EA041932B1 - MONOCLONAL ANTIBODIES WHICH SPECIFICALLY BIND TO THE BETA CHAIN OF THE TRBV-9 FAMILY OF THE HUMAN T-CELL RECEPTOR, AND METHODS OF THEIR APPLICATION - Google Patents

Description

Technical field

The invention relates to the field of biotechnology and biomedicine, namely to antibodies or their antigen-binding fragments, as well as their use. More specifically, the present invention relates to a humanized monoclonal antibody that specifically binds to the human T-cell receptor family. The invention also relates to a nucleic acid encoding a given antibody or an antigen-binding fragment thereof, an expression vector, a method for producing the antibody, and the use of the antibody for the treatment of diseases or disorders associated with the human T cell receptor family.

Prior Art

Autoimmune diseases are caused by autoreactive T lymphocytes (Haroon N et al., Arthritis Rheum. 2013 Oct; 65(10): 2645-54., Duarte J. et al., PloS One 2010 May 10; 5(5): e10558 ; Konig M. et al., Front Immunol 2016 Jan 25; 7: 11). It is known from the prior art that the T-cell receptor (TCR) sequence is a marker for identifying a T-lymphocyte clone involved in the pathogenesis of an autoimmune disease. Subunits of T-cell receptors are structurally related to the immunoglobulin superfamily and are formed from several gene segments. The variable regions of the TCR form the antigen-binding center of the TCR. This means that they are clone-specific, i.e. differ in T-lymphocytes that react to different antigens.

According to the amino acid homology of the variable (V) gene segments that make up the TCR variable domain, T-cell receptors are divided into different families. According to the IMGT nomenclature, there are 26 different families for the beta chain and 41 families for the alpha chain (Turner SJ et al., Nature Reviews Immunology 2006, V.6, 883-894). To determine the TCR chain family, a multiple alignment of the tested amino acid sequence with known TCR chain sequences is used, information about which is summarized in the IMGT database (The international ImMunoGeneTics information system, Lefranc M-P., Nucl Acids Res 2001; 29: 207-209), available at the Internet at http://www.imgt.org. Multiple alignment and TCR chain family determination can be performed using the IgBlast software package.

Described are monoclonal antibodies W112 and 2D1 to regions of the beta chain of the human T receptor variable domains belonging to the TRBV5-3 TRBV8-1 families (WO9006758), proposed as a tool for the diagnosis and therapy of rheumatoid arthritis. These monoclonal antibodies recognize, respectively, 0.3-5% of peripheral T lymphocytes carrying TRBV5-3 and 0.5-13% of peripheral T lymphocytes carrying TRBV8-1. The basis for the use of monoclonal antibodies specific to the regions of beta chains of T-receptors was the results of many studies demonstrating the involvement of T-lymphocytes in the pathogenesis of rheumatoid arthritis. In particular, these articles by F.M. Brennan et al., Clin Exp Immunol. 1988 Sep; 73(3): 417-423, which demonstrated an increase in the percentage of TRBV5-carrying TRBV8 T lymphocytes in synovial samples from patients suffering from rheumatoid arthritis compared to healthy donors. Also, for the diagnosis and therapy of rheumatoid arthritis, monoclonal antibodies are described that interact with the epitope of the VB3.1 variable region of the human T-cell receptor (WO9405801), which interact with the TCR V (beta)3.1 subfamily.

Also described are monoclonal antibodies that specifically recognize the beta chain of the 13th rat TRK family. It has been shown in animal models that these antibodies can preventively remove a small population of T cells whose T receptor contains the VB13 beta chain (VB13+ T cells), and this procedure has been shown to protect against the development of type I diabetes in predisposed rats. this disease line, and also significantly reduces the risk of developing virus-induced diabetes (Zhijun Liu et al., Diabetes. 2012 May; 61(5): 1160-1168.). At the same time, the removal of T cells whose T receptor contains a different beta chain family (VB16) did not differ in outcome from the control groups. It is important to note that even the first administration of a monoclonal antibody against VB13 leads to a 60% decrease in the number of VB13+ T cells in the spleen of rats.

A consensus variant of autoimmune TCCs in ankylosing spondylitis (AS or Bechterew's disease) is described, it is shown that it is present in the synovial fluid and peripheral blood in patients with AS and is absent at the same depth of analysis in healthy donors, regardless of the status of the HLA*B27 allele (Faham M et al., Arthritis Rheumatol 2017; 69(4):774-784; Komech E et al. 12th EJI-EFIS Tatra Immunology Conference; 2016 Sep 3-7; Strbske Pleso, Slovakia Abstract book p. 39). These TCRs belong to the TRBV9 family (according to the IMGT nomenclature). It has been shown that T-cell receptors carrying beta chains of the TRBV9 family are also involved in the development of such an autoimmune disease as celiac disease (Petersen J et al., J Immunol. 2015; 194(12): 6112-22). They are also found on the surface of T cells susceptible to magnification in T-cell lymphomas and T-cell leukemias, including Epstein-Barr virus (EBV) T-cell lymphoma (Toyabe S et al., Clin Exp Immunol. 2003; 134(1): 92-97).

Recently, chimeric monoclonal antibodies have been described that have the ability to specifically bind to the beta chain region of the TRBV9 family of the human T receptor, which can be used in the treatment of autoimmune and oncological diseases, the pathogenesis of which involves TCR belonging to the TRBV9 family, for example, AC, celiac disease and some T-cell lymphomas and T-cell leukemias (application for the invention of the Russian Federation 2017145662).

These antibodies are the only antibodies known today that can be used to eliminate T cells carrying TCRs from the TRBV9 family. The main disadvantage of these antibodies is their relatively low degree of humanization - they contain human-specific constant regions and structural components, but have a rat-specific variable domain. The degree of humanization of the variable fragment of the heavy chain of these antibodies is 72%, and the variable fragment of the light chain - 69%.

The above parental monoclonal antibody includes:

1) their heavy chain variable domain (VH), which contains 3 hypervariable regions HCDR1, HCDR2 and HCDR3, where

HCDR1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1,

HCDR2 has the amino acid sequence of SEQ ID NO: 2 HCDR3 has the amino acid sequence of SEQ ID NO: 3;

2) their light chain variable domain (VL), which contains 3 hypervariable regions LCDR1, LCDR2 and LCDR3, in which:

LCDR1 has the amino acid sequence of SEQ ID NO: 4, LCDR2 has the amino acid sequence of SEQ ID NO: 5, LCDR3 has the amino acid sequence of SEQ ID NO: 6.

The above parental monoclonal antibody includes heavy and light chain variable domains that have the amino acid sequences shown in SEQ ID NOS: 8 and 10.

The above parental monoclonal antibody comprises a light chain which has the amino acid sequence shown in SEQ ID NO: 12 and an antibody heavy chain which has the amino acid sequence shown in SEQ ID NO: 14.

Examples of nucleotide sequences encoding the indicated amino acid sequences of the heavy and light chains of the above parent antibody are shown in SEQ ID NOs: 13 and 11.

The invention is directed to the creation of a monoclonal antibody that can be used to eliminate T cells carrying TCRs of the TRBV9 family, in particular, for the treatment of AS, celiac disease and malignant blood diseases, in the pathogenesis of which TCRs of the TRBV9 family are involved, and which is characterized by a high degree of humanization. Humanization at the same time often leads to a critical decrease in the affinity and/or solubility of antibodies. Thus, obtaining humanized functional antibodies is an urgent task.

Brief description of the invention

The present invention relates to a humanized monoclonal antibody and antigen-binding fragment thereof, which have the ability to specifically bind with high affinity to the region of the beta chain of the TRBV9 family of the human T receptor. The antibody according to the invention can be used as a drug for the treatment of autoimmune and oncological diseases, the pathogenesis of which involves TCR belonging to the TRBV9 family, for example, AS, celiac disease and some T-cell lymphomas and T-cell leukemias.

In preferred embodiments, an antibody of the present invention comprises a heavy chain variable domain (VH) with three hypervariable regions:

1) HCDR 1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1,

2) HCDR 2 has the amino acid sequence of SEQ ID NO: 2

3) HCDR 3 has the amino acid sequence of SEQ ID NO: 3;

2) light chain variable domain (VL) with three hypervariable regions LCDR1, LCDR2 and LCDR3, in which:

LCDR 1 has the amino acid sequence of SEQ ID NO: 4,

LCDR 2 has the amino acid sequence of SEQ ID NO: 5,

LCDR 3 has the amino acid sequence of SEQ ID NO: 6.

Hereinafter, when determining the CDR of antibodies, the known nomenclature of Kabat is used, unless otherwise specified.

At the same time, the variable domains of the heavy and light chains of the antibody contain amino acid substitutions in the FR fragments of the variable domains of the heavy and light chains, which increase the degree of humanization of the antibody compared to the parent antibody.

In some embodiments, the heavy chain variable domain of an antibody of the present invention contains at least 10 humanizing amino acid substitutions compared to the heavy chain variable domain of the parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 8.

In preferred embodiments, the heavy chain variable domain of an antibody of the present invention has the sequence shown in SEQ ID NO: 16.

- 2 041932

In some embodiments, the heavy chain variable domain of an antibody of the present invention contains additional amino acid substitutions that do not affect the specificity of the antibody.

In some embodiments, the light chain variable domain of an antibody of the present invention contains at least 10 humanizing amino acid substitutions compared to the light chain variable domain of the parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 10.

In preferred embodiments, the light chain variable domain of an antibody of the present invention has the sequence shown in SEQ ID NO: 18.

In some embodiments, the light chain variable domain of an antibody of the present invention contains additional amino acid substitutions that do not affect the specificity of the antibody.

In some embodiments, the monoclonal antibodies of the invention are full-length human IgG antibodies, such as IgG1 or IgG2 or IgG3 or IgG4.

In some embodiments, an antibody of the invention comprises a heavy chain whose amino acid sequence is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least 91% identical. at least 92% or at least 93% identical or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.

In some embodiments, an antibody of the invention comprises a light chain whose amino acid sequence is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least 91% identical. at least 92%, or at least 93% identical, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98 % or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.

In some embodiments, the antibody has a light chain, the amino acid sequence of which is shown in SEQ ID NO: 22, and a heavy chain, the amino acid sequence of which is shown in SEQ ID NO: 20.

Also provided are nucleic acids that encode the heavy and light chain variable domains of an antibody of the invention, nucleic acids that encode the heavy and light chains of antibodies of the invention, and functional antibody fragments.

Also provided are expression cassettes and expression vectors comprising the nucleic acid of the present invention and the regulatory elements necessary for the expression of the nucleic acid in the selected host cell. The expression vector or cassette can be present in the host cell as an extrachromosomal element or integrated into the cell's genome by introducing (by transfection) said expression cassette or vector into the cell.

In addition, cells and stable cell lines comprising the nucleic acids, vectors or expression cassettes of the present invention, and methods for producing the same are provided.

Also provided is a method for producing the above antibody or its antigen-binding fragment, which consists in culturing the above host cell in a culture medium under conditions that ensure the production of the specified antibody. In some embodiments, the method includes subsequent isolation and purification of the resulting antibody.

Also provided is a pharmaceutical composition for the prevention or treatment of a disease or disorder mediated by the beta chain portion of the TRBV9 family of the human T receptor, comprising the above antibody or antigen-binding fragment thereof, in combination with one or more pharmaceutically acceptable excipients.

In one embodiment, the pharmaceutical composition is intended for the prevention or treatment of a disease or disorder selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.

Also provided is a pharmaceutical combination for the prevention or treatment of a disease or disorder mediated by a human T-cell receptor carrying a beta chain of the TRBV9 family, comprising the above antibody or antigen-binding fragment and at least one other therapeutically active compound.

In one embodiment, the pharmaceutical combination is for the prevention or treatment of a disease or disorder selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.

In one embodiment, the pharmaceutical combination or composition includes another therapeutically active compound selected from a small molecule, an antibody, or steroid hormones, such as corticosteroids.

Also provided is a method for inhibiting the biological activity of a T cell receptor whose beta chain belongs to the TRBV9 family in a subject in need of such inhibition, comprising administering to the subject an effective amount of the above antibody or antigen-binding fragment thereof.

- 3 041932

Also provided is a method for treating a disease or disorder mediated by a human T-cell receptor carrying a beta chain of the TRBV9 family, comprising administering to a subject in need of such treatment, the above antibody or antigen-binding fragment or the above pharmaceutical composition, in a therapeutically effective amount.

In one embodiment of the method for treating a disease or disorder, the disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.

Also provided is the use of the above antibody, or an antigen-binding fragment thereof, or the above pharmaceutical composition, for the treatment, in a subject in need of such treatment, of a disease or disorder mediated by the human T-cell receptor carrying the beta chain of the TRBV9 family.

In one application, the disease is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.

The technical result of the present invention is to obtain antibodies with a high degree of humanization that specifically bind with high affinity to TCR, the beta chain of which belongs to the TRBV9 family and can be used to treat autoimmune and oncological diseases, the pathogenesis of which involves TCR, the beta chain of which belongs to to the TRBV9 family.

In preferred embodiments, the antibody heavy chain variable fragment is characterized by a degree of humanization of 87%. In preferred embodiments, the antibody light chain variable fragment is characterized by a degree of humanization of 85%.

Brief description of the figures

Fig. 1 shows the result of sorting T lymphocytes with the MA-042 antibody.

Fig. 2 shows the result of flow cytometry of T lymphocytes after testing for cytotoxic activity in the presence of the MA-042 antibody at a concentration of 1 ng/ml (right) and 1 μg/ml (left). The rectangle shows the population of CD45+, CD3+, TRBV9+.

Fig. 3 shows a plot of T cell death versus MA042 concentration to determine the semi-effective concentration of MA-042 (EC ₅₀ ) in a cytotoxic test.

Detailed description of the invention

The present invention relates to isolated monoclonal antibodies and their functional fragments, which have the ability to specifically bind to the region of the beta chain of the TRBV9 family of the human T receptor with an increased degree of humanization relative to analogues. Also provided are nucleic acids encoding antibodies and fragments thereof of the invention, expression cassettes, and expression vectors comprising the nucleic acid of the invention and the regulatory elements necessary for expression of the nucleic acid in a selected host cell. In addition, cells and stable cell lines are provided that include the nucleic acids, vectors, or expression cassettes of the present invention. Also provided are a method for producing a monoclonal antibody or a functional fragment thereof, a pharmaceutical composition and a pharmaceutical combination containing an antibody of the present invention in an effective amount in combination with one or more pharmaceutically acceptable excipients, diluents or carriers, and methods for diagnosing and treating AS and other diseases using antibodies. of the present invention.

