EA041880B1 - MONOCLONAL ANTIBODIES AND METHODS FOR THEIR APPLICATION - Google Patents

Description

Technical field

The invention relates to the field of biotechnology and biomedicine, namely to antibodies or their antigen-binding fragments, as well as their use. More specifically, the present invention relates to monoclonal antibodies that specifically bind to the human T-cell receptor family. The invention also relates to a nucleic acid encoding the antibody or an antigen-binding fragment thereof, an expression vector, a method for producing the antibody, and the use of the antibody for the treatment of diseases or disorders associated with the human T-cell receptor family.

Prior Art

In the treatment of human autoimmune diseases, drugs based on antibodies against the main mediators of the inflammatory process, such as TNFalpha, IL1, IL6, IL17, IL23, have recently become widely used (van der Heijde D et al., Ann Rheum Dis. 2011 Jun; 70 (6):905-8, Baeten D, et al., N Engl J Med. 2015 Dec 24;373(26):2534-48). Monoclonal antibodies with immunomodulatory properties against the CD3 and CD4 receptor complexes are at the stage of clinical research for the treatment of autoimmune diseases, (Kuhn C. and Weiner L., Immunotherapy 2016 Jul; 8(8):889-906; Helling B. et al., Immunology and Cell Biology 2015 Apr; 93(4):396-405; Konig M. et al., Front Immunol 2016 Jan 25; 7:11). However, it has been shown that the use of such drugs, although it leads to a decrease in inflammation, does not stop the development of the disease and does not directly affect the cause of the disease - autoreactive T lymphocytes (Haroon N et al., Arthritis Rheum. 2013 Oct; 65(10):2645 -54., Duarte J. et al., PloS One 2010 May 10;5(5):e10558; Konig M. et al., Front Immunol 2016 Jan 25; 7:11).

Despite the success in the symptomatic treatment of ankylosing spondylitis (AS, Bechterew's disease) using monoclonal antibodies, an effective drug has not yet been obtained that can selectively and long-term suppress the autoimmune response and stop the progression of AS. Thus, an urgent task is to create antibodies that allow the removal of autoreactive clones of T-lymphocytes from the body of patients with AS, the appearance of which is associated with the development of the disease.

It is known that the most important role in the emergence of autoreactive clones of T-lymphocytes is played by the interaction of the antigen-recognizing T-cell receptor (TCR) with proteins of the major histocompatibility complex (MHC, HLA), which present on their surface processed peptides of intracellular proteins or proteins of pathogenic organisms. A number of autoimmune diseases are associated with the presence of a specific variant of the HLA gene in humans. Thus, the HLA-B27 allele is associated with AS, reactive arthritis, and Crohn's disease. The risk of developing autoimmune diseases in carriers of certain HLA allelic variants can be explained by the preferential presentation by these alleles of certain peptides that are autoantigens, the immune response against which initiates the development of an autoimmune disease. One of the possible mechanisms for the occurrence of an autoimmune reaction is the presentation by molecules of the histocompatibility complex of peptides from proteins of bacterial or viral origin, homologous to the body's own peptides, which can lead to an immune response against self antigens due to cross-reactivity.

It is known from the prior art that the T cell receptor (TCR) sequence is a marker for identifying a T-lymphocyte clone involved in the pathogenesis of an autoimmune disease. Subunits of T-cell receptors are structurally related to the immunoglobulin superfamily and are formed from several gene segments. The variable regions of the TCR form the antigen-binding center of the TCR. This means that they are clone-specific, i.e. differ in T-lymphocytes that react to different antigens.

According to the amino acid homology of the variable (V) gene segments that make up the TCR variable domain, T-cell receptors are divided into different families. According to the IMGT nomenclature, there are 26 different families for the beta chain and 41 families for the alpha chain (Turner SJ et al., Nature Reviews Immunology 2006, V.6, 883-894). To determine the TCR chain family, a multiple alignment of the tested amino acid sequence with known TCR chain sequences is used, information about which is summarized in the IMGT database (The international ImMunoGeneTics information system, Lefranc M-P., Nucl Acids Res 2001; 29:207-209), available in the Internet at http://www.imgt.org. Multiple alignment and TCR chain family determination can be performed using the IgBlast software package.

A consensus variant of autoimmune TCCs in AS has been described, it has been shown that it is present in the synovial fluid and peripheral blood in patients with AS and is absent at the same depth of analysis in healthy donors, regardless of the status of the HLA*B27 allele (Faham M. et al., Arthritis Rheumatol 2017;69(4):774-784; Komech E et al. 12th EJI-EFIS Tatra Immunology Conference; 2016 Sep 3-7; Strbske Pleso, Slovakia. Abstract book p. 39). These TCRs belong to the TRBV9 family (according to the IMGT nomenclature).

It has been shown that T cell receptors carrying beta chains of the TRBV9 family are also involved in the development of such an autoimmune disease as celiac disease (Petersen J et al., J Immunol. 2015; 194(12): 6112-1 041880

22). They are also found on the surface of T cells prone to magnification in T-cell lymphomas and T-cell leukemias, including T-cell lymphoma caused by the virus.

Epstein-Barr (EBV) (Toyabe S et al., Clin Exp Immunol. 2003; 134(1): 92-97).

The closest analogues of the present invention are monoclonal antibodies W112 and 2D1 to the beta chain regions of the human T receptor variable domains belonging to the TRBV5-3 TRBV8-1 families, which were described in a patent application (WO 9006758) as a tool for the diagnosis and therapy of rheumatoid arthritis. These monoclonal antibodies recognize, respectively, 0.3-5% of peripheral T lymphocytes carrying TRBV5-3 and 0.5-13% of peripheral T lymphocytes carrying TRBV8-1. The basis for the use of monoclonal antibodies specific to the regions of beta chains of T-receptors was the results of many studies demonstrating the involvement of T-lymphocytes in the pathogenesis of rheumatoid arthritis. In particular, these articles by F.M. Brennan et al., Clin Exp Immunol. 1988 Sep; 73(3): 417-423, which demonstrated an increase in the percentage of TRBV5-carrying TRBV8 T lymphocytes in synovial samples from patients suffering from rheumatoid arthritis compared to healthy donors.

Also described for the diagnosis and therapy of rheumatoid arthritis are monoclonal antibodies that interact with the epitope of the VB3.1 variable region of the human T-cell receptor (WO 9405801), which interact with the TCR V(beta)3.1 subfamily.

The main disadvantage of the approaches described in patents WO 9405801 and WO 9006758 for the treatment of rheumatoid arthritis is the lack of convincing evidence of an association between pathogenesis and a particular beta chain variable segment family.

Also described are monoclonal antibodies that specifically recognize the beta chain of the 13th rat TRK family. It has been shown in model animals that these antibodies can preventively remove a small population of T cells whose T receptor contains the VB13 beta chain (VB13+ T cells), and this procedure has been shown to protect against the development of type I diabetes in rats predisposed to this disease. line, and also significantly reduces the risk of developing virus-induced diabetes (Zhijun Liu et al., Diabetes. 2012 May; 61(5): 1160-1168). At the same time, depletion of T cells whose T-receptor contains another family of beta chains (VB16) does not differ in results from control groups. It is important to note that even the first administration of a monoclonal antibody against VB13 leads to a 60% decrease in the number of VB13+ T cells in the spleen of rats.

All described analogs do not bind to TCRs that belong to the TRBV9 family, and are not suitable for the treatment of AS and other diseases associated with TCRs that belong to the TRBV9 family.

Monoclonal antibodies suitable for the elimination of T cells carrying TCR of the TRBV9 family, which can be used in the treatment of AS and celiac disease, have not been described.

Brief description of the invention

The invention is directed to the creation of antibodies that can be used to eliminate T cells carrying TCRs of the TRBV9 family, in particular, for the treatment of AS, celiac disease and malignant blood diseases, in the pathogenesis of which TCRs of the TRBV9 family are involved.

The present invention relates to monoclonal antibodies and antigen-binding fragments thereof, which are capable of specifically binding to the beta chain region of the TRBV9 family of the human T receptor. Antibodies according to the invention can be used as a drug for the treatment of autoimmune and oncological diseases, the pathogenesis of which involves TCR belonging to the TRBV9 family, such as AS, celiac disease and some T-cell lymphomas and T-cell leukemias.

The antibodies and antigen-binding fragments of the present invention are characterized in that:

1) the variable domain of their heavy chain (VH) contains 3 hypervariable regions HCDR1, HCDR2 and HCDR3, where

HCDR 1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1,

HCDR 2 has the amino acid sequence of SEQ ID NO: 2

HCDR 3 has an amino acid sequence selected from the group SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6;

2) their light chain variable domain (VL) contains 3 hypervariable regions LCDR1, LCDR2 and LCDR3, in which

LCDR 1 has the amino acid sequence of SEQ ID NO: 7,

LCDR 2 has the amino acid sequence of SEQ ID NO: 8,

LCDR 3 has the amino acid sequence of SEQ ID NO: 9.

Hereinafter, when determining the CDR of antibodies, the known nomenclature of Kabat is used, unless otherwise specified.

The antibodies of the invention may be chimeric, humanized or human antibodies. In some embodiments, the antibodies of the present invention contain human-specific constant regions and structural components, but have a rat-specific variable domain.

