITALICS = leader sequence, BOLD = furin cleavage site, UNDERLINE = P2A sequence, lowercase letters = RFP) SEQ ID NO: 21: Control bispecific T cell activator-P2A-RFP (versus FHA) (ITALICS = leader sequence, BOLD = furin cleavage site, UNDERLINE = P2A sequence, lowercase = RFP) SEQ ID NO: 22: Human FAP DNA coding sequence SEQ ID NO: 23: Amino acid sequence of human FAP SEQ ID NO: 24: CMV promoter sequence SEQ ID NO: 25: SV40 late region polyadenylation sequence SEQ ID NO: 26: NG-605 (EnAd-CMV-FAP bispecific T cell activator) SEQ ID NO: 27: NG-606 (EnAd-SA-FAP bispecific T cell activator) SEQ ID NO: 28 EnAd genome SEQ ID NO: 29 DNA sequence Βχ, corresponding to and including b.p. 28166-28366 genome EnAd SEQ ID NO: 30 Βγ DNA sequence corresponding to and including b.p. 29345-29379 genome EnAd

- 26 044599

SEQ ID NO: 31

HIS tag

SEQ ID NO: 32

SEQ ID NO: 33

Splice acceptor sequence.

SV40 polyadenylation sequence

SEQ ID NO: 34 sequence of nucleic T cell activator (T-cell activator) acids

FAP bispecific

SEQ ID NO: 35 T cell activator (aCD3) acid nucleic acid sequence

FAP bispecific

SEQ ID NO: 36

SEQ ID NO: 37

SEQ ID NO: 38

Transgenic

Transgenic

Transgenic cassette cassette cassette

SEQ ID NO: 39

SEQ ID NO: 40

SEQ ID NO: 41

SEQ ID NO: 42

SEQ ID NO: 43

SEQ ID NO: 44

SEQ ID NO: 45

SEQ ID NO: 46 splice (bSA)

SEQ ID NO: 47

SEQ ID NO: 48

SEQ ID NO: 49 (IRES)

SEQ ID NO: 50

SEQ ID NO: 51

SEQ ID NO: 52

SEQ ID NO: 53

SEQ ID NO: 54

SEQ ID NO: 55

SEQ ID NO: 56

SEQ ID NO: 57

SEQ ID NO: 58

SEQ ID NO: 59

SEQ ID NO: 60

NG-611

NG-612

NG-613

Insertion fragment with restriction site (Βχ)

Insertion fragment with restriction site (Bu)

CMV promoter sequence

PGK promoter sequence

CBA promoter sequence

Short splice acceptor (SSA) DNA sequence

Splice acceptor (SA) DNA sequence

Branched acceptor DNA sequence Kozak sequence (null sequence)

Example of a start codon

Sequence of the internal ribosome landing site

Peptide P2A peptide F2A peptide E2A peptide T2A polyadenylation sequence (poly(A))

Leadership sequence

Leadership sequence

Amino acid sequence of IFN-γ

Amino acid sequence of IFN-a

Amino acid sequence of TNF-a

DNA sequence corresponding to the E2B region of the genome

EnAd (po. 10355-5068)

- 27 044599

SEQ ID NO: 61: Bispecific anti-FAP T cell activator DNA coding sequence with N-terminal signal sequence without C-terminal decahistidine affinity tag SEQ ID NO: 62: Amino acid sequence of a bispecific T cell activator against FAP with an N-terminal signal sequence without a C-terminal decahistidine affinity tag SEQ ID NO:63: DNA coding sequence of a control (anti-FHA) bispecific T cell activator with an N-terminal signal sequence without a C-terminal decahistidine affinity tag SEQ ID NO:64: Amino acid sequence of control (anti-FHA) bispecific T cell activator with N-terminal signal sequence without C-terminal decahistidine affinity tag SEQ ID NO: 65: Control bispecific T cell activator (anti-FHA) without

C-terminal decahistidine affinity tag

SEQ ID NO: 66: NG-605 (EnAd-CMV-FAP bispecific activator T- cells) without a decahistidine affinity tag SEQ ID NO: 67: NG-606 (EnAd-SA-FAP bispecific activator T cells) without decahistidine affinity tag SEQ ID NO: 68: Sequence nucleic acids (OKT3)FAP bispecific T cell activator SEQ ID NO: 69: Sequence nucleic acids (aCD3)FAP

bispecific T-cell activator

SEQ ID NO: 70: Transgene cassette NG-611 SEQ ID NO: 71: Transgene cassette NG-612 SEQ ID NO: 72: Transgene cassette NG-613 SEQ ID NO: 73: Transgene cassette NG-614 SEQ ID NO: 74: Transgene cassette NG-617

SEQ ID NO: 75: Amino acid sequence (OKT3)FAP bispecific T cell activator

SEQ ID NO: 76: Amino acid sequence (aCD3)FAP bispecific T cell activator

SEQ ID NO: 77: NG-611 Genome

SEQ ID NO: 78: NG-612 Genome

SEQ ID NO: 79: NG-613 Genome

SEQ ID NO: 80: NG-614 Genome

SEQ ID NO: 81: NG-617 Genome

- 28 044599

SEQ ID NO: 82: Genome NG-615 SEQ ID NO: 83: Genome NG-640 SEQ ID NO:84: Genome NG-641 SEQ ID NO: 85: Zero sequence SEQ ID NO: 86: Flt3L nucleic acid sequence SEQ ID NO:87: Zero sequence SEQ ID NO:88: M1P1a nucleic acid sequence SEQ ID NO: 89: Flexible linker sequence SEQ ID NO: 90: IFN-a nucleic acid sequence SEQ ID NO:91: Nucleic acid sequence of CXCL10 SEQ ID NO:92: Nucleic acid sequence of CXCL9 SEQ ID NO:93: Transgene cassette NG-615 SEQ ID NO:94: Transgene cassette NG-640 SEQ ID NO:95: Transgene cassette NG-641 SEQ ID NO:96: Amino acid sequence of FLT3L SEQ ID NO:97: Amino acid sequence of M1P1a SEQ ID NO:98: Amino acid sequence of IFN-a SEQ ID NO: 99: Amino acid sequence of CXCL9 SEQ ID NO: 100: Amino acid sequence of CXCL10 SEQ ID NO: 101: Genome NG-618

SEQ ID NO: 102: Nucleic acid sequence of NG-618 FAP bispecific T cell activator

SEQ ID NO: 103: Transgene cassette NG-618

SEQ ID NO: 104-277 linker sequences

SEQ ID NO: 278 Genome NG-616

SEQ ID NO: 279-281 primers

Examples

Example 1.

Recombinant bispecific T cell activators were developed and proteins were prepared as described in this example.

1.1. Construction of a bispecific T cell activator.

Bispecific T-cell activators are produced by connecting two single-chain antibody fragments (ScFv) with different specificities with a flexible Cly ₄ Ser linker. ScFv is produced by connecting the VH and VL domains of the parent monoclonal antibodies with a linker. The design of each bispecific T cell activator included an N-terminal signal sequence for mammalian secretion and a C-terminal decahistidine affinity tag for detection and purification. Bispecific T cell activators were constructed using standard DNA cloning techniques and inserted into protein expression vectors (Fig. 1).

An anti-FAP bispecific T cell activator was generated de novo using the anti-FAP ScFv of WO 2010037835A2 and the anti-CD3 ScFv of WO 2005040220 (set forth therein as SEQ ID 63) with the addition of a signal sequence and an affinity tag. For the control bispecific activator of T cells, we used ScFv directed against FHA (filamentous hemagglutinin of Bordetella pertussis) from the work of Hussein et al (2007) Construction and characterization of single-chain variable fragment antibodies directed against the Bordetella pertussis surface adhesins filamentous hemagglutinin and pertactin. Infect Immunity 75, 5476-5482) and the anti-CD3 ScFv of WO 2005040220 (cited SEQ ID NO: 63) with the addition of a signal sequence and an affinity tag.

1.2. Preparation of recombinant bispecific T-cell activator.

Recombinant bispecific T cell activator proteins were produced by cloning the corresponding sequences into the pSF-CMV vector using the CMV promoter (SEQ ID NO: 24) to drive protein expression (Fig. 1). Plasmid DNA concentrations for plasmids, pSF-CMVFAP bispecific T cell activator and pSF-CMV-Control bispecific T cell activator (Table 2) were measured using NanoDrop. An empty pSF-CMV vector is included as a negative control. 54.7 μg of each component was diluted in 4 ml OptiMEM. 109.2 μg of PEI (linear, MW 25000, Polysciences, USA) was diluted in 4 ml of OptiMEM medium and mixed with 4 ml of diluted

DNA to obtain DNA-PEI complexes (DNA:PEI ratio = 1:2 (by weight)). After incubation at room temperature for 20 minutes, the complex mixture was diluted to 18 ml with OptiMEM and the transfection mixture was added to a T175 vial containing Ad293 cells at 90% confluency. After incubating the cells with this transfection mixture for 4 hours at 37°C, 5% CO ₂ , 30 ml of cell medium (DMEM with high glucose and glutamine added, without phenol red) was added to the cells and the flasks were incubated at 37°C, 5% CO ₂ for 48 hours. In another flask, cells were transfected in parallel with pSF-CMV-GFP to ensure efficient transfection. To collect secreted protein, supernatant from transfected cells was collected and centrifuged at 350d and 4°C for 5 minutes to remove cell components (Allegra X-15R, Beckman Coulter). Supernatants were transferred to Amicon Ultra-15 centrifugal filters with a nominal molecular weight cutoff of 10 kDa (Millipore). After centrifugation at 4750 rpm at 4°C, the volume of the retentate was brought to a 50-fold concentration by the flow-through fraction. Aliquots of concentrated protein were stored at -80°C.

table 2

Plasmid ID [Plasmid DNA] ng/ml pSF-CMV-FAP bispecific T-note activator 6700 pSF-CMV-Control bispecific T-note activator 5300 pSF-Lenti-FAP 659.6

The p prefix in construct names indicates that the construct is a plasmid.

1.3. Production of viruses expressing FAP-bispecific T-cell activator in combination with immunomodulatory proteins.

Three viruses (NG-640, NG-641, and NG-615) were produced encoding a FAP-targeting bispecific T-cell activator molecule and 2 or 3 immunomodulatory proteins (Table 1). NG-640 encodes three transgenic proteins, the FAP-bispecific activator of T-cell molecule, and the chemokines CXCL9 and CXCL10. Both NG-641 and NG-615 encode four transgenic proteins. NG-641 encodes the FAP bispecific activator of T cells, the chemokines CXCL9 and CXCL10, and the cytokine IFN-α, and NG-615 encodes the FAP bispecific activator of T cells, the chemokine MIP1a, and the cytokines Flt3 ligand and IFN-α. A virus encoding only the FAP-bispecific T-cell activator molecule (NG-617) was also obtained.

Table 1

Virus ID Transgene cassette NG-615 (SEQ ID NO: 1) 55A ¹ -PAPbispecific activator of T cells ² -E2A ³ Flt3L ⁴ -P2A ⁵ -MIP1a ⁶ -T2A ⁷ -IFNa ⁸ -PA ⁹ NG-640 (SEQ ID NO: 2) 55A ¹ -PAPbispecific activator of T cells ² -P2A ⁵ CXCL1O ¹ °-T2A ⁷ -CXCL9 ¹¹ - RA ⁹ NG-641 (SEQ ID NO: 3) 55A ¹ -PAPbispecific activator of T cells ² -P2A ⁵ CXCL10 ¹ ° -T2A ⁷ -CXCL9 ¹¹ -E2A ³ -IFNa ⁸ -PA ⁹ NG-617 (SEQ ID NO: 4) 55A ¹ -PAPbispecific activator of T cells ² -PA ⁹

In each transgene cassette, cDNA encoding bispecific T-cell activator and other immunomodulatory proteins was flanked at the 5' end by a short splice acceptor sequence (SSA, CAGG) and at the 3' end by the SV40 late poly(A) sequence (PA, SEQ ID NO: 25). The cDNA sequences for each transgene were separated using highly efficient self-cleaving peptide 2A sequences (P2A, T2A, E2A, SEQ ID NO: 50, 53 and 52).

Getting the virus.

Plasmid pEnAd2.4 was used to generate plasmids pNG-615, pNG-640 and pNG-641 by direct insertion of synthesized transgene cassettes (SEQ ID NOs: 93, 94 and 95, respectively). NG615 contains four transgenes encoding FAP-targeting bispecific T cell activator (SEQ ID NO: 102), Flt3L (SEQ ID NO. 86), MIP1a (SEQ ID NO. 88) and IFN-α (SEQ ID NO. 90) . NG-640 and NG-641 encode FAP-targeting bispecific T cell activator (SEQ ID NO. 102), CXCL9 (SEQ ID NO. 92) and CXCL10 (SEQ ID NO. 91). NG-641 also contains a fourth transgene encoding IFN-α (SEQ ID NO. 90). Schematic representations of these transgene cassettes are shown in FIG.

- 30 044599

1. Plasmid DNA construction was confirmed by restriction analysis and sequencing

DNA.

Plasmids pNG-615, pNG-640, and pNG-641 were linearized by restriction digestion with AscI to obtain viral genomes. Viruses were amplified and purified according to the methods below. Digested DNA was purified by phenol-chloroform extraction and precipitated for 16 hours, -20°C in 300 ml >95% molecular grade ethanol and 10 ml 3 M sodium acetate. The precipitated DNA was pelleted by centrifugation at 14,000 rpm for 5 minutes and washed in 500 ml of 70% ethanol, then centrifuged again at 14,000 rpm for 5 minutes. Clean pelleted DNA was air dried, resuspended in 500 ml OptiMEM containing 15 ml Lipofectamine transfection reagent, and incubated for 30 minutes at room temperature. The transfection mixture was then added dropwise to a T-25 flask containing 293 cells cultured to 70% confluency. After incubating the cells with the transfection mixture for 2 hours at 37°C, 5% CO ₂ , 4 ml of cell medium (DMEM with high glucose and glutamine, supplemented with 2% FBS) was added to the cells and the flasks were incubated at 37°C , 5% CO ₂ . Transfected 293 cells were monitored every 24 hours and additional medium was added every 48-72 hours. Virus production was monitored by the observed significant cytopathic effect (SPE) in the cell monolayer. Once the observed intense CPE was observed, virus was harvested from 293 cells through three freeze-thaw cycles. The collected viruses were used to reinfect 293 cells to amplify stock viral material. The production of viable virus during amplification was confirmed based on the observed significant CPE in the cell monolayer. Once the observed CPE was detected, virus was harvested from 293 cells using three freeze-thaw cycles. The amplified viral stock material was used for further amplification, after which the viruses were purified by double cesium chloride separation to obtain purified viral stock material.

Example 2. Analysis of virus replication and oncolytic activity.

Virus replication.