Definitions.

For the purpose of easier understanding of the invention, some terms are first defined.

It should be understood that the materials and methods provided herein are not limited to specific compositions or method steps, as they may vary. It is indicated that, as used in this specification and the appended claims, the singular forms include the corresponding plural forms, unless the context clearly dictates otherwise.

The T cell receptor, also referred to as the TRK, T receptor or human TCR, is a heterodimeric protein complex located on the surface of the T lymphocyte. The receptor is present only on T-lymphocytes. The main function of TCR is the specific recognition of processed antigens associated with major histocompatibility complex (HLA) molecules.

Human TCR consists of two subunits, α and β, or γ and δ chains, linked by a disulfide bond and anchored in the cell membrane. Each of the TCR chains has an N-terminal variable (V) domain, a junction domain, and a constant (C) domain connected to a transmembrane domain that anchors the receptor in the T-lymphocyte plasma membrane. The length of the constant domain of the alpha and beta chains is 91 and 129 amino acid residues, respectively. The length of the connecting and transmembrane domain of the alpha chain is 30 and 17 amino acid residues (a.a.), while the length of the beta chain is 21 and 22 a.a. The length of the variable domains of T receptors varies from 104 to 125 a.a.

A small fraction of T-lymphocytes has T-receptors of the γ/δ type. According to their structure, they

- 4 041932 are similar to α/β receptors, but differ in primary structure and have a number of functional features. Their variability is much lower (limited clone specificity), they recognize antigens in combination with non-classical (non-MHC) antigen-presenting molecules or even free antigens.

The T receptor interacts with the MHC-antigen complex through six complementarity determining regions (CDRs): three alpha chain regions and three beta chain regions. These CDRs are hypervariable regions, loops of the T-cell receptor variable domains - Valfa and Vbeta.

The terms TRBV9 or the TRBV9 family refer to the ninth family of T-cell receptor beta chains, defined according to the IMGT nomenclature, which is characterized in that the amino acid sequence of their variable domain includes the unique motifs CDR1 (amino acid sequence - S-G-D-L-S) and CDR2 (amino acid sequence - Y-Y-N-G-E-E) . The term TCR of the TRBV9 family refers to a T-cell receptor whose beta chain belongs to the TRBV9 family.

The term pathological in relation to T-lymphocytes or TCR means that a given TCR, or a T-lymphocyte carrying it, is associated with a disease or pathology and/or is the cause of the disease and/or contributes to the development of the disease.

The term autoimmune in relation to TCR means that this TCR is involved in the development of an autoimmune disease.

The term antibody as used herein is intended to refer to an immunoglobulin molecule consisting of four polypeptide chains (two heavy (H) chains and two light (L) chains) linked by disulfide bonds. Light chains are classified as kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon and define the isotype of an antibody, such as IgG, IgM, IgA, IgD, and IgE, respectively, and several of these can be further divided into subclasses (isotypes), such as IgG1 , IgG2, IgG3, IgG4, IgA1 and IgA2. Each type of heavy chain is characterized by a particular constant region.

Each heavy chain contains a heavy chain variable region (abbreviated here as HCVR or VH) and a heavy chain constant region. The heavy chain constant region contains three domains CH1, CH2 and CH3. Each light chain contains a light chain variable region (abbreviated here as LCVR or VL) and a light chain constant region. The light chain constant region contains one CL domain. The VH and VL regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDRs), surrounded by regions that are more conserved, called skeletal regions (FRs). Each of VH and VL consists of three CDRs and four FR regions, arranged from amino to carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

In this application, the 3 heavy chain CDRs are referred to as HCDR1, HCDR2, and HCDR3, and the 3 light chain CDRs are referred to as LCDR1, LCDR2, and LCDR3. CDRs contain most of the residues that form specific interactions with the antigen. The numbering and positioning of the CDR amino acid residues within the HCVR and LCVR regions of the antibodies of this invention is done with the well-known Kabat nomenclature, unless otherwise indicated. This application uses, unless otherwise indicated, conventional letter designations for amino acids.

The terms anti-TRBV9 antibody, anti-TRBV9 antibody, antibody specifically binding to the beta chain of the TRBV9 family, or anti-beta chain antibody of the TRBV9 family and the like are used interchangeably in the context of this application and refer to an antibody that specifically binds to an epitope of the beta chain of the TRBV9 family human T-cell receptor.

In addition, the monoclonal antibody as used herein may be a single chain Fv fragment, which may be obtained by linking the DNA encoding LCVR and HCVR to a linker sequence (see Pluckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315, 1994). Regardless of whether fragments or portions are indicated, the term antibody, as used in this application, is intended to include such fragments or portions as well as single chain forms. As long as a protein retains the ability to specifically or preferentially bind to its target (eg, an epitope or antigen), it is referred to as an antibody. Antibodies may or may not be glycosylated and are within the scope of the invention.

The terms antibody and monoclonal antibody for the purposes of this application refer to the anti-TCR monoclonal antibody of the TRBV9 family. As used herein, a monoclonal antibody refers to a rodent, primate, or Camelidae antibody, preferably a mouse, macaque, camel, or llama antibody, a chimeric antibody, a humanized antibody, or a fully human antibody, unless otherwise indicated.

A monoclonal antibody population refers to a homogeneous or substantially homogeneous antibody population (i.e., at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, more preferably at least about 97% or 98% or even more preferably, at least 99% of the antibodies in the population will compete in the ELISA assay for the same antigen or epitope, or more

- 5 041932 preferably the antibodies are identical in amino acid sequence). Antibodies may or may not be glycosylated and still fall within the scope of the invention.

Monoclonal antibodies may be homogeneous if they have an identical amino acid sequence, although they may differ in post-translational modification, such as the pattern of glycolysis.

The variable regions of each of the light/heavy chain pairs form the antigen-binding sites of the antibody. As used herein, an antigen-binding portion, or an antigen-binding site, or an antigen-binding domain, or an antigen-binding center refer, interchangeably, to that portion of an antibody molecule that contains amino acid residues that interact with the antigen and confer on the antibody its specificity and affinity for the antigen. This portion of the antibody includes the framework amino acid residues necessary to maintain the proper conformation of the antigen-binding residues.

The term human antibody as used herein means an antibody in which the variable and constant domain sequences are derived from human sequences. Human antibodies of the invention may include non-human amino acid residues (eg, mutations introduced by non-targeted or site-directed mutagenesis in vitro or somatic mutation in vivo), for example, in CDRs and especially in CDR3.

The term humanized in relation to antibodies is used to refer to antibodies that are characterized by the presence of human constant regions and structural components, but have complementarity determining regions (CDRs) that are characteristic of immunoglobulins of other origin or corresponding fragments of modified antibodies.

The parent antibody in this application is an antibody encoded by the amino acid sequence that is used to obtain the variant. The parent antibody may be from a rodent, llama, chimeric, humanized or human antibody.

The term degree of humanization with respect to antibodies is used to denote the percentage sequence identity of a humanized antibody framework relative to the primary human acceptor framework that was used to generate the humanized antibody and is available from the human library. Preferably, the antibody of the invention contains a framework region with an identity of at least 80%, usually at least 82%, more often at least 83%, for example, at least 84%, or at least 85%, or at least 86%, or at least 87% identity with respect to the framework plot obtained from the human library.

The term humanizing substitutions refers to amino acid substitutions that increase the degree of humanization of an antibody or fragment thereof.

The term chimeric in relation to antibodies of the present invention is used to refer to antibodies that are characterized by the presence of human constant regions, but have variable domains of a different origin. In such antibodies, light and/or heavy chain variable domains of non-human origin (eg, taken from rats) are operably linked to the constant domains of the corresponding human chains.

The term operably linked or similar when describing antibodies refers to polypeptide sequences that are in physical (covalent unless otherwise indicated) and functional relationship with one another. In the most preferred embodiments, the functions of the polypeptide components of the chimeric molecule are not altered compared to the functional properties of the isolated polypeptide components. The term operatively linked or similar when describing nucleic acids means that nucleic acids are covalently linked in such a way that there are no frame breaks and stop codons at their junctions. As is obvious to any person skilled in the art, nucleotide sequences encoding a chimeric protein, including operably linked components (proteins, polypeptides, linker sequences, protein domains, etc.), consist of fragments encoding these components, where these fragments are covalently linked in such a way that during translation and transcription of the nucleotide sequence, a full length chimeric protein is produced, for example a chimeric antibody of the invention.

As used here, the terms isolated and isolated mean a molecule or cell that is in an environment different from the environment in which the molecule or cell is in natural conditions.

In preferred embodiments, the antibodies of the present invention are recombinant, that is, produced using recombinant DNA techniques.

The term recombinant antibody as used herein includes all antibodies that are made, expressed, generated or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector introduced into a host cell, antibodies isolated from a set of known recombinant combinatorial human antibodies, antibodies, isolated from an animal that is transgenic for human immunoglobulin genes (see, for example, Taylor L.D. et al. (1992) Nucl. Acids Res. 20: 6287-6295). In some embodiments, recombinant human antibodies are subjected to in vitro mutagenesis (or, if an animal transgenic for human Ig sequences, somatic in vivo mutagenesis is used) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, because they isolated from and close to human germline VH and VL sequences cannot naturally exist in the human germline in vivo.

The term specifically binds, as used herein, refers to that situation in which one member of a specific binding pair does not significantly bind molecules other than its specific binding partner(s). The term is also applicable when, for example, the antigen-binding domain of an antibody of the invention is specific for a particular epitope that is carried by a number of antigens, in which case the specific antibody having the antigen-binding domain will be capable of specifically binding to different epitope-bearing antigens. Accordingly, the monoclonal antibody of the invention specifically binds an epitope of the human T cell receptor beta chain belonging to the TRBV9 family, while it does not specifically bind TCR beta chains of other families and the TCR alpha chain.

The term epitope refers to that portion of a molecule that is capable of being recognized by and bound to an antibody at one or more antigen-binding sites on the antibody. Epitopes often consist of reactive surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics as well as specific charge characteristics.

The term epitope as used herein also refers to a portion of a polypeptide that has antigenic and/or immunogenic activity in an animal, preferably a mammal, such as a mouse, rat or human. The term antigenic epitope, as used herein, is defined as the portion of a polypeptide to which an antibody can specifically bind, as determined by any method well known in the art, such as by conventional immunoassay. Antigenic epitopes need not be immunogenic, but may also be immunogenic. An immunogenic epitope, as used herein, is defined as the portion of a polypeptide that elicits an antibody response in an animal, as determined by any method known in the art. A non-linear epitope or conformational epitope comprises non-contiguous polypeptides (or amino acids) within an antigenic protein to which an epitope-specific antibody binds.

The expressions biological property or biological characteristic or the terms activity or bioactivity with respect to an antibody and its functional fragments of the invention are used interchangeably in this application and include, but are not limited to, epitope/antigenic affinity and specificity, the ability to inhibit or antagonize TCR activity, which includes a beta chain belonging to the TRBV9 family.

Other biological properties or characteristics of an antibody identifiable in the art include, for example, cross-reactivity (i.e., with non-human target peptide homologues, or with other proteins or targets in general), and the ability to maintain high levels of protein expression in mammalian cells. The above properties or characteristics may be observed, measured, or evaluated using techniques recognized in the art, including, but not limited to, ELISA assay, competitive ELISA, BIACORE or KINEXA surface plasmon resonance assay, in vitro or in vivo inhibition assays without restrictions, receptor binding, cytokine or growth factor production and/or secretion, signal transduction, and immunohistochemistry of tissue sections obtained from various sources, including human, primate, or any other source.

The terms inhibit or neutralize, as used herein, in relation to the activity of an antibody of the invention, means the ability to substantially counteract, interfere with, prevent, limit, slow down, interrupt, eradicate, stop, reduce, for example, the development or severity of what inhibit, including, but not limited to, the biological activity of an antibody or property, disease, or condition.

As used herein, the term mutant or variant refers to an antibody of the present invention in which one or more amino acids are added and/or substituted and/or removed (deleted) and/or inserted (inserted) at the N-terminus and/or C -end, and/or within the native amino acid sequences of the antibodies of the present invention or fragments thereof. As used here, the term mutant also refers to a nucleic acid molecule that encodes a mutated protein. In addition, the term mutant refers to any variant that is shorter or longer than a protein or nucleic acid.

The term homology is used to describe the relationship of nucleotide or amino acid sequences to other nucleotide or amino acid sequences, as determined by the degree of identity and/or similarity between said compared sequences.

- 7 041932

As used herein, an amino acid or nucleotide sequence is substantially similar or substantially the same as a reference sequence if the amino acid or nucleotide sequence shares at least 85% identity with the specified sequence within the region selected for comparison. Thus, substantially similar sequences include those that have, for example, at least 90% identity, or at least 91% identity, or at least 92% identity, or at least 93% identity, or at least at least 94% identity, or at least 95% identity, or at least 96% identity, or at least 97% identity, or at least 98% identity, or at least 99% identity. Two sequences that are identical to one another are also substantially similar.

Sequence identity is determined based on the reference sequence. Algorithms for sequence analysis are known in the art, such as IgBLAST as described in Ye et al. Nucleic Acids Res. 2013, W34-40. For the purposes of the present invention, comparison of nucleotide and amino acid sequences using the IgBLAST software package provided by the National Center for Biotechnology Information (https://www.ncbi.nlm.nih) can be used to determine the level of identity and similarity between nucleotide sequences and amino acid sequences. .gov/igblast/) using discontinuous alignment with default settings. The full length of the reference sequence, such as the variable region, is used to calculate percent identity.

Reference to a nucleotide sequence encoding a polypeptide means that this polypeptide is produced from the nucleotide sequence during translation and transcription of the mRNA. In this case, both the coding strand, identical to mRNA and usually used in the sequence listing, and the complementary strand, which is used as a template for transcription, can be indicated. As is obvious to any person skilled in the art, the term also includes any degenerate nucleotide sequences encoding the same amino acid sequence. Nucleotide sequences encoding a polypeptide include sequences containing introns.