- 2 041880

In some embodiments, the light chain variable domain of an antibody has the amino acid sequence of SEQ ID NO: 11, and the heavy chain variable domain of an antibody of the present invention has an amino acid sequence selected from the group of SEQ ID NO: 13, SEQ ID NO: 15, SEQ

ID NO: 17, SEQ ID NO: 19.

Also provided is an antibody whose light chain variable domain amino acid sequence is substantially similar (e.g., at least 90% identical) to the sequence shown in SEQ ID NO: 11.

Also provided is an antibody whose heavy chain variable domain amino acid sequence is substantially similar (e.g., at least 90% identical) to a sequence selected from the group of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19.

In some embodiments, an antibody of the invention comprises a light chain whose amino acid sequence is substantially similar to SEQ ID NO: 29 and a heavy chain whose amino acid sequence is substantially similar to a sequence selected from the group of SEQ ID NO: 21, SEQ ID NO: 23 , SEQ ID NO: 25, SEQ ID NO: 27.

In some embodiments, the monoclonal bodies of the invention are full-length human IgG antibodies, such as IgG1 or IgG2 or IgG3 or IgG4.

Also provided are nucleic acids that encode the heavy and light chain variable domains of an antibody of the invention, nucleic acids that encode the heavy and light chains of antibodies of the invention, and functional antibody fragments.

Also provided are expression cassettes and expression vectors comprising the nucleic acid of the present invention and the regulatory elements necessary for the expression of the nucleic acid in the selected host cell. The expression vector or cassette can be present in the host cell as an extrachromosomal element or integrated into the cell's genome by introducing (by transfection) said expression cassette or vector into the cell.

In addition, cells and stable cell lines comprising the nucleic acids, vectors or expression cassettes of the present invention, and methods for producing the same are provided.

Also provided is a method for producing the above antibody or its antigen-binding fragment, which consists in culturing the above host cell in a culture medium under conditions that ensure the production of the specified antibody. In some embodiments, the method includes subsequent isolation and purification of the resulting antibody.

Also provided is a pharmaceutical composition for preventing or treating a disease or disorder mediated by the beta chain region of the TRBV9 family of the human T receptor, comprising the above antibody or antigen-binding fragment thereof, in combination with one or more pharmaceutically acceptable excipients.

In one embodiment, the pharmaceutical composition is intended for the prevention or treatment of a disease or disorder selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.

Also provided is a pharmaceutical combination for the prevention or treatment of a disease or disorder mediated by the human T-cell receptor carrying the beta chain of the TRBV9 family, comprising the above antibody or antigen-binding fragment and at least one other therapeutically active compound.

In one embodiment, the pharmaceutical combination is for the prevention or treatment of a disease or disorder selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.

In one embodiment, the pharmaceutical combination includes another therapeutically active compound selected from a small molecule, an antibody, or steroid hormones, such as corticosteroids.

Also provided is a method for inhibiting the biological activity of a T cell receptor whose beta chain belongs to the TRBV9 family in a subject in need of such inhibition, comprising administering to the subject an effective amount of the above antibody or antigen-binding fragment thereof.

Also provided is a method for treating a disease or disorder mediated by a human T-cell receptor carrying a beta chain of the TRBV9 family, comprising administering to a subject in need of such treatment, the above antibody or antigen-binding fragment or the above pharmaceutical composition, in a therapeutically effective amount.

In one embodiment of the method for treating a disease or disorder, the disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma.

Also provided is the use of the above antibody, or an antigen-binding fragment thereof, or the above pharmaceutical composition, for the treatment, in a subject in need of such treatment, of a disease or disorder mediated by the human T-cell receptor carrying the beta chain of the TRBV9 family.

In one application, the disease is selected from the group: ankylosing spondylitis,

- 3 041880 celiac disease, T-cell leukemia, T-cell lymphoma.

The technical result of the present invention is to obtain new antibodies that specifically bind to TCR, the beta chain of which belongs to the TRBV9 family and can be used to treat autoimmune and oncological diseases, the pathogenesis of which involves TCR, the beta chain of which belongs to the TRBV9 family. Also, the technical result consists in increasing the effectiveness of therapy for AS and/or celiac disease, which is ensured by the production of antibodies that can act directly on autoimmune T-lymphocytes, and the ability to achieve long-term remission in AS.

Brief description of the figures

Fig. 1-4 show two-parameter histograms of blood mononuclear fraction cell distribution using eFluor 405 labeled anti-CD3 monoclonal antibody (y-axis) and FITC-labeled anti-TRBV9 mAb (abscissa): anti-TRBV9-1 (FIG. 1), anti-TRBV9-2 (Fig. 2), anti-TRBV9-3 (Fig. 3), anti-TRBV9-4 (Fig. 4). Each anti-TRBV9 monoclonal antibody variant was used at two concentrations of 270 ng (upper graph) or 27 ng (lower graph) per test. The specific CD3+TRBV9+ population is indicated by a small box.

Fig. 5 shows two-parameter histograms of blood mononuclear fraction cell distribution using eFluor 405 labeled anti-CD3 monoclonal antibody (y-axis) and FITC-labeled anti-TRBV9 monoclonal antibody (abscissa) after a cytotoxic test: incubation with anti-TRBV9-2 (experiment ) and remicade (control).

Detailed description of the invention

The present invention relates to isolated monoclonal antibodies and functional fragments thereof that are capable of specifically binding to the beta chain region of the TRBV9 family of the human T receptor. Also provided are nucleic acids encoding antibodies and fragments thereof of the invention, expression cassettes, and expression vectors comprising the nucleic acid of the invention and the regulatory elements necessary for expression of the nucleic acid in a selected host cell. In addition, cells and stable cell lines are provided that include the nucleic acids, vectors, or expression cassettes of the present invention. Also provided are a method for producing a monoclonal antibody or a functional fragment thereof, a pharmaceutical composition and a pharmaceutical combination containing an antibody of the present invention in an effective amount in combination with one or more pharmaceutically acceptable excipients, diluents or carriers, and methods for diagnosing and treating AS and other diseases using antibodies. of the present invention.

Definitions

For the purpose of easier understanding of the invention, some terms are first defined.

It should be understood that the materials and methods provided herein are not limited to specific compositions or method steps, as they may vary. It is indicated that, as used in this specification and the appended claims, the singular forms include the corresponding plural forms, unless the context clearly dictates otherwise.

The T cell receptor, also referred to as the TRK, T receptor or human TCR, is a heterodimeric protein complex located on the surface of the T lymphocyte. This receptor is present only on T lymphocytes. The main function of TCR is the specific recognition of processed antigens associated with major histocompatibility complex (HLA) molecules.

Human TCR consists of two subunits, α and β, or γ and δ chains, linked by a disulfide bond and anchored in the cell membrane. Each of the TCR chains has an N-terminal variable (V) domain, a junction domain, and a constant (C) domain connected to a transmembrane domain that anchors the receptor in the T-lymphocyte plasma membrane. The length of the constant domain of the alpha and beta chains is 91 and 129 amino acid residues, respectively. The length of the connecting and transmembrane domain of the alpha chain is 30 and 17 amino acid residues (a.a.), while the length of the beta chain is 21 and 22 a.a. The length of the variable domains of T receptors varies from 104 to 125 a.a.

A small fraction of T-lymphocytes has receptors of the γ/δ type. In their structure, they are similar to α/β receptors, but differ in their primary structure and have a number of functional features. Their variability is much lower (limited clone specificity), they recognize antigens in combination with non-classical (non-MHC) antigen-presenting molecules or even free antigens.

The T receptor interacts with the MHC-antigen complex through six complementarity determining regions (CDRs): three alpha chain regions and three beta chain regions. These CDRs are hypervariable regions, loops of the T-cell receptor variable domains V alpha and V beta.

The terms TRBV9 or the TRBV9 family refer to the ninth family of T-4 beta chain receptors, identified according to the IMGT nomenclature, which is characterized in that the amino acid sequence of their variable domain includes the unique motifs CDR1 (amino acid sequence - S-G-D-L-S) and CDR2 (amino acid sequence - Y-Y-N-G-E-E).

The term TCR of the TRBV9 family denotes a T-cell receptor whose beta chain refers to

TRBV9 family.

The term pathological in relation to T-lymphocytes or TCR means that a given TCR, or a T-lymphocyte carrying it, is associated with a disease or pathology and/or is the cause of the disease and/or contributes to the development of the disease.

The term autoimmune in relation to TCR means that this TCR is involved in the development of an autoimmune disease.

The term antibody as used herein is intended to refer to an immunoglobulin molecule consisting of four polypeptide chains (two heavy (H) chains and two light (L) chains) linked by disulfide bonds. Light chains are classified as kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta or epsilon and define the isotype of an antibody such as IgG, IgM, IgA, IgD and IgE, respectively, and several of these can be further divided into subclasses (isotypes), for example, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. Each type of heavy chain is characterized by a particular constant region.

