EA043083B1 - ENHANCED ACID ALPHA-GLUCOSIDASE FOR THE TREATMENT OF POMPE DISEASE - Google Patents

Description

Field of invention

The present invention provides a method for treating Pompe disease, comprising administering to an individual a combination of acid α-glucosidase and its pharmacological chaperone. More specifically, the present invention provides a method of treating Pompe disease comprising administering to an individual a combination of recombinant human α-glucosidase and miglustat.

Background of the invention

Pompe disease, also known as acid maltase deficiency or type II glycogen storage disease, is one of several lysosomal storage disorders. Lysosomal storage disorders are a group of autosomal recessive genetic disorders characterized by the accumulation of cellular glycosphingolipids, glycogen, or mucopolysaccharides in intracellular compartments called lysosomes. Individuals with these diseases carry mutant genes encoding enzymes that are defective in catalyzing the hydrolysis of one or more of these substances, which then accumulate in lysosomes. Other examples of lysosomal disorders include Gaucher's disease, G _M1 -gangliosidosis, fucosidosis, forms of mucopolysaccharidosis, Hurler-Scheie disease, Niemann-Pick types A and B, and Fabry disease. Pompe disease is also classified as a neuromuscular disease or metabolic myopathy.

Pompe disease is estimated to occur in about 1 in 40,000 newborns and is caused by a mutation in the GAA gene, which codes for the enzyme lysosomal α-glucosidase (EC:3.2.1.20), also commonly known as acid α-glucosidase. Acid α-glucosidase is involved in the metabolism of glycogen, a branched polysaccharide that is the main form of glucose storage in animals, by catalyzing its hydrolysis to glucose in lysosomes. Because individuals with Pompe disease produce a mutant, defective acid α-glucosidase that is inactive or under-active, glycogen breakdown is slower or non-existent, and glycogen is stored in the lysosomes of various tissues, particularly striated muscle. leading to a wide range of clinical manifestations, including progressive muscle weakness and respiratory failure. In particular, tissues such as cardiac and skeletal muscles are affected.

Pompe disease can vary widely in terms of enzyme deficiency, severity, and age of onset, and more than 500 different mutations in the GAA gene have been identified, many of which cause disease symptoms of varying severity. The disease was classified into main types: early onset or infantile form and late onset. Earlier onset of the disease and lower enzymatic activity are usually associated with a more severe course of the disease. The infantile form of Pompe disease is the most severe, being due to a complete or near complete deficiency of acid α-glucosidase, and presents with symptoms that include severe lack of muscle tone, weakness, enlarged liver and heart, and cardiomyopathy. The tongue may become enlarged and protrude, and swallowing may become difficult. The most severely affected children die from respiratory and cardiac complications before reaching the age of two. Late onset Pompe disease can present at any age over 12 months and is characterized by no cardiac involvement and a better short-term prognosis. Symptoms are associated with progressive skeletal muscle dysfunction and include generalized muscle weakness and atrophy of the respiratory muscles in the trunk, proximal lower extremities, and diaphragm. Some adult patients do not have major symptoms or movement restrictions. The prognosis usually depends on the degree of damage to the respiratory muscles. Most subjects with Pompe disease eventually develop physical exhaustion requiring the use of a wheelchair and assisted ventilation, with frequent premature death due to respiratory failure.

Current treatment options for Pompe disease include enzyme replacement therapy (ERT) using recombinant human acid α-glucosidase (rhGAA). Traditional rhGAA based products are known as alglucosidase-alpha, Myozyme® or Lumizyme®; Genzyme Inc. ERT is a long-term treatment required throughout the life of the patient and involves the administration of an enzyme replacement by intravenous infusion. The replacement enzyme is then transported into the bloodstream and enters the lysosomes within the cells, where its action is to break down the stored glycogen, which compensates for the deficiency in the activity of the endogenous defective mutant enzyme and thus alleviates the symptoms of the disease. In subjects with infancy-onset Pompe disease, treatment with alglucosidase-alpha has been shown to significantly improve survival compared to historical controls, and in late-onset Pompe disease, alglucosidase-alpha has been shown to be statistically significant, although and no significant effect on 6-minute walk test (6MWT) and forced vital capacity (FVC) compared to placebo.

However, the condition of most subjects remains stable or continues to deteriorate despite being treated with alglucosidase-alpha. The reason for the expressed

- 1 043083 suboptimal effect of ERT with alglucosidase-alpha is unclear, but this may be due in part to the progressive nature of the underlying muscle pathology or the weak targeting of existing ERT on tissues. For example, an infused enzyme is unstable at neutral pH, including plasma pH (approximately pH 7.4), and may be irreversibly inactivated in the circulation. In addition, infused alglucosidase-alpha exhibits insufficient uptake by major diseased muscles, possibly due to improper glycosylation by mannose-6-phosphate (M6P) residues. Such residues bind to cation-independent mannose-6-phosphate receptors (CIMPRs) on the cell surface, allowing the enzyme to enter the cell and its lysosomes. Therefore, high doses of enzyme may be necessary for effective treatment so that the proper amount of active enzyme can reach the lysosomes, making therapy costly and time consuming.

In addition, patients with Pompe disease often develop neutralizing antibodies to human recombinant acid α-glucosidase due to repeated exposure to treatment. Such immune responses can significantly reduce the tolerability of treatment by patients. The US prescribing information for alglucosidase alfa includes a black warning box with information about the potential risk of a hypersensitivity reaction. Life-threatening anaphylactic reactions, including anaphylactic shock, have been observed in subjects treated with alglucosidase-alpha.

To eliminate these shortcomings, a new generation of ERT is being developed. In one strategy, recombinant enzymes can be co-administered with pharmacological chaperones that can induce or stabilize the proper enzyme conformation to prevent or reduce enzyme degradation and/or unfolding to an inactive form in vitro (e.g., when stored prior to administration) or in vivo. Such a strategy is described in International Patent Application Publication Nos. WO 2004/069190, WO 2006/125141, WO 2013/166249 and WO 2014/014938.

The results of clinical trials of co-administration of alglucosidase-alpha and miglustat in patients with Pompe disease have been described. In clinical trials conducted in 13 subjects with Pompe disease (3 with early onset (infantile form) and 10 with late onset) at 4 treatment centers in Italy, alglucosidase alfa 20-40mg/kg was administered alone and then administered together with 4 doses of 80 mg miglustat. The results of the study show an average 6.8-fold increase in the exposure of the active form of acid α-glucosidase (measured by the pharmacokinetic parameter AUC (area under the concentration-time curve)) when co-administered in comparison with alglucosidase-alpha administered alone (Parenti, G., G. Andria, et al (2015) Lysosomal Storage Diseases: From Pathophysiology to Therapy Annu Rev Med 66(1): 471486 In addition, a study conducted at the University of Florida evaluated the plasma pharmacokinetic parameters (PK) of miglustat when co-administered with alglucosidase-alpha by intravenous infusion in subjects with Pompe disease (Doerfler, P. A., J. S. Kelley, et al. (2014). Pharmacological chaperones prevent the precipitation of rhGAA by anti-GAA antibodies during enzyme replacement therapy Mol Genet Metab 111(2): S38).

However, there remains a need for further improvements in enzyme replacement therapy in the treatment of Pompe disease. For example, novel human recombinant acid α-glucosidase enzymes are described that may have one or more advantages over currently used enzymes, including, but not limited to, improved tissue uptake, improved enzymatic activity, improved stability, or reduced immunogenicity.

Short description

The present invention provides a method for treating Pompe disease in a patient in need thereof, the method comprising administering miglustat to the patient in combination with recombinant human acid α-glucosidase (rhGAA), wherein the recombinant human acid α-glucosidase is expressed in Chinese hamster ovary (CHO ) and has an increased content of N-glycan units bearing one or two mannose-6-phosphate residues compared to the content of N-glycan units bearing one or two mannose-6-phosphate residues in alglucosidase-alpha. In at least one embodiment, human recombinant acid α-glucosidase is administered intravenously at a dose of about 20 mg/kg and miglustat is administered orally at a dose of about 260 mg.

In another aspect, the present invention provides a combination of miglustat and recombinant human acid α-glucosidase as defined herein for the treatment of Pompe disease in a patient in need thereof.

In another aspect, the present invention provides for the use of a combination of miglustat and recombinant human acid α-glucosidase as defined herein in the preparation of an agent for the treatment of Pompe disease in a patient in need thereof.

In another aspect of the present invention, a combination therapy kit is provided for

- 2 043083 Pompe disease in a patient in need thereof, wherein the kit contains a pharmaceutically acceptable dosage form containing miglustat, a pharmaceutically acceptable dosage form containing recombinant human acid α-glucosidase as defined herein, and instructions for administering a pharmaceutically acceptable dosage form containing miglustat and a pharmaceutically acceptable dosage form containing recombinant acid α-glucosidase to a patient in need thereof.

Brief description of graphic materials

Additional features of the present invention will become apparent from the following written description and the accompanying figures, which show the following.

Fig. 1 is a graph showing the percentage of unfolded ATB200 protein at various pH values and in the presence and absence of miglustat as a function of temperature.

In FIG. 2A and 2B respectively show the results of CIMPR affinity chromatography for Lumizyme® and Myozyme®. The dotted lines refer to the elution gradient with M6P. M6P elution displaces GAA molecules bound to CIMPR via an M6P-containing glycan. As shown in FIG. 2A, 78% of the active GAA form in Lumizyme® was eluted prior to the addition of M6P. In FIG. 2B shows that 73% of the active form of GAA in Myozyme® was eluted prior to the addition of M6P. Only 22% or 27% of rhGAA respectively in Lumizyme® or Myozyme® was eluted with M6P. These figures show that most of the rhGAA molecules in these two conventional rhGAA products lack the M6P glycans that are required for cellular uptake and lysosome targeting.

In FIG. 3 shows a DNA construct for transforming CHO cells with DNA encoding rhGAA. CHO cells were transformed with a DNA construct encoding rhGAA.

In FIG. 4A and 4B respectively show CIMPR affinity chromatography results for rhGAA Myozyme® and ATB200. As is evident from FIG. 4B, approximately 70% of the rhGAA molecules in rhGAA ATB200 contain M6P.

In FIG. 5A and 5B show CIMPR affinity chromatography results for rhGAA ATB200 with and without anion exchange column capture (AEX).

In FIG. 6 shows elution profiles with Polywax for rhGAA Lumizyme® and ATB200.

In FIG. 7 shows a summary of Lumizyme® N-glycan structures compared to three different rhGAA-based ATB200 preparations, designated BP-rhGAA, ATB200-1, and ATB200-2.

In FIG. 8A-8H show the results of a site-specific N-glycosylation analysis of rhGAA ATB200.

In FIG. 9A compares CIMPR binding affinity for rhGAA ATB200 (left curve) with Lumizyme® binding affinity (right curve).

In FIG. 9B shows a comparison of Bis-M6P content in rhGAA Lumizyme® and ATB200.

In FIG. 10A shows a comparison of rhGAA ATB200 activity (left curve) with Lumizyme® rhGAA activity (right curve) in normal fibroblasts at various GAA concentrations.

In FIG. 10B shows a comparison of rhGAA ATB200 activity (left curve) with Lumizyme® rhGAA activity (right curve) in fibroblasts from a Pompe disease subject at various GAA concentrations.

In FIG. 10C shows a comparison (K _nO g _ΛOchenue ) of fibroblasts obtained from healthy subjects and subjects with Pompe disease.

Fig. 11 is a graph showing the population pharmacokinetic (PK) model fitting accuracy for ATB200.

Fig. 12 is a graph showing dose-normalized plasma concentration profiles of miglustat and duvoglustat over time.

Fig. 13A is a graph demonstrating the accuracy of population PK model fitting for plasma duvoglustat.

Fig. 13B is a graph demonstrating the accuracy of fitting a population PK model for duvoglustat in muscle tissue.

Fig. 14 is a graph demonstrating the fit accuracy of the population PK model for miglustat.

Fig. 15 is a graph showing the predicted concentration-time profile obtained from infusion of a single intravenous dose (IV) of 20 mg/kg ATB200 to humans over a 4-hour period.

Fig. 16A is a graph showing the amount of glycogen versus dose of human recombinant acid α-glucosidase in mouse heart muscle after contact with an inert medium (negative control), with 20 mg/kg of alglucosidase-alpha (Lumizyme®) or with 5, 10, or 20 mg/kg ATB200.

- 3 043083

Fig. 16B is a graph showing the amount of glycogen versus dose of human recombinant acid α-glucosidase in mouse quadriceps after contact with an inert medium (negative control), with 20 mg/kg of alglucosidase-alpha (Lumizyme®) or with 5, 10, or 20 mg/kg ATB200.

Fig. 16C is a graph showing the amount of glycogen versus dose of human recombinant acid α-glucosidase in mouse triceps after contact with an inert medium (negative control), with 20 mg/kg of alglucosidase-alpha (Lumizyme®), or with 5, 10, or 20 mg/kg ATB200.

Fig. 17 is a graph plotting the ratio of glycogen levels in mice treated with various doses of miglustat in the presence of ATB200 and glycogen levels in mice treated with ATB200 alone versus the ratio of miglustat AUC value to ATB200 AUC value.

Fig. 18 is a graph showing the predicted miglustat plasma concentration versus time profile after repeated dosing of 466 mg, 270 mg, and 233 mg of miglustat.

Fig. 19 is a graph showing the predicted time profile of miglustat concentration in tissue lysosomes after repeated doses of 466 mg, 270 mg, and 233 mg of miglustat.

Fig. 20 is a series of photomicrographs of cardiac muscles, diaphragms, and soleus muscles of wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha, and ATB200 in the presence and absence of miglustat, showing levels of lysosome-associated membrane protein ( LAMP1).

Fig. 21 is a series of photomicrographs of cardiac and soleus muscles of wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha and ATB200 in the presence and absence of miglustat, showing glycogen levels by staining with Schiff's reagent and iodic acid (PAS ).

Fig. 22 is a series of photomicrographs (1000x) of quadriceps muscles of wild type and Gaa knockout mice treated with inert medium, alglucosidase-alpha and ATB200 in the presence and absence of miglustat, stained with methylene blue to show vacuoles (indicated arrows).

Fig. 23 is a series of photomicrographs (400x) of quadriceps muscles of wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha and ATB200 in the presence and absence of miglustat, showing levels of microtubule-associated protein light chain 3 autophagy markers. 1A/1B, conjugated with phosphatidylethanolamine (LC3A II), and p62, insulin-dependent glucose transporter GLUT4 and insulin-independent glucose transporter GLUT1.

Fig. 24A-24D are graphs showing active GAA plasma concentration versus time profiles in human subjects following a dose of 5, 10, or 20 mg/kg ATB200 or 20 mg/kg ATB200 and 130 or 260 mg miglustat.

Fig. 25A-25D are graphs showing plasma total GAA protein concentration versus time profiles in human subjects following a dose of 5, 10 or 20 mg/kg ATB200, 20 mg/kg ATB200 and 130 mg miglustat or 20 mg/kg ATB200 and 260 mg miglustat.

Fig. 26 is a graph showing the time profiles of miglustat plasma concentration in human subjects after administration of a dose of 130 mg or 260 mg of miglustat.

Fig. 27 is a series of micrographs of wild-type and Pompe disease fibroblasts subjected to immunofluorescence staining for GAA and LAMP1 levels.

Fig. 28 is a series of muscle fiber micrographs from wild-type and Gaa knockout mice showing levels of dystrophin, α- and β-dystroglycans, and dysferlin.

Fig. 29A and 29B are photomicrograph series (200x) of muscle fibers of the rectus femoris (RF) and vastus lateralis/vassus medialis (VL/VM) mice of wild-type and Gaa knockout mice treated with an inert medium, alglucosidase- alpha and ATB200 with and without miglustat showing IHC signals from LAMP1.

Fig. 30A and 30B are photomicrograph series (200x) of RF and VL/VM muscle fibers from wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha, and ATB200 in the presence and absence of miglustat, showing IHC signals. from LC3-II.

Fig. 31A and 31B are photomicrograph series (200x) of RF and VL/VM muscle fibers from WT and Gaa knockout mice treated with inert medium, alglucosidase-alpha and ATB200 in the presence and absence of miglustat, showing IHC signals.

- 4 043083 from dysferlin.

Fig. 32A-32D are graphs showing glycogen levels in quadriceps, triceps, gastrocnemius, and cardiac muscle cells of wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha, and ATB200 in the presence and absence of miglustat.

Fig. 33A and 33B are graphs showing wire hang and muscle grip strength data in WT and Gaa knockout mice treated with inert medium, alglucosidase-alpha and ATB200 in the presence of miglustat.

Fig. 34A-34G are graphs showing glycogen levels in quadriceps, triceps, and cardiac muscle cells of wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha, and ATB200 in the presence and absence of miglustat.

Fig. 35 is a series of micrographs of VL/VM muscle fibers from wild type and Gaa knockout mice treated with inert medium, alglucosidase-alpha and ATB200 in the presence and absence of miglustat, showing IHC signals from LAMP1, LC3 and dysferlin.

Fig. 36 is a graph showing the plasma concentration-time profiles of the active form of GAA in Gaa knockout mice after administration of two batches of ATB200 having different sialic acid content.

Fig. 37A-37D are graphs showing glycogen levels in quadriceps, triceps, gastrocnemius, and cardiac muscle cells of wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha, and ATB200.

Fig. 38 is a graph showing alanine aminotransferase (ALT) levels in human patients following escalating doses of ATB200 (5, 10 and 20 mg/kg) followed by co-administration of ATB200 (20 mg/kg) and miglustat (130 and 260 mg).

Fig. 39 is a graph showing aspartate aminotransferase (AST) levels in human patients following escalating doses of ATB200 (5, 10 and 20 mg/kg) followed by co-administration of ATB200 (20 mg/kg) and miglustat (130 and 260 mg).

Fig. 40 is a graph showing creatine phosphokinase (CPK) levels in human patients following escalating doses of ATB200 (5, 10 and 20 mg/kg) followed by co-administration of ATB200 (20 mg/kg) and miglustat (130 and 260 mg).

Fig. 41 is a graph showing mean levels of ALT, AST and CPK in human patients following escalating doses of ATB200 (5, 10 and 20 mg/kg) followed by co-administration of ATB200 (20 mg/kg) and miglustat (130 and 260 mg ).

Fig. 42 is a series of photomicrographs (100x and 200x) of vastus lateralis (VL) muscle fibers of wild-type and Gaa knockout mice treated with inert medium, alglucosidase-alpha and ATB200 in the presence and absence of miglustat, showing signals from dystrophin.

Definitions

The terms used in this description, as a rule, have their usual meanings in the art, in the context of the present invention and in the specific context in which each term is used. Certain terms are discussed below or elsewhere in this specification to provide additional guidance to the practitioner.

In the present description, except when the context otherwise requires due to language or necessary implied meaning, the word contain or variants such as contains or containing are used in the inclusive sense, i.e. to indicate the presence of the recited features, but without excluding the presence or addition of additional features in various embodiments of the present invention.

As used herein, the term Pompe disease, also referred to as acid maltase deficiency, glycogen storage disease type II (GSDII), and glycogenosis type II, is intended to refer to a genetic lysosomal storage disorder characterized by mutations in the GAA gene, which codes for the enzyme human acid α-glucosidase. . The term includes, without limitation, early and late onset forms of the disease, including, but not limited to, onset Pompe disease in infancy, adolescence, and adulthood.

As used herein, the term acidic α-glucosidase is intended to mean a lysosomal enzyme that hydrolyzes the α-1,4 bonds between the D-glucose units of glycogen, maltose and isomaltose. Alternative names include, without limitation, lysosomal α-glucosidase (EC: 3.2.1.20); glucoamylase; 1,4-α-D-glucanglucohydrolase; amyloglucosidase; gammaamylase and exo-1,4-a-glucosidase. Human acid α-glucosidase is encoded by the GAA gene (Gene ID 2548 at the National Center for Biotechnology Information (NCBI)), which has been mapped to the long arm of chromosome 17 (location 17q25.2-q25.3). To date, more than 500 mutations have been identified in the human GAA gene, many of which are associated with Pompe disease. Mutations

- 5 043083 resulting in misfolding or misprocessing of the acid α-glucosidase enzyme include T1064C (Leu355Pro) and C2104T (Arg702Cys). In addition, GAA mutations that affect enzyme maturation and processing include Leu405Pro and Met519Thr. The activity of the acid α-glucosidase protein requires the presence of the conserved WIDMNE hexapeptide at amino acid residues 516-521. As used herein, the abbreviation GAA is meant to mean the enzyme acid α-glucosidase, while the italicized abbreviation GAA is meant to mean the human gene encoding the enzyme human acid α-glucosidase. The italicized abbreviation Gaa is meant to refer to non-human genes encoding non-human acid α-glucosidase enzymes, including but not limited to rat or mouse genes, and the abbreviation Gaa is meant to refer to non-human acid α-glucosidase enzymes. Thus, the abbreviation rhGAA is meant to mean the enzyme recombinant human acid α-glucosidase.

As used herein, the term alglucosidase-alpha is meant to mean recombinant human acid α-glucosidase identified as [199-arginine,223 histidine]prepro-α-glucosidase (human); registration number in Chemical Abstracts 420794-05-0. Alglucosidase-alpha has been approved by Genzyme for sale in the US since October 1, 2014 as Lumizyme® and Myozyme® products.

As used herein, the term ATB200 is intended to refer to the human recombinant acid α-glucosidase described in patent application PCT/US2015/053252 co-pending with the patent office, the disclosure of which is incorporated herein by reference.

As used herein, the term glycan is intended to mean a polysaccharide chain covalently linked to an amino acid residue in a protein or polypeptide. As used herein, the term N-glycan or N-linked glycan is meant to mean a polysaccharide chain attached to an amino acid residue in a protein or polypeptide by forming a covalent bond with the nitrogen atom of the amino acid residue. For example, an N-glycan may be covalently attached to the side chain nitrogen of an aspartic residue. Glycans may contain one or more monosaccharide units, and the monosaccharide units may be covalently linked to form a straight chain or a branched chain. In at least one embodiment, the N-glycan units attached to ATB200 may contain one or more monosaccharide units, each independently selected from N-acetylglucosamine, mannose, galactose, or sialic acid. N-glycan units in a protein can be determined using any suitable analytical technique such as mass spectrometry. In some embodiments, N-glycan units can be determined by tandem mass spectrometry liquid chromatography (LC-MS/MS) using instruments such as the Orbitrap Velos Pro™ mass spectrometer from Thermo Scientific, the Orbitrap Fusion Lumos Tribid™ mass spectrometer from Thermo Scientific or Waters Xevo® G2-XS QTof mass spectrometer.

As used herein, the term high mannose N-glycan is intended to mean an N-glycan having one to six or more mannose units. In at least one embodiment, the high mannose N-glycan unit may comprise a 6uc(Nacetylglucosamine) chain linked to an aspartic residue and further linked to a branched polymannose chain.

As used herein, the interchangeable terms M6P or mannose-6-phosphate are intended to mean a mannose unit phosphorylated at position 6; those. having a phosphate group linked to a hydroxyl group at position 6. In at least one embodiment, one or more mannose units of one or more N-glycan units are phosphorylated at position 6 to form mannose-6-phosphate units. In at least one embodiment, the terms M6P or mannose-6-phosphate refer to both a mannose phosphodiester having N-acetylglucosamine (GlcNAc) as a cap in the phosphate group, as well as a mannose unit having an accessible phosphate group lacking a GlcNAc cap. In at least one embodiment, the N-glycans of a protein may have multiple M6P groups, wherein at least one M6P group has a GlcNAc cap and at least one other M6P group lacks a GlcNAc cap.

As used herein, the term complex N-glycan is meant to mean an N-glycan containing one or more galactose and/or sialic acid units. In at least one embodiment, the N-glycan complex can be a high mannose N-glycan wherein one or more mannose units are further linked to one or more monosaccharide units each independently selected from N-acetylglucosamine, galactose, and sialic acid.

As used herein, the compound miglustat, also known as N-butyl-1-6 043083 deoxynojirimycin, or NB-DNJ, or (2R,3R,4R,5S)-1-butyl-2-(hydroxymethyl)piperidine-3 ,4,5triol, is a compound having the following chemical formula:

He

He

One miglustat-based formulation is marketed commercially under the trade name Zavesca® as a monotherapy for type 1 Gaucher's disease.

As discussed below, pharmaceutically acceptable salts of miglustat can also be used in the present invention. If miglustat salt is used, the dosage of the salt is adjusted so that the dose of miglustat received by the patient is equivalent to the amount that would be obtained with the free base form of miglustat.

As used herein, the compound duvoglustat, also known as 1deoxynojirimycin or DNJ or (2R,3R,4R,5S)-2-(hydroxymethyl)piperidine-3,4,5-triol, is a compound having the following chemical formula:

He

He

As used herein, the term pharmacological chaperone, or sometimes simply the term chaperone, is intended to mean a molecule that specifically binds to acid α-glucosidase and is characterized by one or more of the following effects:

improves the formation of a stable molecular conformation of the protein;

improves proper protein transport from the endoplasmic reticulum to another location in the cell, preferably a native location in the cell, in order to prevent protein degradation associated with the endoplasmic reticulum;

prevents aggregation of conformationally unstable or misfolded proteins;

at least partially restores and/or improves the function, stability and/or activity of the wild-type protein and/or improves the phenotype or function of a cell containing acid α-glucosidase.

Thus, the pharmacological chaperone for acid α-glucosidase is a molecule that binds to acid α-glucosidase, which causes proper folding, transport, non-aggregation and activity of acid α-glucosidase. This term, as used herein, includes, without limitation, active site-specific chaperones (ASSCs) that bind to the active site of an enzyme, inhibitors or antagonists, and agonists. In at least one embodiment, the pharmacological chaperone may be an inhibitor or antagonist of acid α-glucosidase. As used herein, the term antagonist is intended to mean any molecule that binds to acid α-glucosidase and partially or completely blocks, inhibits, reduces or neutralizes acid α-glucosidase activity. In at least one embodiment, the pharmacological chaperone is miglustat. Another non-limiting example of a pharmacological chaperone for acid aglucosidase is duvoglustat.

As used herein, the term active site is intended to mean a region of a protein that is associated with, and is required for, a particular biological activity of the protein. In at least one embodiment, the active site may be a site at which binding occurs to a substrate or other binding partners and which provides amino acid residues directly involved in the formation and destruction of chemical bonds. In the present invention, active sites may include enzyme catalytic sites, antibody antigen-binding sites, ligand-binding domains of receptors, regulatory binding domains, or receptor-binding domains of secreted proteins. Active sites may also encompass transactivation domains, domains involved in protein-protein interactions, or DNA-binding domains of transcription factors and regulators.

As used herein, the term AUC is intended to mean a mathematical calculation for estimating the overall effect of a specified drug on the body over time. The graph shows how the blood concentration of a drug administered to a subject changes over time after a dose, with the drug concentration variable plotted on the y-axis and time plotted on the x-axis. The area between the drug concentration curve and the x-axis for a given time interval is called AUC (area under the curve). AUC is used as a guideline for dosing schedules and for comparing the bioavailability of different drugs, which determines their availability in

- 7 043083 body.

As used herein, the term C _max is intended to refer to the maximum plasma drug concentration achieved after administration to a subject.

As used herein, the term volume of distribution or V is intended to mean the theoretical volume that would be required to contain the total amount of drug administered at the same concentration as observed in plasma and represents the extent to which the drug is distributed into tissues body and not in plasma. Higher V values indicate a higher degree of tissue distribution. The central volume of distribution or V _c is meant to mean the volume of distribution in blood and tissues well perfused with blood. Peripheral volume of distribution or V2 is meant to mean the volume of distribution in peripheral tissues.

As used herein, the interchangeable terms clearance, systemic clearance, or CL are intended to refer to the volume of blood plasma that is completely cleared of an administered drug per unit time. Peripheral clearance is meant to mean the volume of peripheral tissue cleared of administered drug per unit time.

As used herein, a therapeutically effective dose and an effective amount are intended to mean an amount of acid α-glucosidase and/or miglustat and/or combinations thereof that is sufficient to elicit a therapeutic response in a subject. A therapeutic response may be any response that the user (eg, consultant physician) recognizes as an effective response to therapy, encompassing any of the surrogate clinical markers or symptoms described herein and known in the art. Thus, in at least one embodiment, the therapeutic response may be a reduction in intensity or inhibition of one or more symptoms or markers of Pompe disease, such as those known in the art. Symptoms or markers of Pompe disease include, without limitation, reduced tissue acid α-glucosidase activity; cardiomyopathy; cardiomegaly; progressive muscle weakness, especially in the trunk or lower extremities; deep hypotension; macroglossia (and in some cases protrusion of the tongue); difficulty swallowing, sucking and/or feeding; respiratory failure; hepatomegaly (moderate); lethargy of the muscles of the face; areflexia; intolerance to physical activity; shortness of breath on exertion; orthopnea; sleep apnea; morning headaches; drowsiness; lordosis and/or scoliosis; decreased deep tendon reflexes; low back pain and inconsistency with key stages of motor development. It should be noted that the concentration of miglustat that has an inhibitory effect on acid α-glucosidase may be an effective amount for the purposes of the present invention due to dilution (and subsequent shift in binding due to a change in equilibrium state), bioavailability and metabolism of miglustat when administered in vivo.

As used herein, the term enzyme replacement therapy or ERT is intended to mean the administration of a non-native purified enzyme to an individual deficient in that enzyme. The protein to be administered can be obtained from natural sources or through recombinant expression. The term also refers to the administration of a purified enzyme to an individual otherwise requiring or benefiting from the administration of a purified enzyme. In at least one embodiment, such an individual suffers from an enzyme deficiency. The enzyme administered may be a purified recombinant enzyme obtained in vitro, or a protein purified from isolated tissue or fluid, such as, for example, placenta or animal milk, or from plants.

As used herein, the term combination therapy is intended to mean any therapy in which two or more separate therapeutic agents are administered simultaneously or sequentially. In at least one embodiment, the results of combination therapy are improved in comparison with the effect of each type of therapy carried out separately. Enhancement may include any improvement in the effect of different therapies that may result in a favorable outcome compared to those achieved with those therapies alone. Enhanced effect or results may include synergistic enhancement, where the enhanced effect is greater than the additive effects of each of the therapies administered alone; additive amplification, where the enhanced effect is essentially equal to the additive effect of each of the therapies carried out separately; or a less synergistic effect, where the enhanced effect is weaker than the additive effect of each of the therapies administered alone, but still better than the effect of each of the treatments alone. Enhanced effect can be measured using any of the methods known in the art that measure the effectiveness or outcome of a treatment.

As used herein, the term pharmaceutically acceptable is intended to mean

- 8 043083 denoting molecular entities and compositions that are physiologically tolerable and do not usually cause adverse reactions when administered to a human. As used herein, the term "pharmaceutically acceptable" preferably means approved by a regulatory agency of the federal or state government or referred to in the USP or other generally accepted pharmacopoeia for use in animals and, more specifically, in humans.

As used herein, the term carrier is intended to mean the diluent, adjuvant, excipient, or inert medium with which the compound is administered. Suitable pharmaceutical carriers are known in the art and in at least one embodiment are described in Remington's Pharmaceutical Sciences E. W. Martin, 18th edition or other editions.

As used herein, the terms subject or patient are intended to mean a human or non-human animal. In at least one embodiment, the subject is a mammal. In at least one embodiment, the subject is a human.

