EA043675B1 - HUMAN MONOCLONAL ANTIBODIES AGAINST CD20 - Google Patents

Description

Prerequisites for creating the invention

The CD20 molecule (also called human B lymphocyte differentiation-restricted antigen, or Bp35) is a hydrophobic transmembrane protein with a molecular weight of approximately 35 kDa located on pre-B and mature B lymphocytes (Valentine et al. (1989) J. Biol. Chem. 264( 19): 11282-11287, and Einfield et al (1988) EMBO J. 7(3):711-717). (Protein) CD20 is found on the surface of more than 90% of peripheral blood or lymphoid organ B cells and is expressed during early pre-B cell development and remains until plasma cell differentiation. CD20 is present in both normal B cells and malignant B cells. In particular, CD20 is expressed in more than 90% of non-Hodgkin lymphoma (NHL) B cells (Anderson et al. (1984) Blood 63(6):14241433), but is not found in hematopoietic stem cells, pro-B cells, normal plasma cells or other normal tissues (Tedder et al. (1985) J. Immunol. 135(2) 973-979).

The 85 amino acid carboxy-terminal region of the CD20 protein is located in the cytoplasm. The extent of this region is in contrast to the extent of other B cell-specific surface structures, such as the heavy chains of IgM, IgD and IgG or the α or β chains of class II histocompatibility antigens, which have relatively short intracytoplasmic regions of 3, 3 , 28, 15 16 amino acids, respectively (Komaromy et al. (1983) NAR 11:6775-6785). Of the last 61 terminal amino acids, 21 are acidic residues and only 2 are basic, indicating that this region has a strong negative charge. GenBank no. NP 690605.

It is believed that CD20 may be involved in the regulation of early stage(s) in the processes of activation and differentiation of B cells (Tedder et al. (1986) Eur. J. Immunol. 16:881-887) and may function as a calcium channel (Tedder et al. (1990) J. Cell. Biochem. 14D:195).

Despite uncertainty regarding the actual function of CD20 in promoting B cell proliferation and/or differentiation, it represents an important target for antibody-mediated therapy and for killing B cells involved in cancers and autoimmune disorders. In particular, the expression of CD20 on tumor cells such as NHL makes it an important antibody-mediated therapy target for specifically targeting therapeutic agents against CD20-positive neoplastic cells. However, although the results obtained to date clearly characterize CD20 as a target for immunotherapy, they also show that currently available murine and chimeric antibodies are not ideal chemical agents.

Therefore, there is a need for improved therapeutic antibodies against CD20 effective for the prevention and/or treatment of a number of diseases involving cells expressing CD20.

The essence of the invention

The present invention includes improved antibody medicinal substances for the treatment and/or prevention of diseases associated with cells expressing CD20, including tumor-related diseases and immune diseases, including autoimmune diseases. The antibodies covered by the invention are improved in the sense that they are fully human and are thus less immunogenic in patients.

As exemplified herein, the human antibodies of the invention mediate killing of CD20-expressing B cells through various mechanisms. In one embodiment, the human antibodies of the invention induce complement-dependent cytotoxicity (CDC), for example, at least about 20% of CDC-mediated lysis, preferably, about 30% of CDC-mediated lysis, and more preferably, in approximately 40-50% of cases, CDC-mediated lysis occurs in cells such as chronic B-lymphocytic leukemia (B-CLL) cells. In another embodiment, the human antibodies of the invention induce apoptosis of cells expressing CD20. In another embodiment, the human antibodies of the invention induce homotypic adhesion of cells expressing CD20. In addition, the human antibodies of the invention can induce antibody-dependent cellular cytotoxicity (ADCC) of cells expressing CD20 in the presence of human effector cells (eg, monocytes, mononuclear cells, NK cells and PMNs). In addition, the human antibodies of the invention can induce phagocytosis of cells expressing CD20 in the presence of macrophages. The human monoclonal antibodies of the invention may operate by one or more of these mechanisms. Examples of cells that can be lysed by the antibodies of this invention include, but are not limited to, CD20-expressing B cells, such as tumorigenic B cells and B cells involved in immune diseases. In a specific embodiment of the invention, human antibodies are used to mediate the killing of B lymphocytes in the treatment of lymphoma, B-cell non-Hodgkin lymphoma.

Human antibodies of the invention include IgG1 (eg IgG,K), IgG3 (eg IgG3,K)

- 1 043675 and IgG4 (eg IgG,K) antibodies. However, other antibody isotypes are also covered by the invention, including IgG2, IgM, IgA1, IgA2, secretory IgA, IgD and IgE. Antibodies can be whole antibodies or antigen binding fragments thereof, including, for example, Fab, F(ab') ₂ , Fv, single chain Fv fragments or bispecific antibodies. In addition, antigen binding fragments include chimeric immunoglobulin binding domain fusion proteins comprising (i) a binding domain polypeptide (such as a heavy chain variable region or a light chain variable region), (ii) a CH2 constant region of an immunoglobulin heavy chain fused to a hinge polypeptide region, and (iii) a CH3 constant region of an immunoglobulin heavy chain fused to a CH2 constant region. Such chimeric immunoglobulin binding domain proteins are further described in US patent applications 2003/0118592 and 2003/0133939.

Specific human antibodies of the present invention include the antibodies designated 11B8, 2F2 and 7D8, encoded by human heavy chain and human kappa light chain nucleic acids containing the nucleotide sequences in their variable regions represented by SEQ ID NO: 1, 5 or 9 and SEQ ID NO: 3, 7 or 11, respectively, and conserved sequence modifications thereof. In another embodiment, human antibodies are characterized in that they comprise human heavy chain and human kappa light chain variable regions comprising the amino acid sequences represented by SEQ ID NO: 2, 6 or 10 and SEQ ID NO: 4, 8 or 12, accordingly, and modifications of their conservative sequences.

In yet another embodiment, human antibodies are characterized in that they contain human heavy chain and human kappa light chain variable regions that are at least 90% homologous, preferably at least 95% homologous, and more preferably at least 98% or at least 99% homologous to the amino acid sequences represented by SEQ ID NO: 2 and SEQ ID NO: 4, respectively; SEQ ID NO: 6 and SEQ ID NO: 8, respectively; or SEQ ID NO: 10 and SEQ ID NO: 12, respectively.

Other specific human antibodies of the invention include antibodies that contain a CDR domain having a human heavy and light chain region CDR1, a human heavy and light chain region CDR2, and a human heavy and light chain region CDR3, wherein (a) CDR1, CDR2, and The heavy chain CDR3 regions of human origin comprise an amino acid sequence selected from the group consisting of the amino acid sequences CDR1, CDR2 and CDR3 shown in FIG. 53, 55 or 57 (SEQ ID NOs: 13-15, 19-21 and 25-27), and modifications of conserved sequences thereof, and (b) the CDR1, CDR2 and CDR3 light chain regions of human origin contain an amino acid sequence selected from the group , consisting of the amino acid sequences CDR1, CDR2 and CDR3 shown in FIG. 53, 55 or 57 (SEQ ID NOs: 16-18, 22-24 and 28-30), and modifications of conserved sequences thereof.

Also included in the present invention are antibodies that dissociate from CD20 with an equilibrium dissociation constant (K _D ) of about 1-10 nM or lower. Such antibodies also include antibodies that do not cross-react with related cell surface antigens and thus do not inhibit their function.

In another embodiment, the human anti-CD20 antibodies of the present invention can be characterized by one or more of the following properties:

a) specificity for human CD20;

b) CD20 binding affinity (KD) of about 10 nM or lower, preferably about 5 nM or lower, and more preferably about 1-3 nM or lower, as determined by the binding experiment presented in Example 5 (FIG. 9) according to this description;

c) the dissociation rate constant (kd) of their associate with CD20 is about 10 ^-4 s ^-1 or less, preferably about 10 ^-5 s ^-1 or less, and more preferably about 10 ^-6 s ^-1 as determined by the binding experiment presented in example 5 (Fig. 9) according to this description;

d) the ability to mediate high levels of CDC on either CD55/59 negative or CD55/59 positive cells;

e) the ability to translocate into lipid rafts (lipid rafts) upon binding to CD20;

f) the ability to inhibit the growth of cells expressing CD20;

g) the ability to induce apoptosis of cells expressing CD20;

h) the ability to induce homotypic adhesion of cells expressing CD20;

i) the ability to induce ADCC of cells expressing CD20 in the presence of effector cells;

j) the ability to prolong the survival of a subject having tumor cells expressing CD20;

k) the ability to deplete cells expressing CD20; and/or

- 2 043675

l) the ability to deplete cells expressing low levels of CD20 (CD20 ^low cells).

The human anti-CD20 antibodies of the present invention may be derivatized, bound to, or co-expressed with other binding specificities. In a particular embodiment, the invention includes a bispecific or multispecific molecule comprising at least one first CD20 binding specificity (e.g., a human anti-CD20 antibody or mimetic thereof) and a second human effector cell binding specificity, such as an Fc receptor binding specificity (e.g., a human Fcy receptor, such as FcyRI, or human Fca receptor) or T cell receptor, such as CD3.

Therefore, the present invention includes bispecific and polyspecific molecules that bind to both human CD20 and the Fc receptor, eg CD3. Examples of Fc receptors are, for example, the human IgG receptor, for example the Fc gamma receptor (FcyR), such as FcyRI (CD64), FcyRII (CD32) and FcyRIII (CD16). Other Fc receptors, such as human IgA receptors (eg, FcaRI), can also be targeted. The Fc receptor is preferably located on the surface of an effector cell, for example a monocyte, macrophage or activated mononuclear cell. In a preferred embodiment of the invention, bispecific and monospecific molecules bind to the Fc receptor at a site different from the immunoglobulin Fc receptor binding site (eg, IgG or IgA). Therefore, the binding of bispecific and polyspecific molecules is not blocked by physiological levels of immunoglobulins.

In yet another aspect, the human anti-CD20 antibodies of the invention are derivatized, linked, or coexpressed with another functional molecule, such as a peptide or protein (eg, a Fab' fragment). For example, an antibody of the invention may be operably linked (e.g., by chemical bonding, genetic fusion, non-covalent association, or other means) to one or more other molecular entities, such as another antibody (e.g., to form a bispecific or polyspecific antibody), a cytotoxin, a cellular ligand or antigen (eg, to form an immunoconjugate such as an immunotoxin). The antibody of this invention may be associated with other therapeutic moieties, such as a radioisotope, a small molecule anticancer drug, an anti-inflammatory agent, or an immunosuppressant. Accordingly, the present invention covers a wide range of antibody conjugates, bispecific or polyspecific molecules and chimeric (fusion) proteins, all of which bind to cells expressing CD20, and all of which can be used to target other molecules to such cells.

In yet another aspect, the invention includes compositions, for example, pharmaceutical and diagnostic compositions/kits, containing a pharmaceutically acceptable carrier formulated with a single human monoclonal antibody or a combination of human monoclonal antibodies. In a particular embodiment of the invention, the composition includes a combination of antibodies that bind to different epitopes or that have different functional characteristics, such as CDC-inducing and apoptosis-inducing.

The human antibodies, immunoconjugates, bispecific and polyspecific molecules and compositions of the present invention can be used in various methods to inhibit the growth of CD20 expressing cells and/or kill CD20 expressing cells by contacting the cells with an effective amount of the antibody, immunoconjugate, bispecific/polyspecific molecule or a composition such that cell growth is inhibited and/or the cell dies. In one embodiment, the method includes killing a cell expressing CD20 in the presence of effector cells, for example, by CDC, apoptosis, ADCC, phagocytosis, or a combination of two or more of these mechanisms. Preferably, cells are lysed or inhibited without killing or inhibiting the activity of cells that do not express CD20 but that may, for example, express a structurally related cell surface antigen (i.e., without cross-reactivity with related but functionally distinct cell surface antigens). surface). Cells expressing CD20 that can be inhibited or killed using the human antibodies of the invention include, for example, tumorigenic B cells.

Therefore, the human antibodies of the present invention can be used to treat and/or prevent various diseases involving cells expressing CD20 by administering the antibodies to patients suffering from such diseases. Examples of diseases that can be treated (eg, alleviated) or prevented include, but are not limited to, tumorigenic diseases and immune diseases, such as autoimmune diseases. Examples of tumorigenic diseases that can be treated and/or prevented include B cell lymphoma, such as NHL, including B lymphoblastic leukemia/progenitor cell lymphoma, and mature B cell tumors, such as B cell chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma (SLL), B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, mantle cell lymphoma (MCL), follicular lymphoma (FL), including low-, intermediate- and high-grade FL, cutaneous follicular cell lymphoma centers, B-cell lymphoma

- 3 043675 from marginal zone cells (MALT type, nodular type, splenic type), hairy cell leukemia, diffuse large B-cell lymphoma, Burkitt's lymphoma, plasmacytoma, plasma cell myeloma, post-transplantation lymphoproliferative disorder, Waldenström's macroglobulinemia and anaplastic large cell lymphoma ohm (ALCL ). Examples of immune disorders involving CD20-expressing B cells that can be treated and/or prevented include psoriasis, psoriatic arthritis, dermatitis, systemic scleroderma and multiple sclerosis, inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, respiratory distress syndrome, meningitis, encephalitis, uveitis, glomerulonephritis, eczema, asthma, atherosclerosis, leukocyte adhesion deficiency, multiple sclerosis, Raynaud's syndrome, Sjögren's syndrome, juvenile diabetes, Reiter's disease, Behçet's disease, immune complex nephritis, IgA nephropathy, IgM polyneuropathy, immune thrombocytopenia , such as acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpura, hemolytic anemia, myasthenia gravis, lupus nephritis, systemic lupus erythematosus, rheumatoid arthritis (RA), atopic dermatitis, pemphigus, Graves' disease, Hashimoto's thyroiditis, Wegener's granulomatosis, Omen syndrome on, chronic renal failure, acute infectious mononucleosis, HIV and diseases associated with the herpes virus. Additional examples are severe acute respiratory distress syndrome and choreoretinitis. Other additional examples are diseases and disorders caused by infection of B cells by a virus such as Epstein-Barr virus (EBV).

In a particular embodiment of the invention, the subject to whom the antibody is administered is further treated with a chemotherapeutic agent, radiation, or an agent that modulates, i.e. increases or inhibits the expression or activity of the Fc receptor, Fca receptor or Fcy receptor, such as a cytokine. Typical cytokines to be administered during treatment include granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), interferon-γ (IFN-γ), and tumor necrosis factor (TNF). Typical therapeutic agents include, among others, antineoplastic agents such as doxorubicin, cisplatin, bleomycin, carmustine, chlorambucil and cyclophosphamide.

In yet another aspect, the present invention provides a method for detecting in vitro or in vivo the presence of CD20 in a sample or individually, for example, to diagnose CD20-related diseases, preferably at an early stage. It may also be useful for monitoring disease and treatment response and for determining and adjusting the dose of antibody administered. The in vivo method can be performed using an imaging technique such as PET (positron emission tomography) or SPECT (single photon emission computed tomography). In one embodiment of the invention, imaging is accomplished by contacting a test sample, optionally along with a control sample, with a human monoclonal antibody of the invention under conditions that allow formation of a complex of the antibody and CD20. Complex formation is then detected (eg by FACS analysis or Western blotting). If a control sample is used along with the test sample, the complex is detected in both samples, and any statistically significant difference between samples in complex formation is an indication of the presence of CD20 in the test sample.

In yet another aspect, the invention provides a transgenic non-human animal, such as a transgenic mouse, that expresses human monoclonal antibodies that bind to CD20. In a particular embodiment of the invention, the transgenic non-human animal is a transgenic mouse having a genome comprising a human heavy chain transgene and a human light chain transgene encoding all or a fragment of an antibody of the invention. A transgenic non-human animal can be immunized with a purified or enriched preparation of CD20 antigen and/or cells expressing CD20. Preferably, the transgenic non-human animal, eg, a transgenic mouse, is capable of producing multiple isotypes of human anti-CD20 monoclonal antibodies (eg, IgG, IgA and/or IgM) using V-D-J recombination and isotype switching. Isotype switching can be accomplished using classical or non-classical isotype switching.

Accordingly, in yet another aspect, the invention includes isolated B cells from a transgenic non-human animal described above, for example, a transgenic mouse that expresses human anti-CD20 antibodies. The isolated B cells can then be immortalized by fusion with an immortalized cell to create a source (eg, hybridoma) of human anti-CD20 antibodies. Such hybridomas (ie those that produce human anti-CD20 antibodies) are also within the scope of the present invention.

As shown in the examples herein, human antibodies of the invention can be produced directly from hybridomas that express the antibody, or can be cloned and recombinantly expressed in a host cell (eg, a CHO cell, NS/0 cell or lymphocyte). Other examples of host cells are microorganisms such as E. coli and Gry

- 4 043675 would be, such as yeast. Or they can be produced by recombinant DNA methods in a transgenic non-human animal or plant. Accordingly, in another aspect, the present invention covers methods for producing monoclonal antibodies that bind to human CD20. In one embodiment, the method comprises immunizing a non-human transgenic animal, e.g., a transgenic mouse as previously described (e.g., having a genome containing a human heavy chain transgene and a human light chain transgene encoding all or a fragment thereof of an anti-CD20 antibody ), a purified or enriched preparation of human CD20 antigen and/or cells expressing human CD20. B cells (eg, spleen B cells) from the animal are then obtained and fused with myeloma cells to form immortal hybridoma cells that secrete human monoclonal antibodies against CD20.

In yet another aspect, the invention includes nucleotide molecules encoding human anti-CD20 antibodies (eg, variable regions thereof), as well as recombinant expression vectors that include the nucleic acids of the invention, and host cells transfected using such vectors. Methods for producing antibodies by culturing these host cells are also covered by this invention. The specific nucleic acids of the invention comprise the nucleotide sequences shown by SEQ ID NO: 1, 5 or 9 and SEQ ID NO: 3, 7 or 11, encoding the heavy and light chains, respectively, of the human anti-CD20 antibodies 2F2, 7D8 and 11B8.

Other features and advantages of the present invention will be apparent from the following detailed description and claims.

Brief description of the figures

In fig. 1 shows the pCONγ1f/variable (region)-heavy (chain) vector used for the recombinant production of human monoclonal antibodies 2F2 and 11B8.

In fig. Figure 2 shows the pCONγ1f/variable (region) - heavy (chain) vector used for the recombinant production of 2F2 and 11B8.

In fig. Figure 3 shows the two-gene cloning vector (pCONy1f/k2A2) used for the recombinant production of 2F2 and 11B8.

In fig. 4 shows a graph comparing the flow cytometry-determined binding of human antibodies 2F2, 7D8 and 11B8 to NS/0 cells transfected with Raji, Daudi and CD20 and parental NS/0 cells.

In fig. 5A and 5B show flow cytometry-determined binding of 2F2 to PBMC from three human donors.

In fig. 6 is a graph comparing the binding affinities of ^125I -labeled 2F2 and ^125I -labeled 11B8 to Ramos-EHRB cells.

In fig. 7A and 7B show the binding of ^125I -labeled 2F2 and 125I-labeled 11B8 compared to ^{125I -} labeled rituximab (anti-CD20 chimeric antibody, IDEC) and ^125I -labeled B1 (the term B1 refers to the unlabeled form of Bexxar™, which is a ^131I -labeled murine anti-human CD20 antibody, Coulter) with Ramos-EHRB cells (A) and Daudi cells (B).

In fig. 8 shows a graph comparing the dissociation rates of ^125I -labeled 11B8T, ^125I -labeled 2F2, ^125I -labeled rituximab (RIT), and ^125I -labeled B1.

In fig. Figure 9 shows the dissociation rates of F(ab') ₂ fragments 2F2, 11B8T and rituximab in Ramos-EHRB cells.

In fig. 10A and 10B show CDC (complement dependent cytotoxicity) induced by 2F2, 11B8T, rituximab and isotype control antibody (HuMad-KLH), Daudi cells (A) and SUDHL-4 cells (B) at various time points (functional off-rate), determined by flow cytometry.

In fig. 11A-E show the kinetics of CDC induced by 2F2 and rituximab in various cell lines determined using flow cytometry.

In fig. 12A-D show the kinetics of CDC induced by 2F2 and rituximab in various cell lines as a function of complement concentration (normal human serum (NHS)), at two different antibody concentrations, determined using flow cytometry.

In fig. 13A-D show the concentration-dependent induction of CDC 2F2 and rituximab in various cell lines determined using flow cytometry.

In fig. 14A and D show the concentration-dependent induction of CDC caused by 2F2, 2F2T, 11B8T, B1 and rituximab in Daudi (A) and Raji (B) cells determined using flow cytometry.

In fig. 15A and 15B show graphs comparing CDC (cellular cytotoxicity) of Daudi cells (cells expressing low levels of CD55/59) caused by human monoclonal antibodies 2F2, 7D8 and 11B8T and rituximab; graph (A) shows the percentage lysis of unwashed cells, and graph (B) shows the percentage lysis of cells washed before adding serum.

- 5 043675

In fig. 16A and 16B show graphs comparing CDC of Raji cells (cells expressing high levels of CD55/59) induced by human monoclonal antibodies 2F2, 7D8, 11B8T, B1 and rituximab; graph (A) shows the lysis (percentage) of cells not blocked by antibodies against

CD55 and anti-CD59, and graph (B) shows the percentage of cell lysis blocked by anti-CD55 and anti-CD59 antibodies.

In fig. 17A-C show the role of CD55 and CD59 in CDC induced by 2F2 and rituximab in Raji cells. In fig. (A) shows the percentage of cells lysed upon addition of anti-CD55 antibody; in fig. (B) shows the percentage of cells lysed upon addition of anti-CD59 antibody, and graph (C) shows the percentage of cells lysed upon addition of both anti-CD55 antibody and anti-CD59 antibody.

In fig. 18A-D show the binding of complement factor C1q using 2F2 and rituximab in various cell lines, determined by flow cytometry.

In fig. 19A-D show deposition of complement factor C4c fragment by 2F2 and rituximab in various cell lines as determined by flow cytometry.

In fig. 20 shows the lysis of ARH-77 cells by 2F2, rituximab and 11B8T in the presence of PMN, MNC, plasma or whole blood.

In fig. 21 shows the lysis of B-CLL cells by 2F2, rituximab and 11B8T in the presence of PMN, MNC, plasma or whole blood.

In fig. 22 shows the lysis of HCL (hairy cell leukemia) cells with 2F2, rituximab and 11B8T in the presence of PMN, MNC, plasma or whole blood.

In fig. 23 shows the lysis of B-ALL cells by 2F2, rituximab and 11B8T in the presence of PMN, MNC, plasma or whole blood.

In fig. 24 shows the lysis of follicular lymphoma cells by 2F2, rituximab and 11B8T in the presence of PMN, MNC, plasma or whole blood.

In fig. 25 shows the lysis of lymphoma cells from mantle cells by 2F2, rituximab and 11B8T in the presence of PMN, MNC, plasma or whole blood.

In fig. 26 shows concentration-dependent lysis of ARH-77 cells by 2F2 and rituximab in the presence of whole blood.

In fig. 27 shows MNC-mediated lysis of ARH-77 cells by 2F2, 11B8T and rituximab.

In fig. 28 shows MNC-mediated lysis of Raji cells by 2F2, 11B8T and rituximab.

In fig. 29A, B and D are graphs showing the formation of CD20 clusters in lipid rafts upon incubation with 2F2, 7D8 or 11B8T by FRET analysis and Triton-X insolubility assay.

In fig. Figure 30 shows the formation of CD20 clusters in lipid rafts when incubated with 2F2, rituximab or 11B8T, constructed using FRET analysis.

In fig. 31 shows the ratio of CD20 remaining in the insoluble raft fraction after treatment with Triton-X-100 (TX) and incubation with 2F2, rituximab and 11B8T.

In fig. Figure 32 shows the distribution of CD20 between raft and non-raft membrane fractions when Daudi 2F2 cells are stimulated with rituximab and 11B8T.

In fig. 33A-G show apoptosis of Daudi cells by 2F2, 7D8 and 11B8T determined by flow cytometry.

In fig. 34 shows the induction of apoptosis of Raji cells by 2F2, 11B8T, rituximab or B1, determined by flow cytometry.

In fig. 35A shows the induction of apoptosis of Daudi cells by 2F2, 11B8T, rituximab or B1 as determined by flow cytometry.

In fig. 35B shows early and late stage apoptosis of Daudi cells by 2F2, 11B8T, rituximab or B1 as determined by flow cytometry.

In fig. 36A-E show homotypic adhesion of Ramos-EHRB cells using 2F2, 7D8 and 11B8T determined by optical spectroscopy.

In fig. 37 shows homotypic adhesion of Daudi cells using 2F2, rituximab and B1 determined by optical spectroscopy.

In fig. 38 is a graph showing the survival rate of SCID mice injected with Daudi cells and treated with 2F2 or 7D8.

In fig. 39 is a graph showing the percentage of survival of SCID mice injected with Tanoue cells and treated with 2F2, rituximab or B1.

In fig. 40 shows the survival rate of SCID mice injected with Daudi cells and treated with various concentrations of 2F2 or rituximab.

In fig. 41 shows the survival rate of SCID mice injected with Daudi cells and treated with 11B8T or B1.

In fig. 42 shows bioluminescent imaging of tumor cells in SCID mice on day 39 (day 31 after administration of 10 μg of B1, rituximab, 11B8T. 2F2T or huIgG). Bioluminescence is represented in red (dark areas in the mouse image) (light intensity > 50 photons per 5 min) as an overlap of black and white in the mouse image.

In fig. 43 shows tumor mass in each mouse, quantified by integrating light signals from the body surface on days 25, 32, 39 and 46 after administration, on day 8, 10 μg B1, rituximab, 11B8T. 2F2T or huIgG.

In fig. 44A-C show flow cytometric analysis of CD20+ cells in the peripheral blood of Cynomolgus monkeys after intravenous administration of various doses, 4x1.25 mg/kg (A), 4x6.25 mg/kg (B) or 4x12.50 mg/kg (C). ), - 2F2 or rituximab.

In fig. 45A-C show flow cytometric analysis of CD21+ cells in the peripheral blood of Cynomolgus monkeys after intravenous administration of various doses - 4x1.25 mg/kg (A), 4x6.25 mg/kg (B) or 4x12.50 mg/kg (C) ), - 2F2 or rituximab.

In fig. 46A-C show flow cytometric analysis of CD20+ cells in the lymph nodes of Cynomolgus monkeys after intravenous administration of various doses, 4x1.25 mg/kg (A), 4x6.25 mg/kg (B) or 4x12.50 mg/kg (C). ), - 2F2 or rituximab.

In fig. 47A-C show flow cytometric analysis of CD20 ^low CD23 ⁺ CD40 ^hlgh expressing cells in the peripheral blood of Cynomolgus monkeys after intravenous administration of various doses, 4x1.25 mg/kg (A), 4x6.25 mg/kg (B) or 4x12.50 mg/kg (C), - 2F2 or rituximab.

In fig. 48A-E show binding of rituximab (A), 2F2 (B), 11B8T (C), B1 (D), or isotype control antibody (E) to CHO cells expressing wild-type (WT) CD20, mutant CD20 (AchR), or both WT CD20 and mutant CD20 (AchR) determined by flow cytometry.

In fig. 49A-F shows the percentage of binding of 2F2, 11B8T, B1 or rituximab to the mutant P172S vs WT CD20 (A), the percentage of binding of 2F2, 11B8T, B1, CAT (CAT 12.6E12, mouse monoclonal IgG2A antibody against CD20, Diatec.Com.), isotype control antibody (KLH) or rituximab with mutant CD20 (AxP) vs WT CD20 (B), percentage of binding of 2F2, 11B8T, B1 or rituximab to mutant N166D vs WT CD20 (C), percentage of binding of 2F2T, CAT or rituximab to mutant N166D vs WT CD20 (D), percentage binding of 2F2T, 2F2, 11B8T, B1 or rituximab to mutant N1663D vs WT CD20 (E) and percentage binding of 2F2T, CAT or rituximab to mutant N163D vs WT CD20 (F).

In fig. 50 shows the binding of 2F2T, 7D8, and an isotype control antibody, as determined by ELISA, to three anti-idiotypic antibodies, anti-2F2 sab 1.1, anti-2F2 sab 1.2, and anti-2F2 sab 1.3, specific for 2F2.

In fig. 51 shows the binding of 11B8T, as determined by ELISA, with three anti-idiotypic antibodies, anti-11B8T sab 2.2, anti-11B8T sab 2.3, anti-11B8T sab 2.4, anti-11B8T sab 2.5, anti-11B8T sab 2.6, specific to 11B8T, but not binding to anti-idiotypic antibodies against 2F2.

In fig. 52A-C show the dose-dependent binding of 2F2T, as determined by ELISA, to three anti-idiotypic antibodies, anti-2F2 sab 1.1 (A), anti-2F2 sab 1.2 (B) and anti-2F2 sab 1.3 (C), specific for 2F2 .

In fig. 53 shows the amino acid sequence (SEQ ID NO: 2) of the heavy chain V region and the amino acid sequence (SEQ ID NO: 4) of the light (kappa) chain of the human monoclonal antibody 2F2 with the CDR regions designated.

In fig. 54 shows the nucleotide sequence (SEQ ID NO: 1) of the V region of the heavy chain and the nucleotide sequence (SEQ ID NO: 3) of the V region of the light (kappa) chain of the human monoclonal antibody 2F2.

In fig. 55 shows the amino acid sequence (SEQ ID NO: 6) of the heavy chain V region and the amino acid sequence (SEQ ID NO: 8) of the light (kappa) chain of the human monoclonal antibody 7D8 with the CDR regions designated.

In fig. 56 shows the nucleotide sequence (SEQ ID NO: 5) of the V region of the heavy chain and the nucleotide sequence (SEQ ID NO: 7) of the V region of the light (kappa) chain of the human monoclonal antibody 7D8.

In fig. 57 shows the amino acid sequence (SEQ ID NO: 10) of the V region of the heavy chain and the amino acid sequence (SEQ ID NO: 12) of the V region of the light (kappa) chain of human monoclonal antibody 11B8 with the CDR regions designated.

In fig. 58 shows the nucleotide sequence (SEQ ID NO: 9) of the V region of the heavy chain and the nucleotide sequence (SEQ ID NO: 11) of the V region of the light (kappa) chain of the human monoclonal antibody 11B8.