Lung (A549), breast (MDA-MB-453) or bladder (RT4) carcinoma cell lines inoculated for 72 h 1 h/cell treatment NG-615, NG-640, NG-641, NG-617, enadenotucireva (EnAd) or uninfected were used to quantify viral DNA using qPCR. Cell supernatants were collected and clarified by centrifugation for 5 minutes at 1200 rpm. 50 μl of the supernatant was used for DNA analysis.

DNA was extracted from the supernatant sample using the Qiagen DNeasy kit according to the manufacturer's protocol. A standard curve was also generated using EnAd viral particles (2.5e10 - 2.5e5 wp) and extraction was performed using the DNeasy kit. Each extracted sample or standard was analyzed by qPCR using a viral gene-specific primer/probe targeting the E3 early gene. Quantification of the number of detected viral genomes per cell demonstrated viral replication in A549, MDA-MB-453, and RT4 for all viruses tested (NG-617, NG-615, NG-640, and NG-641) (Fig. 2). Viral replication was similar for all viruses and was equivalent to that observed for the parental EnAd virus. Viral genomes were not detected in uninfected cells.

Oncolytic activity.

Lung carcinoma cells (A549) inoculated with 100 h/cell NG-615, NG-640, NG641, NG-617, EnAd or uninfected were monitored using the xCELLigence Real Time Cell Analyzer (RTCA). Cell proliferation was monitored every 60 minutes for up to 96 hours. Cell oncolysis was assessed by calculating the 50% killing time (KT50), which is the time point at which 50% lysis is achieved (Fig. 3). These data demonstrate equivalent KT50 for all viruses tested, including the parental EnAd virus. No oncolytic effect was observed in untreated cells.

Taken together, these data indicate that inclusion of a bispecific T cell activator and two or three immunomodulatory transgenes does not significantly affect the replicative or oncolytic activity of the EnAd virus.

Example 3 Virus-mediated transgene expression assay. Detection of recombinant bispecific T cell activator.

To detect bispecific T cell activator, the C-terminal decahistidine affinity tag can be probed with an anti-His antibody using Western blotting techniques. Protein samples were adjusted to a final volume of 15 μl with lysis buffer, including 2.5 μl of 6x Laemmli SDS sample buffer, which contains p-mercaptoethanol and SDS. Samples were incubated for 5 minutes at 95°C to denature proteins and loaded onto 15-well precast 10% polyacrylamide gel sets (Mini-PROTEAN TGX precast gels, BioRad, UK). Running through the gels was carried out at 180 V for 45 minutes in 1x running buffer in the system

- 31 044599

Mini-PROTEAN Tetra (BioRad, UK). Proteins from SDS gels were transferred to nitrocellulose membranes by wet electroblotting at 300 mA and 4°C for 90 minutes in 1x transfer buffer in a Mini Trans-Blot Cell system (BioRad, UK). Transfer was performed in the presence of an ice pack to limit temperature. The nitrocellulose membrane was then blocked with 5% milk in PBS-T on a shaker for 1 hour at room temperature, and probed with anti-His (C-conc.) antibody (mouse a-6xHis antibody, clone 3D5, Invitrogen, UK, #46-0693 ), diluted to 1:5000 in PBS/5% milk. After incubation on a shaker overnight at 4°C, the membrane was washed and probed with HRP-labeled polyclonal secondary a-mouse Ig antibody (1:10,000 in PBS/5% milk, Dako, #P0161) for 1 hour at room temperature . For visualization, SuperSignal West Dura Extended Duration Substrate (Thermo Fisher Scientific, UK) was used, following the manufacturer's instructions, brought into contact with radiographic film and developed in a developing machine. The results demonstrated expression and secretion of bispecific T-cell activator protein by Ad293 cells transfected with bispecific T-cell activator expression plasmids, but not with the parent vector.

Quantification of recombinant bispecific T cell activator.

To measure the amount of recombinant bispecific T cell activator protein, a dot blot technique was used to compare the bispecific T cell activator signal with that of a His-tagged (10His at the C-terminus) standard protein (10 x His-tagged human cathepsin D, Biolegend , #556704). Two-fold serial dilutions of bispecific T-cell activator and standard protein samples were prepared, 1.5 μl of each dilution was applied directly to a nitrocellulose membrane and air-dried for 20 minutes. The blocking and staining protocol described above for Western blotting was then followed. The molar concentration of the standard protein was adjusted to the corresponding bispecific T cell activator concentration of 250 μg/ml. The results obtained (Fig. 13A) demonstrated the expression and secretion of bispecific T cell activator protein by Ad293 cells transfected with bispecific T cell activator expression plasmids.

FAP binding ELISA.

FAP-binding activity of FAP bispecific T cell activator and control (anti-FHA) bispecific T cell activator (SEQ ID NO: 2 and 4) secreted from cells transfected with pSF-CMV-FAP bispecific T cell activator or pSF-CMV Control bispecific T-cell activator, was assessed using an enzyme-linked immunosorbent assay (ELISA). Supernatants with empty pSF-CMV vector were included as a negative control. ELISA plates (Nunc Immuno MaxiSorp 96-well microplates) were prepared by coating overnight at 4°C with human FAP protein/seprase (100 ng/well, Sino Biological Inc, 10464-H07H-10) in PBS buffer. Plates were washed between all subsequent binding steps with PBS plus 0.05% Tween 20. Plates were blocked for 1 hour at room temperature with 5% BSA in PBS plus 0.05% Tween 20. Aliquot bispecific T-cell activator protein, or protein collected from wells transfected with the empty pSF-CMV vector were diluted 10-fold in PBS/5% BSA/0.05% Tween 20. All samples were added to FAP-coated plates and incubated for 2 hours at room temperature. Anti-His (C-conc.) detection antibody (mouse AT anti-6xHis, clone 3D5, Invitrogen, UK, #46-0693) was diluted 1:1000 and treated for 1 hour at room temperature. This was followed by treatment with HRP-conjugated anti-mouse Fc antibody (1:1000 in PBS/5% milk, Dako) for 1 hour at room temperature before HRP detection using HRP substrate solution 3.3.5.5'-tetramethylethylenediamine (TMB, Thermo-Fisher ). A stop solution was used to stop the reaction and the developed color was measured at 450 nm on a plate reader. The absorbance at 450 nm was plotted for supernatants with FAP bispecific T cell activator, control bispecific T cell activator, and empty vector, demonstrating the specific binding of FAP bispecific T cell activator to FAP protein. The results obtained (Fig. 13B) demonstrate specific binding of FAP by the bispecific T cell activator, but not by the control bispecific T cell activator, to the recombinant FAP protein.

Assessment of transgene expression using ELISA.

Expression of chemokine or cytokine transgenes, IFN-α, MIP1a, FLT3L, CXCL10, and CXCL9 was assessed using ELISA. Carcinoma cell lines A549 and RT4 were inoculated with 1 h/cell NG615, NG-640, NG-641, NG-617, EnAd or left uninfected for up to 7 days. At 4 days and 7 days after inoculation, cell supernatants were clarified and transgene expression was assessed using ELISA.

IFN-α ELISA was performed using Verikine Human IFN-alpha ELISA Kit (PBL Assay Science), MIP1a ELISA was performed using Quantikine Human CCL3 ELISA Kit (R&D Systems), ELISA ELISA Flt3L was performed using the human Flt3L ELISA kit (Abcam), CXCL9 ELISA was performed with

- 32 044599 using an ELISA kit for human CXCL9 (Abcam); and CXCL10 ELISA were performed using a human CXCL10 ELISA kit (Abcam). All analyzes were performed according to the manufacturer's protocol.

Concentrations of secreted IFN-α, MIPα, FLt3L, CXCL9, and CXCL10 were determined by interpolation from standard curves. The expression of IFN-α, MIP1a and Flt3L can be detected in the cell supernatant from NG-615 treated cells, IFN-α, CXCL9 and CXCL10 can be detected in the supernatant from NG-641 treated cells and CXCL9 and CXCL10 can be detected in the supernatant from treated cells. NG-640 cells (Fig. 4 and 5). Transgenic expression of chemokines or cytokines was not detected in EnAd-treated or untreated control cells.

Assessment of transgene expression using cell-based reporter assays.

Expression of functional FAP-bispecific T-cell activator and IFN-α transgenes was assessed in assays using the Jurkat-Dual reporter cell line (Invivogen). These cells are immortalized human T lymphocyte lineage (Jurkat) cells transformed by stable integration of two inducible reporter constructs. One of these inducible reporter constructs allows us to study the activation of the IFN pathway of interferon regulatory factors (IRFs) based on the secretion and activity of secreted embryonic alkaline phosphatase (SEAP), and the second is an NF-kB-sensitive secreted luciferase reporter activated by signaling through T- cellular receptor. SEAP activity is proportional to the level of IFN present in the supernatant and can be measured by detecting SEAP-induced degradation of the Quanti-Blue™ substrate. Expression of functional MIP1a was assessed using a CCR5 reporter cell line (Cno-Κι CCR5 β-Arrestin, Invivogen). A549 carcinoma cell lines were inoculated with 1 h/cell NG-615, NG-640, NG-641, NG-617, EnAd or left uninfected. At 2, 3, or 4 days postinoculation, cell supernatants were collected and clarified for analysis. To assess IFN-α function, 20 µl of each supernatant, diluted 1:10, 1:50 or 1:250 in culture medium, was added to Jurkat Dual cells (2x105 cells/well) and incubated for 16-20 hours. Supernatants were then collected from the plates and treated with 200 µl Quanti-Blue™ reagent for 1 hour. The plates were analyzed using a microplate reader, measuring absorbance (Abs) at 640 nm. Responses demonstrating the presence of functional IFN-α could be detected in supernatants from NG-615- and NG-641-treated carcinoma cells, but not from NG-640-, NG-617-, EnAd-treated, or uninfected controls (Fig. 6A). The detected level of functional IFN-α was similar in NG-615- and NG-641-treated supernatants.

To assess MIP1α function, CCR5 reporter cells were seeded (5x103 cells/well) and incubated for 20-24 hours. Then, 5 μl of supernatant from the treated tumor cells was added to each well and incubated for 90 minutes. Luciferase reporter activity was then detected using detection and quantitation solution on a fluorescence plate reader. Responses demonstrating the presence of functional MIP1a were detected in supernatants from NG-615-treated carcinoma cells and supernatants from cells treated with a positive control virus known to express MIP1a, NG-347 (Fig. 6B).

To assess FAP bispecific T cell activator function, MRC-5 lung fibroblasts (which express FAP on the cell membrane) were seeded (2x104 cells/well) and incubated for 4 hours to allow cells to adhere to the plates. Jurkat-Dual cells (2x105 cells/well) were then added to the wells along with 20 μl of supernatant from the treated tumor cells. The plates were incubated for 16-20 hours. Supernatants were then collected and treated with 50 μl of Quanti-Luc reagent before directly reading the plates on a plate reader to detect luciferase activity. Responses demonstrating the presence of functional FAP bispecific T cell activator were detected in supernatants from NG-617, NG-615, NG-640 and NG-641 treated carcinoma cells, but not from EnAd-treated or untreated control supernatants (Fig. 7). Surprisingly, given the similar levels of IFN-α produced by NG-615 and NG-641, supernatants from NG-615-treated cells had significantly lower expression levels of functional FAP bispecific activator T cells compared to all other bispecific activator T cell expressions tested. cells by viruses, including another virus containing 4 transgenes, NG-641.

Example 2.

The functional activity of recombinant bispecific T-cell activator proteins was assessed in several different assays prior to the construction of bispecific T-cell activator transgene-carrying EnAd viruses.

Isolation of human peripheral blood mononuclear cells (PBMCs).

Human PBMCs were isolated by density gradient centrifugation from either fresh human blood samples from healthy donors or from buffy cones from whole blood that

- 33 044599 received from NHS Blood and Transplant, UK, Oxford. In all cases, samples were diluted 1:2 in PBS and 25 ml of this mixture was applied to 13 ml of Ficoll (1.079 g/ml, Ficoll-Paque Plus, GE Healthcare) in a 50 ml Falcon tube. Samples were centrifuged (AllegraX-15R, Beckman Coulter) at 1600 rpm for 30 min at 22°C with minimal negative acceleration to maintain phase separation. After centrifugation, 4 layers could be observed, comprising a plasma layer on top, followed by an intermediate layer containing PBMCs, a Ficoll layer, and a layer of red blood cells and granulocytes at the bottom. PBMCs were collected using a Pasteur pipette and washed twice with PBS (1200 rpm for 10 min at room temperature) and resuspended in RPMI medium supplemented with 10% PBS.

Isolation of CD3-positive T cells.

CD3-positive (CD3+) T cells were extracted from PBMCs by depletion of CD3-negative cells using the Pan T Cell Isolation Kit (Miltenyi Biotec, #130-096535) according to the manufacturer's protocol.

Processing of primary ascites samples.

Primary human ascites samples were obtained from the Churchill Hospital (Oxford University Hospital) Oncology Unit from patients with a range of indications including, but not limited to, ovarian, pancreatic, breast and gastric cancer. Once obtained, the cellular and liquid fractions were separated, and aliquots of the liquids were frozen at -20°C for storage and further analysis. The cell fraction was treated with erythrocyte lysis buffer (Roche, #11814389001) to remove erythrocytes, following the manufacturer's instructions. Cell types present in each sample were determined by staining for EpCAM, EGFR, FAP, CD45, CD11b, CD56, CD3, CD4, CD8, PD1 and CTLA4, and analyzed using flow cytometry. The cells were then used fresh for ex vivo T cell activation and target cell lysis experiments. In some cases, cells were subcultured in DMEM supplemented with 10% FBS for use in experiments later.

Maintenance of cell lines.

All cell lines were maintained in DMEM (Sigma-Aldrich, UK) or RPMI (Sigma-Aldrich, UK) medium according to Table 3, supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco™) and 1% (v/v) ) penicillin/streptomycin (10 mg/ml, Sigma-Aldrich, UK), in a humidified incubator (MCO-17AIC, Sanyo) at 37°C and 5% CO ₂ unless otherwise stated. Cells were separated every 2–3 days until confluent by enzymatic digestion with trypsin/EDTA (0.05% trypsin, 0.02% EDTA, Sigma-Aldrich, UK). During this process, the culture medium was aspirated and the cells were washed with 15 ml of PBS, and then the cells were treated with 2 ml of trypsin/EDTA for 2-10 minutes at 37°C. Trypsin was neutralized with 10 ml of DMEM containing 10% FBS, and some of the cells were transferred to new flasks containing fresh medium. For routine cell culture, 10% FBS was added to the medium, for infection and transfection with viral plasmids, 2% FBS was added, and for transfection with plasmids with recombinant bispecific T-cell activator, no FBS was added.