Each heavy chain contains a heavy chain variable region (abbreviated here as HCVR or VH) and a heavy chain constant region. The heavy chain constant region contains three domains CH1, CH2 and CH3. Each light chain contains a light chain variable region (abbreviated here as LCVR or VL) and a light chain constant region. The light chain constant region contains one CL domain. The VH and VL regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDRs), surrounded by regions that are more conserved, called skeletal regions (FRs). Each of VH and VL consists of three CDRs and four FR regions, arranged from amino to carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

In this application, the 3 heavy chain CDRs are referred to as CDRH1, CDRH2 and CDRH3, and the 3 light chain CDRs are referred to as CDRL1, CDRL2 and CDRL3. CDRs contain most of the residues that form specific interactions with the antigen. The numbering and positioning of the CDR amino acid residues within the HCVR and LCVR regions of the antibodies of this invention is done with the well-known Kabat nomenclature, unless otherwise indicated. This application uses, unless otherwise indicated, conventional letter designations for amino acids.

The terms anti-TRBV9 antibody, anti-TRBV9 antibody, antibody specifically binding to the beta chain of the TRBV9 family, or anti-beta chain antibody of the TRBV9 family and the like are used interchangeably in the context of this application and refer to an antibody that specifically binds to an epitope of the beta chain of the TRBV9 family human T-cell receptor.

The terms antibody and monoclonal antibody for the purposes of this application refer to the anti-TCR monoclonal antibody of the TRBV9 family. As used herein, a monoclonal antibody refers to a rodent, primate, or Camelidae antibody, preferably a mouse, macaque, camel, or llama antibody, a chimeric antibody, a humanized antibody, or a fully human antibody, unless otherwise indicated.

The variable regions of each of the light/heavy chain pairs form the antigen-binding sites of the antibody. As used herein, an antigen-binding portion, or an antigen-binding site, or an antigen-binding domain, or an antigen-binding center refer, interchangeably, to that portion of an antibody molecule that contains amino acid residues that interact with the antigen and confer on the antibody its specificity and affinity for the antigen. This portion of the antibody includes the framework amino acid residues necessary to maintain the proper conformation of the antigen-binding residues.

The term human antibody as used herein means an antibody in which the variable and constant domain sequences are derived from human sequences. Human antibodies of the invention may include non-human amino acid residues (eg, mutations introduced by non-targeted or site-directed mutagenesis in vitro or somatic mutation in vivo), for example, in CDRs and especially in CDR3.

The term humanized in relation to antibodies is used to refer to antibodies that are characterized by the presence of human constant regions and structural components, but have complementarity determining regions (CDRs) that are characteristic of immunoglobulins of other origin or corresponding fragments of modified antibodies.

The term chimeric in relation to antibodies of the present invention is used to refer to antibodies that are characterized by the presence of human constant regions, but have variable domains of a different origin. In such antibodies, light and/or heavy chain variable domains of non-human origin (eg, taken from rats) are operably linked to the constant domains of the corresponding human chains.

The term operably linked or similar when describing antibodies refers to polypeptide sequences that are in physical (covalent unless otherwise indicated) and functional relationship with one another. In the most preferred embodiments, the functions of the polypeptide components of the chimeric molecule are not altered compared to the functional properties of the isolated polypeptide components. The term operatively linked or similar when describing nucleic acids means that nucleic acids are covalently linked in such a way that there are no frame breaks and stop codons at their junctions. As is obvious to any person skilled in the art, nucleotide sequences encoding a chimeric protein, including operably linked components (proteins, polypeptides, linker sequences, protein domains, etc.), consist of fragments encoding these components, where these fragments are covalently linked in such a way that during translation and transcription of the nucleotide sequence, a full-length chimeric protein is produced, for example, a chimeric antibody of the invention.

As used here, the terms isolated and isolated mean a molecule or cell that is in an environment different from the environment in which the molecule or cell is in natural conditions.

In preferred embodiments, the antibodies of the present invention are recombinant, that is, produced using recombinant DNA techniques. The term recombinant antibody as used herein includes all antibodies that are made, expressed, generated or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector introduced into a host cell, antibodies isolated from a set of known recombinant combinatorial human antibodies, antibodies isolated from an animal that is transgenic for human immunoglobulin genes (see, for example, Taylor L.D. et al. (1992) Nucl. Acids Res. 20:6287-6295). In some embodiments, recombinant human antibodies are subjected to in vitro mutagenesis (or, if an animal transgenic for human Ig sequences, somatic in vivo mutagenesis is used) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, because they are isolated from sequences of human germline VH and VL and close to them, cannot naturally exist in the germline set of human antibodies in vivo.

The term specifically binds, as used herein, refers to that situation in which one member of a specific binding pair does not significantly bind molecules other than its specific binding partner(s). The term is also applicable when, for example, the antigen-binding domain of an antibody of the invention is specific for a particular epitope that is carried by a number of antigens, in which case the specific antibody having the antigen-binding domain will be capable of specifically binding to different epitope-bearing antigens. Accordingly, the monoclonal antibody of the invention specifically binds the human TCR beta chain epitope of the TRBV9 family, while it does not specifically bind the TCR beta chains of other families and the TCR alpha chain.

The term epitope refers to that portion of a molecule that is capable of being recognized by and bound to an antibody at one or more antigen-binding sites on the antibody. Epitopes often consist of reactive surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics as well as specific charge characteristics.

The term epitope as used herein also refers to a portion of a polypeptide that has antigenic and/or immunogenic activity in an animal, preferably a mammal, such as a mouse, rat or human. The term antigenic epitope, as used herein, is defined as the portion of a polypeptide to which an antibody can specifically bind, as determined by any method well known in the art, such as by conventional immunoassay. Antigenic epitopes need not be immunogenic, but may also be immunogenic. An immunogenic epitope, as used herein, is defined as the portion of a polypeptide that elicits an antibody response in an animal, as determined by any method known in the art. A non-linear epitope or conformational epitope comprises non-contiguous polypeptides (or amino acids) within an antigenic protein to which an epitope-specific antibody binds.

The expressions biological property or biological characteristic or the terms activity or bioactivity with respect to an antibody and its functional fragments of the invention are used interchangeably in this application and include, but are not limited to, epitope/antigenic affinity and specificity, the ability to inhibit or antagonize TCR activity, which includes a beta chain belonging to the TRBV9 family.

Other biological properties or characteristics of an antibody identifiable from the prior art include, for example, cross-reactivity (i.e., with non-human homologues of the peptide

- 6 041880 targets or with other proteins or targets, in general), and the ability to maintain high levels of protein expression in mammalian cells. The above properties or characteristics may be observed, measured, or evaluated using techniques recognized in the art, including, but not limited to, ELISA assay, competitive ELISA, BIACORE or KINEXA surface plasmon resonance assay, in vitro or in vivo inhibition assays without restrictions, receptor binding, cytokine or growth factor production and/or secretion, signal transduction, and immunohistochemistry of tissue sections obtained from various sources, including human, primate, or any other source.

The terms inhibit or neutralize, as used herein, in relation to the activity of an antibody of the invention, means the ability to substantially counteract, interfere with, prevent, limit, slow down, interrupt, eradicate, stop, reduce, for example, the development or severity of what inhibit, including, but not limited to, the biological activity of an antibody or property, disease, or condition.

As used herein, the term mutant or variant refers to an antibody of the present invention in which one or more amino acids are added and/or substituted and/or removed (deleted) and/or inserted (inserted) at the N-terminus and/or C -end, and/or within the native amino acid sequences of the antibodies of the present invention or fragments thereof. As used here, the term mutant also refers to a nucleic acid molecule that encodes a mutated protein. In addition, the term mutant refers to any variant that is shorter or longer than a protein or nucleic acid.

The term homology is used to describe the relationship of nucleotide or amino acid sequences to other nucleotide or amino acid sequences, as determined by the degree of identity and/or similarity between said compared sequences.

As used herein, an amino acid or nucleotide sequence is substantially similar or substantially the same as a reference sequence if the amino acid or nucleotide sequence shares at least 70% identity with the specified sequence within the region selected for comparison. Thus, substantially similar sequences include those that have, e.g., at least 75% identity, e.g., at least 80% identity, at least 85% identity, at least 90% identity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98% or 99% identical). Two sequences that are identical to one another are also substantially similar.

Sequence identity is determined based on the reference sequence. Algorithms for sequence analysis are known in the art, such as IgBLAST as described in Ye et al. Nucleic Acids Res. 2013, W34-40. For the purposes of the present invention, comparison of nucleotide and amino acid sequences using the IgBLAST software package provided by the National Center for Biotechnology Information (https://www.ncbi.nlm.nih) can be used to determine the level of identity and similarity between nucleotide sequences and amino acid sequences. .gov/igblast/) using discontinuous alignment with default settings. The full length of the reference sequence, such as the variable region, is used to calculate percent identity.

Reference to a nucleotide sequence encoding a polypeptide means that this polypeptide is produced from the nucleotide sequence during translation and transcription of the mRNA. In this case, both the coding strand, identical to mRNA and usually used in the sequence listing, and the complementary strand, which is used as a template for transcription, can be indicated. As is obvious to any person skilled in the art, the term also includes any degenerate nucleotide sequences encoding the same amino acid sequence. Nucleotide sequences encoding a polypeptide include sequences containing introns.