- 7 043675

Detailed Description of the Invention

The present invention provides improved antibody therapy for the treatment and diagnosis of disorders involving cells expressing CD20. The therapy of the invention utilizes isolated human monoclonal antibodies that specifically bind to an epitope on CD20. Isolated human monoclonal antibodies covered by the present invention include IgA, IgG-4, IgE, IgM and IgD antibodies.

In one embodiment, the antibody is an IgG1 antibody, more specifically of the IgG1,K or IgG1,λ isotype. In another embodiment, the antibody is an IgG3 antibody, more specifically of the IgG3,K or IgG3,λ isotype. In yet another embodiment, the antibody is an IgG4 antibody, more specifically of the IgG4,K or IgG4,λ isotype. In yet another embodiment, the antibody is an IgA1 or IgA2 antibody.

In yet another embodiment, the antibody is an IgM antibody.

In one embodiment, human antibodies are produced in a non-human transgenic animal, such as a transgenic mouse, capable of producing multiple isotypes of human CD20 monoclonal antibodies using V-D-J recombination or isotype switching. Accordingly, aspects of the invention include not only antibodies, antibody fragments, and pharmaceutical compositions thereof, but also non-human transgenic animals, B cells, host cell transfectomes, and hybridomas that produce monoclonal antibodies. Such a transgenic animal may also be a transgenic rabbit to produce polyclonal antibodies, such as the polyclonal antibodies described in US patent application 2003/0017534. Accordingly, the invention also covers human polyclonal antibodies that specifically bind to CD20. In one embodiment, the invention provides polyclonal antibodies that bind to an epitope on CD20 (i) that does not contain or require the amino acid residue proline at position 172; (ii) which does not contain or require the amino acid residues alanine at position 170 or proline at position 172; (iii) which contains or requires the amino acid residues asparagine at position 163 and asparagine at position 166; (iv) which does not contain or require the amino acid residue proline at position 172, but which contains or requires the amino acid residues asparagine at position 163 and asparagine at position 166; or (v) which does not contain or require the amino acid residues alanine at position 170 or proline at position 172, but which contains or requires the amino acid residues asparagine at position 163 and asparagine at position 166.

In another embodiment, the invention provides human polyclonal antibodies that have one or more of the following characteristics: (i) bind to the P172S mutant CD20 (proline at position 172 is replaced by serine) with at least the same affinity as human CD20; (ii) bind to mutant AchR (alanine at position 170 is replaced by serine and proline at position 172 is replaced by serine) with at least the same affinity as human CD20; (iii) show 50% or more reduced binding to the N166D mutant (asparagine at position 166 is replaced by aspartic acid) compared to human CD20 at an antibody concentration of 10 μg/ml; and/or (iv) show 50% or more reduced binding to the N163D mutant (asparagine at position 163 is replaced by aspartic acid) compared to human CD20 at an antibody concentration of 10 μg/ml.

In yet another embodiment, the invention provides human monoclonal antibodies that bind to an epitope in the small first extracellular loop of human CD20. In yet another embodiment, the invention also covers human monoclonal antibodies that bind to a discontinuous epitope on CD20. In yet another embodiment, the invention provides human monoclonal antibodies that bind a discontinuous epitope on CD20 that contains a first small extracellular loop region and a second extracellular loop region. In yet another embodiment, the invention provides human polyclonal antibodies that bind to a discontinuous epitope on CD20 containing the minor first extracellular loop AGIYAP residues and the second extracellular loop MESLNFIRAHTPYI residues.

The invention covers methods of using the antibodies of the invention to detect a cell expressing CD20. Also covered are methods of using antibodies of the invention to block or inhibit CD20-induced activities, such as proliferative activity and/or differentiation activity, and these methods are useful for treating CD20-associated disorders such as tumorigenic diseases (eg, B cell lymphoma) and autoimmune diseases (eg RA (rheumatoid arthritis, RA), Crohn's disease and Wegener's granulomatosis).

In order to better understand the present invention, certain terms are first defined. Additional definitions are introduced during the detailed description.

The terms CD20 and CD20 antigen are used interchangeably herein and include any variants, isoforms and homologs of human CD20 that are naturally expressed by cells or expressed in cells transfected with the CD20 gene. The binding of the antibody of the invention to the CD20 antigen mediates the killing of CD20-expressing cells (eg, tumor cells) by inactivating CD20. Killing of CD20-expressing cells can occur by one or more of the following mechanisms:

complement dependent cytotoxicity (CDC) of cells expressing CD20;

apoptosis of cells expressing CD20;

effector cell-induced phagocytosis of CD20-expressing cells; or effector cell-induced antibody-dependent cellular cytotoxicity (ADCC) of CD20-expressing cells.

Art-recognized synonyms for CD20 include B-lymphocyte antigen CD20, B-lymphocyte surface antigen B1, Leu-16, BP35, BM5 and LF5.

As used herein, the expression inhibits growth (e.g., of a cell) is intended to include any measurable decrease in the growth of cells when exposed to an anti-CD20 antibody compared to the growth of the same cells not exposed to an anti-CD20 antibody, e.g., growth inhibition cell culture by at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 99 or 100%. This reduction in cell growth can occur through various mechanisms, such as phagocytosis by effector cells, ADCC, CDC and/or apoptosis.

The term raft refers to membrane microdomains enriched with sphingolipids and cholesterol, localized on the outer surface of the plasma membrane of the cell. The ability of some proteins to associate with such domains may influence protein function. For example, translocation of CD20 molecules into lipid rafts, upon binding by human antibodies of the present invention, produces high-density CD20 antigen-antibody complexes in plasma membranes. This high density of CD20-antibody complexes may contribute to efficient activation of the complement system during CDC.

The term antibody as used herein includes whole antibodies and any antigen-binding fragment (ie, antigen-binding region) or single chain thereof. An antibody refers to a glycoprotein containing at least two heavy (H) chains and two light (L) chains linked by disulfide bonds, or an antigen-binding fragment thereof. Each heavy chain consists of a heavy chain variable region (abbreviated herein as _VH ) and a heavy chain constant region. Each light chain consists of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and _VL regions can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs), interspersed with more conserved regions called scaffolding regions. Each VH and VL region consists of three CDRs and four FRs, located from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with the antigen. Antibody constant regions can mediate the binding of immunoglobulin to host tissues or factors, including various cells of the immune system (eg, effector cells) and the first component (C1q) of the classical complement system.

The term antigen-binding region (region, fragment) of an antibody (or simply region (region, fragment) of an antibody as used herein refers to one or more fragments of an antibody that retain the ability to specifically bind an antigen (for example, CD20). It has been shown that the antigen-binding function of an antibody can carried out by fragments of a full-length antibody.Examples of binding fragments covered by the term antigen-binding region of an antibody include (i) a Fab fragment, a monovalent fragment consisting of _VH , _VL , _CL and _CH1 domains; (ii) an F(ab') ₂ fragment. a divalent fragment containing two Fab fragments linked by disulfide bridges in the hinge region; (iii) an Fd fragment consisting of the VH and C _H1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of the antibody molecule; (v) a fragment dAb (Ward et al., (1989) Nature 341:544-546), which consists of a V _H domain; (vi) a dedicated variable region (CDR), and (vii) a combination of two or more isolated CDRs, which are optionally , can be connected by a synthetic linker. In addition, although the two domains of the Fv fragment, V _L and V _H , are encoded by separate genes, they can be joined, using recombinant DNA techniques, using a synthetic linker that allows them to exist as a single protein chain in which V _L and V _H regions pair to form monovalent molecules (known as single chain Fv (scFv); see, for example, Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci USA 85:5879-5883). Such single chain antibodies are intended to be encompassed by the term antigen binding antibody fragment. Another example is immunoglobulin binding domain fusion proteins comprising (i) a binding domain polypeptide that is fused to an immunoglobulin hinge region polypeptide, (ii) a CH2 immunoglobulin heavy chain constant region fused to a hinge region polypeptide, and (iii) a CH3 heavy chain constant region immunoglobulin fused to the CH2 constant region. The binding domain polypeptide may be a heavy chain variable region or a light chain variable region. Such chimeric immunoglobulin binding domain proteins are further described in US patent applications

- 9 043675

2003/0118592 and 2003/0133939. These antibody fragments are prepared by conventional methods known to those skilled in the art, and the fragments are screened for utility in the same manner as intact antibodies.

The term epitope means a protein determinant capable of specifically binding to an antibody. Epitopes usually consist of chemically active molecules grouped on the surface, such as side chains of amino acids or sugars, and, as a rule, have specific features of a three-dimensional structure, as well as a specific charge. Conformational and non-conformational epitopes differ in that binding to the former, but not to the latter, is lost in the presence of denaturing agents.

The term discontinuous epitope as used herein means a conformational epitope on a protein antigen that is formed from at least two distinct regions in the primary sequence of the protein.

The term bispecific molecule is intended to include any agent, such as a protein, peptide, or protein or peptide complex, that has two different binding specificities. For example, the molecule may bind to, or interact with (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell. The term multispecific molecule or heterospecific molecule is intended to include any agent, such as a protein, peptide, or protein or peptide complex, that has more than two different binding specificities. For example, the molecule may bind to, or interact with (a) a cell surface antigen and (b) an Fc receptor on the surface of an effector cell and (c) at least one other component. Accordingly, the invention includes, but is not limited to, bispecific, trispecific, tetraspecific and other multispecific molecules that are directed to cell surface antigens such as CD20 and other targets such as Fc receptors on effector cells.

The term bispecific antibody also includes diabodies. Diabodies are bivalent bispecific antibodies in which the VH and _VL domains are expressed on a single polypeptide chain, but because a linker is used that is too short to allow pairing of two domains on the same chain, the domains are forced pair with complementary domains of the other chain and create two antigen-binding sites (see, for example, Hollinger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ, et al. (1944) Structure 2: 1121-1123).

The term human antibody derivatives refers to any modified form of an antibody, such as a conjugate of an antibody and another agent or antibody.

The expression is derived from, from, derived from a particular germline sequence is used herein if the antibody is obtained from a system using human immunoglobulin sequences, for example by immunizing a transgenic mouse carrying human immunoglobulin genes, or screening a library of human immunoglobulin genes, wherein the amino acid sequence of the selected a human antibody that is at least 90%, more preferably at least 95%, even more preferably at least 96, 97, 98 or 99% identical to the amino acid sequence encoded by a germline immunoglobulin gene. Typically, a human antibody derived from a particular human germline sequence exhibits no more than 10 amino acid differences, more preferably no more than 5, or even more preferably no more than 4, 3, 2 or 1 amino acid difference from the amino acid sequence encoded by the gene germline immunoglobulin.

As used herein, the term heteroantibodies refers to two or more antibodies, their derivatives or antigen-binding regions linked together, at least two of which have different specificities. These various specificities include specificity for binding to an Fc receptor on an effector cell and specificity for binding to an antigen or epitope on a target cell, such as a tumor cell.

The term human antibody as used herein is intended to include antibodies having variable and constant regions of human germline immunoglobulin sequences. Human antibodies of the invention may include amino acid residues not encoded by germline human immunoglobulin gene sequences (eg, mutations introduced by random or site-specific mutagenesis in vitro or somatic mutation in vivo). However, the term human antibody as used herein is not intended to include antibodies in which CDR sequences from the germ line of other mammalian species, such as mouse, can be introduced (grafted) into human backbone sequences.

The terms monoclonal antibody or monoclonal antibody composition as used herein refer to a preparation of antibody molecules of a single molecular composition. A monoclonal antibody composition exhibits a single (overall) specificity and affinity for a particular epitope. Therefore, the term human monoclonal antibody refers to antibodies exhibiting a single specificity that have variable and constant regions from human germline immunoglobulin sequences. In one embodiment, human monoclonal antibodies are produced by a hybridoma that includes a B cell derived from a transgenic or transchromosomal non-human animal, for example, a transgenic mouse, having a genome containing a human heavy chain transgene and a human light chain transgene fused to an immortalized cell.

The term recombinant human antibody as used herein includes all human antibodies that are produced, expressed, created or isolated by recombinant DNA techniques, such as (a) antibodies isolated from an animal (eg, mouse), transgenic or transchromosomal for human immunoglobulin genes or derived from them hybridomas (described below in Section 1), (b) antibodies isolated from a host cell transformed to express the antibody, for example, from a transfectome, (c) antibodies isolated using a combinatorial library containing recombinant human antibodies, and ( d) antibodies produced, expressed, created or isolated by any other means that involve splicing human immunoglobulin gene sequences into other DNA sequences. Such recombinant human antibodies have variable and constant regions from human germline immunoglobulin sequences. However, in some embodiments, such recombinant human antibodies may undergo in vitro mutagenesis (or, if an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis), and thereby the amino acid sequences of the VH and _VL regions of the recombinant antibodies are sequenced in such a manner. that although they are derived from and related to human germline VH and _VL sequences, they cannot naturally exist within a human germline antibody in vivo.

The term transfectome as used herein includes a recombinant eukaryotic host cell expressing an antibody, such as CHO cells, NS/0 cells, HEK293 cells, plant cells or fungal cells, including yeast cells.

As used herein, the term heterologous antibody is defined in connection with the transgenic, non-human organism that produces such antibody. This term refers to an antibody having an amino acid sequence or a coding nucleotide sequence corresponding to those of an antibody found in an organism other than a transgenic non-human animal, and typically a species other than the species in the transgenic non-human , animal.

As used herein, the term heterohybrid antibody refers to an antibody having light and heavy chains originating from different organisms. For example, an antibody having a heavy chain associated with a murine light chain is a heterohybrid antibody. Examples of heterohybrid antibodies include the chimeric and humanized antibodies discussed above.

The term isolated antibody as used herein is intended to refer to an antibody that is substantially free of other antibodies having distinct antigen specificities (e.g., an isolated antibody that specifically binds to CD20 is substantially free of antibodies that specifically bind to antigens other than CD20 ). An isolated antibody that specifically binds to an epitope, isoform, or variant of human CD20 may, however, have cross-reactivity against other related antigens, eg, from other species (eg, CD20 species homologs). In addition, the isolated antibody may be substantially free of other cellular material and/or chemicals. In one embodiment of the invention, a combination of isolated monoclonal antibodies having different specificities are combined into a specific composition.

As used herein, the term specific binding refers to an antibody that binds to a given antigen. Typically, the antibody binds with a KD affinity of about 1 x 10 ^-7 M or less, and binds to a given antigen with a KD affinity that is at least two orders of magnitude (in absolute value) lower than its binding affinity with a nonspecific antigen (eg, BSA, casein) other than the target antigen or a closely related antigen. The expressions antibody that recognizes an antigen and an antibody that is specific for an antigen are used interchangeably herein, interchangeably with the expression antibody that binds specifically to an antigen.

The expression k _d ( c ^-1 ) as used herein is intended to refer to the dissociation rate constant of a particular antibody-antigen interaction. This value is also called the kof _f value.

The expression k _a (M ^-1 x s ^-1 ) as used herein is intended to refer to the association rate constant of a particular antibody-antigen interaction.

As used herein, the expression KD(M) is intended to refer to the equilibrium dissociation constant of a particular antibody-antigen interaction.

- 11 043675

It is assumed that the expression KA (M ^-1 ) as used herein refers to the equilibrium association constant of a particular antibody-antigen interaction and is obtained by dividing k _a by k _d .

The term isotype, as used herein, is intended to refer to a class of antibodies (eg, IgM or IgG1) that are encoded by heavy chain constant region genes.

As used herein, the expression isotype switching refers to the phenomenon where the class, or isotype, of an antibody changes from one Ig class to one of the other Ig classes.

As used herein, the expression unswitched isotype refers to the isotype class of heavy chain that is produced when isotype switching does not occur; The CH gene encoding the non-switched isotype is usually the first gene immediately downstream of the functionally rearranged VDJ gene. Isotype switching is classified as classical or non-classical isotype switching. Classic isotype switching occurs through recombination events that involve at least one switch sequence region in the transgene. Non-classical isotype switching can occur, for example, by homologous recombination between human _σμ and human _Σμ (δ-associated deletion). Alternative non-classical switching mechanisms, such as intertransgenic and/or interchromosomal recombination, among others, can occur and effect isotype switching.

As used herein, the term switch sequence refers to DNA sequences responsible for switch recombination. The switch donor sequence, typically the μ switch region, is located 5' (ie, upstream) of the region of the construct removed during switch recombination. The switch acceptor region is between the construct being deleted and the constant replacement region (eg, γ, ε, etc.). Because there is no specific site at which recombination always occurs, the sequence of the final gene generally cannot be predicted from the design.

As used herein, the term glycosylation pattern, glycosylation pattern, is defined as a pattern of carbohydrate units covalently associated with a protein, more specifically an immunoglobulin protein (antibody protein). The glycosylation pattern of a heterologous antibody can be characterized as substantially similar to the glycosylation patterns found naturally on antibodies produced by a non-human animal species when one of ordinary skill in the art recognizes that the glycosylation pattern of the heterologous antibody is more similar to the glycosylation pattern of a non-human animal species than on the species from which the CH genes of the transgene are formed.

The term natural, as used herein, applied to an object, refers to those cases in which the object may occur in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including viruses) that can be isolated from a source in nature and that is not intentionally modified by humans in a laboratory is natural.

The term rearranged as used herein refers to a heavy chain or light chain configuration of an immunoglobulin locus in which the V segment is positioned immediately adjacent to the DJ or J segment in a conformation encoding substantially the entire VH and _VL domain, respectively. The rearranged immunoglobulin (antibody) gene locus can be identified by comparison with germline DNA; the rearranged locus contains at least one recombined heptameric/nonamer homology element.

The term unarranged (unrearranged) or germline configuration as used herein in relation to the V segment refers to a configuration in which the V segment does not recombine so as to be directly adjacent to the D or J segment.

The term nucleotide molecule, nucleic acid molecule as used herein is intended to include DNA molecules and RNA molecules. The nucleotide molecule can be single-stranded (single-stranded) or double-stranded (double-stranded), but preferably double-stranded DNA.

The term isolated nucleic acid molecule as used herein, with respect to nucleic acids (nucleotides) encoding entire antibodies or antibody regions (eg, VH, _VL , CDR3) that bind CD20, is intended to refer to a nucleotide molecule in which the nucleotides the sequences encoding the intact antibody or antibody fragment do not contain other nucleotide sequences encoding the complete antibody or antibody fragments (regions) that bind antigens other than CD20, which other sequences may naturally flank the nucleic acid in human genomic DNA. In one embodiment, the human anti-CD20 antibody comprises the nucleotide or amino acid sequence of 2F2, 7D8 or 11B8, and heavy chain (VH) and light chain ( _VL ) variable regions having the sequences shown in SEQ ID NO: 1, 5 or 9 and SEQ ID NO: 3, 7 or 11, respectively - 12 043675.

As described herein and claimed in the claims herein, the sequences set forth in SEQ ID NO: 1-30 include modifications of conserved sequences, i.e. modifications to nucleotide or amino acid sequences that do not significantly affect or significantly alter the binding characteristics of the antibody encoded by the nucleotide sequence or containing the amino acid sequence. Such modifications of conserved sequences include nucleotide and amino acid substitutions, additions or deletions. Modifications can be introduced into SEQ ID NO: 1-30 by standard methods known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions include substitutions in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues having similar side chains have been identified (characterized, established) in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenylalanine , tryptophan, histidine). Thus, a non-essential amino acid residue in a human anti-CD-20 antibody is preferably replaced with another amino acid residue from a family with the same side chains.

The present invention also covers derivatives of the amino acid sequences represented by SEQ ID NO: 1-30, and modifications of their conserved sequences in which one or more amino acid residues are derivatized, for example, by acylation or glycosylation, which does not significantly affect or significantly change the binding characteristics of the antibody containing amino acid sequences.

In addition, the present invention includes antibodies in which changes are made in the Fc region to change the functional or pharmacokinetic properties of the antibodies. Such changes may result in decreased or increased C1q binding and CDC or FcyR binding and ADCC. It is possible, for example, to make substitutions at one or more amino acid residues at positions 234, 235, 236, 237, 297, 318, 320 and 322 of the heavy chain constant region, thereby causing a change in effector function while maintaining the ability to bind antigen , compared to unmodified antibody, cf. US patents 5624821 and 5648260.

In vivo, the half-life of antibodies can also be increased by modifying the scavenger receptor epitope of the Ig constant domain or Ig-like constant domain so that the molecule does not contain an intact CH2 domain or an intact Ig Fc region, cf. US patents 6121022 and 6194551. In addition, in vivo half-life can be increased by making mutations in the Fc region, for example, replacing threonine with leucine at position 252, replacing threonine with serine at position 254, or replacing threonine with phenylalanine at position 256, cf. US patent 6277375.

In addition, the type of glycosylation of antibodies can be modified in order to change the effector function of antibodies. For example, it is possible to express antibodies in a transfectome that does not add the fucose unit typically linked to Asn at position 297 of the Fc region to increase the affinity of the Fc region for FcyRIII, which in turn will lead to increased ADCC of antibodies in the presence of NK cells, cf. Shield et al. (2002), JBC, 277:26733. Additionally, galactosylation can be modified to modify CDC.

Alternatively, in another embodiment, mutations can be introduced randomly throughout or a portion of the anti-CD-20 antibody coding sequence, for example, by saturation mutagenesis, and the resulting modified anti-CD-20 antibodies can be screened for binding activity.

Accordingly, antibodies encoded by (heavy and light chain variable regions) nucleotide sequences as defined herein and/or containing (heavy and light chain variable regions) amino acid sequences as defined herein (i.e., SEQ ID NO: 1-30) include Substantially similar antibodies, encoded by similar sequences or containing similar sequences conservatively modified. Additional discussion of how these substantially similar antibodies can be prepared from partial (eg, heavy and light chain variable regions) sequences herein, such as SEQ ID NO: 1-30, is given below.

In the case of nucleic acids, the term practical homology indicates that two nucleic acids or their specified sequences, when optimally superimposed and compared, are identical, with corresponding nucleotide insertions or deletions in at least about 80% of the nucleotides, typically at least at least approximately 90-95% of nucleotides, and more

- 13043675 preferably in at least about 98-99.5% of the nucleotides. Alternatively, practical homology exists when the segments hybridize under selective hybridization conditions with the complement of the chain.

With respect to nucleotide and amino acid sequences, the term homology indicates the degree of identity between two nucleotide or amino acid sequences when optimally superimposed and compared with corresponding insertions or deletions. Or, practical homology exists when DNA segments hybridize under selective hybridization conditions with the complement of the strand.

The percentage identity of two sequences is a function of the number of identical positions shared by the sequences (e.g. % homology = # identical positions/total number (#) positions x 100), taking into account the number of gaps and the length of each gap that must be introduced for optimal alignment ( superposition) of two sequences. Comparing sequences and determining the percentage identity of two sequences can be performed using the mathematical algorithm described in the non-limiting examples below.

The percentage identity of two nucleotide sequences can be determined using the GAP program in GCG software (available at http://www.gcg.com), using the NWSgapdna.CMP matrix and a gap mass of 40, 50, 60, 70 or 80 length weight (length weight) 1, 2, 3, 4, 5 or 6. The percentage identity of two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)), which is built into the ALIGN program (version 2.0), using the PAM120 residue mass table, gap length penalty function 12, gap penalty function 4. In addition, the percentage of identity of two amino acid sequences can be determined using the algorithm of Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970)), which is built into the GAP program in the GCG software (available at the Internet address http://www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix and gap weight 16, 14, 12, 10, 8, 6 or 4 and length weight 1, 2, 3, 4, 5 or 6.

Further, the nucleotide and amino acid sequences of this invention can be used as a query sequence to search available databases, for example, to identify related sequences. Such a search can be performed, for example, using the programs NBLAST and XBLAST (version 2.0) Altschul, et al. (1990) J. Mol. Biol. 215:403-10. A BLAST nucleotide search can be performed using the NBLAST program, score (degree) = 100, code length = 12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. A BLAST search for proteins can be performed using the XBLAST program, degree = 50, code length = 3, to obtain amino acid sequences homologous to the protein molecules of the invention. The Gapped BLAST program described by Altschul et al., (1997) Nucleic Acids Res. can be used to perform alignments of gapped sequences for comparison purposes. 25(17):3389-3402. When using the BLAST and Gapped BLAST programs, you can use the default settings of the corresponding programs (for example, XBLAST and NBLAST). See http://www.ncbi.nlm.nih.gov.

Nucleic acids may be present in whole cells, in cell lysates, or in partially purified or substantially pure form. A nucleic acid is isolated or presented substantially pure when it is purified from other cellular components or other impurities, such as other cellular nucleic acids or proteins, by standard methods including alkali/SDS treatment, CsCl banding, column chromatography, electrophoresis in agarose gel and other methods generally known in the art. See F. Ausubel, et al., ed. Current Protocols in Molecular Biology, Greene Publishing and Wiley Interscience, New York (1987).

The nucleic acid compositions of the present invention, although often having the native sequence (except for modified restriction sites and the like) of any cDNA, genomic or mixtures thereof, can be mutated by standard methods to obtain gene sequences. In the case of coding sequences, these mutations can, if desired, affect the amino acid sequence. In particular, DNA sequences substantially homologous to native V, D, J, constant, switch and other such sequences as described herein or derived from these sequences are contemplated (where derived indicates that the sequence is identical to another sequence or is obtained by modifying another sequences).

A nucleic acid is operably linked if it is in a functional relationship with another nucleotide sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects transcription of the sequence. With regard to transcription of regulatory sequences, operably linked means that the DNA sequences, when linked, are adjacent and, if it is necessary to connect two protein coding regions, adjacent and in frame. For switch sequences, operably linked indicates that the sequences are capable of switch recombination.

The term vector as used herein is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it is associated. One type of vector is a plasmid, a term referring to a loop of circular double-stranded DNA into which additional DNA segments can be ligated. Another type of vector is a viral vector, where additional DNA segments can be ligated into the viral genome. Some vectors are capable of autonomous replication in the host cell into which they are introduced (eg, bacterial vectors having a bacterial origin of replication and mammalian episomal vectors). Other vectors (eg, non-episomal mammalian vectors) can be integrated into the host cell genome upon introduction into the host cell, and thereby replicated along with the host genome. In addition, some vectors are capable of directing the expression of genes to which they are functionally linked. Such vectors are referred to herein as recombinant expression vectors (or simply expression vectors). In general, expression vectors used in recombinant DNA techniques are often in the form of plasmids. As used herein, plasmid and vector may be used interchangeably, since plasmid is the most commonly used form of vector. It is intended, however, that the invention includes other forms of expression vectors such as viral vectors (eg, replication-defective retroviruses, adenoviruses and adeno-associated viruses) that perform similar (equivalent) functions.

The term recombinant host cell (or simply host cell) as used herein is intended to refer to a cell into which a recombinant expression vector is introduced. It should be understood that such terms are intended to refer not only to a cell of a particular subject, but to the progeny of such a cell. Since some modifications may occur in subsequent generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell but are nevertheless encompassed by the term host cell of the present invention. Recombinant host cells include, for example, transfectomes such as CHO cells, NS/0 cells and lymphocytes.

The term subject as used herein includes a human or non-human animal. The term non-human animal includes all vertebrates such as mammals and non-mammals such as non-human primates, sheep, dogs, cows, chickens, amphibians, reptiles, etc.

The expression transgenic non-human animal refers to a non-human animal having a genome containing one or more heavy and/or light chain transgenes or transchromosomes of human origin (whether or not integrated into the animal's natural genomic DNA) and capable of expressing fully human antibodies. For example, a transgenic mouse may have a light chain transgene of human origin and either a heavy chain transgene of human origin or a transchromosome of heavy chain of human origin such that the mouse, when immunized with CD20 antigen and/or cells expressing CD20, produces human anti-CD20 antibodies . The human heavy chain transgene can be integrated into the mouse chromosomal DNA, as in the case of transgenic, e.g., HuMAb mice, such as Hco7 or Hco12 mice, or the human heavy chain transgene can be maintained off-chromosome, as in the case of transchromosomal (e.g., KM ) mice described in International Application WO 02/43478. Such transgenic and transchromosomal mice are capable of producing many isotypes of human anti-CD20 monoclonal antibodies (eg, IgG, IgA and/or IgE) if they undergo V-D-V recombination and isotype switching.

Various aspects of the invention are described in more detail in the subsections below.

I. Production of human antibodies to CD20.

Human monoclonal antibodies of the invention can be produced by many methods, including conventional monoclonal antibody methodology, for example, the standard somatic cell hybridization method of Kohler and Milstein, Nature 256:495 (1975). Although somatic cell hybridization methods are preferred, in principle other methods, such as viral or oncogenic transformation of B cells or phage display methods using human antibody gene libraries, can be used to produce a monoclonal antibody.

The preferred animal system for producing hybridomas that secrete human monoclonal antibodies is the murine system. The production of hybridomas in mice is a generally accepted method. Immunization protocols and methods for isolating immunized splenocytes for fusion (hybridization) are known in the art. Hybridizing partner cells (eg murine myeloma cells) and hybridization techniques are also known.

In a preferred embodiment of the invention, human monoclonal antibodies against CD20 can be produced using transgenic or transchromosomal mice carrying fragments of the human immune system rather than the murine system. These transgenic and transchromosomal mice include mice referred to herein as HuMAb mice and KM mice, respectively.

- 15 043675 and in this description are collectively called transgenic mice.

The HuMAb mouse contains human immunoglobulin gene miniloci that encode unrearranged human immunoglobulin heavy (μ and γ) and light (k) chain sequences, together with targeted mutations that inactivate the endogenous μ and k chain loci (Lonberg, N. et al (1994) Nature 368 (6474): 856-859). Accordingly, mice exhibit reduced expression of murine IgM or κ and, in response to immunization, introduced heavy and light chain transgenes of human origin undergo class switching and somatic mutation to produce human monoclonal IgG antibodies to κ (Lonberg, N. et al. (1994) , see above; reviewed in Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49-101; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13: 65-93, and Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764: 536-546). Generation of HuMAb mice is described in detail in Taylor, L. et al. (1992) Nucleic Acids Research 20:6287-6295; Chen, J. et al (1993) International Immunology 5: 647-656; Tuaillon et al. (1994) J. Immunol. 152:2912-2920, Lonberg et al., (1994) Nature 368(6474): 856-859; Lonberg, N. (1994) Handbook of Experimental Pharmacology 113:49-101; Taylor, L. et al. (1994) International Immunology 6: 579-591; Lonberg, N. and Huszar, D. (1995) Intern. Rev. Immunol. Vol. 13:65-93; Harding, F. and Lonberg, N. (1995) Ann. N.Y. Acad. Sci 764:536546; Fishwild, D. et al. (1996) Nature Biotechnology 14:845–851. In addition, see US Patents 5545806; 5569825; 5625126; 5633425; 5789650; 5877397; 5661016; 5814318; 5874299; and 5770429; all issued to Lonberg and Kay, and US Patent 5,545,807 issued to Surani et al.; International applications WO 98/24884, WO 94/25585, WO 93/1227, WO 92/22645, WO 92/03918 and WO 01/09187.