As used herein, the term anti-drug antibody is intended to mean an antibody that specifically binds to a drug administered to a subject and elicited by the subject as at least part of the humoral immune response to administration of the drug to the subject. In at least one embodiment, the drug is a therapeutic protein drug. An anti-drug antibody present in a subject can elicit immune responses ranging from mild to severe, including, but not limited to, life-threatening immune responses, which include, but are not limited to, an anaphylactic reaction, cytokine release syndrome, and cross-neutralization of endogenous proteins mediating vital functions. In addition, or alternatively, an anti-drug antibody present in a subject may decrease the effectiveness of the drug.

As used herein, the term neutralizing antibody is intended to mean an antibody to a drug that acts to neutralize the function of the drug. In at least one embodiment, the therapeutic protein drug is an analog of an endogenous protein whose expression in the subject is reduced or absent. In at least one embodiment, the effect of neutralizing antibodies may be to neutralize the function of an endogenous protein.

As used herein, the terms approximately and approximately are intended to mean an acceptable degree of error for the quantity being measured, taking into account the nature or accuracy of the measurements. For example, the degree of error may be indicated by the number of significant digits provided for the measurement, as understood in the art, and includes, without limitation, a change of ± 1 of the most accurate significant digit provided for the measurement. Typical exemplary degrees of error are within 20 percent (%), preferably within 10%, and more preferably within 5% of the specified value or range of values. Alternatively, and in particular in biological systems, the terms about and approximately can mean values that are within an order of magnitude, preferably within a 5-fold and more preferably within a 2-fold change in said value. Numerical values given in this document are approximate unless otherwise indicated, which means that the term approximately or approximately may be an estimate unless specifically stated.

The term simultaneously, as used herein, is intended to mean at the same time as, or within a reasonably short period of time before or after, as will be understood by one skilled in the art. For example, if two treatments are administered simultaneously with each other, then one treatment may be administered before or after the other treatment, making allowance for the time required to prepare the last of the two treatments. Therefore, simultaneous administration of two treatments includes, without limitation, administration of one treatment agent following the other 20 minutes or less, about 20 minutes, about 15 minutes, about 10 minutes, about 5 minutes, about 2 minutes, about 1 minute or less than 1 min.

The term pharmaceutically acceptable salt as used herein is meant to mean a salt which, under careful medical judgment, is suitable for use in contact with tissues of humans and lower animals without non-specific toxicity, sensitization, allergic reaction, etc., is reasonable the ratio of risk and benefit, is usually water- or fat-soluble or dispersible and is effective for the intended application. The term includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts. Lists of suitable salts are found, for example, in S. M. Birge et al., J. Pharm. Sc., 1977, 66, p. 1-19, incorporated herein by reference.

- 9 043083

The term pharmaceutically acceptable acid addition salt as used herein is intended to mean those salts that retain the biological efficacy and properties of free bases and that are not biologically or otherwise undesirable formed with inorganic acids, including without limitation with hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, nitric acid, phosphoric acid, etc., and organic acids, including but not limited to acetic acid, trifluoroacetic acid, adipic acid, ascorbic acid, aspartic acid, benzenesulfonic acid , benzoic acid, butyric acid, camphoric acid, camphorsulfonic acid, cinnamic acid, citric acid, digluconic acid, ethanesulfonic acid, glutamic acid, glycolic acid, glycerophosphoric acid, hemisulfate acid, hexanoic acid, formic acid, fumaric acid, 2-hydroxyethanesulfonic acid (isethionic acid), lactic acid, hydroxymaleic acid, malic acid, malonic acid, mandelic acid, mesitylenesulfonic acid, methanesulfonic acid, naphthalene sulfonic acid, nicotinic acid, 2-naphthalene sulfonic acid, oxalic acid, pamoic acid, pectic acid, phenylacetic acid, 3 -phenylpropionic acid, pivalic acid, propionic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, sulfanilic acid, tartaric acid, p-toluenesulfonic acid, undecanoic acid, and the like.

The term pharmaceutically acceptable base addition salt as used herein is intended to mean those salts that retain the biological efficacy and properties of free acids and that are not biologically or otherwise undesirable formed with inorganic bases, including without limitation with ammonia or hydroxide, ammonium carbonate or bicarbonate or a metal cation such as sodium, potassium, lithium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. Salts derived from pharmaceutically acceptable organic non-toxic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, quaternary ammonium compounds, substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, isopropylamine, tripropylamine, tributylamine, ethanolamine, diethanolamine, 2dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, tetramethylammonium compounds, tetraethylammonium compounds, pyridine, N,N-dimethylaniline, N-methylpiperidine, N-methylmorpholine, dicyclohexylamine, dibenzylamine, N,Ndibenzylphenethylamine, 1-ephenamine, N,N'-dibenzylethylenediamine , polyamine resins, etc.

Detailed description

The present invention provides a method of treating Pompe disease in a patient in need thereof, the method comprising administering to the patient miglustat or a pharmaceutically acceptable salt thereof in combination with recombinant human acid α-glucosidase, wherein the recombinant human acid aglucosidase is expressed in Chinese hamster ovary (CHO ) and has an increased content of N-glycan units bearing one or two mannose-6-phosphate residues compared to the content of N-glycan units bearing one or two mannose-6-phosphate residues in aglucosidase-alpha. In at least one embodiment, the recombinant human acid aglucosidase has low levels of galactose-terminated complex glycans. In another aspect, the present invention provides for the use of miglustat and recombinant human α-glucosidase in combination for the treatment of Pompe disease in a patient in need thereof.

In at least one embodiment, miglustat is administered orally. In at least one embodiment, miglustat is administered at an oral dose of about 200 mg to about 600 mg, or an oral dose of about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, approximately 500 mg, approximately 550 mg or approximately 600 mg. In at least one embodiment, miglustat is administered at an oral dose of about 233 mg to about 400 mg. In at least one embodiment, miglustat is administered at an oral dose of about 250 to about 270 mg, or an oral dose of about 250 mg, about 255 mg, about 260 mg, about 265 mg, or about 270 mg. In at least one embodiment, miglustat is administered at an oral dose of about 260 mg.

Those skilled in the art will appreciate that an oral dose of miglustat in the range of about 200 mg to 600 mg, or any lesser range therein, may be appropriate for an adult patient with an average body weight of about 70 kg. For patients who have a significantly lower body weight than approximately 70 kg, including

- 10 043083 without limitation infants, children or underweight adults, a lower dose may be considered appropriate by the attending physician. Therefore, in at least one embodiment, miglustat is administered as an oral dose of about 50 mg to about 200 mg, or as an oral dose of about 50 mg, about 75 mg, about 100 mg, 125 mg, about 150 mg, approximately 175 mg or approximately 200 mg. In at least one embodiment, miglustat is administered as an oral dose of about 65 mg to about 195 mg, or as an oral dose of about 65 mg, about 130 mg, or about 195 mg.

In at least one embodiment, miglustat is administered in a pharmaceutically acceptable dosage form suitable for oral administration, which includes, without limitation, tablets, capsules, vaginal suppositories, tinctures, solutions or suspensions, gels, syrups, mouthwashes, or dry powder for oral administration. dilution with water or other suitable inert medium prior to use, optionally with flavoring and coloring agents for immediate, delayed, modified, sustained, intermittent or controlled release routes of use. Solid compositions such as tablets, capsules, lozenges, lozenges, pills, boluses, powders, pastes, granules, suppositories, dragees or premix preparations may also be used. In at least one embodiment, miglustat is administered as a tablet. In at least one embodiment, miglustat is administered as a capsule. In at least one embodiment, the dosage form contains from about 50 mg to about 300 mg of miglustat. In at least one embodiment, the dosage form contains approximately 65 mg of miglustat. In at least one embodiment, the dosage form contains approximately 130 mg of miglustat. In at least one embodiment, the dosage form contains approximately 260 mg of miglustat. It is contemplated that if the dosage form contains approximately 65 mg of miglustat, then miglustat can be administered as a dosage of four dosage forms or in a total dose of 260 mg of miglustat. However, for patients who are significantly lower than the average adult weight of 70 kg, including but not limited to infants, children, or underweight adults, miglustat can be administered as a single dose dosage form (for a total dose of 65 mg miglustat), two dosage forms (for a total dose of 130 mg miglustat) or three dosage forms (for a total dose of 195 mg miglustat).

Solid and liquid compositions for oral use can be obtained in accordance with methods well known in the art. Such compositions may also contain one or more pharmaceutically acceptable carriers and excipients, which may be in solid or liquid form. Tablets and capsules can be prepared by conventional methods using pharmaceutically acceptable excipients, including, but not limited to, binders, fillers, lubricants, disintegrants, or wetting agents. Suitable pharmaceutically acceptable excipients are known in the art and include, without limitation, pregelatinized starch, polyvinylpyrrolidone, povidone, hydroxypropyl methylcellulose (HPMC), hydroxypropyl ethylcellulose (HPEC), hydroxypropyl cellulose (HPC), sucrose, gelatin, gum arabic, lactose, microcrystalline cellulose, calcium hydrogen phosphate, magnesium stearate , stearic acid, glyceryl behenate, talc, silicon dioxide, corn, potato or cassava starch, sodium starch glycolate, sodium lauryl sulfate, sodium citrate, calcium carbonate, dibasic calcium phosphate, glycine, croscarmellose sodium and complex silicates. Tablets can be coated by methods well known in the art. In at least one embodiment, miglustat is administered as a formulation commercially available as Zavesca® (Actelion Pharmaceuticals).

In at least one embodiment, recombinant human acid α-glucosidase is expressed in Chinese hamster ovary (CHO) cells and has an increased content of N-glycan units bearing one or more mannose-6-phosphate residues compared to N-glycan units bearing one or more mannose-6-phosphate residues, in alglucosideasealpha. In at least one embodiment, the acid α-glucosidase is recombinant human acid α-glucosidase, referred to herein as ATB200, as described in International Patent Application PCT/US2015/053252, co-pending with the Patent Office. ATB200 has been shown to bind to cation-independent mannose-6-phosphate receptors (CIMPRs) with high affinity (KD ~ 2-4 nM) and is efficiently internalized by Pompe disease fibroblasts and skeletal muscle myoblasts ( _{KnoglO u e ~} 7 -14 nM). ATB200 has been characterized in vivo and shown to have a shorter apparent plasma half-life (t _1/2 ~ 45 min) than alglucosidase-alpha (t _1/2 ~ 60 min).

In at least one embodiment, the recombinant human acid α-glucosidase is an enzyme having the amino acid sequence listed under SEQ ID NO: 1, SEQ ID NO: 2 (or encoded by SEQ ID NO: 2), SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5.

- 11 043083

SEQ ID NO: 1 Met Gly Vai Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Vai Cys Ala Leu Vai Ser Leu Ala Thr Ala Ala Leu Leu Gly His He Leu Leu His Asp Phe Leu Leu Vai Pro Arg Ser Glu Leu Ser Gly Ser Pro Vai Leu Glu Glu Thr His Pro Ala His Gin Gin Gly Ala Ser Arg Pro Gly Pro Arg Asp Ala Gin Ala His Pro Gly Arg Pro Arg Ala Vai Pro Thr Gin Cys Asp Vai Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys Ala He Thr Gin Glu Gin Cys Glu Ala Arg Gly Cys Cys Tyr He Pro Ala Lys Gin Gly Leu Gin Gly Ala Gin Met Gly Gin Pro Trp Cys Phe Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr Pro Thr Phe Phe Pro Lys Asp He Leu Thr Leu Arg Leu Asp Vai Met Met Glu Thr Glu Asn Arg Leu His Phe Thr He Lys Asp Pro Ala Asn Arg Arg Tyr Glu Vai Pro Leu Glu Thr Pro Arg Vai His Ser Arg Ala Pro Ser Pro Leu Tyr Ser Vai Glu Phe Ser Glu Glu Pro Phe Gly Vai He Vai His Arg Gin Leu Asp Gly Arg Vai Leu Leu Asn Thr Thr Vai Ala Pro Leu Phe Phe Ala Asp Gin Phe Leu Gin Leu Ser Thr Ser Leu Pro Ser Gin Tyr He Thr Gly Leu Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser Trp Thr Arg lie Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly Gly Ser Ala His Gly Vai Phe Leu Leu Asn Ser Asn Ala Met Asp Vai Vai Leu Gin Pro Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly He Leu Asp Vai Tyr He Phe Leu Gly Pro Glu Pro Lys Ser Vai Vai Gin Gin Tyr Leu Asp Vai Vai Gly Tyr Pro Phe Met Pro Pro Tyr Trp Gly Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala He Thr Arg Gin Vai Vai Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Vai Gin Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met Vai Gin Glu Leu His Gin Gly Gly Arg Arg Tyr Met Met He Vai Asp Pro Ala He Ser Ser Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg Gly Vai Phe He Thr Asn Glu Thr Gly Gin Pro Leu He Gly Lys Vai Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu Ala Trp Trp Glu Asp Met Vai Ala Glu Phe His Asp Gin Vai Pro Phe Asp Gly Met Trp He Asp Met Asn Glu Pro Ser Asn Phe He Arg Gly Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu Asn Pro Pro Tyr Vai Pro Gly Vai Vai Gly Gly Thr Leu Gin Ala Ala Thr He Cys Ala Ser Ser His Gin Phe Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly Leu Thr Glu Ala He Ala Ser His Arg Ala Leu Vai Lys Ala Arg Gly Thr Arg Pro Phe Vai He Ser Arg Ser Thr Phe Ala Gly His Gly Arg Tyr Ala Gly His Trp Thr Gly Asp Vai Trp Ser Ser Trp Glu Gin Leu Ala Ser Ser Vai Pro Glu He Leu Gin Phe Asn Leu Leu Gly Vai Pro Leu Vai Gly Ala Asp Vai Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu Leu Cys Vai Arg Trp Thr Gin Leu Gly Ala Phe Tyr Pro Phe Met Arg Asn His Asn Ser Leu Leu Ser Leu Pro Gin Glu Pro Tyr Ser

- 12 043083

Phe Ser Glu Pro Ala Gin Gin Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala Leu Leu Pro His Leu Tyr Thr Leu Phe His Gin Ala His Vai Ala Gly Glu Thr Vai Ala Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser Thr Trp Thr Vai Asp His Gin Leu Leu Trp Gly Glu Ala Leu Leu He Thr Pro Vai Leu Gin Ala Gly Lys Ala Glu Vai Thr Gly Tyr Phe Pro Leu Gly Thr Trp Tyr Asp Leu Gin Thr Vai Pro He Glu Ala Leu Gly Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu Pro Ala He His Ser Glu Gly Gin Trp Vai Thr Leu Pro Ala Pro Leu Asp Thr He Asn Vai His Leu Arg Ala Gly Tyr He He Pro Leu Gin Gly Pro Gly Leu Thr Thr Thr Glu Ser Arg Gin Gin Pro Met Ala Leu Ala Vai Ala Leu Thr Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp Asp Asp Gly Glu Ser Leu Glu Vai Leu Glu Arg Gly Ala Tyr Thr Gin Vai He Phe Leu Ala Arg Asn Asn Thr He Vai Asn Glu Leu Vai Arg Vai Thr Ser Glu Gly Ala Gly Leu Gin Leu Gin Lys Vai Thr Vai Leu Gly Vai Ala Thr Ala Pro Gin Gin Vai Leu Ser Asn Gly Vai Pro Vai Ser Asn Phe Thr Tyr Ser Pro Asp Thr Lys Vai Leu Asp He Cys Vai Ser Leu Leu Met Gly Glu Gin Phe Leu Vai Ser Trp Cys

SEQ ID NO: 2 gc ctgtaggagctgtccaggccatctccaaccatgggagtgaggcacccgccctgctcccaccggc tcctggccgtctgcgccctcgtgtccttggcaaccgctgcactcctggggcacatcctactccatg atttcctgctggttccccgagctgagtggctcctccccagtcctggaggagactcacccagctc accagcaggga gccagcagaccagggccccgggatgcccaggcacaccccggccgtcccag agcagtgcccacacagtgcgacgtcccccccaacagccgcttcgattgcgcccctgacaaggcc atcaccggaacagtgcgaggcccgcggctgctgctacatccctgcaaagcaggggctgcag ggagcccagatggggcagccctggt gcttcttcccacccagctaccccagctacaagctggaga acctgagctcctctgaaatgggctacacggccaccctgacccgtaccacccccaccttcttcccca aggacatcctgaccctgcggctggacgtgatgatggagactgagaaccgcctccacttcacgatc aaagatccagctaacaggcgctacgaggtgcccttggagaccccg cgtgtccacagccggggca

- 13 043083 ccgtccccactctacagcgtggagttctccgaggagcccttcggggtgatcgtgcaccggcagct ggacggccgcgtgctgctgaacacgacggtggcgcccctgttctttgcggaccagttccttcagc tgtccacctcgctgccctcgcagtatatcacaggcctcgccga gcacctcagtcccctgatgctca gcaccagctggaccaggatcaccctgtggaaccgggaccttgcgcccacgcccggtgcgaacc tctacgggtctcaccctttctacctggcgctggaggacggcgggtcggcacacggggtgttcctg ctaaacagcaatgccatggatgtggtcctgcagccgagccctgcc cttagctggaggtcgacag gtgggatcctggatgtctacatcttcctgggcccagagcccaagagcgtggtgcagcagtacctg gacgttgtgggatacccgttcatgccgccatactggggcctgggcttccacctgtgccgctgggg ctactcctccaccgctatcacccgccaggtggtggagaacatgaccagggcccactt ccccctgg acgtccaatggaacgacctggactacatggactcccggagggacttcacgttcaacaaggatgg cttccgggacttcccggccatggtgcaggagctgcaccagggcggccggcgctacatgatgatc gtggatcctgccatcagcagctcgggccctgccgggagctacaggccctacgacgagggtctg cggagggg ggttttcatcaccaacgagaccggccagccgctgattgggaaggtatggcccggg tccactgccttccccgacttcaccaaccccacagccctggcctggtgggaggacatggtggctga gttccatgaccaggtgcccttcgacggcatgtggattgacatgaacgagccttccaacttcatcag aggctctgaggacggctgccccaacaatgagctggagaaccca ccctacgtgcctggggtggtt ggggggaccctccaggcggccaccatctgtgcctccagccaccagtttctctccacacactacaa cctgcacaacctctacggcctgaccgaagccatcgcctcccacagggcgctggtgaaggctcgg gggacacgcccatttgtgatctcccgctcgacctttgctggccacggccgatacgccggcc actg gacgggggacgtgtggagctcctgggagcagctcgcctcctccgtgccagaaatcctgcagttta gc tcagtctgccccaggagccgtacagcttcagcgagccggcccagcaggccatgaggaaggccc tcaccctgcgctacgcactcctcccccacctctacacactgttccaccaggcccacgtcgcgggg gagaccgtggcccggcccctcttcctggagttccccaaggactctagcacctggactgtggacca ccagctcctg tggggggaggccctgctcatcaccccagtgctccaggccgggaaggccgaagt gactggctacttccccttgggcacatggtacgacctgcagacggtgccaatagaggcccttggca gcctcccacccccacctgcagctccccgtgagccagccatccacagcgaggggcagtgggtga cgctgccggcccctggacaccatcaacgtccacct ccgggctgggtacatcatccccctgca gggccctggcctcacaaccacagagtcccgccagcagcccatggccctggctgtggccctgac caagggtggagaggcccgaggggagctgttctgggacgatggagagcctggaagtgctgg

- 14 043083 agcgaggggcctacacacaggtcatcttcctggccaggaataacacgatcgtgaatgagctggta cgtgtgaccagtgagggagctggcctgcagctgcagaaggtgactgtcctgggcgtggccacg gcgccccagcaggtcctctccaacggtgtccctgtctccaacttcacctacagcc ccgacaccaa ggtcctggacatctgtgtctcgctgttgtgggagagcagtttctcgtcagctggtgttagccgggc aaccattccaagcc gccgcatcgcttgtttccacctcctgggccggggctctggcccccaacgtgtctaggagagctttc tccctagatcgcactgtgggccggggcctggagggctgctctgtgttaataagattgtaaggtttgc cctcctcacctgttgccggcatgcggtagtattagccacccccctccatctgttcccag caccgg agaagggggtgctcaggtggaggtgtggggtatgcacctgagctcctgcttcgcgcctgctgctc aggggcatttggaatc

SEQ ID NO: 3 Met Gly Vai Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Vai Cys Ala Leu Vai Ser Leu Ala Thr Ala Ala Leu Leu Gly His He Leu Leu His Asp Phe Leu Leu Vai Pro Arg Ser Glu Leu Ser Gly Ser Pro Vai Leu Glu Glu Thr His Pro Ala His Gin Gin Gly Ala Ser Arg Pro Gly Pro Arg Asp Ala Gin Ala His Pro Gly Arg Pro Arg Ala Vai Pro Thr Gin Cys Asp Vai Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys Ala He Thr Gin Glu Gin Cys Glu Ala Arg Gly Cys Cys Tyr He Pro Ala Lys Gin Gly Leu Gin Gly Ala Gin Met Gly Gin Pro Trp Cys Phe Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr Pro Thr Phe Phe Pro Lys Asp He Leu Thr Leu Arg Leu Asp Vai Met Met Glu Thr Glu Asn Arg Leu His Phe Thr He Lys Asp Pro Ala Asn Arg Arg Tyr Glu Vai Pro Leu Glu Thr Pro Arg Vai His Ser Arg Ala Pro Ser Pro Leu Tyr Ser Vai Glu Phe Ser Glu Glu Pro Phe Gly Vai He Vai His Arg Gin Leu Asp Gly Arg Vai Leu Leu Asn Thr Thr Vai Ala Pro Leu Phe Phe Ala Asp Gin Phe Leu Gin Leu Ser Thr Ser Leu Pro Ser Gin Tyr He Thr Gly Leu Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser

- 15 043083

Trp Thr Arg He Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly Gly Ser Ala His Gly Val Phe Leu Leu Asn Ser Asn Ala Met Asp Val Val Leu Gin Pro Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly He Leu Asp Val Tyr He Phe Leu Gly Pro Glu Pro Lys Ser Val Val Gin Gin Tyr Leu Asp Val Val Gly Tyr Pro Phe Met Pro Pro Tyr Trp Gly Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala He Thr Arg Gin Val Val Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Val Gin Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met Val Gin Glu Leu His Gin Gly Gly Arg Arg Tyr Met Met He Val Asp Pro Ala He Ser Ser Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg Gly Val Phe He Thr Asn Glu Thr Gly Gin Pro Leu He Gly Lys Val Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu Ala Trp Trp Glu Asp Met Val Ala Glu Phe His Asp Gin Val Pro Phe Asp Gly Met Trp He Asp Met Asn Glu Pro Ser Asn Phe He Arg Gly Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu Asn Pro Pro Tyr Val Pro Gly Val Val Gly Gly Thr Leu Gin Ala Ala Thr He Cys Ala Ser Ser His Gin Phe Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly Leu Thr Glu Ala He Ala Ser His Arg Ala Leu Val Lys Ala Arg Gly Thr Arg Pro Phe Val He Ser Arg Ser Thr Phe Ala Gly His Gly Arg Tyr Ala Gly His Trp Thr Gly Asp Val Trp Ser Ser Trp Glu Gin Leu Ala Ser Ser Val Pro Glu He Leu Gin Phe Asn Leu Leu Gly Val Pro Leu Val Gly Ala Asp Val Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu Leu Cys Val Arg Trp Thr Gin Leu Gly Ala Phe Tyr Pro Phe Met Arg Asn His Asn Ser Leu Leu Ser Leu Pro Gin Glu Pro Tyr Ser Phe Ser Glu Pro Ala Gin Gin Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala Leu Leu Pro His Leu Tyr Thr Leu Phe His Gin Ala His Val Ala Gly Glu Thr Val Ala Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser Thr Trp Thr Val Asp His Gin Leu Leu Trp Gly Glu Ala Leu Leu He Thr Pro Val Leu Gin Ala Gly Lys Ala Glu Val Thr Gly Tyr

- 16 043083

Phe Pro Leu Gly Thr Trp Tyr Asp Leu Gin Thr Vai Pro He Glu Ala Leu Gly Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu Pro Ala He His Ser Glu Gly Gin Trp Vai Thr Leu Pro Ala Pro Leu Asp Thr He Asn Vai His Leu Arg Ala Gly Tyr He He Pro Leu Gin Gly Pro Gly Leu Thr Thr Thr Glu Ser Arg Gin Gin Pro Met Ala Leu Ala Vai Ala Leu Thr Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp Asp Asp Gly Glu Ser Leu Glu Vai Leu Glu Arg Gly Ala Tyr Thr Gin Vai He Phe Leu Ala Arg Asn Asn Thr He Vai Asn Glu Leu Vai Arg Vai Thr Ser Glu Gly Ala Gly Leu Gin Leu Gin Lys Vai Thr Vai Leu Gly Vai Ala Thr Ala Pro Gin Gin Vai Leu Ser Asn Gly Vai Pro Vai Ser Asn Phe Thr Tyr Ser Pro Asp Thr Lys Vai Leu Asp He Cys Vai Ser Leu Leu Met Gly Glu Gin Phe Leu Vai Ser Trp Cys

Met Gly Vai Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Vai Cys Ala Leu Vai Ser Leu Ala Thr Ala Ala Leu Leu Gly His He Leu Leu SEQ ID NO: 4

His Asp Phe Leu Leu Vai Pro Arg Glu Leu Ser Gly Ser Ser Pro Vai Leu Glu Glu Thr His Pro Ala His Gin Gin Gly Ala Ser Arg Pro Gly Pro Arg Asp Ala Gin Ala His Pro Gly Arg Pro Arg Ala Vai Pro Thr Gin Cys Asp Vai Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys Ala He Thr Gin Glu Gin Cys Glu Ala Arg Gly Cys Cys Tyr He Pro Ala Lys Gin Gly Leu Gin Gly Ala Gin Met Gly Gin Pro Trp Cys Phe Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr Thr Pro Thr Phe Phe Pro Lys Asp He Leu Thr Leu Arg Leu Asp Vai Met Met Glu Thr Glu Asn Arg Leu His Phe Thr He Lys Asp Pro Ala Asn Arg Arg Tyr Glu Vai Pro Leu Glu Thr Pro His Vai His Ser Arg Ala Pro Ser Pro Leu Tyr Ser Vai Glu Phe Ser Glu Glu Pro Phe Gly Vai He Vai Arg Arg Gin Leu Asp Gly Arg Vai Leu Leu Asn Thr Thr Vai Ala Pro Leu Phe Phe Ala Asp Gin Phe Leu Gin Leu Ser Thr Ser Leu Pro Ser Gin Tyr He Thr Gly Leu Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser Trp Thr Arg He Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly

- 17 043083

Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly Gly Ser Ala His Gly Vai Phe Leu Leu Asn Ser Asn Ala Met Asp Vai Vai Leu Gin Pro Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly He Leu Asp Vai Tyr He Phe Leu Gly Pro Glu Pro Lys Ser Vai Vai Gin Gin Tyr Leu Asp Vai Vai Gly Tyr Pro Phe Met Pro Pro Tyr Trp Gly Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala He Thr Arg Gin Vai Vai Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Vai Gin Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met Vai Gin Glu Leu His Gin Gly Gly Arg Arg Tyr Met Met He Vai Asp Pro Ala He Ser Ser Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg Gly Vai Phe He Thr Asn Glu Thr Gly Gin Pro Leu He Gly Lys Vai Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu Ala Trp Trp Glu Asp Met Vai Ala Glu Phe His Asp Gin Vai Pro Phe Asp Gly Met Trp He Asp Met Asn Glu Pro Ser Asn Phe He Arg Gly Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu Asn Pro Pro Tyr Vai Pro Gly Vai Vai Gly Gly Thr Leu Gin Ala Ala Thr He Cys Ala Ser Ser His Gin Phe Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly Leu Thr Glu Ala He Ala Ser His Arg Ala Leu Vai Lys Ala Arg Gly Thr Arg Pro Phe Vai He Ser Arg Ser Thr Phe Ala Gly His Gly Arg Tyr Ala Gly His Trp Thr Gly Asp Vai Trp Ser Ser Trp Glu Gin Leu Ala Ser Ser Vai Pro Glu He Leu Gin Phe Asn Leu Leu Gly Vai Pro Leu Vai Gly Ala Asp Vai Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu Leu Cys Vai Arg Trp Thr Gin Leu Gly Ala Phe Tyr Pro Phe Met Arg Asn His Asn Ser Leu Leu Ser Leu Pro Gin Glu Pro Tyr Ser Phe Ser Glu Pro Ala Gin Gin Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala Leu Leu Pro His Leu Tyr Thr Leu Phe His Gin Ala His Vai Ala Gly Glu Thr Vai Ala Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser Thr Trp Thr Vai Asp His Gin Leu Leu Trp Gly Glu Ala Leu Leu He Thr Pro Vai Leu Gin Ala Gly Lys Ala Glu Vai Thr Gly Tyr Phe Pro Leu Gly Thr Trp Tyr Asp Leu Gin Thr Vai Pro Vai Glu Ala

- 18 043083

Leu Gly Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu Pro Ala He His Ser Glu Gly Gin Trp Vai Thr Leu Pro Ala Pro Leu Asp Thr He Asn Vai His Leu Arg Ala Gly Tyr He He Pro Leu Gin Gly Pro Gly Leu Thr Thr Thr Glu Ser Arg Gin Gin Pro Met Ala Leu Ala Vai Ala Leu Thr Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp Asp Gly Glu Ser Leu Glu Vai Leu Glu Arg Gly Ala Tyr Thr Gin Vai He Phe Leu Ala Arg Asn Asn Thr He Vai Asn Glu Leu Vai Arg Vai Thr Ser Glu Gly Ala Gly Leu Gin Leu Gin Lys Vai Thr Vai Leu Gly Vai Ala Thr Ala Pro Gin Gin Vai Leu Ser Asn Gly Vai Pro Vai Ser Asn Phe Thr Tyr Ser Pro Asp Thr Lys Vai Leu Asp He Cys Vai Ser Leu Leu Met Gly Glu Gin Phe Leu Vai Ser Trp Cys

SEQ ID NO: 5 Gin Gin Gly Ala Ser Arg Pro Gly Pro Arg Asp Ala Gin Ala His Pro Gly Arg Pro Arg Ala Vai Pro Thr Gin Cys Asp Vai Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys Ala He Thr Gin Glu Gin Cys Glu Ala Arg Gly Cys Cys Tyr He Pro Ala Lys Gin Gly Leu Gin Gly Ala Gin Met Gly Gin Pro Trp Cys Phe Phe Pro Pro Ser Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Ser Glu Met Gly Tyr Thr Ala Thr Leu Thr Arg Thr Pro Thr Phe Phe Pro Lys Asp He Leu Thr Leu Arg Leu Asp Vai Met Glu Thr Glu Asn Arg Leu His Phe Thr He Lys Asp Pro Ala Asn Arg Arg Tyr Glu Vai Pro Leu Glu Thr Pro Arg Vai His Ser Arg Ala Pro Ser Pro Leu Tyr Ser Vai Glu Phe Ser Glu Glu Pro Phe Gly Vai He Vai His Arg Gin Leu Asp Gly Arg Vai Leu Leu Asn Thr Vai Ala Pro Leu Phe Phe Ala Asp Gin Phe Leu Ser Gin Leu Ser Thr Leu Pro Ser Gin Tyr He Thr Gly Leu Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser Trp Thr Arg He Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly Ala Asn Leu Tyr Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly Gly Ser Ala His Gly Vai Phe Leu Leu Asn Ser Asn Ala Met Asp Vai Vai Leu Gin Pro Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly He Leu Asp Vai Tyr He Phe Leu Gly Pro Glu Pro Lys Ser Vai Vai Gin Gin Tyr Leu Asp Vai Vai Gly Tyr

- 19 043083

Pro Phe Met Pro Pro Tyr Trp Gly Leu Gly Phe His Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala He Thr Arg Gin Vai Vai Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Vai Gin Trp Asn Asp Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe Asn Lys Asp Gly Phe Arg Asp Phe Pro Ala Met Vai Gin Glu Leu His Gin Gly Gly Arg Arg Tyr Met Met He Vai Asp Pro Ala He Ser Ser Ser Gly Pro Ala Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg Gly Vai Phe He Thr Asn Glu Thr Gly Gin Pro Leu He Gly Lys Vai Trp Pro Gly Ser Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu Ala Trp Trp Glu Asp Met Vai Ala Glu Phe His Asp Gin Vai Pro Phe Asp Gly Met Trp He Asp Met Asn Glu Pro Ser Asn Phe He Arg Gly Ser Glu Asp Gly Cys Pro Asn Asn Glu Leu Glu Asn Pro Tyr Vai Pro Gly Vai Vai Gly Gly Thr Leu Gin Ala Ala Thr He Cys Ala Ser Ser His Gin Phe Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly Leu Thr Glu Ala He Ala Ser His Arg Ala Leu Vai Lys Ala Arg Gly Thr Arg Pro Phe Vai He Ser Arg Ser Thr Phe Ala Gly His Gly Arg Tyr Ala Gly His Trp Thr Gly Asp Vai Trp Ser Ser Trp Glu Gin Leu Ala Ser Ser Vai Pro Glu He Leu Gin Phe Asn Leu Leu Gly Vai Pro Leu Vai Gly Ala Asp Vai Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu Glu Leu Cys Vai Arg Trp Thr Gin Leu Gly Ala Phe Tyr Pro Phe Met Arg Asn His Asn Ser Leu Leu Ser Leu Pro Gin Glu Pro Tyr Ser Phe Ser Glu Pro Ala Gin Gin Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala Leu Leu Pro His Leu Tyr Thr Leu Phe His Gin Ala His Vai Ala Gly Glu Thr Vai Ala Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser Thr Trp Thr Vai Asp His Gin Leu Leu Trp Gly Glu Ala Leu Leu He Thr Pro Vai Leu Gin Ala Gly Lys Ala Glu Vai Thr Gly Tyr Phe Pro Leu Gly Thr Trp Tyr Asp Leu Gin Thr Vai Pro He Glu Ala Leu Gly Ser Leu Pro Pro Pro Pro Ala Ala Pro Arg Glu Pro Ala He His Ser Glu Gly Gin Trp Vai Thr Leu Pro Ala Pro Leu Asp Thr He Asn Vai His Leu Arg Ala Gly Tyr He He Pro Leu Gin Gly Pro Gly Leu Thr Thr Glu Ser Arg Gin Gin Pro Met Ala Leu Ala Vai Ala Leu Thr Lys Gly Gly Glu Ala Arg Gly Glu Leu Phe Trp Asp Asp Gly Glu Ser Leu Glu Vai Leu Glu Arg Gly Ala Tyr Thr Gin Vai He Phe Leu Ala Arg Asn Asn Thr He Vai Asn Glu Leu Vai Arg Vai Thr Ser Glu Gly Ala Gly Leu Gin Leu Gin Lys Vai Thr Vai Leu Gly Vai Ala Thr Ala Pro Gin Gin Vai Leu Ser Asn Gly Vai Pro Vai Ser Asn Phe Thr Tyr Ser Pro Asp Thr Lys Vai Leu Asp He Cys Vai Ser Leu Leu Met Gly Glu Gin Phe Leu Vai Ser Trp Cys

In at least one embodiment, the recombinant human acid α-glucosidase has the wild type GAA amino acid sequence set forth under SEQ ID NO: 1 as described in US Pat. In at least one embodiment, the human recombinant acid α-glucosidase has the wild type GAA amino acid sequence encoded by SEQ ID NO: 2, the mRNA sequence of which has GenBank accession number Y00839.1. In at least one embodiment, the recombinant human acid α-glucosidase has the wild-type GAA amino acid sequence listed under SEQ ID NO: 3. In at least one embodiment, the recombinant human acid α-glucosidase has the GAA amino acid sequence listed under SEQ ID NO: 4, and has an access number at the National Center for Biotechnology Information (NCBI) NP_000143.2. In at least one embodiment, the recombinant human acid α-glucosidase is glucosidase alpha, a human acid α-glucosidase enzyme encoded by the most predominant of the nine observed GAA gene haplotypes.