Table 3

Cell line Origin of cells Medium for culture research Source Ascites-derived cell lines Primary human ascites DMEM NHS Blood & Transplant UK BTC100 Human primary lung cancer-associated fibroblasts (CAFs) DMEM Oxford University SNO-K1 Chinese hamster ovary, adhesive RPMI ATSS Stable CHO-K1 cell lines Chinese hamster ovary, adhesive RPMI - DLD1 Adenocarcinoma of the human colon and rectum RPMI ATSS NEK293A Human embryonic kidney, adherent cells DMEM ATSS HEK 293A stable cell lines Human embryonic kidney, adherent cells DMEM - HEK293T Human embryonic kidney, adherent cells DMEM ATSS

- 34 044599

MCF-7 Human mammary cells, breast, adherent DMEM ATSS Normal human dermal fibroblasts (NHDF) Normal adult primary human dermal fibroblasts DMEM ATSS SKOV3 Human ovarian adenocarcinoma DMEM ATSS

Statistics.

When comparing two conditions, statistical analyzes were performed using t tests. In all other cases, statistical analyzes were performed using one-way ANOVA.

Characterization of human T cell activation by recombinant FAP bispecific T cell activator.

The ability of FAP bispecific T cell activator to induce T cell activation in the presence or absence of normal human dermal fibroblasts (NHDF) was compared. Human CD3+ T cells (70,000 cells per well in 96-well U-bottom plates) were co-cultured, alone or with NHDF cells (10:1 T:NHDF), in medium alone or with 300 ng/ml FAP or control bispecific T cell activator. Cells were cocultured for 24 hours at 37°C and then harvested using enzyme-free cell detachment buffer (Thermo, #13151014). Expression levels of CD69 (FIG. 14A) and CD25 (FIG. 14B) on CD45+ T cells were then analyzed using antibody staining and flow cytometry and reported as geometric mean fluorescence intensity (gMFI). Plate-immobilized anti-CD3 antibody (7.5 μg/ml) was used as a positive control for T cell activation. FAP bispecific T cell activator selectively induced the expression of activation markers CD69 and CD25 on T cells, indicating its ability to activate T cells.

In a second similar experiment, T cells were assessed using intracellular cytokine staining 6 hours after coculture with NHDF cells (200,000 CD3+ cells plus 40,000 NHDF per well of a 96-well plate) and 300 ng/ml FAP or bispecific T activator control -cells. Intracellular staining of CD45+ T cells was performed to determine the expression of IFN-γ with brefeldin A added to the culture medium 5 hours before collection. As a positive control, T cells were stimulated with soluble PMA (10 ng/ml) and ionomycin (1 μg/ml). The results presented in Fig. 14C show that FAP bispecific T cell activator in the presence of NHDF produced significantly more IFN-γ expressing T cells compared to the control bispecific T cell activator.

Example 4.

To further evaluate the functionality of IFN-α derived from the transgene in NG-641, Jurkat-Dual™ cells were treated with supernatants from A549 tumor cells, either uninfected or infected with 10 particles per cell (p/cell) of adenotutucirev (EnAd) or NG-641 within 3 days. To demonstrate that SEAP secretion was IFN-α-specific, IFN-α was blocked by incubating IFN-α-specific antibodies with A549 supernatants for 30 minutes before treatment of the Jurkat-Dual reporter cell line—an isotype control antibody was included as a negative control. The data show (Fig. 8A) that the activity of the supernatant from NG-641-treated tumor cells in the Jurkat Dual reporter assay is inhibited by the anti-IFN-α antibody, but not by the isotype control antibody, and is accordingly mediated by IFN-α. Another reporter assay system was used to evaluate the functionality of the CXCL9 and CXCL10 chemokine transgenes in NG-641. This assay used the PathHunter β-Arrestin reporter cell line expressing CXCR3, a receptor for both chemokines (Eurofins). Activation of GPCRs upon binding of CXCL9/10 to CXCR3 expressed by these cells results in the recruitment of rarrestin to the receptor, which is measured using a signal amplification assay based on enzyme fragment complementation (EFC) technology. PathHunter β-Arrestin CXCR3 reporter cells were treated with supernatants from A549 tumor cells uninfected or infected with 10 particles per cell (pcell) of EnAd or NG-641 for 3 days. The concentration of CXCL9/10 in the supernatant is proportional to the luminescence in the assay. To demonstrate that GPCR activation was CXCL9/10 specific, CXCL9 and CXCL10 were blocked by incubating CXCL9/10 specific antibodies with A549 supernatants for 30 min before treating PathHunter cells with β-Arrestin. The data shown in Fig. 8B indicate increased activity of CXCR3 reporter cells in the presence of supernatants from NG-641-treated tumor cells compared to EnAd or uninfected controls, and blocking of this increase by anti-CXCL9/10 antibodies.

As an alternative measure of chemokine functionality, a spo-based assay was used.

- 35 044599 the ability of chemokines to down-regulate cell surface expression of their specific receptors by assessing CXCR3 receptor levels on anti-CD3/CD28 antibody-activated human T cells. A549 tumor cells were either left uninfected or infected with 1 viral particle per cell (h/cell) of enadenotucirev (EnAd) or NG-641 for 7 days, and supernatants were collected. Activated T cells were then treated with supernatants for 30 minutes and CXCR3 levels were measured using flow cytometry; data were presented as a plot of mean fluorescence intensity (MFI). To demonstrate that down-regulation of cell surface CXCR3 was CXCL9/10 specific, CXCL9 and CXCL10 were blocked by incubating CXCL9/10-specific antibodies with supernatants from A549 tumor cells for 30 minutes before treatment of activated T cells. The data presented in Fig. 9 indicate selective down-regulation of CXCR3 expression on both CD4 and CD8 T cells induced by supernatants from NG-641-infected A549 tumor cells, an effect that was reversed by pretreatment with anti-CXCL9/10 antibodies.

Example 5. Functional activity of viruses expressing FAP-bispecific activator of T cells in cultures of human tumor cells ex vivo.

Samples of freshly extracted human tumors from scheduled surgeries, provided by the biobank after full ethical approval, were first minced with scissors and a scalpel, and then single cell suspensions were prepared using GentleMACs tissue dissociator (Miltenyi Biotec). These non-detached cell formulations were found to contain tumor cells, fibroblasts, and various immune cells, including T cells, and were used to evaluate the ability of viruses to infect primary tumor cells, produce their encoded transgenes, and activate tumor-infiltrating T cells. , also present in these cultures. Cells were resuspended in a culture medium consisting of Ham's F-12 medium, GlutaMAX™ Supplement (Gibco), 1x insulin-transferrin-selenaethanolamine (ITS-X) (Gibco), 2.5 mg/ml amphotericin B (Gibco™), 100 U/ml penicillin, 100 mg/ml streptomycin, sodium pyruvate and 10% FBS, and seeded at a density of ~1x10 ⁶ cells/ml in either 96-well plates (final volume 0.25 ml) or 24-well plates (final volume 0.5 ml). They were inoculated with EnAd, NG-615, NG-617, NG-640, or NG-641 at 1000 h/cell or left untreated (UIC). As a positive control for T cell activation, some wells were also stimulated with anti-CD3 and anti-CD28 antibodies, each at a concentration of 2 μμg/ml. Cells were cultured in duplicate wells for 72 hours, then supernatants were collected and the levels of various cytokines produced were measured using fluorescent bead multi-cytokine kits (LEGENDplex™) and a flow cytometer. Three samples of non-small cell lung carcinoma (NSCLC) (T016, T017, T024), one sample of renal cell carcinoma (RCC), and one sample of liver metastases from colorectal cancer (CRC) were tested. Consistent with the transgene expression data in FIG. 4-6, IFN-α was selectively produced in cultures treated with NG615 and NG-641 (Fig. 10A). Flt3 ligand (FLT3L) was readily detected after treatment with NG-615, but only very low levels were detected when treated with other viruses, and the levels reported were similar to those induced by T cell activation with anti-CD3/28 antibody, indicating that Flt3L in NG-615 cultures was a transgenic product. Results for other cytokines showed that, as in the tumor cell line inoculation study described in Example 3 (FIG. 7), inoculation with NG-615 resulted in significantly lower levels of T cell activation compared to other FAP-encoding bispecifics. T-cell activator viruses NG-617, NG-640 and another 4-transgene virus NG-641, as shown for IFN-γ, TNF-α, IL-17, granzyme B and IL-13 in FIG. 10V.

Activation of endogenous tumor T cells in excised NSCLC tumor cell culture was also measured using flow cytometry, assessing the levels of T cell activation markers CD25, CD69 and CD107a, as well as the expression of intracellular cytokines (IFN-γ and TNF-α) and CD4, and CD8 cells after 3 days of culture. As shown in FIG. 11A-D, EnAd had little effect on either markers of activation or cytokine expression, whereas treatment with any of NG617, NG-640, and NG-641 resulted in up-regulation of all of these markers of T cell activation. Similar levels of activation observed for FAP-bispecific T cell activator-carrying viruses are consistent with the findings for cytokines reported above (Fig. 10B).

Example 6.

In this example, the ability of T cells activated by recombinant FAP bispecific T cell activator to induce death of target fibroblast cells was assessed.

FAP bispecific T-cell activator induces T-cell-mediated lysis of FAP-positive cell lines and primary cells.

NHDF (7000 cells) were cocultured with 70,000 T cells in wells of a 96-well U-bottom plate in the presence of medium alone or 300 ng/ml control bispecific T cell activator or FAP bispecific T cell activator. After 24 hours of co-culture, supernatants were collected and cytotoxicity was determined by LDH assay following the manufacturer's instructions. The results in Fig. 15A show that FAP bispecific T cell activator significantly increased lysis of NHDF cells.

In a similar experiment, 7000 primary lung fibroblasts (BTC100) were cocultured with 70,000 CD3+ T cells in the presence or absence of 300 ng/ml control bispecific T cell activator or FAP bispecific T cell activator. After 24 h of co-culture, supernatants were collected and cytotoxicity was determined by LDH assay. The results in Fig. 15B and C show that FAP bispecific T cell activator significantly increased the lysis of primary human cancer associated fibroblasts (CAF). Expression of FAP by these cells and other cell lines from patients is shown in FIG. 16. The dose-response relationship for FAP bispecific T-cell activator-mediated cell lysis was assessed by co-cultivating 8,000 NHDF cells with 40,000 T cells for bispecific T-cell activator concentrations ranging from 2x103 to 2x10-2 ng/mL. After co-culture for 24 hours at 37°C, LDH assay was performed on the supernatants to determine the cytotoxicity of the target cells. Empirical dose-response curves were generated using a four-parameter nonlinear fitting model integrated in GraphPad Prism, yielding an EC ₅₀ value for bispecific T-cell activator FAP of 3.2 ng/mL. The results (FIG. 17A) show a dose-dependent relationship between FAP bispecific T cell activator concentration and cytotoxicity as assessed using the LDH assay (designation: AbS ₄₉₀ ).

Example 7.

Stable FAP-expressing cell lines CHO and Ad293 were generated to demonstrate the FAP antigen specificity of the FAP bispecific T cell activator protein by comparison with parental untransfected cells. Generation of FAP-expressing stably transfected cell lines The protein sequence of the FAP gene was obtained from the NCBI database (SEQ ID 23), reverse transcribed to the DNA coding sequence, which was synthesized at Oxford Genetics Ltd (Oxford, UK). The FAP gene was cloned into the pSFLenti vector using standard cloning techniques, yielding the pSF-Lenti-FAP vector. HEK293T cells were transfected with the indicated FAP lentiviral expression vector along with pSFCMV-HIV-Gag-Pol, pSF-CMV-VSV-G, pSF-CMV-HIV-Rev. Lipofectamine 2000 was used as a transfection reagent; it was added to vector DNA in a DNA:lipofectamine ratio of 1:2 and incubated with cells at 37°C. The supernatant containing lentivirus was collected after 48 hours and mixed with polybrene (final concentration 8 μg/ml). The lentivirus/polybrene mixture was added to seeded Ad293 or CHO cells and incubated at 37°C. On day 4, the supernatant was replaced with medium containing puromycin (2 μg/ml for Ad293 and 7.5 μg/ml for CHO). Stable variants were then subjected to clonal selection, FAP expression from parental cell lines or the stably transfected variant was determined by staining with anti-FAP antibody or isotype control antibody, and analyzed using flow cytometry (FIG. 18A).

FAP bispecific T cell activator-mediated lysis of target cells is specific to FAP-expressing cells.

CHO or CHO-FAP cells (7000 cells) were cocultured, alone or with human T cells (70,000), in the presence of medium alone or 2 μg/ml control bispecific T cell activator or FAP bispecific T cell activator in 96 wells -well plate with a U-shaped bottom. After 24 hours of incubation, supernatants were collected and the cytotoxicity of the target cells was measured using an LDH cytotoxicity assay as described in Example 4 (FIG. 18B). T cell activation was also determined by analyzing CD69 and CD25 expression levels using flow cytometry (FIG. 19). Cytotoxicity was observed only when CHO-FAP cells were cultured with T cells and FAP bispecific T-cell activator. This demonstrates that FAP bispecific T cell activator-mediated T cell activation and target cell lysis is highly specific and limited to FAP-expressing cells and does not affect the FAP-negative parental cell line.

Example 8.

An additional experiment assessed the ability of recombinant bispecific T cell activator protein FAP to activate CD4 or CD8 T cells and the ability of each of these T cell subsets to lyse NHDF cells. CD3+ T cells (35,000) were cocultured with 7000 NHDF cells in the presence of 300 ng/ml control bispecific T cell activator or FAP bispecific T cell activator in the wells of a 96-well U-bottom plate and incubated at 37°C C within 24 hours. Cells were collected and stained with antibodies to CD4 or CD8, and CD69 and CD25, and analyzed using flow cytometry. The results (FIG. 20A) demonstrated that FAP bispecific T cell activator induced increased levels of activation markers CD69 and CD25 on both CD4+ and CD8+ T cells. In a similar experiment, the ability of each subset of T cells (CD4 and CD8) to kill target cells was assessed. CD4+ T cells extragyro

- 37 044599 from purified CD3 cells using positive selection using a CD4 T cell isolation kit (Miltenyi Biotec, #130-045-101) according to the manufacturer's protocol, with CD8 cells in the unisolated flow-through fraction. In wells of a 96-well U-bottom plate, 7000 NHDF were cultured with 35,000 CD4+ or CD8+ T cells and 300 ng/ml control bispecific T cell activator or FAP bispecific T cell activator and incubated at 37°C. After 24 hours, supernatants were collected and the cytotoxicity of the target cells was measured using an LDH cytotoxicity assay. The results (Fig. 20B) show that FAP bispecific T cell activator induced killing of NHDF cells with both CD4+ and CD8+ T cells.

Example 9.

Characterization of FAP bispecific T cell activator-mediated activation of autologous tumor-associated lymphocytes from primary malignant ascites.

To evaluate the activity of bispecific T cell activator proteins using cells from patients with cancer, fluid samples of primary malignant ascites containing both CD3+ T cells and FAP+ cells were obtained for testing. Crude ascites cells (thus unchanged from receipt) were seeded at a density of 250,000 cells per well in a 96-well U-bottom plate in either 100% ascites fluid or medium supplemented with 1% human serum in the presence of 500 ng /ml control bispecific T-cell activator or FAP bispecific T-cell activator. Untreated wells served as negative controls. After incubation at 37°C for 5 days, the total cell population was collected and the number of CD3+ T cells (FIG. 21A) and CD25 expression levels on CD3+ T cells were determined (FIG. 21B). The total number of cells per well was determined using beads for accurate counting. The results show that FAP bispecific T cell activator provided a significant increase in the activation of tumor-associated T cells from patients with cancer.