The KM mouse contains a transchromosome with a heavy chain of human origin and a kappa light chain of human origin transgene. Endogenous murine heavy and light chain genes are also dissociated in KM mice, so that immunization of mice results in the production of human immunoglobulins rather than murine immunoglobulins. The design of KM mice and their use for inducing human immunoglobulins is described in detail in International Application WO 02/43478.

Immunization.

To obtain fully human monoclonal antibodies to CD20, transgenic or transchromosomal mice containing human immunoglobulin genes (for example, HCo12, HCo7 or KM mice) can be immunized with a preparation enriched with CD20 antigen and/or cells expressing CD20, described, for example, in Lonberg et al. (1994), see above; Fishwild et al. (1996), supra, and International Patent Application WO 98/24884. Alternatively, mice can be immunized with DNA encoding human CD20. Preferably, mice are taken at 6-16 weeks of age for the first infusion. For example, a fortified preparation (5-50 μg) of CD20 antigen can be used to immunize mice intraperitoneally with HuMAb. In an event where immunization with purified and enriched CD20 antigen does not result in antibodies, mice can also be immunized with cells expressing CD20, such as a cell line, to induce an immune response.

Cumulative experience with various antigens has shown that HuMAb transgenic mice respond best when they are first immunized intraperitoneally (IP) or subcutaneously (SC) with CD20-expressing cells in Freund's complete adjuvant, followed by IP immunizations one week later (every two weeks). ) (up to 10 in total) with CD20-expressing cells in PBS. Monitoring of the immune response can be carried out during the course of immunization according to the protocol with plasma samples obtained from retro-orbital hemorrhage. Plasma screening can be done using a FACS assay (described below), and mice with satisfactory human anti-CD20 immunoglobulin titers can be used for fusions. Mice can be boosted intravenously with CD20-expressing cells 3 days before sacrifice and spleen removal.

Preparation of hybridomas producing human monoclonal antibodies against CD 20.

To produce hybridomas that produce human monoclonal antibodies to human CD20, splenocytes and lymph node cells from immunized mice can be isolated and hybridized to an appropriate immortalized cell line, such as a murine myeloma cell line. The resulting hybridomas can then be screened for the production of antigen-specific antibodies. For example, a single suspension of splenic lymphocytes from immunized mice can be hybridized with SP2/O Ag8.653 nonsecreting murine myeloma cells (ATCC, CRL 1580) with 50% PEG (w/v). Cells can be seeded at an approximate density of 1x10 per well in a microtiter plate with a flat well bottom profile, followed by two weeks of incubation in a selective medium containing, in addition to the usual reagents, 10% fetal (calf) cloning serum, 5-10% hybridoma cloning initiation factor ( IGEN) and 1X HAT (Sigma). After approximately two weeks, cells can be cultured in a medium in which HAT is replaced by NT. Individual cells can then be screened by ELISA for antibodies containing human kappa light chain and by FACS analysis using CD20-expressing cells for CD20 specificity. Usually, when intensive growth of hybridomas occurs, the environment can be observed after 10-14 days. Antibody-secreting hybridomas can be cultured again, screened again and, if positive for human IgG, anti-CD20 monoclonal antibodies can be subcloned at least twice at limited dilutions. Stable subclones can then be cultured in vitro to produce the antibody in tissue culture medium for characterization.

Generation of transfectomes producing human monoclonal antibodies with CD20.

Human antibodies of the invention can also be produced in a host cell transfectome using, for example, a combination of recombinant DNA and gene transfection techniques well known in the art (Morrison, S. (1985) Science 229:1202).

For example, in one embodiment, the gene(s) of interest, such as human antibody genes, can be ligated into an expression vector, such as a eukaryotic cell expression plasmid, such as that used by the GS gene expression system described in International applications WO 87/04462, WO 89/01036 and European patent EP 338841, or other expression systems well known in the art. The purified plasmid with cloned antibody genes can be introduced into eukaryotic host cells such as CHO cells, NS/0 cells or HEK293 cells, or other eukaryotic cells such as plant, fungal or yeast cells. The method used to introduce these genes may be a method described in the art, such as electroporation, lipofectin, lipofectamine or other methods. Once these antibody genes are introduced into host cells, cells expressing the antibody can be identified and selected. These cells are transfectomes that can be amplified to their expression level and made capable of producing antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and/or cells.

Additional recombinant methods for the production of human monoclonal antibodies to CD20.

Alternatively, cloned antibody genes can be expressed in other expression systems, including prokaryotic cells, such as microbial cells such as E. coli to produce single chain Fv antibodies, algae, and insect cells. In addition, antibodies can be produced in transgenic non-human animals, for example in the milk of sheep and rabbits or in chicken eggs, or in transgenic plants. See, for example, Verma, B, et al. (1998). Antibody engineering: Comparison bacterial, yeast, insect and mammalian expression systems. J. Immunol. Meth. 216:165-181; Pollock, et al (1999). Transgenic milk as a method for the production of recombinant antibodies. J. Immunol. Meth. 231:147-157; and Fischer, B, et al. (1999). Molecular farming of recombinant antibodies in plants. Biol. Chem. 380:825–839.

Use of partial antibody sequences to express intact antibodies.

Antibodies interact with target antigens primarily through amino acid residues located on the six hypervariable regions (CDRs) of the heavy and light chains. For this reason, amino acid sequences within the CDR are more diverse in individual antibodies than sequences outside the CDR.

Since CDR sequences are responsible for most antigen-antibody interactions, it is possible to express recombinant antibodies that mimic the properties of specific natural antibodies by constructing expression vectors that include the CDR sequences of a specific natural antibody transplanted into backbone sequences from a different antibody with different ( other) properties (see, for example, Riechmann, L. et al. (1998) Nature 332:323-327; Jones, P. et al. (1986) Nature 321:522-525; and Queen, S. et al. (1989) Proc. Natl. Acad. Sci. U.S.A. 86:10029-10033). Such backbone sequences can be obtained from available DNA databases that include germline antibody gene sequences. These germline antibody gene sequences differ from the mature antibody gene sequences because they do not include the fully assembled variable genes that are formed by the V(D)J junction during B cell maturation. The germline gene sequences will also differ from the high affinity secondary antibody sequences in an individual uniformly throughout the variable region. For example, somatic mutations are relatively infrequent on the amino-terminal portion of backbone region 1 and on the carboxy-terminal portion of backbone region 4. In addition, many somatic mutations subtly alter the binding properties of the antibody. For this reason, it is not necessary to obtain the complete DNA sequence encoding a particular antibody in order to recreate an intact recombinant antibody having binding properties similar to those of the original antibody (see WO 99/45962). Typically, a partial heavy and light chain sequence spanning the CDR regions is sufficient for this purpose. The partial sequence is used to determine which germline variable and connecting gene segments contribute to the recombined antibody variable genes. The germline sequence is then used to fill in the missing portions of the variable domains. The leader sequences of the heavy and light chains are cleaved off during protein maturation and do not contribute to the properties of the final antibody. To add missing sequences, cloned cDNA sequences can be combined with synthetic oligonucleotides by ligation or PCR amplification. Alternatively, complete variable domains can be synthesized as a set of short, overlapping oligonucleotides and combined by PCR amplification to create a fully synthetic variable region clone. This process has certain advantages, such as the elimination or inclusion of specific restriction sites or the optimization of specific codons.

Nucleotide sequences and light chain transcripts from hybridomas are used to design an overlapping set of synthetic oligonucleotides to create synthetic V sequences with amino acid coding capacity identical to natural sequences. Synthetic heavy and kappa chain sequences can differ from natural sequences in three ways: the series of repeating nucleotide bases are interrupted to simplify oligonucleotide synthesis and PCR amplification; optimal translation initiation sites are introduced according to Kozak's rules (Kozak, 1991, J. Biol. Chem. 266:19867-19870); and HindIII sites are created in the 3'-5' (upstream) direction from the translation initiation sites.

For both heavy and light chain variable regions, the optimized coding and corresponding non-coding chain sequences are split into 30-50 nucleotides approximately in the middle (midpoint) of the non-coding oligonucleotide. Thus, for each strand, the oligonucleotides can be assembled into overlapping double-stranded sets that span segments of 150-400 oligonucleotides. The pools are then used as templates to obtain PCR amplification products of 150-400 oligonucleotides. Typically, a single set of variable region oligonucleotides can be split into two pools, which are amplified separately to produce two overlapping PCR products. These overlapping products are then joined by PCR amplification to form the complete variable region. It may also be desirable to introduce an overlapping heavy or light chain constant region fragment (comprising the BbsI site of the kappa light chain or the AgeI site of the gamma heavy chain) into the PCR amplification to produce fragments that can be easily cloned into expression vector constructs.

The reconstructed heavy and light chain variable regions are then combined with the cloned promoter, leader, translation initiation site, constant region, 3' untranslated region, polyadenylation site, and transcription termination site sequences to form expression vector constructs. The heavy and light chain expression constructs can be combined into a single vector, cotransfected, sequentially transfected, or separately transfected into host cells, and then fused (hybridized) to form a host cell expressing both chains.

Plasmids for use in constructing an expression vector for human IgGK are described below. The plasmids are designed so that PCR-amplified V heavy and V kappa light chain cDNA sequences can be used to reconstruct full heavy and light chain minigenes. These plasmids can be used to express fully human or chimeric IgG1,K or IgG4,K antibodies. Similar plasmids can be constructed to express other light chain isotypes or to express antibodies containing lambda light chains.

Thus, in another aspect of the invention, structural features (features) of human anti-CD20 antibodies of the invention, for example, 11B8, 2F2 or 7D8, are used to create structurally related human anti-CD20 antibodies that retain at least one functional property of the antibodies of the invention, such as binding to CD20. More specifically, one or more of the 2F2, 7D8, or 11B8 CDR regions can be combined recombinantly with known human-derived backbone regions and CDRs to generate additional recombinant DNA-derived anti-CD20 antibodies of the invention.

Accordingly, in another embodiment, the invention includes a method for producing an anti-CD20 antibody, comprising: producing an antibody comprising (1) human heavy chain backbone regions and human heavy chain CDRs, wherein at least one of the human heavy chain CDRs contains an amino acid sequence selected from the CDR amino acid sequences shown in FIG. 53, 55 or 57 (or the corresponding amino acid residues in SEQ ID NO: 13-15, 19-21 or 25-27); and (2) human light chain backbone regions and human light chain CDRs, wherein at least one of the human light chain CDRs contains an amino acid sequence selected from the amino acid sequences of the CDRs shown in FIG. 53, 55 or 57 (or the corresponding amino acid residues in SEQ ID NO. 16-18, 22-24 or 28-30); where the antibody retains the ability to bind to CD20.

The ability of an antibody to bind CD20 can be determined using standard binding assays such as those presented in the examples (eg, FACS analysis).

Since it is well known in the art that the heavy and light chain CDR3 domains play a particularly important role in the specificity/affinity of antibody-antigen binding, the recombinant antibodies of the invention prepared as presented above preferably contain the heavy and light chain CDR3 regions 2F2, 7D8 or 11B8. Antibodies may further comprise CDR2 regions 2F2, 7D8 or 11B8. In addition, antibodies may contain CDR1 regions 2F2, 7D8 or 11B8. Accordingly, the invention further comprises anti-CD20 antibodies: (1) (1) human heavy chain core regions and the human heavy chain CDR1 region, the human heavy chain CDR2 region and the human heavy chain CDR3 region, in which the human heavy chain CDR3 region origin is CDR3 2F2, 7D8 or 11B8 shown in FIG. 53, 55 or 57 (or the corresponding amino acid residues in SEQ ID NO: 15, 21 or 27); and (2) human light chain core regions and the human light chain CDR1 region, the human light chain CDR2 region, and the human light chain CDR3 region, wherein the human light chain CDR3 region is CDR3 2F2, 7D8, or 11B8, shown in fig. 53, 55 or 57 (or the corresponding amino acid residues in SEQ ID NO: 15, 21 or 27) in FIG. 53, 55 or 57 (or the corresponding amino acid residues in SEQ ID NO: 18, 24 or 30); where the antibody binds to CD20. The antibody may further comprise heavy and/or light chain CDR2 2F2, 7D8 or 11B8. In addition, antibodies may contain CDR1 regions of the heavy and/or light chain 2F2, 7D8 or 11B8.

Preferably, the CDR1, 2 and 3 of the recombinant DNA antibodies described above contain exactly the same amino acid(s) as 2F2, 7D8 or 11B8 as described herein. However, one of ordinary skill in the art will appreciate that there may be some deviation from the exact CDR sequences 2F2, 7D8 or 11B8 while the antibody still retains the ability to effectively bind CD20 (eg, conservative substitutions). Accordingly, in another embodiment of the invention, an antibody produced by recombinant DNA may consist of one or more CDR regions that are, for example, 90, 95, 98 or 99.5% identical to one or more CDR regions 2F2, 7D8 or 11B8.

In addition to simply binding to CD20, recombinant DNA-derived antibodies such as those described above may be selected for their retention of other functional properties of the antibodies of the invention, such as:

(1) low rate of dissociation of the associate with CD20;

(2) high binding affinity to CD20;

(3) binding to a unique epitope on CD20;

(4) mediation of high levels of CDC on either CD55/59 negative or CD55/59 positive cells;

(5) translocation into lipid rafts upon binding to CD20;

(6) inhibition of growth of cells expressing CD20;

(7) inducing (stimulating) apoptosis of cells expressing CD20;

(8) inducing homotypic adhesion of cells expressing CD20;

(9) prolonged survival of a subject having tumor cells expressing CD20;

(10) ADCC mediation of CD20 targets upon mixing with appropriate effector cells;

(11) the ability to deplete cells expressing CD20; and/or (12) the ability to deplete cells expressing low levels of CD20 (CD20 ^low cells). Characteristics of monoclonal antibodies binding to CD20.

To purify human anti-CD20 antibodies, selected hybridomas can be grown in two-liter monoclonal antibody purification flasks. Supernatants can be filtered and evaporated before affinity chromatography with protein A-Sepharose (for IgG1 isotype antibodies) (Pharmacia, Piscataway, NJ) or anti-human IgG-coated Sepharose or G-Sepharose for IgG3 isotype antibodies. To ensure purity, eluted IgG can be tested by gel electrophoresis or high-performance liquid chromatography. The buffer solution can be replaced with PBS and the concentration can be determined by OD ₂₈₀ using a factor of 1.43. Monoclonal antibodies can be aliquoted and stored at -80°C.

In order to determine whether human monoclonal antibodies against CD20 bind to unique epitopes, site-directed or multi-site-directed mutagenesis can be used.

An isotype ELISA can be performed to determine the isotype of purified antibodies. The wells of microtiter plates can be coated with a film of 10 µg/ml anti-human Ig overnight at 4°C. After blocking with 5% BSA, 10 μg/ml monoclonal antibodies or purified isotype controls are added to the plate wells at room temperature for two hours. The well contents can then react with either human IgG1, IgG2, IgG3 or IgG4 or conjugated human IgM-specific alkaline phosphatase probes. After washing, the plates are treated with pNPP substrate (1 mg/ml) and analyzed at OD 405-650.

Flow cytometry can be used to demonstrate the presence of anti-CD20 antibodies in the sera of immunized mice or the binding of monoclonal antibodies to living cells expressing CD20. Briefly, cell lines expressing CD20

- 19 043675 puppies under standard culture conditions) are mixed with monoclonal antibodies at various concentrations in PBS containing 0.1 BSA and 0.02% sodium azide, and incubated at 4°C for 30 minutes. After washing, the cells are reacted with fluorescein-labeled anti-human IgG antibody under the same conditions as the primary antibody staining. Samples can be analyzed by flow cytometry on a FACS instrument using light scattering and side scattering on single living cells. An alternative analysis using fluorescence microscopy can be used in addition to, or instead of, flow cytometry. Cells can be stained exactly as described above and examined by fluorescence microscopy. This technique allows single cell imaging but may have reduced sensitivity depending on antigen density.

Human anti-CD20 IgG can be further tested for CD20 reactivity by Western blotting. Briefly, cell extracts of CD20-expressing cells can be prepared and subjected to electrophoresis on a dodecyl sulfate (SDS)-polyacrylamide gel. After electrophoresis, the separated antigens can be transferred to nitrocellulose membranes, blocked with 20% mouse serum and hybridized with the test monoclonal antibody probe. Human IgG binding can be detected by using anti-IgG alkaline phosphatase conjugate and treatment with BCIP/NBT substrate tablets (Sigma Chem. Co., St. Louis, MO).

Phagocytic activity of human monoclonal antibodies to CD20 and their cell killing activity.

In addition to specifically binding to CD20, human monoclonal antibodies against CD20 can be tested for their ability to mediate phagocytosis and killing of CD20-expressing cells. Testing monoclonal antibody activity in vitro will provide initial screening before testing in vivo models. Briefly, polymorphonuclear cells (PMN), NK cells, monocytes or other effector cells from healthy donors can be purified by density centrifugation in Ficoll Hypaque followed by lysis of contaminated red blood cells. Washed PMNs can be suspended in RPMI medium supplemented with 10% heat-inactivated fetal calf serum and mixed with ⁵¹ Cr-labeled CD20-expressing cells at varying ratios of effector cells to tumor cells (effector cells: tumor cells). Purified anti-CD20 IgG can then be added at varying concentrations. Irrelevant human IgG can be used as a negative control. The assay can be performed for 4-20 hours at 37°C depending on the type of effector cells used. Samples can be analyzed for cytolysis by measuring the release of ⁵¹ Cr into the culture supernatant. Anti-CD20 monoclonal antibodies can also be tested in combination with each other to determine whether cytolysis is enhanced in the presence of multiple monoclonal antibodies.

Human monoclonal antibodies that bind to CD20 can also be tested in in vivo models (eg, mice) to determine their effectiveness in regulating the growth of CD20-expressing tumor cells. These antibodies can be selected, for example, on the basis of the following criteria, which are not intended to be exclusive:

1. binding to living cells expressing CD20;

2. low rate of dissociation of the associate with CD20;

3. high binding affinity to CD20;

4. binding to a unique epitope on CD20; and/or binding in a specific orientation to CD20, and/or binding to a specific form of CD20;

5. opsonization of cells expressing CD20;

6. mediating cell inhibition, phagocytosis and/or killing of CD20 expressing cells in the presence of human effector cells;

7. ability to induce CDC on either CD55/59 negative or CD55/59 positive cells;

8. ability to induce homotypic adhesion;

9. the ability to induce translocation into lipid rafts (lipid rafts) upon binding to CD20;

10. ability to induce (stimulate) apoptosis;

ability to induce ADCC on cells expressing CD20;

12. ability to deplete cells expressing CD20; and/or

13. ability to deplete cells expressing low levels of CD20 (CD20 ^low cells).

Preferred human monoclonal antibodies of the invention meet one or more of these criteria.

Human monoclonal antibodies against CD20 can be tested for their ability to mediate CDC by various known methods. For example, complement serum can be obtained from the blood of healthy subjects and can be centrifuged and collected. Various methods can be used to determine the CDC activity of various mAbs. For example, the release of ⁵¹ Cr can be determined or increased membrane permeability can be assessed using the stain exclusion method.

- 20 043675 cross-linking with propidium iodide (PI). Briefly, target cells can be washed and resuspended in RPMI - 1% BSA at a density of 1x10 ⁶ /ml. Various concentrations of mAbs can be added to the cells and allowed to bind for 10-15 minutes at room temperature. Serum can then be added to a final concentration of 20% vol and the cells incubated at 37°C for 45 minutes. All cells from each sample can be added to the PI solution in a FACS tube. The mixture can then be immediately assessed by flow cytometry on a FACScalibur flow cytometer and analyzed using CellQuest pro software (BD Biosciences, Mountain view, CA).

To test the ability to initiate apoptosis, human monoclonal antibodies against CD20 can, for example, be incubated with CD20 positive tumor cells, for example Daudi, at 37°C for approximately 20 hours. Cells can be collected, washed with Annexin-V-FITC binding buffer (BD biosciences) and labeled with Annexin-V-FITC (BD biosciences) for 15 min in the dark at 4°C. All cells from each sample can be added to a solution of PI (10 μg/mL in PBS) in a FACS tube and immediately assessed by flow cytometry (as above).

In a particular embodiment of the invention, human monoclonal antibodies are used in combination, for example, in the form of a pharmaceutical composition containing two or more anti-CD20 monoclonal antibodies. For example, human monoclonal antibodies having different but complementary activities can be combined into a single drug to achieve a desired therapeutic or diagnostic effect. In a preferred embodiment, the composition comprises a human anti-CD20 monoclonal antibody that mediates CDC combined with another human monoclonal antibody that promotes apoptosis. In another embodiment, the composition comprises a human anti-CD20 monoclonal antibody that mediates highly efficient killing of target cells in the presence of effector cells, combined with another human anti-CD20 monoclonal antibody that inhibits the growth of cells expressing CD.

II. Generation of transgenic non-human animals that generate human monoclonal antibodies against CD20.

In yet another aspect, the invention includes transgenic or transchromosomal non-human animals, such as transgenic or transchromosomal mice, that are capable of expressing human antibodies that specifically bind to CD20. In a particular embodiment, the invention includes a transgenic or transchromosomal mouse having a genome containing a heavy chain transgene of human origin such that when immunized with cells expressing CD20, the mouse produces human monoclonal antibodies against CD20. A heavy chain transgene of human origin can be integrated into mouse chromosomal DNA, as in the case of transgenic mice, such as HuMAb, as described in detail and exemplified herein. Alternatively, the heavy chain transgene of human origin can be maintained off-chromosome, as in the case of transchromosomal mice (eg KM) described in International Application WO 02/43478. Such transgenic and transchromosomal animals are capable of producing many isotypes of human anti-CD20 monoclonal antibodies (eg, IgG, IgA and/or IgF) by undergoing V-D-V/V-J recombination and isotype switching. The design of a transgenic or transchromosomal non-human animal that responds to foreign antigen stimulation with a spectrum of heterologous antibodies requires that the heterologous immunoglobulin transgenes in the transgenic animal function correctly throughout B cell development. This includes, for example, isotype switching of the heterologous transgene Accordingly, transgenes are designed to induce isotype switching and one or more of the following features of antibody genes: (1) high level of expression and its cell type specificity, (2) functional gene rearrangement, (3) activation allele exclusion and response, (4) expression of a sufficient primary spectrum, (5) signal transduction, (6) somatic hypermutation, and (7) dominance of the antibody-encoding transgene locus during the immune response.

All of the above criteria do not have to be present. For example, in those embodiments in which the endogenous immunoglobulin gene loci of a transgenic animal are functionally disrupted, allelic exclusion does not need to be activated for the transgene. In addition, in those embodiments in which the transgene contains a functionally rearranged immunoglobulin heavy and/or light chain gene, the second criterion for functional gene rearrangement is optional, at least for the transgene that is already rearranged. For general information about molecular immunology, see Fundamental Immunology. ^2nd edition (1989), Paul William E., ed. Raven Press, NY

In other embodiments, the transgenic or transchromosomal non-human animals used to produce the human monoclonal antibodies of the invention contain rearranged, unrearranged, or a combination of rearranged and unrearranged heterologous immunoglobulin heavy and light chain transgenes in the germline of the transgenic animal. Each of the heavy chain transgenes contains at least one CH gene. In addition, the heavy chain transgene may contain functional iso switch sequences

- 21 043675 type, which are capable of supporting isotype switching of many _CH- encoding genes of a heterologous transgene in B cells of a transgenic animal. Such switch sequences may be those sequences that occur naturally in the germline immunoglobulin locus of the species that serves as the source of the C _H genes of the transgene, or such switch sequences may be derived from sequences that occur naturally in the form used to produce the transgene construct (transgenic animal). For example, a transgenic construct of human origin that is used to produce a transgenic mouse may produce a higher frequency of isotype switch events if it introduces switch sequences similar to the switch sequences that naturally occur at the mouse heavy chain locus, since the mouse switch sequences are presumably optimized in such a way as to function with the recombinase enzyme system, whereas the switch sequences of human origin are not optimized. Switch sequences can be isolated and cloned by conventional cloning methods or can be synthesized de novo from overlapping synthetic oligonucleotides designed based on published sequence information related to switch region sequences (Mills et al., Nucl. Acids Res. 15 ^L 7305-7316 (1991); Sideras et al., Intl. Immunol. 1:631-642 (1989)). In each of the above transgenic animals, functionally rearranged heterologous immunoglobulin heavy and light chain transgenes were found in a significant proportion of the B cells of the transgenic animal (at least 10%).

Transgenes used to produce transgenic non-human animals of the invention include a heavy chain transgene comprising DNA encoding at least one variable gene segment, one D segment, one connecting gene segment and at least one constant region segment gene. An immunoglobulin light chain transgene contains DNA encoding at least one variable gene segment, one connecting gene segment, and at least one constant region gene segment. The gene segments encoding (or rather corresponding to) the light and heavy chain gene segment(s) are heterologous for the transgenic animal in that they are formed from or correspond to DNA corresponding to the heavy and light chain gene segments of a species not consisting of transgenic non-human animal. In one aspect of the invention, the transgene is constructed such that the individual gene segments are unarranged, i.e. The transgene is not arranged to encode a functional immunoglobulin light or heavy chain. Such unrearranged transgenes promote recombination of the V, D and J gene segments (functional rearrangement) and preferably promote the incorporation of all or part of the D gene segment into the resulting rearranged immunoglobulin heavy chain in the transgenic animal upon exposure to the CD20 antigen.

In an alternative embodiment of the invention, the transgenes contain an unarranged minilocus. Such transgenes typically contain a significant portion of the C, D, and J segments, as well as a subpopulation of V gene segments. In such transgenic constructs, various regulatory sequences, for example, promoters, enhancers, class switch regions, splice donor and acceptor sequences for RNA processing, recombination signals, etc., contain corresponding heterologous DNA sequences. Such regulatory sequences may be included in a transgene from the same or related non-human species used in the invention. For example, human immunoglobulin gene segments can be joined in a transgene to a rodent immunoglobulin enhancer sequence for use in a transgenic mouse. Alternatively, synthetic regulatory sequences may be included in a transgene in which such synthetic regulatory sequences are not homologous to a functional DNA sequence known to occur naturally in mammalian genomes. Synthetic regulatory sequences are built according to rules of agreement (consensus), for example, regulatory sequences that determine the permitted sequence of the splice acceptor site or promoter/enhancer motif. For example, the minilocus contains a portion of an immunoglobulin genomic locus having at least one internal deletion (ie, not at the end of the region) of a non-essential DNA region (eg, an intron or part thereof) compared to the natural germline Ig locus.

Preferred transgenic and transchromosomal non-human animals, such as mice, produce a significant spectrum of immunoglobulins, almost ideally similar to the human immunoglobulin spectrum after correction for volume.

The spectrum ideally approximates the human spectrum after correction for volume, usually with a diversity of at least about 10%, preferably 25-50% or more. Overall, this results in at least a thousand different immunoglobulins (ideally IgG), preferably 104-106 or more, depending on the number of different V, J and D regions introduced into the mouse genome and driven by the additional diversity caused by V- rearrangements (D)-J gene segments randomly added to connecting regions. Typically, immunoglobulins exhibit an affinity (KD) for preselected antigens below 10 ^-7 M, such as an affinity lower than 10 ^-8 M, 10 ^-9 M or 10 ^-10 M

- 22 043675 or even lower.

Transgenic and transchromosomal non-human animals, such as mice, as described above, can be immunized, for example, with cells expressing CD20. Alternatively, transgenic animals can be immunized with DNA encoding human CD20. Animals that then produce B cells that undergo class switching by recombination switch (cis-switch) and express CD20-reactive immunoglobulins. Immunoglobulins may be human antibodies (also referred to as human-derived antibodies) in which the heavy and light chain polypeptides are encoded by human-derived transgene sequences, which may include sequences generated using somatic mutation and recombinatory region V junctions, as well as sequences encoded by germline genes; these human antibodies can be considered virtually identical to the polypeptide sequence encoded by the V _L and J _L segments or the V _H , DH and JH genes of human origin, even though, as a result of somatic mutation and differences in the VJ and VDJ recombined connecting parts, others may be present non-germ line sequences. The variable regions of each antibody chain are typically at least 80% similar to the V, J and, in the case of heavy chains, D segments of germline genes of human origin; often at least 85% similar to the germline sequences in the transgene; often 90 and 95% similar to germline sequences in the transgene. However, since non-human germline sequences are introduced by somatic mutation and VJ and VDJ junction, antibodies with a sequence of human origin will often have some variable region sequences that are not encoded by the V, D or J gene segments of human origin found in the human transgene(s). origin in the mouse germ line. Typically, non-human sequences (or individual nucleotide positions) cluster in or near CDRs, or in regions where somatic mutations are known to cluster.

Another aspect of the invention includes B cells from transgenic or transchromosomal non-human animals as herein described. The cells can be used to produce hybridomas expressing human monoclonal antibodies that bind with high affinity (eg, equilibrium dissociation constant (KD) below 10 ^-7 M) to human CD20. Thus, in one embodiment, the invention includes a hybridoma that produces a human antibody having an affinity (KD) lower than 10 ^-7 M, such as an affinity lower than 10 ^-8 M, 10 ^-9 M or 10 ^-10 M or even lower , when determined by analyzing CD20-expressing cells using the Scatchard method, using a radiolabeled monoclonal antibody, or by determining the half-maximal binding concentration using FACS analysis.