- 20 043083

In at least one embodiment, recombinant human acid α-glucosidase is initially expressed as having the full-length wild-type 952-amino acid GAA sequence shown under SEQ ID NO: 1 and the recombinant human acid α-glucosidase undergoes intracellular processing that removes a portion of the amino acids , for example, the first 56 amino acids. Accordingly, recombinant human acid α-glucosidase secreted by the host cell may have a shorter amino acid sequence than recombinant human acid α-glucosidase that is originally expressed in the cell. In at least one embodiment, the shorter protein may have an amino acid sequence shown under SEQ ID NO: 5, which differs from SEQ ID NO: 1 only in that the first 56 amino acids containing the signal peptide and the precursor peptide have been deleted from thus resulting in a protein having 896 amino acids. Other differences in the number of amino acids are also possible, such as having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more deletions, substitutions, and/or insertions at compared to the amino acid sequence described under SEQ ID NO: 1 or SEQ ID NO: 5. In some embodiments, the rhGAA product contains a mixture of human recombinant acid α-glucosidase molecules having different amino acid lengths.

In at least one embodiment, the recombinant human acid α-glucosidase undergoes post-translational and/or chemical modifications at one or more amino acid residues of the protein. For example, methionine and tryptophan residues can be oxidized. As another example, N-terminal glutamine can form pyroglutamate. As another example, aspartic residues can be deamidated to aspartic acid. As yet another example, aspartic acid residues can be isomerized to isoaspartic acid. As yet another example, unpaired pistein residues in a protein can form disulfide bonds with free glutathione and/or cysteine. Accordingly, in some embodiments, the enzyme is initially expressed as having the amino acid sequence listed under SEQ ID NO: 1, SEQ ID NO: 2 (or encoded by SEQ ID NO: 2), SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 and the enzyme undergoes one or more of these post-translational and/or chemical modifications. Such modifications are also within the scope of the present invention.

Polynucleotide sequences encoding GAA and such human GAA variants are also contemplated and can be used for recombinant expression of rhGAA in accordance with the present invention.

Preferably, no more than 70%, 65%, 60%, 55%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of the total human recombinant acid α-glucosidase molecules lack the N-glycan unit bearing one or more mannose-6-phosphate residues, or no ability to bind to the cation-independent mannose-6-phosphate receptor (CIMPR). Alternatively, <100% or more of human recombinant acid α-glucosidase molecules contain at least one N -glycan link bearing one or more residues of mannose-6-phosphate, or have the ability to bind to CIMPR.

Human recombinant acid α-glucosidase molecules can have 1, 2, 3 or 4 mannose-6-phosphate (M6P) groups in their glycans. For example, only one N-glycan in a molecule of human recombinant acidic α-glucosidase can carry M6P (monophosphorylated), a single N-glycan can carry two M6P groups (bisphosphorylated), or each of two different N-glycans in the same molecule of recombinant acidic Human α-glucosidase can carry distinct M6P groups. Human recombinant acid α-glucosidase molecules can also have N-glycans that do not carry M6P groups. In another embodiment, the N-glycans average more than 2.5 mol/mol M6P and more than 4 mol/mol sialic acid, so that the recombinant human acid α-glucosidase contains an average of at least 2.5 mol of mannose-6- phosphate per mole of human recombinant acid α-glucosidase; and at least 4 moles of sialic acid per mole of human recombinant acid α-glucosidase. On average, at least about 3, 4, 5, 6, 7, 8, 9, or 10% of the total glycans in human recombinant acid α-glucosidase may be in mono-M6P-glycan, e.g., about 6.25% of the total glycans can carry one M6P group, and on average at least about 0.5, 1, 1.5, 2.0, 2.5, 3.0% of the total glycans in human recombinant acid α-glucosidase are in the form of a bis-M6P-glycan, and on average less than 25% of the total number of human recombinant acid α-glucosidase molecules do not contain a phosphorylated glycan that binds to CIMPR.

The human recombinant acid α-glucosidase can have an average content of M6P-bearing N-glycans in the range of 0.5 to 7.0 mol/mol of human recombinant acid α-glucosidase, or any intermediate value in the subrange, including 0.5, 1 .0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5 or 7.0 mol/mol recombinant human acid α-glucosidase. Recombinant human α-glucosidase can be fractionated to produce drugs based on

- 21 043083 recombinant human acid α-glucosidase with different average number of glycans bearing

M6P or bearing 6c-M6P, thus allowing for further customization of recombinant human α-glucosidase targeting lysosomes in target tissues by selecting a particular fraction or by selectively pooling different fractions.

Up to 60% of the N-glycans in human recombinant acid α-glucosidase may be fully sialylated, for example up to 10, 20, 30, 40, 50 or 60% of the N-glycans may be fully sialylated. In some embodiments, 4 to 20% of the total N-glycans are fully sialylated. In other embodiments, no more than 5%, 10%, 20%, or 30% of the N-glycans in the recombinant acid α-glucosidase carry sialic acid and a terminal galactose (Gal) residue.

This range includes all intermediate values and sub-ranges, for example, from 7 to 30% of the total number of N-glycans in human recombinant acid α-glucosidase can carry sialic acid and terminal galactose. In several other embodiments, no more than 5%, 10%, 15%, 16%, 17%, 18%, 19%, or 20% of the N-glycans in human recombinant acid α-glucosidase have only terminal galactose and do not contain sialic acid. This range includes all intermediate values and sub-ranges, for example, from 8 to 19% of the total number of N-glycans in the recombinant human α-glucosidase in the composition may have only terminal galactose and do not contain sialic acid.

In other embodiments, 40%, 45%, 50%, 55-60% of the total N-glycans in human recombinant acid α-glucosidase are complex-type N-glycans; or not more than 1, 2, 3, 4, 5, 6, 7% of the total number of N-glycans in human recombinant acid α-glucosidase are N-glycans of the hybrid type; not more than 5, 10, or 15% of the high-mannose type N-glycans in human recombinant acid α-glucosidase are unphosphorylated; at least 5% or 10% of the high-mannose type N-glycans in human recombinant acid α-glucosidase are mono-M6P-phosphorylated; and/or at least 1 or 2% of the high-mannose type N-glycans in human recombinant acid α-glucosidase are bis-M6P-phosphorylated. These values include all intermediate values and sub-ranges. Recombinant human acid α-glucosidase may fall within one or more of the content ranges described above.

In some embodiments, the recombinant human acid α-glucosidase will carry an average of 2.0 to 8.0 moles of sialic acid residues per mole of recombinant human acid α-glucosidase. This range includes all intermediate values and subranges, including 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6, 5, 7.0, 7.5 and 8.0 mol residues/mol recombinant human acid α-glucosidase. Without wishing to be bound by theory, it is believed that the presence of N-glycan units bearing sialic acid residues may prevent unproductive clearance of recombinant human α-acid α-glucosidase by asialoglycoprotein receptors.

In one or more embodiments, rhGAA has M6P and/or sialic acid units at specific N-glycosylation sites on a recombinant human lysosomal protein. For example, there are seven potential N-linked glycosylation sites in rhGAA. These potential glycosylation sites are at the following positions of SEQ ID NO: 5: N84, N177, N334, N414, N596, N826 and N869. Similarly, for the full length amino acid sequence of SEQ ID NO: 1, these potential glycosylation sites are at the following positions: N140, N233, N390, N470, N652, N882 and N925. Other rhGAA variants may have similar glycosylation sites depending on the location of the aspartic residues. Generally, the ASN-XSER or ASN-X-THR sequences in the amino acid sequence of a protein indicate potential glycosylation sites, except that X cannot be HIS or PRO.

In various embodiments, rhGAA has a defined N-glycosylation profile. In one or more embodiments, at least 20% of rhGAA is phosphorylated at the first N-glycosylation site (eg, N84 in SEQ ID NO: 5 and N140 in SEQ ID NO: 1). For example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of rhGAA may be phosphorylated at the first N-glycosylation site. This phosphorylation may be due to the presence of mono-M6P and/or 6c-M6P units. In some embodiments, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% of rhGAA carry a mono-M6P moiety in the first N-glycosylation site. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of rhGAA carry the 6c-M6P moiety in the first N-glycosylation site.

In one or more embodiments, at least 20% of rhGAA is phosphorylated at the second N-glycosylation site (eg, N177 in SEQ ID NO: 5 and N223 in SEQ ID NO: 1). For example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of rhGAA may be phosphorylated at the second N-glycosylation site. This phosphorylation may be due to the presence of mono-M6P and/or 6c-M6P units. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of rhGAA carry a mono-M6P at the second N-glycosylation site. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 6θ, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of rhGAA carry a bisM6P link at the second site N-glycosylation. In one or more embodiments, at least 5% of rhGAA is phosphorylated at the third N-glycosylation site (eg, N334 in SEQ ID NO: 5 and N390 in SEQ ID NO: 1). In other embodiments, less than 5%, 10%, 15%, 20%, or 25% of rhGAA are phosphorylated at the third N-glycosylation site. For example, the third N-glycosylation site may have a combination of non-phosphorylated high mannose glycans, two-, three-, and four-antennary complex glycans, and hybrid glycans as major forms. In some embodiments, at least 3%, 5%, 8%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of rhGAA are sialylated at the third N-glycosylation site.

In one or more embodiments, at least 20% of rhGAA is phosphorylated at the fourth N-glycosylation site (eg, N414 in SEQ ID NO: 5 and N470 in SEQ ID NO: 1). For example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of rhGAA may be phosphorylated at the fourth N-glycosylation site. This phosphorylation may be due to the presence of mono-M6P and/or 6c-M6P units. In some embodiments, at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% of rhGAA carry a mono-M6P moiety in fourth site of N-glycosylation. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of rhGAA carry the 6c-M6P moiety in fourth site of N-glycosylation. In some embodiments, at least 3%, 5%, 8%, 10%, 15%, 20%, or 25% of rhGAA are sialylated at the fourth N-glycosylation site.

In one or more embodiments, at least 5% of rhGAA is phosphorylated at the fifth N-glycosylation site (eg, N596 in SEQ ID NO: 5 and N692 in SEQ ID NO: 1). In other embodiments, less than 5%, 10%, 15%, 20%, or 25% of rhGAA are phosphorylated at the fifth N-glycosylation site. For example, the fifth N-glycosylation site may have fucosylated two-antennary complex glycans as the main forms. In some embodiments, at least 3, 5, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 6θ, 65, 70, 75, 80, 85, 90, or 95% rhGAA are sialylated at the fifth N-glycosylation site.

In one or more embodiments, at least 5% of rhGAA is phosphorylated at the sixth N-glycosylation site (eg, N826 in SEQ ID NO: 5 and N882 in SEQ ID NO: 1). In other embodiments, less than 5%, 10%, 15%, 20%, or 25% of rhGAA are phosphorylated at the sixth N-glycosylation site. For example, the sixth N-glycosylation site may have a combination of two-, three-, and four-antennary complex glycans as major forms. In some embodiments, at least 3, 5, 8, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% rhGAA are sialylated at the sixth N-glycosylation site.

In one or more embodiments, at least 5% of rhGAA is phosphorylated at the seventh N-glycosylation site (eg, N869 in SEQ ID NO: 5 and N925 in SEQ ID NO: 1). In other embodiments, less than 5%, 10%, 15%, 20%, or 25% of rhGAA are phosphorylated at the seventh N-glycosylation site. In some embodiments, less than 40%, 45%, 50%, 55%, 60%, or 65% of rhGAA have any glycan at the seventh N-glycosylation site. In some embodiments, at least 30%, 35%, or 40% of rhGAA have a glycan at the seventh N-glycosylation site.

Recombinant human α-glucosidase is preferably produced by Chinese hamster ovary (CHO) cells, such as CHO cell lines GA-ATB-200 or ATB-2OO-OO1-X5-14, or a subculture or derivative of such a CHO cell culture. DNA constructs that express allelic variants of acid α-glucosidase or amino acid sequences of other variants of acid α-glucosidase, such as at least 90%, 95%, 98% or 99% identical to SEQ ID NO: 1 or SEQ ID NO: 5 , can be constructed and expressed in CHO cells. These amino acid sequences of acid α-glucosidase variants may contain deletions, substitutions and/or insertions compared to SEQ ID NO: 1 or SEQ ID NO: 5, such as having 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15 or more deletions, substitutions and/or insertions compared to the amino acid sequence described under SEQ ID NO: 1 or SEQ ID NO: 5. Those skilled in the art can select alternative vectors suitable for transforming CHO cells to obtain such DNA constructs.

Various alignment algorithms and/or programs can be used to calculate identity between two sequences, including FASTA or BLAST, which are available as part of the GCG sequence analysis software package (University of Wisconsin, Madison, Wisconsin), and can be used, for example, with default settings.

For example, polypeptides are provided that are at least 90%, 95%, 98%, or 99% identical to the specific polypeptides described herein, and preferably exhibit substantially the same functions, as well as polynucleotides encoding such polypeptides. Unless otherwise stated, calculation

- 23 043083 similarity score will be based on the application of BLOSUM62. When using BLASTP, the percent similarity is based on the BLASTP Positive score and the percent sequence identity is based on the BLASTP Identical score. Identical in BLASTP show the number of residues in pairs of sequences with a high similarity score that are identical and their proportion of the total number of residues; a Positive in BLASTP shows the number and proportion of residues for which alignment scores are positive and are similar to each other. The present invention contemplates and embraces amino acid sequences having these degrees of identity or similarity, or any intermediate degree of identity or similarity, to the amino acid sequences disclosed herein. The polynucleotide sequences of similar polypeptides are derived from the genetic code and can be obtained using conventional methods, in particular by restoring their amino acid sequences from the genetic code.

The present inventors have found that a recombinant human α-glucosidase having an exceptional ability to target cation-independent mannose 6-phosphate receptors (CIMPR) and cellular lysosomes, as well as glycosylation patterns that reduce unproductive clearance from it in vivo, can be obtained using Chinese hamster ovary (CHO) cells. These cells can be induced to express human recombinant acid α-glucosidase with significantly higher levels of N-glycan units bearing one or more mannose-6-phosphate residues than traditional human recombinant acid α-glucosidase products such as alglucosidase. -alpha. The recombinant human acid α-glucosidase produced by these cells, exemplified by ATB200, has a significantly higher content of muscle cell-targeting mannose-6-phosphate (mono-M6P) and bis-mannose-6-phosphate (6uc-M6P) N-glycan residues, than traditional acid α-glucosidase such as Lumizyme®. Without wishing to be bound by any theory, it is believed that this extensive glycosylation allows the ATB200 enzyme to be more efficiently taken up by target cells, and therefore more efficiently cleared from the circulation, than other recombinant human acid α-glucosidases, such as, for example, alglucosidase-alpha, which has much lower content of M6P and 6c-M6P. ATB200 has been shown to potently bind to CIMPR and is efficiently taken up by skeletal muscle and cardiac muscle and has a glycosylation pattern that provides a favorable pharmacokinetic profile and reduces wasted clearance in vivo.

It is also contemplated that the unique glycosylation of ATB200 may help reduce the immunogenicity of ATB200 compared to, for example, alglucosidase-alpha. As will be recognized by those skilled in the art, glycosylation of proteins with conservative mammalian sugars generally improves the solubility of the product and reduces the aggregation and immunogenicity of the product. Glycosylation indirectly alters the immunogenicity of a protein by minimizing protein aggregation, as well as by shielding immunogenic epitopes of the protein from immune system attack (Guidance for Industry - Immunogenicity Assessment for Therapeutic Protein Products, U.S. Department of Health and Human Services, Food and Drug Administration, Center for Drug Evaluation and Research, Center for Biological Product Evaluation and Research, August 2014). Therefore, in at least one embodiment, the administration of recombinant human acid α-glucosidase does not induce the production of antibodies to the drug. In at least one embodiment, administration of human recombinant acid α-glucosidase induces the production of anti-drug antibodies in the subject at a lower incidence than the level of anti-drug antibodies induced by administration of alglucosidase-alpha.

As described in co-pending International Patent Application PCT/US2015/053252, cells such as CHO cells can be used to produce the rhGAA described herein, and this rhGAA can be used in the present invention. Examples of such CHO cell lines are GA-ATB-200 or ATB-200-001-X5-14 or a subculture thereof that produces the rhGAA-based composition described herein. Such CHO cell lines may contain multiple copies of a gene, such as 5, 10, 15, or 20 or more copies of a GAA-encoding polynucleotide.

rhGAA rich in M6P and 6c-M6P, such as rhGAA ATB200, can be obtained by transforming CHO cells with a DNA construct that encodes GAA. Although CHO cells have previously been used to produce rhGAA, it has not been recognized that transformed CHO cells can be cultured and selected to produce rhGAA having a high content of M6P and bis-M6P glycans that target CIMPR.

Surprisingly, it has been found that it is possible to transform CHO cell lines, select transformants that produce rhGAA having a high content of M6P-bearing glycans.

- 24 043083 or bis-M6P that target CIMPR and stably express this rhGAA high in M6P. Thus, methods for obtaining these CHO cell lines are also described in international patent application PCT/US2015/053252, which is simultaneously pending by the patent office. The method comprises transforming a CHO cell with DNA encoding GAA or a GAA variant, selecting a CHO cell whose chromosome(s) stably integrates DNA encoding GAA and which stably expresses GAA, and selecting a CHO cell that expresses GAA having a high content of glycans bearing M6P or 6c-M6P; and optionally selecting a CHO cell having N-glycans high in sialic acid and/or having a low content of non-phosphorylated high-mannose N-glycans. In at least one embodiment, GAA has low levels of galactose-terminated complex glycans.

These CHO cell lines can be used to produce rhGAA and rhGAA based compositions by culturing the CHO cell lines and recovering said composition from the CHO cell culture.

The recombinant human α-glucosidase, or a pharmaceutically acceptable salt thereof, can be formulated according to conventional procedures into a pharmaceutical composition adapted for administration to humans. For example, in a preferred embodiment, the intravenous composition is a solution in sterile isotonic aqueous buffer. If necessary, the composition may also contain a solubilizing agent and a local anesthetic to relieve pain at the injection site. Typically, the ingredients are supplied individually or mixed together in a unit dosage form, for example, as a dry lyophilized powder or anhydrous concentrate in a hermetically sealed container such as an ampoule or sachet, indicating the amount of active agent. If the composition is to be administered by infusion, it may be dispensed into an infusion bottle containing sterile pharmaceutical grade water, saline, or a dextrose/water mixture. When the composition is administered by injection, an ampoule of sterile water for injection or saline may be provided so that the ingredients can be mixed prior to administration.

Recombinant human acid α-glucosidase (or a composition or drug product containing recombinant human recombinant acid α-glucosidase) is administered by a suitable route. In one embodiment, recombinant human acid α-glucosidase is administered intravenously. In other embodiments, human recombinant acid α-glucosidase is administered by direct injection into a target tissue such as cardiac or skeletal muscle (eg, intramuscularly) or into the nervous system (eg, by direct injection into the brain; intraventricular; intrathecal). If necessary, more than one path can be used simultaneously.

The recombinant human α-glucosidase (or composition or drug product containing the recombinant human α-glucosidase) is administered in a therapeutically effective amount (e.g., at a dose level that, when administered at regular intervals, is sufficient to treat a disease, such as by reducing the intensity of symptoms associated with a disease, preventing or delaying the onset of a disease, and/or reducing the severity or frequency of symptoms of a disease). The amount that will be therapeutically effective in the treatment of a disease will depend on the nature and extent of the effects of the disease and can be determined using standard clinical techniques. In addition, in vitro or in vivo assays may optionally be used to assist in determining optimal dosage ranges. The exact dose to be used will also depend on the route of administration and the severity of the disease and should be determined according to the judgment of the physician and the condition of each patient. Effective doses can be extrapolated from dose-response curves obtained using in vitro test systems or animal models. In at least one embodiment, human recombinant acid α-glucosidase is administered by intravenous infusion at a dose of about 5 mg/kg to about 30 mg/kg, typically about 5 mg/kg to about 20 mg/kg. In at least one embodiment, human recombinant acid α-glucosidase is administered by intravenous infusion at a dose of about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, or about 20 mg/kg. In at least one embodiment, recombinant human α-glucosidase is administered by intravenous infusion at a dose of about 20 mg/kg. The effective dose for a particular individual may vary (eg, increase or decrease) over time, depending on the needs of the individual. For example, the amount can be increased during times of medical illness or stress, or when anti-acid α-glucosidase antibodies appear or increase, or when the symptoms of the disease worsen.

A therapeutically effective amount of human recombinant acid α-glucosidase (or a composition or drug product containing recombinant human recombinant acid α-glucosidase) is administered at regular intervals depending on the nature and severity of the effects of the disease and on an ongoing basis. Introduction at regular intervals, as used in this document

- 25 043083 mente, indicates that a therapeutically effective amount is administered periodically (as opposed to a single dose). The interval can be determined using standard clinical techniques. In preferred embodiments, human recombinant acid α-glucosidase is administered monthly, twice a month; once a week; twice a week or daily. The administration interval for the needs of an individual does not have to be a fixed interval and may vary over time depending on the needs of the individual. For example, the interval between doses can be reduced during medical illness or stress, or in the event of the appearance or increase in the number of antibodies to human recombinant acid α-glucosidase, or worsening of the symptoms of the disease. In some embodiments, a therapeutically effective amount of 5, 10, 20, 50, 100, or 200 mg of enzyme/kg of body weight is administered twice a week, once a week, or every two weeks with or without a chaperone.

The recombinant human α-glucosidase of the present invention can be prepared for later use, such as in a single dose vial or syringe, or in an intravenous bottle or sachet. Kits containing human recombinant acid α-glucosidase, and optionally excipients or other active ingredients such as chaperones or other drugs, may be enclosed in a packaging material and provided with dilution, dilution or dosing instructions for the treatment of a subject in need of treatment, such as a patient with Pompe disease.

In at least one embodiment, miglustat and recombinant human α-glucosidase are administered simultaneously. In at least one embodiment, miglustat and recombinant human acid α-glucosidase are administered sequentially. In at least one embodiment, the miglustat is administered prior to the administration of the recombinant human acid α-glucosidase. In at least one embodiment, miglustat is administered less than 3 hours prior to administration of recombinant human α-acid glucosidase. In at least one embodiment, miglustat is administered approximately 2 hours prior to administration of the recombinant human α-acid α-glucosidase. In at least one embodiment, the miglustat is administered less than 2 hours prior to administration of the human recombinant acid α-glucosidase. In at least one embodiment, the miglustat is administered about 1.5 hours prior to administration of the recombinant human α-acid α-glucosidase. In at least one embodiment, the miglustat is administered approximately one hour prior to administration of the human recombinant acid α-glucosidase. In at least one embodiment, the miglustat is administered from about 50 minutes to about 70 minutes prior to administration of the human recombinant acid α-glucosidase. In at least one embodiment, miglustat is administered from about 55 minutes to about 65 minutes prior to administration of the human recombinant acid α-glucosidase. In at least one embodiment, the miglustat is administered about 30 minutes prior to administration of the recombinant human α-acid α-glucosidase. In at least one embodiment, the miglustat is administered from about 25 minutes to about 35 minutes prior to administration of the human recombinant acid α-glucosidase. In at least one embodiment, miglustat is administered from about 27 minutes to about 33 minutes prior to administration of the human recombinant acid α-glucosidase.

In at least one embodiment, the miglustat is administered concurrently with the administration of recombinant human acid α-glucosidase. In at least one embodiment, the miglustat is administered over a period of 20 minutes before or after administration of the human recombinant acid α-glucosidase. In at least one embodiment, miglustat is administered over a period of 15 minutes before or after administration of the human recombinant acid α-glucosidase. In at least one embodiment, miglustat is administered over a period of 10 minutes before or after administration of the human recombinant acid α-glucosidase. In at least one embodiment, the miglustat is administered over a period of 5 minutes before or after administration of the human recombinant acid α-glucosidase.

In at least one embodiment, miglustat is administered following administration of human recombinant acid α-glucosidase. In at least one embodiment, the miglustat is administered within a period of up to 2 hours after the administration of the recombinant human α-acid α-glucosidase. In at least one embodiment, the miglustat is administered about 30 minutes after administration of the human recombinant acid α-glucosidase. In at least one embodiment, the miglustat is administered approximately one hour after administration of the recombinant human α-glucosidase acid. In at least one embodiment, the miglustat is administered about 1.5 hours after administration of the human recombinant acid α-glucosidase. In at least one embodiment, the miglustat is administered about 2 hours after administration of the human recombinant acid α-glucosidase.

In another aspect of the present invention, a kit is provided for the combination therapy of Pompe disease in a patient in need thereof. The kit contains a pharmaceutically acceptable drug

- 26 043083 venous form containing miglustat, a pharmaceutically acceptable dosage form containing recombinant human acid α-glucosidase as defined herein, and instructions for administering a pharmaceutically acceptable dosage form containing miglustat and a pharmaceutically acceptable dosage form containing recombinant acid α- glucosidase, to a patient in need thereof. In at least one embodiment, the pharmaceutically acceptable dosage form containing miglustat is the oral dosage form described herein, including, without limitation, a tablet or capsule. In at least one embodiment, a pharmaceutically acceptable dosage form containing recombinant human acid α-glucosidase is a sterile injectable solution as described herein. In at least one embodiment, instructions for administering dosage forms include instructions for administering a pharmaceutically acceptable dosage form containing miglustat orally prior to administration of a pharmaceutically acceptable dosage form containing recombinant human α-glucosidase by intravenous infusion as described herein.

Without wishing to be bound by theory, it is believed that miglustat acts as a pharmacological chaperone for recombinant human α-glucosidase ATB200 and binds to its active site. Thus, as seen in FIG. 1, miglustat was found to reduce the percentage of the unfolded ATB200 protein and stabilize the active conformation of ATB200, preventing its denaturation and irreversible inactivation at neutral plasma pH and allowing it to withstand conditions in the bloodstream long enough to reach and be taken up by tissues. However, the binding of miglustat to the active site of ATB200 can also lead to inhibition of the enzymatic activity of ATB200 by interfering with the access of the natural glycogen substrate to the active site. It is believed that in cases where miglustat and recombinant human α-glucosidase are administered to a patient under the conditions described herein, plasma and tissue concentrations of miglustat and ATB200 are such that ATB200 stabilizes until it can be taken up by the tissues and target lysosomes, but due to rapid clearance from miglustat, glycogen hydrolysis by ATB200 in lysosomes is not overly inhibited by the presence of miglustat, and the enzyme retains sufficient activity to be therapeutically useful.