Antibodies.

As stated above, the present invention relates to isolated humanized monoclonal antibodies and functional fragments thereof, which are capable of specifically binding to the beta chain region of the TRBV9 family of the human T receptor.

The antibodies of the invention may be chimeric, humanized or human antibodies, or antigen-binding fragments thereof, and may be used as a drug for the treatment of AS and other diseases in which TCRs belonging to the TRBV9 family are involved, such as celiac disease or T-cell lymphoma.

The antibody of the invention is monoclonal. Monoclonal antibodies of the invention can be prepared using, for example, hybridoma techniques well known in the art, as well as recombinant techniques, phage display techniques, synthetic techniques or combinations of such techniques, or other techniques well known in the art. The term monoclonal antibody, as used in this application, refers to an antibody obtained from a single copy or clone, including, for example, any eukaryotic, prokaryotic or phage clone, and not to the method of obtaining it.

Humanized and chimeric antibodies can be generated by peptide synthesis or using recombinant DNA techniques as described below in the Nucleic Acids section.

In some embodiments, the antibodies of the present invention are chimeric and are characterized in that they have light and heavy chain variable domains of non-human origin (eg, rat or mouse) and human constant domains.

The antibody of the present invention contains a heavy chain variable domain (VH) with three hypervariable regions:

1) HCDR1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1,

2) HCDR2 has the amino acid sequence of SEQ ID NO: 2,

3) HCDR3 has the amino acid sequence of SEQ ID NO: 3;

2) light chain variable domain (VL) with three hypervariable regions LCDR1, LCDR2 and LCDR3, in which:

LCDR 1 has the amino acid sequence of SEQ ID NO: 4, LCDR 2 has the amino acid sequence of SEQ ID NO: 5, LCDR 3 has the amino acid sequence of SEQ ID NO: 6. Hereinafter, the known Kabat nomenclature is used in determining the CDR of antibodies, unless otherwise noted. .

In all embodiments, the light and heavy chain variable domains of an antibody of the present invention are humanized and differ from the light and heavy chain variable domains of the parent antibody by humanizing amino acid substitutions, wherein the heavy and light chain variable domains of the antibody contain amino acid substitutions in the FR fragments of the heavy variable domains. and light chain, which increase the degree of humanization of the antibody compared to the parent antibody.

In some embodiments, the heavy chain variable domain of an antibody of the present invention contains at least 10 humanizing amino acid substitutions compared to the heavy chain variable domain of the parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 8.

In preferred embodiments, the heavy chain variable domain of an antibody of the present invention has the amino acid sequence shown in SEQ ID NO: 16.

In some embodiments, the heavy chain variable domain of an antibody of the present invention contains additional amino acid substitutions that do not affect the specificity of the antibody.

In some embodiments, the light chain variable domain of an antibody of the present invention contains at least 10 humanizing amino acid substitutions compared to the light chain variable domain of the parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 10.

In preferred embodiments, the light chain variable domain of an antibody of the present invention contains amino acid substitutions and has the sequence shown in SEQ ID NO: 18.

In some embodiments, the light chain variable domain of an antibody of the present invention contains additional amino acid substitutions that do not affect the specificity of the antibody.

In some embodiments, the monoclonal antibodies of the invention are full-length human IgG antibodies, such as IgG1 or IgG2 or IgG3 or IgG4.

In some embodiments, an antibody of the invention comprises a heavy chain whose amino acid sequence is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least 91% identical. at least 92% or at least 93% identical or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.

In some embodiments, an antibody of the invention comprises a light chain whose amino acid sequence is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least 91% identical. at least 92% or at least 93% identical or at least 94% or at least 95% or at least 96% or at least 97% or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.

In some embodiments, the antibody has a light chain, the amino acid sequence of which is shown in SEQ ID NO: 22, and a heavy chain, the amino acid sequence of which is shown in SEQ ID NO: 20.

It is known in the art that mutations can be introduced in antibody sequences, including variable domains, that do not substantially affect the ability of the antibody to bind to an antigen. The antibodies of the present invention may also contain additional mutations that do not result in the loss of the ability of the antibody to bind the TRBV9 family TCR beta chain, but may result in a decrease in antibody-dependent cell-mediated cytotoxicity or an increase in affinity or other biological properties of the antibodies. In particular, it is well known in the art that conservative amino acid substitutions can be made in antibody sequences. By conservative substitution in the context of the application is meant a substitution in which an amino acid residue is replaced by another amino acid residue having a close side chain. Families of amino acid residues having close side chains are defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). Preferably, no more than five conservative amino acid substitutions are made in the CDR3 regions in the VL and/or VH domains, more often no more than three conservative substitutions. Generally, conservative substitutions are not made at amino acid positions critical for binding of the TRBV9 family beta chain epitope.

The above-described variants (mutants) of antibodies according to the invention can be obtained by peptide synthesis or using recombinant DNA techniques as described below in the section Nucleic acids.

In preferred embodiments, the antibody comprises a heavy chain constant region, such as a human IgG1, IgG2, IgGS, IgG4, IgA, IgE, IgM, IgD constant region. Preferably, the heavy chain constant region is a human IgG1 heavy chain constant region. Moreover, the antibody may comprise, as a light chain constant region, either a kappa light chain constant region or a light chain lambda constant region. Preferably, the antibody contains a light chain kappa constant region.

- 9 041932

In preferred embodiments, the antibody heavy chain variable fragment is characterized by a degree of humanization of 87%. In preferred embodiments, the antibody light chain variable fragment is characterized by a degree of humanization of 85%.

Antigen-binding fragments of antibodies of the present invention are also provided. The term antigen-binding antibody fragment (or functional antibody fragment or active antibody fragment) as used herein refers to one or more antibody fragments that retain the ability to specifically bind an antigen. It has been shown that the antigen-binding function of an antibody can be performed by full-length antibody fragments. Examples of binding fragments encompassed by the term antibody antigen-binding fragment include (a) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (b) an F(ab')2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge in the region of the loop; (c) Fd fragment consisting of VH and CH1 domains; (d) an Fv fragment consisting of the VL and VH domains of one antibody arm; (e) a dAb fragment (Ward et al. (1989) Nature 341: 544-546), which consists of a VH domain, and (f) a complementarity-determining region (CDR). Moreover, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they can be recombinantly linked using a synthetic linker that provides them as a single protein chain in which the VL and VH regions are paired to form monovalent molecules ( known as single chain Fv (scFv), see for example Bird et al (1988) Science 242: 423-426; Huston et al (1988) Proc Natl Acad Sci USA 85: 5879-5883) . It is contemplated that such single chain antibodies are also encompassed by the term antigen-binding antibody fragment. They also include other forms of single chain antibodies, such as diabodies. Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on the same polypeptide chain, but using a linker that is too short to allow pairing of the two domains on the same chain, which causes the domains to pair with the complementary domains of the other chain. and create two antigen binding sites (see, for example, Holliger P. et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak R. J. et al. (1994) Structure 2: 1121-1123) .

Antibody fragments such as Fab and F(ab')2 can be prepared from whole antibodies using established methods such as papain or pepsin digestion, respectively, of whole antibodies. Moreover, antibodies, antibody fragments and immunoadhesion molecules can be produced using standard methods using recombinant DNA.

An antibody or antigen-binding fragment thereof may be part of larger immunoadhesion molecules formed by covalent or non-covalent bonding of an antibody or antibody fragment to one or more proteins or peptides. Examples of such immunoadhesion molecules include the use of a streptavidin core region to produce a tetrameric scFv molecule (Kipriyanov S.M. et al. (1995) Human Antibodies and Hybridomas 6:93-101) and the use of a cysteine residue, a marker peptide, and a C-terminal polyhistidine tag to produce bivalent and reduced biomolecules. scFv (Kipriyanov S. M. et al. (1994) Mol. Immunol., 31: 1047-1058). Other chemical bindings of antibody fragments are also well known in the art.

The antibodies and their functional fragments according to the invention are in an isolated form, i.e. this means that the protein is essentially free from the presence of other proteins or other naturally occurring biological molecules such as oligosaccharides, nucleic acids and fragments thereof, etc., where the term is essentially free in this case means that less than 70%, usually less than 60% and more often less than 50% of the specified composition containing the isolated protein, is another natural biological molecule. In some embodiments, said proteins are present in a substantially purified form, wherein the term substantially purified form means a purity of at least 95%, typically at least 97%, and more often at least 99%.

Methods for purifying an antibody obtained by recombinant or hybridoma technology are well known in the art, for example, purification can be carried out by chromatography (for example, ion exchange, affinity, especially affinity for specific protein A or protein G antigens, and size column chromatography), centrifugation , differential solubility, or any other standard technique for protein purification. In addition, antibodies according to the technology in accordance with the present invention, or fragments thereof, can be fused with heterologous polypeptide sequences (eg, a histidine tag) to facilitate purification.

The affinity of an antibody can be determined using a standard assay through the determination of the dissociation constant (KD). KD is calculated via the equation KD=kdis/kon, where kdis is the experimentally calculated dissociation rate constant and kon is the experimentally calculated association rate constant of the antibody-antigen complex.

Preferred antibodies are those that bind a human antigen with a KD value of no more than about 1 x 10 ^-7 M; preferably no more than about 1x10' ⁸ M; more often no more than about 1 x 10' ⁹ M; more preferably no more than about

- 10 041932

1 x 10 ^-10 M, and most preferably no more than about 1 x 10 ^-11 M, for example, no more than about 1 x 10 ^-12 M.

Preferred antibodies include the MA-042 antibody, described in detail in the experimental section below.

Antibodies and their fragments that can be used in the present compositions and methods are biologically active antibodies and fragments, that is, capable of binding the desired antigenic epitopes and exhibiting a biological effect directly or indirectly.

Antibodies and their functional fragments according to the invention are able to specifically bind the epitope (section) of the beta chain of the TRBV9 family. In preferred embodiments, their specific binding to the beta chain of the TRBV9 family results in inhibition of the activity of TCRs comprising said beta chain. In general, inhibition is preferably at least about 20% or 30% or 40% or 50% or 60% or 70% or 80% or 90% or 95% or more.

In some embodiments, an anti-TRBV9 family beta chain antibody of the invention, or a fragment thereof, can eliminate T lymphocytes carrying a TCR containing a TRBV9 family beta chain. In some embodiments, an antibody or fragment thereof according to the invention may provide at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% elimination of T-lymphocytes.

In a preferred embodiment of the invention, the antibody is a MA-042 antibody.

The MA-042 antibody includes heavy and light chain variable domains that have the amino acid sequences shown in SEQ ID NOs: 16 and 18.

The MA-042 antibody includes heavy and light chains, which have the amino acid sequences shown in SEQ ID NOs: 20 and 22, respectively.

Nucleic acids

The present invention provides nucleic acid molecules encoding the heavy and light chains of an antibody of the present invention, functional fragments and variable domains thereof, which can be used to produce chimeric antibodies comprising the variable domains of the invention operatively fused to known constant domains of human antibodies.

In preferred embodiments, the nucleic acid of the invention encodes an antibody heavy chain whose variable domain contains the 3 hypervariable regions HCDR1, HCDR2 and HCDR3, where

HCDR1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1;

HCDR2 has the amino acid sequence of SEQ ID NO: 2;

HCDR3 has the amino acid sequence of SEQ ID NO: 3.

In preferred embodiments, the nucleic acid of the invention encodes an antibody light chain whose variable domain contains 3 hypervariable regions LCDR1, LCDR2 and LCDR3, in which:

LCDR1 has the amino acid sequence of SEQ ID NO: 4;

LCDR2 has the amino acid sequence of SEQ ID NO: 5;

LCDR3 has the amino acid sequence of SEQ ID NO: 6.

In preferred embodiments, the nucleic acid of the invention encodes heavy and light chain variable domains of an antibody that contain amino acid substitutions in the FR fragments of the heavy and light chain variable domains that increase the degree of humanization of the antibody relative to the parent antibody.

Nucleic acid molecules encoding homologues and mutants of these antibody chains, their functional fragments and domains are also within the scope of the present invention.

In some embodiments, the nucleic acid encodes a heavy chain variable domain of an antibody of the present invention that contains at least 10 humanizing amino acid substitutions compared to the heavy chain variable domain of the parent antibody, the amino acid sequence of which is shown in SEQ ID NO: 8.

In some embodiments, the nucleic acid encodes an antibody heavy chain whose variable domain has the amino acid sequence of SEQ ID NO: 16.

In some embodiments, the nucleic acid encodes an antibody light chain whose variable domain contains at least 10 humanizing amino acid substitutions compared to the light chain variable domain of the parent antibody whose amino acid sequence is shown in SEQ ID NO: 10.

In some embodiments, the nucleic acid encodes an antibody light chain whose variable domain has the amino acid sequence of SEQ ID NO: 18.

In some embodiments, the nucleic acid encodes an antibody heavy chain, an amino acid

- 11 041932 which is at least 85% identical, or at least 85% identical

90% or at least 91% identical or at least 92% identical or at least 93% identical or at least 94% or at least 95% identical or at least 96% or at least 97% or at least 98% or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 20.

In some embodiments, the nucleic acid encodes an antibody light chain whose amino acid sequence is at least 85% identical, or at least 90% identical, or at least 91% identical, or at least 91% identical. at least 92%, or at least 93% identical, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98 % or at least 99% or 100% identical to the amino acid sequence of SEQ ID NO: 22.

Examples of nucleic acids encoding the light and heavy chains of the invention are shown in SEQ ID NOS: 19 and 21.

Nucleic acids encoding the light and heavy chain variable domains of an antibody are also of interest. Nucleic acids encoding the heavy and light chain variable domains of an antibody can be used for operational fusion with nucleic acids encoding the corresponding antibody constant domains.

In some embodiments, the nucleic acid encodes an antibody heavy chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 16.

In some embodiments, the nucleic acid encodes an antibody light chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 18.

Examples of nucleic acids encoding the heavy and light chain variable domains of the antibody are shown in SEQ ID NOS: 15 and 17.