The monoclonal antibodies herein contain a light chain with a sequence of human origin, consisting of (1) a light chain variable region having a polypeptide sequence substantially identical to the polypeptide sequence encoded by the V _L gene segment of human origin and the J _L gene segment of human origin, and 2) a light chain constant region encoded by the C _L gene segment of human origin, and a heavy chain with a sequence of human origin, consisting of (1) a heavy chain variable region having a polypeptide sequence substantially identical to the polypeptide sequence encoded by the human V _H gene segment, region D and the JH gene segment of human origin, and 2) the heavy chain constant region encoded by the CL gene segment of human origin.

The generation of high affinity human monoclonal antibodies against CD20 can be facilitated by a method of expanding the range of variable region gene segments of human origin into a transgenic non-human animal having a genome containing an integrated human immunoglobulin transgene, which method involves introducing into the genome of a transgene a V gene containing region V gene segments that are not present in said integrated human immunoglobulin transgene. Often a V region transgene is a yeast artificial chromosome containing part of a set of VH and _VL ( _VK ) gene segments of human origin that may occur in the human genome or can be separately excised when spliced together by recombinant DNA methods, which may include non-standard (outliers) ) V gene segments. Often, at least five or more functional Vgene segments are contained on YAC (yeast artificial chromosomes, I.h.d.). In this embodiment, it is possible to obtain a transgenic animal by the V spectrum expansion method, wherein the animal expresses an immunoglobulin chain containing the variable domain sequence encoded by the V gene region segment present in the V region transgene and the C region encoded by the human Ig transgene. Using the V spectrum expansion method, it is possible to obtain transgenic animals having at least 5 different V genes; and it is also possible to obtain animals containing at least about 24 V genes. Some V gene segments may be non-functional (eg, pseudogenes, etc.); these segments, if required, can be stored or can be selectively

- 23 043675 delete (remove) using recombinant DNA methods available to specialists in the field of technology.

When a mouse germline sequence is generated by recombinant DNA to contain a functional YAC having an expanded range of V segments virtually absent in a human Ig transgene containing J and C gene segments, the trait can be propagated and bred in other genetic environments, including environments in which functional YACs having an extended spectrum of V segments are introduced into the germline of a non-human animal having a different human Ig transgene. Many functional YACs having an expanded range of V segments can be introduced into the germline to work with a human Ig transgene (or many human Ig transgenes). Although such transgenes are referred to herein as YAC transgenes, such transgenes, when integrated into the genome, may substantially lack yeast sequences, such as sequences required for autonomous replication in yeast; such sequences may optionally be removed by recombinant DNA techniques (e.g., restriction digestion and pulsed electric field gel electrophoresis or other suitable method) after replication in yeast, they are no longer needed (e.g., before introduction into a mouse ES cell or mouse phagocyte). Methods for propagating an immunoglobulin expression trait with sequences of human origin include breeding a transgenic animal having a human Ig transgene(s), and optionally also having a functional YAC with an expanded spectrum of V segments. Both VH and _VL gene segments may be present on YAC. The transgenic animal can be bred in any media desired by the practitioner, including media containing other transgenes of human origin, including human Ig transgenes and/or transgenes encoding other human lymphocyte proteins. The invention also includes a high affinity immunoglobulin with a sequence of human origin produced by a transgenic mouse having a YAC transgene containing an extended spectrum V region. While the foregoing describes a preferred embodiment of the transgenic animal of the invention, other embodiments of the invention are contemplated and fall into three classes:

I. Transgenic animals containing an immunoglobulin transgene with an unrearranged heavy and rearranged light chain;

II. Transgenic animals containing an immunoglobulin transgene with an unrearranged heavy and unrearranged light chain; And

III. Transgenic animals containing an immunoglobulin transgene with a rearranged heavy and unrearranged light chain.

The order of preference for these classes (categories) of transgenic animal is as follows: I > II > III, where endogenous light chain genes (or at least the K gene) are knocked out by homologous recombination (or other method), and I > II > III , where endogenous light chain genes are not knocked out and should be dominant when allelic exclusion is used.

III. Bispecific/Polyspecific molecules that bind to CD20.

In yet another embodiment, human anti-CD20 monoclonal antibodies can be derivatized or linked to another functional molecule, such as another peptide or protein (eg, a Fab' fragment) to form a bispecific or polyspecific molecule that binds to multiple binding sites or epitopes. targets. For example, an antibody of the invention may be operably linked (eg, by chemical bonding, genetic fusion, non-covalent association, or other means) to one or more binding molecules, such as another antibody, peptide, or binding mimetic.

Accordingly, the present invention includes bispecific and polyspecific molecules comprising at least one binding specificity for CD20 and a second binding specificity for a second target epitope. In a particular embodiment of the invention, the second targeted epitope is an Fc receptor, a human FcyRI (CD64) receptor or a human Fca receptor (CD89), or a T cell receptor, eg CD3. The invention therefore includes bispecific and polyspecific molecules capable of binding to effector cells expressing both FcyR, FcaR and FcεR (eg, monocytes, macrophages or polymorphonuclear cells (PMN)) and target cells expressing CD20. These bispecific and multispecific molecules target CD20-expressing cells to an effector cell and, like the human monoclonal antibodies of the invention, involve Fc receptor-mediated effector cell activities such as phagocytosis of CD20-expressing cells, antibody-dependent cellular cytotoxicity (ADCC), cytokine release, or formation of superoxide anion.

Further, the bispecific and polyspecific molecules of the invention may include a third binding specificity in addition to the anti-Fc binding specificity and the anti-CD20 binding specificity. In one embodiment of the invention, the third binding specificity is a portion of an anti-enhancement factor (EF), for example, a molecule that binds

- 24 043675 with a surface protein, is included in the cytotoxic activity and thereby increases the immune response to the target cell. The anti-enhancement factor (EF) site may be an antibody, a functional fragment of an antibody, or a ligand that binds to a given molecule, such as an antigen or receptor, and thereby results in an enhanced effect of the binding determinants on the Fc receptor or antigen. target cells. The counter-enhancement factor region may bind to an entity different from the entity to which the first and second specificities are associated. For example, the binding site may bind a cytotoxic T cell (eg, via CD2, CD3, CD8, CD28, CD4, CD40, ICAM-1, or other immune cell, which results in an enhanced immune response against the target cell).

In one embodiment, the bispecific and polyspecific molecules of the invention contain as binding specificity at least one antibody, including Fab, Fab', F(ab') ₂ , Fv or single chain Fv. The antibody can also be a light or heavy chain dimer or a minimal fragment thereof, such as Fv, or a single chain construct as described by Ladner et al. in US Pat. No. 4,946,778. The antibody may also be a chimeric immunoglobulin binding domain protein described in US Patent Applications 2003/0118592 and 2003/0133939.

In one embodiment, the bispecific and monospecific molecules of the invention comprise a binding specificity to an FcyR or FcaR on the surface of an effector cell, and a second binding specificity to a target cell antigen, for example, CD20.

In one embodiment, Fc receptor binding specificity is provided by a human monoclonal antibody whose binding is not blocked by human immunoglobulin G (IgG). As used herein, the term IgG receptor refers to any of the eight γ-chain genes located on chromosome 1. These genes encode a total of twelve membrane or soluble receptor isoforms, which are grouped into three classes of Fcy receptors: FcyRI (CD64), FcyRII (CP32) and FcyRIII (CD16). In one preferred embodiment of the invention, Fcy is human high affinity FcyRI.

The production and characterization of these preferred monoclonal antibodies are described by Fanger et al. in International Application WO 88/00052 and US Patent 4,954,617. These antibodies bind to the FcyRI, FcyRII and FcyRIII epitope at a site that is distinct from the Fcy receptor binding site and thus their binding is substantially unblocked by physiological levels of IgG. Specific anti-FcyRI antibodies useful in this invention are mAb 22, mAb 32, mAb 44, mAb 62, and mAb 197. In other embodiments, the anti-Fcγ receptor antibody is a humanized form of monoclonal antibody 22 (H22).

The production and characterization of the H22 antibody is described in Graziano, R.F. et al. (1995) J. Immunol 155 (10): 4996-5002 and in International Application WO 94/10332. The cell line producing the H22 antibody was deposited in the American Type Cell Culture Collection on November 4, 1992 under the name HA022CL1 and has No. CRL 11177.

In other preferred embodiments, Fc receptor binding specificity is provided by an antibody that binds to a human IgA receptor, for example the Fc alpha receptor (FcaRI (CD89)), the binding of which is preferably not blocked by human immunoglobulin A (IgA). The term IgA receptor is believed to include the gene product of the a gene (FcaRI), located on chromosome 19. This gene is known to encode several alternatively spliced transmembrane isoforms ranging from 55 to 110 kDa. FcaRI (CD89) is constitutively expressed on monocytes/macrophages, eosinophilic and neutrophilic granulocytes, but not on non-effector cell populations. FcaRI has an affinity for both IgA1 and IgA2 that is increased by exposure to cytokines such as G-CSF or GM-CSF (Morton, N.C. et al. (1996) Critical Reviews in Immunology 16: 423-440). Four FcaRI-specific monoclonal antibodies, identified as A3, A59, A62 and A77, that bind FcaRI outside the IgA ligand-binding domain are described (Monteiro, R.C. et al. (1992) J. Immunol. 148:1764).

FcaRI and FcyRI are preferred trigger receptors for use in the invention because they (1) are expressed primarily on immune effector cells; (2) expressed at high levels (eg, 5000-1000000 per cell); (3) are mediators of cytotoxic activities (eg, ADCC, phagocytosis); (4) mediate increased antigenic presentation of antigens, including self-targeted antigens.

In another embodiment of the invention, the bispecific molecule is composed of two monoclonal antibodies of the invention that have complementary functional activities such that one antibody predominantly works to induce CDC and the other antibody predominantly works to induce apoptosis, for example, 2F2 in combination with 11B8.

In other embodiments, the bispecific and polyspecific molecules of the invention further comprise a binding activity that recognizes a target cell antigen, eg, binds to a target cell antigen, eg CD20. In a preferred embodiment of the invention, binding specificity is provided by a human monoclonal antibody

- 25 043675 to this invention.

The expression effector cell specific antibody as used herein refers to an antibody or functional antibody fragment that binds to effector cells.

Preferred antibodies for use as subject matter of the invention bind to effector cells at a site that is not bound by endogenous immunoglobulin.

As used herein, the term effector cell refers to an immune cell that participates in the effector phase of an immune response, as opposed to the cognitive and activation phases of the immune response. Examples of immune cells include cells of myeloid or lymphoid origin, such as lymphocytes (e.g., B cells and T cells, including cytolytic T cells (CTL), killer cells, natural killer cells, macrophages, monocytes, eosinophils, neutrophils, polymorphonuclear cells, granulocytes, mast cells and basophils. Some effector cells express specific Fc receptors and perform immune functions. In preferred embodiments of the invention, the effector cell is capable of inducing antibody-dependent cellular cytotoxicity (ADCC), for example, a neutrophil is capable of inducing ADCC. For example, monocytes, macrophages that express FcR, are involved in the specific killing of target cells and the presentation of antigens to other components of the immune system, or in binding to cells that contain (present) antigens.In other embodiments of the invention, the effector cell can phagocytose the targeted antigen, target cell or microorganism.Expression of a specific FcR on the effector cell can be regulated by humoral factors such as cytokines. It has been found, for example, that FcyRI expression is positively regulated by interferon gamma (IFN-γ). This increased expression enhances the cytotoxic activity of FcYRI-bearing cells against targets. The effector cell can phagocytose or lyse the target antigen or target cell.

The term target cell shall mean any undesired cell of a subject (eg, human or animal) that may be the target of a composition (eg, monoclonal antibody, bispecific or multispecific molecule) of the invention. In preferred embodiments of the invention, the target cell is a cell expressing or overexpressing CD20. Cells expressing CD20 typically include B cells and B cell tumors.

Although human monoclonal antibodies are preferred, other antibodies, namely murine, chimeric and humanized monoclonal antibodies, can be used in the bispecific and monospecific molecules of this invention. Such murine, chimeric and humanized monoclonal antibodies can be produced by methods known in the art.

Bispecific and polyspecific molecules of the present invention can be prepared by chemical methods (see, for example, D. M. Kranz et al. (1981) Proc. Natl. Acad. Sci. USA 78:5807), polydominant methods (see US Patent 4474893 issued to Reading ), or recombinant DNA methods.

In particular, bispecific and monospecific molecules of this invention can be prepared by conjugating components of binding specificities, for example, anti-FcR and anti-CD20 binding specificities, using methods known in the art and described in the examples herein. For example, each binding specificity of a bispecific and a polyspecific molecule can be prepared separately and then conjugated to each other. When the binding specificities are proteins or peptides, a variety of linkers and cross-linkers can be used for covalent conjugation. Examples of crosslinking agents include protein A, carbodiimide, Nsuccinimidyl-S-acetylthioacetate (SATA), 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), phenylenedimaleimide (oPDM), N-succinimidyl-3-(2-pyridylthio) propionate (SPDP) and sulfosuccinimidinyl 4-(N-maleinimidomethyl)cyclohexane-1-carboxylate (sulfo-SMCC) (see, for example, Karpovsky et al. (1984) J. Exp. Med. 160:1686; Liu, MA et al (1985) Proc Natl Acad Sci USA 82:8648). Other methods include those described by Paulus (Behring Ins. Mitt. (1985) No. 78, 118-132); Brennan et al. (Science (1985) 229:81-83), and Glennie et al. (J. Immunol. (1987) 139: 2367-2375). Preferred conjugating agents are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford, IL).

If the binding specificities are antibodies, they can be conjugated by binding the sulfhydryl groups of the C-terminal hinge regions of the two heavy chains. In a particularly preferred embodiment of the invention, the hinge region is modified to contain an odd number of sulfhydryl residues, preferably one, prior to conjugation.

Alternatively, both binding specificities can be encoded in the same vector and expressed in the same host cell. This method is particularly applicable in cases where the bispecific and polyspecific molecule is an mAb x mAb, mAb x Fab, Fab x F(ab')2 or a ligand x Fab chimeric protein. The bispecific and multispecific molecule of the invention, for example, a bispecific molecule, may be a single chain molecule, such as a single chain bispecific antibody, a single chain bispecific molecule containing two binding determinants. Bispecific and polyspecific molecules may also be single chain molecules, or at least may contain at least two single chain molecules. Methods for obtaining bi- and polyspecific molecules are described, for example, in US patents

- 26 043675

5260.203; 5455030; 4881175; 5132405; 5091513; 5476.786; 5013653; 5258498 and 5482858.

The binding of bispecific and polyspecific molecules to their specific targets can be confirmed by enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis, bioassay (eg, growth inhibition) or Western blotting. Each of these assays typically detects the presence of protein-antibody complexes of particular interest using a labeled reagent (eg, antibody) specific for the complex of interest. For example, FcR-antibody complexes can be detected using, for example, an enzyme-linked antibody or antibody fragment that recognizes and specifically binds to antibody-FcR complexes. Alternatively, complexes can be detected using any of a variety of other immunoassays. For example, the antibody can be radiolabeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B, Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986). A radioactive isotope can be detected by methods such as the use of a γ-ray counter or scintillation counter, or autoradiography.

IV. Immunoconjugates.

In another aspect, the present invention includes a human anti-CD20 monoclonal antibody conjugated to a therapeutic moiety, such as a cytotoxin, a drug (eg, an immunosuppressant), or a radioisotope. Such conjugates are referred to herein as immunoconjugates. Immunoconjugates that include one or more cytotoxins are called immunotoxins. A cytotoxin or cytotoxic agent includes any agent that is harmful to cells (eg, kills cells). Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, doxorubicin, daunorubicin, dihydroxyanthracinedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol and puromycin and their analogs or homologues.

Suitable therapeutic agents for the formation of immunoconjugates of the invention include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa, chlorambucil, melphalan , carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C and cis-dichlorodiamine platinum (II) (DDP), cisplatin), anthracyclines (for example, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg, dactinomycin (formerly actinomycin), bleomycin, mithramycin and anthramycin (AMC)) and antimitotic agents (eg, vincristine and vinblastine). In a preferred embodiment of the invention, the therapeutic agent is a cytotoxic agent or a radiotoxic agent. In another embodiment of the invention, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is GM-CSF. In a preferred embodiment, the therapeutic agent is doxorubicin, cisplatin, bleomycin, sulfate, carmustine, chlorambucil, cyclophosphamide, or ricin A.

Antibodies of the present invention can also be conjugated to a radioisotope, such as iodine-131, yttrium-111, to produce cytotoxic radiopharmaceuticals for the treatment of a CD20-related disorder such as cancer. The antibody conjugates of the invention can be used to modify a given biological response, and the drug content should not be designed as limited to classical chemical therapeutic agents. For example, a portion (element, particle, fragment) of a drug substance may be a protein or polypeptide that has a given biological activity. Such proteins may include, for example, an enzymatically active toxin or an active fragment thereof, such as abrin, ricin A, pseudomonad exotoxin or diphtheria toxin; a protein such as tumor necrosis factor or interferon-γ; or biological response modifiers, for example, lymphokines, interleukin 1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte-macrophage colony-stimulating factor (GF-CSF), granulocyte colony-stimulating factor (G-CSF) or other growth factors.

Methods for conjugating such a therapeutic moiety to antibodies are well known, see, for example, Amon et al., Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985), Hellstrom et al., Antibodies For Drug Delivery, in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, Antibody Carriers Of Cytotoxic Agents in Cancer Therapy: A Review, in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy, in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates, Immunol. Rev. 62:119-58 (1982).

- 27 043675

In yet another embodiment, the human monoclonal antibodies of the invention are attached to a chelator linker, for example, tiuxetan, which promotes conjugation of the antibody with the radioisotope.

V. Pharmaceutical compositions.

In another aspect, the present invention includes a composition, for example a pharmaceutical composition, containing one or a combination of human monoclonal antibodies of the present invention. Pharmaceutical compositions can be prepared with pharmaceutically acceptable carriers or diluents, as well as other known adjuvants and excipients, by conventional methods, such as those described in Remington: The Science and Practice of Pharmacy, ^19th Edition, Gennaro, Ed., Mack Publishing Co. ., Easton, PA, 1995. In one embodiment, the compositions include a combination of multiple (e.g., two or more) isolated human antibodies of the invention that act by different mechanisms, e.g., one antibody that acts primarily to induce CDC, in combination with another antibody that acts primarily by inducing apoptosis.

The pharmaceutical compositions of the invention can also be used in combination therapy, i.e. combine with other agents. For example, a combination therapy may include a composition of the present invention with at least one anti-inflammatory agent and at least one immunosuppressant. In one embodiment, such therapeutic agents include one or more anti-inflammatory agents, such as steroid drugs or NSAIDs (non-steroidal anti-inflammatory drugs). Preferred agents include, for example, aspirin and other salicylates, Cox-2 inhibitors such as rofecoxib (Vioxx) and celecoxib (Celebrex), NSAIDs such as ibuprofen (Motrin, Advil), fenoprofen (Nalfon), naprofen (Naprosyn), sulindac (clinoril), diclofenac (Voltaren), piroxicam (Felden), ketoprofen (Orudis), diflunisal (Dolobid), nabumetone (Relafen), etodolac (Lodin), oxaprozin (Daipro) and indomethacin (Indocin).

In another embodiment, such therapeutic agents include one or more disease-modifying antirheumatic drugs (DMARDs), such as methotrexate (Rheumatrex), hydroxychloroquine (Plaquenil), sulfasalazine (Asulfidine), pyrimidine synthesis inhibitors, e.g., leflunomide (Arava), IL blockers -1 receptor blockers, such as anakinra (Kineret), and TNF-α blockers, such as etanercept (Enbrel), infliximab (Remicade), and adalimumab.

In another embodiment, such agents include one or more immunosuppressants, such as cyclosporine (Sandimmune, Neoral) and azathioprine (Imiral).

In another embodiment, such therapeutic agents include one or more chemotherapeutic agents such as doxorubicin (Adriamycin), cisplatin (Platinol), bleomycin (Blenoxan), carmustine (Gliadel), cyclophosphamide (Cytoxan, Procytox, Neosar) and chlorambucil (Leukeran).

In one embodiment, the human antibodies of this invention can be administered in combination with chlorambucil and prednisolone; cyclophosphamide; vincristine; doxorubicin and prednisone; fludarabine and anthracycline; or in combination with other conventional multidrug regimens for NHL, such as those described, for example, in: Non-Hodgkin's Lymphomas: Making sense of Diagnosis, Treatment, and Options, Lorraine Johnston, 1999, O'Reilly and Associates, Inc.

In yet another embodiment, human antibodies can be administered in combination with radiation therapy and/or autologous peripheral stem cell or bone marrow transplantation.

In yet another embodiment, human antibodies can be administered in combination with one or more antibodies selected from anti-CD25 antibodies, anti-CD19 antibodies, anti-CD21 antibodies, anti-CD22 antibodies, anti-CD37 antibodies, anti-CD38 antibodies, anti-IL6R antibodies, anti-IL8 antibodies , anti-IL15 antibodies, anti-IL15K antibodies, anti-CD4 antibodies, anti-CD11a antibodies (eg, efalizumab), anti-alpha-4/beta-1 integrin (VLA4) antibodies (eg, natalizumab), and CTLA4-Ig.

In a particular embodiment of the invention, human monoclonal antibodies are administered in combination with an anti-CD25 antibody for the treatment of bullous pemphigoid, for example, in patients with a homologous disease.

In another particular embodiment of the invention, human monoclonal antibodies are administered in combination with one or more antibodies selected from anti-CD19 antibodies, anti-CD21 antibodies, anti-CD22 antibodies, anti-CD37 antibodies and anti-CD38 antibodies for the treatment of malignant tumors.

In yet another embodiment, human antibodies are administered in combination with one or more antibodies selected from anti-IL6R antibodies, anti-IL8 antibodies, anti-IL15 antibodies, anti-IL15R antibodies, anti-CD4 antibodies, anti-CD11a antibodies (eg, efalizumab), anti-alpha4 antibodies /beta-1 integrin (VLA4) (eg, natalizumab), and CTLA4-Ig for the treatment of inflammatory diseases.

In yet another embodiment, human antibodies can be administered in combination with an anti-C-C3b(i) antibody to enhance complement activation.

As used herein, the expression pharmaceutically acceptable carrier includes any and all of the following physiologically compatible solvents, dispersion media, antibacterial and antifungal agents, isotonic and antihypertensive agents.

- 28 043675 absorption agents and the like. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (eg by injection or infusion). Depending on the route of administration, the active compound, i.e. the antibody, bispecific and polyspecific molecule may be coated to protect the compound from acids and other natural conditions that may inactivate the compound.

The expression pharmaceutically acceptable salt refers to a salt that retains the intended biological activity of the parent compound and has no undesirable toxicological effects (see, for example, Berge, S. M. et al. (1977) J. Pharm. Sci. 66:1-19). Examples of such salts include acid addition salts and base addition salts. Acid addition salts include salts formed by the addition of non-toxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphoric, etc., as well as non-toxic organic acids, such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids , hydroxyalkanoic acids, aromatic acids, aromatic sulfonic acids, etc. Base addition salts include those formed by the addition of alkali and alkaline earth metal bases such as sodium, potassium, magnesium, calcium, etc., as well as non-toxic organic amines such as N,N'-dimethylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, procaine, etc.

The composition of this invention can be administered by various methods known in the art. As will be understood by one skilled in the art, the route and/or method of administration varies depending on the desired result. The active compounds can be formulated with carriers that prevent the compound from being rapidly released, as in a sustained release (controlled release) formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene-vinyl acetate copolymer, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid can be used. Methods for preparing such preparations are well known to those skilled in the art. See, for example. Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978.

To administer a compound of the invention by certain methods, it may be necessary to coat the compound with a material that prevents inactivation, or to administer the compound simultaneously with this material. For example, the compound can be administered to a subject in a suitable carrier, such as liposomes, or in a diluent. Pharmaceutically acceptable diluents include physiological saline and aqueous buffer solutions. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7:27).

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions or sterile powders for the immediate preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is known in the art. The use of any conventional media or agents in the pharmaceutical compositions of the invention is contemplated, except those that are incompatible with the active ingredient. Active additives can be added to the composition.

Therapeutic compositions generally must be sterile and stable under conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable for high drug concentrations. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (eg, glycerin, propylene glycol and liquid polyethylene glycol, etc.) and suitable mixtures thereof.

Adequate fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the desired particle size distribution in the case of a dispersion and by using surfactants. In many cases, it is preferable to include isotonic agents in the composition, for example, sugars, polyols such as mannitol, sorbitol, or sodium chloride. Prolonged absorption of injected compositions can be caused by including in the composition an agent that slows down the absorption of, for example, salts - monostearates and gelatin.

Sterile injection solutions can be prepared by administering, if necessary, the active compound in the required amount in a suitable diluent with one or a combination of the ingredients listed above, followed by sterilization microfiltration. Typically, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and other desired ingredients selected from those listed above. When sterile powders are used to prepare sterile injectable solutions, the preferred methods of preparation are vacuum drying and lyophilization (frozen drying), which yield a powder of the active ingredient plus any desired ingredient from their solution, previously purified by sterilization microfiltration.

Dosage regimens are adjusted to provide the optimal desired response (eg, therapeutic response). For example, you can administer a single bolus, you can enter

- 29 043675 several separate doses over time or the dose can be proportionally reduced or increased, in accordance with situations that unexpectedly arise during treatment. Particularly preferred are parenteral compositions formulated in a unit dosage form to facilitate administration and promote uniformity of dosage form. The expression unit dosage form (dose) as used herein refers to physically discrete units of dosage form for subjects undergoing treatment; each unit contains a predetermined amount of active compound, calculated on the basis that it is desired to obtain a given therapeutic effect in combination with the desired pharmaceutical carrier. The specifications for unit dosage forms of the invention are dictated by or directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic effect sought to be achieved, and (b) the limitations inherent in the technique of preparing such active compound for the treatment of sensitivity in an individual.

Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants such as alkorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (INT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

For therapeutic compositions, the preparations of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The preparations may generally be in unit dosage forms (unit doses) and may be prepared by any methods known in the art of pharmacy. The amount of active ingredient that can be combined with the carrier material to obtain a unit dosage form depends largely on the subject being treated and the particular route of administration. The amount of active ingredient that can be combined with the carrier material to form a unit dosage form is generally such that the composition produces a therapeutic effect. Typically, based on one hundred percent, this amount will be in the range of about 0.01-95% of the active ingredient, preferably about 0.1-70%, most preferably about 1-30%.

Formulations of the present invention suitable for vaginal use also include pessaries, tampons, creams, gels, pastes, foams or spray preparations containing such carriers as are known in the art to be suitable. Dosage forms of the compositions of this invention for topical or transdermal use include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and volatile inhalants. The active compound can be mixed under sterile conditions with a pharmaceutically acceptable carrier and any desired preservatives, buffers or dispersants.

The expressions parenteral administration (use) and parenterally administered as used herein mean methods of administration (use) other than enteral and local, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardial, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion.

Examples of suitable aqueous and non-aqueous carriers that can be used in the pharmaceutical compositions of the invention include water, ethanol, polyols (such as glycerin, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Suitable fluidity must be maintained, for example by the use of coating materials such as lecithin, by maintaining the particle size distribution in the case of dispersions, and by the use of surfactants.

These compositions may also contain adjuvants such as preservatives, humectants, emulsifiers and dispersing agents. Prevention of the presence of microorganisms can be achieved both by sterilization, see above, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorbic acid, etc. It may also be desirable to include isotonic agents such as sugars, sodium chloride and the like in the compositions. In addition, prolonged absorption of the pharmaceutical injection form can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin.

In one embodiment, the human monoclonal antibodies of the invention are administered in crystalline form by subcutaneous injection, cf. Yang et al. (2003) PNAS, 100(12):6934-6939.

When the compounds of the present invention are administered, in the form of pharmaceutical preparations, to humans or animals, they may be given individually or in the form of a pharmaceutical composition containing, for example, 0.01-99.5% (more preferably 0.1-90%) of the active ingredient in combination with a pharmaceutically acceptable carrier.

Regardless of the mode of administration chosen, the compounds of the present invention, which can be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention are prepared in pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art.

The actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention may be varied so as to obtain an amount of the active ingredient effective to achieve the desired therapeutic response for a particular patient, composition and route of administration, without being toxic to the patient. The dose level selected will depend on a number of pharmacokinetic factors, including the potency of the particular compositions of this invention, or ester, salt or amide thereof employed, route of administration, time of administration, excretion rate of the particular compound employed, duration of treatment, other drugs, compounds and/or the materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and medical history of the patient being treated, and other similar factors generally known in the medical art.

A physician or veterinarian of ordinary skill in the art can readily determine and prescribe the required effective amount of the pharmaceutical composition. For example, a physician or veterinarian may begin with doses of the compounds of the invention used in the pharmaceutical compositions of the invention lower than required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved. Generally, a suitable daily dose of a compound of the invention is that amount of compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend on the factors described above. Preferably, administration is intravenous, intramuscular, intraperitoneal or subcutaneous, preferably proximal to the desired site. Desirably, an effective daily dose of a therapeutic composition can be administered in two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally in a unit dosage form. Although the compound of the present invention can be administered individually, it is preferably administered in the form of a pharmaceutical composition (composition, preparation).

In one embodiment, the human monoclonal antibodies of the invention can be administered by infusion at a weekly dose of 10-500 mg/ ^m2 , such as 200-400 mg/ ^m2 . Such administration may be multiple times, for example 1-8 times, such as 3-5 times. Administration can be carried out as a continuous infusion (infusion) over 2-24 hours, for example, over 2-12 hours.

In another embodiment of the invention, human monoclonal antibodies are administered by slow continuous infusion, for example, over 24 hours, to reduce toxic side effects.

In yet another embodiment, human monoclonal antibodies are administered at a weekly dose of 250-2000 mg, for example, at a dose of 300, 500, 700, 1000, 1500 or 2000 mg, up to 8 times, for example 4-6 times. Administration can be carried out by continuous infusion over 2-24 hours, for example over 2-12 hours. This regimen can be repeated one or more times if necessary, for example after 6 or 12 months. Dosage can be determined or adjusted by measuring, after administration in a biological sample, the amount of anti-CD20 monoclonal antibodies in the bloodstream using anti-idiotypic monoclonal antibodies targeting anti-CD20 antibodies.