All of the embodiments described above can be combined. This covers specific embodiments relating to:

the nature of the pharmacological chaperone, eg miglustat; and the active site for which it is specific;

dosage, route of administration of the pharmacological chaperone (miglustat) and type of pharmaceutical composition, including the nature of the carrier and the use of commercially available compositions;

the nature of the drug, e.g., a therapeutic protein drug, which may be an analogue of an endogenous protein whose expression in the subject is reduced or absent, in the appropriate case, recombinant human acid α-glucosidase, for example, recombinant human acid α-glucosidase expressed in cells Chinese Hamster Ovary (CHO) and having an increased content of N-glycan units bearing one or more mannose-6-phosphate residues compared to the content of N-glycan units bearing one or more mannose-6-phosphate residues in alglucosidase-alpha ; and suitably having the amino acid sequence listed under SEQ ID NO: 1, SEQ ID NO: 2 (or encoded by SEQ ID NO: 2), SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5;

the number and type of N-glycan units in the human recombinant acid α-glucosidase, for example, N-acetylglucosamine, galactose, sialic acid, or complex N-glycans formed by combining them, attached to the recombinant human acid α-glucosidase;

the degree of phosphorylation of mannose units in recombinant human acid α-glucosidase with the formation of mannose-6-phosphate and/or bis-mannose-6-phosphate;

the dosage and route of administration (for example, intravenous administration, especially intravenous infusion, or direct administration to the target tissue) of the replacement enzyme (recombinant human α-glucosidase) and type of formulation, including carriers and a therapeutically effective amount;

dosing interval of pharmacological chaperone (miglustat) and recombinant human acid α-glucosidase;

the nature of the therapeutic response and the results of the combination therapy (eg, improved results compared to the effect of each therapy given alone);

timing of combination therapy, e.g., co-administration of miglustat and recombinant human α-glucosidase or sequential administration, for example, where miglustat is administered before recombinant human α-glucosidase or after recombinant human α-glucosidase, or at a specific time before or after administration recombinant human acid α-glucosidase; and the nature of the patient being treated (eg, a mammal, such as a human) and the condition the subject is suffering from (eg, enzyme deficiency).

Any of the embodiments listed above may be combined with one or more of the other embodiments in the list.

Examples

Other features of the present invention will become apparent from the following non-limiting examples, which illustrate the principles of the present invention by way of example.

Example 1 Limitations of Current rhGAA Based Myozyme® and Lumizyme® Products.

To assess the potential of rhGAA in Myozyme® and Lumizyme®, the only currently approved treatments for Pompe disease, these rhGAA-based drugs were injected into a CIMPR column (which binds to rhGAA having M6P groups) and then eluted in a free M6 gradient. . Fractions were collected in a 96-well plate and GAA activity was analyzed on a 4MU-α-glucose substrate. Relative amounts of bound and unbound rhGAA were determined based on GAA activity and reported as a percentage of total enzyme.

In FIG. 2A-B describe the problems associated with traditional ERTs (Myozyme® and Lumizyme®): 73% rhGAA in Myozyme® (Fig. 2B) and 78% rhGAA in Lumizyme® (Fig. 2A) did not bind to CIMPR, see extreme left peaks on each figure. Only 27% of rhGAA in Myozyme® and 22% of rhGAA in Lumizyme® contained M6P, which can efficiently target CIMPR in muscle cells.

An effective dose of Myozyme® and Lumizyme® corresponds to the amount of rhGAA containing M6P that targets CIMPR in muscle cells. However, most of the rhGAA in these two conventional products does not target the CIMPR receptor in the target muscle cells. The introduction of traditional rhGAA, where most of the rhGAA does not target muscle cells, increases the risk of an allergic reaction or induction of an immune response to the untargeted rhGAA.

Example 2 Preparation of CHO cells producing rhGAA ATB200 having a high content of N-glycans bearing mono- or 6c-M6P.

CHO cells were transfected with DNA that expresses rhGAA, followed by selection of transformants that produce rhGAA. A DNA construct for transforming CHO cells with DNA encoding rhGAA is shown in FIG. 3. CHO cells were transfected with DNA that expresses rhGAA, followed by selection of transformants that produce rhGAA.

After transfection, CHO-DG44 (DHFR-) cells containing a stably integrated GAA gene were selected on hypoxanthine/thymidine (-HT)-free medium. Upregulation of GAA expression in these cells was induced by treatment with methotrexate (MTX, 500 nM). Cell populations that expressed GAA at high levels were identified by GAA enzyme activity assays and used to create single clones that produce rhGAA. Individual clones were obtained in culture dishes with semi-solid medium, collected using the ClonePix system and transferred to plates with 24 deep wells. Individual clones were analyzed for GAA enzyme activity to identify clones expressing GAA at a high level. In conditioned media, the α-glucosidase substrate, which is 4-MU-α-glucopyranoside, was used to determine GAA activity. Clones producing GAA at higher levels, as measured by GAA enzyme assays, were further evaluated for viability, growth ability, GAA production productivity, N-glycan structure, and stable protein expression. CHO cell lines, including the CHO cell line GA-ATB-200 expressing rhGAA with increased levels of mono-M6P or bis-M6P-N-glycans, were isolated using this procedure.

Example 3 Capture and purification of rhGAA ATB200.

Several batches of rhGAA according to the present invention were prepared in shake flasks and perfusion bioreactors using the CHO GA-ATB-200 cell line and binding to CIMPR was measured. Purified rhGAA ATB200 from different production lots showed binding to the CIMPR receptor similar to that shown in FIG. 4B and FIG. 5A (~70%) indicating that rhGAA ATB200 can be obtained stably. As shown in FIG. 2A, 2B, 4A and 4B, rhGAA Myozyme® and Lumizyme® showed significantly less binding to CIMPR than rhGAA ATB200.

Example 4 Analytical Comparison of ATB200 with Lumizyme®.

Weak anion exchange liquid chromatography (WAX) was used to fractionate rhGAA ATB200 at terminal phosphate. Elution profiles were obtained by eluting the ERT agent with increasing amounts of salt. The profiles were monitored using UV irradiation (A280 nm). rhGAA ATB200 was obtained from CHO cells and purified. Lumizyme® was obtained from a commercial source. Lumizyme® showed a high peak on the left side of his profile

- 28 043083 elution. rhGAA ATB200 showed four distinct elution peaks to the right of Lumizyme® (FIG. 6). This confirms that rhGAA ATB200 was phosphorylated to a greater extent than Lumizyme®, since this assessment was done by terminal charge and not by CIMPR affinity.

Example 5 Characterization of oligosaccharides in rhGAA ATB200

Purified rhGAA ATB200 and Lumizyme® glycans were evaluated by MALDI-TOF to determine the structures of the individual glycans found in each ERT agent (FIG. 7). ATB200 samples were found to contain lower amounts of non-phosphorylated high-mannose type N-glycans than Lumizyme®. The higher content of M6P glycans in ATB200 than in Lumizyme® allows rhGAA ATB200 to target muscle cells more efficiently. The high percentage of monophosphorylated and bisphosphorylated structures as determined by MALDI is consistent with the CIMPR binding profiles, which illustrate a significantly greater degree of ATB200 binding to the CIMPR receptor. Analysis of N-glycans by MALDI-TOF mass spectrometry confirmed that, on average, each ATB200 molecule contains at least one native bis-M6P-N-glycan structure. This higher content of 6uc-M6P-Nglycans in rhGAA ATB200 directly correlates with high affinity CIMPR binding in plate M6P receptor binding assays (KD approx. 2-4 nM), FIG. 9A.

rhGAA ATB200 was also analyzed for site-specific N-glycan profiles using two different LC-MS/MS analytical techniques. In the first assay, the protein was denatured, reduced, alkylated, and cleaved prior to LCMS/MS analysis. During protein denaturation and reduction 200 µg protein sample, 5 µl 1 mol/l Tris-HCl (final concentration 50 mM), 75 µl 8 mol/l guanidine-HCl (final concentration 6 M), 1 µl 0.5 mol/l l EDTA (final concentration 5 mM), 2 μl 1 mol/l DTT (final concentration 20 mM) and Milli-Q® water were added to a 1.5 ml tube to give a total volume of 100 μl. The sample was mixed and incubated at 56°C for 30 min in a dry heat bath. During alkylation, the denatured and reduced protein sample was mixed with 5 µl of 1 mol/l iodoacetamide (IAM, final concentration 50 mM), then incubated at 10-30°C in the dark for 30 min. After alkylation, 400 μl of pre-chilled acetone was added to the sample, and the mixture was freeze-refrigerated at -80°C for 4 hours. The sample was then centrifuged for 5 minutes at 13,000 rpm and 4°C, and the supernatant was removed. 400 µl of pre-chilled acetone was added to the pellet, which was then centrifuged for 5 min at 13,000 rpm and 4° C., and the supernatant was removed. The sample was then air dried on ice in the dark to remove residual acetone. To dissolve the protein, 40 μl of 8 M urea and 160 μl of 100 mM NH ₄ HCO ₃ were added to the sample. During trypsin digestion, trypsin digestion buffer was then added to 50 μg of protein to a final volume of 100 μl and 5 μl of 0.5 mg/ml trypsin was added (protein to enzyme ratio 20/1 w/w). The solution was thoroughly mixed and incubated overnight (16±2 h) at 37°C. 2.5 μl of 20% TFA was added to quench the reaction (0.5% final concentration). The sample was then analyzed using an Orbitrap Velos Pro™ mass spectrometer from Thermo Scientific.

In the second LC-MS/MS analysis, the ATB200 sample was prepared following a similar denaturation, reduction, alkylation, and cleavage procedure, except that iodoacetic acid (IAA) was used as the alkylating reagent instead of IAM, and then analyzed by mass -Orbitrap Fusion Lumos Tribid™ spectrometer from Thermo Scientific.

In a third LC-MS/MS analysis, ATB200 was prepared following a similar denaturation, reduction, alkylation, and cleavage procedure using iodoacetamide (IAM) as the alkylating reagent and then analyzed using a Thermo Scientific Orbitrap Fusion mass spectrometer.

The results of the first and second analyzes are shown in FIG. 8B-8H, and the result of the third analysis is shown in FIG. 8A. In FIG. 8B-8H, the results of the first analysis are represented by the bars on the left (dark gray), and the results of the second analysis are represented by the bars on the right (light gray). In FIG. 8B-8H, the symbol nomenclature for representing glycans is according to Varki, A., Cummings, R.D., Esko J.D., et al., Essentials of Glycobiology, 2nd edition (2009). In FIG. 8A-8H, glycosylation sites are indicated relative to SEQ ID NO: 5: N84, N177, N334, N414, N596, N826 and N869. For the full length amino acid sequence of SEQ ID NO: 1, these potential glycosylation sites are at the following positions: N140, N233, N390, N470, N652, N882 and N925.

As can be seen in FIG. 8B-8H, the first two analyzes gave similar results, although there was some difference between the results. This difference may be due to a number of factors, including the instrument used and the completeness of the N-glycan analysis. For example, if some forms of phosphorylated glycans have not been identified and/or quantified, then the total number of phosphorylated glycans may be underrepresented, and the percentage of rhGAA bearing phosphorylated glycans at a given site may be underrepresented. As another example, if some forms of non-phosphorylated glycans were not

- 29 043083 have been identified and/or not quantified, the total number of non-phosphorylated glycans may be underrepresented, and the percentage of rhGAA bearing phosphorylated glycans at a given site may be overrepresented.

In FIG. 8A shows N-glycosylation site occupancy in ATB200. As can be seen in FIG. 8A, the first, second, third, fourth, fifth, and sixth N-glycosylation sites were mostly occupied, with about 90% to about 100% of the ATB200 enzyme molecules found to have a glycan at each potential site. However, the seventh potential N-glycosylation site was glycosylated in approximately half of the cases.

In FIG. 8B shows the N-glycosylation profile for the first site, N84. As can be seen in FIG. 8B, the major form of the glycans was bis-M6P glycans. Both the first and second analyzes revealed that more than 75% of ATB200 had a bis-M6P-glycan at the first site.

In FIG. 8C shows the N-glycosylation profile for the second site, N177. As can be seen in FIG. 8C, the main forms of glycans were mono-M6P-glycans and non-phosphorylated high-mannose glycans. Both the first and second analyzes revealed that more than 40% of ATB200 had a monoM6P glycan at the second site.

In FIG. 8D shows the N-glycosylation profile for the third site, N334. As can be seen in FIG. 8D, the main forms of glycans were unphosphorylated high mannose glycans, two-, three-, and four-antennary complex glycans, and hybrid glycans. Both the first and second analyzes revealed that more than 20% of ATB200 had a sialic acid residue at the third site.

In FIG. 8E shows the N-glycosylation profile for the fourth site -N414. As can be seen in FIG. 8E, the main forms of glycans were bis-M6P and mono-M6P glycans. Both the first and second analyzes revealed that more than 40% of ATB200 had a bis-M6P-glycan at the fourth site. Both the first and second analyzes also revealed that more than 25% of ATB200 had a mono-M6P-glycan at the fourth site.

In FIG. 8F shows the N-glycosylation profile for the fifth site, N596. As can be seen in FIG. 8F, the main forms of glycans were fucosylated two-antennary complex glycans. Both the first and second analyzes revealed that more than 70% of ATB200 had a sialic acid residue at the fifth site.

In FIG. 8G shows the N-glycosylation profile for the sixth site, N826. As can be seen in FIG. 8G, the main forms of glycans were two-, three-, and four-antennary complex glycans. Both the first and second analyzes revealed that more than 80% of ATB200 had a sialic acid residue at the sixth site.

In FIG. 8H shows a summary of phosphorylation at each of the first six potential N-glycosylation sites. As can be seen in FIG. 8H in both the first and second assays showed high levels of phosphorylation at the first, second and fourth sites. In both assays, more than 80% of ATB200 was mono- or diphosphorylated at the first site, more than 40% of ATB200 was monophosphorylated at the second site, and more than 80% of ATB200 was mono- or diphosphorylated at the fourth site.

Example 6 Affinity Characterization of ATB200 for CIMPR.

In addition to having a higher percentage of rhGAA that can bind to CIMPR, it is important to understand the quality of this interaction. Binding of Lumizyme® and rhGAA ATB200 to receptors was determined using a CIMPR binding assay on plates. Briefly, CIMPR coated plates were used to capture GAA. Various concentrations of rhGAA were applied to the immobilized receptor, and unbound rhGAA was washed out. The amount of rhGAA remaining was determined by GAA activity. As shown in FIG. 9A, rhGAA ATB200 bound to CIMPR significantly better than Lumizyme®.

In FIG. 9B shows the relative content of bis-M6P-glycans in Lumizyme®, traditional rhGAA, and ATB200 in accordance with the present invention. In the case of Lumizyme®, on average only 10% of the molecules have a bisphosphorylated glycan. In contrast, in the case of ATB200, on average, each rhGAA molecule has at least one bisphosphorylated glycan.

Example 7 rhGAA ATB200 was more efficiently internalized by fibroblasts than Lumizyme®.

The relative uptake of rhGAA ATB200 and Lumizyme® cells was compared using a normal fibroblast cell line and a Pompe disease fibroblast cell line. Comparisons involved 5-100 nM rhGAA ATB200 according to the present invention and 10-500 nM conventional rhGAA Lumizyme®. After a 16 hour incubation, extrinsic rhGAA was inactivated with TRIS base and cells were washed 3 times with PBS before being harvested. Internalized GAA was measured by 4MU-α-glucoside hydrolysis and the data plotted against total cellular protein level and the results are shown in FIG. 10A-B.

It was also shown that rhGAA ATB200 was efficiently internalized into cells (FIGS. 10A and 10B, which respectively show that rhGAA ATB200 is internalized as in normal cells).

- 30 043083 fibroblast cells and fibroblast cells in Pompe disease, and that it is internalized to a greater extent than conventional rhGAA Lumizyme®). rhGAA ATB200 saturates cellular receptors at approximately 20 nM, while Lumizyme® requires approximately 250 nM. The uptake efficiency constant (K _uptake ) extrapolated from these results is 2-3 nM for ATB200 and 56 nM for Lumizyme® as shown in FIG. 10C. These results suggest that rhGAA ATB200 is a well-targeted treatment for Pompe disease.

Example 8 Population Pharmacokinetic (PK) Modeling for ATB200 and Miglustat.

Pharmacokinetic data for acid α-glucosidase (ATB200), including sampling times, dosing history and plasma concentrations of acid α-glucosidase, were obtained from mice, rats and monkeys administered ATB200 by intravenous injection. Pharmacokinetic data for miglustat and duvoglustat in plasma and tissue were collected from humans or mice.

Modeling and simulation experiments were performed using Phoenix® NLME™ v1.3. To assess the PK of ATB200 in blood plasma, compartmental PK models were constructed. The models included: description of the relationship between plasma concentration and time;

dispersion component characterizing the interorganismal and intraorganismal variability of model parameters in animals; and a component describing the uncertainty in the level of knowledge about the critical components of the model.

Nonlinear mixed effects models (NLME) are of the form: with _p< =c(Dn/,,3) + ¾ 3 =(¾. 0 , where Cpij is the concentration at the jth collection time (tj) for the animal i, Di is the dosing history for animal i, θ _i is the vector of PK parameters for animal i, and eij is the random error associated with the jth concentration for animal i.

The inter-subject variability (BSV) of the parameters was modeled as a log-normal distribution:

θ _ιη = θ _τνη exp {η _ιη \ where θρνη is the typical value of the ^nth PK parameter (e.g., clearance) in the population, and ni _n is the random cross-organism effect in animals on the ^nth parameter for animal i. The random effects (n1...,nm) were normally distributed with a mean of 0 and an estimated variance ω ² included in the OMEGA (Ω) matrix.

PKs were assumed to be species-independent and scaled according to Dedrick's generalized approach, according to which the pharmacokinetic distribution is scaled according to the power of the animal's body weight index:

SCr), = a _(p) BW,

V _(p)1 = c _(p) BW, ^d where CL = systemic clearance, V = volume of distribution, BW = body weight, p = peripheral, b and d = allometric exponents, and a and c = typical values for BW = 1. In this case, the exponents b and d can be compared with more generalized values accepted in the literature (b = 0.75 and d = 1.0). Nominal BW values (0.025, 0.25 and 2.5 kg) were used in the assays.

Baseline acid α-glucosidase concentration was modeled as _Cbaseline = acid α-glucosidase synthesis rate/CL and can be extrapolated to humans because _Cbaseline is species-specific, does not depend on ATB200 concentration, and is known in people with Pompe disease. The baseline model was determined using FOCE-ELS on Phoenix® to evaluate which of the 1- or 2-compartment models best fits the data. The sources of variability in the PK of acid α-glucosidase were also examined visually and by identifying the effect of various wild-type/species/dose-related effects on PK.

In the case of ATB200, the two-compartment linear excretion model adequately characterizes the concentration profiles of the active form of acid α-glucosidase over time at all dose levels across different animal species. The model included a theoretical allometric component that takes into account the effect of differences in body weight among different animal species on clearance (CL) and volume of distribution (Vc). The population PK model fitting accuracy for ATB200 is shown in FIG. 11. Population PK parameters of ATB200 obtained in non-clinical studies are presented in Table 31 043083. 1.

Table 1

RK parameter Typical values (relative standard error (%)) Intersubject variability (%) System clearance (CL; l/h) 0.00957 x (BW/0.25) ^11'78 ( ^5.1 ) (3.2) 21.0 Central volume of distribution (V _c ; l) 0.0101 x (BW/0.25) ^0'83 ( ^4.3 ) (1.7) 5.3 Peripheral clearance (CL _d ; l/h) 0.000290 x (BW/0.25) ^{0'78 (} 43.2) NA Peripheral volume of distribution (V2; l) 0.000653 x (BW/0.25) ^0'83 (35.6 ⁾ NA Synthesis rate of endogenous acid aglucosidase (SYNT; mg/h) Mouse: 0.00401 (8.1) Rat: 0.0203 (13.3) Monkey: 0.00518 (16.9) NA

BW: body weight.

The concentration-time profiles for miglustat (200 mg) in patients with Pompe disease were compared with profiles obtained after administration of duvoglustat to healthy volunteers (dose range: 50, 100, 250, 600 and 1000 mg). Dose-normalized plasma concentration-time profiles of miglustat and duvoglustat are shown in FIG. 12. Since the concentration-time profiles of miglustat in patients with Pompe disease were similar to those observed after dosing duvoglustat in healthy subjects for 24 h, the PK data collected for duvoglustat in peripheral tissues were used as a surrogate for modeling miglustat exposure. To characterize duvoglustat tissue concentration versus time profiles, a two-compartment model with linear derivation was used.

The accuracy of fitting the PK model for duvoglustat is shown in FIG. 13A and 13B. The final simulated PK parameters of duvoglustat in plasma and tissues are shown in Table 1. 2.

__________________________Table 2__________________________

RK parameter Typical values (CV, %) Volume of distribution (V; l) 44.5 (7.41) Systemic clearance (CL; l/h) 9.44 (6.99) Suction rate constant (K _a ; 1/h)) 1.10(14.0) Peripheral volume of distribution (V2; l) 8.68 (19.39) Clearance in the central compartment (CL2; l/h.) 0.205 (23.7) Intercompartmental volume of distribution (VQ; L) 61.8(21.2) Hatch Rate Constant (Keo) 0.378 (11.1) Intercompartmental volume of distribution in central compartment (VQ2; l) 3390 Clearance in peripheral compartment (CL3; l/h) 88.0 (7.72) Apparent intercompartmental clearance (CLQ; l/h) 40.6 (10.6) Lag time (h) 0.176 (30.7) Relative standard error for the central compartment 0.477 (6.56) Relative standard error for the peripheral compartment 0.368 (8.19)

CV: coefficient of variation.

A population PK model for miglustat was constructed with oral dosing in Gaa knockout (KO) mice. Population PK parameters of miglustat in mice with KO Gaa are presented in Table. 3. The selection accuracy is shown in FIG. 14. The model had a residual additive error of 0.475 ng/mL.

Table 3

RK parameter Typical values (BSV, %) Suction rate constant (Ka; h-1) 2.09 (4.56) Systemic clearance (CL; ml/h) 43.3 (9.61) Central volume of distribution (Vc; ml) 4.55 (45.1) Peripheral clearance (CLd; ml/h) 4.57(32.1) Peripheral volume of distribution (V2; ml) 19.6(23.3)

BSV: intersubject variability.

Example 9 Modeling of Pharmacokinetic Parameters (PK) of Recombinant Acid α-32 043083 Glucosidase (ATB200) in Humans.

Pharmacokinetic models (Example 8) were used to perform simulation experiments and to predict acid α-glucosidase concentration versus time profiles in human subjects with advanced Pompe disease following ATB200 dosing. The allometric function allowed association of body weight with clearance and volume of distribution and hence predicted PK parameters in typical human subjects with a body weight of 70 kg. The model was individually adapted by including the rate of endogenous acid α-glucosidase synthesis in humans (Umapathysivam K, Hopwood JJ, Meikle PJ. Determination of acid alpha-glucosidase activity in blood spots as a diagnostic test for Pompe disease. Clin Chem. (2001) Aug ; 47(8): 1378-83).

In humans, a single IV dose of 20 mg/kg of ATB200 administered over 4 hours by infusion was predicted to result in the concentration-time profile shown in FIG. 15. PK parameters in a typical human weighing 70 kg and exposure parameters obtained after IV infusion of ATB200 at a dose of 20 mg/kg for 4 hours are presented in table. 4.

Table 4

Pharmacokinetic parameter predicted value Systemic clearance (CL; l/h) 0.768 Central volume of distribution (V _c ; l) 1.09 Area under the curve extrapolated to infinity (AUCo-inf; mg h/L) 1822 Maximum concentration (Stach; mg/l) 423 Time to reach maximum concentration (Tta _X ; h) 4 Half-life (Tsh; h.) 2.17

The predicted systemic clearance (CL) and volume of distribution (V) of ATB200 in a typical 70 kg patient were 0.768 l/h and 2.41 l, respectively.

According to the Lumizyme® (alglucosidase-alpha) prescribing information, the systemic clearance of acid α-glucosidase at week 52 after repeated doses of Lumizyme® in patients with advanced Pompe disease is 601 ml/hour. (0.601 L/h), and the half-life of Lumizyme® is 2.4 hours. According to the model described above, the systemic clearance of ATB200 in adult subjects with Pompe disease is expected to be approximately 28% higher than the systemic clearance reported for Lumizyme®. In addition, the predicted AUC in humans after administration of ATB200 at 20 mg/kg is expected to be approximately 25% lower (AUC _0-inf : 1822 mg-h/L) than the AUC reported after administration of Lumizyme® in dose of 20 mg/kg (~ 2700 mg-h/ml).

Example 10: Exposure-response Models for Glycogen Depletion

Gaa knockout mice were injected with acid α-glucosidase (ATB200) intravenously at doses of 5, 10 and 20 mg/kg, increasing oral doses of miglustat (1, 3 and 10 mg/kg) concomitantly with intravenous doses of 5 or 10 mg/kg ATB200 or increasing oral doses of miglustat (1, 3, 5, 10, 20 and 30 mg/kg) concomitantly with intravenous doses of 20 mg/kg ATB200. Glycogen levels were measured as previously described (Khanna, R, Flanagan, JJ, Feng, J, Soska, R, Frascella, M, Pellegrino, LJ et al. (2012). The pharmacological chaperone AT2220 increases recombinant human acid α-glucosidase uptake and glycogen reduction in a mouse model of Pompe disease PLoS One 7(7): e40776). The ratios of glycogen levels observed after each treatment in combination therapy and glycogen levels observed after monotherapy (ratio of glycogen levels) were calculated. The results are presented in table. 5.

- 33 043083

Table 5

Means for treatment Glycogen level (mcg/mg protein) Ratio (combination other therapy/monotherapy) ATB200 (mg/kg) Mig lu stat (mg/kg) Monotherapy Combination Therapy Median value (N) Study #1 Median (N) Study #2 Median (N) Study #3 Median (N) 5 ΝΑ 307 (N=7) ΝΑ ΝΑ 307 (N=7) ΝΑ 10 ΝΑ 259 (N=7) ΝΑ ΝΑ 259 (N=7) ΝΑ 20 ΝΑ 157 (N=7) ΝΑ 195 (Ν = 14) 181 (N=21) ΝΑ 5 1 ΝΑ 323 (N=7) ΝΑ 323 (N=7) 1.05 3 ΝΑ 359 (N=6) ΝΑ 359 (N=6) 1.17 10 ΝΑ 352 (N=7) ΝΑ 352 (N=7) 1.15 10 1 ΝΑ 273 (N=7) ΝΑ 273 (N=7) 1.05 3 ΝΑ 252 (N=7) ΝΑ 252 (N=7) 0.973 10 ΝΑ 278 (N=7) ΝΑ 278 (N=7) 1.07 20 1 ΝΑ 154 (N=7) ΝΑ 154 (N=7) 0.851 3 ΝΑ 175 (N=7) ΝΑ 175 (N=7) 0.967 5 ΝΑ ΝΑ 163 (N=14) 163 (N=14) 0.900 10 ΝΑ 97 (N=6) 145 (N=13) 118 (N=19) 0.652 20 ΝΑ ΝΑ 122 (N=13) 122 (N=13) 0.674 thirty ΝΑ 167 (N=6) 175 (N=14) 170 (N=20) 0.939

In addition, in FIG. 15A-15C show the effects of alglucosidase-alpha (Lumizyme®) and ATB200 administration on glycogen clearance in Gaa knockout mice. Animals received two IV bolus injections (once every two weeks); tissues were collected two weeks after the last dose and analyzed for acid α-glucosidase activity and glycogen content.

As can be seen from the results presented in Table. 5, ATB200 was found to deplete tissue glycogen stores in a dose-dependent manner in acid α-glucosidase (Gaa) gene knockout mice. The 20 mg/kg dose of ATB200 consistently removed more stored glycogen in Gaa knockout mice than the 5 and 10 mg/kg dose levels. However, as seen in FIG. 15A-15C, ATB200 administered at a dose of 5 mg/kg showed a decrease in glycogen levels in mouse cardiac and skeletal muscles (quadriceps and triceps) similar to that of Lumizyme® administered at a dose of 20 mg/kg, whereas ATB200, administered at 10 and 20 mg/kg showed significantly better reduction in skeletal muscle glycogen levels than Lumizyme®.

In addition, doses of 10 and 20 mg/kg of miglustat, co-administered with ATB200 at 20 mg/kg, resulted in a decrease in glycogen levels in Gaa knockout mice to 118 and 122 μg/mg protein, respectively. The introduction of miglustat at a dose of 30 mg/kg caused a smaller decrease in glycogen levels. Without wishing to be bound by theory, it is believed that at higher concentrations of miglustat, the inhibition of acid α-glucosidase in lysosomes may exceed the beneficial effect of chaperone, thereby reducing glycogen degradation in lysosomes.

Pharmacokinetic models (example 8) were used to predict the effects of acid α-glucosidase and miglustat, consistent in time with the values of glycogen levels in tissue lysosomes presented in table. 5. Miglustat/ATB200 Steady State Exposure Ratios (AUC) (mean exposure over 24 h) were obtained for each treatment combination tested, plotted against the respective ratio of glycogen levels (Table 5), and these data were fitted mathematical function. The action-response curve is shown in Fig. 17.

As can be seen from the results in Fig. 17, the co-administration of doses of 10 and 20 mg/kg of miglustat with a dose of 20 mg/kg of ATB200 provides good stability of the active form of acid α-glucosidase in blood plasma with a maximum decrease in glycogen levels. Lower doses of miglustat (1, 3, and 5 mg/kg) are thought to result in suboptimal stabilization of the active form of acid α-glucosidase, while the highest dose of miglustat (30 mg/kg) is thought to result in excessive inhibition of the active form. forms of α-glucosidase in lysosomes.

Based on pharmacokinetic models (Example 8), the observed miglustat/ATB200 AUC ratio of 0.01159 (10 mg/kg miglustat co-administered with 20

- 34043083 mg/kg ATB200) would correspond to a miglustat dose of approximately 270 mg when co-administered with 20 mg/kg ATB200 in a typical 70 kg human. AUC ratios of 0.01 and 0.02 would correspond to miglustat doses of 233 and 466 mg, respectively, when co-administered with 20 mg/kg ATB200 in a typical 70 kg subject.

Example 11 Simulation of Miglustat/Duvoglustat Concentrations in Humans

Pharmacokinetic models (Example 8) were used to predict the length of time that plasma or tissue concentrations of duvoglustat (a substitute for miglustat) would remain above the IC ₅₀ (concentration producing 50% maximum inhibition of acid α-glucosidase activity) in plasma and lysosomes. Inhibition of the active form of acid α-glucosidase was determined using the methods described previously (Flanagan JJ, Rossi B, Tang K, Wu X, Mascioli K, et al. (2009) The pharmacological chaperone 1deoxynojirimycin increases the activity and lysosomal trafficking of multiple mutant forms of acid alphaglucosidase Hum Mutat 30: 1683-1692). The IC ₅₀ value of miglustat at plasma pH (pH 7.0) was determined to be 170 μg/l, while the IC ₅₀ value at lysosomal compartment pH (pH 5.2) was determined to be 377 μg/l.

The prediction results based on the model are presented in Table. 6. The predicted time profiles of miglustat plasma and lysosome concentrations after repeated dosing are shown in FIG. 17 and 18.

____________________Table 6____________________

Miglustat dose (mg) Time > IC50 (h) Blood plasma (pH 7.0) Lysosomes (pH 5.2) 100 13.1 0 150 15.0 0 200 16.4 1.19 233 17.2 2.96 250 17.5 3.58 270 17.9 4.15 300 18.4 4.92 466 20.7 8.04 600 22.0 9.96 699 22.8 AND 2

Taking into account the results presented in table. 6 and in FIG. 17 and 18, a dose of 260 mg of miglustat is expected to provide binding and stabilization of ATB200 in plasma for up to 18 hours, while inhibition of the active form of acid α-glucosidase in lysosomes is expected to last only 4 hours.