As used here, a nucleic acid molecule or nucleic acid is a DNA molecule, such as genomic DNA or a cDNA molecule, or an RNA molecule, such as an mRNA molecule. In some embodiments, a nucleic acid molecule of the present invention is a DNA (or cDNA) molecule containing an open reading frame that encodes an antibody or antibody fragment of the present invention and is capable, under suitable conditions (e.g., physiological intracellular conditions), of being used for expression in a heterologous system expression.

In some embodiments, the nucleic acid molecule of the present invention is obtained by genetic engineering. Methods for obtaining nucleic acids are well known in the art. For example, the availability of amino acid sequence information or nucleotide sequence information makes it possible to prepare the isolated nucleic acid molecules of the present invention using oligonucleotide synthesis. In the case of information about the sequence of amino acids, several nucleic acids can be synthesized that differ from each other due to the degeneracy of the genetic code. Methods for selecting codon variants for a desired host are well known in the art.

Synthetic oligonucleotides can be prepared using the phosphoramidite method and the resulting constructs can be purified using methods well known in the art such as high performance liquid chromatography (HPLC) or other methods as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, and according to the instructions described in, for example, United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research. Long double-stranded DNA molecules of the present invention can be synthesized as follows: several smaller fragments can be synthesized with the necessary complementarity, which contain suitable ends capable of cohesion with the neighboring fragment. Adjacent fragments can be ligated using DNA ligase or a NDP-based method.

The nucleic acid molecules of the present invention may also be cloned from biological sources.

The present invention also encompasses nucleic acids that are homologous, substantially similar, identical, or derived from nucleic acids encoding the polypeptides of the present invention.

Nucleic acids of the invention are found in an environment different from the environment in which they are naturally found, for example, they are isolated, present in increased abundance, found or expressed in in vitro systems, or in cells or organisms other than those in which they are found. in natural conditions.

Changes or differences in the nucleotide sequence between highly similar nucleotide sequences may represent nucleotide substitutions in the sequence that occur during normal replication or duplication. Other substitutions may be specifically designed and inserted into the sequence for specific purposes, such as changing the codons of certain amino acids or the nucleotide sequence of a regulatory region. Such specific substitutions can be made in vitro using various mutagenesis techniques or obtained in host organisms under specific breeding conditions that induce or select for these changes. Such tailor-made sequence variants may be referred to as mutants or derivatives of the original sequence.

Mutant or derivative nucleic acids or nucleic acid variants can be produced on a template nucleic acid selected from the nucleic acids described above by modifying, deleting or adding one or more nucleotides in the template sequence, or combinations thereof, to produce a template nucleic acid variant. Modifications, additions or deletions can be made by any method known in the art (see, for example, Gustin et al., Biotechniques (1993) 14:22; Barany, Gene (1985) 37:111-123; and Colicelli et al. ., Mol. Gen. Genet. (1985) 199: 537-539, Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp. 15.3-15.108), including error-prone PCR (error- prone PCR), shuffling, oligonucleotide directed mutagenesis, assembly PCR, pairwise PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive multiple mutagenesis, exponential multiple mutagenesis, site-specific mutagenesis, random mutagenesis, gene reassembly, gene saturation mutagenesis (GSSM), artificial rearrangement with ligation (SLR), or combinations thereof. Modifications, additions or deletions can also be performed by a method including recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, double-skip mutagenesis, point mismatch reductive mutagenesis, reduction-deficient strain mutagenesis, chemical mutagenesis, radioactive mutagenesis, deletion mutagenesis, restriction selective mutagenesis, restriction mutagenesis with purification, artificial gene synthesis, multiple mutagenesis, generation of chimeric multiple nucleic acids, and combinations thereof.

Also provided are degenerate variants of nucleic acids that encode the proteins of the present invention. Degenerate nucleic acid variants include substitutions of nucleic acid codons with other codons encoding the same amino acids. In particular, degenerate nucleic acid variants are designed to increase expression in the host cell. In this embodiment, nucleic acid codons that are not preferred or less preferred in the genes of the host cell are replaced with codons that are abundant in the coding sequences of the genes in the host cell, where said changed codons code for the same amino acid.

The above modifications do not substantially change the properties of antibodies and their functional fragments, but may facilitate protein folding in the host cell, reduce the ability to aggregate, or modulate other biochemical properties of proteins, such as half-life decay. In some embodiments, these modifications do not change the biochemical properties of the protein. In some embodiments, these modifications result in a decrease in the immunogenicity of the antibodies. All kinds of modifications and mutations mentioned above are carried out at the level of nucleic acid.

The claimed nucleic acids can be isolated and obtained in essentially purified form. Essentially, a purified form means that the nucleic acids are at least about 50% pure, typically at least about 90% pure, and are typically recombinant, that is, flanked by one or more nucleotides with which it is usually unlinked on a naturally occurring chromosome in its natural host.

Also provided are nucleic acids that encode fusion proteins comprising the protein of the present invention, or fragments thereof, which are discussed in more detail below. Nucleic acids encoding the variable domains of the invention can be operatively fused to nucleic acids encoding the corresponding antibody light and heavy chain constant domains. Nucleic acids encoding the antibody light and heavy chains can be operatively fused to nucleic acids encoding a leader peptide that transports expression products from the host cell. The leader peptide is subsequently cleaved off during polypeptide maturation.

Vector.

A vector and other nucleic acid constructs containing the claimed nucleic acids are also provided. The term vector includes a nucleic acid molecule capable of transporting another nucleic acid to which it is operably linked. Certain vectors are capable of autonomous replication in the host cell into which they are introduced, while other vectors can be integrated into the genome of the host cell and thus replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as recombinant expression vectors (or, more simply, expression vectors or expression vectors), and illustrative vectors are well known in the art. Suitable vectors include viral and non-viral vectors, plasmids, cosmids, phages, etc., preferably plasmids, and are used to clone, amplify, express, transfer, etc., the nucleic acid sequence of the present invention into a suitable host. The choice of an appropriate vector is understandable for

- 13 041932 a qualified specialist in this field. The full-length nucleic acid, or a portion thereof, is typically inserted into a vector by attachment by DNA ligase to a restriction enzyme-cleaved site in the vector. Alternatively, the desired nucleotide sequence may be inserted by in vivo homologous recombination, typically by adding homologous regions to the vector on the flanks of the desired nucleotide sequence. Homologous regions are added by oligonucleotide ligation or polymerase chain reaction, using primers including, for example, both the homologous regions and a portion of the desired nucleotide sequence. The vector, as a rule, has an origin of replication, which ensures its reproduction in host cells as a result of its introduction into the cell as an extrachromosomal element. The vector may also contain regulatory elements that allow the expression of the nucleic acid in the host cell and the production of the target polypeptide. In an expression vector, said nucleic acid is operably linked to a regulatory sequence, which may include promoters, enhancers, terminators, operators, repressors and inducers, as well as a polypeptide start codon. In some embodiments of the nucleic acid of the invention, the nucleic acid is also operably linked to a leader peptide allowing release of the expression product from the host cell to the extracellular space.

Also provided are expression cassettes or systems used, inter alia, to generate the subject polypeptides (e.g., the light and heavy chains of an antibody of the invention or the variable domains of the light and heavy chains of an antibody of the invention) based thereon or to replicate the claimed nucleic acid molecules. The expression cassette may exist as an extrachromosomal element or may be incorporated into the cell's genome by introducing said expression cassette into the cell. For expression, the protein product encoded by the nucleic acid of the invention is expressed in any convenient expression system, including, for example, bacterial systems, yeast, plants, insects, amphibians, or mammalian cells. In the expression cassette, the target nucleic acid is operatively linked to regulatory sequences, which may include promoters, enhancers, termination sequences, operators, repressors, and inducers, as well as the start codon of the polypeptide. In some embodiments of the nucleic acid of the invention, the nucleic acid is also operably linked to a leader peptide allowing release of the expression product from the host cell to the extracellular space. Methods for obtaining expression cassettes or systems capable of expressing the desired product are known to those skilled in the art.

Host cell.

The expression systems described above can be used in prokaryotic or eukaryotic hosts. For protein production, host cells such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or higher organism cells such as yeast cells, plant cells, vertebrate cells, mammalian cells, human cells, e.g., CHO cells (e.g., ATCC CRL-9096), NS0 cells, SP2/0 cells, HEK293 cells, COS cells (e.g., ATCC CRL-1650, CRL-1651), and HeLa cells (e.g., ATCC CCL-2 ).

The above host cell does not refer to a host cell obtained using human embryos.

The above host cell does not refer to a host cell obtained by modifying the genetic integrity of human germline cells.

To obtain an antibody of the invention, a host cell is co-transformed with an expression vector comprising a nucleic acid encoding an antibody light chain and an expression vector comprising a nucleic acid encoding an antibody heavy chain. In some embodiments, a single expression vector is used in which nucleic acids encoding both the light and heavy chains of the antibody are introduced.

For expression of the light and heavy chains, the expression vector(s) encoding the heavy and light chains are transformed (co-transformed) into a host cell such that the light and heavy chains are expressed in the host cell and are preferably isolated into a medium in which the host cells are cultured, antibodies can be isolated from this medium. Various interpretations of the term transformation are intended to include a wide range of methods commonly used in the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, for example, electroporation, calcium phosphate precipitation, transfection with DEAE-dextran, etc., as described by Sambrook, Fritsch and Maniatis (eds) Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. (1989; Ausubel F.M. et al. (eds.) Current Protocols in Molecular Biology, Green Publishing Associates (1989).

When recombinant expression vectors containing antibody nucleic acids are introduced into host cells, antibodies are generated by culturing the host cells for a period of time that is sufficient to express the antibody in the host cell, or (more preferably) secrete the antibody into the culture medium, in in which host cells are grown. Antibodies can be isolated from the culture medium using standard protein purification methods. Culture conditions for various cells are well known to those skilled in the art and are described, for example, in Current Protocols in Cell Biology, ed. Bonifacino J.S., Dasso M., Harford J.B., Lippincott-Schwartz J. and Yamada K.M., John Wiley & Sons, Inc., 2000.

If any of the aforementioned host cells or other suitable host cells or organisms are used to replicate and/or express the nucleic acids of the invention, then the resulting replicated nucleic acid, expressed protein or polypeptide is within the scope of the invention as the product of the host cell or organism. The product may be isolated in a suitable manner known in the art.

Cell lines that stably express the proteins of the present invention can be selected by methods known in the art (e.g., co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin, making it possible to identify and isolate transfected cells that contain gene included in the genome).

The nucleic acid molecules of the present invention can also be used to determine the expression of a gene in a biological sample. The method in which cells are examined for the presence of specific nucleotide sequences, such as genomic DNA or RNA, is well established in the art. Briefly, DNA or mRNA is isolated from a cell sample. mRNA can be amplified by RT-PCR using reverse transcriptase to form a complementary strand of DNA, followed by polymerase chain reaction amplification using primers specific for the claimed DNA sequences. Alternatively, the mRNA sample is separated by gel electrophoresis, transferred to a suitable carrier such as nitrocellulose, nylon, etc., and then tested with a DNA fragment of the claimed DNA as a probe. Other methods may also be used, such as oligonucleotide crosslinking assays, in situ hybridization, and hybridization with DNA probes immobilized on a solid chip. The detection of mRNA hybridizing to the claimed sequence indicates the expression of the gene in the sample.

Therapeutic Use of Antibodies of the Invention.

In one aspect, the antibody or active fragment thereof of the present invention is used in the treatment of disorders that are associated with the activity of pathological T-lymphocytes bearing on the surface of the TRBV9 family of TCRs, for example, with the activity of autoimmune T-lymphocytes in AS, celiac disease, T-cell lymphomas.

The term patient in this application refers to a mammal, including, but not limited to, mice, monkeys, humans, mammalian farm animals, mammalian sports animals, and mammalian pets; preferably the term refers to humans. In a certain embodiment, the patient is further characterized by a disease or disorder or condition mediated by the presence in the body of a TCR whose beta chain belongs to the TRBV9 family. It is known from the prior art that TCR, the beta chain of which belongs to the TRBV9 family, is associated with AS and celiac disease. Also, TCR, the beta chain of which belongs to the TRBV9 family, may be associated with the development of a number of blood diseases, such as T-cell lymphoma caused by the Epstein-Barr virus.

As used herein, the terms co-administration, co-administration, and in combination with referring to an antibody with one or more other therapeutic agents are intended to mean, refer to, or include:

1) simultaneous administration of such a combination of an antibody of the present invention and a therapeutic agent to a patient in need of treatment, when such components are formulated together in a single dosage form from which said components are released substantially simultaneously to said patient;

2) simultaneous administration of such a combination of an antibody of this invention and a therapeutic agent to a patient in need of treatment, when such components are formulated separately in different dosage forms, the administration of which occurs at almost the same time to said patient, after which these components are released almost simultaneously the specified patient;

3) sequential administration of such a combination of an antibody of this invention and a therapeutic agent to a patient in need of treatment, when such components are formulated separately from each other in separate dosage forms that are taken in sequential time by the indicated patient with a significant time interval between each administration, after whereby said components are released at substantially different times to said patient; and

4) sequential administration of such a combination of an antibody of this invention and a therapeutic agent to a patient in need of treatment, when such components are formulated together in a single dosage form from which the release of these components occurs in a controlled manner, after which they are simultaneously, sequentially or jointly released into one and the same time and/or different time to the specified patient, where each part can be entered in one or different ways.

The antibody of this invention can be administered without additional therapeutic treatment, i.e. as a standalone therapy. In addition, treatment with an antibody of this invention

- 15 041932 may include at least one additional therapeutic treatment (combination therapy). In some embodiments, the antibody may be co-administered or formulated with another drug/drug for an autoimmune or oncological disease in which TCRs containing the TRBV9 beta chain are involved, e.g., AS, celiac disease, T-cell lymphoma, T-cell leukemia.

Doses and routes of administration.

The antibody of this invention will be administered in an amount effective to treat the condition in question, i. in doses and for periods of time necessary to achieve the desired result. The therapeutically effective amount may vary depending on factors such as the particular condition being treated, the age, sex, and weight of the patient, and whether administration of the antibody is alone or in combination with one or more additional immunosuppressive or anti-inflammatory therapies. treatment.