In yet another embodiment, human monoclonal antibodies are administered as maintenance therapy, for example, once a week for 6 months or more.

In yet another embodiment, the human monoclonal antibodies of the invention can be administered in a regimen comprising a single infusion of a human anti-CD20 monoclonal antibody followed by an infusion of a radioisotope-conjugated human monoclonal anti-CD20 antibody. The scheme can be repeated after 7-9 days.

Therapeutic compositions can be administered using medical devices known in the art. For example, in a preferred embodiment of the invention, the therapeutic composition of the invention can be administered using a needleless hypodermic injector, such as the devices described in US patents 5399163; 5383851; 5312335; 5064413; 4941880; 4790824; or 4,596,556. Examples of well-known implants and modules useful in this invention include: US Pat. No. 4,487,603, which describes an implantable microinfusion pump for dispensing a drug at a controlled rate; US Pat. No. 4,486,194, which describes a therapeutic device for administering medications through the skin; US Pat. No. 4,447,233, which describes a medical infusion pump for delivering a medical agent at a precise infusion rate; US Pat. No. 4,447,224, which describes an implantable variable-rate infusion device for continuous drug delivery; US patent 4439196, which describes an osmotic drug delivery system with multi-chamber cells; and US patent

- 31 043675

4475196, which describes an osmotic drug delivery system. Many other implants, delivery systems and modules are known to those skilled in the art.

In some embodiments, human monoclonal antibodies of the invention can be formulated to ensure appropriate distribution in vivo. For example, the blood-brain barrier (BBB) excludes many highly hydrophilic compounds. In order to ensure that the drug compounds of the invention penetrate (if required) through the BBB, they must be formulated, for example, in liposomes. For methods of preparing liposomes, see, for example, US patents 4,522,811; 5374548; 5399331. Liposomes may contain one or more particles that are selectively transferred (transported) to specific cells or organs, thereby increasing targeted drug delivery (see, for example, V. V. Ranade (1989) J. Clin. Pharmacol. 29:685) . Examples of targeted particles include folate or biotin (see, for example, US Pat. No. 5,416,016 to Low et al.); mannosides (Umezawa et al., (1988) Biochem. Biophys. Res. Commun. 153:1038); antibodies (P.G. Bloeman et al. (1995) FEBS Lett. 357:140; M. Owais et al. (1995) Antimicrob Agents Chemother. 39:180); surfactant protein A receptor (Briscoe et al. (1995) Am. J. Physiol. 1233:134), various forms of which may include the formulations of the invention, as well as components of the molecules of the invention; p120 (Schreier et al. (1994) J. Biol. Chem. 269:9090); see also K. Keinanen; M.L. Laukkanen (1994) FEBS Lett. 346:123; J.J. Killion; I.J. Fidler (1994) Immunomethods 4:273. In one embodiment of the invention, the drug compounds of the invention are formulated in liposomes (encapsulated in liposomes); in a more preferred embodiment of the invention, the liposomes include a target particle. In the most preferred embodiment of the invention, drug compounds in liposomes are delivered by bolus injection to a site proximal to the desired area, for example, to a site of inflammation or infection or to a tumor. The composition should be so liquid that it can be easily drawn into a syringe. It must be stable under the conditions of receipt and storage and must be protected from the contaminating action of microorganisms such as bacteria and fungi.

In yet another embodiment, the human monoclonal antibodies of the invention can be formulated to prevent or reduce their transport across the placenta. This can be done by methods known in the art, for example, PEGation of antibodies or the use of F(ab) ₂ '-fragments. Additional references can be made to Cunningham-Rundles. S, Zhuo Z, Griffith B, Keenan X (1992). Biological activities polyethylene-glycol immunoglobulin conjugates. Resistance to enzymatic degradation. J Immunol Methods. 152:177-190; and on Landor M. (1995) Maternal-fetal transfer of immunoglobulins, Ann Allergy Asthma Immunol 74:279-283. This is especially important when antibodies are used to treat or prevent recurrent spontaneous miscarriage.

The therapeutically effective dose for tumor therapy can be determined by objective tumor responses, which may be complete or partial. Complete tumor response (CR) is defined as the absence of clinical, radiological, or other evidence of disease. A partial response (PR) is determined based on the fact that the total tumor size has decreased by more than 50%. The average time of development (progression) is a measure that characterizes the duration of the objective response of the tumor.

A therapeutically effective dose in tumor therapy can also be measured by its ability to stabilize disease progression. The ability of a compound to suppress cancer can be assessed in an animal model system that predicts the effectiveness of treatment of human tumors. Alternatively, this property of the composition can be assessed by studying the ability of the compound to inhibit cell growth or apoptosis using in vitro assays known to the skilled practitioner. A therapeutically effective amount of a drug compound may reduce tumor size or otherwise reduce symptoms in a subject. One of ordinary skill in the art will be able to determine such amounts based on factors such as the size of the subject, the symptoms of the subject, and the particular composition or particular method selected for use.

A therapeutically effective dose for rheumatoid arthritis preferably results in improvement according to the ACR20 preliminary definition of improvement criteria, more preferably results in improvement according to the ACR50 preliminary definition of improvement criteria, and even more preferably results in improvement according to the ACR70 preliminary definition of improvement criteria.

The ACR20 preliminary definition of improvement criteria is defined as: >20% improvement in Tender Joint Count (TCJ) and Swollen Joint Count (SWJ) and >20% improvement in 3 out of 5 of the following scores: Patient Pain Score (VAS), Patient Global Assessment (VAS), physician global assessment (VAS), patient self-assessment of disability (HAQ), acute phase reagent (CRP or ESR).

ACR50 and ACR70 are determined in the same way with improvements of >50% and >70%, respectively. For more details, see Felson et al. in American College of Rheumatology Preliminary Determination of Improvement in Rheumatoid Arthritis; Arthritis Rheumatism (1995) 38: 727–735.

- 32 043675

The composition must be sterile and so fluid that the composition can be drawn into a syringe. In addition to water, carriers may include isotonic buffered saline, ethanol, polyol (eg, glycerin, propylene glycol and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Adequate fluidity must be maintained, for example by the use of a coating such as lecithin, by maintaining the required particle size distribution in the case of a dispersion and by the use of a surfactant. In many cases, it is preferred to include isotonic agents in the composition, for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride. Prolonged absorption of injectable compositions can be achieved by including in the composition an absorption delaying agent, for example aluminum monostearate or gelatin.

If the active compound is protected as described above, the compound can be administered orally, for example, with an inert diluent or with a digestible edible carrier.

IV. Application and methods according to the invention.

The human antibodies (including immunoconjugates, bispecific/monospecific antibodies, compositions and other derivatives herein) of the present invention have numerous in vitro and in vivo applications in diagnosis and therapy, including the diagnosis and treatment of disorders involving CD20 expressing cells. For example, antibodies can be administered to cells in culture, for example, in vitro and ex vivo, or to humans, for example, in vivo, for the treatment, prevention and diagnosis of a variety of disorders. The term subject, as used herein, is intended to include a human and non-human animal that produces an immune response to human anti-CD20 antibodies. Preferred subjects include human patients with disorders that can be corrected or ameliorated by suppression or control of B cells (normal or malignant).

For example, in one embodiment, the human antibodies of the present invention can be used to treat a subject with a tumorigenic disorder, such as a disorder characterized by the presence of tumor cells expressing CD20, including, for example, B cell lymphoma, such as NHL. Examples of tumorigenic diseases that can be treated and/or prevented include B cell lymphoma, such as NHL, including B cell progenitor leukemia/lymphoma, and mature B cell neoplasms, such as B cell chronic lymphocytic leukemia (CLL) )/small lymphocytic lymphoma (SLL), prolymphocytic B cell leukemia, lymphoplasmacytic lymphoma, mantle cell lymphoma (MCL), follicular lymphoma (FL), including low-grade, intermediate-grade and high-grade FL, cutaneous follicular center cell lymphoma, Marginal zone cell lymphoma (MALT type, nodal type and spleen), hairy cell leukemia, large diffuse B-cell lymphoma, Burkitt lymphoma, plasmacytoma, plasma cell myeloma, post-transplant lymphoproliferative disease, Waldenström macroglobulinemia and anaplastic large cell lymphoma (ALCL).

Other examples of B-cell non-Hodgkin's lymphomas are lymphomatoid granulomatosis, primary effusion lymphoma, intravascular B-cell lymphoma, mediastinal large B-cell lymphoma, heavy chain diseases (including γ, μ and α disease), lymphomas caused by immunosuppressant therapy such as lymphoma cyclosporine-induced and methotrexate-induced lymphoma.

In another embodiment, the human antibodies of the present invention can be used to treat Hodgkin lymphoma.

Examples of immune system disorders involving CD20-expressing B cells that can be treated and/or prevented include autoimmune disorders such as psoriasis, psoriatic arthritis, dermatitis, systemic scleroderma and multiple sclerosis, inflammatory bowel disease (IBD), Crohn's disease, ulcerative colitis, respiratory distress syndrome, meningitis, encephalitis, uveitis, glomerulonephritis, eczema, asthma, atherosclerosis, leukocyte adhesion deficiency, multiple sclerosis, Raynaud's syndrome, Sjögren's syndrome, juvenile diabetes, Reiter's disease, Behçet's disease, nephritis with deposits immune complexes, IgA nephropathy, IgM polyneuropathy, immune system-mediated thrombocytopenia, such as acute idiopathic thrombocytopenic purpura and chronic idiopathic thrombocytopenic purpura, hemolytic anemia, myasthenia gravis, lupus nephritis, systemic erythematous lupus, rheumatoid arthritis (RA, RA), diffuse neurodermatitis , pemphigus, Graves' disease, Hashimoto's thyroiditis, Wegener's granulomatosis, Omenn's syndrome, chronic renal failure, acute infectious mononucleosis, HIV and herpes virus-related diseases. Other examples are acute respiratory distress syndrome and choreoretinitis. In addition, other diseases and disorders include those caused or mediated by infection of B cells with a virus, such as Epstein-Barr virus (EBV).

Other examples of inflammatory, immune and/or autoimmune disorders in which an important

- 33 043675 antibodies and/or excessive activity of B lymphocytes play a role and which can be treated and/or prevented include the following diseases and disorders:

Vasculitides and other vascular diseases such as microscopic polyangiitis, Churg-Strauss syndrome and other ANCA-associated vasculitides, polyarteritis nodosa, essential cryoglobulinemic vasculitis, cutaneous leukocytoclastic angiitis, Kawasaki disease, Takayashi arteritis, giant cell arteritis, Henoch-Schönlein purpura, primary or isolated cerebral angiitis, erythema nodosum, thromboangiitis obliterans, thrombotic thrombocytopenic purpura (including hemolytic uremic syndrome), and secondary vasculitides, including cutaneous leukocytoclastic vasculitis (eg, secondary to hepatitis B, hepatitis C, Waldenström's macroglobulinemia, B-cell neoplasia, rheumatoid arthritis, Sjögren (Sjögren) or systemic lupus erythematosis); other examples are erythema nodosum, allergic vasculitis, panniculitis, Weber-Christian disease, hyperglobulinemic purpura and Buerger's disease;

skin diseases such as contact dermatitis, linear IgA dermatosis, vitiligo, pyoderma gangrenosum, epidermolysis bullosa acquisita, pemphigus vulgaris (including cicatricial pemphigoid and bullous pemphigoid), alopecia areata (including alopecia universalis and alopecia completeta), dermatitis herpetiformis , erythema multiforme and chronic autoimmune urticaria (including angioedema and urticarial vasculitis);

immune cytopenias such as autoimmune neutropenia and true red cell aplasia;

connective tissue disorders such as CNS lupus, discoid lupus erythematosus, CREST syndrome, mixed connective tissue disease, polymyositis/dermatomyositis, inclusion body myositis, secondary amyloidosis, cryoglobulinemia type I and type II, fibromyalgia, antiphospholipid syndrome, secondary hemophilia, relapsing polychondritis, sarcoidosis, stiff neck syndrome, rheumatic fever; another example is eosinophilic fasciitis;

arthritids such as ankylosing spondylitis, juvenile chronic arthritis, adult Still's disease and SAPHO syndrome; other examples are sacroiliitis, reactive arthritis, Still's disease and gout;

hematological disorders such as hypoplastic anemia, primary hemolytic anemia (including cold agglutinin disease), secondary hemolytic anemia due to CLL or systemic lupus erythematosus; PORMS syndrome, pernicious anemia and macroglobulinemic Waldenström purpura; other examples are agranulocytosis, autoimmune neutropenia, Franklin's disease, Seligmann's disease, μ chain disease, secondary paraneoplastic syndrome due to thymoma and lymphomas, and factor VIII inhibitor formation;

endocrinopathies such as polyendocrinopathy and Addison's disease; other examples are autoimmune hypoglycemia, autoimmune hypothyroidism, autoimmune insulin syndrome, de Quervain's thyroiditis and insulin receptor antibody-mediated insulin resistance;

liver and gastrointestinal diseases such as celiac disease, Whipple's disease, primary biliary cirrhosis, chronic active hepatitis and primary sclerosing cholangitis; another example is autoimmune gastritis;

nephropathies such as rapidly progressive glomeluronephritis, post-streptococcal glomeluronephritis, Goodpasture's syndrome, membranous glomerulonephritis and cryoglobulinemic nephritis; another example is minimal change disease;

nonprologic disorders such as autoimmune neuropathies, mononeuritis multiplex, Lambert-Eaton myasthenic syndrome, Sydenham's chorea, tabes dorsalis, and Guillain-Barré syndrome; other examples are myelopathy/inferior spastic paraparesis, myasthenic severe myasthenia, acute inflammatory demyelinating polyneuropathy and chronic inflammatory demyelinating polyneuropathy;

cardiac and pulmonary diseases such as fibrous alveolitis, bronchiolitis obliterans, allergic aspergillosis, cystic fibrosis, Loeffler's syndrome, myocarditis and pericarditis; other examples are pulmonary hypersensitivity and secondary paraneoplastic syndrome due to lung cancer;

allergic diseases such as bronchial asthma and hyper-IgE syndrome; another example is transient blindness;

eye diseases such as idiopathic chorioretinitis;

infectious diseases such as parvovirus B infection (including hands-and-socks syndrome); and obstetric and gynecological diseases such as recurrent miscarriage, recurrent fetal loss and intrauterine growth restriction; another example is secondary paraneoplastic syndrome due to gynecological neoplasms (tumors);

reproductive dysfunction in men, such as secondary paraneoplastic syndrome due to testicular tumors; and transplantation-induced disorders such as allograft and xenograft rejection and homologous disease.

In one embodiment of the invention, the disease is an inflammatory, immune/and/or autoimmune disease selected from ulcerative colitis, Crohn's disease, juvenile diabetes, immune thrombocytopenia such as acute idiopathic thrombocytopenic purpura, and hemolytic anemia (including autoimmune hemolytic anemia), severe pseudoparalytic myasthenia gravis, systemic sclerosis and pemphigus vulgaris.

In another embodiment, the antibodies of the invention can be used to detect levels of CD20 or levels of cells that contain CD20 on the surface of the cell membrane, these levels can then be correlated with certain disease symptoms. Alternatively, antibodies can be used to deplete or interfere with the function of cells expressing CD20, thereby recruiting these cells as important mediators of disease. This can be achieved by contacting the sample and control sample with an anti-CD20 antibody under conditions that promote the formation of a complex between the antibody and CD20. Any complexes formed between the antibody and CD20 in the sample and control samples are detected and compared.

Human antibodies of the invention may first be tested for binding activity associated with therapeutic or diagnostic use in vitro. For example, antibodies can be tested using liquid cytometry methods described in the Examples below. In addition, the activity of antibodies can be analyzed when engaging at least one mediator-mediated effector cell activity, including inhibition of growth and/or killing of CD20-expressing cells. For example, the ability of antibodies to enable CDC and/or apoptosis can be analyzed. Assay protocols for CDC, homotypic adhesion, molecular clustering, or apoptosis are described in the examples below.

In addition, the human antibodies of the invention have utility in the therapy and diagnosis of a number of diseases associated with CD20. For example, human antibodies can be used to detect in vivo or in vitro one or more of the following biological activities: inhibition of growth and/or differentiation of cells expressing CD20; killing of cells expressing CD20; mediating phagocytosis or ADCC of a cell expressing CD20 in the presence of human effector cells; mediating CDC of a cell expressing CD20 in the presence of complement; mediating apoptosis of a CD20-expressing cell; induction of homotypic adhesion; and/or induction of translocation into lipid rafts upon CD20 binding.

In a particular embodiment of the invention, human antibodies are used in vivo for the treatment, prevention or diagnosis of a number of diseases caused by CD20. Examples of diseases caused by CD20 include, among others, B cell lymphoma, such as NHL, and immune diseases, such as autoimmune diseases, such as the diseases described above.

In a particular embodiment, the antibodies of the invention are used to treat or prevent NHL because the antibodies deplete CD20-bearing tumor cells).

Non-Hodgkin's lymphoma is a type of B-cell lymphoma. Lymphomas, such as B-cell lymphomas, are a group of related cancers that occur when a lymphocyte (blood cell) becomes cancerous. The normal function of lymphocytes is to protect the body from invaders: microorganisms, viruses, fungi, even cancer. There are many subtypes and stages of lymphocyte maturation and therefore there are many types of lymphomas. Like normal cells, malignant lymphocytes can migrate to various parts of the body. Typically, lymphoma cells form tumors in the lymphatic system: bone marrow, lymph nodes, spleen and blood. However, these cells can migrate to other organs. Some types of lymphoma tend to grow in areas where a normal cell would be found. For example, follicular NHL tumors usually form in the lymph nodes.

Typically, elevated levels of CD20 are expressed on neoplastic (ie, tumorigenic) B cells associated with NHL. Accordingly, the CD20-binding antibodies of the invention can be used to deplete CD20-bearing tumor cells that lead to NHL, and thus can be used to prevent or treat this disease.

Human antibodies (eg, human monoclonal antibodies, polyspecific and bispecific molecules) of the present invention can also be used to block or suppress other effects of CD20. It is known, for example, that CD20 is expressed on B lymphocytes and is involved in the proliferation and/or differentiation of these cells. Because lymphocytes function as immunomodulators, CD20 is an important target for antibody-mediated therapy against B lymphocyte targets, such as inactivation or killing of B lymphocytes involved in autoimmune disorders. Such autoimmune disorders include, for example, the diseases listed above.

Suitable methods for administering the antibody compositions (eg, human monoclonal antibodies, multispecific and bispecific molecules and immunoconjugates) of the invention in vitro and in vivo are well known in the art and can be selected by one of ordinary skill in the art. For example, antibody compositions can be administered by injection (eg, intravenous or subcutaneous). Suitable

- 35 043675 dosages of molecules depend on the age and weight of the subject and on the concentration and/or composition of the antibody composition.

In addition, tumor burden can be determined and used to calculate appropriate doses.

As described previously, the human anti-CD20 antibodies of the invention can be used in conjunction with one or more therapeutic agents, for example, a cytotoxic agent, a radiotoxic agent, or an immunosuppressant. The antibody may be associated with the agent (as an immunocomplex) or may be used separately from the agent. In the latter case (separate use), the antibody may be administered before, after, or simultaneously with the agent, or may be used in conjunction with other known therapies, such as anticancer therapies such as radiation. Such therapeutic agents include, among others, antineoplastic agents such as doxorubicin, cisplatin, bleomycin, carmustine, chlorambucil and cyclophosphamide. The combined use of human anti-CD20 antibodies of the present invention with chemotherapeutic agents provides two anti-cancer agents that work through different mechanisms, thereby exerting a cytotoxic effect on human tumor cells. Such co-administration may overcome problems arising from the emergence of drug resistance or changes in the antigenicity of tumor cells, making them non-reactive to the antibody.

Target-specific effector cells, for example, effector cells associated with the compositions (eg, human antibodies, polyspecific and bispecific molecules) of the invention, can also be used as therapeutic agents. The target effector cells may be human leukocytes such as macrophages, neutrophils or monocytes. Other cells include eosinophils, natural killer cells, and other cells bearing the IgG or IgA receptor. If necessary, effector cells can be obtained from the subject undergoing treatment. Target-specific effector cells can be used as a cell suspension in a physiologically acceptable solution. The number of introduced cells can be on the order of ^108-109 , but varies depending on the goals of therapy. In general, the amount should be sufficient to localize to a target cell, such as a tumor cell expressing CD20, and to cause cell death, such as by phagocytosis.

To remove target cells, therapy with target-specific effector cells can be performed in combination with other methods. For example, antitumor therapy using compositions (eg, human antibodies, polyspecific and bispecific molecules) of the invention and/or effector cells armed with these compositions can be used in combination with chemotherapy. In addition, combination immunotherapy can be used to target two separate populations of cytotoxic effector cells to reject tumor cells. For example, anti-CD20 antibodies coupled to anti-FcyRI or anti-CD3 antibodies can be used in combination with agents that specifically bind to IgG or IgA receptors.

The bispecific and polyspecific antibodies of the invention can also be used to modulate the levels of FcyR and FcaR on effector cells, for example, by capping and eliminating cell surface receptors. Anti-Fc receptor mixtures can also be used for this purpose.

Compositions (eg, human antibodies, multispecific and bispecific molecules and immunoconjugates) of the invention that contain complement binding sites, such as IgG1, -2 or -3 or IgM regions that bind complement, can also be used in the presence of complement. In one embodiment of the invention, ex vivo treatment of a population of cells containing target cells with the coupling agent of the invention and corresponding effector cells can be supplemented by the addition of complement or serum containing complement. Phagocytosis of target cells coated with the binding agent of the invention can be enhanced by binding complement proteins. In another embodiment, target cells coated with the compositions (ie, human antibodies, polyspecific and bispecific particles) of the invention can also be lysed using complement. In yet another embodiment, the compositions of the invention do not activate complement.

The compositions (eg, human antibodies, polyspecific and bispecific molecules and immunoconjugates) of the invention can also be administered with complement. Accordingly, compositions containing human antibodies, polyspecific or bispecific molecules and serum or complement are included within the scope of the invention. The advantage of these compositions is that complement is located in close proximity to human antibodies, polyspecific or bispecific molecules. Alternatively, human antibodies, polyspecific or bispecific molecules of the invention and complement or serum can be administered separately. Binding of the compositions of the present invention to target cells causes translocation of the CD20 antigen-antibody complex into lipid rafts of the cell membrane. This translocation creates a high density of antigen-antibody complexes that can effectively activate and/or increase CDC.

- 36 043675

Also included within the scope of the present invention are kits containing the antibody compositions of the invention (eg, human antibodies and immunoconjugates) and instructions for use. In addition, the kit contains one or more additional reagents, such as an immunosuppressant, a cytotoxic agent or a radiotoxic agent, or one or more additional human antibodies of the invention (eg, human antibodies with complementary activity).

Thus, patients undergoing treatment with antibody compositions of the invention may be additionally administered (before, concurrently, or after administration of a human antibody of the invention) another therapeutic agent, such as a cytotoxic or radiotoxic agent, that enhances or enhances the therapeutic effect of the human antibodies.

In other embodiments of the present invention, the subject may be further treated with an agent that modulates, eg, increases or suppresses, the expression or activity of Fcy or Fca receptors, such as a cytokine. Preferred cytokines for use during treatment with multispecific molecules include granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), interferon-γ (IFN-γ) and tumor necrosis factor (TNF).

The compositions (eg, human antibodies, polyspecific and bispecific molecules) of the invention can also be used to target cells expressing FcyR or CD20, for example, to label such cells. For this purpose, the coupling agent can be combined with a molecule that can be detected. Thus, the invention includes methods for localizing ex vivo or in vitro cells expressing Fc receptors such as FcyR or CD20. The detectable label may be, for example, a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor.

In a particular embodiment, the invention includes methods for detecting the presence of CD20 antigen in a sample or determining the amount of CD20 antigen by contacting the sample and control sample with a human monoclonal antibody that specifically binds CD20, under conditions that promote the formation of a complex between the antibody or portion thereof and CD20 . Complex formation is then detected, with the difference in complex formation between the sample and the control sample being an indication of the presence of CD20 antigen in the sample.

In other embodiments, the present invention includes methods of treating a disorder involving CD20 expressing cells in a subject, such as non-Hodgkin's lymphoma or rheumatoid arthritis, by administering the human antibodies described above to the subject. Such antibodies and their derivatives are used to inhibit CD20-stimulated activities associated with certain disorders, such as proliferation and/or differentiation. When the antibody is contacted with CD20 (eg, when the antibody is administered to a subject), the ability of CD20 to promote activity is inhibited and thus the associated disorder is treated.

Accordingly, in another embodiment, the present invention includes a method of treating or preventing a tumorigenic disorder involving cells expressing CD20, such as NHL. The method involves administering to a subject an antibody composition of the present invention in an amount effective to treat or prevent the disorder. The antibody composition may be administered alone or together with another therapeutic agent, such as a cytotoxic or radiotoxic agent that interacts with or acts synergistically with the antibody composition, to treat or prevent diseases involving CD20-expressing cells. In a particularly preferred embodiment, the present invention covers a method of treating non-Hodgkin's lymphoma.

In another embodiment, the present invention provides a method for treating or preventing an autoimmune disorder involving cells expressing CD20, such as the diseases listed above. The method comprises administering to a subject an antibody composition of the present invention in an amount effective to treat or prevent the disorder. The antibody composition may be administered with another therapeutic agent, such as an immunosuppressant, that interacts with or acts synergistically with the antibody composition to treat or prevent a disease involving CD20-expressing cells.

In yet another embodiment, the invention provides a method for detecting the presence or number of cells expressing CD20 in vivo or in vitro. The method includes (i) administering to a subject a composition (eg, a poly- or bispecific molecule) of the invention conjugated to a detectable marker; (ii) exposing the subject to means of detecting said detectable marker to identify regions containing cells expressing CD20.

In yet another embodiment, the immunoconjugates of the invention can be used to target compounds (eg, therapeutic agents, tags, cytotoxins, radiotoxins, immunosuppressants, etc.) to cells with CD20 expressed on their surface by binding such compounds to an antibody. Thus, the invention also covers ex vivo or in vitro localization methods

- 37 043675 cells expressing CD20, such as Reed-Sternberg cells (eg, with a detectable label such as a radioisotope, fluorescent compound, enzyme or enzyme cofactor). Alternatively, immunoconjugates can be used to kill cells containing CD20 expressed on their surface by targeting cytotoxins or radiotoxins to CD20.

The present invention is further illustrated by the following examples, which should not be construed as limiting.

Examples

B cell lines used in the examples

Line cells Origin Received from Daudi African Burkitt's lymphoma ECASS (Daudi) ARH-77 Leukemia (IgG type) plasma cells (85011437) DCMZ (ACC 512) DOHH Refractory immunoblastic B- DCMZ (ACC 47) Rayi cellular lymphoma African Burkitt's lymphoma ECASS (Raji) SU-DHL-4 B- NHL, diffuse histiocytic (85011429) DCMZ (ACC 495) Ramos-EHRB lymphoma Burkitt's lymphoma ECASS Tanoue Human B cell leukemia (85030804) DCMZ (ACC 399)

Daudi, ARH-77, DOHH, Raji, Ramos-EHRB and Tanoue B cell lines were cultured in RPMI 1640 culture medium supplemented with 10% fetal calf serum (FCS) (Optimum C241, Wisent Inc., st. Bruno, Canada), 2 mM L-glutamine, 100 IU/ml penicillin, 100 μg/ml streptomycin, and 1 mM sodium pyruvate (all Gibco BRL, Life Technologies, Paisley, Scotland).

The SU-DHL-4 cell line was cultured in the same medium but without sodium pyruvate.

Cultures are incubated in a humidified 5% CO2 incubator at 37°C, split and harvested at 80-90% monolayer. The medium is replaced with fresh one twice a week. At this time, cells are digested and seeded at a density of 1-1.5 x 10 ⁶ cells/ml to ensure survival and optimal growth.

Example 1. Preparation of human antibodies against CD20.

HCo7 and KM mice.

Fully human monoclonal antibodies to CD20 are produced using HCo7 and KM mice that express human antibody genes. In the KM mouse strain, endogenous murine kappa light chain is homozygously separated as described in Chen et al. (1993) EMBO J 12:811-820, and the endogenous murine heavy chain was homozygously separated as described in PCT Example 1 of published International Application WO 01/09187. This mouse strain carries the human-derived kappa light chain transgene, KCo5, described in Fishwild et al. (1996) Nature Biotechnology 14:845–851. This mouse strain also carries a heavy chain of human origin in the transchromosome, consisting of the hCF fragment (SC20) of chromosome 14, as described in International Application WO 02/43478.

HCo7 mice have a JKD gap in the endogenous light chain (kappa) genes (as described in Chen et al. (1993) EMBO J. 12: 821-830), a CMD gap in the endogenous heavy chain genes (as described in example 1 in the International WO 01/14424), the KCo5 light chain kappa transgene of human origin (described in Fishwild et al. (1996) Nature Biotechnology 14:845-851), and the HCo7 heavy chain transgene of human origin (described in US Pat. No. 5,770,429).

Immunization of mice with HCo7 and KM.

HCo7 and KM mice are immunized with NS/O cells transfected with the human CD20 gene. For the first immunization of one mouse, 1x107 cells in 150 μl PBS are mixed 1:1 with Freund's complete adjuvant and injected intraperitoneally (i.p.). Subsequent i.p. immunizations are carried out by introducing the same number of cells without an adjuvant. Three or two days before fusion, mice are given a booster injection of 0.5 x 107 cells suspended in PBS.

The presence of anti-human CD20 antibodies in mouse serum is monitored by flow cytometry by FACS analysis using NS/0 cells transfected with the human CD20 gene as well as CD20-negative parental NS/0 cells.

Generation of hybridomas producing human monoclonal antibodies to CD20.