As a continuation of the experiment described above, the contents of the replicate wells were collected and the number of FAP+ cells was determined using flow cytometry (Fig. 21C). The total number of cells per well was determined using beads for accurate counting. The results show that FAP bispecific T cell activator provided a significant reduction in the number of autologous FAP expressing cells in the ascites sample.

Example 10.

Recombinant bispecific T cell activator-expressing EnAd viruses were constructed, produced and purified using the methods described below.

Preparation of enadenotucirev, which expresses the bispecific T-cell activator.

EnAd is a replication-competent chimeric adenovirus of group B that contains frequent non-homologous nucleotide substitutions from Ad3 to Ad11p in the E2B region, a nearly complete deletion of E3, and a smaller deletion of E4 mapped to E4orf4 (Kuhn et al, Directed evolution generates a novel oncolytic virus for the treatment of colon cancer, PLoS One, 2008 Jun 18; 3(6): e2409).

Plasmid pEnAd2.4 was used to obtain plasmids ppEnAd2.4-CMV-FAP bispecific T-cell activator, pEnAd2.4-SA-FAP bispecific T-cell activator, pEnAd2.4-CMVControl bispecific T-cell activator, pEnAd2.4-SA -Control bispecific T cell activator (Table 4) by direct insertion of a cassette encoding FAP bispecific T cell activator (SEQ ID NO: 1) or control bispecific T cell activator (SEQ ID NO: 3). This transgene cassette contained a short 5' splice acceptor sequence CAGG or exogenous CMV promoter (SEQ ID NO: 24), EpCAM, a FAP cDNA sequence of a bispecific T cell activator or a control bispecific T cell activator and a 3' polyadenylation sequence (SEQ ID NO: 25). Plasmid construction is confirmed by DNA sequencing. The exogenous CMV promoter is constitutively active and, accordingly, leads to early expression of transgenes. The splice acceptor sequence drives expression under the control of the viral core late promoter and leads to late transgene expression after initiation of viral genome replication.

- 38 044599

Table 4

Plasmid ID [plasmid DNA] ng/ml pEnAd2.4-CMV-FAP bispecific T cell activator 1322.8 pEnAd2.4-SA-FAP bispecific T cell activator 3918.3 repAb2.4-SM\/-Control bispecific activator of T-notes 189.1 repAb2.4-5A-Control bispecific T-cell activator 236.2 pEnAd2.4-CMV-FAP bispecific T cell activator -RFP 1599 pEnAd2.4-SA-FAP bispecific T cell activator -RFP 1872 repAb2.4-SM\/-Control bispecific activator of T-caps RFP 1294 repAb2.4-5A-Control bispecific activator of T-caps RFP 2082

Preparation and characterization of the virus.

Plasmids EnAd2.4-CMV-EpCAM bispecific activator of T cells, pEnAd2.4-SA-EpCAM bispecific activator of T cells, pEnAd2.4-CMV-FAP bispecific activator of T cells, pEnAd2.4-SA-FAP bispecific activator of T -cells, pEnAd2.4-CMV-Control bispecific T-cell activator, pEnAd2.4-SA-Control bispecific T-cell activator was linearized by restriction digestion with AscI to obtain a linear viral genome. Digested DNA was purified by isopropanol extraction and precipitated for 16 hours at -20°C in 300 ml >95% molecular grade ethanol and 10 ml 3 M sodium acetate. The precipitated DNA was pelleted by centrifugation at 14,000 rpm for 5 minutes and washed in 500 ml of 70% ethanol, then centrifuged again at 14,000 rpm for 5 minutes. Pure pelleted DNA was air dried and resuspended in 100 μl of water. 6.25 μg of DNA was mixed with 15.6 μl of Lipofectamine transfection reagent in OptiMEM and incubated for 20 min at RT. The transfection mixture was then added to a T-25 flask containing Ad293 cells cultured to 80% confluency. After incubating the cells with the transfection mixture for 4 hours at 37°C in 5% CO2, 4 ml of cell medium (DMEM with high glucose and glutamine, supplemented with 10% FBS) was added to the cells and the flasks were incubated at 37°C, 5 % CO2. Transfected Ad293 cells were monitored every 24 hours and additional medium was added every 48 to 72 hours. Virus production was monitored by the observed significant cytopathic effect (SPE) in the cell monolayer. Following detection of the observed intense CPE, virus was harvested from Ad293 cells through three freeze-thaw cycles. Single virus clones were selected by serial dilution of the collected lysate and reinfection of Ad293 cells, and the contents of wells containing single plaques were collected. Once the infection had reached complete CPE, serial infection of Ad293 cells was performed to amplify stock viral material. The production of viable virus during amplification was confirmed based on the observed significant CPE in the cell monolayer.

Virus purification.

After amplification of the active viral stock, the viruses were purified by double cesium chloride density gradient centrifugation (separation) to obtain viral stock NG-603, NG-604, NG-605 and NG-606. The specified stock material was titrated using the Micro BCA Assay (Life Technologies) following the manufacturer's instructions (Table 5).

- 39 044599

Table 5

ID EnAd NG ID NO: SEQID Viral Genome V.Ch./ML TCIDSO/ml EnAd-CMV-Control bispecific T-cell activator NG-603 1.42607x10 ¹² 5.01χ10 ¹⁰ EnAd-SA-Control bispecific T-cell activator NG-604 3.31073x10 ¹² 2.00x10 ¹¹ EnAd-CMV-FAP bispecific T cell activator NG-605 SEQ ID NO: 26 1.64653x10 ¹² 1.58x10 ¹¹ EnAd-SA-FAP bispecific T cell activator NG-606 SEQ ID NO: 27 1.28148x10 ¹² 3.98x1O ¹⁰ EnAd-CMV-Control bispecific T-cell activator -P2A-RFP NG-607 5,963x10 ¹² 1.26x10 ⁹ EnAd-SA-Control bispecific T cell activator -P2A-RFP NG-608 1.51848x10 ¹² 6.31x10 ⁹ EnAd-CMV-FAP bispecific T cell activator -P2A-RFP NG-609 1.57517x10 ¹² 7.94x10 ⁹ EnAd-SA-FAP bispecific T cell activator-P2A-RFP NG-610 7.74881x10 ¹¹ 5,O1x1O ¹⁰

Example 11.

The activity of viruses NG-601, NG-602, NG-603, NG-604, NG-605 and NG-606 was characterized using the methods described below.

Characterization of the activity of the bispecific T cell activator encoding EnAd compared to EnAd in carcinoma cell lines.

The replication ability of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606, or EnAd was analyzed by infecting A549 lung carcinoma cells and assessed using qPCR. A549 cells were seeded into the wells of a 24-well plate at a density of 2x10 ⁵ cells/well. The plates were incubated for 18 hours, 37°C, 5% CO ₂ , after which the cells were infected with 100 viral particles per cell (h/cell) or left uninfected. Well contents were collected at 24, 48, or 72 h postinfection, and DNA was purified using the PureLink Genomic DNA Purification Mini Kit (Invitrogen) according to the manufacturer's protocol. Total viral genomes were quantified by qPCR for each extracted sample or standard using a hexon EnAd gene-specific primer/probe set added to the reaction mixture detailed in Table 1 . 6. qPCR was carried out according to the program from table. 7.

Table 6

Reagent Volume/well (ml) 2χ qPCRBIO Probe Mix (PCRBiosystems) 10 Direct primer EnAd 0.08 Reverse primer EnAd 0.08 EnAd probe 0.8 NFW 4.04 Sample 5 Well volume 20

Table 7

Number of cycles Temperature (°C) Duration (seconds) 1 95 120 40 95 60-65 5 20-30

Quantification of the number of detected viral genomes per cell demonstrated that replication of all NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 and EnAd viruses was comparable in the A549 cell line (Fig. 22A) . The oncolytic activity of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 or EnAd was assessed by infection with A549 (Fig. 22B). A549 cells were seeded in a 96-well plate at a density of 1.5x104 cells/well. The plates were incubated for 18 hours, 37°C, 5% CO ₂ , after which the cells were infected with increasing amounts of viral

- 40 044599 particles per cell (5-fold serial dilutions, from 4.1 x 10 ^-7 to 5000 viral particles per cell) or left uninfected. A549 cytotoxicity was measured on day 5 using the CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega, #G3582). Empirical dose-response curves were generated using a four-parameter nonlinear fitting model integrated in GraphPad Prism. IC50 values obtained for each virus demonstrated that the oncolytic activities of NG-601, NG-602, NG-603, NG-604, NG-605, NG-606 and EnAd were comparable among all viruses.

Confirmation of transgenic expression of functional bispecific T cell activators with NG-603, NG-604, NG-605, NG-606.

To determine whether the NG-601, NG-602, NG-605, NG-606 viruses produced functional bispecific T cell activators, T cell activation assays were performed using the CHO, CHO-EpCAM, and CHO-FAP cell lines as target cells. 10,000 target cells were co-cultured with 50,000 CD3+ T cells in wells of a 96-well U-bottom plate with Ad293 viral supernatants diluted 100-fold in culture medium and incubated for 24 hours, 37°C, 5% _CO2 . T cells were collected, stained with antibodies specific for CD25 and CD69, and analyzed using flow cytometry. The results (FIGS. 23A and 23B) indicate that the NG-601 and NG-602 viruses expressed a functional bispecific T cell activator transgene that activated T cells when co-cultured with CHO-EpCAM, a NG-605 and NG cells -606 expressed a functional bispecific T cell activator transgene that activated T cells when co-cultured with CHO-FAP cells but not when co-cultured with CHO cells.

Quantification of bispecific T cell activator expression in a colon carcinoma cell line.

The expression level of bispecific T cell activator was assessed during infection with NG-601, NG-602, NG-605, NG-606 cells of the human colon carcinoma line DLD. DLD cells were seeded in 6-well culture plates at a density of 1.2 x 10 ⁶ cells per well. 18 h after plating, DLD cells were infected with EnAd, NG-601, NG-602, NG-603, NG-604, NG-605, NG606 at a rate of 100 h/cell. Cells were cultured for 72 hours, after which supernatants were collected from the wells and centrifuged for 5 minutes at 1200 rpm to remove cell debris. The clarified supernatants were then used for killing assays comparing cytotoxicity to a standard curve obtained for recombinant bispecific T-cell activator at a known concentration, allowing the amount of bispecific T-cell activator to be determined in the viral supernatants. To determine the amount of bispecific T cell activator FAP produced with NG-605 and NG-606, a cytotoxicity assay was performed in which 8,000 NHDF were cocultured with 40,000 CD3+ T cells and viral supernatants from DLD diluted 1 in 103.1 in 10 ⁴ and 1 to 105. A standard curve was constructed by incubating NHDF and CD3+ T cells with FAP bispecific T cell activator or control bispecific T cell activator in 10-fold serial dilutions at concentrations from 3333 to 3.33x10 ^-4 ng/ µl Supernatants were collected 24 hours after treatment and cytotoxicity was measured using the LDH assay. The amount of bispecific T cell activator expressed was determined by comparing the cytotoxicity of viral supernatants with data from a standard curve for recombinant bispecific T cell activator. The results (FIG. 24) indicate that the NG-605 and NG-606 viruses produced 9.8 and 49.2 μg of FAP bispecific T cell activator per million DLD cells, respectively.

Example 12.

Along with the FAP-encoding bispecific T-cell activator or the control bispecific T-cell activator NG-607, NG-608, NG-609, NG-610, the viruses also carry a red fluorescent protein (RFP) transgene for visualizing infected cells using fluorescence microscopy techniques (SEQ ID NO: 20 and 21, Table 4). The functional activity of these viruses was characterized using the methods described below.

Confirmation of transgene expression with NG-607, NG-608, NG-609, NG-610.

The ability of the NG-607, NG-608, NG-609, and NG-610 viruses to produce the bispecific T-cell activator transgene was assessed by infecting Ad293 cells. Ad293 cells were seeded in a 6-well plate at a density of 1x10 ⁶ cells/well. The plates were incubated for 24 hours at 37°C, with 5% CO ₂ , after which the cells were infected with viruses in an amount of 100 h/cell or left uninfected. 48 hours after infection, plaques were irradiated with a fluorescent mercury lamp and photographed (Fig. 18). The results suggest that the NG-607, NG-608, NG-609, and NG-610 viruses express the RFP transgene.

Example 13.

In the next series of experiments, the ability of EnAd and FAP-carrying bispecific T cell activator or control bispecific T cell activator viruses NG-603, NG-604, NG-605, NG-606, NG-607, NG-608, NG-609 was assessed , NG-610 to killing target cells, including tumor cells

- 41 044599 cells and fibroblasts. In the first study, EnAd's ability to kill DLD cells was assessed using xCELLigence technology. DLD cells were seeded into a 48-well E-plate at a density of 1.2 x ^{10 4} cells/well and incubated for 18 hours at 37°C in 5% CO ₂ , after which the cells were infected with 100 h/cell EnAd or left uninfected. XCELLigence was used to measure the cytotoxicity of target cells every 15 minutes over an 8-day incubation period.

A similar experiment assessed the ability of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells in co-culture with SKOV tumor cells and CD3+ T cells using xCELLigence. NHDF cells and SKOV cells were seeded in a 48-well E-plate at a density of 4x10 ³ and 1x10 ³ cells/well, respectively. The plates were incubated for 18 hours, 37°C, 5% CO ₂ , after which the cells were infected with 100 h/cell EnAd, NG-603, NG-604, NG-605 or NG-606 or left uninfected. After 2 hours of incubation, 37,500 CD3+ T cells were added to each well. xCELLigence was used to measure the cytotoxicity of target cells every 15 minutes. The results (Fig. 26A) demonstrate that the FAP bispecific T cell activator expressing viruses NG-605 and NG606, but not EnAd or the control bispecific T cell activator expressing viruses NG-603 and NG-604, were able to induce lysis of NHDF cells, while kinetics depend on the promoter used to express the bispecific T-cell activator (faster when using the CMV promoter).

A similar experiment assessed the ability of NG-603, NG-604, NG-605, NG-606 and EnAd to kill NHDF cells in co-culture with SKOV cells and CD3+ T cells using an LDH cytotoxicity assay. NHDF cells and SKOV cells were seeded in a 96-well U-bottom plate at a density of 8 × 10 ³ and 2 × 10 ³ cells/well, respectively, and either infected with 100 h/cell EnAd, NG-603, NG-604, NG-605, or NG- 606, or were left uninfected. After 2 hours of incubation, 75,000 CD3+ T cells were added to each well and the plates were incubated at 37°C with 5% CO ₂ . Supernatants were collected at 0, 24, 48 and 96 hours after treatment and cytotoxicity was measured using an LDH cytotoxicity assay. The results (FIG. 26B) demonstrate that the FAP bispecific T cell activator expressing viruses NG-605 and NG606, but not the EnAd or control bispecific T cell activator expressing viruses NG-603 and NG-604, were able to induce lysis of NHDF cells. the kinetics depend on the promoter used to express the bispecific T-cell activator.