Example 12 Physiological and Morphological Characteristics of Muscles in Gaa Knockout Mice.

Gaa knockout mice received two IV boluses of human recombinant acid α-glucosidase (alglucosidase-alpha or ATB200) at 20 mg/kg once every two weeks. Miglustat was administered orally at 10 mg/kg to a subgroup of animals treated with ATB200 over 30 minutes. before the introduction of ATB200. Control mice were treated with inert medium only. Soleus, quadriceps, and diaphragm tissue was collected two weeks after the last dose of human recombinant acid α-glucosidase. Soleus muscle and diaphragm tissue were analyzed for glycogen levels by staining with Schiff's reagent and iodic acid (PAS) and for lysosome proliferation by measuring levels of a lysosome-associated membrane marker protein (LAMP1), which is overexpressed in Pompe disease. Semithin sections of quadriceps embedded in epoxy resin (Epon) were stained with methylene blue and examined by electron microscopy (1000x) to determine the degree of presence of vacuoles. Quadriceps muscle samples were analyzed by immunohistochemistry to determine the levels of phosphatidylethanolamine-conjugated microtubule-associated protein 1A/1B light chain autophagy 3 (LC3A II) and p62, insulin-dependent glucose transporter GLUT4, and insulin-independent glucose transporter GLUT1.

In a similar study, Gaa knockout mice received four IV boluses of human recombinant acid α-glucosidase (alglucosidase-alpha or ATB200) at 20 mg/kg once every two weeks. Miglustat was administered orally at 10 mg/kg to a subgroup of animals treated with ATB200 over 30 minutes. before the introduction of ATB200. Control mice were treated with inert medium only. Cardiac muscle tissue was harvested two weeks after the last dose of human recombinant acid α-glucosidase and analyzed for glycogen levels by iodic acid-Schiff staining (PAS) and for lysosome proliferation by measuring LAMP1 levels.

As seen in FIG. 20, a decrease in lysosome proliferation in cardiac muscle tissue, diaphragm tissue, and skeletal muscle tissue (soleus muscle tissue) was demonstrated with ATB200 administration compared to traditional treatment with alglucosidase-alpha, and when co-administered

- 35 043083 miglustat with ATB200 showed a significantly greater reduction in lysosome proliferation approaching levels observed in wild-type (WT) mice. Moreover, as seen in FIG. 21, with the introduction of ATB200, a decrease in glycogen levels in the form of pinpoint deposits in cardiac and skeletal muscle tissue (soleus tissue) was demonstrated compared with conventional treatment with alglucosidase-alpha, and when miglustat was co-administered with ATB200, a significantly greater decrease was shown, in this case also approaching to levels seen in wild-type (WT) mice.

Also, as seen in FIG. 22, co-administration of miglustat with ATB200 significantly reduced the number of vacuoles in quadriceps muscle fiber in Gaa knockout mice compared to untreated and alglucosidase-alpha treated mice. As seen in FIG. 23, both LC3 II and p62 levels were increased in Gaa knockout mice compared to WT mice, however, they were significantly reduced by treatment with ATB200 and miglustat, indicating that the increase in autophagy associated with acid α deficiency -glucosidase, decreases with the combined administration of ATB200 and miglustat. In addition, levels of the insulin-dependent glucose transporter GLUT4 and the non-insulin-dependent glucose transporter GLUT1 were increased in Gaa knockout mice compared to wild-type mice, but were also significantly reduced in this case when treated with ATB200 and miglustat. Elevated levels of GLUT4 and GLUT1, associated with acid α-glucosidase deficiency, may increase glucose uptake by muscle fibers and increase glycogen synthesis both in the basal state and after a meal. Thus, combined treatment with ATB200 and miglustat was found to improve skeletal muscle morphology and physiology in a mouse model of Pompe disease.

Example 13 Toxicity of ATB200 co-administered with miglustat in cynomolgus monkeys.

Previously unexperimented cynomolgus monkeys from Cambodia were assigned to the dosing groups shown in Table 1. 7. The animals were allowed to acclimatize to the study area for 18 (female) to 19 (male) days. On the last day of acclimatization, the weight of the animals ranged from 2.243 kg to 5.413 kg, and their age ranged from 2 to 3 years.

Table 7

Group Test drug Path Dose level (mg/kg) Dose concentration (mg/ml) Number of animals (male/female) Autopsy day 99 (male/female) 1 Control (composition buffer) IV infusion 0 0 4/4 4/4 2 Miglustat NG 25 2.5 4/4 4/4 ATV200 IV infusion 50 5 3 Miglustat NG 175 17.5 4/4 4/4 ATV200 IV infusion 100 10 4 Miglustat NG 175 17.5 4/4 4/4 5 ATV200 IV infusion 100 10 4/4 4/4

NG: nasogastric.

Dose levels tested were selected based on previous studies in non-human primates to obtain exposure values (AUC) comparable to or slightly greater than expected clinical AUC values in humans dosed with 260 mg miglustat and 20 mg/kg ATB200 (for the ATB200 group). administration of 25 mg/kg miglustat and 50 mg/kg ATB200), or about 10 and 3 times their (for groups of administration of 175 mg/kg miglustat and/or 100 mg/kg ATB200), predicted based on pharmacokinetic models from example 8 (respectively about 20.9 hours-mcg/ml and about 1822 hours-mcg/ml). In previous studies in non-human primates, an IV dose of 100 mg/kg of ATB200 was found to result in an AUC of 5330 h-µg/mL, and an oral dose of 175 mg/kg of miglustat was extrapolated to give an AUC of 196 h. -mcg/ml.

ATB200 was formulated in 25 mM sodium phosphate buffer pH 6 containing 2.92 mg/ml sodium chloride, 20 mg/ml mannitol and 0.5 mg/ml polysorbate 80 (formulation buffer). The test drug (ATB200 or miglustat) and control drug/inert medium (formulation buffer) were administered once every two weeks for 13 weeks, starting on day 1 and ending on day 85. ATB200 and control drug/inert medium were administered via a 2-hour (±10 min) intravenous (IV) infusion at doses of 0 mg/kg (group 1, control drug), 50 mg/kg (group 2) or 100 mg/kg (groups 3 and 5). Miglustat was administered nasogastrically in USP Sterile Water for Injection at doses of 25 mg/kg (group 2) or 175 mg/kg (groups 3 and 4) 30 minutes (± 2 minutes) prior to the start of the ATB200 infusion, if

- 36 043083 were given in combination. The volume of the administered dose in all groups was 10 ml/kg.

Parameters assessed during the lifetime phase of the study included body weight, food intake, clinical observations, detailed clinical observations, physical examinations, electrocardiographic examination, ophthalmological evaluations, clinical laboratory diagnostics (CBC, clotting test, serum chemistry). ), anti-drug antibody (ADA) assessment, neutralizing ADA assessment, urinalysis data, and toxicokinetic (TK) characteristics of miglustat and the active form and total ATB200 plasma protein. Post-mortem autopsy of the animals was performed on day 99 (14 days after the last dose). At autopsy, macroscopic observations and organ weights were recorded, and tissues were collected for microscopic examination.

All animals survived to the time of scheduled euthanasia, and no changes were observed associated with the administration of ATB200, miglustat, or co-administration of ATB200 and miglustat, during physical examinations or during the assessment of food intake, clinical observations, detailed clinical observations, body weight, ophthalmic indicators or ECG parameters. In addition, there were no ATB200, miglustat, or ATB200/miglustat-related changes in urinalysis, serum chemistry, CBC, or coagulation tests, or during evaluation of macroscopic observations, organ weights, or histopathological characteristics.

Total levels of anti-drug antibodies (ADA) and neutralizing antibodies (NAb)

Total levels of anti-drug antibodies (ADA) and neutralizing antibodies (NAb) were measured in plasma. Blood samples (approximately 1.6 ml) were collected in K ₂ EDTA tubes from all animals once during acclimatization, before dosing (prior to miglustat administration) and on days 1, 85 and 99. Samples were kept on liquid ice until treatment. Blood plasma was obtained by centrifugation at 2 to 8°C and aliquots (approximately 0.2 ml) were transferred into polypropylene vials and stored frozen at -60 to -86°C for 1 hour from the time of blood collection . Sample analysis for ADA was performed using samples collected from animals from groups 1, 2, 3 and 5 (samples from animals treated with miglustat alone were not analyzed). Analysis of neutralizing antibodies was performed using enzyme analysis with fluorogenic substrate 4-methylumbelliferyl-α-D-glucopyranoside (4MU-Glc).

All animals in the ATB200 dosing groups (groups 2, 3 and 5) tested positive for anti-drug antibodies (ADA) on days 85 and 99 (100% incidence). Titers ranged from 25,600 to 409,600 on day 85 and from 51,200 to 819,200 on day 99. There was no clear upward trend in titers with increasing dose levels of ATB200. Five of 8 animals in group 2 (50 mg/kg ATB200 in combination with 25 mg/kg miglustat) tested positive for neutralizing antibodies (NAb) on days 85 and 99. Two of 8 in group 3 (100 mg/kg ATB200 in combination with 175 mg/kg miglustat) were NAb positive on day 85, and 4 of 8 were positive on day 99. Two of 8 in group 5 (100 mg/kg ATB200 as monotherapy) were tested positive for NAb on day 85, and 3 of 8 tested positive on day 99. No clear effect of ADA on exposure to ATB200 or other TK parameters was observed.

Toxicokinetic characteristics of ATB200.

The toxicokinetic characteristics of ATB200 were measured in blood samples collected in K ₂ EDTA tubes from animals on days 1 and 85 at the following time points:

for groups 1, 2, 3 and 5: before dosing (before miglustat administration); 1 hour after the start of the infusion; 2 hours after the start of the infusion; 2.5 hours after the start of the infusion; 3 hours after the start of the infusion; 4 hours after the start of the infusion; 6 hours after the start of the infusion; 12 hours after the start of the infusion; 26 hours after the start of the infusion; 168 hours after the start of the infusion and 336 hours after the start of the infusion (collected before dosing on day 15); and for group 4: before dosing (before miglustat administration); 1.5 hours after administration of miglustat; 2.5 hours after administration of miglustat; 3.5 hours after administration of miglustat; 4.5 hours after administration of miglustat; 6.5 hours after administration of miglustat; 12.5 hours after administration of miglustat; 26.5 hours after administration of miglustat; 168.5 hours after miglustat and 336.5 hours after miglustat (collected before dosing on day 15).

Blood plasma was obtained by centrifugation at 2 to 8°C and aliquots (about 0.1 ml) were transferred into polypropylene vials and stored frozen at -60 to -86°C. Analysis of the active form of acid α-glucosidase ATB200 and total ATB200 protein was performed using samples obtained 2 hours after dosing from animals from group 1 and all samples collected from animals from groups 2, 3 and 5. The level of total ATB200 protein was measured using liquid chromatography combined with tandem mass spectrometry (LCMS/MS). Two signature peptides (TTPTFFPK and VTSEGAGLQLQK) were used as an indicator of the presence of ATB200. The results for these two peptides were stable, indicating that intact ATB200 was present in the analyzed plasma samples. The active form of acid α-glucosidase was analyzed using the fluorogenic substrate 4-methylumbelliferyl-α-D-glucopyranoside (4MU-Glc).

Analysis of toxicokinetic (TK) data was performed using audited/verified datasets (concentration and time) from animals from groups 2, 3 and 5 using WinNonlin Phoenix software version 6.1 (Pharsight Corporation). Non-compartmental analysis of plasma concentration data in individual subjects was used to assess the TK parameters of the active form of acid α-glucosidase and total ATB200 protein (for two signature peptides TTPTFFPK and VTSEGAGLQLQK) after IV infusion. The dose level was administered as the actual dose of ATB200 in mg calculated from the dose volume, body weight and average dose concentration for each individual animal. The start time of each dosing (start of ATB200 infusion) was taken to be zero for all profiles in the dosing regimen. Nominal sample collection times were used for all assays. The area under the plasma concentration-time curves (AUC _0-t ) obtained for ATB200 (total protein level and active form assay datasets) was evaluated using the log-linear trapezoid method. The regression used to estimate λ _ζ was based on uniformly weighted concentration data.

For each ATB200 data set (derived from the two signature peptides in the total ATB200 assay and the active ATB200 assay), the following parameters were calculated:

R ² is the square of the correlation coefficient for the linear regression used to estimate λ _ζα . Used when a specified number of points are used to determine the end phase (or specific time range) of the concentration versus time profile;

R ² corr. is the square of the correlation coefficient for the linear regression applied to estimate λ, adjusted for the number of points used to estimate λ _ζ β. Used when the number of points used to determine the end phase of the concentration versus time profile can vary;

number of points λ _ζ - number of points for linear regression analysis used to estimate λ _ζ ;

λ _ζα - excretion rate constant for the first three times after t _max ;

λ _ζ β - final excretion rate constant;

t _1/2a - half-life for the first three points in time after t _max ;

t _1/2 p - final half-life based on λ _ζ (0.693/λ _ζ );

t _max is the time to reach the maximum analyte concentration in blood plasma;

C _max - maximum observed analyte concentration in blood plasma;

AUC _0-t is the area under the plasma concentration-time curve (AUC) measured from time 0 (before dosing) to time the last measurable concentration was determined;

AUC ₀ .„ - AUC extrapolated to infinity of time;

AUC _ext - part of AUC extrapolated to infinity of time, presented as % of total AUCo-,,;

CL _T - total clearance (according to λ _ζ β); based on the total dose in mg based on actual body weight;

CLT/F - total clearance (based on λ _ζ β); based on the total dose in mg based on actual body weight divided by the bioavailable fraction;

V _ss - apparent volume of distribution in the equilibrium state;

ν _ζ - volume of distribution in the final phase (based on λ _ζ β); based on the total dose in mg based on actual body weight;

Y _g /B - volume of distribution in the final phase (based on λ _ζ β); based on the total dose in mg based on actual body weight divided by the bioavailable fraction; and accumulation ratio - ARC _max = ratio of C _max values on day 85 and day 1;

ARauc = ratio of AUC _0-t values on day 85 and day 1.

ATB200 concentrations and TK parameters were similar between males and females. Plasma concentrations following a 2-hour IV infusion of ATB200 at a dose of 50 mg/kg in combination with 25 mg/kg miglustat were measurable up to 12-26 hours post-dose. At the 100 mg/kg dose level (with or without 175 mg/kg miglustat), ATB200 concentrations were measurable up to 26-168 hours post-dose. Toxicokinetic parameters for a single dose (day 1) are shown in table. 8.

- 38 043083

Table 8

Group Treatment Parameter Units Total protein analysis Active Form Analysis TTPTFFPK VTSEGAG LQLQK ATV200 2 50 mg/kg ATB200 + 25 mg/kg miglustat tmax h. 2.00 2.00 2.06 Stakh mcg/ml 890 900 495 AUCo-t h.mcg/ml 3060 3080 1700 tl/2a h. 1.69 1.69 2.01 ΐ1/2β h. 1.70 1.71 1.92 CL _T l/h 0.058 0.058 0.106 v _ss l 0.145 0.144 0.266 _vz l 0.144 0.143 0.296 3 100 mg/kg ATB200 + 175 mg/kg miglustat tmax h. 2.00 2.00 2.25 Stakh mcg/ml 1960 1980 1150 AUCo-t h.mcg/ml 10400 10400 6130 tl/2a h. 2.77 2.77 3.07 ΐ1/2β h. 2.72 2.70 2.54 CL _T l/h 0.034 0.034 0.057 Vss l 0.140 0.140 0.231 _vz l 0.133 0.133 0.210 5 100 mg/kg ATB200 as monotherapy and tmax h. 1.88 1.88 1.94 Stakh mcg/ml 1690 1670 1270 AUCo-t h.mcg/ml 5490 5410 3230 tl/2a h. 1.56 1.55 1.28 ΐ1/2β h. ID 6.29 1.71 CL _T l/h 0.105 0.105 0.140 Vss l 0.171 0.149 0.168 _vz l 0.729 0.401 0.383

Toxicokinetic parameters for repeated doses (day 85) are shown in table. 9.

Table 9

Group Treatment Parameter Units Total protein analysis Active Form Analysis TTPTFFPK VTSEGA GLQLQK ATV200 2 50 mg/kg ATB200 + 25 mg/kg miglustat tmax h. 2.00 2.00 2.13 Stakh mcg/ml 927 921 586 AUCo-t hours mcg/ml 3700 3700 2390 tl/2a h. 1.98 1.95 2.35 ΐ1/2β h. 2.38 2.40 2.31 CL _T l/h 0.049 0.049 0.076 Vss l 0.147 0.147 0.223 _vz l 0.168 0.168 0.254 3 100 mg/kg ATB200 + 175 mg/kg miglustat tmax h. 2.13 2.19 2.06 Stakh mcg/ml 2270 2270 1600 AUCo-t h mcg/ml 13900 13800 9240 tl/2a Ch. 3.62 3.72 3.34 ΐ1/2β Ch. 4.83 4.83 2.90 CL _T l/h 0.027 0.027 0.040 Vss l 0.140 0.140 0.186 _vz l 0.174 0.174 0.165

- 39 043083

5 100 mg/kg ATB200 as monotherapy tmax 4. 2.13 2.13 2.00 Stakh mcg/ml 2020 2010 1510 AUCo-t hours mcg/ml 7830 7790 4890 tl/2a h. 1.93 1.88 1.44 ΐ1/2β h. 6.62 2.63 2.03 CL _T l/h 0.045 0.045 0.070 v _ss l 0.143 0.127 0.159 _vz l 0.396 0.170 0.205

The time to peak plasma ATB200 concentration (t _max ) was approximately 2 hours post-dose in all three dosing groups. Plasma ATB200 concentrations and TK parameters at day 1 and day 85, measured in the ATB200 total protein assay, were stable for the two signature peptides evaluated TTPTFFPK and VTSEGAGLQLQK.

The impact, measured by C _max and AUCo _-t , was relatively weaker when measured in the analysis of the active form of acid α-glucosidase. This is to be expected since the total protein assay measured the concentration of both active and inactive enzyme, whereas the active form of acid α-glucosidase assay measured the concentration of only the active enzyme. Exposure to ATB200 increased with increasing dose at dose levels of 50 to 100 mg/kg. The mean initial t _1/2a on day 1 (combined data from males and females) for the first three time points after t _max ranged from 1.28 to 3.07 h. The mean terminal half-life (t _1/2 p ) on day 1 ranged from 1.70 to 11.1 hours (higher t _1/2 p values in animals were affected by concentrations measurable up to 168 hours post-dose). A similar range of values was observed after dosing on day 85. With repeated administration once every two weeks, little or no accumulation was observed. The addition of 175mg/kg miglustat to a dose of 100mg/kg ATB200 appears to decrease the clearance of ATB200 and increase its plasma exposure approximately 2-fold compared to 100mg/kg ATB200 alone.

Since adverse changes associated with the test drug were not identified, the no detectable adverse effect dose level (NOAEL) for ATB200 given to cynomolgus monkeys once every two weeks for 13 weeks via a 2-hour infusion while administering miglustat or without, was 100 mg/kg/infusion, which was the highest dosage tested. At this dose level, sex-averaged mean AUC ₀ . _t and C _max (total protein) on day 85 were respectively 7830 (TTPTFFPK) and 7790 (VTSEGAGLQLQK) h.-μg / ml and 2020 (TTPTFFFPK) or 2010 (VTSEGAGLQLQK) μg / ml for ATB200 alone and 13900 (TTPTFFFPK) respectively ) or 13800 (VTSEGAGLQLQK) h-µg/ml and 2270 (both peptides) µg/ml for combination with 175 mg/kg miglustat.

Toxicokinetic characteristics of miglustat.

The toxicokinetic characteristics of miglustat were measured in blood samples collected in K2EDTA tubes from animals on days 1 and 85 at the following time points:

for groups 1, 2, 3 and 5: before dosing (before miglustat administration); 15 minutes after administration of miglustat; at 0 h (before infusion); 0.5 h after the start of the infusion; 1 hour after the start of the infusion; 2 hours after the start of the infusion; 4 hours after the start of the infusion; 6 hours after the start of the infusion; 12 hours after the start of the infusion; 26 hours after the start of the infusion; 50 hours after the start of the infusion and 74 hours after the start of the infusion; and for group 4: before dosing (before miglustat administration); 15 minutes after administration of miglustat; 30 minutes after administration of miglustat; 1 hour after administration of miglustat; 1.5 hours after administration of miglustat; 2.5 hours after administration of miglustat; 4.5 hours after administration of miglustat; 6.5 hours after administration of miglustat; 12.5 hours after administration of miglustat; 26.5 hours after administration of miglustat; 50.5 hours after administration of miglustat and 74.5 hours after administration of miglustat.

Blood plasma was obtained by centrifugation at 2°C to 8°C, and aliquots (about 0.2 ml) were transferred into polypropylene vials and stored frozen at -60°C to -86°C. Miglustat concentration analysis was performed using an LCMS/MS method similar to that described for duvoglustat concentration analysis in Richie Khanna, Allan C. Powe Jr., Yi Lun, Rebecca Soska, Jessie Feng, Rohini Dhulipala, Michelle Frascella, Anadina Garcia, Lee J. Pellegrino, Su Xu, Nastry Brignol, Matthew J. Toth, Hung V. Do, David J. Lockhart, Brandon A. Wustman, Kenneth J. Valenzano. The Pharmacological Chaperone AT2220 Increases the Specific Activity and Lysosomal Delivery of Mutant Acid Alpha-Glucosidase, and Promotes Glycogen Reduction in Transgenic Mouse Model of Pompe Disease. PLOS ONE (1 July 2014) 9(7): e102092.

Analysis of toxicokinetic (TK) data for miglustat was performed using audited/verified data sets (concentration and time) from animals from groups 2, 3 and 4 using WinNonlin Phoenix® software version 6.1 (Pharsight Corporation). Non-compartmental analysis of individual plasma concentration data was used to evaluate TK-40 043083 parameters. The TC parameters of miglustat were evaluated using the linear-logarithmic trapezoidal method. The regression used to estimate λ _ζ was based on uniformly weighted concentration data. The following parameters were calculated:

R ² corr. is the square of the correlation coefficient for the linear regression applied to estimate λ _ζ , adjusted for the number of points used in estimating λ _ζ . Used when the number of points used to determine the end phase of the concentration versus time profile can vary;

number of points λ _ζ - number of points for linear regression analysis used to estimate λ _ζ ;

λ _ζ - final excretion rate constant;

ti/2 - final half-life based on λ _ζ (0.693/λ _ζ );

t _max is the time to reach the maximum analyte concentration in blood plasma;

C _max - maximum observed analyte concentration in blood plasma;

AUCo-t is the area under the plasma concentration-time curve (AUC), measured from time 0 (pre-dose) to time the last measurable concentration was determined;

AUCo-t" - AUC extrapolated to infinity of time;

AUC _ext is the fraction of AUC extrapolated to infinity, expressed as % of total AUC _O . _X ;

L _T /F - total clearance divided by the bioavailable part, based on the total dose in mg based on actual body weight;

V _z /F - the volume of distribution in the final phase, divided by the bioavailable part, based on the total dose in mg based on actual body weight;

accumulation ratio - AR _Cmax = ratio of C _max values on day 85 and day 1; and AR _AU c ⁼ ratio of AUC ₀ - _t values on day 85 and day 1.

A stable effect of sex on the TC parameters of miglustat was not observed. Plasma concentrations of miglustat following nasogastric (NG) administration of 25 mg/kg in combination with 50 mg/kg of ATB200 or NG administration of 175 mg/kg (with or without 100 mg/kg of ATB200) were measurable within a period of 74.5 hours (last time of measurement). Toxicokinetic parameters for a single dose (day 1) and for repeated doses (day 85) are shown in table. 10.

Table 10

Group Treatment Parameter Units Miglustat analysis Day 1 Day 85 2 50 mg/kg ATB200 + 25 mg/kg miglustat tmax h. 2.06 2.88 Stakh ng/ml 7430 7510 AUCo-t hours ng/ml 47300 49100 tl/2 h. 7.44 8.23 CL _T /F l/h 1.92 1.99 _Vz /F l 20.5 23.3 3 100 mg/kg ATV200+ tmax h. 2.69 3.56 Stakh ng/ml 20400 22000 175 mg/kg miglustat AUCo-t hours ng/ml 182000 216000 tl/2 h. 6.85 7.86 CL _T /F l/h 3.22 3.62 _Vz /F l 32.3 39.1 4 175 mg/kg miglustat as monotherapy tmax h. 3.00 4.13 Stakh ng/ml 16400 14700 AUCo-t hours ng/ml 173000 204000 tl/2 h. 6.86 6.66 CL _T /F l/h 3.67 3.49 _Vz /F l 35.9 33.8

The value of t _max was in the range from about 2 to 4 hours after dosing. Miglustat exposure increased with increasing dose at dose levels from 25 to 175 mg/kg. The mean t _1/2 (combined data from males and females) was stable on days 1 and 85 and ranged from 6.66 to 8.23 hours. his absence. No significant effect of co-administration with ATB200 on total miglustat exposure (i.e. AUC ₀ . _t ) or TC parameters was observed.

-41 043083

Because adverse changes associated with the test product were not identified, the no detectable adverse effect dose level (NOAEL) for miglustat given to cynomolgus monkeys once every two weeks for 13 weeks nasogastrically with or without ATB200 is was 175 mg/kg/dose, which was the highest dosage tested. At this dose level, the sex-averaged mean AUC ₀ .t and Cmax on day 85 were, respectively, 204,000 h.-ng / ml and 14,700 ng / ml for miglustat alone and, respectively, 216,000 h.-ng / ml and 22,000 ng / ml for combination with 100 mg/kg ATB200.

Example 14 Clinical study protocol for recombinant acid α-glucosidase (ATB200) administered alone and co-administered with miglustat.

Research plan.

This is an open-label, fixed-sequence, escalating-dose study, the first to be conducted in humans, to evaluate the safety, tolerability, and pharmacokinetic parameters (PK) of recombinant acid α-glucosidase (ATB200, lyophilized powder reconstituted in sterile water for injection and diluted 0. 9% sodium chloride for injection) for intravenous (IV) administration alone and when co-administered with oral miglustat (65 mg hard gelatin capsules). The research is carried out in 2 stages. In Step 1, safety, tolerability, and PK are assessed following sequential single incremental doses of ATB200 every 2 weeks as an approximately 4-hour intravenous infusion over 3 dosing periods at 5, 10, and 20 mg/kg. Step 2 evaluates safety, tolerability, and PK following single and multiple escalating dose combinations: 3 doses of 20 mg/kg ATB200 co-administered every 2 weeks with 130 mg miglustat (two 65 mg capsules) taken orally 1 hour before an approximately 4-hour intravenous infusion of ATB200 followed by 3 doses of 20 mg/kg ATB200 co-administered with 260 mg miglustat (four 65-mg capsules) taken orally 1 hour prior to the approximately 4-hour intravenous infusion of ATB200.

Stage 1 includes twelve subjects with Pompe disease (approximately 6 outpatients and 6 non-ambulatory) receiving enzyme replacement therapy (ERT). These same subjects continue into the study at Stage 2. Prior to inclusion of non-ambulatory subjects, at least 4 outpatient subjects are included and dosed. Subjects (ambulatory) treated with ERT are defined as subjects who received ERT for 2-6 years prior to enrollment, are able to walk at least 200 meters on the six-minute walk test (6MWT) and have an FVC score of 3080% of predicted normal values. Subjects (non-ambulatory) treated with ERT are defined as subjects who are fully wheelchair bound, unable to walk unaided, and have received ERT for >2 years prior to enrollment. Distribution in groups of treatment is shown in tab. eleven.

Table 11

Number of subjects Population: treated with ERT Stage 1 Stage 2 Period 1 Single dose Period 2 Single dose Period 3 Single dose Period 4 Co-administration of multiple doses Period 5 Co-administration of multiple doses 12 ~6 outpatient,~6 non-ambulatory 5 mg/kg ATB200 10 mg/kg ATB200 20 mg/kg ATB200 20 mg/kg ATB200 + 130 mg miglustat 20 mg/kg ATB200 + 260 mg miglustat

ERT = enzyme replacement therapy.

Subjects are required to fast for at least 2 hours prior to and 2 hours after administration of oral miglustat. IV administration of ATB200 should begin 1 hour after oral administration of miglustat.

Research procedures.

The study consists of Screening, Baseline, Stage 1 (3 periods, fixed sequencing, single incremental dose of ATB200 alone) and Stage 2 (2 periods, fixed sequencing, multiple doses of 20 mg/dose). kg ATB200 co-administered with multiple escalating doses of miglustat).

Screening.

All subjects provide informed consent and are screened to determine eligibility. Estimates for all subjects cover medical history, including prior infusion-related reactions (IARs) and history of falls; consideration of prior and concomitant medications and non-pharmacological therapies; vital signs (heart rate [HR], respiratory rate [RR], blood

- 42 043083 pressure [BP] and temperature); height; weight; comprehensive physical examination (PE); 12-lead electrocardiogram (ECG); clinical and laboratory safety assessments (biochemical analysis of blood serum, complete blood count and complete urinalysis); test for diagnosing pregnancy by urinalysis; assessment of hexose tetrasaccharide in the urine sample (Hex4); and GAA genotyping (for subjects for whom a GAA genotyping report was not available at the time of screening). Also, if necessary, a blood sample is obtained to evaluate immunogenicity by exploratory testing (total and neutralizing antibodies, exploratory testing of cytokine levels/other biomarkers of immune system activation, cross-reactivity with alglucosidase alpha, and immunoglobulin E [IgE] level). A subject that meets all of the inclusion criteria and none of the exclusion criteria is moved to stage 1, described in Table 1. eleven.

Determination of the initial level.

Safety assessments for all subjects cover consideration of selection criteria; medical history, including infusion-related reactions (IAR) and history of falls, examination of adverse events (AE) and serious AE (SAE), review of previous and concomitant medications and non-drug therapies; vital signs (HR, RR, BP and temperature); weight; fluent PE; ECG; score on the Pompe disease vitality scale constructed using Rasch analysis (R-PAct); a score on the Rotterdam Disability Scale and a score on the Fatigue Severity Scale; clinical and laboratory safety assessments (biochemical analysis of blood serum, complete blood count and complete urinalysis); test for diagnosing pregnancy by urinalysis; pharmacodynamic parameter (PD) assessments (Hex4 and creatinine phosphokinase [CPK]); immunogenicity assessments (total and neutralizing antibodies, antibody cross-reactivity with alglucosidase-alpha, exploratory study of cytokine levels and other biomarkers of immune system activation, cross-reactivity with alglucosidase-alpha and, if necessary, IgE level); lung function tests (PFT); motor function tests and muscle strength tests for all subjects.

Stage 1, periods 1, 2 and 3.

This stage covers the following.

Safety: consideration of AEs, including serious adverse events (SAEs) and IARs; consideration of concomitant medicinal products and non-pharmacological therapies; vital signs (HR, RR, BP and temperature); fluent PE; ECG; clinical and laboratory safety assessments (serum chemistry, complete blood count, and complete urinalysis) and a pregnancy test by urinalysis

PD: Urinary Hex4 level and serum CPK level.

Immunological parameters: blood samples to determine the titers of antibodies to recombinant acid α-glucosidase (titers of total and neutralizing antibodies to recombinant acid α-glucosidase and cross-reactivity of antibodies with alglucosidase-alpha) and blood samples to measure the levels of pro-inflammatory cytokines and other biomarkers of immune system activation. If necessary, IgE levels are also measured.