Antibodies

As stated above, the present invention relates to isolated monoclonal antibodies and functional fragments thereof, which are capable of specifically binding to the beta chain region of the TRBV9 family of the human T receptor.

The antibodies of the present invention are characterized in that

a) the variable domain of their heavy chain (VH) contains 3 hypervariable regions HCDR1, HCDR2 and HCDR3, where

HCDR1 has (according to Kabat nomenclature) the amino acid sequence DYLVH (SEQ ID NO: 1);

HCDR2 has the amino acid sequence WINTYTGTPTYADDFEG (SEQ ID NO: 2);

HCDR3 has an amino acid sequence selected from the group SWRRGLRGLGFDY (SEQ ID NO: 3), SWRRGLRGIGFDY (SEQ ID NO: 4), SWRRGIRGLGFDY (SEQ ID NO: 5), SWRRGIRGIGFDY (SEQ ID NO: 6);

b) their light chain variable domain (VL) contains 3 LCDR1 hypervariable regions,

- 7 041880

LCDR2 and LCDR3, in which

LCDR1 has the amino acid sequence KASKSINKYLA (SEQ ID NO: 7);

LCDR2 has the amino acid sequence DGSTLQS (SEQ ID NO: 8);

LCDR3 has the amino acid sequence QQHNEYPPT (SEQ ID NO: 9).

The antibodies of the invention may be chimeric, humanized or human antibodies, or antigen-binding fragments thereof, and may be used as a drug for the treatment of ankylosing spondylitis and other diseases in which TCRs belonging to the TRBV9 family are involved, such as celiac disease or T-cell lymphoma. .

Monoclonal antibodies of the invention can be prepared using, for example, hybridoma techniques well known in the art, as well as recombinant techniques, phage display techniques, synthetic techniques or combinations of such techniques, or other techniques well known in the art. The term monoclonal antibody, as used in this application, refers to an antibody obtained from a single copy or clone, including, for example, any eukaryotic, prokaryotic or phage clone, and not to the method of obtaining it.

Humanized and chimeric antibodies can be generated by peptide synthesis or using recombinant DNA techniques as described below in the Nucleic Acids section.

In some embodiments, the antibodies of the present invention are chimeric and are characterized in that they have light and heavy chain variable domains of non-human origin (eg, rat or mouse) and human constant domains. In some embodiments, the antibodies of the present invention are characterized in that they have a heavy chain variable domain amino acid sequence selected from the group of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, and a light chain variable domain amino acid sequence. chain shown in SEQ ID NO: 11. In preferred embodiments, the antibody comprises a heavy chain constant region such as human IgG1, IgG2, IgGS, IgG4, IgA, IgE, IgM, IgD human constant region. Preferably, the heavy chain constant region is a human IgG1 heavy chain constant region. Moreover, the antibody may comprise, as a light chain constant region, either a kappa light chain constant region or a light chain lambda constant region. Preferably, the antibody contains a light chain kappa constant region.

Exemplary amino acid sequences of heavy chains of anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3 or anti-TRBV9-4 antibodies of the invention are shown in SEQ ID NOS: 21, 23, 25 and 27, respectively. An example of an antibody light chain amino acid sequence is shown in SEQ ID NO: 29.

In some embodiments, the amino acid sequences of the antibody variable domain framework regions, or portions thereof, are primarily human in origin and therefore humanized antibodies. This humanization is considered useful in reducing the immunogenicity of said antibody when administered therapeutically to patients. Certain selected amino acid residues in the framework regions remain rat-like and not human-like.

In some embodiments, the antibodies of the present invention and their antigen-binding fragments comprise light chain variable domains whose amino acid sequences are substantially similar to the amino acid sequence of SEQ ID NO: 11, e.g., at least 90% identical, more often at least 93 %, typically 94% or more (preferably 95% or more, 96% or more; 97% or more, 98% or more, 99% or more, or 99.5% or more).

In some embodiments, the antibodies of the present invention and antigen-binding fragments thereof comprise heavy chain variable domains whose variable domain amino acid sequences are substantially similar to an amino acid sequence selected from the group of SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19. For example , have an amino acid sequence identical to the sequence selected from the group SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, at least 90%, more often at least 93%, typically 94% or more (preferably 95% or more, 96% or more; 97% or more, 98% or more, 99% or more, or 99.5% or more).

In some embodiments, an antibody of the invention comprises a heavy chain having an amino acid sequence that is at least 90% identical (e.g., 93% or greater, 94% or greater, 95% or greater, 96% or greater; 97% or greater, 98% or greater, 99% or greater, or 99.5% or greater) of a sequence selected from the group of SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27 and a light chain having an amino acid sequence that is at least 90% identical (e.g., 93% or greater, 94% or greater, 95% or greater, 96% or greater; 97% or greater, 98 % or more, 99% or more, or 99.5% or more) of the sequence of SEQ ID NO:29.

It is known in the art that mutations can be introduced in antibody sequences, including variable domains, that do not substantially affect the ability of the antibody to bind to an antigen. The antibodies of the present invention may also contain additional mutants.

- 8 041880 ions that do not result in loss of the ability of the antibody to bind the beta chain of the TCR of the TRBV9 family, but may result in a decrease in antibody-dependent cell-mediated cytotoxicity or an increase in the affinity or other biological properties of antibodies. In particular, it is well known in the art that conservative amino acid substitutions can be made in antibody sequences. By conservative substitution in the context of the application is meant a substitution in which an amino acid residue is replaced by another amino acid residue having a close side chain. Families of amino acid residues having close side chains are defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g. alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). Preferably, no more than five conservative amino acid substitutions are made in the CDR3 regions in the VL and/or VH domains, more often no more than three conservative substitutions. Generally, conservative substitutions are not made at amino acid positions critical for binding of the TRBV9 family beta chain epitope.

The above-described variants (mutants) of antibodies according to the invention can be obtained by peptide synthesis or using recombinant DNA techniques as described below in the section Nucleic acids.

Antigen-binding fragments of antibodies of the present invention are also provided. The term antigen-binding antibody fragment (or functional antibody fragment or active antibody fragment) as used herein refers to one or more antibody fragments that retain the ability to specifically bind an antigen. It has been shown that the antigen-binding function of an antibody can be performed by full-length antibody fragments. Examples of binding fragments encompassed by the term antibody antigen-binding fragment include (a) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (b) an F(ab')2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge in the region of the loop; (c) Fd fragment consisting of VH and CH1 domains; (d) an Fv fragment consisting of the VL and VH domains of one antibody arm; (e) a dAb fragment (Ward et al. (1989) Nature 341:544-546), which consists of a VH domain, and (f) a complementarity-determining region (CDR). Moreover, although the two domains of the Fv fragment, VL and VH, are encoded by separate genes, they can be recombinantly linked using a synthetic linker that provides them as a single protein chain in which the VL and VH regions are paired to form monovalent molecules ( known as single chain Fvs (scFvs), see for example Bird et al (1988) Science 242:423-426; Huston et al (1988) Proc Natl Acad Sci USA 85:5879-5883) . It is contemplated that such single chain antibodies are also encompassed by the term antigen-binding antibody fragment. They also include other forms of single chain antibodies, such as diabodies. Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are expressed on the same polypeptide chain, but using a linker that is too short to allow pairing of the two domains on the same chain, which causes the domains to pair with the complementary domains of the other chain. and create two antigen binding sites (see, for example, Holliger P. et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak R. J. et al. (1994) Structure 2:1121-1123) .

Antibody fragments such as Fab F(ab')2 can be prepared from whole antibodies using established methods such as papain or pepsin digestion, respectively, of whole antibodies. Moreover, antibodies, antibody fragments and immunoadhesion molecules can be produced using standard methods using recombinant DNA.

An antibody or antigen-binding fragment thereof may be part of larger immunoadhesion molecules formed by covalent or non-covalent bonding of an antibody or antibody fragment to one or more proteins or peptides. Examples of such immunoadhesion molecules include the use of a streptavidin core region to produce a tetrameric scFv molecule (Kipriyanov S.M. et al. (1995) Human Antibodies and Hybridomas 6:93-101) and the use of a cysteine residue, a marker peptide, and a C-terminal polyhistidine tag to produce bivalent and reduced biomolecules. scFv (Kipriyanov S. M. et al. (1994) Mol. Immunol., 31:1047-1058). Other chemical bindings of antibody fragments are also well known in the art.

The antibodies and their functional fragments according to the invention are in an isolated form, that is, this means that the protein is essentially free from the presence of other proteins or other natural biological molecules such as oligosaccharides, nucleic acids and fragments thereof, etc., where the term essentially free in this case means that less than 70%, usually less than 60%, and more often less than 50% of said isolated protein-containing composition is another naturally occurring biological molecule. In some embodiments, said proteins are present in a substantially purified form, wherein the term substantially purified form means a purity of at least 95%, typically at least 97%, and more often at least

- 9 041880

99%.

Methods for purifying an antibody obtained by recombinant or hybridoma are well known in the art, for example, purification can be carried out by chromatography (for example, ion exchange, affinity, especially affinity for specific antigens - protein A or protein G, and size column chromatography), centrifugation, differential solubility, or any other standard technique for protein purification. In addition, antibodies according to the technology in accordance with the present invention, or fragments thereof, can be fused with heterologous polypeptide sequences (eg, a histidine tag) to facilitate purification.