As a continuation of the LDH experiment described above, cells were also collected at 0, 24, 48, and 96 hours post-treatment, stained with antibodies to CD45, CD69, and CD25, and analyzed using flow cytometry. The results (Fig. 27) demonstrate that the FAP bispecific T cell activator expressing viruses NG-605 and NG-606, but not EnAd or the control bispecific T cell activator expressing viruses NG-603 and NG-604, were able to induce T activation -cells, with the kinetics depending on the promoter used for expression of the bispecific T-cell activator.

A similar experiment assessed the FAP-dependence of the ability to induce FAP bispecific T cell activator-mediated T cell activation. In a 96-well U-bottom plate, SKOV cells were seeded at a density of 2 x 10 ³ cells/well, alone or in combination with NHDF cells at a density of 8 x 10 ³ cells/well. Viral particles were added to each well in an amount of 100 h/cell, and the plates were incubated at 37°C in 5% CO ₂ . After two hours, 75,000 CD3+ T cells were added and the plates were further incubated. At 96 hours postinfection, cells were harvested and stained for CD45 and CD25 and analyzed using flow cytometry (Figure 28A). The results demonstrate that the FAP bispecific T cell activator expressing viruses NG-605 and NG-606 induced T cell activation only in the presence of FAP positive NHDF cells. In a similar experiment, the specificity of promoter-driven (CMV or MLP/SA virus) expression of bispecific T-cell activator in NG-605 and NG-606 was further examined. NHDF cells were seeded in a 96-well U-bottom plate at a density of 4 x 10 ³ cells/well. 100 virus particles were added to each well, and the plates were incubated at 37°C with 5% CO2. After two hours, 40,000 CD3 cells were added and the plates were further incubated. At 72 h postinfection, supernatants were collected and cytotoxicity was measured using an LDH cytotoxicity assay. The results (Fig. 28B) demonstrate that the CMV promoter-driven NG-605 virus, but not the SA promoter-driven NG-606 virus, was able to mediate killing of NHDF cells when infecting NHDF cells alone. The results show that both NG-605 and NG606 were able to induce T cell activation and target cell lysis, although the kinetic profile varied slightly depending on the promoter used.

Time-lapse photography was performed to observe viral or T cell-mediated lysis of target cells by recombinant FAP bispecific T cell activator, EnAd, NG-603, or NG-605. NHDF cells were stained with CellTracker Orange CMTMR (Life Tech, #C2927) and CD3 ⁺ T cells were stained with the CellTrace Violet Cell Proliferation Kit (Life Tech, #C34557) following manufacturer's protocols. Stained NHDFs were seeded in a 24-well plate at a density of

- 42 044599

7.5x103 cells/well in co-culture with ^1.35x104 DLD or SKOV tumor cells. The plates were incubated for 18 hours, 37°C, 5% CO2. Cells were then treated with 300 ng/ml FAP bispecific T cell activator or infected with 100 h/cell EnAd, NG-603, and NG-605; or left unprocessed. After two hours of incubation, 100,000 stained CD3+ T cells were added to the appropriate wells along with 1.5 μM CellEvent Caspase 3-7 reagent (Life Tech, #C10423). Videos were obtained using a Nikon TE 2000-E Eclipse inverted microscope, capturing images every 15 minutes for 96 hours. Stills from the videos are shown in Fig. 29. The results show that recombinant FAP bispecific T cell activator and NG-605, but not EnAd or NG-603, were able to induce rapid lysis of NHDF cells.

In a similar experiment, NHDF cells were stained with CellTracker Green CMFDA (Life Tech, #C2925) and CD3 ⁺ T cells were stained with the CellTrace Violet Cell Proliferation Kit (Life Tech, #C34557) following the manufacturer's protocols. Stained NHDFs were seeded in a 24-well plate at a density of 7.5 x 10 ³ cells/well in co-culture with 1.35 x 10 ⁴ DLD or SKOV tumor cells. The plates were incubated for 18 hours at 37°C with 5% CO ₂ . Cells were then infected with 100 h/cell of NG-607, NG-608, NG-609, or NG-610 or left uninfected. After two hours of incubation, 100,000 stained CD3+ T cells were added to the appropriate wells. Videos were obtained using a Nikon TE 2000-E Eclipse inverted microscope, capturing images every 15 minutes for 96 hours. Stills from the videos are shown in Fig. 30. The results show that all viruses mediate infection in tumor cells (RFP, red fluorescence, positive), but only NG-609 and NG-610 were able to induce rapid lysis of NHDF cells when co-cultured.

Example 14.

In this example, activation of autologous tumor-associated lymphocytes from FAP+ primary malignant ascites from patients with cancer by EnAd, NG-603, NG-604, NG-605 and NG-606 viruses was assessed. Patient samples were considered suitable for further analysis if they contained CD3 ⁺ T cells and FAP ⁺ cells. In the first experiment, crude ascites cells from a patient were plated at a density of 250,000 cells per well of a 96-well U-bottom plate in 100% ascites fluid. Cells were infected with viruses at a rate of 100 h/cell; untreated wells served as a negative control. EnAd-CMV-GFP and EnAd-SA-GFP were also included in the experiment as reporters to determine infection and late-stage viral gene expression, respectively, with photomicrographs. After incubation at 37°C for 5 days, the total cell population was collected and the level of CD25 expression on CD3+ T cells was determined (Fig. 32A). The total number of cells per well was determined using beads for accurate counting. The results demonstrate that the FAP bispecific T cell activator viruses NG-605 and NG-606 provided a significant increase in T cell activation from tumor-associated lymphocytes. As a continuation of the experiment described above, the contents of the replicate wells were collected and the number of endogenous FAP + cells was determined using flow cytometry. The total number of cells per well was determined using beads for accurate counting. The results (Fig. 40B) show that NG-605 and NG-606 provided a significant reduction in the number of autologous FAP-expressing cells in ascites samples, suggesting that some FAP+ cells were killed by activated T cells.

In the second experiment, crude (and therefore unchanged from receipt) ascites cells from a cancer patient were seeded at a density of 250,000 cells per well of a 96-well U-bottom plate in either 100% ascites fluid or medium supplemented with 1% human serum. Cells were infected with viruses at a rate of 100 h/cell; untreated wells served as a negative control. EnAd-CMV-GFP and EnAd-SA-GFP were also included as reporters to detect infection and late-stage viral gene expression, respectively, with photomicrographs. After incubation at 37°C for 5 days, the total cell population was collected and the number of CD3+ T cells (FIG. 33) and the level of CD25 expression on CD3+ T cells were determined (FIG. 34). The total number of cells per well was determined using beads for accurate counting. The results demonstrate that for this patient, recombinant FAP bispecific T cell activator and NG-605, but not NG-606, provided a significant increase in T cell activation from tumor-associated lymphocytes in the medium. None of the viruses resulted in activation in ascites fluid. As a continuation of the experiment described above, the contents of the replicate wells were collected and the number of FAP+ cells was determined using flow cytometry (Figure 35). The total number of cells per well was determined using beads for accurate counting. The results demonstrate that recombinant FAP bispecific T cell activator and NG-605, but not NG-606, provided a significant reduction in the number of autologous FAP-expressing cells in the medium. None of the viruses led to a decrease in the level of FAP+ cells in ascites fluid.

Example 15.

Discussion.

- 43 044599

Oncolytic viruses represent an interesting new strategy for combining multiple therapeutic modalities within a single targeted self-amplifying agent (Keller & Bell, 2016; Seymour & Fisher, 2016). Because they selectively replicate in cancer cells and spread from cell to cell, some oncolytic viruses are thought to mediate cell death through non-apoptotic death pathways (Ingemarsdotter et al., 2010; Li et al., 2013) as part of the process that allows viral particles emerge from dying cells. EnAd, in particular, kills cells through a pro-inflammatory process known as oncosis or ischemic cell death (Dyer, 2017). This non-apoptotic mechanism of death causes the release of several pro-inflammatory cellular components such as ATP, HMGB1, and the effects of calreticulin (known as damage-associated molecular patterns, DAMPs) (Weerasinghe & Buja, 2012), and is believed to be fundamental to the ability of the virus to promote effective anti-cancer immune response. Moreover, along with the consequences of direct lysis, viruses offer the possibility of encoding and expressing other anticancer biological agents, eliminating delivery problems and ensuring that the maximum concentration of the biological agent is achieved in the tumor microenvironment. Imlygic encodes GM-CSF, but the potential weaponization of viruses is virtually limitless and provides many exciting opportunities for the development of multimodal therapeutic strategies with additive or synergistic anticancer effects (de Gruijl et al., 2015; Hermiston & Kuhn, 2002).

Encoding a bispecific T cell activator in oncolytic viruses represents an effective way to activate tumor-infiltrating lymphocytes that become cytotoxic and lyse antigen-positive target cells, providing a therapeutic method completely unrelated to the effects of direct viral lysis. In this study, the authors showed that bispecific T cell activator-targeted cytotoxicity is entirely antigen-specific, can be mediated by both CD4 and CD8 T cells (Brischwein et al, 2006), and can be incorporated into oncolytic adenovirus and expressed only in cells that allow viral replication. In addition, the present study shows for the first time that endogenous T cells in liquid cancer biopsies can be activated by bispecific T cell activator and virus-encoded bispecific T cell activators, and can kill endogenous tumor cells without any additional stimulation or reversal of immune suppression. Importantly, this can even occur in primary fluids that constitute the microenvironment of peritoneal ascites or pleural effusions, as surrogates for the immunosuppressive microenvironment of solid tumors.

Arming oncolytic viruses to express a bispecific T cell activator combines two rather different therapeutic mechanisms, the first of which ensures the lytic death of tumor cells permissive to viral infection, and the second of which provides targeted T cell cytotoxicity through a specific selected antigen. This provides significant flexibility in the design of the therapeutic approach, with the possibility of using a bispecific T cell activator to provide cytotoxicity to tumor-associated cells that are relatively resistant to direct killing by the virus. For example, although the present inventors provide herein an example of a technology using a bispecific T cell activator recognizing carcinoma associated antigen (EpCAM), it is also possible to use a bispecific T cell activator method to target cytotoxicity to tumor-associated fibroblasts or other stromal cells. Thus, even if the targets recognized by a bispecific T-cell activator are not restricted to expression in the tumor microenvironment, coupling bispecific T-cell activator production to viral replication allows bispecific T-cell activator expression to be spatially restricted to the tumor, minimizing systemic toxicity. This is important because bispecific T cell activators administered intravenously exhibit relatively short circulation kinetics (Klinger et al, 2012) and are often associated with significant on-target toxicity outside tumors (Teachey et al, 2013).

The possibility of encoding a bispecific T cell activator in oncolytic viruses was previously explored using an oncolytic vaccinia virus targeting the ephrin A2 bispecific T cell activator. This agent demonstrated the ability to mediate PBMC activation and tumor cell killing by targeting the antigen ephrin-targeted bispecific T cell activator both in vitro and in vivo. Interestingly, this bispecific T cell activator, although capable of activating T cells, did not induce T cell proliferation without the addition of exogenous IL-2, whereas the bispecific T cell activator used in the present study induced extensive proliferation and PBMCs in in vitro, and tumor-associated lymphocytes in clinical biopsy samples ex vivo.

The present inventors believe that the observed differences may reflect differences in the design of the bispecific T cell activator, differences in the oncolytic viruses used, or,

- 44 044599 possibly depend on antigenic density to ensure sufficient levels of CD3 cross-linking on T cells. One of the main goals of oncolytic virus therapy is to elicit an anticancer T-cell response that recognizes patient-specific neoantigens as well as common tumor-associated antigens. Lytic viruses may mediate this response by promoting improved antigen presentation through tumor cell lysis in the context of DAMPs along with virus-associated pathogen-associated molecular patterns (PAMPs). Immunohistochemical staining of resected colon tumors following intravenous delivery of EnAd suggests that the virus promotes robust CD8+ T cell entry into tumor tissue (Garcia-Carbonero, 2017). However, although this approach is potentially very effective, adaptive T cell responses ultimately depend on the expression of MHC class I antigens by tumor cells to allow targeted killing. Loss of MHC expression is a well-described strategy for immune tumor invasion (Garrido et al., 2016). It is noteworthy that both cytotoxic strategies, which directly involve oncolytic viruses armed with a bispecific T-cell activator, act in tumor cells independently of MHC class I and, accordingly, can be used to kill cancer cells even when MHC expression in tumor cells is lost.

The present study accordingly demonstrates that encoding a bispecific T cell activator in EnAd represents a particularly promising strategy for achieving targeted expression in disseminated tumors, exploiting the known blood stability and systemic bioavailability of the virus, which is currently being investigated in a number of early stage clinical trials. phases. Notably, in a study where the virus was administered intravenously several days before resection of primary colon cancer, subsequent immunohistological evaluation of tumor sections showed that the virus had reached areas behind the tumors and provided strong intranuclear hexon signals, indicating successful selective infection and replication of the virus in tumor cells . This supports preclinical data (Di et al., 2014; Illingworth, 2017) indicating that the virus is stable in 100% human blood and should be capable of tumor-targeting infection of disseminated and metastatic malignancies in human patients.

Bispecific T cell activators can be encoded in EnAd without any loss of oncolytic virulence, reflecting the significant packaging capacity of the virus. The presence of the transgene does not affect the physicochemical properties of the viral particles, so the modified viruses should exhibit exactly the same clinical pharmacokinetics as the parent agent and should be able to selectively express the bispecific T cell activator-encoded tumors in tumors throughout the body. This provides a promising and potentially highly effective new approach to systemic targeted anticancer immunotherapy that should now be prioritized for clinical evaluation.

Example 16.

Immunosuppression of human T cell activation and target cell cytotoxicity by malignant exudate fluids from patients.

Malignant exudates represent a potentially immunotolerant environment that suppresses immune responses, as is often observed in patients with advanced metastatic cancer. The amount of IL-10, which is considered an anti-inflammatory cytokine, was measured in normal serum or in fluids of malignant exudates from patients (A: peritoneal ascites; P: pleural effusion) using the Human IL-10 ELISA MAX kit (Biolegend, 430604). IL-10 levels in the exudates (88.1–633.4 pg/mL) were much higher than those measured in normal serum (7.2–10 pg/mL).