Sequential sampling 24-hour pharmacokinetic (PK) parameters: during Period 1 (Visit 3, Day 1), Period 2 (Visit 4, Day 15), and Period 3 (Visit 5, Day 29) blood sampling for assessment of levels the active form of acid α-glucosidase and plasma concentrations of total acid α-glucosidase protein are carried out for all subjects.

Stage 2, periods 4 and 5.

Safety: AE review, including SAE and IAR; consideration of concomitant medicinal products and non-pharmacological therapies; vital signs (HR, RR, BP and temperature); weight; PE; ECG; clinical and laboratory safety assessments (serum chemistry, complete blood count, and complete urinalysis) and a pregnancy test by urinalysis

PD: Urinary Hex4 level and serum CPK level.

Immunological parameters: blood samples to determine the titers of antibodies to recombinant acid α-glucosidase (titers of total and neutralizing antibodies to recombinant acid α-glucosidase and cross-reactivity of antibodies with alglucosidase-alpha) and blood samples to measure the levels of pro-inflammatory cytokines and other biomarkers of immune system activation. If necessary, IgE levels are also measured.

Sequential sampling 24-hour PKs: during Period 4 (Visit 6, Day 43 and Visit 8, Day 71) and Period 5 (Visit 9, Day 85 and Visit 11, Day 113), blood sampling to assess active form levels acid α-glucosidase, total acid α-glucosidase protein concentrations, and plasma miglustat concentrations were performed for all subjects.

Completion of the study phase of pharmacokinetic parameters.

Safety: AE review, including SAE and IAR; consideration of concomitant medicinal products and non-pharmacological therapies; vital signs (HR, RR,

- 43 043083

BP and temperature); weight; PE; ECG; clinical and laboratory safety assessments (serum chemistry, complete blood count, and complete urinalysis) and a pregnancy test by urinalysis

PD: Urinary Hex4 level and serum CPK level.

Immunological parameters: blood samples to determine the titers of antibodies to recombinant acid α-glucosidase (titers of total and neutralizing antibodies to recombinant acid α-glucosidase and cross-reactivity of antibodies with alglucosidase-alpha) and blood samples to measure the levels of pro-inflammatory cytokines and other biomarkers of immune system activation. If necessary, IgE levels are also measured.

Subjects who terminate participation in the study prematurely attend an early termination visit and undergo all evaluations that should have been performed during the PK study termination visit. The study drug is not administered. If any of the subjects in the signal cohort prematurely withdraws from the study, then that subject is replaced by the next outpatient subject included in the study (for example, if subject 1 discontinues participation, then this subject is replaced by subject 3 [outpatient] as the subject of the signal cohort).

Subjects who have completed this study and/or other eligible subjects are given the opportunity to participate in a long-term extension study and continue to be assessed for the safety and tolerability of ATB200 when co-administered with miglustat. In addition, in the extended study, functional assessments regarding Pompe disease are performed at regular intervals.

Security monitoring.

Safety monitoring is carried out by the medical observer and investigators on an ongoing basis, and by the Safety Monitoring Committee (SSC) on a regular basis.

Signal injection of doses.

The first 2 outpatients in this study are subjects in the signal cohort of this study and are the first 2 subjects to be dosed in each study period (periods 1-5). In the event that a subject of the signal cohort prematurely withdraws from the study, he/she is replaced by another outpatient subject. Note: Before any non-ambulatory subjects can be dosed, at least 4 outpatient subjects are dosed with 5 mg/kg ATB200.

In stage 1 (periods 1, 2 and 3), subjects are administered single incremental doses of ATB200 (5 mg/kg [period 1], 10 mg/kg [period 2], and 20 mg/kg [period 3]).

After dosing 2 subjects in the signal cohort in each period of the Phase 1 study, evaluation of available safety data (PE, vital signs, AE, infusion reactions, ECG, and available data from locally performed laboratory tests) is performed within period 24-48 h medical observer and researchers. The SSC is collected for formal safety review when safety data are available from the central laboratory for both subjects in the signal cohort at each dose level. If the SSC determines that there are no safety issues that would preclude dosing at the dose level appropriate for this period, then 10 additional subjects are included and dosed. The SSC is also collected for safety review when safety data (including safety data from the central laboratory) is available for all subjects at all 3 dose levels in stage 1.

Stage 2 (periods 4 and 5) doses 2 subjects in the signal cohort and safety is assessed after the first dose, as for each period in stage 1. If the SSC determines that there are safety issues that prevent an additional 20 mg dose /kg ATB200 co-administered with 130 mg miglustat (period 4) or 20 mg/kg ATB200 co-administered with 260 mg miglustat (period 5) are absent, then 10 additional subjects receive 3 doses once every other week at a dose level corresponding to this period. The SSC is recollected when all safety data (including safety data from the central laboratory) is available for all subjects at the time of completion of stage 2. The SSC is also collected specifically in the event of an SAE or an identified safety issue.

The SSC may recommend any of the following findings:

continue the study without changes;

continue the study with changes (amendments);

temporarily suspend dosing;

permanently stop dosing.

If, in the opinion of the SSC, signal group subjects do not have AE or safety issues that may preclude continued dosing in the study, then dosing will continue for all other subjects at that dose level. Careful monitoring of safety for subjects by medical observers and investigators will continue.

- 44 043083 conducting this study, on an ongoing basis and SSC at regular intervals.

Number of subjects (planned).

Stage 1 includes twelve adult subjects with Pompe disease (approximately 6 ambulatory and 6 non-ambulatory) treated with ERT. The same subjects continue the study at stage 2.

Diagnosis and selection criteria.

At the screening visit, adult subjects with Pompe disease treated with ERT are evaluated using the selection criteria outlined below. Each subject must meet all of the inclusion criteria and none of the exclusion criteria. Refusal to check for compliance with the inclusion / exclusion criteria is not allowed.

Inclusion Criteria.

Subjects treated with ERT (outpatient).

1. Male and female subjects aged 18 to 65 inclusive.

2. The subject must provide signed informed consent prior to any study-related procedures.

3. Subjects of reproductive age must consent to the use of medically accepted methods of contraception during the study and for 30 days after the last co-administration of ATB200 + miglustat.

4. The subject is diagnosed with Pompe disease based on a documented deficiency in acid α-glucosidase enzymatic activity or GAA genotyping.

5. Subject has received alglucosidase-alpha ERT for the previous 2-6 years.

6. The subject is currently receiving alglucosidase-alpha at a frequency of once every two weeks.

7. Subject has received and completed the last two infusions with no drug-related adverse events leading to dosing interruption.

8. Subject must be able to walk 200-500 meters in 6MWT; And

9. Forced vital capacity (FVC) in the standing position should be between 30% and 80% of the predicted normal value.

Subjects treated with ERT (non-ambulatory).

10. Male and female subjects aged 18 to 65 inclusive.

11. The subject must provide signed informed consent prior to any study-related procedures.

12. Subjects of reproductive age must consent to the use of medically accepted methods of contraception during the study and for 30 days after the last co-administration of ATB200 + miglustat.

13. The subject has been diagnosed with Pompe disease based on a documented deficiency in acid α-glucosidase enzymatic activity or GAA genotyping.

14. Subject has received alglucosidase-alpha ERT for > 2 years.

15. The subject is currently receiving alglucosidase-alpha at a frequency of once every two weeks.

16. Subject received and completed the last two infusions with no drug-related adverse events leading to dosing interruption; And

17. Subject must be fully wheelchair bound and unable to walk unaided.

exclusion criteria.

Subjects treated with ERT (outpatient).

1. The subject received any investigational Pompe disease therapy other than alglucosidase-alpha within 30 days prior to the baseline visit or is expected to receive it during the course of the study.

2. Subject was treated with illegal drugs (miglitol (eg, Glyset®); miglustat (eg, Zavesca®); acarbose (eg, Precose®, Glucobay®); voglibose (eg, Volix®, Vocarb®, and Volibo® ); albuterol and clenbuterol or any investigational/experimental drug) within the 30 day period prior to the baseline visit.

3. For females, the subject is pregnant or breastfeeding at the time of screening.

4. Subject, whether male or female, plans to conceive a child during the course of the study.

5. Subject requires invasive ventilatory support.

6. Subject uses non-invasive ventilatory support > 6 hours per day while awake.

7. The subject has a medical condition or any other extenuating condition or circumstance that, in the opinion of the investigator, may pose an unreasonable safety risk

- 45 043083 for the subject or calls into question his/her ability to comply with the requirements of the protocol.

8. The subject has a history of an anaphylactic reaction to alglucosidase-alpha.

9. The subject has a history of high sustained titers of antibodies to recombinant acid α-glucosidase.

10. The subject has a history of allergy or sensitivity to miglustat or other imino sugars.

11. The subject has a history of known autoimmune disease, including lupus, autoimmune thyroiditis, scleroderma, or rheumatoid arthritis; And

12. The subject has a known history of bronchial asthma. Subjects treated with ERT (non-ambulatory)

13. The subject has received any investigational Pompe disease therapy other than alglucosidase-alpha within 30 days prior to the baseline visit or is expected to receive it during the course of the study.

14. Subject was treated with illegal drugs (miglitol (eg, Glyset®); miglustat (eg, Zavesca®); acarbose (eg, Precose®, Glucobay®); voglibose (eg, Volix®, Vocarb®, and Volibo® ); albuterol and clenbuterol or any investigational/experimental drug) within the 30 day period prior to the baseline visit.

15. For females, the subject is pregnant or breastfeeding at the time of screening.

16. The subject, whether male or female, plans to conceive a child during the course of the study.

17. The subject has a medical or any other extenuating condition or circumstance that, in the opinion of the investigator, may pose an unreasonable safety risk to the subject or compromise his/her ability to comply with protocol requirements.

18. The subject has a history of an anaphylactic reaction to alglucosidase-alpha.

19. The subject has a history of high sustained titers of antibodies to recombinant acid α-glucosidase.

20. The subject has a history of allergy or sensitivity to miglustat or other iminosugars.

21. The subject has a history of known autoimmune disease, including lupus, autoimmune thyroiditis, scleroderma, or rheumatoid arthritis; And

22. The subject has a known history of bronchial asthma. Investigational drug, dosage and route of administration.

Stage 1 (consists of 3 dosing periods 2 weeks apart):

period 1: IV infusion of a single dose of 5 mg/kg ATB200;

period 2: IV infusion of a single dose of 10 mg/kg ATB200 to all subjects who completed period 1; and period 3: IV infusion of a single dose of 20 mg/kg ATB200 to all subjects who completed period 2.

Stage 2 (consists of 2 dosing periods, each including 3 doses of study drug, 2 weeks apart):

period 4: 130 mg miglustat is administered orally 1 hour before IV infusion of a single dose of 20 mg/kg ATB200 to all subjects who have completed period 3 (repeat every 2 weeks for a total of 3 injections); and period 5: 260 mg miglustat is administered orally 1 hour prior to the IV infusion of a single dose of 20 mg/kg ATB200 to all ERT-treated subjects who have completed period 4 (repeat every 2 weeks for a total of 3 administrations).

Note: Subjects should fast for at least 2 hours prior to and 2 hours after administration of oral miglustat.

Total study duration: up to 22 weeks (up to 4 weeks screening period followed by approximately 18 weeks of study treatment [stages 1 and 2]).

Duration of PK follow-up at a single dose (stage 1, periods 1, 2 and 3): 6 weeks.

Duration of PK follow-up at multiple doses (stage 2, periods 4 and 5): 12 weeks.

Duration of observation of safety, tolerability and immunogenicity (periods 1, 2, 3, 4 and 5): 18 weeks.

Evaluation criteria.

Basic.

Safety ratings:

PE;

vital signs, including body temperature, RR, HR and BP;

AE, including IAR;

- 46 043083

ECG in 12 leads;

clinical and laboratory safety assessments: biochemical analysis of blood serum, complete blood count and complete urinalysis.

PK ATB200 and miglustat in plasma:

PK parameters representing the levels of the active form of acid α-glucosidase and the concentration of total protein of acid α-glucosidase in blood plasma: the maximum observed concentration in blood plasma (C _max ), the time to reach the maximum observed concentration in blood plasma (t _max ), area under the plasma drug concentration curve from time 0 to the last measurable concentration (AUC ₀ . _t ), area under the plasma drug concentration curve from time 0, extrapolated to infinity (AUC ₀ .„), half-life (t _1/2 ) and total clearance after IV administration (CLT);

the ratio of C _max and AUC ₀ .„ active form of acid α-glucosidase and total protein of acid α-glucosidase in blood plasma for all dose regimens;

Miglustat plasma PK parameters: C _max , t _max , AUC ₀ _ _t , AUC ₀ .„ and t _1/2 , apparent systemic clearance of the drug after oral administration (CLT/F) and volume of distribution during the final phase after oral administration (Vz/F) for each dose level;

relative values of C _max and AUC ₀ .„ of miglustat in blood plasma for each dose level.

Functional assessments (carried out at baseline).

For outpatient subjects:

motor function tests:

6 Minute Walk Test (6MWT), 10m Walk Test, Gait, Stair Climb, Gower Maneuver, and Chair Stand Up, Get Up and Walk Test with Time (TUG);

muscle strength test (using medical research criteria [MRC] and portable dynamometer) for both upper and lower extremities;

PFT (FVC, MIP, MEP and SNIP).

For non-ambulatory subjects:

muscle strength test - for upper limbs only:

the use of MRC and a portable dynamometer is carried out only for the upper limbs;

lung function tests (PFT) (forced vital capacity [FVC], maximum inspiratory pressure [MIP], maximum expiratory pressure [MEP], and nasal nasal pressure [SNIP]).

Patient-reported outcomes (performed at baseline) Fatigue Severity Scale score;

indicator according to the Rotterdam disability scale;

score on the Pompe disease vital signs scale constructed using Rasch analysis (R-PAct).

Data from exploratory studies ATB200 antibody titers (total and neutralizing);

cross-reactivity of antibodies to recombinant acid α-glucosidase with alglucosidase alpha;

the level of pro-inflammatory cytokines and other biomarkers of immune system activation;

PD markers (Hex4 and CPK).

Methods of analysis.

statistical methods.

For PK parameters, descriptive statistics are presented. For all variables that are not PK parameters, summary statistics are presented. Evaluation of the ratios of the effects of the active form of acid α-glucosidase and total acid α-glucosidase protein (C _max , AUC ₀ - _t and AUC ₀ . _X ) in relation to dose proportionality at 5, 10 and 20 mg / kg ATB200 separately. Analysis of variance (ANOVA) of the ratios of effects of the active form of acid α-glucosidase and total protein of acid α-glucosidase (C _max , AUC ₀ - _t and AUC ₀ .„) for 20 mg/kg ATB200 alone compared with 20 mg/kg ATB200 + 130 mg miglustat and versus 20 mg/kg ATB200 + 260 mg miglustat in each population and overall. ANOVA of exposure ratios of active form of acid α-glucosidase and total protein of acid α-glucosidase (C _max , AUC ₀ - _t and AUC ₀ .n) between ambulatory and non-ambulatory subjects for 20 mg/kg ATB200 + 130 mg miglustat and 20 mg/kg ATB200 + 260 mg miglustat. Evaluation of relative exposure rates (C _max , AUC ₀ - _t and AUC ₀ .„) in relation to dose proportionality between 130 mg and 260 mg miglustat in each subject population and in general. According to the results of the study of immunogenicity evaluate its effect on PK, PD and safety.

intermediate analyses.

- 47 043083

An interim analysis is performed when at least 50% (n=6) of subjects complete Phase 2 of the study. A maximum of 2 additional interim analyzes may be performed within a study.

Preliminary results of the PK study.

Summary information regarding the PK of the active form of GAA and total GAA protein for subjects, respectively, is shown in table. 12 and 13.

In table. 12-15 and in Fig. 24-26, single dose (SD) measurements were performed after a single administration of miglustat and ATB200, and multiple dose (MD) measurements were performed after a third administration of miglustat and ATB200 at biweekly intervals.

Table 12

Dose at/ βν ¹ t ^b Imax Stakh AUC ₀ ^-tc AiS ₀ - _u ^with AUCo-®/D ^c CL _T ^a v _ss ^a mg/kg ATB200 + mg miglustat (h) (h) (h) (µg/ml) (h/mk g/ml) (h * μg / ml) (h*mcg/ml/mg) (l/h) (l) 5 1.06 (9.7) 3.15 (5.3) 3.5 (3.5 4.0) 53.7 (20.4) 193 (22.5) 193 (22.5) 0.444 (15.4) 2.27 (15.9) 5.61 (21.2) 10 1.26 (22.2) 2.73 (18.2) 3.75 (3.5 -4.5) 115 (28.3) 447 (30.7) 448 (30.6) 0.523 (17.5) 1.93 (15.0) 5.39 (21.2) 20 1.36 (25.7) 2.16 (10.2) 4.0 (3.5 4.0) 256 (30.4) 1020 (37.4) 1021 (37.4) 0.596 (30.1) 1.76 (37.5) 5.01 (28.0) 20 + 130 single dose 1.84 (16.0) 2.49 (9.9) 4.5 (4.0 5.0) 234 (36.0) 1209 (29.9) 1211 (29.9) 0.707 (23.7) 1.45 (25.8) 5.32 (24.8) 20 + 130, multiple doses 1.90 (7.5) 2.53 (11.9) 4.0 (3.5 5.0) 230 (20.2) 1180 (19.1) 1183 (19.0) 0.690 (15.1) 1.46 (14.4) 5.55 (14.2) 20 + 260 single dose 2.39 (I.5) 2.70 (10.8) 4.0 (4.0 4.5) 228 (26.0) 1251 (17.4) 1256 (17.2) 0.733 (15.8) 1.38 (17.3) 5.71 (20.2)

^a Arithmetic mean (CV, %). ^b Median value (min-max).

^c Geometric mean (CV, %). Table 13

Dose ati _/ ^2a t ^b 1m ah Stakh AUC _from ^c AU Co., ^c AUCo-®/D ^c CL _T ^a v _ss ^a mg/kg ATB200 + mg miglustat (h) (h) (h) (µg/ml) (h.*mk g/ml) (h * μg / ml) (h* µg/ml/mg) (l/h) (l) 5 1.02 (3.0) 1.83 (13.8) 4.0 (3.5 -4.0) 61.1 (20.0) 215 (17.1) 218 (17.0) 0.511 (7.3) 1.97 (7.7) 4.57 (6.8) 10 1.36 (5.3) 1.99 (56.9) 4.0 143 (19.5) 589 (16.6) 594 (16.6) 0.694 (12.3) 1.45 (13.4) 3.90 (14.5) 20 1.65 (12.3) 2.62 (18.5) 4.0 338 (ID) 1547 (12.1) 1549 (12.1) 0.904 (12.8) 1.11 (14.4) 3.49 (I.6) 20+ 130 single dose 1.79 (10.7) 2.63 (6.6) 4.0 322 (18.2) 1676 (14.9) 1680 (14.8) 0.980 (15.0) 1.03 (17.6) 3.78 (12.2) 20+ 130, multiple doses 1.99 (10.2) 2.47 (4.2) 4.0 (3.5 -5.0) 355 (16.5) 1800 (12.7) 1804 (12.7) 1.05 (12.9) 0.96 (13.7) 3.70 (S.8) 20 + 260 single dose 2.35 (13.9) 2.73 (10.4) 4.0 350 (14.2) 1945 (15.1) 1953 (15.0) 1.14(15.8) 0.89 (15.7) 3.63 (16.3)

^a Arithmetic mean (CV, %). ^b Median value (min-max).

^c Geometric mean (CV, %).

In FIG. 24A shows concentration-time profiles demonstrating mean plasma exposure to the active form of GAA following 5 mg/kg, 10 mg/kg, and 20 mg/kg doses of ATB200. In FIG. 24B also shows concentration-time profiles demonstrating mean plasma exposure to active GAA after 5 mg/kg, 10 mg/kg, and 20 mg/kg ATB200 doses, but showing active plasma GAA on a logarithmic scale. . As can be seen from FIGS. 24A-24B and Table. 12, ATB200 showed slightly over-proportionately dose-dependent effects of the active form of GAA in plasma.

In FIG. 24C shows concentration-time profiles demonstrating the mean plasma exposure of active GAA following doses of 20 mg/kg ATB200 alone, as well as 20 mg/kg ATB200, and 130 or 260 mg miglustat. In FIG. 24D also shows mean plasma exposure to active GAA after 20 mg/kg doses of ATB200 alone, with 130 mg miglustat or 260 mg miglustat, but with active plasma GAA shown on a logarithmic scale.

In FIG. 25A shows concentration-time profiles demonstrating mean plasma total GAA protein exposure following 5 mg/kg, 10 mg/kg, and 20 mg/kg doses of ATB200. In FIG. 25B also shows concentration-time profiles showing mean plasma total GAA protein exposure after 5 mg/kg, 10 mg/kg, and 20 mg/kg ATB200 doses, but showing plasma total GAA protein on a logarithmic scale. . How

- 48 043083 can be seen from FIG. 25A-25B and tab. 13, ATB200 showed slightly over-proportionately dose-dependent effects of total GAA protein in blood plasma.

In FIG. 25C shows concentration-time profiles demonstrating mean plasma total GAA protein exposure following doses of 20 mg/kg ATB200 alone, 20 mg/kg ATB200 and 130 mg miglustat, and 20 mg/kg ATB200 and 260 mg miglustat. In FIG. 25D also shows the mean exposure to total plasma GAA protein after 20 mg/kg doses of ATB200 alone, with 130 mg miglustat, or 260 mg miglustat, but with total plasma GAA protein plotted on a logarithmic scale.

As shown in Table. 13, when co-administered with miglustat, the plasma half-life of total GAA protein was increased by about 30% compared with the administration of ATB200 alone. The volume of distribution ranged from 3.5 to 5.7 L for all treatments, suggesting that glycosylation of ATB200 allows efficient tissue distribution of ATB200.

A summary of the PK of miglustat is shown in Table 1. 14.

Table 14

Dose Pb/L t ^b imax Stakh ssahtv w ^{c AUC} ₀ - _tc AUCo-oo ^C AUCo^/BW ⁶ _Vz / ^Fa CL/F a mg (h) (h) (µg/ml) (ng/ml/kg) (h/mcg/ml) (h * μg / ml) (h.*ng/ml/kg) (l) (l/h) 130 single dose 4.5 (37.0) 2.75 (1.5 -3.5) 1647 (22.1) 19.2 (23.9) 12620 (13.1) 13157 (13D) 154 (29.7) 65.4 (41.9) 9.93 (13.7) 130, multiple dose 5.6 (12.5) 3.0(1.5 3.5) 1393 (36.8) 16.3 (36.4) 11477 (18.0) 12181 (16.4) 142 (26.9) 88.1 (26.1) 10.8 (16.2) 260 single dose 5.5 (25.9) 2.75 (1.0 -5.0) 3552 (30.2) 41.5 (33.8) 26631 (25.1) 28050 (22.9) 325 (30.8) 79.2 (55.3) 9.51 (27.6)

^a Arithmetic mean (CV, %). ^b Median value (min-max).

^c Geometric mean (CV, %).

In FIG. 26 shows the time profile of miglustat plasma concentration in human subjects following a dose of 130 mg or 260 mg of miglustat.

As can be seen from Table. 14 and FIG. 26, miglustat administered orally 1 hour prior to the ATB200 infusion reached peak plasma concentrations 2 hours after the infusion and showed a dose-proportional relationship of kinetic parameters.

The analysis was carried out in relation to different parts of the curves of the concentration of the active form and total GAA protein in blood plasma to determine the partial AUC. In table. 15 is a summary of the partial AUC 0-t _max , t _max -6 h, t _max -10 h, t _max -12 h and t _max -24 h for the active form and total GAA protein.

Table 15

Average (ng*h/m ; arithmetic k) in the period after vve / 1 meaning (BLUE doses R ; pAUC1=4) analyte Treatment 0“tmax tmax-b Ch. tmax-ΐθ Ch. tmax-12 hours tmax-24 h. Active form of GAA 20 mg/kg 428 382 606 630 654 Active form of GAA 20 mg/kg + 130 mg single dose 456 415 722 770 832 Active 20 mg/kg + 130 mg, GAA form multiple doses 423 392 689 737 796 Active form of GAA 20 mg/kg + 260 mg single dose 423 536 924 996 1094 total protein 20 mg/kg 621 603 943 981 1040 total protein 20 mg/kg + 130 mg single dose 565 614 1041 1106 1189 total protein 20 mg/kg + 130 mg multiple doses 630 612 1079 1154 1244 total protein 20 mg/kg + 260 mg single dose 679 824 1411 1518 1665

As can be seen from Table. 15, mean percentage increases in exposure to the active form of GAA within pAUCt _{max-24 h} . for 20 mg/kg with miglustat compared with 20 mg/kg ATB200 alone were 21.4%, 17.8%, 40.2% for 130 mg SD, 130 mg MD and 260 mg SD, respectively.

- 49 043083

Similarly, the mean percentage increases in total GAA protein exposure within pAUCt _{max-24 h} for 20mg/kg with miglustat versus 20mg/kg ATB200 alone were 12.5%, 16.4%, 37.5% for 130 mg SD, 130 mg MD, and 260 mg SD, respectively.

Thus, the analysis of partial AUC demonstrates that with co-administration of miglustat, the partial AUC of ATB200 in the final phase (t _{max-24 h} ) is significantly increased by about 15% for doses of 130 mg of miglustat and by about 40% for 260 mg of miglustat.

Preliminary results of the study of biomarker levels.

In human patients who were transferred from Lumizyme® to ATB200, levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and creatine phosphokinase (CPK) were monitored. Patients received incremental doses of ATB200 (5, 10 and 20 mg/kg) followed by co-administration of ATB200 (20 mg/kg) and miglustat (130 and 260 mg). High levels of the CPK enzyme may indicate damage or strain to muscle tissue, the heart, or the brain. Elevated levels of ALT and AST are markers of liver and muscle damage due to Pompe disease, respectively. A preliminary analysis of ALT, AST and CPK levels is shown in FIG. 38-41.

As can be seen from FIG. 38-41, two patients showed an initial trend towards improvement in all three biomarkers, and in two patients they remained stable. One patient experienced a decrease in CPK, AST and ALT levels by 44%, 28% and 34%, respectively. Another patient experienced a decrease in CPK, AST and ALT levels by 31%, 22% and 11%, respectively.

So far, there have been no serious adverse events (SAEs). AEs were generally light and temporary. To date, there have been no infusion-related reactions after 100+ infusions in all included patients. All patients had anti-rhGAA antibodies at baseline, which generally remained stable. Cytokine levels during infusions remained low and stable.

Example 15 GAA and LAMP1 Levels in Wild Type and Pompe Disease Fibroblasts.

Immunofluorescence microscopy was used to detect GAA and LAMP1 levels in wild-type and Pompe disease fibroblasts with a common splicing mutation. As shown in FIG. 27, GAA is found in separate lysosomal compartments in wild-type fibroblasts. In FIG. 27 also shows the extensive signal from GAA in Pompe fibroblasts and that signals from both GAA and LAMP1 in Pompe fibroblasts appear to be localized in the ER and Golgi apparatus rather than in distal lysosomes. This indicates a change in the transport of the GAA protein in fibroblasts in Pompe disease.

Example 16 Improvement in Cellular Dysfunction and Muscle Function in Gaa Knockout Mice.

It has been shown that impaired glycogen catabolism in lysosomes due to GAA deficiency causes significant cellular dysfunction, as evidenced by pronounced, sustained autophagy, as well as the proliferation and accumulation of membrane-bound intracellular compartments filled with stored glycogen (N. Raben et al.). The immunohistological data of the present inventors indicate that for many proteins, including several key proteins essential for the stability of muscle cell membranes, such as dystrophies, α- and β-dystroglycans, various sarcoglycans, and others, that make up dystrophin-associated glycoprotein complex, as well as proteins involved in muscle recovery, such as dysferlin, protein transport is significantly altered. These key muscle proteins require proper protein transport to the muscle cell membrane where they function. As shown in FIG. 28, the immunohistological data of the present inventors indicate that a significant proportion of these key muscle proteins are intracellularly localized in muscles of Gaa knockout (KO) mice in a Pompe disease model. These data suggest that improper transport of these key muscle proteins may induce pseudomuscular dystrophy, which ultimately leads to muscle weakness and muscle failure.

Alglucosidase-alpha (Myozyme®) and ATB200 with or without 10 mg/kg miglustat were evaluated in KO Gaa mice at an equivalent dose of ERT agent (20 mg/kg) on a biweekly dosing schedule. After 2 administrations, alglucosidase-alpha slightly reduced glycogen stored in skeletal muscle lysosomes (FIGS. 32A-32C) and had almost no effect on reducing autophagy (FIGS. 30A-30B) or lysosome proliferation (FIGS. 29A-29B). compared to mice treated with an inert medium. In contrast, when using the combination ATB200/miglustat under identical conditions, a significantly better clearance of glycogen in lysosomes was observed (Fig. 32A-32D). The ATB200/miglustat combination also appears to improve overall muscle physiology, as evidenced by reduced levels of LC3 II (FIGS. 30A-30B), a recognized autophagy biomarker, and clearance of accumulated intracellular vesicles stained for LAMP1 (FIGS. 29A29B) , a known lysosome resident integral membrane protein; and dysferlin (FIGS. 31A-31B), a known cell surface protein involved in muscle repair. In addition, the ATB200/miglustat combination significantly improved muscle architecture, which was not unlike

- 50 043083 muscle fibers from wild-type mice.

Also in FIG. Figures 29-32 show that two different batches of ATB200 (from older and later generation manufacturing processes) produced comparable results. In FIG. 32A32D * indicates a statistically significant result compared to Myozyme® alone.

Example 17 Muscle Function in Gaa Knockout Mice.

In longer-term studies with 12 biweekly doses, the combination of 20 mg/kg ATB200 with 10 mg/kg miglustat gradually increased functional muscle strength in KO Gaa mice from baseline, as measured by both grip strength tests and tests hanging on a wire (Fig. 33A-33B). Mice treated with alglucosidase-alpha (Lumizyme®) that received a similar dose of ERT agent (20 mg/kg) experienced a reduction in performance under identical conditions for most of the study (FIGS. 33A-33B). As with the shorter term study, the ATB200/miglustat combination had significantly better glycogen clearance after 3 months (FIGS. 34A-34C) and 6 months (FIGS. 34D-G) treatment than alglucosidase-alpha. The ATB200/miglustat combination also reduced autophagy and intracellular accumulation of LAMP1 and dysferlin after 3 months of treatment (Figure 35) compared to alglucosidase-alpha. In FIG. 33A * indicates a statistically significant result compared to Lumizyme® alone (p < 0.05, 2-tailed t-test). In FIG. 34A-34G * indicates a statistically significant result compared to Lumizyme® alone (p < 0.05, Dunnett's multiple comparison, one-way ANOVA).

Taken together, these data indicate that the ATB200/miglustat combination was effective in targeting muscle, reversing cellular dysfunction and improving muscle function. Importantly, apparent improvements in muscle architecture, as well as reduced autophagy and intracellular accumulation of LAMP1 and dysferlin, may be good surrogates for improved muscle physiology, which correlates with improvements in functional muscle strength. These results suggest that monitoring autophagy and the levels of these key muscle proteins, which may prove to be useful biomarkers in muscle biopsy specimens in clinical studies, may be a viable practical way to evaluate the effectiveness of therapeutic treatments for Pompe disease in KO Gaa mice.