The affinity of an antibody can be determined using a standard assay through the determination of the dissociation constant (KD). KD is calculated via the equation KD=kd/kon, where kd is the experimentally calculated dissociation rate constant and kon is the experimentally calculated association rate constant of the antibody-antigen complex.

Preferred antibodies are those that bind a human antigen with a KD value of no more than about 1x10'7 M; preferably not more than about 1x10' ⁸ M; more often no more than about 1x10'9 M; more preferably no more than about ^1x10'10 M, and most preferably no more than about 1x10'11 M, such as no more than about ^1x10'12 M.

Preferred antibodies include anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3, or anti-TRBV9-4 antibodies that differ in the CDR3 sequence and are described in detail in the experimental section below.

Antibodies and fragments thereof that can be used in the present compositions and methods are biologically active antibodies and fragments, that is, capable of binding the desired antigenic epitopes and exhibiting a biological effect directly or indirectly.

Antibodies and their functional fragments according to the invention are able to specifically bind the epitope (section) of the beta chain of the TRBV9 family. In preferred embodiments, their specific binding to the beta chain of the TRBV9 family results in inhibition of the activity of TCRs comprising said beta chain. Typically, inhibition is preferably at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or greater.

In some embodiments, an anti-TRBV9 family beta chain antibody of the invention, or a fragment thereof, can eliminate T-lymphocytes carrying a TEP containing a TRBV9 family beta chain. In some embodiments, an antibody or fragment thereof according to the invention may provide at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% elimination of T-lymphocytes.

Nucleic acids

The present invention provides nucleic acid molecules encoding the heavy and light chains of an antibody of the present invention, functional fragments and variable domains thereof, which can be used to produce chimeric antibodies comprising the variable domains of the invention operatively fused to known constant domains of human antibodies.

In preferred embodiments, the nucleic acid of the invention encodes an antibody heavy chain whose variable domain contains the 3 hypervariable regions HCDR1, HCDR2 and HCDR3, where

HCDR1 (according to Kabat nomenclature) has the amino acid sequence of SEQ ID NO: 1;

HCDR2 has the amino acid sequence of SEQ ID NO: 2;

HCDR3 has an amino acid sequence selected from the group of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6.

In preferred embodiments, the nucleic acid of the invention encodes an antibody light chain whose variable domain contains the 3 hypervariable regions LCDR1, LCDR2 and LCDR3, in which

LCDR1 has the amino acid sequence of SEQ ID NO: 7;

LCDR2 has the amino acid sequence of SEQ ID NO: 8;

LCDR3 has the amino acid sequence of SEQ ID NO: 9.

Nucleic acid molecules encoding homologues and mutants of said antibody chains, their functional fragments and domains are also within the scope of the present invention.

In some embodiments, the nucleic acid encodes an antibody light chain whose variable domain contains an amino acid sequence substantially similar to the amino acid sequence of SEQ ID NO: 11; for example, at least 90% identical with it, more often at least 93%, usually 94% or more (preferably 95% or more, 96% or more; 97% or more, 98% or higher, 99% or higher, or 99.5% or higher).

- 10 041880

In some embodiments, the nucleic acid encodes an antibody heavy chain, the variable domain of which contains an amino acid sequence substantially similar to an amino acid sequence selected from the group of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19; for example, at least 90% identical with it, more often at least 93%, usually 94% or more (preferably 95% or more, 96% or more; 97% or more, 98% % or more, 99% or more, or 99.5% or more).

In some embodiments, nucleic acids encode an antibody light chain containing a variable domain whose amino acid sequence is shown in SEQ ID NO: 11 and an antibody heavy chain containing a variable domain whose amino acid sequence is selected from the group of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19.

In some embodiments, the nucleic acid encodes variable domains, the amino acid sequences of which are shown in SEQ ID NOs: 11, 13, 15, 19, which can be used for operational fusion with nucleic acids encoding the corresponding antibody constant domains.

Examples of specific types of nucleic acid molecules of interest are disclosed in more detail below in the experimental section.

As used herein, a nucleic acid molecule is a DNA molecule, such as a genomic DNA or cDNA molecule, or an RNA molecule, such as an mRNA molecule. In some embodiments, a nucleic acid molecule of the present invention is a DNA (or cDNA) molecule containing an open reading frame that encodes an antibody or antibody fragment of the present invention and is capable, under suitable conditions (e.g., physiological intracellular conditions), of being used for expression in a heterologous system expression.

In some embodiments, the nucleic acid molecule of the present invention is obtained by genetic engineering. Methods for obtaining nucleic acids are well known in the art. For example, the availability of amino acid sequence information or nucleotide sequence information makes it possible to prepare the isolated nucleic acid molecules of the present invention using oligonucleotide synthesis. In the case of information about the sequence of amino acids, several nucleic acids can be synthesized that differ from each other due to the degeneracy of the genetic code. Methods for selecting codon variants for a desired host are well known in the art.

Synthetic oligonucleotides can be prepared using the phosphoramidite method and the resulting constructs can be purified using methods well known in the art such as high performance liquid chromatography (HPLC) or other methods as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, and according to the instructions described in, for example, United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research. Long double-stranded DNA molecules of the present invention can be synthesized as follows: several smaller fragments can be synthesized with the necessary complementarity, which contain suitable ends capable of cohesion with an adjacent fragment. Adjacent fragments can be ligated using DNA ligase or a PCR based method.

The nucleic acid molecules of the present invention may also be cloned from biological sources.

The present invention also encompasses nucleic acids that are homologous, substantially similar, identical, or derived from nucleic acids encoding the polypeptides of the present invention.

Nucleic acids of the invention are found in an environment different from the environment in which they are naturally found, for example, they are isolated, present in increased abundance, found or expressed in in vitro systems, or in cells or organisms other than those in which they are found. in natural conditions.

Changes or differences in the nucleotide sequence between highly similar nucleotide sequences may represent nucleotide substitutions in the sequence that occur during normal replication or duplication. Other substitutions may be specifically designed and inserted into the sequence for specific purposes, such as changing the codons of certain amino acids or the nucleotide sequence of a regulatory region. Such specific substitutions can be made in vitro using various mutagenesis techniques or obtained in host organisms under specific breeding conditions that induce or select for these changes. Such tailor-made sequence variants may be referred to as mutants or derivatives of the original sequence.

Mutant or derivative nucleic acids can be produced on a template nucleic acid selected from the nucleic acids described above by modifying, deleting or adding one or more nucleotides in the template sequence, or a combination thereof, to produce a variant template nucleic acid. Modifications, additions or deletions may be

- 11 041880 are made by any method known in the art (see, for example, Gustin et al., Biotechniques (1993) 14: 22; Barany, Gene (1985) 37: 111-123; and Colicelli et al., Mol. Gen Genet (1985) 199:537-539, Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, pp. 15.3-15.108), including error-prone PCR, shuffling , oligonucleotide-directed mutagenesis, assembly PCR, pairwise PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive multiple mutagenesis, exponential multiple mutagenesis, site-specific mutagenesis, random mutagenesis, gene reassembly, gene site-saturation mutagenesis ( GSSM), artificial rearrangement with ligation (SLR), or combinations thereof. Modifications, additions or deletions can also be performed by a method including recombination, recursive sequence recombination, phosphothioate-modified DNA mutagenesis, uracil-containing template mutagenesis, double-skip mutagenesis, point mismatch reductive mutagenesis, reduction-deficient strain mutagenesis, chemical mutagenesis, radioactive mutagenesis, deletion mutagenesis, restriction selective mutagenesis, restriction mutagenesis with purification, artificial gene synthesis, multiple mutagenesis, generation of chimeric multiple nucleic acids, and combinations thereof.

Also provided are degenerate variants of nucleic acids that encode the proteins of the present invention. Degenerate nucleic acid variants include substitutions of nucleic acid codons with other codons encoding the same amino acids. In particular, degenerate nucleic acid variants are designed to increase expression in the host cell. In this embodiment, nucleic acid codons that are not preferred or less preferred in the genes of the host cell are replaced with codons that are abundant in the coding sequences of the genes in the host cell, where said changed codons code for the same amino acid. Optimization of the genetic code is well known in the art.

The above modifications do not substantially change the properties of the antibodies and their functional fragments, but may facilitate protein folding in the host cell, reduce the ability to aggregate, or modulate other biochemical properties of proteins, such as half-life decay. In some embodiments, these modifications do not change the biochemical properties of the protein. All kinds of modifications and mutations mentioned above are carried out at the level of nucleic acid.

The claimed nucleic acids can be isolated and obtained in essentially purified form. Essentially, a purified form means that the nucleic acids are at least about 50% pure, typically at least about 90% pure, and are typically recombinant, i.e., flanked by one or more nucleotides with which it is not normally linked on a chromosome naturally occurring in its natural host organism.

Also provided are nucleic acids that encode fusion proteins comprising the protein of the present invention, or fragments thereof, which are discussed in more detail below. Nucleic acids encoding the variable domains of the invention can be operatively fused to nucleic acids encoding the corresponding antibody light and heavy chain constant domains. Nucleic acids encoding the antibody light and heavy chains can be operatively fused to nucleic acids encoding a leader peptide that transports expression products from the host cell. The leader peptide is subsequently cleaved off during polypeptide maturation.