Mouse splenocytes were isolated from HCo7 and KM mice and fused to a murine myeloma cell line using PEG according to a standard protocol. The resulting hybridomas are then screened for IgG,K production by ELISA and for CD20 specificity by FACS analysis using CD20-transfected NS/0 and SKBR3 cells. Single-cell suspensions of splenic lymphocytes from immunized mice are fused (hybridized) with one-fourth of non-SP2/0-secreting murine myeloma cells (ATCC, CM 1581) in the presence of 50% PEG (Sigma). Cells are seeded into flat-bottom microtiter plates at a density of approximately 1 x 10 ⁵ /well and incubated for approximately two weeks in selective medium containing 10% fetal bovine serum, 10% P388D1 (ATCC, CRL TIB-63) conditioned medium , 3-5% origen (IGEN) in DMEM (Mediatech, CRL 10013, high glucose, L-glutamine and sodium pyruvate) plus 5 mM HEPES, 0.055 mM 2-mercaptoethanol, 50 mg/ml gentamicin and 1 x HAT (Sigma, CRL P-7185). After 1-2 weeks, the cells are cultured in a medium in which HAT is replaced by NT. Individual wells are then screened by flow cytometry for human anti-CD20 monoclonal IgG antibodies. After the start of intensive growth of the hybridoma, monitoring of the environment is carried out, as a rule, after 10-14 days. Antibody-secreting hybridomas are plated, screened again and, if still positive for human IgG, anti-CD20 monoclonal antibodies are subcloned at limited dilution. Stable subclones are then cultured in vitro to produce small amounts of antibodies in tissue culture medium for characterization. One clone of each hybridoma is selected that retains the reactivity of the parent cells (FACS analysis). A bank of 5-10 ampoules of each clone is obtained and stored in liquid nitrogen.

Selection of binding of human monoclonal antibodies to CD20/Primary screening.

To determine the isotype of antibodies, an isotype ELISA assay is performed. Microtiter plate wells are coated with 1 μg/ml mouse anti-human kappa light chain antibody, 50 μl/well in PBS, incubated at 4°C overnight. After blocking with 5% chicken serum, the contents of the plates are reacted with the supernatant and purified isotype control. The plates are then incubated at room temperature for 1-2 hours. The contents of the wells are reacted with horseradish peroxidase-conjugated probes specific for human IgG1, IgG2, IgG3 or IgG4. Plates were processed and analyzed as described above.

Four hybridoma cell lines are obtained, three obtained from the fusion of KM mouse cells, and one from the fusion of HCo7 mouse cells, expressing the following antibodies:

2F2: human monoclonal IgG1,K antibody with nucleotide sequences: SEQ ID NO: 1 and 3 and amino acid sequences: SEQ ID NO: 2 and 4.

4C9: human monoclonal IgG1,K antibody with exactly the same amino acid sequences as 2F2. SEQ ID NO: 2 and 4.

7D8: Human monoclonal IgG1,K antibody with nucleotide sequences: SEQ ID NO: 5 and 7 and amino acid sequences: SEQ ID NO: 6 and 8.

11B8: human monoclonal IgG3,K antibody with nucleotide sequences: SEQ ID NO: 9 and 11 and amino acid sequences: SEQ ID NO: 10 and 12.

The term 2F2 is used to refer to both the antibody from hybridoma clone 2F2 and the identical antibody from hybridoma clone 4C9.

The antibodies of the invention can be switched to other isotypes determined using the transgenic or transchromosomal non-human animal from which they are derived. In one embodiment of the invention, the 11B8 human monoclonal IgG3,K antibody can be switched to a human IgG1,K isotype monoclonal antibody having exactly the same V _H and V _L sequences. In another embodiment of the invention, the 2F2 IgG1,K antibody or the 7D8 IgG1,K antibody can be switched to human IgG2, IgG4, IgA1, IgA2 or IgE isotype monoclonal antibodies having exactly the same V _H and V _L sequences.

Example 2: Sequencing of human anti-CD20 antibodies (primary sequence determination).

Sequencing of V _L and V _H regions.

Obtaining RNA. Total RNA was prepared from 5 x 10 ⁶ of all HuMAb CD20 hybridoma cell lines (2F2, 7D8 and 11B8) using the RNeasy kit (Qiagen, Westburg, Leusden, Netherlands) according to the manufacturer's protocol.

Preparation of 2F2 and 7D8 cDNAs: 5'-RACE complementary DNA (cDNA) from RNA template was prepared from 1 μg of total RNA using the SMART RACE cDNA Amplification Kit (Clonetech) according to the manufacturer's protocol.

The V _H and V _L regions are amplified taking advantage of the HF 2 PCR kit (Clonetech, BD) and using the following primers:

Vk RACE2 5' GCA GGC ACA CAA C AG AGG C AG TTC C AG ATT TC annealed in C-kappa

V _H RACE2 5' GCT GTG CCC CCA GAG GTG CTC TTG GAG G annealed in C _Hf

- 39 043675

Obtaining cDNA of 11B8 cells. Complementary DNA (cDNA) from the RNA template of 11B8 cells was obtained from 3 μg of total RNA using AMV reverse transcriptase with buffer (Roche Diagnostics GmbH, Mannheim, Germany), d(T) ₁₅ oligomer (Promega, Madison, WI, USA), dNTP (Roche Diagnostics GmbH, Mannheim, Germany) and RNAsin (Promega) according to the manufacturer's protocol.

(2000, version 3).

PCR primers used to amplify the VH and VL regions for cloning: Primer pairs used:

Vh: FR1 5' primers

AB62 CAg gTK CAg CTg gTg CAg TC

AB63 SAg gTg CAg CTg KTg gAg TC

AB65 gAg gTg CAg CTg gTg CAg TC

Un leader 5' primers

AB85 ATg gAC Tgg ACC Tgg AgC ATC

AB86 ATg gAA TTg ggg CTg AgC Tg

AB87 ATg gAg TTT ggR CTg AgC Tg

AB88 ATg AAA CAC CTg Tgg TTC TTC

AB89 ATg ggg TCA ACC gCC ATS CT

Vh 3' primer

AB90 TgC CAg ggg gAA gAC CgA Tgg

Vk: FR1 5' primers

AB8 RAC ATC CAg ATg AYC CAg TC

AB9 gYC ATC YRg ATg ACC CAg TC

AB 10 gAT ATT gTg ATg ACC CAg AC

AB 11 gAA ATT gTg TTg ACR CAg TC

AB 12 gAA ATW gTR ATg ASA CAg TC

AB 13 gAT gTT gTg ATg ASA CAG TC

AB 14 gAA ATT gTg CTg ACT CAg TC

UK leader 5' primers

AB123 CCC gCT Cag CCC CTg ggg CCC CTg

AB124 CCC TgC TCA gCT CCT ggg gCT gC

AB 125 CCC AgC gCA gCT TCT CTT CCT CCT gC

AB 126 ATg gAA CCA Tgg AAg CCC CAg CAC AgC

Vk 3' primer

AB 16 Cgg gAA gAT gAA gAC AgA Tg where K^ or G, S=C or G, R=A or G, Y=C or T and W=A or T.

PCR conditions for amplification of the VH and VL regions for cloning 2F2 and 7D8. Polymerase chain reaction (PCR) was carried out with HF polymerase mixture (Clonetech.) in a T1 thermoblock (Biometra, Westburg).

- 40 043675

PCR conditions:

°C 30 sec 5 cycles °C 1 min °C 30 sec °C 30 sec 5 cycles °C 1 min °C 30 sec °C 30 sec 27-30 cycles °C 1 min

PCR conditions for amplification of the V _H and VL regions for cloning 11B8. Polymerase chain reaction (PCR) was performed with AmpliTaq polymerase (Perkin Elmer) in a T1 thermoblock (Biometra, Westburg, Leusden, Netherlands).

PCR cyclization protocol:

°C 2 min cycles 70 °C 30 sec °C 30 sec, minus 1 °C per cycle °C 30 sec cycles 94 °C 30 sec °C 30 sec °C 30 sec °C 10 min cool to 4 °C

Cloning of V _H and V _L in pGEMT vector system II (2F2, 7D8 and 11B8).

After analysis of the PCR products on an agarose gel, the products were purified using the QIAEX II Gel Extraction Kit (Qiagen, Westburg, Leusden, Netherlands). Two independently amplified PCR products from each V _H and VL region were cloned into the pGEMT vector system II (Promega) according to the manufacturer's protocol. (1999, version 6).

After transformation into E coli JM109, individual colonies were screened by colony PCR using primers T7 and SP6, 30 cycles of annealing at 55°C. Plasmid DNA from colonies is purified using the Qiaprep Spin miniprep kit (Qiagen). To further analyze the V _H and V _L regions, Nco1/Not1 digestion was performed (NE Biolabs, Westburg, Leusden, Netherlands) and analyzed on an agarose gel.

Sequencing (2F2, 7D8 and 11B8). The V regions are sequenced after cloning into the pGBMT vector system II. Sequencing was performed on Baseclear (Leiden, Netherlands). Sequences were analyzed by germline V gene sequence alignments on Vbase (www.mrccpe.cam.ac.uk/imt-doc/public/intro. htm), http://www.mrc-cpe.cam.ac.uk/ vbase-ok.php?menu=901.

The resulting sequences are shown in Fig. 53-58.

Example 3. Recombinant production of 2F2 and 11B8 in the GS-NS/0 cell line.

2F2T. The heavy and light chain variable regions of the 2F2 antibody were amplified by PCR using a standard cloning vector, pGem-5Zf (Promega), using primers containing the optimal Kozak sequence and suitable restriction sites for cloning the fragments into the pCONY1 and PCONk (Lonza) GS constant region vectors.

After amplification, the fragments are purified and digested with restriction enzymes for cloning and ligated into two vectors. The heavy chain variable region fragment is digested with Hind III and Bsi WI and ligated into the pCONy1 vector, which is digested with Hind III and Bsi WI and dephosphorylated with alkaline phosphatase. The light chain variable fragment is cleaved with Hind/III and Ara I and ligated into the PCONk vector, which is cleaved with Hind III and Ara I and dephosphorylated with alkaline phosphatase. Vectors pCONγ1f/heavy chain variable domain and PCONK/light chain variable domain are shown in FIG. 1 and 2, respectively. Transformed E. coli colonies are screened by colony PCR. 2 positive colonies of each heavy chain (HC) and light chain (LC) construct are grown to isolate the plasmid. The isolated plasmid of these 4 clones was sequenced to confirm the sequence. It was found that both NS clones and one LC clone had the correct sequences.

Two HC constructs and one LC construct are combined to create two LC-HC combinations and transiently transfected into CHO-K! cells to test the constructs for the corresponding production of 41 043675 2P2 antibodies. Normal production levels are achieved for all combinations in this expression experiment, and 1 clone of each of the HC and LC constructs is selected for dual gene vector construction.

To combine HC and LC into a dual gene cloning vector, designated pCONy1f/K2F2, by ligating the complete expression cassette from the heavy chain vector, pCONγ1f/heavy chain variable domain, into the light chain vector, PCONK/light chain variable domain. Vector pCONy1f/K2F2 is shown in FIG. 3.

11V8T. The GS-NS/0 cell line was similarly established for recombinant production of 11B8 (designated 11B8T) with a slight modification of the procedure below.

Four transfections of NS/0 host cells were performed by electroporation with plasmid DNA using linear plasmid DNA. After examining the resulting colonies under a microscope to confirm that the colonies are the appropriate size for analysis (covering more than 60% of the bottom of the well) and that there is only one colony per well, cell supernatants from the 596 transfectants are screened for collected antibody using IgG,K -ELISA. Using these data, 100 transfectants are selected for development and further evaluation in static culture. Cultures of selected cell lines are grown and adapted to low serum medium (bovine serum albumin (BSA) medium supplemented with 1% dFCS) and further assessed for productivity in static culture (ELISA and percentage monolayer determination). The 60 highest ranking cell lines are selected for development (growing), and an additional 13 cell lines for which no performance data are available are also taken for further study (culture). Preliminary assessment of the productivity of selected cell lines is carried out in a suspension culture placed in an intermittently shaken flask in a low-serum medium (medium containing bovine serum albumin (BSA) supplemented with 1% dFCS). Based on the concentration of antibody collected (by ELISA) and acceptable growth characteristics, 10 cell lines are selected for further evaluation in suspension cultures (medium containing bovine serum albumin (BSA) supplemented with 1% dFCS) placed in a fed-batch shake flask. Product concentrations at collection are determined by high-performance liquid chromatography (HPLC) with protein A using well-known standard methods. As a result, one of the cell lines is discarded. All 9 cell lines obtained produced antibody 11B8 (designated 118BT) with good yields in the range of 354-771 mg/L, as determined by Protein A HPLC.

Example 4: Comparison of 2F2 hybridoma antibody and recombinant 2F2T transfectome antibody.

Using gel electrophoresis (SDS-PAGE and native agarose gel electrophoresis), it was shown that 2F2 and 2F2T have the same size and only slightly different electrical charges.

In addition, 2F2 and 2F2T bind to CD20-transfected NS/0 cells and Raya cells with similar affinity as demonstrated by flow cytometry using FACScalibur™ (Becton Dickinson, San Diego, CA, USA). No binding to untransfected NS/0 cells was observed, demonstrating the specificity of 2F2 and 2F2T. 2F2 and 2F2T also induce CDC in a concentration-dependent manner to the same extent as in ARH-77 cells (IgG type of plasma cell leukemia), Daudi cells, DOHH cells (refractory immunoblastic B cell lymphoma, grown from follicular centroblastic/centrolytic cells ) lymphoma, DSMZ, Braunschweig, Germany), Raya cells, by measuring cell lysis (number of PI-positive cells) by flow cytometry (FACScalibur). In the second experiment, the concentrations of 2F2 and 2F2T are kept constant while varying concentrations of serum are added. There are no noticeable differences between 2F2 and 2F2T.

Finally, 2F2 and 2F2T, bound to cell-associated CD20, form a strong and equally strong association with complement factor C1q. The experiment is carried out on Daudi cells, DOHH cells and Raya cells using polyclonal antibodies against C1q to detect binding to C1q.

Example 5 Binding characteristics of human anti-CD20 antibodies.

Binding to various cell lines. NS/0, NS/0 cells transfected with human CD20, Daudi and Raya cells were incubated for 30 min at 4°C with culture supernatant containing human antibodies 2F2, 7D8 and 11B8, followed by incubation with FITC-conjugated Ab against human IgG. Binding was assessed by flow cytometry on a FACScalibur flow cytometer. Fluorescence intensities are compared to negative isotype control samples. As shown in FIG. 4, all three antibodies bind to NS/0 cells transfected with human CD20, whereas no binding is observed in parental untransfected NS/0 cells. All three antibodies also bind to two different B cell lines (Raji and Daudi), indicating that antibodies 2F2, 7D8, and 11B8 are specific for CD20. Supernatants containing 7D8 or 11B8 are analyzed under unsaturated conditions, therefore, a lower intensity is observed compared to C2F2.

EC50 value of 2F2 antibody determined by flow cytometry. To determine the average (apparent) affinity of 2F2 for CD20 expressed on human B cells, a 2F2 binding curve was constructed using isolated PBMCs (peripheral blood mononuclear cells) from three human donors and selecting the passage of CD3 negative cells. Isolated PBMCs were incubated for 1 hour with 2F2-labeled FITC at a range of concentrations and analyzed by FACS to determine the mean fluorescence intensity (MFI). The MFI values are shown in Fig. 5A and 5B as a function of antibody concentration. EC ₅₀ values are calculated by nonlinear regression using Graph Pad Prism 3.02. The EC ₅₀ 2F2 value for humans is similar for all three donors, the mean value (± sem (standard error)) is 287 ± 12.7 ng/ml (1.9 ± 0.1 nM).

Binding of ^125I- labeled mAbs to CD20-expressing cells.

mAbs (monoclonal antibodies) are iodinated using iodine beads (Pierce Chemical Co., Rockford, IL). ^125I -labeled mAbs are serially diluted and incubated with Ramos-EHRB (cells for 2 hours at 37°C in the presence of sodium azide and 2-deoxyglucose to prevent endocytosis. Cell-bound and free ^125I -labeled mAbs are then separated by centrifugation at 14,000 x g for 2 minutes using a mixture of phthalate oils (plasticizers), which give rapid separation without disturbing the equilibrium binding.The deposited cell sediment (pellets) together with the bound antibody are counted in a gamma counter (Wallac UK Ltd, Milton Keynes, UK).

As shown in FIG. 6, 2F2 and 11B8 have similar KD values (or similar saturation points), indicating that both antibodies bind with similar affinity. However, the saturation level of the 11B8 antibody is lower than the saturation level of 2F2, indicating that 11B8 recognizes a different form of CD20. This is also in agreement with another experiment showing that a similar number of 2F2 and rituximab antibody molecules bind to CD20 on Ramos-EHRB cells and Daudi cells, this shows similar levels of binding saturation (approximately 2-3 x 10 ⁵ antibody molecules per cell) . 11B8 and B1, in contrast, saturate at half this level, and only about 1-2x10 ⁵ antibody molecules bind to Ramos-EHRB cells (Fig. 7A) and Daudi cells (Fig. 7B).

To exclude the possibility that iodinated antibodies bind via Fc receptors, binding curves were confirmed using F(ab') ₂ fragments of anti-CD20 antibodies. Again, similar amounts of 2F2 and rituximab-F(ab') ₂ fragments bound to both Ramos-EHRB and Daudi cells. Also in these experiments, the number of 2F2 or rituximab antibody molecules binding to Ramos-EHRB and Daudi cells saturates at approximately twice the number of 11B8 and B1 molecules bound to the cells.

Dissociation rate. To determine the dissociation rate of mAbs, Ramos-EHRB cells (1 ml final volume in the presence of azide/2DOG) are incubated for 2 h at 37°C with 2 μg/ml ¹²⁵ I mAbs until maximum binding is achieved. After centrifugation in a microfuge (2000 rpm for 2 min), the supernatant is removed, and the cell pellet (pellets) is immediately transferred to 9 ml of medium at 37°C in a 15 ml conical tube. At various time points over the next 2 hours, 0.4 ml samples were taken and separated on phthalate oils to determine the level of radiolabeled mAbs remaining on the cell surface. As shown in FIG. 8, both 2F2 and 11B8 dissociate significantly more slowly from their association with CD20 than rituximab or B1.

Dissociation rates of anti-CD20 F(ab) ₂ fragments. Ramos-EHBR cells were saturated using 2 μg/ml ¹²⁵ IF(ab) ₂ labeled antibody fragments 2F2, 11B8 and rituximab, respectively. Ramos-EHBR cells are washed and incubated in the presence of a high concentration of unlabeled antibody. The maximum (initial) binding to Ramos-EHRB cells is set to 100%. At various time points within 3 h after loading (loading, application), 0.4 ml samples were taken and separated on phthalate oil to determine the levels of radiolabeled mAbs remaining on the cell surface. As can be seen in FIG. 9, 2F2 and 11B8 dissociate from the surface of CD20 much more slowly than rituximab. After 90 min, approximately 50% of the rituximab F(ab) ₂ molecules are bound to the cell, while half of the 2F2 F(ab) ₂ molecules dissociate after 3 hours. The k _d (ko _ff ) values for 2F2, 11B8 and rituximab are calculated as follows:

F(ab) ₂ 2F2: k _d = In 2/ti/ ₂ (sec) = In 2/10800 (sec) = 6.4 x 10' ⁵ sec' ¹

F(ab) ₂ 11B8T: k _d = In 2/ti/ ₂ (sec) = In 2/9000 (sec) = 7.7 x 10' ⁵ sec ¹

F(ab) ₂ rshuximab: k _d = In 2/ti/ ₂ (sec) = In 2/5400 (sec) = 1.3 x 10' ⁴ sec' ¹

Functional off' (dissociation) rates of anti-CD20 mAbs. The effect of slow dissociation of 2F2 compared to rituximab was assessed using a functional CDC assay. For this purpose, Daudi or SU-DHL4 cells are preincubated with 10 μg/ml anti-CD20 mAb or isotype control antibody, washed and incubated in the medium for various times. At these time points after the start of the analysis, samples are incubated with complement (normal human serum 20 vol.%), and

- 43 043675 then incubate for a further 45 minutes at 37°C. Cell lysis is then determined on FACS using the PI (propidium iodide) staining method. The % of cells lysed (PI-positive cells) is shown in Fig. 10A (Dowdy cells) or in FIG. 10V (SU-DHL4 cells) as a function of incubation time. 2F2 induces high CDC in both cell types, and still lyses up to 90% of cells after 6 h, indicating that CD20 saturation of cells remains high enough to induce complement-mediated lysis of the majority of cells. In contrast, rituximab, in accordance with the dissociation rate indicated above, quickly dissociates from its associate with the cell and cannot induce specific lysis after a 6-hour incubation. Antibody 11B8 is used as a control and does not induce CDC.

Example 6: CDC of human anti-CD20 antibodies.

Preparation of whey. Complement-dependent lysis serum is prepared by placing the blood of healthy volunteers in autosep gel into clotting activator vacutainer tubes (BD biosciences, Rutherford, NJ), which are kept at room temperature for 30-60 min and then centrifuged at 3000 rpm for 5 min. Serum is collected and stored at -80°C.

Flow cytometry. For flow cytometry, a FACScalibur flow cytometer with CellQuest pro software (BD Biosciences, Mountain view, CA) was used. At least 5000 events are collected for analysis, with cellular debris excluded by adjusting the front side scatter (FCS) boundary.

CDC kinetics. In the first set of experiments (n=3), the CDC kinetics of different B cell lines, namely Daudi, SU-DHL4, Rayi, DOHH and ARH-77, were determined by adding 10 μg/ml 2F2, rituximab and IgG control antibody, respectively, for 10 minutes before adding human serum. At various time intervals (up to one hour) after CDC induction, cells are suspended in PI solution and cell lysis (number of PI-positive cells) is measured by flow cytometry.

The results are shown in Fig. 11A (ARH-77 cells), 11B (Dowdy cells), 11C (Raia cells), 11D (DOHH) and 11E (SU-DHL4). As can be seen, the addition of antibodies causes cell lysis within 5 minutes. It is interesting to note that the addition of 2F2 causes significant - more than 80% - cell lysis in all five B cell lines. Rituximab caused more than 80% cell lysis in the SU-DHL4 and Daudi cell lines only, while cell lysis in the DOHH cell line was ~50% and less than 20% in the ARH-77 and Raya cell lines. No lysis was observed at all in the presence of an IgG control antibody (data only shown in Fig. 11B).

Serum titration for CDC determination. In a separate series of experiments (n=5), NHS (normal human serum) was titrated at two different antibody concentrations: 0.5 μg/ml and 5 μg/ml. Cells were preincubated with 2F2 or rituximab for 10 min before adding NHS at a range of concentrations. 45 min after CDC induction, cells are resuspended in PI solution. Cell lysis (number of PI-positive cells) is measured by flow cytometry. In fig. 12A-D shows the percentage lysed (PI-positive) as a function of NHS concentration. In fig. 12A shows cell lysis of Daudi cells, fig. 12B cell lysis of AKN-77 cells, FIG. 12C cell lysis of DOHH cells and FIG. 12D cell lysis of Raya cells. Increased cell lysis is observed with increasing NHS concentration. The addition of 2F2 causes maximum lysis of Daudi cells at the highest concentrations of NHS and antibody. Rituximab causes approximately 50% cell lysis of Daudi cells at the highest NHS concentration.

In ARH-77 cells, only the highest concentration of NHS and 2F2 caused approximately 75% cell lysis. Lower concentrations are not sufficient to induce cell lysis of ARH-77 cells. Rituximab was unable to induce cell lysis of ARH-77 cells in this experiment.

2F2 can induce NHS concentration-dependent cell lysis of DOHH cells at both high and low concentrations, whereas rituximab cannot induce lysis under these conditions.

Finally, 2F2 induces NHS concentration-dependent cell lysis of Raya cells, which can only be observed at a mAb concentration of 5 μg/ml. No lysis was observed with rituximab.

In these experiments, no lysis was observed with the isotype control antibody.

Antibody titration to determine CDC. To measure the ability of anti-CD20 antibodies to induce CDC at low concentrations, an antibody titration experiment was performed (n=6). The different cell lines were preincubated, respectively, in the presence of 2F2 and rituximab at a range of concentrations for 10 min before adding NHS. After a 45-minute incubation at 37°C (when maximum lysis is achieved), cells are resuspended in PI solution and cell lysis (number of PI-positive cells) is measured by flow cytometry. In fig. 13A (Dowdy cells), 13B (DOHH cells), 13C (ARH-77 cells) and 13D (Raia cells) show the percentage of lysed (PI-positive) cells as a function of antibody concentration. Both 2F2 and rituximab cause a concentration-dependent increase in cell lysis. 2F2 induce more than 80% lysis of Daudi cells with the addition of 2 μg/ml, while in the case of rituximab this level is not reached even after

- 44 043675 addition of 10 mcg/ml. In addition, 2F2 induces more than 80% lysis of DOHH cells at a concentration of 0.4 μg/ml, whereas minimal lysis is observed with rituximab at this concentration. Maximum lysis of DOHH cells by rituximab (~30% of the total number of cells analyzed) was achieved at a concentration of 10 μg/ml. The induction of lysis of ARH-77 cells and Raya cells using 2F2 is lower, but ~70% lysis is still achieved at an antibody concentration of 10 μg/ml. At this highest concentration, rituximab induces lysis of ARH-77 cells by only ~23%, and Raya cells by only ~6%.

In a similar experiment, the ability of 2F2, 2F2T, 11B8T and rituximab to induce CDC in Daudi and Raya cell lines was studied, see FIG. 14A and 14B. This experiment also observed more than 80% lysis of Daudi cells using (transfectome-derived) 2F2T antibodies at a concentration of 10 μg/ml, whereas in the case of rituximab, even at a concentration of 10 μg/ml, only a 60% level of lysis was achieved , Wed fig. 14A. Lysis of Daudi cells using 2F2T is identical to that observed with 2F2 hybridoma.

Lysis of Raya cells is more difficult, but again, in both 2F2 and 2F2T the degree of induction of lysis is similar (Fig. 14B). Rituximab was unable to induce CDC in Raya cells, consistent with the experiment illustrated in FIG. 13D.

As shown in FIG. 14A and 14B, neither Daudi nor Raya cells are sensitive to CDC induced by 11B8T. Antibody B1 induces lysis of Daudi cells, but only to a small extent, and is not able to induce lysis of Raya cells.

CDC activity of anti-CD20 antibodies in Daudi cells. To determine the CDC activity of each antibody, FACS evaluates the increased permeability of cell membranes stained with propidium iodide (PI). Briefly, Daudi cells are washed and resuspended in RPMI/1% BSA culture medium at a density of 1 x 10 ⁶ cells/ml. Various concentrations of human monoclonal antibodies are added to Daudi cells and allowed to bind to CD20 on the cells for 10-15 minutes at room temperature. Serum is then added as a source of complement to a final concentration of 20% by volume and the mixture is incubated for 45 minutes at 37°C. Cells were stored at 4°C until analysis. Each sample (150 μl) is then added to 10 ml of PI solution (10 μg/ml in PBS) in a FACS tube. The mixture was immediately analyzed by flow cytometry. As shown in FIG. 15A, antibodies 2F2 and 7D8 exhibit higher CDC activity compared to rituximab.

In the second experiment, cells were labeled with human monoclonal antibodies as above, then washed and incubated in PBS for 45 min at 37°C before adding human serum. This ensures that only the antibody bound to the cell at the time of serum addition is able to activate complement for cell lysis. As shown in FIG. 15B, with rituximab there is reduced CDC activity compared to 2F2 and 7D8, indicating that the human antibodies (2F2 and 7D8) are not affected by washing the cells before adding serum.

CDC activity of anti-CD20 antibodies in Raya cells. CDC activity is assayed using Raya cells, which have a relatively high surface expression of CD55 and CD59 and are therefore more resistant to complement attack. Human antibodies are added to Raya cells and allowed to bind for 15 minutes. Human serum (20%) is added and the mixtures are incubated for 45 min at 37°C. As shown in FIG. 16A, rituximab does not effectively mediate CDC of Raya cells, whereas significant levels of cell lysis are observed in Raya cells opsonized using 2F2 and 7D8. Therefore, 2F2 and 7D8 have the unique ability to lyse CD55/59 positive target cells.

In a separate experiment, Raya cells were preincubated with saturating concentrations of anti-CD55 mAb (5 μg/ml final concentration) and anti-CD59 mAb (5 μg/ml final concentration) to block the action of these complement defense molecules. Human anti-CD20 antibodies were then added along with serum (20%) as described above for 45 min at 37°C. As shown in FIG. 16B, blockade of CD55 and CD59 molecules causes almost 100% lysis of Raya cells by human antibodies 2F2 and 7D8, whereas only a 25% increase in cell lysis is observed with rituximab.

Role of complement inhibitors I - Expression of surface molecules:

Since complement inhibitors such as CD55 and CD59 appear to play an important role in sensitivity to rituximab-induced CDC, an experiment was conducted to determine the expression of these molecules in the B cell lines studied (Rayi, Daudi, DOHH, ARH-77 and SU- DHL4).

Cells were stained with FITC-conjugated antibodies against CD55, CD59, and CD20, and molecular expression was analyzed by flow cytometry. The results are shown in the table below. 1.

- 45 043675

Table 1

Expression CD20 CD55 CD59 ARH-77 ++ ++++ ++ Rayi + ++ +++ DOHH ++ +++ ++ SU-DHL4 +++ + ++ Daudi ++ + +

The role of complement II inhibitors is blockade of CD55 and CD59. To further examine the role of CD55 and CD59 in CDC induced against CD20, both complement inhibitor molecules were blocked with specific antibodies before CDC induction (n=3). Raya cells are used since 2F2 alone causes only partial lysis. Raya cells (1 x 10 ⁵ cells/50 μl) were preincubated with 2F2 and rituximab at a range of concentrations along with antibodies against CD55 95 μg/ml) and CD59 (5 μg/ml) for 10 min before adding the NHS pool (20 %). 45 min after CDC induction, cells are resuspended in PL solution. Cell lysis (number of PI positive cells) is measured by flow cytometry. In fig. 17A-C show the percentage of lysed (PI positive cells) as a function of antibody concentration and show one experiment which is an example of three experiments. In fig. 17A shows incubation of Raya cells with anti-CD55 antibody, FIG. 17B shows incubation of Raya cells with anti-CD59 antibody and FIG. 17C shows incubation of Raya cells with antibodies against CD55 and CD59.