In FIG. 40 shows that administration of ATB200 with or without miglustat for 6 months reduced intracellular dystrophin accumulation in KO Gaa mice. A more significant reduction in dystrophin accumulation was observed with the ATB200 ± miglustat combination than with Lumizyme®.

Example 18 Effect of Sialic Acid Content in ATB200 in Gaa Knockout Mice.

Two batches of ATB200 with different sialic acid content were evaluated for pharmacokinetic parameters and efficacy in KO Gaa mice. In In tab. 16 provides a summary of performance information for the two batches.

Table 16

Characteristic Party A Party B Sialic acid 4.0 mol/mol protein 5.4 mol/mol protein M6P content 3.3 mol/mol protein 2.9 mol/mol protein Specific activity 115831 (nmol 4ti/mg protein/hour) 120929 (nmol 4ti/mg protein/hour) Linking to CIMPR K _d = 2.7 nM K _d = 2.9 nM

As can be seen from Table. 16, Lot B had a higher sialic acid content than Lot A, but slightly less M6P than Lot A.

In FIG. 36 shows plasma concentration-time profiles of the active form of GAA in KO Gaa mice following a single IV bolus dose of ATB200. The half-life values for parties A and B are presented in table. 17 below.

Table 17

Half-life G-) Mean ± SEM Party A 0.50±0.02 Party B 0.60±0.03

As can be seen from Table. 17, Lot B had a shorter half-life than Lot A. Although the decrease in half-life was not significant, this decrease in half-life was statistically significant (p < 0.05 for 2-tailed t-test).

In a related study, KO Gaa mice were given IV bolus injections of ATB200 (lots A and B) and Lumizyme® in the tail vein once every two weeks for a total of 2 injections. Tissue glycogen levels were measured 14 days after the last injection. As shown in FIG. 37A-37D, Lot B was overall more effective at reducing glycogen levels than Lot A at similar doses. Both Lot A and Lot B were superior to Lumizyme® in terms of glycogen reduction. In FIG. 37A-37D * indicates a statistically significant result compared to Lumizyme® (p < 0.05, t-test), and ^l indicates a statistically significant result comparing Lot A and Lot B at the same dose ( p < 0.05, t-test).

The embodiments described herein are intended to be illustrative of the compositions and methods of the present invention and are not intended to limit the scope of the present invention. Various modifications and changes that are consistent with the description as a whole and obvious to a person skilled in the art are meant to be included. The appended claims should not be limited to the specific embodiments set forth in the examples, but should provide the broadest possible interpretation consistent with the description as a whole.

Throughout this application, patents, patent applications, publications, product descriptions, GenBank access numbers, and protocols, the disclosures of which are incorporated herein by reference in their entirety in all respects, are cited.

Sequence Listing <110> Amicus Therapeutics, Inc.

<120> ENHANCED ACID ALPHA GLUCOSIDASE FOR THE TREATMENT OF POMP DISEASE <130> AT-P8500-PCT <160>6 <170> PatentIn version 3.5 <210>1 <211>952 <212> PROTEIN <213> Homo sapiens <400 >1

Met Gly Val Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Val Cys

5 1015

Ala Leu Val Ser Leu Ala Thr Ala Ala Leu Leu Gly His Ile Leu Leu

2530

His Asp Phe Leu Leu Val Pro Arg Glu Leu Ser Gly Ser Ser Pro Val 35 4045

Leu Glu Glu Thr His Pro Ala His Gln Gln Gly Ala Ser Arg Pro Gly

5560

Pro Arg Asp Ala Gln Ala His Pro Gly Arg Pro Arg Ala Val Pro Thr 65 70 7580

Gln Cys Asp Val Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys 85 9095

Ala Ile Thr Gln Glu Gln Cys Glu Ala Arg Gly Cys Cys Tyr Ile Pro

100 105110

Ala Lys Gln Gly Leu Gln Gly Ala Gln Met Gly Gln Pro Trp Cys Phe

115 120125

- 52 043083

Phe

Glu 145

Pro

Asn

Val

Tyr

Glin 225

Phe

ile

trp

Ala

Gly 305

Val

Leu

Gln

Leu

Pro Pro Ser 130

Met Gly Tyr

Lys Asp Ile

Arg Leu His

180

Pro LeuGlu

195

Ser ValGlu 210

Leu Asp Gly

Ala Asp Gln

Thr Gly Leu

260

Thr Arg Ile

275

Asn Leu Tyr 290

Ser Ala His

Leu Gln Pro

Asp Val Tyr

340

Tyr Leu Asp

355

Gly Phe His

Tyr Pro Ser

135

Thr Ala Thr

150

Leu Thr Leu 165

Phe Thr Ile

Thr Pro Arg

Phe Ser Glu

215

Arg Val Leu

230

Phe Leu Gln 245

Ala Glu His

Thr Leu Trp

Gly Ser His

295

Gly Val Phe

310

Ser Pro Ala 325

Ile Phe Leu

Val Val Gly

Leu Cys Arg

Tyr Lys Leu

Leu Thr Arg

Arg Leu Asp

170

Lys Asp Pro

185

Val His Ser 200

Glu Pro Phe

Leu Asn Thr

Leu Ser Thr

250

Leu Ser Pro

265

Asn Arg Asp 280

Pro Phe Tyr

Leu Leu Asn

Leu Ser Trp

330

Gly Pro Glu

345

Tyr Pro Phe 360

Trp Gly Tyr

Glu Asn Leu

140

Thr Thr Pro 155

Val Met Met

Ala Asn Arg

Arg Ala Pro

205

Gly Val Ile

220

Thr Val Ala 235

Ser Leu Pro

Leu Met Leu

Leu Ala Pro

285

Leu Ala Leu

300

Ser Asn Ala 315

Arg Ser Thr

Pro Lys Ser

Met Pro Pro

365

Ser Ser Thr

Ser Ser Ser

Thr Phe Phe

160

Glu Thr Glu

175

Arg Tyr Glu 190

Ser Pro Leu

Val His Arg

Pro Leu Phe

240

Ser Gln Tyr

255

Ser Thr Ser 270

Thr Pro Gly

Glu Asp Gly

Met Asp Val

320

Gly Gly Ile

335

Val Val Gln 350

Tyr Trp Gly

Ala Ile Thr

- 53 043083

His Phe Pro

395

Leu Asp Val

400

370

375

380

Arg 385

Gln

Asn

Gln

Ser

Gly 465

trp

Ala

asp

Ser

Pro 545

Ser

Leu

Thr

Tyr

Gln Val Val

Glu Asn Met

390

Thr Arg Ala

Trp Asn Asp

Leu Asp Tyr 405

Met Asp Ser

410

Arg Arg Asp

Phe Thr Phe

415

Lys Asp Gly

420

Gly Gly Arg

435

Gly Pro Ala 450

Val Phe Ile

Pro Gly Ser

Trp Trp Glu

500

Gly Met Trp

515

Glu Asp Gly 530

Gly Val Val

His Gln Phe

Thr Glu Ala

580

Arg Pro Phe

595

Ala Gly His 610

Phe Arg Asp

Phe Pro Ala

425

Met Val Gln

Glu Leu His 430

Arg Tyr Met

Met Ile Val 440

Asp ProAla

445

Ile Ser Ser

Gly Ser Tyr

455

Thr Asn Glu

470

Thr Ala Phe 485

Asp Met Val

Ile Asp Met

Cys Pro Asn

535

Gly Gly Thr

550

Leu Ser Thr 565

Ile Ala Ser

Val Ile Ser

Trp Thr Gly

615

Arg Pro Tyr

Asp Glu Gly

460

Leu Arg Arg

Thr Gly Gln

Pro Leu Ile 475

Gly Lys Val

480

Pro Asp Phe

490

Thr Asn Pro

Thr Ala Leu

495

Ala Glu Phe

505

Asn Glu Pro 520

Asn Glu Leu

Leu Gln Ala

His Tyr Asn

570

His Arg Ala

585

Arg Ser Thr 600

Asp Val Trp

His Asp Gln

Val Pro Phe 510

Ser Asn Phe

525

Glu Asn Pro

540

Ala Thr Ile 555

Leu His Asn

Leu Val Lys

Phe Ala Gly

605

Ser Ser Trp

620

Ile Arg Gly

Pro Tyr Val

Cys Ala Ser

560

Leu Tyr Gly

575

Ala Arg Gly 590

His Gly Arg

Glu Gln Leu

- 54 043083

Ala Ser Ser Val Pro 625

Glu Ile Leu Gln Phe 630

Asn Leu Leu Gly Val 635

Leu Val Gly Ala Asp

645

Val Cys Gly Phe Leu

650

Gly Asn Thr Ser Glu

655

Leu Cys Val Arg Trp

660

Thr Gln Leu Gly Ala 6 65

Phe Tyr Pro Phe Met

670

Asn His Asn Ser Leu

675

Leu Ser Leu Pro Gln

680

Glu Pro Tyr Ser Phe 685

Glu Pro Ala Gln Gln

690

Ala Met Arg Lys Ala

695

Leu Thr Leu Arg Tyr

700

Leu Leu Pro His Leu 705

Tyr Thr Leu Phe His 710

Gln Ala His Val Ala 715

Glu Thr Val Ala Arg

725

Pro Leu Phe Leu Glu

730

Phe Pro Lys Asp Ser

735

Thr Trp Thr Val Asp

740

His Gln Leu Leu Trp 745

Gly Glu Ala Leu Leu

750

Thr Pro Val Leu Gln

755

Ala Gly Lys Ala Glu 760

Val Thr Gly Tyr Phe

765

Leu Gly Thr Trp Tyr

770

Asp Leu Gln Thr Val 775

Pro Ile Glu Ala Leu

780

Ser Leu Pro Pro Pro 785

Pro Ala Ala Pro Arg 790

Glu Pro Ala Ile His 795

Glu Gly Gln Trp Val

805

Thr Leu Pro Ala Pro

810

Leu Asp Thr Ile Asn

815

His Leu Arg Ala Gly

820

Tyr Ile Ile Pro Leu

825

Gln Gly Pro Gly Leu

830

Thr Thr Glu Ser Arg

835

Gln Gln Pro Met Ala

840

Leu Ala Val Ala Leu

845

Lys Gly Gly Glu Ala

850

Arg Gly Glu Leu Phe

855

Trp Asp Asp Gly Glu 860

Leu Glu Val Leu Glu 865

Arg Gly Ala Tyr Thr 870

Gln Val Ile Phe Leu 875

Pro 640

Glu

Arg

Ser

Ala

Gly 720

Ser

ile

Pro

gly

Ser 800

Val

Thr

Thr

Ser

Ala 880

- 55 043083

Arg Asn Asn Thr ile 885 Val Asn Glu Leu Val 890 Arg Val Thr Ser Glu 895 gly Ala gly Leu Gln 900 Leu Gln Lys Val Thr 905 Val Leu gly Val Ala 910 Thr Ala Pro Gln Gln 915 Val Leu Ser Asn Gly 920 Val Pro Val Ser Asn 925 Phe Thr Tyr Ser Pro 930 asp Thr Lys Val Leu 935 asp ile Cys Val Ser 940 Leu Leu Met gly

Glu Gln Phe Leu Val Ser Trp Cys

945950 <210>2 <211>3624 <212> DNA <213> Homo sapiens <220>

<221> CDS <222> (220) .. (3078) <220>

<221> mRNA <222> (221)..(3075) <400> 2

cagttgggaa agctgaggtt gtcgccgggg ccgcgggtgg aggtcggggga tgaggcagca 60 ggtaggacag tgacctcggt gacgcgaagg accccggcca cctctagggtt ctcctcgtcc 120 gcccgttgtt cagcgaggga ggctctgggc ctgccgcagc tgacggggaa actgaggcac 180 ggagcgggcc tgtaggagct gtccaggcca tctccaacc atg gga gtg Met Gly Val 1 agg cac Arg His 5 234

ccg Pro ccc Pro tgc Cys tcc Ser cac His 10 cgg Arg ctc Leu ctg Leu gcc Ala gtc Val 15 tgc Cys gcc Ala ctc Leu gtg Val tcc Ser 20 ttg Leu 282 gca acc gct gca ctc ctg ggg cac atc cta ctc cat gat ttc ctg ctg 330 Ala Thr Ala Ala 25 Leu Leu gly His Ile 30 Leu Leu His asp Phe 35 Leu Leu gtt ccc cga gag ctg agt ggc tcc tcc cca gtc ctg gag gag act cac 378 Val Pro Arg 40 Glu Leu Ser gly Ser 45 Ser Pro Val Leu Glu 50 Glu Thr His cca gct cac cag cag gga gcc agc aga cca ggg ccc cgg gat gcc cag 426 Pro Ala 55 His Gln Gln gly Ala 60 Ser Arg Pro gly Pro 65 Arg asp Ala Gln gca cac ccc ggc cgt ccc aga gca gtg ccc aca cag tgc gac gtc ccc 474

- 56 043083

Ala 70cc Pro cag

Gln cag

Gln ccc

Pro gcc Ala 150 acc Thr acg

Thr ccg

Pro tcc

Ser gtg Val 230 ctt Leu gag

Gluctg

Leu tct

Ser gtg Val 310

His Pro Gly Arg Pro Arg Ala Val Pro Thr Gln Cys Asp Val Pro 75 8085 aac agc cgc ttc gat tgc gcc cct gac aag gcc atc acc cag gaa522

Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys Ala Ile Thr GlnGlu

95100 tgc gag gcc cgc ggc tgc tgc tac atc cct gca aag cag ggg ctg570

Cys Glu Ala Arg Gly Cys Cys Tyr Ile Pro Ala Lys Gln GlyLeu

105 110115 gga gcc cag atg ggg cag ccc tgg tgc ttc ttc cca ccc agc tac618

Gly Ala Gln Met Gly Gln Pro Trp Cys Phe Phe Pro Pro SerTyr

120 125130 agc tac aag ctg gag aac ctg agc tcc tct gaa atg ggc tac acg666

Ser Tyr Lys Leu Glu Asn Leu Ser Ser Ser Glu Met Gly TyrThr

135 140145 acc ctg acc cgt acc acc ccc acc ttc ttc ccc aag gac atc ctg714

Thr Leu Thr Arg Thr Thr Pro Thr Phe Phe Pro Lys Asp IleLeu

155 160165 ctg cgg ctg gac gtg atg atg gag act gag aac cgc ctc cac ttc762

Leu Arg Leu Asp Val Met Met Glu Thr Glu Asn Arg Leu HisPhe

170 175180 atc aaa gat cca gct aac agg cgc tac gag gtg ccc ttg gag acc810

Ile Lys Asp Pro Ala Asn Arg Arg Tyr Glu Val Pro Leu GluThr

185 190195 cgt gtc cac agc cgg gca ccg tcc cca ctc tac agc gtg gag ttc858

Arg Val His Ser Arg Ala Pro Ser Pro Leu Tyr Ser Val GluPhe

200 205210 gag gag ccc ttc ggg gtg atc gtg cac cgg cag ctg gac ggc cgc906

Glu Glu Pro Phe Gly Val Ile Val His Arg Gln Leu Asp GlyArg

215 220225 ctg ctg aac acg acg gtg gcg ccc ctg ttc ttt gcg gac cag ttc954

Leu Leu Asn Thr Thr Val Ala Pro Leu Phe Phe Ala Asp GlnPhe

235 240245 cag ctg tcc acc tcg ctg ccc tcg cag tat atc aca ggc ctc gcc1002

Gln Leu Ser Thr Ser Leu Pro Ser Gln Tyr Ile Thr Gly LeuAla

250 255260 cac ctc agt ccc ctg atg ctc agc acc agc tgg acc agg atc acc1050

His Leu Ser Pro Leu Met Leu Ser Thr Ser Trp Thr Arg IleThr

265 270275 tgg aac cgg gac ctt gcg ccc acg ccc ggt gcg aac ctc tac ggg1098

Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly Ala Asn Leu TyrGly

280 285290 cac cct ttc tac ctg gcg ctg gag gac ggc ggg tcg gca cac ggg1146

His Pro Phe Tyr Leu Ala Leu Glu Asp Gly Gly Ser Ala HisGly

295 300305 ttc ctg cta aac agc aat gcc atg gat gtg gtc ctg cag ccg agc1194

Phe Leu Leu Asn Ser Asn Ala Met Asp Val Val Leu Gln ProSer

315 320325

- 57 043083

cct Pro gcc Ala ctt Leu agc Ser tgg Trp 330 agg Arg tcg Ser aca Thr ggt gly ggg Gly 335 atc ile ctg Leu gat asp gtc Val tac Tyr 340 atc ile 1242 ttc ctg ggc cca gag ccc aag agc gtg gtg cag cag tac ctg gac gtt 1290 Phe Leu gly Pro 345 Glu Pro Lys Ser Val 350 Val Gln Gln Tyr Leu 355 asp Val gtg gga tac ccg ttc atg ccg cca tac tgg ggc ctg ggc ttc cac ctg 1338 Val gly Tyr 360 Pro Phe Met Pro Pro 365 Tyr trp gly Leu Gly 370 Phe His Leu tgc cgc tgg ggc tac tcc tcc acc gct atc acc cgc cag gtg gtg gag 1386 Cys Arg 375 trp gly Tyr Ser Ser 380 Thr Ala ile Thr Arg 385 Gln Val Val Glu aac atg acc agg gcc cac ttc ccc ctg gac gtc caa tgg aac gac ctg 1434 Asn 390 Met Thr Arg Ala His 395 Phe Pro Leu asp Val 400 Gln trp Asn asp Leu 405 gac tac atg gac tcc cgg agg gac ttc acg ttc aac aag gat ggc ttc 1482 asp Tyr Met asp Ser 410 Arg Arg asp Phe Thr 415 Phe Asn Lys asp Gly 420 Phe cgg gac ttc ccg gcc atg gtg cag gag ctg cac cag ggc ggc cgg cgc 1530 Arg asp Phe Pro 425 Ala Met Val Gln Glu 430 Leu His Gln gly Gly 435 Arg Arg tac atg atg atc gtg gat cct gcc atc agc agc tcg ggc cct gcc ggg 1578 Tyr Met Met 440 ile Val asp Pro Ala 445 ile Ser Ser Ser Gly 450 Pro Ala gly agc tac agg ccc tac gac gag ggt ctg cgg agg ggg gtt ttc atc acc 1626 Ser Tyr 455 Arg Pro Tyr asp Glu 460 gly Leu Arg Arg Gly 465 Val Phe ile Thr aac gag acc ggc cag ccg ctg att ggg aag gta tgg ccc ggg tcc act 1674 Asn 470 Glu Thr gly Gln Pro 475 Leu ile gly Lys Val 480 trp Pro gly Ser Thr 485 gcc ttc ccc gac ttc acc aac ccc aca gcc ctg gcc tgg tgg gag gac 1722 Ala Phe Pro asp Phe 490 Thr Asn Pro Thr Ala 495 Leu Ala trp trp Glu 500 asp atg gtg gct gag ttc cat gac cag gtg ccc ttc gac ggc atg tgg att 1770 Met Val Ala Glu 505 Phe His asp Gln Val 510 Pro Phe asp gly Met 515 trp ile gac atg aac gag cct tcc aac ttc atc aga ggc tct gag gac ggc tgc 1818 asp Met Asn 520 Glu Pro Ser Asn Phe 525 ile Arg gly Ser Glu 530 asp gly Cys ccc aac aat gag ctg gag aac cca ccc tac gtg cct ggg gtg gtt ggg 1866 Pro Asn 535 Asn Glu Leu Glu Asn 540 Pro Pro Tyr Val Pro 545 gly Val Val gly ggg acc ctc cag gcg gcc acc atc tgt gcc tcc agc cac cag ttt ctc 1914 Gly 550 Thr Leu Gln Ala Ala 555 Thr ile Cys Ala Ser 560 Ser His Gln Phe Leu 565 tcc aca cac tac aac ctg cac aac ctc tac ggc ctg acc gaa gcc atc 1962 Ser Thr His Tyr Asn Leu His Asn Leu Tyr gly Leu Thr Glu Ala ile

570 575 580

- 58 043083

gcc Ala tcc Ser cac His agg Arg 585 gcg Ala ctg Leu gtg Val aag Lys gct Ala 590 cgg Arg ggg gly aca Thr cgc Arg cca Pro 595 ttt Phe gtg Val 2010 atc tcc cgc tcg acc ttt gct ggc cac ggc cga tac gcc ggc cac tgg 2058 ile Ser Arg 600 Ser Thr Phe Ala Gly 605 His gly Arg Tyr Ala 610 gly His trp acg ggg gac gtg tgg agc tcc tgg gag cag ctc gcc tcc tcc gtg cca 2106 Thr Gly 615 asp Val trp Ser Ser 620 trp Glu Gln Leu Ala 625 Ser Ser Val Pro gaa atc ctg cag ttt aac ctg ctg ggg gtg cct ctg gtc ggg gcc gac 2154 Glu 630 ile Leu Gln Phe Asn 635 Leu Leu gly Val Pro 640 Leu Val gly Ala asp 645 gtc tgc ggc ttc ctg ggc aac acc tca gag gag ctg tgt gtg cgc tgg 2202 Val Cys gly Phe Leu 650 gly Asn Thr Ser Glu 655 Glu Leu Cys Val Arg 660 trp acc cag ctg ggg gcc ttc tac ccc ttc atg cgg aac cac aac agc ctg 2250 Thr Gln Leu Gly 6 65 Ala Phe Tyr Pro Phe 670 Met Arg Asn His Asn 675 Ser Leu ctc agt ctg ccc cag gag ccg tac agc ttc agc gag ccg gcc cag cag 2298 Leu Ser Leu 680 Pro Gln Glu Pro Tyr 685 Ser Phe Ser Glu Pro 690 Ala Gln Gln gcc atg agg aag gcc ctc acc ctg cgc tac gca ctc ctc ccc cac ctc 2346 Ala Met 695 Arg Lys Ala Leu Thr 700 Leu Arg Tyr Ala Leu 705 Leu Pro His Leu tac aca ctg ttc cac cag gcc cac gtc gcg ggg gag acc gtg gcc cgg 2394 Tyr 710 Thr Leu Phe His Gln 715 Ala His Val Ala Gly 720 Glu Thr Val Ala Arg 725 ccc ctc ttc ctg gag ttc ccc aag gac tct agc acc tgg act gtg gac 2442 Pro Leu Phe Leu Glu 730 Phe Pro Lys asp Ser 735 Ser Thr trp Thr Val 740 asp cac cag ctc ctg tgg ggg gag gcc ctg ctc atc acc cca gtg ctc cag 2490 His Gln Leu Leu 745 trp gly Glu Ala Leu 750 Leu ile Thr Pro Val 755 Leu Gln gcc ggg aag gcc gaa gtg act ggc tac ttc ccc ttg ggc aca tgg tac 2538 Ala gly Lys 760 Ala Glu Val Thr Gly 765 Tyr Phe Pro Leu Gly 770 Thr trp Tyr gac ctg cag acg gtg cca ata gag gcc ctt ggc agc ctc cca ccc cca 2586 asp Leu 775 Gln Thr Val Pro ile 780 Glu Ala Leu gly Ser 785 Leu Pro Pro Pro cct gca gct ccc cgt gag cca gcc atc cac agc gag ggg cag tgg gtg 2634 Pro 790 Ala Ala Pro Arg Glu 795 Pro Ala ile His Ser 800 Glu gly Gln trp Val 805 acg ctg ccg gcc ccc ctg gac acc atc aac gtc cac ctc cgg gct ggg 2682 Thr Leu Pro Ala Pro 810 Leu asp Thr ile Asn 815 Val His Leu Arg Ala 820 gly tac atc atc ccc ctg cag ggc cct ggc ctc aca acc aca gag tcc cgc 2730 Tyr ile ile Pro Leu Gln gly Pro gly Leu Thr Thr Thr Glu Ser Arg

- 59 043083

825 830 835 cag cag ccc atg gcc ctg gct gtg gcc ctg acc aag ggt gga gag gcc 2778 Gln Gln Pro Met Ala Leu 840 Ala Val Ala Leu Thr Lys Gly 845 850 Gly Glu Ala cga ggg gag ctg ttc tgg gac gat gga gag agc ctg gaa gtg ctg gag 2826 Arg Gly Glu Leu Phe Trp 855 Asp Asp Gly Glu Ser Leu Glu 860 865 Val Leu Glu cga ggg gcc tac aca cag gtc atc ttc ctg gcc agg aat aac acg atc 2874 Arg 870 Gly Ala Tyr Thr Gln 875 Val Ile Phe Leu Ala Arg Asn 880 Asn Thr Ile 885 gtg aat gag ctg gta cgt gtg acc agt gag gga gct ggc ctg cag ctg 2922 Val Asn Glu Leu Val Arg 890 Val Thr Ser Glu Gly Ala Gly 895 Leu Gln Leu 900 cag aag gtg act gtc ctg ggc gtg gcc acg gcg ccc cag cag gtc ctc 2970 Gln Lys Val Thr Val Leu 905 Gly Val Ala Thr Ala Pro Gln 910 Gln Val Leu 915 tcc aac ggt gtc cct gtc tcc aac ttc acc tac agc ccc gac acc aag 3018 Ser Asn Gly Val Pro Val 920 Ser Asn Phe Thr Tyr Ser Pro 925 930 Asp Thr Lys gtc ctg gac atc tgt gtc tcg ctg ttg atg gga gag cag ttt ctc gtc 3066 Val Leu Asp Ile Cys Val 935 Ser Leu Leu Met Gly Glu Gln 940 945 Phe Leu Val

agc tgg tgt tag ccgggcggag tgtgttagtc tctccagagg gaggctggtt3118

Ser Trp Cys 950

ccccagggaa gcagagcctg tgtgcgggca gcagctgtgt gcgggcctgg gggttgcatg 3178 tgtcacctgg agctgggcac taaccattcc aagccgccgc atcgcttgtt tccacctcct 3238 gggccggggc tctggcccc aacgtgtcta ggagagcttt ctcctagat cgcactgtgg 3298 gccggggcct ggagggctgc tctgtgttaa taagattgta aggtttgccc tcctcacctg 3358 ttgccggcat gcgggtagta ttagccccc ccctccatct gttcccagca ccggagaagg 3418 gggtgctcag gtggaggtgt ggggtatgca cctgagctcc tgcttcgcgc ctgctgctct 3478 gccccaacgc gaccgcttcc cggctgccca gagggctgga tgcctgccgg tccccgagca 3538 agcctgggaa ctcaggaaaa ttcacaggac ttgggagatt ctaaatctta agtgcaatta 3598 ttttaataaa aggggcattt ggaatc 3624