A vector and other nucleic acid constructs containing the claimed nucleic acids are also provided. The term vector includes a nucleic acid molecule capable of transporting another nucleic acid to which it is operably linked. Certain vectors are capable of autonomous replication in the host cell into which they are introduced, while other vectors can be integrated into the genome of the host cell and thus replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as recombinant expression vectors (or, more simply, expression vectors or expression vectors), and illustrative vectors are well known in the art. Suitable vectors include viral and non-viral vectors, plasmids, cosmids, phages, etc., preferably plasmids, and are used to clone, amplify, express, transfer, etc., the nucleic acid sequence of the present invention into a suitable host. The choice of an appropriate vector is within the purview of one skilled in the art. The full-length nucleic acid, or a portion thereof, is typically inserted into a vector by attachment by DNA ligase to a restriction enzyme-cleaved site in the vector. Alternatively, the desired nucleotide sequence can be inserted by in vivo homologous recombination, typically by adding homologous regions to the vector on the flanks of the desired nucleotide sequence. Homologous regions are added by oligonucleotide ligation or polymerase chain reaction, using primers including, for example, both the homologous regions and a portion of the desired nucleotide sequence. The vector, as a rule, has an origin of replication, which ensures its reproduction in host cells as a result of its introduction into the cell as an extrachromosomal element. The vector can also

- 12 041880 contain regulatory elements that ensure the expression of the nucleic acid in the host cell and the production of the target polypeptide. In an expression vector, said nucleic acid is operably linked to a regulatory sequence, which may include promoters, enhancers, terminators, operators, repressors, and inducers, as well as a polypeptide start codon. In some embodiments of the nucleic acid of the invention, the nucleic acid is also operably linked to a leader peptide allowing release of the expression product from the host cell to the extracellular space.

Also provided are expression cassettes or systems used, inter alia, to produce the claimed polypeptides (eg, light and heavy chains of an antibody of the invention) based on them or to replicate the claimed nucleic acid molecules. The expression cassette may exist as an extrachromosomal element or may be incorporated into the cell's genome by introducing said expression cassette into the cell. For expression, the protein product encoded by the nucleic acid of the invention is expressed in any convenient expression system, including, for example, bacterial systems, yeast, plants, insects, amphibians, or mammalian cells. In the expression cassette, the target nucleic acid is operatively linked to regulatory sequences, which may include promoters, enhancers, termination sequences, operators, repressors, and inducers, as well as the start codon of the polypeptide. In some embodiments of the nucleic acid of the invention, the nucleic acid is also operably linked to a leader peptide allowing release of the expression product from the host cell to the extracellular space. Methods for obtaining expression cassettes or systems capable of expressing the desired product are known to those skilled in the art.

The expression systems described above can be used in prokaryotic or eukaryotic hosts. Host cells such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism other than human embryonic cells, such as yeasts, plants, vertebrates, can be used to produce the protein. for example, CHO cells (eg, ATCC CRL-9096), NS0 cells, SP2/0 cells, HEK293 cells, COS cells (eg, ATCC CRL-1650, CRL-1651) and HeLa (ATCC CCL-2).

To obtain an antibody of the invention, a host cell is co-transformed with an expression vector comprising a nucleic acid encoding an antibody light chain and an expression vector comprising a nucleic acid encoding an antibody heavy chain. In some embodiments, a single expression vector is used in which nucleic acids encoding both the light and heavy chains of the antibody are introduced.

For expression of the light and heavy chains, the expression vector(s) encoding the heavy and light chains are transformed (co-transformed) into a host cell such that the light and heavy chains are expressed in the host cell and are preferably isolated into a medium in which the host cells are cultured, antibodies can be isolated from this medium. Various interpretations of the term transformation are intended to include a wide range of methods commonly used in the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, for example, electroporation, calcium phosphate precipitation, transfection with DEAE-dextran, etc., as described by Sambrook, Fritsch and Maniatis (eds) Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. (1989; Ausubel F.M. et al. (eds.) Current Protocols in Molecular Biology, Green Publishing Associates (1989).

When recombinant expression vectors containing antibody nucleic acids are introduced into host cells, antibodies are generated by culturing the host cells for a period of time that is sufficient for expression of the antibody in the host cell, or (more preferably) secretion of the antibody into the culture medium, in which host cells are grown. Antibodies can be isolated from the culture medium using standard protein purification methods. Culture conditions for various cells are well known to those skilled in the art and are described, for example, in Current Protocols in Cell Biology, ed. Bonifacino J.S., Dasso M., Harford J.B., Lippincott-Schwartz J. and Yamada K.M., John Wiley & Sons, Inc., 2000.

If any of the aforementioned host cells or other suitable host cells or organisms are used to replicate and/or express the nucleic acids of the invention, then the resulting replicated nucleic acid, expressed protein or polypeptide is within the scope of the invention as the product of the host cell or organism. The product may be isolated in a suitable manner known in the art.

Cell lines that stably express the proteins of the present invention can be selected by methods known in the art (e.g., co-transfection with a selectable marker such as dhfr, gpt, neomycin, hygromycin, which makes it possible to identify and isolate transfected cells that contain the gene, included in the genome).

The nucleic acid molecules of the present invention can also be used to determine the expression of a gene in a biological sample. The method in which cells are examined for the presence of specific nucleotide sequences, such as genomic DNA or RNA, is well established in

- 13 041880 region. Briefly, DNA or mRNA is isolated from a cell sample. mRNA can be amplified by RT-PCR using reverse transcriptase to form a complementary strand of DNA, followed by polymerase chain reaction amplification using primers specific for the claimed DNA sequences. Alternatively, the mRNA sample is separated by gel electrophoresis, transferred to a suitable carrier, eg nitrocellulose, nylon, etc., and then tested with a claimed DNA fragment as a probe. Other methods may also be used, such as oligonucleotide crosslinking assays, in situ hybridization, and hybridization with DNA probes immobilized on a solid chip. The detection of mRNA hybridizing to the claimed sequence indicates the expression of the gene in the sample.

Therapeutic Use of Antibodies of the Invention

In one aspect, the antibody or active fragment thereof of the present invention is used in the treatment of disorders that are associated with the activity of pathological T-lymphocytes bearing on the surface of the TRBV9 family of TCRs, for example, with the activity of autoimmune T-lymphocytes in AS, celiac disease, T-cell lymphomas.

The term patient in this application refers to a mammal, including, but not limited to, mice, monkeys, humans, mammalian farm animals, mammalian sports animals, and mammalian pets; preferably the term refers to humans. In a certain embodiment, the patient is further characterized by a disease or disorder or condition mediated by the presence in the body of a TCR whose beta chain belongs to the TRBV9 family. It is known from the prior art that TCR, the beta chain of which belongs to the TRBV9 family, is associated with AS and celiac disease. Also, TCR, the beta chain of which belongs to the TRBV9 family, may be associated with the development of a number of blood diseases, such as T cell lymphoma caused by the Epstein-Barr virus.

As used herein, the terms co-administration, co-administration, and in combination with referring to an antibody with one or more other therapeutic agents are intended to mean, refer to, or include:

1) simultaneous administration of such a combination of an antibody of the present invention and a therapeutic agent to a patient in need of treatment, when such components are formulated together in a single dosage form from which said components are released substantially simultaneously to said patient,

2) simultaneous administration of such a combination of an antibody of this invention and a therapeutic agent to a patient in need of treatment, when such components are formulated separately in different dosage forms, the administration of which occurs at almost the same time to said patient, after which these components are released almost simultaneously the specified patient

3) sequential administration of such a combination of an antibody of this invention and a therapeutic agent to a patient in need of treatment, when such components are formulated separately from each other in separate dosage forms that are taken in sequential time by the indicated patient with a significant time interval between each administration, after whereby said components are released at substantially different times to said patient; and

4) sequential administration of such a combination of an antibody of this invention and a therapeutic agent to a patient in need of treatment, when such components are formulated together in a single dosage form from which the release of these components occurs in a controlled manner, after which they are simultaneously, sequentially or jointly released into one and the same time and/or different time to the specified patient, where each part can be entered in one or different ways.

An antibody of the invention (eg, anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3, or anti-TRBV9-4) may be administered without additional therapeutic treatment, i. as a standalone therapy. In addition, treatment with an antibody of this invention may include at least one additional therapeutic treatment (combination therapy). In some embodiments, the antibody may be co-administered or formulated with another drug/drug for an autoimmune or oncological disease in which TCRs containing the TRBV9 beta chain are involved, e.g., AS, celiac disease, T-cell lymphoma, T-cell leukemia .

Doses and routes of administration

The antibody of this invention will be administered in an amount effective to treat the condition in question, i. in doses and for periods of time necessary to achieve the desired result. The therapeutically effective amount may vary depending on factors such as the particular condition being treated, the age, sex, and weight of the patient, and whether administration of the antibody is alone or in combination with one or more additional immunosuppressive or anti-inflammatory therapies. treatment.