The ability of KCD3/CD28 antibody beads (Gibco, 11161D) to activate PBMC T cells in the presence of normal serum, ascites, or pleural fluid was tested. Human PBMC T cells (100,000 cells per well of a 96-well plate) were treated with CD3/CD28 beads (following manufacturer's instructions) in normal serum or patient exudate fluid (50%). As a negative control, T cells were left untreated in each fluid. After 24 hours of culture, cells were harvested and the expression levels of CD69 and CD25 on CD3+ T cells were analyzed using antibody staining and flow cytometry, reporting the result as the percentage of double positive cells (CD69+CD25+ cells). In normal serum, anti-CD3/CD28 beads produced approximately 60% double positive T cells for CD25 and CD69, with the presence of ascites fluid attenuating T cell activation in 6/12 fluids. In a similar experiment, 100,000 T cells were treated with CD3/CD28 beads in the presence of normal serum, ascites, or pleural fluid (50%). Antibodies against CD107a or isotype control antibody were added directly to the culture medium. After 1 hour, monensin (BD Golgistop, BD Biosciences) was added according to the manufacturer's instructions. After another 5 hours, cells were harvested and analyzed using flow cytometry to determine degranulation. In normal serum, anti-CD3/CD28 beads degranulated approximately 22.5% of T cells, while the presence of ascites fluid attenuated activation.

T cells in 10/12 fluids. The level of degranulation was significantly correlated (Pearson's coefficient, r = 0.7645; p = 0.0038) with the amount of IL-10 in each fluid.

In a similar experiment, 75,000 T cells were co-cultured with 15,000 SKOV3 and EpCAM in the presence of normal serum, ascites or pleural fluid (50%). As a negative control, T cells in each fluid were treated with a bispecific T cell activator control. After 24 hours of culture, cells were harvested and the expression levels of CD69 and CD25 on CD3+ T cells were analyzed using antibody staining and flow cytometry, reporting the result as the percentage of double positive cells (CD69+CD25+ cells). In normal serum, EpCAM bispecific T cell activator produced approximately 67.6% CD25 and CD69 double positive T cells, while the presence of ascites fluid attenuated T cell activation in 0/12 fluids and slightly induced activation in 4/10 fluids.

In a similar experiment, 75,000 T cells were co-cultured with 15,000 SKOV3 and EpCAM in the presence of normal serum, ascites or pleural fluid (50%). As a negative control, T cells in each fluid were treated with a bispecific T cell activator control. Anti-CD107a antibody or isotype control antibody was added directly to the culture medium. After 1 hour, monensin (BD Golgistop, BD Biosciences) was added according to the manufacturer's instructions. After another 5 hours, cells were harvested and analyzed using flow cytometry to determine degranulation. In normal EpCAM serum, bispecific T cell activators degranulated approximately 41.4% of T cells, while the presence of ascites fluid attenuated T cell activation in 2/12 fluids.

The ability of EnAd-SA-EpCAM bispecific T-cell activator and EnAd-SA-Control bispecific T-cell activator to induce T-cell-mediated lysis of target cells in malignant exudate fluids was assessed using xCELLigence technology. SKOV cells were seeded in 48-well E-plates at a density of 1e4 cells/well, respectively. The plates were incubated for 18 hours at 37°C with 5% CO ₂ , after which the cells were either infected with 100 viral particles per cell (p/cell) or left uninfected. Two hours later, PBMC T cells were added (5:1) in normal serum or patient exudate fluid (50% final volume). xCELLigence was used to measure the cytotoxicity of target cells every 10 minutes. The results show that bispecific T cell activator-mediated lysis of SKOV3 by T cells is independent of the fluid used.

Crude ascites cells (respectively, unchanged from the moment of receipt) are seeded at a density of 100,000 cells per well of a flat-bottomed 96-well plate in RPMI medium or ascites fluid. Cells were treated with EpCAM or a bispecific T cell activator control, and untreated wells served as a negative control. After incubation at 37C for 24 hours, cells were collected and the expression level of CD25 and CD69 on CD3 cells was determined. The results demonstrate that EpCAM bispecific T-cell activator provided a significant increase in T-cell activation (CD69/CD25 double positive) from tumor-associated lymphocytes, which was slightly enhanced by ascites fluid. In a similar experiment, crude ascites cells (thus unchanged since receipt) are seeded at a density of 100,000 cells per well of a flat-bottomed 96-well plate in RPMI medium or ascites fluid. Cells were treated with EpCAM, bispecific T cell activator control, or recombinant bispecific T cell activator viruses (100 i.p./cell), and untreated wells served as negative controls. After incubation at 37C for 5 days, the total cell population was collected, the number of CD3+ cells, the level of CD25 expression on CD3 cells and the number of endogenous EpCaM positive cells were determined using flow cytometry. The total number of cells per well was determined using beads for accurate counting. The results demonstrate that EpCAM bispecific T-cell activator and EnAd, expressing EpCAM bispecific T-cell activator, provided a significant increase in T-cell activation (CD3, CD25 counts) from tumor-associated lymphocytes and cytotoxicity of EpCAM+ cells in both RPMI medium and ascites fluid . As a continuation of the experiment described above, six more patient exudate samples (7 in total) were processed identically in ascites fluid and CD3+ cell counts, CD25 T cell expression, and EpCAM+ cell counts were determined using flow cytometry. Results show that EpCAM bispecific T-cell activator and EnAd expressing EpCAM bispecific T-cell activator provided significant increases in T cell activation (CD3, CD25 counts) from tumor-associated lymphocytes and cytotoxicity of EpCAM+ cells in a reproducible manner in a range of exudate biopsies. .

Example 17.

FAP bispecific T cell activators mediate T cell activation and killing of FAP+ cells by various donor T cells.

In other experiments, the methods described in Example 2 were used to further evaluate the T cell activating properties of the recombinant FAP bispecific T cell activator protein.

- 46 044599 tested in co-cultures of NHDF and T cells, compared to control bispecific T cell activator and polyclonal T cell activation using Dynabeads with anti-CD3/CD28 antibodies. Supernatants obtained after 24 hours of culture were tested using an IFN-γ ELISA (Fig. 36A) and a microbead chip cytokine assay (LEGENDplex Human T Helper Cytokine Panel, BioLegend #74001) for a cytokine panel (Fig. 36B ). The control bispecific T cell activator did not induce a significant change in the level of any cytokine, but the FAP bispecific T cell activator caused a marked increase in the levels of interferon gamma, IL-2, TNF-α, IL-17 and IL-10, according to stimulation of different T cell subsets, and IFN-γ production was significantly higher compared to that triggered by anti-CD3/CD28 antibodies.

FAP stimulation of bispecific T cell activator, but not control bispecific T cell activator, in the presence of NHDF cells also induced rapid degranulation (within 6 h) of T cells in both CD4+ and CD8+ subsets, as assessed by CD107a/LAMP1 surface externalization T cells (determined using flow cytometry), which strongly correlates with their ability to kill target cells (Fig. 36A and B). This induction of bispecific T cell activator FAP degranulation translated into potent fibroblast lysis as assessed using an LDH release assay after 24 hours of co-culture with PBMC T cells (EC ₅₀ ~2.5 ng/ml), with induced T cell activation and observed cytotoxicity using T cells from 6/6 donors. The control bispecific T cell activator did not induce cytotoxicity, consistent with T cells remaining in an unactivated state.

Example 18.

Effect of FAP bispecific T cell activator and EnAd-FAP bispecific T cell activator viruses on cells in primary malignant ascites samples from different cancer patients.

Continuing the studies described in Example 16, fresh primary malignant peritoneal ascites was obtained from additional cancer patients to study the activity of the EnAd FAP bispecific T cell activator virus. Three patient samples containing both tumor EpCAM ⁺ cells and FAP + fibroblasts were expanded ex vivo, and mixed (adherent) cell populations were cultured with PBMC-derived T cells and unmodified or bispecific T-cell activator-expressing EnAd viruses. After 72 hours, all cells were collected and the number of FAP+ (FIG. 38A) and EpCAM ⁺ cells (FIG. 38B) was determined using flow cytometry. In addition, T cell activation status (as measured by CD25 expression) was measured (FIG. 38C). Infection with both EnAd-CMV-FAP bispecific T-cell activator and EnAd-SA-FAP bispecific T-cell activator induced T cell activation and depletion of FAP+ cells in all patient samples, without significantly changing the levels of tumor EpCAM+ cells. Parental EnAd or control viruses did not induce observable T cell activation, and the number of FAP + cells remained similar to that of uninfected controls.

Importantly, this depletion of FAP+ fibroblasts consistently resulted in a marked reduction in the levels of the immunosuppressive cytokine TGF-β detected in the supernatants (FIG. 38D).

In a second set of experiments, the total (and crude) cell population from five biopsy samples from patients was assessed to assess the activity of endogenous tumor-associated T cells in the samples. Cells were seeded in 50% ascites fluid and treated with proteins, recombinant control bispecific T-cell activator or FAP bispecific T-cell activator, or 100 vp/cell EnAd or EnAd-bispecific T-cell activator viruses. After 5 days of incubation, T cell activation (as measured by CD25 expression) and the number of remaining FAP+ cells were measured using flow cytometry (FIG. 39A and B). In all 3 patient samples, recombinant FAP bispecific T cell activator and EnAd-CMV-FAP bispecific T cell activator induced robust T cell activation, with up to ~80% of patient T cells activated, causing significant depletion of FAP+ fibroblasts. Interestingly, EnAd-SA-FAP bispecific activator of T cells induced CD25 expression in 2/3 of samples with no observable activation or depletion of FAP+ cells in patient 1. This may be due to insufficient production of bispecific activator protein for virus infection T cells by the number of tumor cells present (no EpCAM ⁺ tumor cells were detected in this sample by flow cytometry), consistent with the tumor cell requirement for MLP (SA) driven transgene expression (this also presumably explains the lack of T cell activation and T cell depletion FAP+ cells using the EnAd-SA-FAP-bispecific T cell activator virus in the patient ascites sample shown in Figures 42-44). Taken together, these data demonstrate that EnAd expressing the FAP bispecific T cell activator is capable of, following infection of tumor cells, reproducibly leading to the activation of tumor-associated T cells to kill endogenous fibroblasts. Another experiment explored the possibility of improving

- 47 044599 terminating FAP bispecific activator T cell activity by blocking the PD-1 checkpoint using a biopsy sample from a patient that contained 73.6% PD-1 positive T cells and 62.9% PDL1 positive FAP+ cells (Fig. .40A). Co-cultures similar to those described above were established in the presence or absence of purified anti-human PDL1 mouse IgG2b blocking antibody (BioLegend, clone 29E.2A3) at a final concentration of 2.5 μg/ml. After 2 days of culture, all cells were collected and the number of remaining FAP + cells and T cell activation were measured. Inclusion of an anti-PDL1 blocking antibody resulted in a modest increase in CD25 induction (Figure 40B) and twofold higher IFN-γ production (Figure 40C), with no change in depletion in FAP+ cells (Figure 40D) with almost complete lysis by day 2 in all options of conditions. Tumor-associated lymphocytes (TALs) isolated from ascites from a patient with ovarian cancer are reported to have increased PD-1 expression and impaired effector functions, including cytotoxicity and IFN-γ production. Consistent with this, PD-1 expression was 2-fold higher on CD3+ cells from six ascites biopsies from patients with cancer compared with levels in peripheral blood mononuclear cells (PBMCs) from three healthy donors (FIG. 41A). To assess T cell functionality in these cancer biopsy samples, NHDF cells and crude PBMCs or ascites cells (% CD3+ cells for each sample are shown in FIG. 41B) were co-cultured with control bispecific T cell activator or FAP bispecific T cell activator. supernatants, supernatants were collected after 5 days and tested for IFN-γ using an ELISA (Fig. 41C). The control bispecific T cell activator did not induce IFN-γ. Three of the ascites cell samples produced IFN-γ at levels similar to those of the PBMC samples, and the remaining three had an attenuated response to the bispecific T-cell activator FAP. We further examined the ability of these T cells to induce bispecific T cell activator-mediated lysis of NHDF cells. NHDFs were plated, PBMCs or ascites cells were added along with bispecific T-cell activator-containing supernatants, and cell viability in culture was monitored in real time using the xCELLigence Cytotoxicity Assay System. Despite the variability in IFN-γ production, all ascites samples induced complete cytotoxicity of NHDF cells when supplemented with FAP bispecific T cell activator, with an overall rate of bispecific T cell activator-mediated NHDF lysis similar to that observed with PBMC-mediated lysis (FIG. 41D).

To examine the ability of FAP bispecific T cell activator to mediate T cell activation in the presence of malignant exudate samples from patients (all at 50%), PBMC T cells were activated with control bispecific T cell activator or FAP bispecific T cell activator in the presence of cells. NHDF, or activated anti-CD3/CD28 Dynabeads, in either 50% normal human serum (NS) or different (cell-free) malignant exudate samples. While 74% of T cells in normal serum were activated (CD25 and CD69 double positive cells) 24 hours after stimulation with anti-CD3/CD28 beads, 3/5 of the ascites fluids tested significantly attenuated T cell activation compared with response in NS (Fig. 42A). However, when PBMCs were cultured with NHDF and bispecific T cell activator stimulated with FAP, there was no observable suppression of T cell activation in the presence of any fluid exudates (Figure 42B), demonstrating the ability of FAP bispecific T cell activator to overcome immunosuppressive mechanisms for T cell activation. .

Example 19.

EnAd-FAP bispecific T cell activator-mediated oncolysis and T cell stimulation polarize CD11b+ TAMs in patient ascites toward a more activated phenotype.

To investigate whether the production of Th1 cytokines, including IFN-γ, TNF-α, and IL2, by FAP-mediated bispecific T-cell activator T-cell activation with subsequent elimination of FAP+ fibroblasts (and associated reduction in TGF-β1) was associated with other shifts in the tumor microenvironment from immunosuppressive and protumorigenic activity to antitumor activity, the effect on tumor-associated macrophages (TAMs) in an undivided ascites cell sample was assessed. The patient's total population of crude ascites cells was seeded in 50% ascites fluid and treated with free control bispecific T cell activator or FAP bispecific T cell activator, or infected with EnAd-SA control bispecific T cell activator or EnAd-SA-FAP bispecific T cell activator virus (amount 100 w.p./cell). In parallel, some cells were treated with IFN-γ to induce a CD11b-activated myeloid cell phenotype. After 3 days of incubation, T cell activation status was first measured; CD25+ cells were counted using flow cytometry and IFN-γ secretion using ELISA. When treated with FAP bispecific T cell activator and EnAd-SA-FAP bispecific T cell activator in the culture supernatants, up to approximately 60% of CD3+ T cells became CD25+ (Fig. 43A) and significant numbers were observed.

- 48 044599 va IFN-γ (Fig. 43B). There was no increase in CD25 or IFN-γ expression relative to background values when using the control bispecific T-cell activator or the control virus. To assess TAM polarization, expression levels of CD64 and CD86 (M1, or activated macrophage markers) and CD206 and CD163 (M2, or TAM markers) were measured on CD11b+ cells using flow cytometry (Figure 43C). Treatment with free FAP bispecific T cell activator or EnAd expressing FAP bispecific T cell activator induces a more activated phenotype, manifested by a significant increase in CD64 expression and a marked decrease in CD206 and CD163 - similar to that observed when IFN-γ is added to cultures. Although treatment with free FAP bispecific T cell activator or control virus did not induce a clear change in CD86 relative to background values in this experiment, EnAd expressing FAP bispecific T cell activator induced a significant increase in CD86 expression, indicating that EnAd virus infection and activity Bispecific T cell activator FAPs may act synergistically to activate primary myeloid cells in suppressive tumor microenvironments, such as in the malignant ascites fluid samples tested in the studies described. In this study, IFN-γ treatment induced a modest decrease in CD86 levels, indicating that the marked increase in CD86 levels observed with EnAd-SA-FAP bispecific T cell activator may be due to an IFN-γ-independent mechanism.