As can be seen in FIG. 17A, addition of anti-CD55 antibody does not affect CDC induced by 2F2 or rituximab. Addition of anti-CD59 antibody increases the sensitivity of cells to both 2F2 and rituximab by approximately 30% (Fig. 17B). The addition of both anti-CD55 and anti-CD59 antibodies further increased cell lysis induced by anti-CD20 antibodies by approximately 30% (Figure 17C).

The role of complement factors determined by flow cytometry I - C1q binding. Antibodies against CD20 (2F2 and rituximab) and isotype control antibody are added to various B cell lines. Incubate for 10 min and add NHS (1 vol.%). Incubate for an additional 10 min at 37°C and the cells are washed, the supernatant is discarded, and the cell pellets are incubated with FITC-conjugated anti-C1q antibody. Average fluorescence intensity data from cells stained with C1q are shown in FIG. 18A (Dowdy), 18B (ARH-77), 18C (DOHH) and 18D (Rayi) (n=6). The results indicate an antibody concentration-dependent increase in C1q binding by the 2F2 antibody, regardless of the B cell line examined. In addition, C1q binding by antibody 2F2 was consistently higher than binding by rituximab in all cell lines studied. With the isotype control antibody, no increase in mean fluorescence was observed (data not shown).

The role of complement factors determined by flow cytometry II - Activation of complement along the classical pathway. Fixation of C4c on cells with a film of antibodies is an indicator of complement activation along the classical pathway. Antibodies against CD20 (2F2 and rituximab) and isotype control antibody are added to various B cell lines. Incubate at 37°C for 10 min, add NHS (1 vol/%). After additional incubation and washing of the cells, the supernatant was discarded and the cell pellet was incubated with FITC-conjugated anti-C4c antibody. Average fluorescence intensity data for cells stained with C4c are shown in FIG. 19A (Dowdy), 19B (ARH77), 18C (DOHH) and 18D (Rayi) (n=6). Fixation of complement factor C4c to 2F2 was demonstrated in all B cell lines tested (n=3), with a maximum achieved at an antibody concentration of ~1 μg/ml. Fixation of C4c after binding to 2F2 is significantly higher than with rituximab, regardless of the cell line tested. With the isotype control antibody, no increase in mean fluorescence was observed (data not shown).

CDC in heat-inactivated serum. Cells (Daudi cells, ARH-77 cells or Raya cells) and antibodies (rituximab, 2F2, 2F2T, 11B8 and isotype control antibody HuMab-KLH IgG1) are preincubated within the range of anti-CD20 antibody concentrations for 10 min and then NHS (active or heat-inactivated in a water bath at 57°C for 30 min). 45 min after CDC induction, cells are resuspended in PI solution. Cell lysis (number of PI-positive cells) was determined by flow cytometry. In the presence of heat-inactivated serum, regardless of the cell line and anti-CD20 antibody used, no cell lysis was observed, and no CDC was observed in the presence of heat-inactivated serum.

Example 7 ADCC Human Anti-CD20 ADCC Assay I.

Enrichment of human neutrophils. Polymorphonuclear cells (neutrophils, PMN) are enriched from heparinized whole blood. The blood is diluted twice in RPMI 1640 and applied in layers onto

- 46 043675

Ficoll (Lymphocyte Separation Medium, 1077 g/ml, 710 g, RT (room temperature), 20 min; BioWhittaker, cat. 17-829E, lot no. 014832) and centrifuged at 2000 rpm in for 20 minutes. The layer of mononuclear cells is removed and the red blood cells in the sediment (pellets) containing neutrophils are lysed in a hypotonic solution using an ice-cold NH ₄ Cl solution (155 mM NH ₄ Cl, 10 mM NaHCO ₃ , 0.1 mM EDTA, pH 7.4). The remaining neutrophils are washed twice and resuspended in RPMI 1640 medium supplemented with 10% FCS (RPMI-10).

Enrichment of human peripheral blood mononuclear cells. Human blood is diluted twice in RPMI 1640 and the blood cells are layered onto Ficoll (Lymphocyte Separation Medium) 1077 g/ml, 710 g, RT (room temperature), 20 min; BioWhittaker, Cambrex Bio Science Venders, Verviers , Belgium, cat. 17-829E, lot no. 014832). Peripheral blood mononuclear cells (MNC) are collected from interphase, washed and resuspended in RPMI 1640 culture medium supplemented with 10% FCS, 2 mM L-glutamine, 5 U/ml penicillin, 50 μg/ml streptomycin (all from BioWhittaker), to which added 25 mM HEPES (BioWhittaker).

Conducting ADCC analysis. Target B cells (freshly isolated B cells or B cell lines) are labeled with 20 μCi of ⁵¹ Cr (Amersham Biosciences, Uppsala, Sweden) for 2 hours. After extensive washing in RPMI-10 medium, the cell concentration is adjusted to 1x105 cells /ml. Whole blood or isolated effector cells (50 μl; MNC, PMN), or plasma (50 μl), sensitizing antibodies (50 μl) and RPMI-10 (50 μl) were placed in round-bottom microtiter plates (Greiner Bio-One GmbH, Frickenhausen, Germany). Assays are started by adding target cells (50 ml), resulting in a final volume of 200 µl. For isolated effector cells, an effector to target (E:T) ratio of 40:1 is used. For whole blood, an amount of 33 vol% is used, corresponding to the established effector to target ratio of 40:1. After incubation (3 hours, 37°C), the analysis is stopped by centrifugation and the release of ⁵¹ Cr is measured in triplicate by the number of pulses per minute (cpm) using a scintillation counter. Cellular cytotoxicity percentage is calculated using the following formula:

specific lysis % = (experimental srs - basal srs)/ (maximum srs - basal srs) x 100 maximum release (release) of ⁵¹ Cr is measured by adding perchloric acid (final concentration 3%) to target cells, and basal release is measured in the absence sensitizing antibodies and effector cells.

Statistics. Data were analyzed by one-way ANOVA followed by Tukey's test for multiple post-hoc comparisons. Analysis was performed using Graph Pad Prism (version 3.02 for Windows, Graph Pad Software, San Diego, CA, USA).

Lysis of AKN-77 cells. In the first series of experiments, ARH-77 cells were used as target cells (Fig. 20). Addition of 2F2 (n=3), rituximab (n=3) or 11B8T (n=1) caused MNC-mediated lysis of ARH-77 cells by approximately 50%. Specific lysis is not observed in the presence of neutrophils. The addition of plasma (to assess the role of complement) caused lysis of ARH-77 cells after incubation with 2F2, but not after incubation with rituximab (p < 0.05, comparing data in the presence of 2F2 (vs.) and in the absence of antibody, ANOVA) or 11B8T. In the presence of whole blood, ARH77 cell lysis was increased after incubation with 2F2 (p < 0.05, 2F2 vs. rituximab and 2F2 vs. no antibody, ANOVA), but not with rituximab. The specific lysis caused by rituximab is actually very low in the presence of whole blood. 11B8T causes cell lysis at a rate of approximately 25% (n=1) in the presence of whole blood. In the absence of the antibody, 10-15% nonspecific lysis is observed.

Lysis of B-CLL cells. In a second set of experiments, chronic B-lymphocytic leukemia (B-CLL) cells obtained from B-CLL patients (n=12) were subcloned for 5 cycles and then used as experimental target cells (FIG. 21). In the absence of antibody, specific lysis is not observed, but the addition of 2F2, 11B8T or rituximab (10 μg/ml) increases the level of MNC-mediated specific lysis to 10-20% (p < 0.001, ANOVA). Incubation of target cells with plasma and 2F2 induced specific lysis of B-CLL cells, whereas no specific lysis was observed with 11B8T or rituximab (p < 0.001, ANOVA). In addition, 2F2 mediates specific lysis of B-CLL cells after incubation with whole blood. No specific lysis of B-CLL cells by whole blood was observed with 11B8T (p<0.01, ANOVA) or rituximab (p<0.001, ANOVA). No specific lysis was observed in the presence of neutrophils.

Since rituximab is able to mediate effective ADCC, but not CDC (cytotoxicity) of the tumor cells tested, it appears that whole blood-induced B cell lysis with 2F2 is complement-mediated.

Lysis of hairy cell leukemia (HCL) cells. The third set of experiments determined the lysis of HCL cells using 2F2, 11B8T and rituximab using ADCC or in the presence of plasma or whole blood. The data is shown in Fig. 22. While neutrophils cannot mediate ADCC regardless of the mAb used, 11B8T can induce MNC-mediated HCL cell lysis more efficiently than 2F2 (p < .001, ANOVA) or rituximab (p < .05, ANOVA). 2F2 and ri

- 47 043675 tuximab cannot induce MNC-mediated lysis of HCL cells. Plasma-mediated cell lysis was significantly increased with 2F2 compared with rituximab (p < 0.05, ANOVA), 11B8T (p < 0.01, ANOVA), or compared with no antibody (p < 0.001, ANOVA). When lysis induced by anti-CD20 antibody in the presence of whole blood was examined, 2F2 induced complete cell lysis at levels higher than in the presence of rituximab (p < 0.01, ANOVA), 11B8T, or in the absence of antibody (p < 0.001, ANOVA).

Lysis of B-ALL cells. The ability of 2F2 and rituximab to induce lysis of B-ALL cells by ADCC or complement was studied in cells from two patients (Fig. 23). As observed in previous experiments, 2F2 and rituximab induced MNC-mediated ADCC of B-ALL cells to a similar extent. But again, 2F2 is able to induce plasma- or whole blood-mediated lysis of B-ALL cells, whereas rituximab is not.

Lysis of follicular lymphoma cells. When studying the lysis of follicular lymphoma (n=2), a different picture is observed (Fig. 24). Minor PMN-mediated lysis of 2F2 is observed, and both 2F2 and rituximab fail to induce MNC-mediated ADCC. 11B8T is still able to induce MNC-mediated lysis by approximately 20%. Although relatively high levels of plasma-mediated lysis are induced by rituximab, complete plasma-mediated lysis is observed with 2F2. Also, when whole blood is used, complete lysis is observed with 2F2, whereas with rituximab the lysis rate is 70%. In the case of 11B8T, minimal levels of plasma or whole blood mediated lysis are observed.

Lysis of mantle zone lymphoma cells. It is more difficult to cause lysis of mantle zone lymphoma cells (n=1, Fig. 25). Minimal or no lysis with 2F2, 11B8T or rituximab was observed after the addition of PMN or MNC and anti-CD20 mAbs. However, the 2F2 antibody is still able to cause approximately 40% lysis when using plasma or whole blood, whereas only 10-20% of cells are lysed with rituximab. 11B8T is not able to induce lysis of primary mantle cell lymphoma cells.

Antibody concentration-dependent lysis of AIN-77 cells in whole blood. The next experiment (n=4) analyzed the dose-dependent induction of ADCC on ARH-77 cells in the presence of whole blood. As can be seen in FIG. 26, titration of 2F2 induces a dose-dependent increase in the percentage rate of specific lysis (p < 0.05: treatment effect, two-way ANOVA) of ARH-77 cells. No specific lysis of ARH-77 cells was observed with rituximab.

ADCC analysis II.

Preparation of ⁵¹ Cr-labeled target cells. ARH-77 cells and Raya cells are collected (3x106 cells) in RPMI++ medium, separated by centrifugation (1500 rpm, 5 min), resuspended in 140 μl ⁵¹ Cr (Chrome-51; CJS11 - 1 mCi, lot 12, 140 μl, approximately equivalent to 100 µCi) and incubate; (37°C water bath; 1 hour). Cells are washed (1500 rpm, 5 min, in PBS, 3x), resuspended in RPMI++ and counted by trypan blue exclusion. Cells are adjusted to a concentration of 2x10 cells/ml.

Preparation of effector cells: Fresh peripheral blood mononuclear cells (MNC) are isolated from 40 ml of heparinized blood using Ficoll (Bio Whittaker, lymphocyte separation medium, cat 17-829E) according to the manufacturer's recommendations. Cells are resuspended in RPMI++, treated with trypan blue exclusion, and adjusted to a concentration of 1x10 cells/ml.

Definition of ADCC. 50 μl of RPMI++ is pipetted into 96-well plates and 50 μl of ⁵¹ Cr-labeled target cells is added. Then add 50 antibodies diluted in RPMI++ (final concentrations 10, 1, 0.1, 0.01 μg/ml). The cells are incubated (RT, 10 min) and 50 μl of effector cells are added to obtain an effector to target ratio of 50:1 (to determine maximum lysis, 50 μl of 5% Triton-X-100 is added instead of effector cells). Cells are separated by centrifuge (500 rpm, 5 min) and incubated (37°C, 5% CO ₂ , 4 h). The cells are centrifuged (1500 rpm, 5 min), 100 μl of the supernatant is collected in microtubes and counted in a gamma counter. The percentage of specific lysis is calculated as follows:

% specific lysis = (average sample - average of some target cells) / (average of maximum lysis - average of some target cells) x 100

Statistics. Data were analyzed by one-way ANOVA followed by Tukey's test for multiple post-hoc comparisons. Analysis was performed using Graph Pad Prism (version 3.02 for Windows, Graph Pad Software, San Diego, CA, USA).

Antibody concentration-dependent lysis of ARH-77 cells and Raya cells: 2F2T and 11B8T were tested for the ability to induce ADCC of ARH-77 cells and Raya cells (n=3) with rituximab.

A dose-dependent ratio of mAbs to CD20 was observed in ADCC of ARH-77 cells using MNCs as effector cells (FIG. 27). Both 2F2T and 11B8T induce specific lysis of ARH-77 cells, maximum (50%) at a mAb concentration of 10 μg/ml. Rituximab causes only 25% lysis of target cells. Addition of an isotype control antibody (HuMabKLH) does not induce ADCC lysis. No specific lysis was observed without the addition of MNC (data not shown).

- 48 043675

If Raya cells are used as target cells, the same pattern is observed as in the case of ARH-77 cells (Fig. 28). Both 2F2T and 11B8T induce MNC-mediated lysis of Raya cells, although at low concentrations 2F2T appears to be more effective than 11B8T. The maximum level of lysis achieved in the case of 2F2T and 11B8T is about 35%. Rituximab induces MNC-mediated lysis of Raya cells, although only 20% of target cells are sensitive to rituximab. Addition of an isotype control antibody (HuMab-KLH) does not induce ADCC lysis. No specific lysis was observed without the addition of MNC (data not shown).

Example 8 FRET Assay and Triton-X Insolubility Assay (Triton-X)

Preparation of Cy3- and Cy5-conjugated mAbs for fluorescence resonance energy transfer (FRET). Monoclonal antibodies are directly conjugated to bifunctional NHS ester derivatives Cy3 and Cy5 (Amersham Biosciences UK Ltd) as described in the manufacturer's recommendations. Briefly, the mAb is dialyzed against 0.1 M carbonate/bicarbonate buffer (pH 9). The dye is then dissolved in H2O, immediately added to 1 mg mAb and incubated at room temperature in the dark for 45 min. Labeled mAbs are separated from unconjugated dye by size exclusion chromatography on a PD10-Sephadex G25 column equilibrated in PBS. Molar binding ratios are determined spectrophotometrically from ε ₅₅₂ = 150/mM/cm for Cy3, ε ₆₅₀ = 250/mM/cm for Cy5 and ε ₂₈₀ = 170/mM/cm for protein and in the range of 5-8-fold excess of dye: protein .

FRET analysis. Daudi cells are resuspended at a concentration of 5x106 cells/ml in PBS/0.1% BSA and an equimolar amount of donor (Cy3)-conjugated and acceptor (Cy5)-conjugated mAb is added to the cell suspension (final concentration 10 μg/ml). Cells are incubated for 30 min in the dark at 4°C or 37°C. Each experiment involves cells labeled with donor-conjugated or acceptor-conjugated mAb as a result of preincubation with a 5-fold molar excess of unconjugated mAb, and cells labeled with donor-acceptor-conjugated mAb in the presence of an equimolar amount of unconjugated mAb. To assess the association of labeled antigens, flow cytometric FRET measurements are performed on a FACScalibur instrument (BD Biosciences). The fluorescence intensities at 585 nm (FL2) and 650 nm (FL3), both excited at 488 nm, and the fluorescence intensities at 661 nm (FL4), excited at 635 nm, are detected and used to calculate FRET using the equation below, where A is an acceptor (Cy5) and D is a donor (Cy3). All obtained values are corrected for autofluorescence using the following formula:

FRET = FL3(D,A)- FL2(D,A)/a- FL4(D,A)/b where a = FL2(D)/FL3(D) a b = FL4(A)/FL3(A)

Corrected parameters are obtained using data obtained from cells labeled with a single label, and side light scattering is used to filter out cellular debris and dead cells. FRET between donor and acceptor mAb derivatives on dual-labeled cells is expressed as acceptor-sensitized emission at 488 nm. Higher FRET values indicate closer physical association of donor- and acceptor-labeled antibodies or a higher density of acceptor-labeled mAb in proximity to donor-labeled mAb.

Estimation of raft-associated antigen based on Triton-X-100 (TX) insolubility. To quickly assess the presence of antigen in raft microdomains, a flow cytometry method based on the insolubility of Tritonα-X-100 (TX) at low temperatures, described previously, is used. Briefly, Daudi cells are washed in RPMI/1%BSA and resuspended at a concentration of 2.5 x 10 ⁶ /ml. Cells (100 μl) were then incubated with 10 mg/ml FITC-conjugated mAb for 15 min at 37°C, washed in cold PBS/1% BSA/20 mM sodium azide (PBS-BS), and the sample was divided in half. All samples are kept on ice during the rest of the analysis. One half is kept on ice to allow calculation of 100% surface antigen levels, while the other half is treated with 0.5% TX for 15 min on ice to determine the proportion of antigen remaining in the insoluble raft fraction. Cells were then stored at 4°C until the end of the assay, washed with PBS-BS, resuspended in PBS-BS, and analyzed by flow cytometry. To determine the constitutive level of association of rafts with target antigens, cells are first treated with 0.5% TX for 25 min on ice and washed with PBS-BS before binding of FITC-labeled mAbs.

As shown in FIG. 29A, 29B and 29, fluorescence resonance energy transfer (FRET) shows the formation of CD20 clusters when incubated with 2F2 or 7D8. No cluster formation was detected upon incubation with 11B8. These results are consistent with the TX treatment data, cf. fig. 29C (i.e., 2F2 and 7D8, unlike 11B8, remain in the insoluble cell fraction after binding) and support the concept that 2F2 and 7D8, after binding, transfer (translocate) CD20 to the lipid raft compartment of the B cell membrane.

As shown in FIG. 30 (FRET and s.e.m. (standard error) values from three experiments by one-way ANOVA followed by Tukey's test for multiple posthoc comparisons), FRET analysis indicates cluster formation of rituximab and 2F2, whereas no cluster formation is observed in the case of 1188T. These data are in accordance with the data, semi

- 49 043675 measured after treatment with 0.5% TX prior to binding of FITC-labeled mAbs, see FIG. 31 (n=2).

Obtaining the lipid raft fraction and Western blotting. Another way to study the association of CD20 with lipid rafts is to examine the membrane distribution of CD20 between lipid raft and non-raft fractions using the sucrose gradient fractionation method described by Deans, J.P., et al., J. Biol. Chem., 1998. 273(1): p. 344-348, with one change: Optiprep (Sigma) is used instead of sucrose. Anti-CD20 monoclonal antibody (10 μg/ml) was allowed to bind to Daudi cells (1x107) for 20 min at 37°C. After this incubation, cells are centrifuged (pelletized), washed twice with PBS and lysed in ice-cold lysis buffer (1.0% TX in MES-buffered physiological saline (25 mM MES, pH 6.5, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 5 μg/ml aprotinin, 5 μg/ml leupeptin, 10 mM EDTA)). Cell pellets are carefully resuspended for 20 min on ice. The lysate is then mixed with 400 μl of cold 60% Optiprep (Sigma). The sample is coated with 600 µl of each dilution of Optiprep: 35%, 30%, 25%, 20%, 0% in lysis buffer. The gradients are centrifuged at 40,000 rpm at 4°C for 18 hours. Six fractions are collected from above, subjected to electrophoresis on a 4-15% SDS-PAGE gel, transferred to nitrocellulose membranes and incubated with primary antibody (mouse antibodies (polyclonal sera) against CD20 (anti-CD20 polysera; Serotec, UK) and then with an HRP-conjugated secondary antibody (rabbit anti-mouse HRP; Jackson, Bar Harbor, Maine, USA). Blots were visualized using Supersignal West Dura Sustained Release Substrate (Pierce, Woburn, MA, USA).

The results are shown in Fig. 32. It can be seen that the presence of CD20 molecules is limited to the high density fraction 5 (untreated cells). In cells treated with rituximab, there is a marked shift in the distribution of CD20, with a significant proportion in low-density membrane fractions 2 and 3, corresponding to the fraction in which sedimentation of membrane raft regions is expected to occur. In cells treated with 2F2, this shift is also observed in fractions 2 and 3. In contrast, in the case of cells treated for 20 min with 11B8T, a similar distribution is observed, similar to that in untreated cells, with the presence of CD20 molecules in fraction 5. In conclusion, say that binding to 2F2 and rituximab induces a shift of CD20 molecules into membrane fractions with a lower density, while binding to 11B8T does not produce such a shift.

Example 9: Apoptosis of Burkitt cell lines by human anti-CD20 antibodies.

Apoptosis. Daudi cells, 0.5x106 in 1 ml tissue culture medium, are plated in 24-well flat-bottom plates containing 1 or 10 μg/ml mAb or control antibodies and incubated at 37°C. After 20 h, cells were collected, washed in Annexin-V-FITC binding buffer (BD biosciences) and labeled with Annexin-V-FITC (BD biosciences) for 15 min in the dark at 4°C. Cells were stored at 4°C until analysis. Each sample (150 μL) is added to 10 μL of PI solution (10 μg/mL in PBS) in a FACS tube. The mixture was immediately analyzed by flow cytometry on a FACScalibur flow cytometer using CellQuest pro software (BD Biosciences, Mountain view, CA). At least 10,000 events are collected for analysis.

Induction of apoptosis in Daudi cells. Daudi cells are incubated for 20 hours in the presence of human anti-CD20 antibodies (1 μg/ml) (without the addition of secondary cross-linking antibody). Apoptosis induction was analyzed by flow cytometry with Annexin-V/PI staining.

As shown in FIG. 33A-G, in case 11B8 there is clear evidence of induction of apoptosis (similar to apoptosis induced by anti-IgM antibody). 2F2 and 7D8 do not induce apoptosis in Daudi cells. AT80, a mouse anti-CD20 apoptosis-inducing antibody, was used as a control.

Induction of apoptosis in Raya cells. Induction of Raya cell apoptosis was analyzed over a range of anti-CD20 mAb concentrations. In fig. Figure 34 shows the percentage of annexin-V positive cells. As can be seen in FIG. 34, the positive control mouse anti-human CD20 mAb, B1, induced a concentration-dependent increase in Raya cell apoptosis with a maximum value of approximately 70% at 10 μg/ml mAb. 11B8 is also a strong inducer of apoptosis, inducing apoptosis of Raya cells with a maximum of 53.4% at a mAb concentration of 10 μg/ml. On the other hand, 2F2 and rituximab induce apoptosis of Raya cells to a very weak extent: slightly increased levels of apoptosis they induce are comparable to those of the negative control.

Induction of apoptosis in Daudi cells. The same pattern is observed when 1.0 μg/ml anti-CD20 mAb is added when Daudi cells are used as target cells (FIGS. 35A and 35B). Data in Fig. 35 shows the sum (total number) of cells positive for annexin-V, and the data in FIG. 35B (data on the X axis refers to annexin-V and on the y axis refers to PI) shows the percentage of Daudi cells in early apoptosis (annexin-V positive and PI negative cells) and late apoptotic cells (cells positive for annexin-V and positive for PI). Again, both B1 (65.9%) and 11B8T (56.3%) are strong inducers of apoptosis at a concentration of 1.0 μg/ml. Supplementation with 2F2T produces low levels of apoptotic Daudi cells

- 50 043675 (17%). The addition of rituximab causes an apoptosis rate of Daudi cells of 29%. Addition of the isotype control antibody HuMab-KLH did not induce Daudi cell apoptosis (6%).

Example 10. Homotypic cell adhesion to human anti-CD20 antibodies.

Homotypic adhesion correlates with the induction of apoptosis. Therefore, the ability of anti-CD20 mAbs to induce homotypic B cell aggregation is being studied.

Homotypic aggregation of Ramos-EHRB cells. Ramos-EHRB cells (0.5x106 in 1 ml of tissue culture medium) are incubated at 37°C for 4 hours in the presence of anti-CD20 antibodies 11B8, 2F2 or 7D8 (without cross-linking) and the induction of homotypic adhesion is studied by light microscopy (described above).

As shown in FIG. 36A-E, 11B8 causes intense aggregation of Ramos-EHRB cells (similar to the aggregation caused by AT80, a mouse anti-CD20 antibody). 2F2 and 7D8 do not induce homotypic aggregation of Ramos cells.

Homotypic aggregation of Daudi cells. Daudi cells are plated in 24-well flat-bottom plates at a concentration of 1 or 10 μg/ml anti-CD20 mAb or control antibody and incubated at 37°C for 4 hours. The degree of homotypic aggregation is determined by light microscopy. As can be seen in FIG. 37, 2F2 hardly induces Daudi cell aggregation at a concentration of 1.0 μg/ml (and 10 μg/ml, data not shown). Rituximab causes a small homotypic aggregation of Daudi cells. In contrast, antibody B1 is a strong inducer of homotypic aggregation.

Example 11 Immunotherapy using human anti-CD20 antibodies.

High dose (100 mg) treatment of 2F2 and 7D8 SCID mice injected with Daudi cells. SCID mice were obtained from Harlan UK Ltd., Blackthorn, Oxon, UK, and were bred and stored under sterile conditions. Daudi cells (2.5x106) are injected i.v. (intravenously) into the tail vein of groups of 12-16 week old SCID mice, and 7 days later 100 μg of 2F2 or 7D8 was injected in the same way. An indicator of an animal's impairment is paralysis of the limbs in accordance with the instructions of the ethics commission for working with animals. As shown in FIG. 38, the lifespan (survival) of mice is increased after treatment with 2F2 or 7D8.

High dose (100 μg) 2F2 and rituximab treatment of SCID mice injected with (infected) Tanoue cells. Tanoue cells (2.5x106 in 200 µl PBS) were injected i.v. (i.v.) into the tail vein of groups of 12-16 week old SCID mice (Harlan UK Ltd., Blackthorn, Oxon, UK), and 7 days later 100 μg (in 200 μl PBS) of 2F2 or 7D8 were injected in the same manner. In this experiment, 2F2 is compared with rituximab and B1. An indicator of an animal's damage is paralysis of the hind limbs. The results are shown in Fig. 39. On day 39, the first two control mice die, and in this group, on day 54, all animals die. In the group taking 2F2, only one mouse died during this time, and in this group the life expectancy (survival) of other mice was significantly higher. One mouse died on day 81 after injection of tumor cells, and the remaining mice (60% of the total) were alive at the end of the experiment on day ¹⁰⁰ after infection. In contrast, rituximab increases the lifespan of only 2 out of 5 mice (death on days 66 and 83 after infection) and not a single mouse survives to the end of the experiment. In group B-1, the lifespan (survival) of SCID mice is similar to that in group 2F2; in this group, two mice die on day 48, and one mouse on day 76. In this group, forty percent of the mice are alive at the end of the experiment.

Dose effect of 2F2 and rituximab in the treatment of SCID mice infected with Daudi cells. In order to evaluate the effectiveness of 2F2 for protection against tumorigenesis compared to rituximab, their dose was determined for the treatment of SCID mice infected with Daudi tumor cells. Daudi cells express more CD20 than Tanoue cells and are more sensitive to killing in vitro. 10 groups of SCID mice (4 mice per group) and 1 control group (5 SCID mice) were injected with 2.5x106 Daudi cells (in 200 μl PBS) i.v. on day 0 and then on day 7, 20, 5, 2, 0.5, or 0.1 μg of rituximab, 2F2, or PBS (in 200 μl of PBS) are administered intravenously (IV). An indicator of an animal's damage is paralysis of the hind limbs. The results are shown in Fig. 40.

In the control group, all mice died on days 26-29. However, in the case of 2F2, a clear dose effect (dose-response relationship) is observed (Fig. 40, top graph). While no dose effect was observed at the 0.1 mcg and 0.5 mcg 2F2 doses, the 2 mcg 2F2 dose significantly increased survival to 41 days, the 5 mcg 2F2 dose increased survival to 47 days, and the 20 mcg 2F2 dose increased survival to 50 days. .

In contrast, rituximab, even when tested at the highest dose of 20 μg, only slightly increased survival and therefore no dose effect was observed at lower concentrations (Fig. 40, bottom graph).

Treatment of SCID mice with Daudi tumors with 11B8T and B1. Daudi cells (2.5x106) are injected i.v. (intravenously) into the tail vein of groups of 12-16 week old SCID mice, and 7 days later 100 μg of 11B8T or B1 are injected in the same way. An indicator of an animal's damage is paralysis of the lower limbs. In the group of control mice receiving PBS, all mice died between day 35 and day 53 (Fig. 41). Injection of 11B8T reliably protected mice, with mice dying between days 72 and 98 after infection with tumor cells. In the group injected with B1, the majority of mice survive until day 98, and 40% of mice are alive until the end of the experiment, i.e. until day 100.

Example 12: Evaluation of anti-CD20 antibodies in the Daudi-luc xenograft model in SCID mice.

The therapeutic efficacy of anti-CD-20 antibodies is being studied in a mouse model in which human B-cell tumors are expanded and then subjected to external optical imaging (scintigraphy). In this model, tumor cells are transfected using firefly luciferase. When mice are injected with luciferin (Molecular Probes, Leiden, The Netherlands), the labeled cells can be detected in vivo by bioluminescence imaging (scintigraphy) using a high sensitivity CCD camera, cf. Wetterwald et al. (2002) Amencan Jounial of Pathology, 160(3): 1143-1153.