- 14 041880

Drug regimens can be adjusted to provide the optimal desired response. For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally reduced or increased depending on the severity of the therapeutic situation. Especially useful is the formulation of parenteral compositions in unit dosage form for ease of administration and uniformity of dosing. Unit dosage form, as used herein, refers to physically discrete units suitable as unit doses for patients/subjects to be treated; each unit contains a predetermined amount of the active compound calculated to produce the desired therapeutic effect in combination with the required pharmaceutical carrier. The specification for unit dosage forms of the present invention is generally dictated by and directly dependent on (a) the unique characteristics of the chemotherapeutic agent and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the technique of compounding such an active compound to sensitivity treatment in subjects.

Thus, those skilled in the art will appreciate from the disclosure provided herein that doses and dosing regimens are adjusted in accordance with methods well known in the therapeutic field. This means that the maximum tolerated dose can be easily set and the effective amount that provides a detectable therapeutic effect for the patient can also be determined, as well as the time requirements for the administration of each agent to achieve a visible therapeutic effect for the patient. Thus, although some doses and regimens of administration are given as examples in this document, these examples in no way limit the doses and regimens of administration that may be needed for a patient in the practice of the present invention.

It should be noted that dosage values may vary depending on the type and severity of the condition to be alleviated and may include one or more doses. In addition, it should be understood that for any particular patient, specific administration schedules will need to be adjusted over time according to individual need and at the discretion of the healthcare professional who administers or supervises the administration of the compositions, and that the concentration ranges given in this specification are only by way of example and are not intended to limit the scope or practice of the claimed compositions. In addition, the dosage regimen with the compositions of this invention may be based on various factors, including the type of disease, age, weight, sex, health status of the patient, severity of the condition, route of administration, and the particular antibody used. Thus, the dosing regimen may vary widely, but may be determined regularly using standard methods. For example, doses may be adjusted based on pharmacokinetic and pharmacodynamic parameters, which may include clinical effects such as toxic effects or laboratory values. Thus, the present invention encompasses individual dose escalation as determined by the skilled artisan. Determination of the required dose and modes are well known in the relevant field of technology and will be clear to a person skilled in the art after reading the ideas disclosed in this document.

Examples of suitable routes of administration are provided above.

A suitable dose of an antibody of this invention is contemplated to be in the range of 0.1200 mg/kg, preferably 0.1-100 mg/kg, including about 0.5-50 mg/kg, e.g., about 1-20 mg /kg. The antibody may be administered, for example, at a dose of at least 0.25 mg/kg, for example, at least 0.5 mg/kg, including at least 1 mg/kg, for example, at least 1, 5 mg/kg, for example, as well as at least 2 mg/kg, for example, at least 3 mg/kg, including at least 4 mg/kg, for example, at least 5 mg/kg; and, for example, up to a maximum of 50 mg/kg, including up to a maximum of 30 mg/kg, for example, up to a maximum of 20 mg/kg, including up to a maximum of 15 mg/kg. The administration will be repeated usually at suitable intervals, for example, once a week, once every two weeks, once every three weeks, or once every four weeks, and for as long as is deemed appropriate by the physician in charge, who may in some cases increase or reduce dose if necessary.

pharmaceutical composition

An antibody of the invention may be included in a pharmaceutical composition suitable for administration to a patient. The antibodies of the invention may be administered alone or in combination with a pharmaceutically acceptable carrier, diluent and/or excipient in single or multiple doses. Pharmaceutical compositions for administration are designed to suit the selected mode of administration, and pharmaceutically acceptable diluents, carriers and/or excipients such as dispersing agents, buffers, surfactants, preservatives, solubilizing agents, isotonic agents, stabilizers, and the like . used properly. Said compositions have been formulated according to conventional methods as found in, for example, Remington, The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co.,

- 15 041880

Easton, PA 1995, which describes various methods for preparing compositions generally known to those skilled in the art.

Medicinal product (preparation) - a substance or mixture of substances in the form of a pharmaceutical composition in the form of tablets, capsules, powders, lyophilisates, injections, infusions, ointments and other ready-made forms, intended to restore, correct or change physiological functions in humans and animals, and also for the treatment and prevention of diseases, diagnosis, anesthesia, contraception, cosmetology and other things. Any method of administering peptides, proteins, or antibodies accepted in the art can be appropriately used for an antibody of this invention.

The term pharmaceutically acceptable means one or more compatible liquid or solid components that are suitable for administration to a mammal, preferably a human.

The term excipient or excipient is used herein to describe any component other than those previously described in this invention. These are substances of inorganic or organic origin used in the production process, the manufacture of medicines to give them the necessary physical and chemical properties.

The term buffer, buffer composition, buffer agent is understood as a solution capable of maintaining the pH value due to the interaction of the acidic and alkaline components that make up its composition, which enables the antibody preparation to be resistant to changes in pH. In general, pH values of the pharmaceutical composition between 4.0 and 8.0 are preferred. As buffer agents, for example, acetate, phosphate, citrate, histidine, succinate, and the like can be used. buffer solutions, but not limited to.

The terms tonic agent, osmolytic, or osmotic agent, as used herein, refer to an excipient that can supply the osmotic pressure of a liquid antibody preparation. An isotonic preparation is a preparation that has an osmotic pressure equivalent to that of human blood. Isotonic formulations typically have an osmotic pressure of about 250 to 350 mOsm/kg. As isotonic agents, polyols, mono- and disaccharides, amino acids, metal salts such as sodium chloride, and the like can be used, but not limited to.

A stabilizer is understood to be an excipient or a mixture of two or more excipients which provide the physical and/or chemical stability of the active agent. As stabilizers can be used amino acids, for example, arginine, histidine, glycine, lysine, glutamine, proline, but not limited to; surfactants such as polysorbate 20 (trade name Tween 20), polysorbate 80 (trade name Tween 80), polyethylene polypropylene glycol and its copolymers (trade names Poloxaner, Pluronic), sodium dodecyl sulfate (SDS), but , not limited to; antioxidants, for example, methionine, acetylcysteine, ascorbic acid, monothioglycerol, salts of sulfuric acids, and the like, but not limited to; chelating agents such as, but not limited to, ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), sodium citrate, and the like.

A pharmaceutical composition is stable if the active agent retains its physical stability and/or chemical stability and/or biological activity during the stated shelf life at a storage temperature, for example, at 2-8°C. Preferably, the active agent retains both physical and chemical stability, as well as biological activity. The storage period is selected based on the results of a stability study with accelerated and natural storage.

A pharmaceutical composition containing a monoclonal antibody of the invention may be administered to a patient having the pathologies as described herein using standard methods of administration, including oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or using suppositories.

The pharmaceutical composition of the invention preferably contains or is a therapeutically effective amount of an antibody of the invention. A therapeutically effective amount refers to an amount effective at dosages and over periods of time necessary to achieve the desired therapeutic result. A therapeutically effective amount of an antibody may vary depending on factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody or antibody portion to elicit the desired response in the individual. A therapeutically effective amount is also the amount at which the therapeutically beneficial effect of the antibody outweighs the toxic or deleterious effect. A prophylactically effective amount refers to an amount effective at dosages and for periods of time necessary to achieve the desired prophylactic result. Since a prophylactic dose is used in individuals before or at an early stage of the disease, typically the prophylactically effective amount may be less than the therapeutically effective amount.

- 16 041880

A therapeutically effective or prophylactically effective amount is at least the minimum dose, but less than the toxic dose, of the active agent necessary to provide a therapeutic benefit to the patient. On the other hand, a therapeutically effective amount of an antibody of the invention is an amount which, in mammals, preferably humans, reduces the biological activity of autoimmune clones, for example, through the binding of TCR, the beta chain of which belongs to the TRBV9 family, where the presence of these clones causes or contributes to unwanted pathological effects, or reduced levels of TCR, the beta chain of which belongs to the TRBV9 family, produces a beneficial therapeutic effect in a mammal, preferably a human.

The route of administration of an antibody of the invention may be oral, parenteral, inhaled, or topical. Preferably, the antibodies of the invention may be formulated into a pharmaceutical composition suitable for parenteral administration. The term parenteral as used in this application includes intravenous, intramuscular, subcutaneous, rectal, vaginal or intraperitoneal administration. Advantageously, administration is by intravenous or intraperitoneal or subcutaneous injection. Suitable carriers for such injections are directly known in the art.

The pharmaceutical composition, as specified in the relevant guidelines, must be sterile and stable under the conditions of manufacture and storage in a container that is provided, including, for example, a sealed vial (ampoule) or syringe. Therefore, pharmaceutical compositions may be sterile filtered after formulation or otherwise rendered microbiologically acceptable. A typical intravenous infusion composition may have a volume of 250-1000 ml of liquid, such as sterile Ringer's solution, saline, dextrose solution and Hank's solution, and a therapeutically effective dose (for example, 1-100 mg/ml or more) of the antibody concentration. The dose may vary depending on the type and severity of the disease. As is well known in the art, dosages for any given patient depend on many factors, including patient size, body surface area, age, particular compound to be administered, sex, time and route of administration, general health, and other medications. that are entered at the same time. A typical dose may be, for example, in the range of 0.001-1000 μg; however, doses below or above this exemplary range are contemplated, especially given the above factors. The dosage regimen for daily parenteral administration may be 0.1 µg/kg to 100 mg/kg based on total body weight, preferably 0.3 µg/kg to 10 mg/kg, and more preferably 1 µg/kg to 1 mg/kg , even more preferably 0.5 to 10 mg/kg of body weight per day. The treatment process can be monitored by periodically assessing the patient's condition. For repeated administration for several days or longer, depending on the condition of the patient, the treatment is repeated until the desired response is achieved or the symptoms of the disease are suppressed. However, other dosage regimens that are not described in this application may also be used. The desired dosage may be administered by single bolus administration, multiple bolus administrations, or by continuous infusion of the antibody, depending on the pharmacokinetic degradation pattern that the practitioner wishes to achieve.