<210>3 <211>952 <212> PROTEIN <213> Homo sapiens <400>3

Met Gly Val Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Val Cys

5 1015

- 60 043083

Ala

His

Leu

Pro 65

Gln

Ala

Ala

Phe

Glu 145

Pro

Asn

Val

Tyr

Glin 225

Phe

ile

Leu Val

Asp Phe 35

Glu Glu 50

Arg Asp

Cys Asp

Ile Thr

Lys Gln

115

Pro Pro 130

Met Gly

Lys Asp

Arg Leu

ProLeu

195

Ser Val

210

Leu Asp

Ala Asp

Thr Gly

Ser Leu 20

Leu Leu

Thr His

Ala Gln

ValPro

Gln Glu 100

Gly Leu

Ser Tyr

Tyr Thr

Ile Leu

165

His Phe 180

Glu Thr

Glu Phe

Gly Arg

Gln Phe

245

Leu Ala

260

Ala Thr

ValPro

ProAla

Ala His 70

ProAsn

Gln Cys

Gln Gly

Pro Ser

135

Ala Thr 150

Thr Leu

Thr Ile

Pro Arg

SerGlu

215

Val Leu 230

Leu Gln

Glu His

Ala Ala 25

Arg Glu 40

His Gln

Pro Gly

Ser Arg

Glu Ala

105

AlaGln 120

Tyr Lys

Leu Thr

Arg Leu

Lys Asp

185

Val His 200

GluPro

Leu Asn

Leu Ser

Leu Ser

265

Leu Leu

Leu Ser

Gln Gly

Arg Pro

Phe Asp 90

Arg Gly

Met Gly

Leu Glu

Arg Thr

155

Asp Val 170

ProAla

Ser Arg

Phe Gly

Thr Thr

235

Thr Ser

250

ProLeu

Gly His

Gly Ser 45

Ala Ser 60

Arg Ala

Cys Ala

Cys Cys

GlnPro

125

Asn Leu

140

ThrPro

Met Met

Asn Arg

Ala Pro

205

Val Ile 220

Val Ala

Leu Pro

Met Leu

Ile Leu 30

Ser Pro

ArgPro

ValPro

Pro Asp 95

Tyr Ile 110

Trp Cys

Ser Ser

Thr Phe

Glu Thr

175

Arg Tyr 190

Ser Pro

Valhis

ProLeu

SerGln

255

Ser Thr

270

Leu

Val

gly

Thr 80

Lys

Pro

Phe

Ser

Phe 160

Glu

Glu

Leu

Arg

Phe 240

Tyr

Ser

- 61 043083

trp

Ala

Gly 305

Val

Leu

Gln

Leu

Arg 385

Gln

Asn

Gln

Ser

Gly 465

trp

Ala

asp

Thr Arg Ile

275

Thr Leu Trp

Asn Arg Asp 280

Leu Ala Pro

285

Thr Pro Gly

Asn Leu Tyr 290

Gly Ser His

295

Pro Phe Tyr

Leu Ala Leu

300

Glu Asp Gly

Ser Ala His

Gly Val Phe

310

Leu Leu Asn

Ser Asn Ala 315

Met Asp Val

320

Leu Gln Pro

Ser Pro Ala 325

Leu Ser Trp

330

Arg Ser Thr

Gly Gly Ile

335

Asp Val Tyr

340

Tyr Leu Asp

355

Gly Phe His 370

Gln Val Val

Trp Asn Asp

Lys Asp Gly

420

Gly Gly Arg

435

Gly Pro Ala 450

Val Phe Ile

Pro Gly Ser

Trp Trp Glu

500

Gly Met Trp

Ile Phe Leu

Gly Pro Glu

345

Pro Lys Ser

Val Val Gln 350

Val Val Gly

Tyr Pro Phe 360

Met Pro Pro

365

Tyr Trp Gly

Leu Cys Arg

375

Glu Asn Met

390

Leu Asp Tyr 405

Phe Arg Asp

Arg Tyr Met

Gly Ser Tyr

455

Thr Asn Glu

470

Thr Ala Phe 485

Asp Met Val

Ile Asp Met

Trp Gly Tyr

Thr Arg Ala

Met Asp Ser

410

Phe Pro Ala

425

Met Ile Val 440

Arg Pro Tyr

Thr Gly Gln

Pro Asp Phe

490

Ala Glu Phe

505

Asn Glu Pro

Ser Ser Thr

380

His Phe Pro 395

Arg Arg Asp

Met Val Gln

Asp ProAla

445

Asp Glu Gly

460

Pro Leu Ile 475

Thr Asn Pro

His Asp Gln

Ser Asn Phe

Ala Ile Thr

Leu Asp Val

400

Phe Thr Phe

415

Glu Leu His 430

Ile Ser Ser

Leu Arg Arg

Gly Lys Val

480

Thr Ala Leu

495

Val Pro Phe 510

Ile Arg Gly

- 62 043083

Glu Asn Pro Pro Tyr

540

515

520

525

Ser Glu Asp Gly Cys

530

Pro Asn Asn Glu Leu

535

Pro Gly Val Val Gly 545

Gly Thr Leu Gln Ala 550

Ala Thr Ile Cys Ala 555

Ser His Gln Phe Leu

565

Ser Thr His Tyr Asn

570

Leu His Asn Leu Tyr

575

Leu Thr Glu Ala Ile

580

Ala Ser His Arg Ala

585

Leu Val Lys Ala Arg

590

Thr Arg Pro Phe Val

595

Ile Ser Arg Ser Thr 600

Phe Ala Gly His Gly 605

Tyr Ala Gly His Trp 610

Thr Gly Asp Val Trp

615

Ser Ser Trp Glu Gln 620

Ala Ser Ser Val Pro 625

Glu Ile Leu Gln Phe 630

Asn Leu Leu Gly Val 635

Leu Val Gly Ala Asp

645

Val Cys Gly Phe Leu

650

Gly Asn Thr Ser Glu

655

Leu Cys Val Arg Trp

660

Thr Gln Leu Gly Ala

665

Phe Tyr Pro Phe Met

670

Asn His Asn Ser Leu

675

Leu Ser Leu Pro Gln

680

Glu Pro Tyr Ser Phe

685

Glu Pro Ala Gln Gln

690

Ala Met Arg Lys Ala

695

Leu Thr Leu Arg Tyr

700

Leu Leu Pro His Leu 705

Tyr Thr Leu Phe His 710

Gln Ala His Val Ala 715

Glu Thr Val Ala Arg

725

Pro Leu Phe Leu Glu

730

Phe Pro Lys Asp Ser

735

Thr Trp Thr Val Asp

740

His Gln Leu Leu Trp 745

Gly Glu Ala Leu Leu

750

Thr Pro Val Leu Gln

755

Ala Gly Lys Ala Glu

760

Val Thr Gly Tyr Phe

765

Val

Ser 560

gly

gly

Arg

Leu

Pro 640

Glu

Arg

Ser

Ala

Gly 720

Ser

ile

Pro

- 63 043083

Leu Gly Thr Trp Tyr

770

Asp Leu Gln Thr Val 775

Pro Ile Glu Ala Leu

780

Ser Leu Pro Pro Pro 785

Pro Ala Ala Pro Arg 790

Glu Pro Ala Ile His 795

Glu Gly Gln Trp Val

805

Thr Leu Pro Ala Pro

810

Leu Asp Thr Ile Asn

815

His Leu Arg Ala Gly

820

Tyr Ile Ile Pro Leu

825

Gln Gly Pro Gly Leu

830

Thr Thr Glu Ser Arg

835

Gln Gln Pro Met Ala

840

Leu Ala Val Ala Leu

845

Lys Gly Gly Glu Ala

850

Arg Gly Glu Leu Phe

855

Trp Asp Asp Gly Glu 860

Leu Glu Val Leu Glu 865

Arg Gly Ala Tyr Thr 870

Gln Val Ile Phe Leu 875

Arg Asn Asn Thr Ile

885

Val Asn Glu Leu Val

890

Arg Val Thr Ser Glu

895

Ala Gly Leu Gln Leu

900

Gln Lys Val Thr Val

905

Leu Gly Val Ala Thr

910

Pro Gln Gln Val Leu

915

Ser Asn Gly Val Pro

920

Val Ser Asn Phe Thr

925

Ser Pro Asp Thr Lys 930

Val Leu Asp Ile Cys

935

Val Ser Leu Leu Met

940

gly

Ser 800

Val

Thr

Thr

Ser

Ala 880

gly

Ala

Tyr

gly

Glu Gln Phe Leu Val 945

Ser Trp Cys 950 <210>4 <211>952 <212> PROTEIN <213> Homo sapiens <400>4

Met Gly Val Arg His Pro Pro Cys Ser His Arg Leu Leu Ala Val 1 5 1015

Ala Leu Val Ser Leu Ala Thr Ala Ala Leu Leu Gly His Ile Leu

25 30

Cys

Leu

- 64 043083

His Asp Phe Leu Leu 35

Val Pro Arg Glu Leu 40

Ser Gly Ser Ser Pro 45

Leu Glu Glu Thr His 50

Pro Ala His Gln Gln

Gly Ala Ser Arg Pro 60

Pro Arg Asp Ala Gln 65

Ala His Pro Gly Arg 70

Pro Arg Ala Val Pro 75

Gln Cys Asp Val Pro 85

Pro Asn Ser Arg Phe 90

Asp Cys Ala Pro Asp 95

Ala Ile Thr Gln Glu

100

Gln Cys Glu Ala Arg

105

Gly Cys Cys Tyr Ile

110

Ala Lys Gln Gly Leu 115

Gln Gly Ala Gln Met 120

Gly Gln Pro Trp Cys 125

Phe Pro Pro Ser Tyr

130

Pro Ser Tyr Lys Leu 135

Glu Asn Leu Ser Ser

140

Glu Met Gly Tyr Thr 145

Ala Thr Leu Thr Arg 150

Thr Thr Pro Thr Phe 155

Pro Lys Asp Ile Leu

165

Thr Leu Arg Leu Asp

170

Val Met Glu Thr

175

Asn Arg Leu His Phe

180

Thr Ile Lys Asp Pro

185

Ala Asn Arg Arg Tyr

190

Val Pro Leu Glu Thr

195

Pro Arg Val His Ser 200

Arg Ala Pro Ser Pro 205

Tyr Ser Val Glu Phe

210

Ser Glu Glu Pro Phe

215

Gly Val Ile Val His 220

Gln Leu Asp Gly Arg 225

Val Leu Leu Asn Thr 230

Thr Val Ala Pro Leu 235

Phe Ala Asp Gln Phe

245

Leu Gln Leu Ser Thr

250

Ser Leu Pro Ser Gln

255

Ile Thr Gly Leu Ala

260

Glu His Leu Ser Pro

265

Leu Met Leu Ser Thr

270

Val

gly

Thr 80

Lys

Pro

Phe

Ser

Phe 160

Glu

Glu

Leu

Arg

Phe 240

Tyr

Ser

gly

Trp Thr Arg Ile Thr

275

Leu Trp Asn Arg Asp 280

Leu Ala Pro Thr Pro

285

- 65 043083

Ala

Gly 305

Val

Leu

Gln

Leu

Arg 385

Gln

Asn

Gln

Ser

Gly 465

trp

Ala

asp

Ser

Asn Leu Tyr 290

Ser Ala His

Leu Gln Pro

Asp Val Tyr

340

Tyr Leu Asp

355

Gly Phe His 370

Gln Val Val

Trp Asn Asp

Lys Asp Gly

420

Gly Gly Arg

435

Gly Pro Ala 450

Val Phe Ile

Pro Gly Ser

Trp Trp Glu

500

Gly Met Trp

515

Glu Asp Gly 530

Gly Ser His

295

Gly Val Phe

310

Ser Pro Ala 325

Ile Phe Leu

Val Val Gly

Leu Cys Arg

375

Glu Asn Met

390

Leu Asp Tyr 405

Phe Arg Asp

Arg Tyr Met

Gly Ser Tyr

455

Thr Asn Glu

470

Thr Ala Phe 485

Asp Met Val

Ile Asp Met

Cys Pro Asn

535

Pro Phe Tyr

Leu Leu Asn

Leu Ser Trp

330

Gly Pro Glu

345

Tyr Pro Phe 360

Trp Gly Tyr

Thr Arg Ala

Met Asp Ser

410

Phe Pro Ala

425

Met Ile Val 440

Arg Pro Tyr

Thr Gly Gln

Pro Asp Phe

490

Ala Glu Phe

505

Asn Glu Pro 520

Asn Glu Leu

Leu Ala Leu

300

Glu Asp Gly

Ser Asn Ala 315

Met Asp Val

320

Arg Ser Thr

Pro Lys Ser

Met Pro Pro

365

Ser Ser Thr

380

His Phe Pro 395

Arg Arg Asp

Met Val Gln

Asp ProAla

445

Asp Glu Gly

460

Pro Leu Ile 475

Thr Asn Pro

His Asp Gln

Ser Asn Phe

525

Glu Asn Pro

540

Gly Gly Ile

335

Val Val Gln 350

Tyr Trp Gly

Ala Ile Thr

Leu Asp Val

400

Phe Thr Phe

415

Glu Leu His 430

Ile Ser Ser

Leu Arg Arg

Gly Lys Val

480

Thr Ala Leu

495

Val Pro Phe 510

Ile Arg Gly

Pro Tyr Val

- 66 043083

Pro Gly Val Val Gly 545

Gly Thr Leu Gln Ala 550

Ala Thr Ile Cys Ala 555

Ser His Gln Phe Leu

565

Ser Thr His Tyr Asn

570

Leu His Asn Leu Tyr

575

Leu Thr Glu Ala Ile

580

Ala Ser His Arg Ala

585

Leu Val Lys Ala Arg

590

Thr Arg Pro Phe Val

595

Ile Ser Arg Ser Thr 600

Phe Ala Gly His Gly 605

Tyr Ala Gly His Trp 610

Thr Gly Asp Val Trp

615

Ser Ser Trp Glu Gln 620

Ala Ser Ser Val Pro 625

Glu Ile Leu Gln Phe 630

Asn Leu Leu Gly Val 635

Leu Val Gly Ala Asp

645

Val Cys Gly Phe Leu

650

Gly Asn Thr Ser Glu

655

Leu Cys Val Arg Trp

660

Thr Gln Leu Gly Ala

665

Phe Tyr Pro Phe Met

670

Asn His Asn Ser Leu

675

Leu Ser Leu Pro Gln

680

Glu Pro Tyr Ser Phe

685

Glu Pro Ala Gln Gln

690

Ala Met Arg Lys Ala

695

Leu Thr Leu Arg Tyr

700

Leu Leu Pro His Leu 705

Tyr Thr Leu Phe His 710

Gln Ala His Val Ala 715

Glu Thr Val Ala Arg

725

Pro Leu Phe Leu Glu

730

Phe Pro Lys Asp Ser

735

Thr Trp Thr Val Asp

740

His Gln Leu Leu Trp 745

Gly Glu Ala Leu Leu

750

Thr Pro Val Leu Gln

755

Ala Gly Lys Ala Glu

760

Val Thr Gly Tyr Phe

765

Leu Gly Thr Trp Tyr

770

Asp Leu Gln Thr Val 775

Pro Ile Glu Ala Leu

780

Ser Leu Pro Pro Pro

Pro Ala Ala Pro Arg

Glu Pro Ala Ile His

Ser 560

gly

gly

Arg

Leu

Pro 640

Glu

Arg

Ser

Ala

Gly 720

Ser

ile

Pro

gly

Ser

- 67 043083

Leu Asp Thr Ile Asn

815

785

790

795

Glu Gly Gln Trp Val

805

Thr Leu Pro Ala Pro

810

His Leu Arg Ala Gly

820

Tyr Ile Ile Pro Leu

825

Gln Gly Pro Gly Leu

830

Thr Thr Glu Ser Arg

835

Gln Gln Pro Met Ala

840

Leu Ala Val Ala Leu

845

Lys Gly Gly Glu Ala

850

Arg Gly Glu Leu Phe

855

Trp Asp Asp Gly Glu 860

Leu Glu Val Leu Glu 865

Arg Gly Ala Tyr Thr 870

Gln Val Ile Phe Leu 875

Arg Asn Asn Thr Ile

885

Val Asn Glu Leu Val

890

Arg Val Thr Ser Glu

895

Ala Gly Leu Gln Leu

900

Gln Lys Val Thr Val

905

Leu Gly Val Ala Thr

910

Pro Gln Gln Val Leu

915

Ser Asn Gly Val Pro

920

Val Ser Asn Phe Thr

925

Ser Pro Asp Thr Lys 930

Val Leu Asp Ile Cys

935

Val Ser Leu Leu Met

940

800

Val

Thr

Thr

Ser

Ala 880

gly

Ala

Tyr

gly

Glu Gln Phe Leu Val 945

Ser Trp Cys 950 <210>5 <211>952 <212> PROTEIN <213> Homo sapiens <400>5

Met 1 gly Val Arg His 5 Pro Pro Cys Ser His 10 Arg Leu Leu Ala Val 15 Ala Leu Val Ser 20 Leu Ala Thr Ala Ala 25 Leu Leu gly His Ile 30 Leu His asp Phe 35 Leu Leu Val Pro Arg 40 Glu Leu Ser gly Ser 45 Ser Pro Leu Glu Glu Thr His Pro Ala His Gln Gln gly Ala Ser Arg Pro

Cys

Leu

Val

gly

- 68 043083

Arg Ala

ValPro

Pro 65

Gln

Ala

Ala

Phe

Glu 145

Pro

Asn

Val

Tyr

Glin 225

Phe

ile

trp

Ala

Arg Asp

Ala Gln

Cys Asp

Ile Thr

Lys Gln

115

Pro Pro 130

Met Gly

Lys Asp

Arg Leu

ProLeu

195

Ser Val

210

Leu Asp

Ala Asp

Thr Gly

Thr Arg

275

Asn Leu 290

ValPro

Gln Glu 100

Gly Leu

Ser Tyr

Tyr Thr

Ile Leu

165

His Phe 180

Glu Thr

Glu Phe

Gly Arg

Gln Phe

245

Leu Ala

260

Ile Thr

Tyr Gly

Ala His 70

ProAsn

Gln Cys

Gln Gly

Pro Ser

135

Ala Thr 150

Thr Leu

Thr Ile

Pro His

SerGlu

215

Val Leu 230

Leu Gln

Glu His

Leu Trp

Ser His

295

Pro Gly

ArgPro

Ser Arg

Glu Ala

105

AlaGln 120

Tyr Lys

Leu Thr

Arg Leu

Lys Asp

185

Val His 200

GluPro

Leu Asn

Leu Ser

Leu Ser

265

Asn Arg 280

Pro Phe

Phe Asp 90

Cys Ala

Pro Asp

Arg Gly

Met Gly

Leu Glu

Arg Thr

155

Asp Val 170

ProAla

Ser Arg

Phe Gly

Thr Thr

235

Thr Ser

250

ProLeu

Asp Leu

Tyr Leu

Cys Cys

Tyr Ile 110

GlnPro

125

Trp Cys

Asn Leu

140

ThrPro

Met Met

Asn Arg

Ala Pro

205

Val Ile 220

Val Ala

Leu Pro

Met Leu

Ala Pro

285

Ala Leu 300

Ser Ser

Thr Phe

Glu Thr

175

Arg Tyr 190

Ser Pro

Val Arg

ProLeu

SerGln

255

Ser Thr

270

ThrPro

Glu Asp

Thr 80

Lys

Pro

Phe

Ser

Phe 160

Glu

Glu

Leu

Arg

Phe 240

Tyr

Ser

gly

gly

- 69 043083

Gly Ser Ala His Gly 305

Val Phe Leu Leu Asn 310

Ser Asn Ala Met Asp 315

Val Leu Gln Pro Ser

325

Pro Ala Leu Ser Trp

330

Arg Ser Thr Gly Gly

335

Leu Asp Val Tyr Ile

340

Phe Leu Gly Pro Glu

345

Pro Lys Ser Val Val

350

Gln Tyr Leu Asp Val

355

Val Gly Tyr Pro Phe

360

Met Pro Pro Tyr Trp

365

Leu Gly Phe His Leu

370

Cys Arg Trp Gly Tyr

375

Ser Ser Thr Ala Ile

380

Arg Gln Val Val Glu 385

Asn Met Thr Arg Ala 390

His Phe Pro Leu Asp 395

Gln Trp Asn Asp Leu

405

Asp Tyr Met Asp Ser

410

Arg Arg Asp Phe Thr

415

Asn Lys Asp Gly Phe

420

Arg Asp Phe Pro Ala

425

Met Val Gln Glu Leu

430

Gln Gly Gly Arg Arg 435

Tyr Met Met Ile Val

440

Asp Pro Ala Ile Ser 445

Ser Gly Pro Ala Gly

450

Ser Tyr Arg Pro Tyr

455

Asp Glu Gly Leu Arg

460

Gly Val Phe Ile Thr 465

Asn Glu Thr Gly Gln 470

Pro Leu Ile Gly Lys 475

Trp Pro Gly Ser Thr

485

Ala Phe Pro Asp Phe

490

Thr Asn Pro Thr Ala

495

Ala Trp Trp Glu Asp

500

Met Val Ala Glu Phe

505

His Asp Gln Val Pro

510

Asp Gly Met Trp Ile 515

Asp Met Asn Glu Pro 520

Ser Asn Phe Ile Arg

525

Ser Glu Asp Gly Cys

530

Pro Asn Asn Glu Leu

535

Glu Asn Pro Pro Tyr 540

Pro Gly Val Val Gly 545

Gly Thr Leu Gln Ala 550

Ala Thr Ile Cys Ala 555

Val 320

ile

Gln

gly

Thr

Val 400

Phe

His

Ser

Arg

Val 480

Leu

Phe

gly

Val

Ser 560

- 70 043083

Ser

Leu

Thr

Tyr

Ala 625

Leu

Leu

Asn

Glu

Leu 705

Glu

Thr

Thr

Leu

Ser 785

Glu

His Gln Phe

Thr Glu Ala

580

Arg Pro Phe

595

Ala Gly His 610

Ser Ser Val

Val Gly Ala

Cys Val Arg

660

His Asn Ser

675

Pro Ala Gln 690

Leu Pro His

Thr Val Ala

Trp Thr Val

740

Pro Val Leu

755

Gly Thr Trp 770

Leu Pro Pro

Gly Gln Trp

Leu Ser Thr 565

Ile Ala Ser

Val Ile Ser

Trp Thr Gly

615

Pro Glu Ile

630

Asp Val Cys 645

Trp Thr Gln

Leu Leu Ser

Gln Ala Met

695

Leu Tyr Thr

710

Arg Pro Leu 725

Asp His Gln

Gln Ala Gly

Tyr Asp Leu

775

Pro Pro Ala

790

Val Thr Leu 805

His Tyr Asn

570

His Arg Ala

585

Arg Ser Thr 600

Asp Val Trp

Leu Gln Phe

Gly Phe Leu

650

Leu Gly Ala

665

Leu ProGln 680

Arg Lys Ala

Leu Phe His

Phe Leu Glu

730

Leu Leu Trp

745

Lys Ala Glu 760

Gln Thr Val

Ala Pro Arg

Pro Ala Pro

810

Leu His Asn

Leu Val Lys

Phe Ala Gly

605

Ser Ser Trp 620

Asn Leu Leu 635

Gly Asn Thr

Phe Tyr Pro

Glu Pro Tyr

685

Leu Thr Leu

700

Gln Ala His 715

Phe Pro Lys

Gly Glu Ala

Val Thr Gly

765

Pro ValGlu

780

Glu Pro Ala 795

Leu AspThr

Leu Tyr Gly

575

Ala Arg Gly 590

His Gly Arg

Glu Gln Leu

Gly Val Pro

640

Ser Glu Glu

655

Phe Met Arg 670

Ser Phe Ser

Arg Tyr Ala

Val Ala Gly

720

Asp Ser Ser

735

Leu Leu Ile 750

Tyr Phe Pro

Ala Leu Gly

Ile His Ser

800

Ile Asn Val

815

- 71 043083

His Leu Arg Ala Gly

820

Tyr Ile Ile Pro Leu

825

Gln Gly Pro Gly Leu

830

Thr Thr Glu Ser Arg

835

Gln Gln Pro Met Ala

840

Leu Ala Val Ala Leu

845

Lys Gly Gly Glu Ala

850

Arg Gly Glu Leu Phe

855

Trp Asp Asp Gly Glu 860

Leu Glu Val Leu Glu 865

Arg Gly Ala Tyr Thr 870

Gln Val Ile Phe Leu 875

Arg Asn Asn Thr Ile

885

Val Asn Glu Leu Val

890

Arg Val Thr Ser Glu

895

Ala Gly Leu Gln Leu

900

Gln Lys Val Thr Val

905

Leu Gly Val Ala Thr

910

Pro Gln Gln Val Leu

915

Ser Asn Gly Val Pro

920

Val Ser Asn Phe Thr

925

Ser Pro Asp Thr Lys 930

Val Leu Asp Ile Cys

935

Val Ser Leu Leu Met

940

Thr

Thr

Ser

Ala 880

gly

Ala

Tyr

gly

Glu Gln Phe Leu Val 945

Ser Trp Cys 950 <210>6 <211>896 <212> PROTEIN <213> Homo sapiens <400>6

Gln Gln Gly Ala Ser 15

Arg Pro Gly Pro Arg

Asp Ala Gln Ala His 15

Gly Arg Pro Arg Ala

Val Pro Thr Gln Cys

Asp Val Pro Pro Asn

Arg Phe Asp Cys Ala 35

Pro Asp Lys Ala Ile 40

Thr Gln Glu Gln Cys 45

Ala Arg Gly Cys Cys 50

Tyr Ile Pro Ala Lys 55

Gln Gly Leu Gln Gly 60

Gln Met Gly Gln Pro 65

Trp Cys Phe Phe Pro 70

Pro Ser Tyr Pro Ser 75

Pro

Ser

Glu

Ala

Tyr 80

- 72 043083

Lys Leu Glu Asn Leu 85

Ser Ser Ser Glu Met

Gly Tyr Thr Ala Thr 95

Thr Arg Thr Thr Pro

100

Thr Phe Phe Pro Lys

105

Asp Ile Leu Thr Leu

110

Leu Asp Val Met Met 115

Glu Thr Glu Asn Arg 120

Leu His Phe Thr Ile

125

Asp Pro Ala Asn Arg

130

Arg Tyr Glu Val Pro

135

Leu Glu Thr Pro Arg

140

His Ser Arg Ala Pro 145

Ser Pro Leu Tyr Ser 150

Val Glu Phe Ser Glu 155

Pro Phe Gly Val Ile

165

Val His Arg Gln Leu

170

Asp Gly Arg Val Leu

175

Asn Thr Thr Val Ala

180

Pro Leu Phe Phe Ala

185

Asp Gln Phe Leu Gln

190

Ser Thr Ser Leu Pro

195

Ser Gln Tyr Ile Thr 200

Gly Leu Ala Glu His

205

Ser Pro Leu Met Leu

210

Ser Thr Ser Trp Thr

215

Arg Ile Thr Leu Trp 220

Arg Asp Leu Ala Pro 225

Thr Pro Gly Ala Asn 230

Leu Tyr Gly Ser His 235

Phe Tyr Leu Ala Leu

245

Glu Asp Gly Gly Ser

250

Ala His Gly Val Phe

255

Leu Asn Ser Asn Ala

260

Met Asp Val Val Leu

265

Gln Pro Ser Pro Ala

270

Ser Trp Arg Ser Thr

275

Gly Gly Ile Leu Asp 280

Val Tyr Ile Phe Leu

285

Pro Glu Pro Lys Ser 290

Val Val Gln Gln Tyr

295

Leu Asp Val Val Gly

300

Pro Phe Met Pro Pro 305

Tyr Trp Gly Leu Gly 310

Phe His Leu Cys Arg 315

Gly Tyr Ser Ser Thr

Ala Ile Thr Arg Gln

Val Val Glu Asn Met

Leu

Arg

Lys

Val

Glu 160

Leu

Leu

Leu

Asn

Pro 240

Leu

Leu

gly

Tyr

TRP 320

Thr

- 73 043083

Asn Asp Leu Asp Tyr

350

325

330

335

Arg Ala His Phe Pro

340

Leu Asp Val Gln Trp

345

Asp Ser Arg Arg Asp 355

Phe Thr Phe Asn Lys 360

Asp Gly Phe Arg Asp 365

Pro Ala Met Val Gln

370

Glu Leu His Gln Gly

375

Gly Arg Arg Tyr Met

380

Ile Val Asp Pro Ala 385

Ile Ser Ser Ser Gly 390

Pro Ala Gly Ser Tyr 395

Pro Tyr Asp Glu Gly

405

Leu Arg Arg Gly Val

410

Phe Ile Thr Asn Glu

415

Gly Gln Pro Leu Ile

420

Gly Lys Val Trp Pro

425

Gly Ser Thr Ala Phe

430

Asp Phe Thr Asn Pro 435

Thr Ala Leu Ala Trp 440

Trp Glu Asp Met Val 445

Glu Phe His Asp Gln 450

Val Pro Phe Asp Gly

455

Met Trp Ile Asp Met 460

Glu Pro Ser Asn Phe 465

Ile Arg Gly Ser Glu 470

Asp Gly Cys Pro Asn 475

Glu Leu Glu Asn Pro

485

Pro Tyr Val Pro Gly

490

Val Val Gly Gly Thr

495

Gln Ala Ala Thr Ile

500

Cys Ala Ser Ser His

505

Gln Phe Leu Ser Thr

510

Tyr Asn Leu His Asn 515

Leu Tyr Gly Leu Thr 520

Glu Ala Ile Ala Ser

525

Arg Ala Leu Val Lys

530

Ala Arg Gly Thr Arg

535

Pro Phe Val Ile Ser

540

Ser Thr Phe Ala Gly 545

His Gly Arg Tyr Ala 550

Gly His Trp Thr Gly 555

Val Trp Ser Ser Trp

565

Glu Gln Leu Ala Ser

570

Ser Val Pro Glu Ile

575

Met

Phe

Met

Arg 400

Thr

Pro

Ala

Asn

Asn 480

Leu

His

His

Arg

Asp 560

Leu

- 74 043083

Gln Phe Asn Leu 580 Leu gly Val Pro Leu 585 Val gly Ala asp Val 590 Cys gly Phe Leu Gly 595 Asn Thr Ser Glu Glu 600 Leu Cys Val Arg TRP 605 Thr Gln Leu gly Ala 610 Phe Tyr Pro Phe Met 615 Arg Asn His Asn Ser 620 Leu Leu Ser Leu Pro 625 Gln Glu Pro Tyr Ser 630 Phe Ser Glu Pro Ala 635 Gln Gln Ala Met Arg 640 Lys Ala Leu Thr Leu 645 Arg Tyr Ala Leu Leu 650 Pro His Leu Tyr Thr 655 Leu Phe His Gln Ala 660 His Val Ala gly Glu 665 Thr Val Ala Arg Pro 670 Leu Phe Leu Glu Phe 675 Pro Lys asp Ser Ser 680 Thr trp Thr Val asp 685 His Gln Leu Leu Trp 690 gly Glu Ala Leu Leu 695 ile Thr Pro Val Leu 700 Gln Ala gly Lys Ala 705 Glu Val Thr gly Tyr 710 Phe Pro Leu gly Thr 715 trp Tyr asp Leu Gln 720 Thr Val Pro ile Glu 725 Ala Leu gly Ser Leu 730 Pro Pro Pro Pro Ala 735 Ala Pro Arg Glu Pro 740 Ala ile His Ser Glu 745 gly Gln trp Val Thr 750 Leu Pro Ala Pro Leu 755 asp Thr ile Asn Val 760 His Leu Arg Ala Gly 765 Tyr ile ile Pro Leu 770 Gln gly Pro gly Leu 775 Thr Thr Thr Glu Ser 780 Arg Gln Gln Pro Met 785 Ala Leu Ala Val Ala 790 Leu Thr Lys gly Gly 795 Glu Ala Arg gly Glu 800 Leu Phe trp asp asp 805 gly Glu Ser Leu Glu 810 Val Leu Glu Arg Gly 815 Ala Tyr Thr Gln Val 820 ile Phe Leu Ala Arg 825 Asn Asn Thr ile Val 830 Asn Glu

- 75 043083

Leu Val Arg Val Thr Ser Glu Gly Ala Gly Leu Gln Leu Gln Lys Val 835 840845

Thr Val Leu Gly Val Ala Thr Ala Pro Gln Gln Val Leu Ser Asn Gly 850 855860

Val Pro Val Ser Asn Phe Thr Tyr Ser Pro Asp Thr Lys Val LeuAsp

865 870 875880

Ile Cys Val Ser Leu Leu Met Gly Glu Gln Phe Leu Val Ser TrpCys

885 890895

Claims (17)

1. A method of treating Pompe disease in a patient in need thereof, comprising administering to the patient a first composition containing recombinant human recombinant acid α-glucosidase (rhGAA) molecules and a second composition containing miglustat, wherein the first composition is administered intravenously at a dose of 5 to 20 mg/kg, and the second composition is administered orally at a dose of 260 or 130 mg; and wherein the rhGAA molecules are derived from Chinese Hamster Ovary (CHO) cells, the rhGAA molecules contain seven potential N-glycosylation sites at the following positions of SEQ ID NO: 5: N84, N177, N334, N414, N596, N826 and N869, 40-60% The N-glycans in rhGAA molecules are complex-type N-glycans, and at least 50% of rhGAA molecules have a bis-mannose-6-phosphate (6c-M6P) unit at the first potential N-glycosylation site. 2. The method of claim 1, wherein the rhGAA molecules contain a sequence at least 95% identical to SEQ ID NO: 5. 3. The method of claim 1, wherein the rhGAA molecules are expressed as having: (i) a sequence at least 95% identical to SEQ ID NO: 4; or (ii) the sequence of SEQ ID NO: 4, where the rhGAA molecules undergo post-translational modification, which removes the first 56 amino acids. 4. The method according to any one of claims 1 to 3, wherein at least 55% of the rhGAA molecules have a 6c-M6P link at the first potential N-glycosylation site. 5. The method of any one of claims 1-4, wherein at least 70% of the rhGAA molecules are phosphorylated at the first potential N-glycosylation site. 6. The method of any one of claims 1-5, wherein at least 40% of the rhGAA molecules have a monomannose-6-phosphate (mono-M6P) unit at the second potential N-glycosylation site. 7. The method according to any one of claims 1 to 6, wherein at least 40% of the rhGAA molecules have a 6c-M6P link at the fourth potential N-glycosylation site. 8. The method according to any one of claims 1 to 7, wherein at least 25% of the rhGAA molecules have a mono-M6P unit at the fourth potential N-glycosylation site. 9. The method according to any one of claims 1 to 8, wherein up to 60% of the N-glycans in the rhGAA molecules are fully sialylated. 10. The method of claim 9, wherein 4 to 20% of the N-glycans in the rhGAA molecules are fully sialylated. 11. The method of claim 9 or 10, wherein at least 20% of the rhGAA molecules have sialic acid at the third potential N-glycosylation site. 12. The method of any one of claims 9-11, wherein at least 70% of the rhGAA molecules have sialic acid at the fifth potential N-glycosylation site. 13. The method of any one of claims 9-12, wherein at least 80% of the rhGAA molecules have sialic acid at the sixth potential N-glycosylation site. 14. The method according to any one of claims 1-3, where: (a) at least 40% of the rhGAA molecules have a mono-M6P unit at a second potential N-glycosylation site; (b) at least 20% of the rhGAA molecules have sialic acid at a third potential N-glycosylation site; (c) at least 40% of the rhGAA molecules have a 6c-M6P unit at the fourth potential N-glycosylation site; (d) at least 25% of rhGAA molecules have a mono-M6P unit at the fourth potential site - 76 043083 N-glycosylation and (e) at least 70% of rhGAA molecules have sialic acid at the fifth potential site N-glycosylation. 15. The method of claim 14, wherein at least 80% of the rhGAA molecules have sialic acid at the sixth potential N-glycosylation site, and wherein 4 to 20% of the N-glycans in the rhGAA molecules are fully sialylated. 16. The method according to claim 14 or 15, wherein at least 55% of the rhGAA molecules have a 6c-M6P link at the first potential N-glycosylation site. 17. The method of any one of claims 1-16, wherein the first composition is administered over about 4 hours.