Drug regimens can be adjusted to provide the optimal desired response. For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased depending on the severity of the therapeutic situation. Especially useful is the formulation of parenteral compositions in unit dosage form for ease of administration and uniformity of dosing. Unit dosage form, as used herein, refers to physically discrete units suitable as unit doses for patients/subjects to be treated; each unit contains a predetermined amount of the active compound calculated to produce the desired therapeutic effect in combination with the required pharmaceutical carrier. The specification for unit dosage forms of the present invention is generally dictated by and directly dependent on (a) the unique characteristics of the chemotherapeutic agent and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the technique of compounding such an active compound to sensitivity treatment in subjects.

Thus, those skilled in the art will appreciate from the disclosure provided herein that doses and dosing regimens are adjusted in accordance with methods well known in the therapeutic field. This means that the maximum tolerated dose can be easily set and the effective amount that provides a detectable therapeutic effect for the patient can also be determined, as well as the time requirements for the administration of each agent to achieve a visible therapeutic effect for the patient. Thus, although some doses and regimens of administration are given as examples in this document, these examples in no way limit the doses and regimens of administration that may be needed for a patient in the practice of the present invention.

It should be noted that dosage values may vary depending on the type and severity of the condition to be alleviated and may include one or more doses. In addition, it should be understood that for any particular patient, specific administration schedules will need to be adjusted over time according to individual need and at the discretion of the healthcare professional who administers or supervises the administration of the compositions, and that the concentration ranges given in this specification are only by way of example and are not intended to limit the scope or practice of the claimed compositions. In addition, the dosage regimen with the compositions of this invention may be based on various factors, including the type of disease, age, weight, sex, health status of the patient, severity of the condition, route of administration, and the particular antibody used. Thus, the dosing regimen may vary widely, but may be determined regularly using standard methods. For example, doses may be adjusted based on pharmacokinetic and pharmacodynamic parameters, which may include clinical effects such as toxic effects or laboratory values. Thus, the present invention encompasses individual dose escalation as determined by the skilled artisan. Determination of the required dose and modes are well known in the relevant field of technology and will be clear to a person skilled in the art after reading the ideas disclosed in this document.

Examples of suitable routes of administration are provided above.

It is contemplated that a suitable dose of an antibody of this invention will be in the range of 0.1200 mg/kg, preferably 0.1-100 mg/kg, including about 0.5-50 mg/kg, e.g., about 1-20 mg /kg. The antibody can be administered, for example, at a dose of at least 0.25 mg/kg, for example, at least 0.5 mg/kg, including at least 1 mg/kg, for example, at least 1, 5 mg/kg, for example, as well as at least 2 mg/kg, for example, at least 3 mg/kg, including at least 4 mg/kg, for example, at least 5 mg/kg; and, for example, up to a maximum of 50 mg/kg, including up to a maximum of 30 mg/kg, for example, up to a maximum of 20 mg/kg, including up to a maximum of 15 mg/kg. The administration will be repeated usually at suitable intervals, for example, once a week, once every two

- 16 041932 weeks, once every three weeks or once every four weeks, and for as long as deemed appropriate by the responsible physician, who may in some cases increase or decrease the dose as necessary.

Pharmaceutical composition.

An antibody of the invention may be included in a pharmaceutical composition suitable for administration to a patient. The antibodies of the invention may be administered alone or in combination with a pharmaceutically acceptable carrier, diluent and/or excipient in single or multiple doses. Pharmaceutical compositions for administration are designed to suit the selected mode of administration, and pharmaceutically acceptable diluents, carriers and/or excipients such as dispersing agents, buffers, surfactants, preservatives, solubilizing agents, isotonic agents, stabilizers, and the like . used properly. Said compositions have been formulated according to conventional methods as found in, for example, Remington, The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA 1995, which describes various methods for preparing compositions, in general known to experts.

Medicinal product (preparation) - a substance or mixture of substances in the form of a pharmaceutical composition in the form of tablets, capsules, powders, lyophilisates, injections, infusions, ointments and other ready-made forms, intended to restore, correct or change physiological functions in humans and animals, and also for the treatment and prevention of diseases, diagnosis, anesthesia, contraception, cosmetology and other things. Any method of administering peptides, proteins, or antibodies accepted in the art can be appropriately used for an antibody of this invention.

The term pharmaceutically acceptable means one or more compatible liquid or solid components that are suitable for administration to a mammal, preferably a human.

The term excipient or excipient is used herein to describe any component other than those previously described in this invention. These are substances of inorganic or organic origin used in the manufacturing process, the manufacture of medicines to give them the necessary physical and chemical properties.

The term buffer, buffer composition, buffer agent is understood as a solution capable of maintaining the pH value due to the interaction of the acidic and alkaline components that make up its composition, which enables the antibody preparation to be resistant to changes in pH. In general, pH values of the pharmaceutical composition between 4.0 and 8.0 are preferred. As buffer agents, for example, acetate, phosphate, citrate, histidine, succinate, and the like can be used. buffer solutions, but not limited to.

The terms tonic agent, osmolytic, or osmotic agent, as used herein, refer to an excipient that can supply the osmotic pressure of a liquid antibody preparation. An isotonic preparation is a preparation that has an osmotic pressure equivalent to that of human blood. Isotonic formulations typically have an osmotic pressure of about 250 to 350 mOsm/kg. As isotonic agents, polyols, mono- and disaccharides, amino acids, metal salts such as sodium chloride, and the like can be used, but not limited to.

A stabilizer is understood to be an excipient or a mixture of two or more excipients which provide the physical and/or chemical stability of the active agent. As stabilizers can be used amino acids, for example, arginine, histidine, glycine, lysine, glutamine, proline, but not limited to; surfactants, e.g. polysorbate 20 (trade name Tween 20), polysorbate 80 (trade name Tween 80), polyethylene polypropylene glycol and its copolymers (trade names Poloxaner, Pluronic), sodium dodecyl sulfate (SDS) ), but not limited to; antioxidants, for example, methionine, acetylcysteine, ascorbic acid, monothioglycerol, salts of sulfuric acids, and the like, but not limited to; chelating agents such as, but not limited to, ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), sodium citrate, and the like.

The pharmaceutical composition is stable if the active agent retains its physical stability and/or chemical stability and/or biological activity during the stated shelf life at a storage temperature, for example, at 2-8°C. Preferably, the active agent retains both physical and chemical stability, as well as biological activity. The storage period is selected based on the results of a stability study with accelerated and natural storage.

A pharmaceutical composition containing a monoclonal antibody of the invention may be administered to a patient having the pathologies as described herein using standard methods of administration, including oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or using suppositories.

- 17 041932

The pharmaceutical composition of the invention preferably contains or is a therapeutically effective amount of an antibody of the invention. A therapeutically effective amount refers to an amount effective at dosages and over periods of time necessary to achieve the desired therapeutic result. A therapeutically effective amount of an antibody may vary depending on factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody or antibody portion to elicit the desired response in the individual. A therapeutically effective amount is also the amount at which the therapeutically beneficial effect of the antibody outweighs the toxic or deleterious effect. A prophylactically effective amount refers to an amount effective at dosages and for periods of time necessary to achieve the desired prophylactic result. Since a prophylactic dose is used in individuals before or at an early stage of the disease, typically the prophylactically effective amount may be less than the therapeutically effective amount.

A therapeutically effective or prophylactically effective amount is at least the minimum dose, but less than the toxic dose, of the active agent necessary to provide a therapeutic benefit to the patient. On the other hand, a therapeutically effective amount of an antibody of the invention is an amount which, in mammals, preferably humans, reduces the biological activity of autoimmune clones, for example, through binding of TCR, the beta chain of which belongs to the TRBV9 family, where the presence of these clones causes or contributes to undesirable effects, or a decrease in the levels of TCR, the beta chain of which belongs to the TRBV9 family, causes a beneficial therapeutic effect in a mammal, preferably a human.

The route of administration of an antibody of the invention may be oral, parenteral, inhaled, or topical. Preferably, the antibodies of the invention may be formulated into a pharmaceutical composition suitable for parenteral administration. The term parenteral as used in this application includes intravenous, intramuscular, subcutaneous, rectal, vaginal or intraperitoneal administration. Advantageously, administration is by intravenous or intraperitoneal or subcutaneous injection. Suitable carriers for such injections are directly known in the art.

The pharmaceutical composition, as specified in the relevant guidelines, must be sterile and stable under the conditions of manufacture and storage in a container that is provided, including, for example, a sealed vial (ampoule) or syringe. Therefore, pharmaceutical compositions may be sterile filtered after formulation or otherwise rendered microbiologically acceptable. A typical intravenous infusion composition may have a volume of 250-1000 ml of liquid, such as sterile Ringer's solution, saline, dextrose solution and Hank's solution, and a therapeutically effective dose (for example, 1-100 mg/ml or more) of the antibody concentration. The dose may vary depending on the type and severity of the disease. As is well known in the art, dosages for any given patient depend on many factors, including patient size, body surface area, age, particular compound to be administered, sex, time and route of administration, general health, and other medications. that are entered at the same time. A typical dose may be, for example, in the range of 0.001-1000 μg; however, doses below or above this exemplary range are contemplated, especially given the above factors. The dosage regimen for daily parenteral administration may be 0.1 µg/kg to 100 mg/kg based on total body weight, preferably 0.3 µg/kg to 10 mg/kg, and more preferably 1 µg/kg to 1 mg/kg , even more preferably 0.5 to 10 mg/kg of body weight per day. The treatment process can be monitored by periodically assessing the patient's condition. For repeated administration for several days or longer, depending on the condition of the patient, the treatment is repeated until the desired response is achieved or the symptoms of the disease are suppressed. However, other dosage regimens that are not described in this application may also be used. The desired dosage may be administered by single bolus administration, multiple bolus administrations, or by continuous infusion of the antibody, depending on the pharmacokinetic degradation pattern that the practitioner wishes to achieve.

These estimated amounts of antibody are highly dependent on the judgment of the therapist. The key factor in selecting the appropriate dose and regimen is the desired outcome. Factors considered in this context include the particular disease being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of administration of the antibody, the particular type of antibody, route of administration, mode of administration, and other factors known to medical practitioners. .

Therapeutic agents of the invention may be frozen or lyophilized and reconstituted in a suitable sterile vehicle prior to use. Lyophilization and reconstitution can result in varying degrees of loss of antibody activity. Dosages may be adjusted to compensate for this loss. In general, pH values of the pharmaceutical composition are between 6 and 8.

- 18 041932

Product(s) and kits.

A further embodiment of the invention is an article of manufacture which contains products useful in the treatment of autoimmune diseases and related conditions and malignant blood diseases in which TCRs carrying the beta chain of the TRBV9 family are involved. Such diseases include, for example, AS, celiac disease, T-cell leukemia, T-cell lymphoma, and others.

The product is a container with a label and leaflet, which can be placed in a blister and / or pack. Suitable containers are, for example, vials, ampoules, syringes, etc. The containers can be made from various materials such as glass or polymeric materials. The container contains a composition effective for treating a particular condition and may have a sterile inlet). At least one active ingredient in the composition is an antibody of the invention. The label and package insert indicate that the drug is used to treat a specific condition. The label and/or package insert should additionally contain instructions for administering the antibody composition to a patient, including information about the indications, use, dose, route of administration, contraindications, and/or precautions regarding the use of such therapeutic products. In one embodiment, the package insert states that the composition is used to treat specify what.

In addition, the product may include other products required from a commercial and consumer point of view, such as, but not limited to solvents, diluents, filters, needles and syringes.

The invention also relates to kits that can be used for various purposes, for example, to assess the ability to destroy T-cells bearing TCRs of the TRBV9 family, to purify or immunoprecipitate the TRB V9 receptor from cells. For isolation and purification, the kit may contain an antibody bound to beads (eg, Sepharose beads). The set contains a container and a label and leaflet in the package.

diagnostic use.

The antibodies of the present invention are also used for diagnostic purposes (eg, in vitro, ex vivo). For example, the antibody can be used to detect or measure the level of TCRs containing the TRBV9 family of TCRs in samples obtained from a patient, such as a tissue sample or a body fluid sample such as inflammatory exudate, blood, intestinal fluid, saliva, or urine. Suitable detection and measurement methods include immunological methods such as flow cytometry, enzyme-linked immunosorbent assay (ELISA), chemiluminescent assay, radioimmunoassay, and immunohistology. The invention further includes kits, such as diagnostic kits, containing the antibodies described herein.

For a better understanding of the invention, the following examples are given. These examples are provided for illustrative purposes only and should not be construed as limiting the scope of the invention in any form.

All publications, patents, and patent applications referenced in this specification are incorporated herein by reference. Although the above invention has been described in some detail by way of illustration and example in order to avoid ambiguity, it will be quite clear to those skilled in the art based on the ideas disclosed in this invention that certain changes and modifications can be made without deviating from the essence and scope of the attached options. implementation of the invention.

Experimental part.

Example 1 In silico humanization of antibody variable domain sequences.

The sequences of the heavy and light chain variable domains of the anti-TRBV9-2 antibody, the amino acid sequences of which are shown in SEQ ID Nos: 8 and 10, were used as parental (reference) sequences.

Amino acid sequences of heavy and light chain variable domains were compared with a pool of germline sequences of human immunoglobulin variable domains, germline sequences of rat immunoglobulin variable domains, sequences of mature human and rat antibodies obtained both from open sources and from a donor library provided by Biocad (Russia) . The Ylab software package (Biocad, Russia) was used for analysis.

During the analysis, in the sequences of the variable domains of the analyzed antibodies, the positions and their combinations were established that are most characteristic of animals and not characteristic of humans. At the same time, the combinations of amino acids that are most often present in human antibodies at these positions were established. Based on the data obtained, the design of artificial sequences of variable domains containing substitutions that increase the degree of humanization of the antibody was carried out.

Codon optimization of the nucleotide sequences encoding the proposed amino acid variants was also carried out in order to express the humanized antibody in the CHO cell line. Humanized nucleotide sequences of heavy and light chain variable domains (SEQ ID Nos: 15 and 17) were synthesized de novo and cloned into pEE-HC, pEE-CK vectors, IgG1 format (Xu et al. Front. Chem. Sci Eng. 2015, 9(3): 376-380) for the SalI/NheI and SalI/BsiWI restriction sites, respectively.