Example 20.

EnAd-FAP bispecific T cell activator activates tumor-infiltrating lymphocytes and induces cytotoxicity in ex vivo solid prostate tumor biopsies.

Tissue section cultures represent one of the most realistic preclinical models for a variety of tissues, organs, and tumors. To evaluate the activity of FAP-expressing bispecific T-cell activator viruses in these clinically highly relevant conditions, several paired puncture biopsies of malignant and benign prostate tissue from resected human prostate glands were studied. The initial screen showed that prostate tissue reproducibly contained round rings of EpCAM+ tumor cells (FIG. 44A) interspersed with large areas of stroma that contained scattered CD8 T cells (FIG. 44B). FAP staining was detected on fibroblasts adjacent to tumor areas (Figure 44C). Biopsies were cut with a vibratome to a thickness of 300 µm and section cultures were formed in the presence of the virus (1.5e9 w.p./section) or the cultures were left uninfected. After 7 days, sections were fixed, embedded in paraffin, slides were prepared, and T cell activation status was assessed by immunohistochemistry (IHC) by staining for CD25 expression (FIG. 44D). Only samples treated with EnAd-CMV-FAP bispecific T-cell activator or EnAd-SA-FAP bispecific T-cell activator showed activation of tumor-infiltrating T cells as evidenced by strong CD25 staining. Neither untreated nor control virus-treated preparations contained detectable CD25-positive cells. Supernatants from these section cultures, taken at days 4 and 7 postinfection, were tested for IFN-γ and IL-2 using ELISA, and increased levels of IFN-γ were detected in supernatants from malignant, but not benign, prostate section cultures. , infected with any virus with FAP bispecific T-cell activator (Fig. 44E), and IL2 in cultures with EnAd-SA-FAP bispecific T-cell activator virus (Fig. 44F). EnAd-SA-FAP bispecific T-cell activator induced the production of greater amounts of IFN-γ, which were detected earlier than when using the CMV promoter-driven FAP bispecific T-cell activator.

Example 21.

Additional EnAd viruses expressing FAP bispecific T cell activator.

Five viruses were obtained (NG-611, NG-612, NG-613, NG-614, NG-617), which encode a single bispecific activator of T cells (Table 8).

- 49 044599

Table 8

Virus ID Transgene cassette NG-612 (SEQIDNO: 78 SSA ¹ -FAP bispecific T cell activator ⁵ -His ³ -PA ⁴ NG-613 (SEQ ID NO: 79) SA ⁶ -FAP bispecific T cell activator ⁵ -His ³ -PA ⁴ NG-614(SEQ ID NO: 73) SA ⁶ -FAP bispecific T cell activator ⁷ -His ³ -PA ⁴ NG-617 (SEQ ID NO: 81) SSA ¹ -FAP bispecific T cell activator ⁵ -PA ⁴

In each transgene cassette, cDNA encoding a bispecific T cell activator was flanked at the 5' end by either a short splice acceptor sequence (SSA, CAGG) or a longer splice acceptor sequence (SA, SEQ ID NO: 45). At the 3' end of the bispecific T cell activator, the late poly(A) sequence of SV40 (PA, SEQ ID NO: 54) was encoded, preceded by a histidine tag (HIS), or the tag was absent. Viruses NG-611, NG-612, NG-613, and NG-617 used a single-chain variant of the mouse anti-human CD3ε monoclonal antibody OKT3 in the anti-CD3 portion of the bispecific T-cell activator molecule.

Getting the virus.

Plasmid pEnAd2.4 was used to produce plasmids pNG-611, pNG-612, pNG-613, pNG-614 and pNG-617 by direct insertion of the synthesized transgene cassettes (SEQ ID NO: 70-7'4, respectively). Transgene cassettes pNG-612, pNG-613 and pNG-617 encode the FAP-targeting bispecific T cell activator of SEQ ID NO. 75, and the transgene cassette pNG-614 encodes the FAP-targeting bispecific T cell activator of SEQ ID NO. 76. Schematic representations of transgene cassettes are shown in FIG. 45A-C. The construction of plasmid DNA was confirmed using restriction analysis and DNA sequencing.

The indicated plasmids, pNG-611, pNG-612, pNG-613, pNG-614 and pNG-617, were linearized by restriction digestion with AscI to obtain viral genomes. Viruses were amplified and purified according to the methods described below. Digested DNA was purified by phenol-chloroform extraction and precipitated for 16 hours at -20°C in 300 ml >95% molecular grade ethanol and 10 ml 3 M sodium acetate. The precipitated DNA was pelleted by centrifugation at 14,000 rpm for 5 minutes and washed with 500 ml of 70% ethanol, then centrifuged again at 14,000 rpm for 5 minutes. Clean pelleted DNA was air dried, resuspended in 500 ml OptiMEM containing 15 ml Lipofectamine transfection reagent, and incubated for 30 min at RT. The transfection mixture was then added dropwise to a T-25 flask containing 293 cells cultured to 70% confluency. After incubating the cells with the transfection mixture for 2 hours at 37°C, 5% CO ₂ , 4 ml of cell medium (DMEM with high glucose and glutamine, supplemented with 2% FBS) was added to the cells and the flasks were incubated at 37°C , 5% CO ₂ .

Transfected 293 cells were monitored every 24 hours and additional medium was added every 48-72 hours. Virus production was monitored by the observed significant cytopathic effect (SPE) in the cell monolayer. Once the observed intense CPE was observed, virus was harvested from 293 cells using three freeze-thaw cycles. The collected viruses were used to reinfect 293 cells to amplify stock viral material. The production of viable virus during amplification was confirmed based on the observed significant CPE in the cell monolayer. Once the observed CPE was detected, virus was harvested from 293 cells using three freeze-thaw cycles. The amplified viral stock material was used for further amplification, after which the viruses were purified by double cesium chloride separation to obtain purified viral stock material.

Assessment of virus activity using qPCR.

A549 cells that were either infected for 72 h with 1 h/cell of NG-611, NG-612, NG-617, ENadenotucir, or left uninfected were used for quantification of viral DNAs using qPCR. Cell supernatants were collected and clarified by centrifugation for 5 minutes at 1200 rpm. DNA was extracted from 45 μl of supernatant using the Qiagen DNeasy kit according to the manufacturer's protocol. A standard curve was also generated using enadenotucirev viral particles (2.5e10-2.5e5 w.p.) and extraction was performed using the DNeasy kit. Each extracted sample or standard was analyzed by qPCR using a viral gene-specific primer/probe targeting the E3 early gene.

- 50 044599

Quantification of the number of detected viral genomes per cell demonstrated that significant genome replication of NG-611, NG-612 and NG-617 was observed in the A549 cell lines (Fig. 45D). This result was similar for all viruses tested, including the parental enadenotucir virus, indicating that inclusion of the bispecific T cell activator transgene does not affect the replicative activity of the virus. No viral genomes were detected in uninfected cells (data not shown).

T cell activation and degranulation mediated by bispecific T cell activator expressing viruses.

Infection of carcinoma cells.

A549 cells were seeded in 24-well plates at a density of 2.5e5 cells/well. The plates were incubated for 4 hours at 37°C in 5% CO ₂ , after which the cells were infected with 1 h/cell of NG-611, NG-612, enadenotucirev, or left uninfected. At 24, 48, or 72 h postinfection, cell supernatants were collected, clarified by centrifugation for 5 min at 1,200 rpm, and flash frozen.

T cell analysis.

FAP-expressing lung fibroblast cell lines MRC-5 or EpCam-expressing ovarian carcinoma cell lines SKOV3 were seeded in 48-well plates at a density of 5.7e4 cells/well and 1.2e5 cells/well, respectively. The plates were incubated for 4 hours at 37°C in 5% CO2, after which the medium was replaced with thawed supernatant collected from A549 plates in a volume of 150 μl/well. Purified CD3 T cells isolated from human donor PBMCs were also added to the plates at a 2:1 ratio of T cells to MRC-5 or SKOV3. Co-cultures were incubated for 16 hours at 37°C in 5% CO2, after which cell supernatants were collected for ELISA, and T cells were collected for flow cytometric analysis. The culture medium containing nonadherent cells was removed from the coculture wells and centrifuged (300xg). The supernatant was carefully removed, diluted 1:2 in PBS with 5% BSA and saved for ELISA. Monolayers of adherent cells were washed once with PBS and then detached using trypsin. Trypsin was inactivated with RPMI medium with 10% FBS, and cells were added to cell pellets obtained from culture supernatants. Cells were centrifuged (300xg), the supernatant was discarded, and the cell pellet was washed with 200 μl of PBS. Cells were centrifuged again and then resuspended in 50 μl of PBS containing Live/Dead Aqua (Life tech) for 15 min at RT. Cells were washed once in FACs buffer before staining with panels of directly conjugated antibodies: anti-CD3, conjugated to AF700; anti-CD25 conjugated to BV421; anti-HLA-DR conjugated to PE/CY5; anti-CD40L conjugated to BV605; anti-CD69 conjugated to PE and anti-CD107a conjugated to FITC. A sample of cells from each coculture variant was also stained with the relevant isotype control antibodies. All stainings were performed in FACs buffer in a total volume of 50 μl/well for 15 minutes at 4°C. Cells were then washed twice with FACs buffer (200 μl) before resuspension in 200 μl FACs buffer and analysis using flow cytometry (Attune).

Positive regulation of T cell activation markers.

Flow cytometric analysis of T cell activation was performed assessing the expression of T cell activation markers CD25, CD69, HLA-DR and CD40L or the T cell degranulation marker CD107a on live single cells. The data obtained showed that when co-cultured with EpCam ⁺ SKOV3 cells, the number of T cells expressing CD25, CD69, HLA-DR, CD40L or CD107a on the cell surface was significantly increased when supernatants with NG-611 were added to the cells compared with supernatants with NG -612, enadenotucir or untreated control supernatants (Fig. 47). Based on the results for all of these markers, supernatants from A549 cells stimulated little activation of T cells after 24 hours of infection, while supernatants from 48 hours after infection stimulated significant activation of T cells according to the results for all markers. The same was observed 72 hours after infection.

When co-cultured with FAP+ MRC-5 cells, the number of T cells expressing CD25, CD69, HLA-DR, CD40L, or CD107a on the cell surface was significantly increased when supernatants with NG-612 were added to the cells compared with supernatants with NG-611, enadenotucir. or untreated control supernatants (Fig. 48). Some T cell activation may also be observed with the NG-611 virus, presumably due to the low but detectable expression of EpCam (~5%) on MRC-5 cell lines, involving the bispecific T cell activator expressed by the NG-611 EpCam virus (Fig. 49). . Judging by the results for all of these markers, supernatants from A549 cells after 24 hours of infection stimulated insignificant activation of T cells, while supernatants obtained 48 hours after infection stimulated significant activation of T cells according to the results for all markers. There was also an upregulation of CD25 and CD69 markers after incubation with supernatants collected 72 hours after infection; however, when using supernatants collected 72 hours after infection, there was

- 51 044599 lower levels of activation markers, HLA-DR, CD40L and CD107a were detected than when using supernatants collected 48 hours after infection. This may be due to high levels of bispecific T cell activator at this later stage of infection, which lead to rapid and potent T cell activation, meaning that effector functions must be measured at time points up to 16 hours after incubation with supernatants.

To detect IFN-γ expression, co-culture supernatants were diluted in assay buffer with 5% BSA/PBS (dilution range from 1:10 to 1:1000) and ELISA was performed using the Quantikine human IFN-γ ELISA kit (R&D Systems) in accordance with the manufacturer's protocol. The concentration of secreted IFN-γ was determined by interpolation from a standard curve. IFN-γ expression can be detected in co-culture supernatants when NG-611 is applied to SKOV3 cells (Fig. 50A) or when NG-611, NG-612 is applied to MRC-5 cells (Fig. 50B).

Example 22.

Immune activation and antitumor efficacy of bispecific T-cell activator-expressing viruses in vivo.

NSG mice humanized with CD34+ hematopoietic stem cells (from Jackson Labs) were subcutaneously implanted with HCT116 tumor cells in both flanks 18 weeks after inoculation. After the tumors reached a size of 80-400 mm ³ , mice were divided into groups of 7 mice so that the distribution of tumor volume was equivalent in each treatment group. Mice were injected intratumorally with either saline, EN, or NG611 at 5 x 10 ⁹ particles per injection, 2 injections per tumor. Tumors were treated on both sides. Tumor volume was measured 3-4 times a week; it was demonstrated that treatment with NG-611 resulted in a significant antitumor response up to 20 days after dosing compared to adenotucirev or untreated controls (Fig. 51a). After 20 days of dosing, one tumor from 4 mice in each group was prepared for flow cytometry, and the remaining tumors were frozen on dry ice.

Flow cytometry.

Tumor samples were mechanically crushed immediately after resection in a small volume of RPMI medium. Then the crushed tumors were passed through a cell sieve with a pore diameter of 70 μm and centrifuged at 300 g for 10 minutes. Cell pellets were resuspended in 100 μl of PBS containing Live/Dead Aqua (Life tech) for 15 min on ice. Cells were washed once in FACs buffer (5% BSA in PBS) before staining with a panel of directly conjugated antibodies: anti-CD8 (RPA-r8, AF700); anti-CD4 (RPA-T4, PE); anti-CD45 (2D1, APC-Fire 750); anti-CD3 (OKT3, PerCP-Cy5.5); anti-CD25 (M-A251, PE-Dazzle 594); against CD69 (FN50, APC); against HLA-DR (L243, BV605); against CD107a (H4A3, FITC). Pooled tumor cell suspensions were also stained with relevant isotype control antibodies. In all cases, staining was performed in FAC buffer in a total volume of 50 μl/well for 20 minutes at 4°C. Cells were washed three times with FACs buffer (200 μl) before resuspension in 200 μl FACs buffer and analysis using flow cytometry (Attune). FACs analysis demonstrated that the ratio of CD8 to CD4 T cells in the tumor was significantly increased in NG-611-treated tumors compared to EN-treated or untreated controls (Fig. 51b).

Example 23.

EnAd viruses coexpressing FAP bispecific T cell activator and immunomodulatory cytokines and chemokines.

Three viruses were obtained (NG-615, NG-640 and NG-641), which encoded FAP bispecific T-cell activator and immunomodulatory proteins (Table 9).