Daudi cells were transfected with gWIZ luciferase from Gene Therapy Systems (San Diego, CA) and cultured in RPMI with 10% FCS, Pen/Strep, sodium pyruvate, and 1 μg/ml puromycin (Sigma). Cells are analyzed for luciferase expression (expressed in RLU/x10 ⁵ cells) using a luminometer and for CD20 expression using FACS. 2.5x106 luciferase-transfected Daudi cells/mouse are injected i.v. SCID mice. Eight days after inoculation, mice were treated with a single dose (10 μg) of 2F2T, 11B8T, rituximab, B1, or isotype control antibody (huIgG1) (6 mice per treatment group). For imaging (scintigraphy), mice are euthanized using an IP (intraperitoneal injection) of ketamine/xelazine/atropine. Synthetic D-luciferin (sodium salt, (Molecular Probes) Molecular Probes) is administered intraperitoneally at a dose of 25 mg/ml. The mice were then placed in a light, tight box, and scintigraphy was started 3 min later using a liquid nitrogen-cooled VersArray 1300B CCD detector (Roper Scientific). The photons emitted by luciferase are counted over an exposure period of 5 min. Black and white images under lighting are taken as a standard. MetaVue software (Universal Imaging Corp) is used for data acquisition and image analysis. The statistical significance of the difference between groups was determined by one-way analysis of variance using the Newman-Keusle test using GraphPad PRISM, version 3.02, (Graphpad Software Inc).

Scintigraphy from the dark side is carried out at weekly intervals. On the eighth day, the day of treatment, light emission was detected only at the inoculation sites in the tail. Tumor formation at distant sites was detected at day 14 in all mice in the isotype control antibody (huIgG1) group and in one mouse in the rituximab group. In the following weeks, the light emission increases continuously. In fig. 42 shows images of mice on day 39 (31 days post-treatment) with bioluminescence represented in red (dark areas in mice) (light intensity >50 photons per 5 min) superimposed on a black and white image of the mice. Tumor mass is quantified on days 25, 32, 39 and 46 by integrating light signal areas on the body surface, cf. fig. 43. The most rapid tumor growth was observed in the group that received the isotype control antibody. Treatment with rituximab results in a significant delay in tumor growth. However, the inhibition (delay) of tumor growth under the influence of 2F2T, 11B8T and B1 is much more significant (see Table 2 below for significance levels).

- 52 043675

table 2

Significance levels for differences in total light intensity between groups at different time points (time points)

Day 25 Day 32 Day 39 Day 46

Bl vs. P > 0.05 P < 0.05 P < 0.01 P < 0.001 rituximab Bl vs. P > 0.05 P < 0.05 P > 0.05 P < 0.05 11B8T Bl vs. 2FT2 P > 0.05 P < 0.05 P > 0.05 P < 0.05 Bl vs. P < 0.001 P < 0.001 P < 0.001 huIgGl rituximab P > 0.05 P < 0.05 P < 0.01 P < 0.001 vs. 11B8T rituximab P > 0.05 P < 0.05 P > 0.05 P < 0.001 vs. 2F2T rituximab P < 0.001 P > 0.05 P < 0.05 vs. huIgGl 11B8T vs. P > 0.05 P < 0.05 P > 0.05 P < 0.05 2F2T 11B8T vs P < 0.001 P < 0.001 P < 0.001 huIgGl 2FT2 vs. P <0.001 P < 0.01 P < 0.01

11V8T

Example 13: Pilot and pharmacokinetic study in cynomolgus macaques.

The objective is to determine the pharmacokinetic pattern and pharmacological action of 2F2 in cynomolgus macaques (approximate age 2 years; weight range 2.1-2.6 kg) after a single daily infusion (into the saphenous vein in the legs) for 4 consecutive days. This study also compares the pharmacological actions of rituximab to determine its equivalent potential. To this end, 6 male and 6 female cynomolgus macaques are divided into 6 dose groups and receive 2F2 or rituximab at dose levels of 1.25, 6.25 and 12.5 mg/kg/day at a constant dose volume of 10 ml/kg for 4 consecutive days, for a total of 5, 25 and 50 mg/kg, respectively. After the last dose, animals are kept for follow-up for 130 days. The practical work and techniques in this study are in accordance with the OSCE Good Laboratory Practice set by the UK Department of Health. All animals are regularly monitored for signs of disease or response to treatment and undergo physical examination. In the process of laboratory hematological studies, blood coagulation is determined, a clinical analysis and urine analysis are performed. Blood samples and lymph node biopsies are obtained (from superficial lymph nodes) for flow cytometry analysis during dosing and follow-up. The following cell phenotypes were analyzed by flow cytometry: CD3, CD4, CD8, CD20 and CD21. At the end of the observation period after the last dose, the animals were sacrificed and a detailed necropsy was performed.

There are no clinical signs of side effects or any manifestations that can be said to be related to treatment with 2F2 or rituximab. In fig. 44 and 45 show flow cytometry analysis of peripheral blood cells expressing CD20 or CD21. In fig. 46 shows analysis of lymph node cells expressing CD20 or CD21 by flow cytometry. Together, both phenotypes analyzed in the study show strong and efficient B cell depletion following administration of 2F2 and rituximab at 6.25 mg/kg/day (25 mg/kg total) and 12.5 mg/kg/day (50 mg/kg total). In addition, the data show that repopulation of CD20-expressing cells in the lymph nodes and peripheral blood of 2F2-treated animals begins again at day 75 after total doses of 25 mg/kg and 50 mg/kg, i.e. noticeably later than in animals treated with rituximab.

In addition, in FIG. 47A-C show the results of flow cytometry analysis of subpopulations of peripheral blood cells expressing CD20 ^low CD23 ⁺ CD40 ^high (Y. Vugmeyster et al.

- 53 043675 (2003) Cytometry 52A:101-109).

Peripheral blood cells from monkeys treated with 2F2 or rituximab at dose levels of 1.25 mg/kg (FIG. 47A), 6.25 mg/kg (FIG. 47B), and 12.5 mg/kg (FIG. 47C) once daily infusion 4 consecutive days, incubate with FITC mouse anti-human CD20 monoclonal antibody (Coulter) at room temperature for 10 min. Counting beads are then added along with PBS and the cells are washed twice (300 g for 10 min) and then immediately analyzed on a flow cytometer (Beckman Coulter) for the subpopulation of cells expressing CD20 ^low CD23 ⁺ CD40 ^hlsh versus the subpopulation of cells expressing CD20 ^hlsh CD23 ⁺ CD40 ^low . Results showing the number of cells expressing CD20 ^low CD23 ⁺ CD40 ^hlsh are expressed as cells/ml. As can be seen in FIG. 47, the 2F2 antibody is able to cause complete and more prolonged depletion of cells expressing CD20 ^low CD23 ⁺ CD40 ^hlsh compared to rituximab.

Example 14 Epitope mapping using site-directed mutagenesis.

Epitope mapping studies using a mutagenesis approach indicate that alanine at position 170 (A170) and proline at position 172 (P172) in the second extracellular loop are important for recognition of human CD20 by known anti-CD20 antibodies. In the works of Deans and colleagues (M.J. Polyak, et al., Blood, (2002) 99(9): p. 3256-3262; M.J. Polyak, et al., J. Immunol., (1998) 161(7 ): pp. 3242-3248) binding of all anti-CD20 mAbs tested was abolished when A170 and P172 were replaced by the corresponding residues S170 and S172 of mouse CD20. Some heterogeneity is observed in the recognition of the AchR epitope, however, while most rituximab-like antibodies recognize murine CD20 with S170 and S172 mutated to the A170xP172 sequence of human origin, some other antibodies require additional mutations immediately adjacent to the N-terminus of the AchR sequence. To test whether the A17-xP172 motif is important for binding of the antibodies of the invention, the AchR sequence is mutated to SxS using site-directed mutagenesis (AchP mutant = A170S, P172S), cells are transfected with the AchR mutant and wild-type CD20 DNA ( WT) and compare the binding characteristics of anti-CD20 mAbs.

Using site-directed mutagenesis, additional mutants are generated, P172S (proline at position 172 mutates to serine), N166D (asparagine at position 166 mutates to aspartic acid), and N163D (asparagine at position 163 mutates to aspartic acid) to evaluate the importance of mutant amino acid residues for binding of antibodies according to the invention.

To study this question, a CD20 expression vector is constructed by amplification of the coding sequence using suitable primers introducing ideal Kozak sequence restriction sites for optimal expression. The amplified fragment is digested and ligated into the pEE13.4 expression vector. After transformation into E. coli, colonies are screened for inserts and two clones are selected for sequencing to confirm the correct sequence. The construct is designated pEE13.4CD20HS.

Mutagenesis is carried out to introduce an AchR mutation and 20 murine sequence mutations into the extracellular loop region of human CD20. Mutagenesis is tested using restriction enzyme digestion and sequencing. The constructs were transiently transfected into CHO cells (for AchR mutations) or into HEK293F cells and analyzed 24 and 48 h after transfection by flow cytometry.

Oligonucleotide PCR (PCR) primers. Oligonucleotide primers were synthesized and quantified using Isogen BV (Maarssen, The Netherlands). Primers are reconstituted in water at a concentration of 100 pmol/μl and stored at -20°C until required. Brief information about PCR and primer sequencing is given in Table. 3.

Determination of the optical density of nucleic acids. Optical density was determined using an Ultrospec 2100 pro Classic instrument (Amersham Biosciences, Uppsala, Sweden) according to the manufacturer's instructions. DNA concentration is determined by analyzing _{OD260 nm} , where one unit of OD260 _nm = 50 μg/ml. The reference solution is identical to the solution used to dissolve nucleic acids.

Isolation of plasmid DNA from E. coli culture. Plasmid DNA was isolated from E. coli cultures using kits from Qiagen according to the manufacturer's instructions (Westburg BV, Leusden, The Netherlands). To obtain bulk quantities of the plasmid, use either the Hi-Speed plasmid Maxi kit or the Hi-Speed plasmid Midi kit (Qiagen). To obtain the plasmid in small quantities (i.e. 2 ml of E. coli culture), the Qiaprep Spin Miniprep Kit (Qiagen) is used and the DNA is eluted in 50 μl of TE (Tris-HCl 10 mM pH 8.0, EDTA 1 mM).

PCR amplification. PCR reactions were performed according to the manufacturer's recommendations for Pfu-Turbo© Hotstart DNA polymerase (Stratagene, Amsterdam, The Netherlands). Each reaction mixture with a volume of 20 μl of 1 x PCR reaction buffer, 200 μM dNTP, 6.7 pmol of forward and reverse primers, about 1 ng of template DNA and 1 Unit of Pfu-Turbo© Hotstart polymerase. PCR reactions are carried out in a gradient thermal cycler (thermoblock) T-gradient Thermocycler 96 (Biometra GmbH, Goettingen, Germany) according to a program of 30 cycles: +95°C for 2 min, then 30 cycles: +95°C for 30 s, from - 54 043675 annealing: gradient 45-65°C for 30 s and extension: +72°C for 2 min followed by a final extension stage of 10 min at 72°C, and storage at 4°C. Upon completion, the reaction mixtures are analyzed by electrophoresis on an agarose gel.

Electrophoresis on agarose gel. Agarose gel electrophoresis was performed according to Sambrook (Molecular Cloning Laboratory Manual, 3rd edition), using 50 ml gels in 1 x Tris/acetic acid/EDTA (TAE) buffer. DNA is visualized by incorporating ethidium bromide into the gel and observing under UV light. The gel image was recorded using a CCD camera and image analysis system (GeneGnome; Syngene, Cambridge, UK).

Restriction enzyme digestion. Restriction enzymes are supplied by New England Biolabs (Beverly, MA) and used according to the manufacturer's recommendations. Typically, 100 ng is digested with 5 Units of enzyme(s) in a suitable buffer in a final volume of 10 µl. Use suitable volumes of reaction mixtures. The digestion products are incubated for a minimum of 60 minutes at the temperature recommended by the manufacturer.

For fragments requiring double digestion with restriction enzymes with incompatible buffer or temperature requirements, digestions are performed sequentially so that each enzyme in turn has the preferred conditions.

Alkaline phosphatase treatment. Shrimp alkaline phosphatase (USB, Cleveland, OH) was used as recommended by the supplier. Alkaline phosphatase removes 5'-phosphate groups at the ends of DNA fragments, thereby preventing self-crosslinking (self-ligation). It is especially significant when self-religation of a DNA fragment can produce a replication-competent vector. The enzyme is active in most enzyme buffers and is added as needed.

After cleavage, the enzyme is inactivated by raising the temperature to 70°C for 15 minutes.

PCR purification and products of interaction with restriction enzymes. Purification is carried out using the PCR Purificatin kit for trace elimination (from Qiagen) according to the manufacturer's instructions. Briefly, DNA samples are diluted in 5 volumes of binding buffer I (Qiagen) and applied to a minicolumn in an Eppendorf centrifuge tube. The assembly (ensemble) is centrifuged on a tabletop microcentrifuge. The column is washed twice with buffer II (Qiagen). After the buffer, the kit is centrifuged and the wash liquid (flow-through) is discarded. The column is dried in a centrifuge in the absence of buffer. The DNA is eluted by passing elution buffer through the column and quantified by UV spectroscopy and content assessed by agarose gel electrophoresis.

Isolation of DNA fragments from agarose gel. When required (ie, when multiple fragments are present), DNA samples are separated by gel electrophoresis and the desired fragment is excised from the gel and regenerated using the QIAEX II Gel Extraction Kit (Qiagen). In accordance with the manufacturer's recommendations. Briefly, DNA bands are excised from the agarose gel and melted in a suitable buffer at +55°C. Add QIAEX P polymer and incubate for 5 minutes. QIAEX P polymer is precipitated (pellets) by short-term centrifugation (1 min, 14000 g, RT) and washed with aqueous PE buffer (twice 500 μl). Finally, the pellets are dried in laminar, and the DNA is eluted with the appropriate volume of TE and at the appropriate temperature (depending on the size of the DNA).

Ligation of DNA fragments. Ligation is performed using the Quick Ligation Kit (New England Biolabs) according to the manufacturer's recommendations. For each ligation, vector DNA is mixed with approximately a 3-fold molar excess of insert DNA, so that the total amount of DNA is less than 200 ng in 10 μl, if necessary, adjusted to the required volume with water. To this mixture add 10 μl of 2 χ Quick Ligation Buffer and 1 μl of Quick T4 DNA ligase and the ligation mixture is incubated for 5-30 minutes at room temperature.

Transformation of DNA into bacteria. DNA samples are used to transform single One Shot DH5a-T1R competent E. coli cells (Invitrogen, Breda, The Netherlands) according to the manufacturer's instructions. Briefly, 1-5 μl of DNA solution (typically 2 μl of DNA ligation mixture) is added to an aliquot of transformed competent bacterial cells and the mixture is incubated on ice for 30 minutes. The cells are then heat shocked by transferring them to a water bath for 30 s at 42°C, followed by additional incubation on ice for 5 min. Cells are allowed to regenerate by incubation in non-selective culture medium (SOC) for 1 hour with shaking at 37°C and then plated (spread) onto agaragar plates containing a suitable selective agent (ampicillin at a concentration of 50 μg/ml). The plates are incubated for 16-18 hours at +37°C or until bacterial colonies become visible.

Screening of bacterial colonies using PCR. Bacterial colonies are screened for the presence of vectors containing specified sequences using colony screening PCR. 20 μl of a reaction mixture containing 0.5 volumes of HotStarTaq Master Mix (Qiagen), 4 pmol of forward and reverse primers and supplemented with water is placed in a PCR tube. Colonies are lightly touched with the tip of a 20 µL pipette touched once to LB cultures in a 2 ml tube (for growing bacteria containing the appropriate plasmid) and resuspended in 20 µL of PCR mixture

- 55 043675

PCR is carried out in a T-gradient Thermocycler (thermal block) T-gradient Thermocycler 96 (Biometra) according to a program of 30 cycles: +95°C for 15 min, then 35 cycles: +94°C for 30 s, annealing: gradient 55 °C for 30 s and extension: +72°C for 2 min followed by a final extension step of 10 min at 72°C, and subsequent storage at 4°C. Upon completion, the reaction mixtures are analyzed by electrophoresis on an agarose gel. See table. 3 is a detailed description of the primer pairs used in colony PCR.

DNA sequencing. Plasmid samples are sent to AGOWA (Berlin, Germany) for sequencing. Sequences were analyzed using VectorNTI software (Informax, Frederick, MD, USA).

Table 3

Name Application Length Subsequence oligonucleotide CD20P172S CD20 mutagenesis 6 TGGGGAGTTTTTCTCAGAGGAATT CGATGGTTCACAGTTGTA CD20N166D CD20 mutagenesis 9 TGTAACAGTATTGGGTAGATGGG CD20N163D CD20 mutagenesis 6 AATCATGGACATACTTAATATTA cd20exfor CD20 mutagenesis 1 TATAGCCCGGGGCCGCCACCATG ACAACACCCAGAAATTCA cd20exrev CD20 design 8 GCGTCTCATGTACATTAAGGAGA GCTGTCATTTTCTAT pee!34seqrev2 Colony PCR 3 TCGGACATCTCATGACTTTCT'T pConKseql GPTR colonies 3 GTAGTCTGAGCAGTACTCGTrGC cd20hsapmutr (AxP) CD20 mutagenesis 2 TGGGOAGTTTTCTCAGAGGAATrC GATGGTTCACAGTTGTA cd20hs apmutf (AxP) CD20 mutagenesis 2 TACAACTGTGAACCATCGAATICC TCTGAGAAAAACTCCCCA CD20seq2 CD20 sequencing 3 TGTAACAGTATTGGGTAGATGGG cd20seql CD20 sequencing 3 AATCATGGACATACTTAATATTA

Mutagenesis. Mutagenesis was performed using the QuikChange® XL Site-Directed Mutagenesis Kit (Cat 200517-5, Lot 1120630, Stratagene Europe) according to the manufacturer's instructions.

Mutagenesis reaction mixtures are concentrated by ethanol precipitation and transformed either into single shot DH5a-T1R competent E. coli cells or by electroporation into ElectroTen-Blue® electrocompetent cells. Before transfection, colonies are checked by colony PCR and restriction enzyme digestion.

Transfection of HEK293F cells. HEK293F cells were obtained from Invitrogen and transfected according to the manufacturer's instructions using 293fectin. HEK293F cells were used for all single mutant sequences.

Transfection of CHO cells. CHO cells grown to approximately 95% monolayer were transiently transfected with wild-type CD20, mutant cDNA, or a combination of both constructs using Lipofectamine 2000 (M668-019, Invitrogen, Breda, Netherlands). For this purpose, 24 μg of precipitated DNA is diluted (1 μg/ml) in 500 μl of optimem in the ratios AchP 100%: WT 0%; AChR 33.3%: WT 66.6%; AChR 66.6%: WT 33.3%; AxP 0%:WT 100%. For each transfection, 24 lipofectamines are diluted in 500 μl of optimem. The diluted Lipofectamine is then incubated (RT, 5 min) and the diluted DNA is combined with the diluted Lipofectamine. Gently stir and incubate the solution (RT, 20 min), 1000 µl DNA/Lipofectamine is added to CHO cells, mixed thoroughly and incubated for 48 h at 37°C, 5% CO ₂ . 2 days after transfection of CHO cells, the cells are washed twice with FACS buffer (PBS supplemented with 0.1% BSA and 0.002% NaN ₃ ). CHO cells were treated with trypsin/EDTA (Gibco BRL, Life Technologies, Paisley, Scotland) and removed from the culture plates.

- 56 043675

Binding to anti-CD20 antibody. HEK293F cells and CHO cells are mixed in PBS at a concentration of 2x10 ml and placed in round bottom plates (1x10 ⁵ /well). Then add 50 μl of CD20 mAb at serial dilutions of 10, 5, 2.5 or 0 μg per well (4°C, 30 min). After washing in buffer

FACS (PBS supplemented with 0.1% BSA and 0.002% NaN ₃ ) cells were analyzed on a flow cytometer (Becton Dickinson, San Diego, CA, USA), and at high flow rate 5000 events per sample were required.

As can be seen in FIG. 48A-E, all anti-CD20 mAbs bind effectively to CHO cells expressing WT (wild type) CD20. As expected, rituximab did not bind to the AchP mutant (Fig. 48A), and B1 weakly bound to this mutant (Fig. 48D). In contrast, both 2F2 and 11B8 bound equally to WT and AchP mutant CD20 (FIGS. 48B and 48C). However, titration of the amount of WT CD20 on the surface shows only binding of rituximab and B1. Again, both 2F2 and 11B8 are insensitive to the absence or presence of the mutation.

This study shows that the binding of 2F2 and 11B8 to human CD20 is insensitive to mutations at amino acid positions 170 and 172. Therefore, 2F2 and 11B8 represent a new class of CD20 mAbs that recognize a novel CD20 epitope.

In fig. 49A shows the percentage of binding of 2F2, 11B8T, B1 or rituximab to the P172S mutant vs. (compared to) WT CD20, Fig. 49B shows the percentage of binding of 2F2T, 11B8T, B1, CAT (CAT 13.6E12, anti-CD20 mouse monoclonal IgG2A antibody, Diatec.Com), isotype control antibody (KLH) or rituximab to mutant CD20 (AchR) vs. (compared to) WT CD20.

In the case of a mutant in which asparagine at position 166 is replaced by aspartic acid (CD20N166D), 2F2 shows very low binding, while B1, rituximab and 11B8T are able to bind, see FIG. 49C. In a similar experiment, CAT 13.6E12 and rituximab are able to bind to CD20N166D, while 2F2T shows only a very low degree of binding, see FIG. 49D. In the case of a mutant in which the asparagine at position 163 is replaced by aspartic acid (CD20N163D), again rituximab, 11B8T and B1 are able to bind to CD20N163D, while 2F2 and 2F2T show only a very low degree of binding, see Fig. 49E. In a similar experiment, CAT 13.6E12 and rituximab are able to bind to CD20N163D, while 2F2T shows only a very low degree of binding, see FIG. 49F.

These experiments show that 2F2 and 11B8 bind to different epitopes.

Example 15 Epitope mapping using the Pepscan method.

Peptide synthesis: 7-, 9- and 15-mer peptides are synthesized using standard methods. In some cases, chemical linkage of a 15-mer peptide helps identify the amino acid sequences of a potentially discontinuous epitope. According to known methods (N.M. Geysen et al. (1984) Proc. Natl. Acad. Sci. USA, 81:3998; JW Slootstra et al. (1996) Mol. Drivers 1:87; and WO 01/60769) synthesize 7-, 9-, and 15-mer peptides, which could be binding sites or epitopes included in the binding of 2F2 or 11B8 to the human CD20 molecule. The 9- and 15-mers are synthesized as loops and screened in mini-PEPSCAN boards in credit card format (455 peptides/board format). In all loop-shaped peptides, the amino acids at variable positions are replaced by cysteine (for example, acetyl-XXXXXXXXXXXXXXXXX mini-card). Peptides are synthesized using a standard chemical method with Fmoc protection and deprotection using TFA with an acceptor (acid). The deprotected peptides are then reacted on the microarray with a 0.5 mM solution of 1,3bis(bromomethyl)benzene in ammonium bicarbonate (20 mM, pH 7.9) supplemented with acetonitrile (1:1 (v/v)). The microarrays are gently shaken in the solution for 30-60 minutes until they are completely covered with the solution. Finally, the microarrays are extensively washed with excess Millipore _H2O and subjected to ultrasonic disintegration in a buffer containing 1% sodium dodecyl sulfate, 0.1% βmercaptoethanol in PBS (pH 7.2), at 70°C for 30 min, followed by ultrasonic disintegration in millipore H2O for more within 45 min. The microplate wells are then ready for ELISA screening.

Pepscan ELISA: 455-well credit card-size polyethylene plates containing covalently linked peptides are incubated with serum (1:1000 dilution in blocking solution containing 5% vol horse serum and 5% egg white (w/v)) (4°C, overnight). After washing, the peptides are incubated with human antibody peroxidase (dilution 1:1000, 1 hour, 25°C) and, after washing the peroxidase substrate, 2,2-azinodi-3ethylenebisthiazoline sulfonate and 2 μl/ml 3% H ₂ O ₂ are added. After 1 hour, the color development is measured. The color development of the ELISA is quantitatively calculated using a CCD camera and image processing system. The setup consists of a CCD camera and a 55 mm lens (Sony CCD Video Camera XC-77RR, Nikon micronique or 55 mm f/2.8 lens), a photo attachment (Sony Camera adapter DC-77RR) and Optimas image processing system software, version 6.5 ( Media Cybernetics, Silver Spring, MD 20910, USA). The Optimas software is installed on a Pentium II computer system.

The optical density (OD values) of the peptides at various antibody concentrations is presented below in table. 4 and 5.

- 57 043675

Table 4

11B8 11B8 7D8 7D8 rituximab 2F2 2F2 IN 1 IN 1 10 100 10 100 10 µg/ml 10 100 10 100 µg/ml µg/ml µg/ml µg/ml µg/ml µg/ml µg/ml µg/ml

Table 5

118V 1 Omkg/ml 7D8 1 Omkg/ml rituximab 1 Omkg/ml 2F2 10 µg/ml

As is clear from the table. 4, in the case of 11B8, binding to the AGIYAP sequence of the small first extracellular loop of human CD20 is observed at both a concentration of 10 μg/ml and at a concentration of 100 μg/ml, while for other antibodies tested there is no significant binding to the AGIYAP fragment.

In addition, 11B8 binds to the MESLNFIRAHTPYI sequence of the second extracellular loop of human CD20 at both 10 μg/ml and 100 μg/ml concentrations, while no significant binding to the MESLNFIRAHTPYI fragment is observed for the other antibodies tested.

As is clear from the table. 5, for rituximab, binding to EPANPSEK of the second extracellular loop of human CD20 was observed at both concentrations of 1 μg/ml and at concentrations of 10 μg/ml, while for other antibodies tested, no significant binding to the EPANPSEK fragment was observed.

Example 16. Anti-idiotypic antibodies.

Preparation of anti-idiotypic antibodies: Mouse anti-idiotypic antibodies are produced by immunizing Balb/C mice with 2F2 or 11B8T and generating hybridomas from the spleens of these mice by fusion with NS1 myeloma cells using standard methods. The following anti-idiotypic antibodies are obtained: αanti-2F2 sab 1.1, anti-2F2 sab 1.2, anti-2F2 sab 1.3, anti-11B8T sab 2.2, anti-11B8T sab 2.3, anti-11B8T sab 2.4, anti-11B8T sab 2.5 and anti-11B8T sab 2.6. They are tested for specific binding to 2F2T, 7D8 and 11B8T. ELISA plates are coated with purified 2F2T, 7D8 or 11B8T (diluted in PBS to a final concentration of 1-2 µg/ml, 37°C, 2 h). The plates are blocked with PBS containing 0.05% Tween-20 and 2% chicken serum (RT, 1 h). The plates are then incubated with culture supernatants of anti-idiotypic antibodies (final concentration adjusted to 1-10 μg/ml, RT, 2 h). Bound mouse anti-idiotypic antibodies were detected using rabbit anti-mouse IgG-HRP conjugated antibody (Jackson ImmunoResearch).

As shown in FIG. 50, anti-2F2 sab 1.1, αanti-2F2 sab 1.2, and anti-2F2 sab 1.3 bind to 2F2T and 7D8, but not to 11B8T or an unrelated isotype control human antibody. Since 2F2T and 7D8 have a high degree of sequence homology to V _L and VH, it was assumed that anti-2F2 idiotypic antibodies react with 7D8.

In fig. 51 shows that anti-11B8T sab 2.2, anti-11B8T sab 2.3, anti-11B8T sab 2.4, anti-11B8T sab 2.5 and anti-11B8T sab 2.6 all bind to 11B8T to a similar extent.

Anti-idiotypic antibodies as an immunodiagnostic tool. Anti-idiotypic antibodies 2F2/7D8 and 11B8T can be used as an immunodiagnostic tool to detect and quantify levels of human monoclonal antibodies against CD20 in laboratory samples or in patient samples. This can be used to study the pharmacokinetics of an anti-CD20 antibody or detect and adjust the dosage of an anti-CD20 antibody and to monitor a patient's disease and treatment response. An example of such an assay: ELISA plates are coated using 4 μg/ml αanti-2F2 sab 1.1, anti-2F2 sab 1.2 or αanti-2F2 sab 1.3. The plates are blocked with PBS containing 0.05% Tween-20 and 2% chicken serum (RT, 1 h). The plates are then incubated in a serial dilution of 2F2T (10,000 - 9.77 ng/ml, RT, 2 h). Bound 2F2T is detected using a mouse HRP-conjugated anti-human IgG antibody. As shown in FIG. 52A-C, a dose dependence of 2F2T binding is observed.

Equivalents.

Those skilled in the art will recognize, or will be able to ascertain through only routine experimentation, that there are many equivalents to the specific embodiments of the invention herein described. Such equivalents are intended to be covered by the following claims. Any combination of embodiments described in the dependent claims is considered to be within the scope of this invention.

Claims (5)

CLAIM 1. Pharmaceutical composition for subcutaneous administration for the treatment or prevention of multiple sclerosis, containing: i) an isolated human monoclonal antibody that binds to human CD20 and which contains heavy chain CDR1, CDR2 and CDR3 regions having the amino acid regions represented in SEQ ID NOs: 13, 14 and 15; and light chain CDR1, CDR2 and CDR3 regions having the amino acid regions shown in SEQ ID NOs: 16, 17 and 18; and ii) a pharmaceutically acceptable carrier. 2. The composition according to claim 1, wherein the antibody is an IgG1 antibody. 3. The composition according to any one of claims 1, 2, in which the antibody is encoded by nucleic acids encoding a heavy chain of human origin and kappa light chain of human origin, which contain the nucleotide sequences presented in SEQ ID NO: 1 and SEQ ID NO: 3 , respectively, encoding their variable regions. 4. The composition according to any one of claims 1, 2, in which the antibody has variable regions of a heavy chain of human origin and kappa light chain of human origin, containing the amino acid sequences presented in SEQ ID NO: 2 and SEQ ID NO: 4, respectively. 5. The composition according to any one of claims 1, 3 and 4, in which the antibody is an intact antibody selected from the group consisting of: intact IgG1 antibody, intact IgG2 antibody, intact IgG3 antibody, intact IgG4 antibody, intact IgM antibody, intact IgA1 antibody, intact IgA2 antibody, intact secretory IgA antibody, intact IgD antibody and intact IgE antibody, wherein the antibody is glycosylated in a eukaryotic cell.