The nucleic acid sequences of the resulting light and heavy chains were verified by Sanger sequencing.

For further work, the MA-042 antibody was selected, the amino acid and nucleotide sequences of the light and heavy chains of which are shown in SEQ ID Nos: 19-22.

The MA-042 antibody includes heavy and light chain variable domains that have the amino acid sequences shown in SEQ ID NOs: 16 and 18.

The degree of humanization of the heavy chain variable domain of the MA-042 antibody was 87%, and the degree of humanization of the light chain variable domain was 85% (Table 1). The heavy chain constant domain is represented by the IgG1 allotype Gm3 format.

Table 1. Comparison of the degree of humanization of the variable domains of the parent antibody and antibody MA-042

Antibody The degree of humanization of the variable domain of the heavy chain, % The degree of humanization of the variable domain of the light chain, % TRBV9-2 72 69 MA-042 87 85

Example 2 Obtaining a recombinant antibody and determining its affinity.

Vectors containing nucleic acids encoding the light and heavy chains of the MA042 antibody, obtained as described in Example 1, were generated in E. coli cells and purified using a kit for purification of plasmid DNA manufactured by Qiagen (Germany) and used for transfection of the CHO-cell line. Fut8 with linear polyethyleneimine (PEI MAX, Polysciences, USA) according to the manufacturer's instructions. The resulting reaction mixtures were incubated at 37°C on a shaker. 9 days after transfection, the culture fluid was separated from the cells by filtration through a filter with a pore size of 0.5/0.22 μm. The culture fluid after filtration was used to isolate antibodies using affinity chromatography on PreDictor RoboColumn MabSelect SuRe columns of 0.2 ml (GE Healthcare, USA) equilibrated with phosphate-buffered saline (PBS, pH 7.4). The column was then washed with 5 volumes of PBS. The carrier-bound protein was eluted using 0.1 M glycine buffer pH 3. The main peak containing the protein was collected and the pH was adjusted to neutral with 1 M Tris buffer (pH 7.5). All stages were carried out at a flow rate of 110 cm/h. Next, the protein was transferred into PBS (pH 7.4) using dialysis, filtered through a filter with a diameter of 0.22 μm, and transferred into new sterile tubes.

The quality of isolation was assessed using 12% PAGE-electrophoresis under denaturing conditions. Quantification was carried out by measuring on a NanoDrop2000 microspectrophotometer at 280A. The isolated protein was stored at -70°C.

The antibody affinity was determined using an OctetRed 96 instrument (ForteBio, USA). The antigen at a concentration of 20 μg/mL was immobilized on the surface of AR2G sensors (ForteBio) according to the standard protocol according to the manufacturer's instructions. The analysis was carried out at 30°C using PBS containing 0.1% Tween-20 and 0.1% BSA as working buffer. After the baseline was written in the buffer solution, the sensors were immersed in the wells with the antibody solution for 300 s, where the association of the complex occurred. Then the dissociation of the complex in the buffer solution was detected for 600 seconds.

Binding curves minus the reference signal were analyzed using Octet Data Analysis (version 9.0) according to a standard procedure using a 1:1 Global interaction model. The data obtained (Table 2) showed that the antibody specifically and with high affinity binds to the human antigen.

Table 2. Affinity characterization of the MA-042 antibody

Antibody KD (M) kon(l/Ms) kdis(l/s) Full R ^A 2 MA-042 <1.0E-12 ZD9E+05 <1.0E-07 0.9758

Example 3. Obtaining a cell line that stably produces an antibody in IgG1 format, and the production of antibodies.

The heavy and light chain sequences of the MA-042 antibody were obtained as described in Example 1 and cloned into pSX vectors at the HindIII, XbaI restriction sites. The resulting plasmids were generated in E. coli cells and isolated using a BenchPro 2000 device (Life Technology, USA) according to the manufacturer's instructions in an amount of 600-700 μg. Plasmids were linearized overnight with PvuI endonuclease, then precipitated with ethanol, the precipitate was dissolved in water, the concentration in the final volume was 900-1100 ng/μl.

- 20 041932

The CHO-K1-S cell line was cultivated in Ham's F12 Gibco medium (Thermo, USA). Transfection with genetic constructs containing the coding sequences of MA-042 chains was performed using electroporation on a Nucleofector™ device (Lonza, Switzerland) according to the manufacturer's protocol.

The next day after transfection, antibiotic selection of transfected cells was carried out for 24 days by adding puromycin (final concentration 7.2 μg/ml) and hygromycin B (final concentration 640 μg/ml) to the medium. Next, structurally homogeneous, antibiotic-resistant cell clones expressing MA-042 at a high level were selected.

CHO-K1-S expressing MA-042 was cultivated using Ham's F12 Gibco serum-free medium (Thermo, USA) supplemented with 25-100 μM 2-deoxy-2-fluoro-L-fucose (CarboSynth, Great Britain).

The production of monoclonal antibody MA-042 for preclinical studies was carried out in a HyClone single-use bioreactor fermenter (Thermo Fisher Scientific) with a working volume of 50 liters. Producer cells were removed from the culture liquid using a Millistak SONS depth filter (Merck-Millipore, USA). The primary purification of the antibody from the clarified culture liquid was carried out on an affinity sorbent with protein A. Specific elution of the target protein was carried out under acidic conditions pH 3.3-3.8 in glycine buffer. The resulting eluate was kept in acidic pH for 30-60 minutes for viral inactivation, and then neutralized with 1M Tris-HCl solution to pH 6.5-7.0. To remove possible impurities (DNA, producer cell proteins, cleaved ligand of the affinity sorbent, aggregates and fragments of antibodies), the final chromatographic purification in the breakthrough mode was carried out on a CaptoAdhere sorbent (GE HealthCare LifeSciences, USA). buffer with a pH of 6.5-7.0 at a low conductivity value (<3 mS/cm ² ).

The purified protein was subjected to antiviral filtration using a Viresolve PRO filter kit (Millipore, USA), concentration and diafiltration against a final buffer containing acetate buffer (pH 5.0-5.5) and trehalose.

Example 4 Use of an antibody for specific binding to TCR of the TRBV9 family.

Monoclonal antibodies MA-042, obtained as described in example 3, were used to sort subpopulations of lymphocytes. Antibodies were labeled with fluorescein using the fluorescein isothiocyanate reagent (Sigma, USA) according to the manufacturer's protocol. The amount of fluorophores that reacted with antibody molecules was controlled by the ratio of the absorption spectrum at wavelengths of 495/280 nm.

T-lymphocytes were obtained from the peripheral blood of a healthy donor. Blood was collected in Vacuette tubes with EDTA (2x9 ml), mononuclear fraction according to the standard method described in (Kovalchuk L. V. et al. Immunology: workshop -2010. -176 s). After isolation, cells were transferred to phosphate buffered saline (PBS) containing 0.5% bovine serum albumin (BSA) and 2 mM EDTA. The total number of cells and their viability were determined by the trypan blue staining method as described by H.R. Lang. (Stimulation of lymphocytes M.: Medicine, 1976. -288 s). An equal volume of 0.1% trypan blue solution was added to the cell suspension, then stained (dead) and unstained blue cells were counted in the Goryaev chamber. Based on these data, a conclusion was made about the percentage of dead cells in the test sample.

To confirm the selectivity of MA-042 binding to the target population of T-lymphocytes carrying TCR belonging to the TRBV9 family on their membrane, 500 thousand cell aliquots from the mononuclear fraction were added to PBS buffer containing 0.5% bovine serum albumin (BSA), 2 mM EDTA pH8, MA-042 antibodies labeled with FITC, CD3-eFluor405 (T-lymphocyte marker) (eBioscience, USA) and CD45-PC5 (eBioscience, USA) (total leukocyte marker) at a concentration of 100 ng/ml. Reaction mixtures with a volume of 50 μl were incubated at room temperature for 30 min, after which the cells were washed with PBS buffer with 0.5% BSA 2 mM EDTA. The cells after the staining procedure were used for sorting using flow cytometry (FACSARIAIII, USA, Fig. 1). The use of these markers for staining made it possible to isolate cells of the target population that carried TRBV9+, CD3+, CD45+ on their surface, and also to obtain cells from the negative population, that is, corresponding to the TRBV9-, CD3+, CD45+ immunophenotype. Cells obtained in duplicate from the TRBV9+ and TRBV9- populations were used for total RNA isolation and sequencing of TCR beta chain sequences.

The resulting cell fractions were placed in RLT buffer (Quagen, Germany) and RNA was isolated from them using Quiagen RNAeasy mini kit #217004 (Quagen) according to the manufacturer's protocol. cDNA was synthesized on the isolated RNA template, and fragments of the T receptor beta chain were amplified according to the protocol described by Britanova et al (J Immunol, 2016, 196 (12) 5005-5013) using the Mint cDNA synthesis kit (Evrogen, Russia). Illumina adapters (USA) were ligated to the accumulated amplicons and sequenced on the MiSeq Illumina platform according to the protocol of the sequencer manufacturer. Sequencing data were analyzed using the MiGEC, MiXCR and

- 21 041932

VDJtools presented on the website on the Internet: https://milaboratory.com. Analysis of the obtained repertoires of TCR beta chains showed that the libraries obtained as a result of sorting with the help of the MA-042 antibody were enriched by 93% with sequences that were encoded by the gene segment

TRBV9. Whereas in the repertoires of the beta chains of the TRBV9-negative fraction, sequences containing TRBV9 were not found.

Example 5 Functional activity of the MA-042 antibody in vitro.

Monoclonal antibody MA-042 was obtained as described in example 3. Mononuclear fraction of human blood was obtained as described in example 4.

The cytotoxic activity of MA-042 was determined using the cytofluometric method. An aliquot of cells from the mononuclear fraction was used to count the total number of cells, viability was determined by the ability to stain with trypan blue. To determine the effectiveness of cytotoxicity, 3-4x10 ⁶ cells were incubated in PBS buffer for an hour with the MA-042 antibody at a concentration of 20, 40, 100, 200, 500 ng/ml and 1 μg/ml; incubation was performed as a null control. without adding antibody. After incubation, cells were washed twice with PBS, transferred to RPMI medium containing 10% human serum, and incubated for 72 hours in a CO ₂ incubator. Next, the cells were centrifuged and stained with CD4-PE, CD3-eFluor405 (eBioscience, USA), and MA-042-FITC antibodies. Stained cell samples were used in cytometric analysis on a FacsAria III cell sorter (BD, USA). The cytotoxic effect was assessed by a progressively decreasing proportion of TRBV9-positive cells in the population of CD3+ lymphocytes, a decrease in the number of target cells correlated with an increase in the concentration of the MA-042 antibody until the target population was completely eliminated. Complete disappearance of the target population upon staining with MA-042 was observed at an antibody concentration of 500 ng/ml. In zero control, the percentage of TRBV9 T-lymphocytes remained at the same level. A typical flow cytometry result is shown in Fig. 2. Thus, the EC ₅₀ value was obtained (half-maximum effective concentration, which means the concentration of an antibody that causes an effect equal to half the maximum possible for a given antibody after a certain period of time) for the MA-042 antibody, it was 100 ng / ml (Fig. 3 ).

Example 6 Functional activity of the MA-042 antibody in vivo.

Monoclonal antibody MA-042 was obtained as described in example 3. In order to assess the specific activity and the main pharmacokinetic parameters, a single intravenous administration of MA-042 to rhesus monkeys (Macaca mulatto) was carried out. The experiment was carried out on mature male rhesus monkeys weighing 4-10 kg, provided by the Research Institute of Medical Primatology. After admission, the animals were kept in quarantine for 30 days.

To form a cohort of experimental and control animals, the proportion of TRBV9+ lymphocytes in the peripheral blood was preliminarily assessed. Venous blood of animals was collected in 4 ml vacuum tubes (Vacuette, Greiner Bio-One, Austria) with EDTA. Next, the mononuclear cell fraction was isolated in a ficoll gradient (1.077 g/cm ³ PanEco, Russia). For immunophenotyping, 100 thousand cells were used, to which 1 μl of commercial antibodies anti-CD8 PE/Cy5 (clone RPA-T8) (BioLegend, USA), anti-CD4-Alexa Fluor 488 (clone S3.5) (Thermo Fisher, USA) were added. ) and anti-CD2-PerCP Cy 5.5 (clone RPA-2.10) (BioLegend, USA), anti-TcRVβ1 (TRBV9)-PE (Beckman Coulter, USA) were incubated at room temperature for 20 minutes and washed with an equal volume of Hanks medium 2 times. The samples were analyzed using a FACSAria III cell sorter (USA).

At the time of the experiment, the selected animals were kept in individual metal cages equipped with feed bins, label holders, the number of animals in one cage was 1 pc. The food ration consisted of a complete feed, fruits, vegetables according to the average feed consumption standards. Animals received water from the central water supply.

According to the results of cytometric analysis using antibodies to the main surface determinants of lymphocytes (CD4, CD8, CD2), the animals were divided into three groups of 4 each, including the control group. The control group of animals received intravenous human immunoglobulin (Immunovenin, Microgen, Russia).

To conduct a comparative analysis of the effect of the drug at different doses on the percentage (%) content of TRBV9+ T cells in the peripheral blood of rhesus monkeys (Macaca mulatta), two experimental groups were administered MA-042 at doses of 1 and 10 mg per animal, respectively. Immunovenin was diluted with sterile water according to the instructions and administered at a concentration of 10 mg per animal. MA-042 was diluted with Dulbecco's phosphate-buffered saline solution (DPBS) without calcium and magnesium. The drugs were administered in a volume not exceeding 5 ml per injection into the cubital vein of the right forelimb.

The observation period was 42 days. Blood samples were taken as indicated in Table. 3. Immunophenotyping and sample analysis were performed as described above.

- 22 041932

Table 3 Whole blood sampling scheme for determining the percentage (%) of TRBV9+ among T cells.