Table 9

Virus ID Transgene cassette NG-615 (SEQ ID NO: 82) SSA ¹ -FAP bispecific T cell activator ² -E2A ³ -Flt3L ⁴ P2A ⁵ -MIP1 a ⁶ -T2A ⁷ -l FNa ⁸ -PA ⁹ NG-640 (SEQ ID NO: 83) SSA ¹ -FAP bispecific T cell activator ² -P2A ⁵ CXCL10 ¹⁰ -T2A ⁷ -CXCL9 ¹¹ -PA ⁶ NG-641 (SEQ ID NO: 84) SSA ¹ -FAP bispecific T cell activator ⁵ -P2A ⁵ CXCL10 ¹⁰ -T2A ⁷ -CXCL9 ¹¹ -E2A ³ -I FNa ⁸ -PA ⁶ NG-615 (SEQ ID NO: 278) SA ¹² -FAP bispecific T cell activator ² -E2A ³ -Flt3L ⁴ P2A ⁵ -MIP1 a ⁶ -T2A ⁷ -l FNa ⁸ -PA ⁹

Getting the virus.

Plasmid pEnAd2.4 was used to produce plasmids pNG-615, pNG-616, pNG-640 and pNG-641 by direct insertion of synthesized transgene cassettes (SEQ ID NO: 93-95, respectively). NG615 and NG-616 contain four transgenes encoding a FAP-targeting bispecific activator

- 52 044599

T cells (SEQ ID NO: 75), Flt3L (SEQ ID NO. 96), MIP1α (SEQ ID NO. 97) and IFN-α (SEQ ID NO. 98). NG-640 and NG-641 encode FAP-targeting bispecific T cell activator (SEQ ID NO. 75), CXCL9 (SEQ ID NO. 99) and CXCL10 (SEQ ID NO. 100), NG-641 also contains a fourth transgene, encoding IFN-α (SEQ ID NO. 98). The construction of plasmid DNA was confirmed using restriction analysis and DNA sequencing. These plasmids, pNG-615, pNG-616, pNG-640 and pNG-641, were linearized by restriction digestion with AscI to obtain viral genomes. Viruses were amplified and purified according to the methods detailed in Example 33.

Assessment of virus activity using qPCR and ELISA for transgenes.

Infection of carcinoma cells.

A549 cells that were infected for 72 h with 1 h/cell NG-615, enadenotucirev, or left uninfected were used for quantification of viral DNA using qPCR and transgene expression analysis using ELISA. Cell supernatants were collected and clarified by centrifugation for 5 minutes at 1200 rpm. 45 μL of the supernatant was used for DNA analysis, and the remaining supernatant was used for ELISA.

qPCR.

DNA was extracted from the supernatant sample using the Qiagen DNeasy kit according to the manufacturer's protocol. A standard curve was also generated using enadenotucirev viral particles (2.5e10-2.5e5 wp) and extraction was performed using the DNeasy kit. Each extracted sample or standard was analyzed by qPCR using a viral gene-specific primer/probe targeting the E3 early gene. Quantification of the number of detected viral genomes per cell demonstrated significant replication of the NG615 genome in the A549 cell lines, at a level similar to that of the parent ENAD virus (FIG. 52). These data indicate that the inclusion of bispecific T-cell activators and three immunomodulatory transgenes does not significantly affect viral replication activity. Viral genomes were not detected in uninfected cells.

ELISA.

IFN-α ELISA was performed using the Verikine Human IFN-α ELISA Kit (PBL Assay Science), MIP1a ELISA was performed using the Quantikine Human CCL3 ELISA Kit (R&D Systems); and Flt3L ELISA were performed using the human Flt3L ELISA kit (Abcam). All analyzes were performed according to the manufacturer's protocol.

Concentrations of secreted IFN-α, MIPa, or FLt3L were determined by interpolation from standard curves. Expression of IFN-α, MIP1a and Flt3 L could be detected in the cell supernatant of NG-615, but not EN or untreated control cells (Fig. 53).

T cell activation and degranulation mediated by bispecific T cell activator expressing viruses.

Infection of carcinoma cells.

A549 cells were seeded in 24-well plates at a density of 2.5e5 cells/well. The plates were incubated for 4 hours at 37°C with 5% CO ₂ , after which the cells were infected with 1 h/cell of NG-612, NG-615, enadenotucirev or left uninfected. At 24, 48, or 72 h postinfection, cell supernatants were collected, clarified by centrifugation for 5 min at 1,200 rpm, and flash frozen.

T cell analysis.

Cells of the FAP-expressing lung fibroblast line MRC-5 were seeded in 48-well plates at a density of 5.7e4 cells/well. The plates were incubated for 4 hours at 37°C, with 5% CO ₂ , after which the medium was replaced with thawed supernatant collected from the A549 plates in a volume of 150 μl/well. Purified CD3 T cells isolated from human donor PBMCs were then also added to the plates, resulting in a T cell to MRC-5 ratio of 2:1. Co-cultures were incubated for 16 hours at 37°C with 5% CO2, after which cell supernatants were collected for ELISA analysis and T cells were collected for flow cytometric analysis according to the methods detailed in Example 29.

Positive regulation of T cell activation markers.

Flow cytometric analysis of T cell activation was assessed by expression of the T cell activation markers CD25, CD69, HLA-DR, and CD40L or the T cell degranulation marker, CD107a, on live single CD3+ cells. These data showed that when co-cultured with FAP+ MRC-5 cells, the number of T cells expressing CD25, CD69, HLA-DR, CD40L, or CD107a was significantly increased when NG-615 or 612 supernatants were added to the cells compared to those treated with EN-615 or 612. untreated control supernatants (Fig. 54).

Secretion of the stimulating cytokine IFN-γ.

To detect IFN-γ expression, co-culture supernatants were diluted in an analytical

- 53 044599 buffer with 5% BSA/PBS (range from 1:10 to 1:1000) and ELISA was performed using the kit

Human IFN gamma Quantikine kit (R&D Systems) in accordance with the manufacturer's protocol. The concentration of secreted IFN-γ was determined by interpolation from a standard curve. Expression

IFN-γ could only be detected in co-culture supernatants using supernatants from A549 infected with NG-612 or NG-615 (Fig. 55).

SEQ ID NO: 95 Transgene cassette for NG-641.

CAGGCCCACCATGGGCTGGAGCTGCATCATCTTGTTCCCTGGTCGCAACTGCTACCGGAGT

CCATTCGGACATCGTCATGACCCAAAGCCCTGACTCGCTCGCTGTGTCACTGGGAGAGCG

GGCGACTATCAACTGCAAATCATCCCAGAGCCTGCTGTATTCACGCAATCAGAAAAACTAC

CTGGCCTGGTATCAGCAGAAGCCGGGCCAGCCTCCCAAGCTGCTGATCTTCTGGGCCTC

CACCCGCGAAAGCGGCGTGCCGGACCGCTTCAGCGGAAGCGGATTCGGAACTGACTTTA

CTCTGACCATTAGCTCCTTGCAGGCGGAGGACGTGGCCGTCTACTACTGCCAGCAGTATT

TCTCCTATCCGCTCACCTTTGGGCAAGGCACCAAGGTGGAGATTAAGGGAGGGGGCGGC

AGCGGGGGAGGCGGCAGCGGCGGCGGGGGATCGCAGGTCCAGCTCGTCCAATCCGGA

GCCGAAGTCAAGAAGCCGGGAGCGTCGGTCAAGGTCAGCTGCAAAACTTCGCGCTACAC

CTTCACTGAGTACACGATCCACTGGGTCCGCCAGGCGCCCGGCCAGCGGCTGGAGTGGA

TCGGCGGGATCAACCCAAACAACGGAATCCCAAATTACAATCAGAAATTTAAAGGGCGGG

TGACTATCACCGTGGATACCTCGGCCTCCACGGCGTACATGGAGCTCTCATCACTCAGAT

CGGAGGACACCGCGGTCTATTACTGCGCCCGCCGCCGGATCGCTTATGGATACGATGAA

GGACATGCGATGGATTACTGGGGCCAGGGCACCCTCGTCACGGTGTCGTCAGGAGGCG

GCGGTTCACAGGTGCAGCTGCAGCAGTCTGGGCTGAACTGGCAAGACCTGGGGCCTCA

GTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGGTACACGATGCACTGGGTA

AAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCCGTGGTTAT

ACTAATTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTACAGACAAATCCTCCAGCA

CAGCCTACATGCAACTGAGCAGCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAA

- 54 044599

GATATTATGATGATCATTACTGCCTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTC

CTCAGGTGGCGGTGGCTCGGGCGGTGGTGGATCTGGTGGCGGCGGATCTGATATCGTG

CTCACTCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACCATGACCTGC

AGTGCCAGCTCAAGTGTAAGTTACATGAACTGGTACCAGCAGAAGTCAGGCACCTCCCCC

AAAAGATGGATTTATGACACATCCAAACTGGCTTCTGGAGTCCCTGCTCACTTCAGGGGCA

GTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCGGCATGGAGGCTGAAGATGCTGCCA

CTTATTACTGCCAGCAGTGGAGTAGTAACCCATTCACGTTCGGCTCGGGGACAAAGTTGG

AAATAAACCGGGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTG

GAGGAGAACCCTGGACCTAATCAAACTGCCATTCTGATTTGCTGCCTTATCTTTCTGACTC

TAAGTGGCATTCAAGGAGTACCTCTCTCTAGAACTGTACGCTGTACCTGCATCAGCATTAG

TAATCAACCTGTTAATCCAAGGTCTTTAGAAAAACTTGAAATTATTCCTGCAAGCCAATTTT

GTCCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAATC

CAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGTCTAAAAGATC

TCCTGGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATC

CTGGACCTAAGAAAAGTGGTGTTCTTTTCCTTGGGCATCATCTTGCTGGTTCTGATTGG

AGTGCAAGGAACCCCAGTAGTGAGAAAGGGTCGCTGTTCCTGCATCAGCACCAACCAAG

GGACTATCCACCTACAATCCTTGAAAGACCTTAAACAATTTGCCCCAAGCCCTTCCTGCGA

GAAAATTGAAATCATTGCTACACTGAAGAATGGAGTTCAAACATGTCTAAACCCAGATTCA

GCAGATGTGAAGGAACTGATTAAAAAGTGGGAGAAACAGGTCAGCCAAAAGAAAAAGCAA

AAGAATGGAAAAAACATCAAAAAAAGAAAGTTCTGAAAGTTCGAAAATCTCAACGTTCTC

GTCAAAAGAAGACTACAGGAAGCGGACAGTGTACTAATTATGCTCTCTTGAAATTGGCTGG

AGATGTTGAGAGCAACCCTGGACCTGCCTTGACCTTTGCTTTACTGGTGGCCCTCCTGGT

GCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTGTGATCTGCCTCAAACCCACAGCCTGGG

TAGCAGGAGGACCTTGATGCTCCTGGCACAGATGAGGAGAATCTCTCTTTTCTCCTGCTT

GAAGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAGGC

TGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCTCTTCAGCACAAAG

GACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACAAATTCTACACTGAACTCTACCAGC

AGCTGAATGACCTGGAAGCCTGTGTGATACAGGGGGTGGGGGTGACAGAGACTCCCCTG

ATGAAGGAGGACTCCATTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGA

AAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCTT

TTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAATAAGCTAGCTTGACTGAC

TGAGATACAGCGTACCTTCAGCTCACAGACATGATAAGATACATTGATGAGTTTGGACAAA

CCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTA

TTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTT

CAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGT

AGTCGTCAGCTAT

Claims (18)

1. Recombinant adenovirus containing the sequence of formula (I): 5'ITR-Bi-Ba-B2-Bx-Bb-By-B3-3'ITR (I) where: B ₁ represents a bond or contains: E1A, E1B or E1A-E1B; BA contains E2B-L1-L2-L3-E2A-L4; B ₂ represents a connection or contains: EZ; B _x represents a DNA link or sequence containing: a restriction site, one or more transgenes; or both the first and the second; BB contains L5; BY contains a transgene cassette containing four transgenes, the genes encoding FAP bispecific activator of T cells, CXCL10, CXCL9 and IFN-α; B ₃ represents a bond or contains: E4. 2. The recombinant adenovirus according to claim 1, wherein said FAP-encoded bispecific T-cell activator contains an anti-CD3 sequence set forth in SEQ ID NO: 5, or a sequence at least 95% identical to that specified, for example, SEQ ID NO: 5. H. Recombinant adenovirus according to claim 1 or 2, characterized in that said FAP- - 55 044599 bispecific T cell activator contains the anti-FAP sequence presented in SEQ ID NO: 9, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO: 9. 4. The recombinant adenovirus according to claim 1, wherein said FAP-encoded bispecific T cell activator contains a sequence selected from SEQ ID NO: 75, 76, or a sequence at least 95% identical to any of these sequences. 5. Recombinant adenovirus according to any one of claims 1 to 4, characterized in that said transgene cassette encodes CXCL10 presented in SEQ ID NO: 100, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO: 100 . 6. Recombinant adenovirus according to any one of claims 1 to 5, characterized in that the specified transgene cassette encodes CXCL9 presented in SEQ ID NO: 99, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO: 99 . 7. Recombinant adenovirus according to any one of claims 1 to 6, characterized in that said transgene cassette encodes IFN-α presented in SEQ ID NO: 98, or a sequence at least 95% identical to the specified one, for example, SEQ ID NO : 98. 8. Recombinant adenovirus according to any one of claims 1 to 7, characterized in that said transgenes are functionally linked. 9. Recombinant adenovirus according to any one of claims 1 to 8, characterized in that said transgenes are separated by 3 different highly efficient self-cleaving peptides. 10. Recombinant adenovirus according to claim 9, characterized in that said self-cleaving peptides are independently selected from E2A, F2A, P2A and T2A. 11. A recombinant adenovirus according to any one of claims 1 to 10, characterized by the following relative order of transgenes from L5 to E4: FAP bispecific T cell activator, CXCL10, CXCL9 and IFN-α, for example, as shown in FIG. 1C. 12. Recombinant adenovirus according to any one of claims 1 to 11, characterized in that said transgene cassette contains a polynucleotide sequence presented in SEQ ID NO: 95, or a polynucleotide encoding the same amino acid sequence, in particular, SEQ ID NO: 95. 13. Recombinant adenovirus according to any one of claims 1 to 12, characterized in that said adenovirus contains SEQ ID NO: 84. 14. Recombinant adenovirus according to any one of claims 1-13, characterized in that said adenovirus is replication-competent. 15. Recombinant adenovirus according to any one of claims 1-14, characterized in that said adenovirus is oncolytic. 16. Recombinant adenovirus according to any one of claims 1 to 15, characterized in that said virus contains hexon and fiber protein from Ad11. 17. Pharmaceutical composition containing a recombinant adenovirus according to any one of claims 1 to 16 and an excipient, diluent or carrier. 18. A method of treating a patient, including administering a recombinant adenovirus according to any of claims 1-16 or a pharmaceutical composition according to claim 17. 19. Use of a recombinant adenovirus according to any one of claims 1 to 16 or a pharmaceutical composition according to claim 17 for the treatment of cancer.