A week Day Hour A comment 1 1 0 Background (before the 1st introduction) 1 4 72 72 hours after injection 1 7 144 144 hours after administration 3 15 336 336 hours after administration 4 25 576 576 hours after administration 6 42 984 984 hours after administration

As a result, almost complete disappearance of TRBV9+ in the peripheral blood of animals was detected 72 hours after the administration of MA-042 at both concentrations. 336 hours after administration of the drug at a concentration of 1 mg/animal, the proportion of TRBV9+ lymphocytes was detected. In animals that received the drug at a dose of 10 mg, TRBV9+ lymphocytes were not detected. In 42 days after administration, TRBV9+ lymphocytes were not detected in the experimental groups in any case; in the control group, the level of TRBV9+ lymphocytes remained at the same level as before the start of the experiment.

Example 8 Preparation of a pharmaceutical composition containing an antibody according to the invention.

The pharmaceutical composition was obtained by standard methods, which are known from the prior art.

The components of the pharmaceutical composition are shown in table. 4.

Table 4. The concentration of the components of the pharmaceutical composition

Component Concentration Antibody MA-042 10-50 mg/ml Citrate buffer 10 mM to pH 6.0-7.0 Sodium chloride 50-150 mM sucrose, trehalose 0.3-0.5% Water for injections up to 1 ml.

Example 9 A kit containing a pharmaceutical composition with antibodies.

For the production of kits with a dosage form containing the composition with the MA-042 antibody, the pharmaceutical composition obtained according to example 5 is sealed into 1 ml ampoules or syringes under sterile conditions, labeled and packaged in containers made of plastic or cardboard material.

Also, instructions for use are included in the container with the ampoule.

- 23 041932

Sequence listing.

<110> JSC BIOCAD JSC BIOCAD <120> Monoclonal antibodies that specifically bind to the beta chain region of the TRBV-9 family of the human T-cell receptor, and methods for their use <130> MA042.docx <160> 22 <170> : Patentin version 3.5 < 210> 1 < 211> 5 < 212> PRT < 213> Artificial < 220>

<223> HCDR1 sequence of parent antibody TRBV9-2 <400> 1

Asp Tug Leu Vai His

5 .

< 210> 2 < 211> 17

W) PRT _L ill <213> Artificial <220>

<223> HCDR2 sequence of parent antibody TRBV9-2 <400>

Trp lie Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe Glu

Gly < 210> 3 < 211> 13 < 212> PRT < 213> Artificial <220>

<223> HCDR3 sequence of parent antibody TRBV9-2 <400> 3

Ser Trp Arg Arg Gly Leu Arg Gly He Gly Phe Asp Tyr 15 10 < 210> 4 < 211> 11 < 212> PRT < 213> Artificial

- 24 041932 <22θ>

<223> LCDR1 sequence of the parent antibody TRBV9-2 <400> 4

Lys Ala Ser Lys Ser He Asn Lys Tyr Leu Ala

IS 10 < 210> 5 < 211> 7 < 212> PRT < 213> Artificial < 220 >

< 223> LCDR2 sequence of the parent antibody TRBV9-2 < 400 > 5

Asp Gly Ser Thr Leu Gin Ser < 210> 6 < 211> 9 < 212> PRT < 213> Artificial <220>

<223> LCDR3 sequence of the parent antibody TRBV9-2 <400> 6

Gin Gin His Asn Glu Tyr Pro Pro Thr . . S < ' < 210> 7 < 211> 366 < 212> DNA < 213> Artificial <220>

< 223> Нуклеотидная последовательность вариабельного домена тяжелой цепи родительского антитела TRBV9-2 < 4В0> 7 caaatacaac tggtgcagag cgggccagaa ttgagagaac ccggagaatc tgtgaagctg60 agttgtaagg ccagcggata cactttcact gactatctcg tgcactgggt gaaacaggct120 cccggtaagg gattgaaatg gatgggatgg atcaatactt ataccggcac acctacatat180 gcagacgatt tcgaggggcg atttgtgttc agtttggagg cctctgccag cacggcgaac240 ctgcagatat cgaatctcaa gaatgaggac accgccacgt atttctgcgc tagatcttgg300 agacgcggat tgagaggtat cggattcgac tactggggac aaggcgtctt cgtgactgta360 tcatcc366 <210> 8 <211> 122

-25 041932 < 212> PRT < 213> Artificial < 220> :' < 223> Amino acid sequence of the heavy chain variable domain of the parental TRBV9-2 antibody < 400> 8·

Gin Not Gin Leu Vai Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu

IS 1015

Ser Vai Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 2530

Leu Vai His Trp Vai Lys Gin Ala Pro Gly Lys Gly Leu Lys Trp Met 35 4045

Gly Trp He Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 5560

Glu Gly Arg Phe Vai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn 65 70 7580

Leu Gin He Ser Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095

Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly He Gly Phe Asp Tyr Trp

100 105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser

115120 < 210> 9 < 211> 321 < 212> DNA < 213> Artificial <220>

< 223> Нуклеотидная последовательность вариабельного домена легкой цепи родительского антитела TRBV9-2 < 400> 9 gatgtacaga tgacacaatc accctacaac cttgctgctt cccctgggga aagtgtcagt60 atcaattgca aggcatcgaa gtcgatcaac aagtatcttg cgtggtatca gcagaagcca120 ggaaagccca acaagctcct gatctatgac ggctctacac tgcaatctgg cataccttcg180 cggttttctg gctcggggtc cgggactgac ttcactctta caatacgagg acttgaaccc240 gaagacttcg gcctgtatta ctgccagcag cacaatgagt atccacctac cttcggggct300 ggcaccaagt tggagcttaa g321 <210> 10

- 26 041932 <211> 107 <212> PRT <213> Artificial <220>

<223> Amino acid sequence of the light chain variable domain of the parent antibody TRBV9-2 <400> 10

Asp Val Gin Met Thr Gin Ser Pro Tyr Asn Leu Ala Ala Ser Pro Gly

5 1015

Glu Ser Val Ser lie Asn Cys Lys Ala Ser Lys Ser lie Asn Lys Tyr 20 2530

Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Pro Asn Lys Leu Leu lie 35 4045

Tyr Asp Gly Ser Thr Leu Gin Ser Gly He Pro Ser Arg Phe Ser Gly 50 5560

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr He Arg Gly Leu Glu Pro 65 70 7580

Glu Asp Phe Gly Leu Tyr Tyr Cys Gin Gin His Asn Glu Tyr Pro Pro 85 9095

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100105 < 210> 11 < 211> 639 < 212> DNA < 213> Artificial <220>

< 223> Нуклеотидная последовательность легкой цепи родительского антитела TRBV9-2 < 400> И gacgtgcaga tgacccagtc cccctacaac ctggccgcct cccccggcga gtccgtgtcc atcaactgca aggcctccaa gtccatcaac aagtacctgg cctggtacca gcagaagccc ggcaagccca acaagctgct gatctacgac ggctccaccc tgcagtccgg catcccctcc aggttctccg gctccggctc cggcaccgac ttcaccctga ccatcagggg cctggagccc gaggacttcg gcctgtacta ctgccagcag cacaacgagt acccccccac cttcggcgcc ggcaccaagc tggagctgaa gcgaactgtg gctgcaccat ctgtcttcat cttcccgcca tctgatgagc agttgaaatc tggaactgcc tctgtcgtgt gcctgctgaa taacttctat cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag gagagtgtca cagagcagga cagcaaggac agcaccgtca gccatcagg

120

180

240

300

360

420

480

540

-27041932 ctgagcaaag cagactacga gaaacacaaa gtctacgcct gcgaagtcac ccatcagggc 600 ctgtcctcgc ccgtcacaaa gagcttcaac aggggagag 639 < 210> 12 < 211> 213 < 212> PRT ( < 213> Artificial <220>

<223> Light chain amino acid sequence of parental TRBV9-2 antibody <400> 12

Asp Vai Gin Met Thr Gin Ser Pro Tyr Asn Leu Ala Ala Ser Pro Gly

1015

Glu Ser Vai Ser He Asn Cys Lys Ala Ser Lys Ser He Asn Lys Tyr 20 2530

Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Pro Asn Lys Leu Leu He 35 4Θ45

Tyr Asp Gly Ser Thr Leu Gin Ser Gly He Pro Ser Arg Phe Ser Gly 50 5560

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr He Arg Gly Leu Glu Pro 65 70 758Θ

Glu Asp Phe Gly Leu Tyr Tyr Cys Gin Gin His Asn Glu Tyr Pro Pro 85 9095

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Vai Ala Ala

100 105110

Pro Ser Vai Phe He Phe Pro Ser Asp Glu Gin Leu Lys Ser Gly

115 120125

Thr Ala Ser Vai Vai Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala

130 135140

Lys Vai Gin Trp Lys Vai Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin 145 150 155160

Glu Ser Vai Thr Glu Gin Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser

165 170175

Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Vai Tyr

180 185190

-28 041932

Ala Cys Glu Vai Thr His Gin Gly Leu Ser Ser Pro Vai Thr Lys Ser

195 200 205

Phe Asn Arg Gly Glu

210

<210> 13 <211> 1365 <212> DNA <213> Artificial <220> <223> Nucleotide sequence of the heavy chain of the parental TRBV9-2 antibody <400> 13 cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg 60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactggggt gaagcaggcc 120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 180 gccgacgact tcgagggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac 240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggcc tgaggggcat cggcttcgac tactggggcc agggcgtgtt cgtgaccgtg 360 tcctccgcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc 420 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 480 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 540 tcctcaggac tctactccct cagcagcgtg gtgactgtgc cctctagcag cttgggcacc 600 cagacctaca tctgcaacgt gaatcacaag ccagcaaca ccaaggtgga caagaaagtt 660 gagcccccga aatcttgtga caaaactcac acatgcccac cgtgcccagc acctgaactc 720 ctggggggac cgtcagtctt ccctcttcccc ccaaaaccca aggacaccct catgatctcc 780 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 840 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 900 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 960 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa 1020 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1080 cgggatgagc tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1140 agcgacatcg ccgtggagtgggagagcaat gggcagccgg agaacaacta caagaccacg 1200 cctcccgtgc tggactccga cggctccttc ttcctctaca gcaagctcac cgtggacaag 1260 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1320 cactacacgc agaagagcct ctccctgtct ccgggtaaat gataa 1365

-29 041932 < 210> 14 < 211> 453 < 212> PRT < 213> Artificial <220>

<223> Heavy chain amino acid sequence of parental TRBV9-2 antibody <400> 14

Gin Ue Gin Leu Vai Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu

1015

Ser Vai Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 2530

Leu Vai His Trp Vai Lys Gin Ala Pro Gly Lys Gly Leu Lys Trp Met 35 4045

Gly Trp He Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 5560

Glu Gly Arg Phe Vai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn 65 70 7580

Leu Gin He Ser Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095

Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly He Gly Phe Asp Tyr Trp

100 105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser Ala Ser Thr Lys Gly Pro

115 120125

Ser Vai Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr

130 135140

Ala Ala Leu Gly Cys Leu Vai Lys Asp Tyr Phe Pro Glu Pro Vai Thr

145 150 155160

Vai Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Vai His Thr Phe Pro

165 170175

Ala Vai Leu Gin Ser Ser Gly Leu Tyr Ser Leu Ser Ser Vai Vai Thr

180 185190

Vai Pro Ser Ser Ser Leu Gly Thr Gin Thr Tyr He Cys Asn Vai Asn

195 200205

His Lys Pro Ser Asn Thr Lys Vai Asp Lys Lys Vai Glu Pro Pro Lys

210 215220

- 30 041932

Ser Cys Asp Lys Thr His Thr

225 230

Cys Pro Pro Cys Pro Ala Pro Glu Leu

235 240

Leu Gly Gly Pro Ser Vai Phe

245

Leu Phe Pro Pro Lys Pro Lys Asp Thr

250 255

Leu Met lie Ser Arg Thr Pro 26@

Glu Vai Thr Cys Vai Vai Vai Asp Vai

265 270

Ser His Glu Asp Pro Glu Vai

275

Lys Phe Asn Trp Tyr Vai Asp Gly Vai

280 285

Glu Vai His Asn Ala Lys Thr

290 295

Lys Pro Arg Glu Glu Gln Tyr Asn Ser

300

Thr Tyr Arg Vai Vai Ser Vai

305 310

Leu Thr Vai Leu His Gln Asp Trp Leu

315 320

Asn Gly Lys Glu Tyr Lys Cys

325

Lys Vai Ser Asn Lys Ala Leu Pro Ala

330 335

Pro He Glu Lys Thr He Ser

340

Lys Ala Lys Gly Gln Pro Arg Glu Pro

345 350

Gln Vai Tyr Thr Leu Pro Pro

355

Ser Arg Asp Glu Leu Thr Lys Asn Gln

360 365

Vai Ser Leu Thr Cys Leu Vai

370 375

Lys Gly Phe Tyr Pro Ser Asp He Ala

380

Vai Glu Trp Glu Ser Asn Gly

385 390

Gln Pro Glu Asn Asn Tyr Lys Thr Thr

395 400

Pro Pro Vai Leu Asp Ser Asp

405

Gly Ser Phe Phe Leu Tyr Ser Lys Leu

410'415

Thr Vai Asp Lys Ser Arg Trp

420

Gln Gln Gly Asn Vai Phe Ser Cys Ser

425 430

Vai Met His Glu Ala Leu His

435

Asn His Tyr Thr Gln Lys Ser Leu Ser

440 445

Leu Ser Pro Gly Lys

450 <210> 15 <211> 366 <212> DNA

-31 041932 <213> Artificial <220>

< 223> Нуклеотидная последовательность вариабельного домена тяжелой цепи антитела МА-042 < 400> 15 caggtgcaac ttgttcagtc ggggagcgaa cttaagaagc caggggaaag tgtaaaagtg60 agctgcaaag cctcaggcta cacgtttacc gattatcttg tgcattgggt tagacaggct120 ccaggtcaag gactggaatg gatgggatgg atcaatacct atacagggac acccacatat180 gccgatgact ttgagggacg gtttgtcttc tcacttgata ccagtgtttc cactgctaac240 ctccagataa gcagcctgaa ggcagaggac accgccgttt atttctgcgc ccgatcatgg300 aggagaggct tgcgaggaat tggattcgat tactggggtc agggcacttt agtcactgtc360 tctagc366 < 210> 16 < 211> 122 < 212> PRT < 213> Artificial <220>

<223> MA-042 Heavy Chain Variable Domain Amino Acid Sequence <400> 16

Gin Vai Gin Leu Vai Gin Ser Gly Ser Glu Leu Lys Lys Pro Gly Glu

5 10 15

Ser Val Lys Vai Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

Leu Val His Trp Val Arg Gin Ala Pro Gly Gin Gly Leu Glu Trp Met

Gly Trp lie Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe

Glu Gly Arg Phe Val Phe Ser Leu Asp Thr Ser Val Ser Thr Ala Asn

Leu Gin He Ser Ser Leu Lys Ala Glu Asp Thr Ala Val Tyr Phe Cys

Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly lie Gly Phe Asp Tyr Trp

100

Gly Gin Gly Thr Leu Val Thr Val Ser Ser

- 32 041932 <210> 17 <211> 321 <212> DNA <213> Artificial <220>

<223> Nucleotide sequence of the light chain variable domain of antibody MA-042 <400> 17

gacatacaga tgactcaaag cccttattcg ctcagtgcgt cggtcggggga cagagtaacc 60 atcacctgca aggcgtcaaa gtcaatcaat aagtatctgg cgtggttcca gcagaagcca 120 ggaaagccta acaagctatt aatatacgat gggtctaccc tccaatccgg ggtcccttca 180 cgattttctg gaagcggctc aggaaccgat ttcacgctga ccatcagtag cttggagcct 240 gaggactttg ccacttatta ttgccagcag cacaacgagt atcctcccac cttcggacag 300 ggtacaaaac tggagatcaa g 321

<210> 18 <211> 107 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of the light chain variable domain of antibody MA-042 <400> 18 .....

Asp Not Gin Met Thr Gin Ser Pro Tyr Ser Leu Ser Ala Ser Vai Gly

1015

Asp Arg Vai Thr He Thr Cys Lys Ala Ser Lys Ser He Asn Lys Tyr 20 2530

Leu Ala Trp Phe Gin Gin Lys Pro Gly Lys Pro Asn Lys Leu Leu He 35 4045

Tyr Asp Gly Ser Thr Leu Gin Ser Gly Vai Pro Ser Arg Phe Ser Gly 50 5560

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu Glu Pro 65 70 . 75.80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gin Gin His Asn Glu Tyr Pro Pro 85 9095

Thr Phe Gly Gin Gly Thr Lys Leu Glu He Lys

100105 <210> 19 <211> 1356 <212> DNA

- 33 041932 <213> Artificial <220>

<223> Nucleotide sequence of the heavy chain of antibody MA-042 <400> 19 ......

caggtgcaac ttgttcagtc ggggagcgaa cttaagaagc caggggaaag tgtaaaagtg60 agctgcaaag cctcaggcta cacgtttacc gattatcttg tgcattgggt tagacaggct120 ccaggtcaag gactggaatg gatgggatgg atcaatacct atacagggac acccacatat180 gccgatgact ttgagggacg gtttgtcttc tcacttgata ccagtgtttc cactgctaac240 ctccagataa gcagcctgaa ggcagaggac accgccgttt atttctgcgc ccgatcatgg3Θ0 aggagaggcc tacgaggaat cggattcgat tactggggtc agggcacttt agtcactgtc360 tctagcgcta gcaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc420 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg480 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacagS40 tcctcaggac tctactccct cagcagcgtg gtgaccgtgc cctccagcag cttgggcacc600 cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caagagagtt660 gagcccaaat cttgtgacaa aactcacaca tgcccaccgt gcccagcacc tgaactcctg720 gggggaccgt cagtcttcct cttcccccca aaacccaagg acaccctcat gatctcccgg780 acccctgagg tcacatgcgt ggtggtggac gtgagccacg aagaccctga ggtcaagttc840 aactggtacg tggacggcgt ggaggtgcat aa tgccaaga caaagccgcg ggaggagcag900 tacaacagca cgtaccgtgt ggtcagcgtc ctcaccgtcc tgcaccagga ctggctgaat960 ggcaaggagt acaagtgcaa ggtctccaac aaagccctcc cagcccccat cgagaaaacc1020 atctccaaag ccaaagggca gccccgagaa ccacaggtgt acaccctgcc cccatcccgg1080 gaggagatga ccaagaacca ggtcagcctg acctgcctgg tcaaaggctt ctatcccagc1140 gacatcgccg tggagtggga gagcaatggg cagccggaga acaactacaa gaccacgcct1200 cccgtgctgg actccgacgg ctccttcttc ctctatagca agctcaccgt ggacaagagc1260 aggtggcagc aggggaacgt cttctcatgc tccgtgatgc atgaggctct gcacaaccac1320 tacacgcaga aaagcctctc cctgtccccg ggtaaa1356 < 210>20'...

< 211> 452 < 212> PRT < 213> Artificial < 220> ... . ..

<223> Heavy chain amino acid sequence of antibody MA-042 <400> 20'

Gin Val Gin Leu Val Gin Ser Gly Ser Glu Leu Lys Lys Pro Gly Glu 1 5 10 .15

- 34 041932

Ser

Vai

Lys

Vai 20

Ser

Cys

Lys

Ala

Ser 25

gly

Tyr

Thr

Phe

Thr 30

asp

Tyr

Leu

Vai

His 35

trp

Vai

Arg

gin

Ala

Pro

gly

gin

gly

Leu

Glu

trp

Met

gly

TRP 50

He

Asn

Thr

Tyr

Thr 55

gly

Thr

Pro

Thr

Tyr 60

Ala

asp

asp

Phe

Glu 65

Gly Arg

Phe

Vai

Phe 70

Ser

Leu

asp

Thr

Ser 75

Vai

Ser

Thr

Ala

Asn 80

Leu

Gin lie

Ser

Ser

Leu

Lys

Ala

Glu

Asp 90

Thr

Ala

Vai

Tyr

Phe 95

Cys

Ala

Arg

Ser

trp

100

Arg

Arg

gly

Leu

Arg

105

gly

He

gly

Phe

asp

110

Tyr

trp

gly

gin

gly

115

Thr

Leu

Vai

Thr

Vai

120

Ser

Ser

Ala

Ser

Thr

125

Lys

gly

Pro

Ser

Vai

130

Phe

Pro

Leu

Ala

Pro

135

Ser

Ser

Lys

Ser

Thr

140

Ser

Gly Gly

Thr

Ala

145

Ala

Leu

gly

Cys

Leu

150

Vai

Lys

asp

TuPhe

155

Pro

Glu

Pro

Vai

Thr

160

Vai

Ser

trp

Asn

Ser

165

gly

Ala

Leu

Thr

Ser

170

gly

Vai

His

Thr

Phe

175

Pro

Ala

Vai

Leu

gin

180

Ser

Ser

gly

Leu

Tyr

185

Ser

Leu

Ser

Ser

Vai

190

Vai

Thr

Vai

Pro

Ser

195

Ser

Ser

Leu

gly

Thr

200

gin

Thr

Tyr

I le cys

205

Asn

Vai

Asn

His

Lys

210

Pro

Ser

Asn

Thr

Lys

215

Vai

asp

Lys

Arg

Vai

220

Glu

Pro

Lys

Ser

Cys

225

asp

Lys

Thr

His

Thr

230

Cys

Pro

Pro

Cys

Pro

235

Ala

Pro

Glu

Leu

Leu

240

gly

gly

Pro

Ser

Vai

245

Phe

Leu

Phe

Pro

Pro

250

Lys

Pro

Lys

asp

Thr

255

Leu

Met

He

Ser

Arg

260

Thr

Pro

Glu

Vai

Thr

265

Cys

Vai

Vai

Vai

Asp 270

Vai

Ser

- 35 041932

His Glu Asp Pro Glu Vai Lys Phe Asn Trp Tyr Vai Asp Gly Vai Glu

275 280285

Vai His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr

290 295300

Tyr Arg Vai Vai Ser Vai Leu Thr Vai Leu His Gin Asp Trp Leu Asn

305 310 315320

Gly Lys Glu Tyr Lys Cys Lys Vai Ser Asn Lys Ala Leu Pro Ala Pro

325 330335 lie Glu Lys Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin

340 345350

Vai Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gin Vai

355 360365

Ser Leu Thr Cys Leu Vai Lys Gly Phe Tyr Pro Ser Asp He Ala Vai

370 375380

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro

385 390 395400

Pro Vai Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr

405 410415

Vai Asp Lys Ser Arg Trp Gin Gin Gly Asn Vai Phe Ser Cys Ser Vai

420 425430

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu

435 440445

Ser Pro Gly Lys

450 <210> 21 <211> 642 <212> DNA <213> Artificial .

<220>

<223> Nucleotide sequence of the light chain of antibody MA-042 <400> 21

gacatacaga tgactcaaag cccttattcg ctcagtgcgt cggtcgggga cagagtaacc 60 atcacctgca aggcgtcaaa gtcaatcaat aagtatctgg cgtggttcca gcagaagcca 120 ggaaagccta acaagctatt aatatacgat gggtctaccc tccaatccgg ggtcccttca 180 cgattttctggaagcggctc aggaaccgat ttcacgctga ccatcagtag cttggagcct 240

- 36 041932

gaggactttg ccacttatta ttgccagcag cacaacgagt atcctcccac cttcggacag 300 ggtacaaaac tggagatcaa gcgtacggtg gctgcaccat ctgtcttcat cttcccgcca 360 tctgatgagc agttgaaatc tggaactgcc tctgttgtgt gcctgctgaa taacttctat 420 cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag 480 gagagtgtca cagagcagga cagcaaggac agcacctaca gcctcagcag caccctgacg 540 ctgagcaaag cagactacga gtctacgcct gcgaagtcac ccatcagggc 600 ctgagctcgc ccgtcacaaa gagcttcaac aggggagagt gt 642 <210> 22 <211>214 <212>PRT <213> Artificial <220> <223> Amino acid MA-042 antibody light chain sequence <400> 22 Asp He Gin Met Thr Gin Ser Pro Tyr Ser Leu Ser Ala Ser Vai Gly

10 15

Asp Arg Vai Thr He Thr Cys Lys Ala Ser Lys Ser He Asn Lys Tyr 20 2530

Leu Ala Trp Phe Gin Gin Lys Pro Gly Lys Pro Asn Lys Leu Leu He 35 4045

Tyr Asp Gly Ser Thr Leu Gin Ser Gly Vai Pro Ser Arg Phe Ser Gly 50 55 60.

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr He Ser Ser Leu Glu Pro 65 70 7580

Glu Asp Phe Ala Thr Tyr Tyr Cys Gin Gin His Asn Glu Tyr Pro Pro 85 9095

Thr Phe Gly Gin Gly Thr Lys Leu Glu He Lys Arg Thr Vai Ala Ala

100 105110

Pro Ser Vai Phe lie Phe Pro Ser Asp Glu Gin Leu Lys Ser Gly

115 120125

Thr Ala Ser Vai Vai Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala

130 135140

Lys Vai Gin Trp Lys Vai Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin

145 150 155150

- 37 041932

Glu Ser Vai Thr Glu Gin Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170175

Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Vai Tyr 180 185190

Ala Cys Glu Vai Thr His Gin Gly Leu Ser Ser Pro Vai Thr Lys Ser 195 2002Θ5

Phe Asn Arg Gly Glu Cys

Claims (18)

CLAIM 1. A monoclonal antibody or antigen-binding fragment thereof that specifically binds to the beta chain region of the TRBV-9 family of the human T-cell receptor, comprising a heavy chain variable domain, the amino acid sequence of which is shown in SEQ ID NO: 16 and a light chain variable domain, the amino acid sequence which is shown in SEQ ID NO: 18. 2. A monoclonal antibody according to claim 1, which includes a heavy chain having the amino acid sequence of SEQ ID NO: 20 and a light chain having the amino acid sequence of SEQ ID NO: 22. 3. The monoclonal antibody of claim 2, which is a full length IgG antibody. 4. A nucleic acid that encodes a monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, wherein the antibody or antigen-binding fragment thereof specifically binds to the beta chain region of the TRBV9 family of the human T receptor. 5. An expression vector containing the nucleic acid according to claim 4. 6. A method for obtaining a host cell for obtaining an antibody or antigen-binding fragment according to any one of claims 1 to 3, including co-transformation of the cell with a vector according to claim 5. 7. A host cell for producing an antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, containing a nucleic acid according to claim 4. 8. A method for producing an antibody or its antigen-binding fragment according to any one of claims 1 to 3, which consists in cultivating the host cell according to claim 7 in a culture medium under conditions that ensure the production of said antibody, followed by isolation and purification of the resulting antibody. 9. Pharmaceutical composition for the prevention or treatment of a disease or disorder mediated by the beta chain region of the TRBV9 family of the human T-cell receptor, containing in a therapeutically effective amount an antibody or an antigen-binding fragment according to any one of claims 1 to 3, in combination with one or more pharmaceutical acceptable excipients. 10. Pharmaceutical composition according to claim 9, where said disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma. 11. Pharmaceutical composition for the prevention or treatment of a disease or disorder mediated by a human T-cell receptor carrying a beta chain of the TRBV9 family, containing in a therapeutically effective amount an antibody or an antigen-binding fragment according to any one of claims 1 to 3 and at least in a therapeutically effective amount of one other therapeutically active compound. 12. The pharmaceutical composition according to claim 11, where said disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma. 13. Pharmaceutical composition according to any one of claims 11-12, wherein the other therapeutically active compound is selected from small molecule, antibody, or steroid hormones. 14. A method of inhibiting the biological activity of a T cell receptor whose beta chain belongs to the TRBV9 family in a subject in need of such inhibition, comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof according to any one of claims 1-3. 15. A method of treating a disease or disorder mediated by a human T-cell receptor carrying a beta chain of the TRBV9 family, comprising administering to a subject in need of such treatment an antibody or antigen-binding fragment thereof according to any one of claims 1 to 3 or a pharmaceutical composition according to claim 9 -13 in a therapeutically effective amount. 16. A method of treating a disease or disorder according to claim 17, wherein the disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma. 17. The use of an antibody or antigen-binding fragment according to any one of claims 1-3 or far- - 38 041932 a pharmaceutical composition according to any one of claims 9 to 13 for treating, in a subject in need of such treatment, a disease or disorder mediated by the human T-cell receptor carrying the beta chain of the TRBV9 family. 18. Use according to claim 17, where the disease is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.