These estimated amounts of antibody are highly dependent on the judgment of the therapist. The key factor in selecting the appropriate dose and regimen is the desired outcome. Factors considered in this context include the particular disease being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of administration of the antibody, the particular type of antibody, route of administration, mode of administration, and other factors known to medical practitioners. .

Therapeutic agents of the invention may be frozen or lyophilized and reconstituted in a suitable sterile vehicle prior to use. Lyophilization and reconstitution can result in varying degrees of loss of antibody activity. Dosages may be adjusted to compensate for this loss. In general, pH values of the pharmaceutical composition are between 6 and 8.

Product(s) and kits

A further embodiment of the invention is an article of manufacture which contains products useful in the treatment of autoimmune diseases and related conditions and malignant blood diseases in which TCRs carrying the beta chain of the TRBV9 family are involved. Such diseases include, for example, AS, celiac disease, T-cell leukemia, T-cell lymphoma, and others.

The product is a container with a label and leaflet, which can be placed in a blister and / or pack. Suitable containers are, for example, vials, ampoules, syringes, etc. The containers can be made from various materials such as glass or polymeric materials. The container contains a composition effective for treating a particular condition and may have a sterile inlet). At least one active ingredient in the composition is an antibody of the invention. The label and package insert indicate that the drug is used to treat a specific condition. The label and/or package insert should additionally contain instructions for administering the antibody composition to a patient, including information about the indications, use, dose, route of administration, contraindications, and/or precautions regarding the use of such therapeutic products. In one embodiment, the package insert states that the composition is used to treat specify what.

In addition, the product may include other products required from a commercial and consumer point of view, such as, but not limited to solvents, diluents, filters, needles and syringes.

The invention also relates to kits that can be used for various purposes, for example, to assess the ability to destroy T-cells bearing TCR of the TRBV9 family, to purify or immunoprecipitate the TRBV9 receptor from cells. For isolation and purification, the kit may contain an antibody bound to beads (eg, Sepharose beads). The set contains a container and a label and leaflet in the package.

Diagnostic use

The antibodies of the present invention are also used for diagnostic purposes (eg, in vitro, ex vivo). For example, the antibody can be used to detect or measure the level of TCRs containing the TRBV9 family of TCRs in samples obtained from a patient, such as a tissue sample or a body fluid sample such as inflammatory exudate, blood, intestinal fluid, saliva, or urine. Suitable detection and measurement methods include immunological methods such as flow cytometry, enzyme-linked immunosorbent assay (ELISA), chemiluminescent assay, radioimmunoassay, and immunohistology. The invention further includes kits, such as diagnostic kits, containing the antibodies described herein.

For a better understanding of the invention, the following examples are given. These examples are provided for illustrative purposes only and should not be construed as limiting the scope of the invention in any form.

All publications, patents, and patent applications referenced in this specification are incorporated herein by reference. Although the above invention has been described in some detail by way of illustration and example in order to avoid ambiguous interpretation, it will be quite clear to those skilled in the art based on the ideas disclosed in this invention that certain changes and modifications can be made without deviating from the essence and scope of the attached options. implementation of the invention.

experimental part

Example 1 Antibody Production and Purification

Nucleic acids (SEQ ID NO: 10, 12, 14, 16, 18) encoding the variable domains of the heavy and light chains of the antibody were obtained by amplifying DNA fragments using overlapping primers and high fidelity Q5 polymerase (NEB, USA). The resulting nucleic acids were purified on Quagen columns (Germany) using a reagent kit (# 28104) and cloned into commercially available pFuse vectors containing constant regions of the human heavy (IgG1) and light (kappa) chain genes (Invivogen, USA). The sequences of the cloned fragments were confirmed by Sanger sequencing.

As a result, plasmids were obtained containing coding sequences for four variants of the heavy chain of the antibody:

HV anti-TRBV9-1, the nucleotide and amino acid sequences of which are shown in SEQ ID NOs: 20 and 21;

HV anti-TRBV9-2, the nucleotide and amino acid sequences of which are shown in SEQ ID NOs: 22 and 23;

HV anti-TRBV9-3, the nucleotide and amino acid sequences of which are shown in SEQ ID NOs: 24 and 25;

HV anti-TRBV9-3, the nucleotide and amino acid sequences of which are shown in SEQ ID NOs: 26 and 27;

and for one light chain variant of the anti-TRBV9 LV antibody (SEQ ID NOS: 28 and 29).

The degree of humanization of the heavy chain of the antibody is 72%, and the light chain - 69%.

To obtain antibodies, plasmids were transfected into a suspension HEK293F cell line. The 293fectine reagent (Thermo Fisher scientific, USA # 1234701) was used for transfection. 30 million cells were placed in 30 ml of FreeStyle medium, 30 μg of the pFuse plasmid encoding one of the antibody heavy chain variants, 30 μg of the pFuse plasmid encoding the antibody light chain, and 60 μl of 293fectine (Thermo Fisher scientific, USA) were added to them. 12347019). Plasmids containing immunoglobulin heavy and light chains were dissolved in endotoxin-tested water (Quagen, USA)

The resulting reaction mixtures were incubated at 37°C on a shaker for a week. A week later, the cell supernatant was collected and used to isolate antibodies. For this, the supernatant was centrifuged three times at 10,000 rpm for 10 min, and the liquid fraction was purified using a 1-mL HiTrap PrG column (Thermo Fisher scientific, USA). 0.1 M glycine was used for elution.

- 18 041880 buffer pH 2.5, adjusted with HCl. The quality of isolation was assessed using 12% PAGE-electrophoresis under denaturing conditions. Quantification was carried out by measuring on a NanoDrop2000 microspectrophotometer at 280A. The resulting product was stored at +4°C.

Characteristics of the isolated proteins are given in table. 1.

Table 1. Characteristics of antibodies

Name Molecular mass (theor.), kDa isotochka Extinction coefficient Purity squirrel, % Protein concentration, mg/ml Absorbent at 400 nm 1=1cm TRBV9- 1 146.3 8.35 1.52 98.3 2.58 0.005 TRBV9- 2 146.5 8.35 1.52 98.7 1.91 0.003 TRBV9- 3 146.5 8.35 1.52 97.8 1.83 0.003 TRBV9- 4 146.5 8.35 1.52 98.9 1.56 0.004

Affinity determination of anti-TRBV9 antibodies was performed on an OctetRed 96 instrument (from ForteBio). Antigens were nonspecifically immobilized on the surface of second-generation amino-reactive sensors (from AR2G) (Table 1) according to the standard protocol according to the manufacturer's instructions for the preparation and immobilization of AR2G sensors. The assay was performed at 30° C. using phosphate buffered saline (PBS) containing 0.1% Tween-20 and 0.1% BSA as running buffer. Binding affinity analysis of anti-TRBV9 antibodies was performed using running buffer from a concentration of 126 nM to 2 nM in steps of 2. Binding curves minus the reference signal were analyzed using Octet Data Analysis software (version 7.0) according to the standard procedure using interaction model 1: 1. The results are summarized in table. 2.

Table 2. Assessment of antibody affinity

Antigen: TRBV9+TRAV26 Antigen: TRBV9+TRAV38 kD, M cop, 1/Ms kdis, 1/s R2 kD, M cop, 1/Ms kdis, 1/s R2 TRBV 9-1 2.20E- 10 5.15E+ 05 1.13E- 04 0.991 5 4,14E- 10 4.41E+ 05 1.83E- 04 0.981 5 2.78E- 10 6.58E+ 05 1.83E- 04 0.99 3.65E- 10 5.62E+ 05 2.05E- 04 0.977 6 2.04E- 10 5.59E+ 05 1.14E- 04 0.984 1 5.29E- 10 3.71E+ 05 1.96E- 04 0.987 7 TRBV 9-2 1.35E- eleven 4.47E+ 05 6.02E- 06 0.990 5 <1.0E- 12 3.97E+ 05 <1.0E- 07 0.977 2 <1.0E- 12 3.81E+ 05 <1.0E- 07 0.986 1 <1.0E- 12 2.89E+ 05 <1.0E- 07 0.989 4 TRBV 9-3 3.19E- 10 2.87E+ 05 9.16E- 05 0.999 1 3.11E- 10 3.09E+ 05 9.61E- 05 0.994 2 5.82E- 10 1.68E+ 05 9.80E- 05 0.999 8 4.00E- 10 2.29E+ 05 9.16E- 05 0.996 2 TRBV 9-4 <1.0E- 12 8.65E+ 05 <1.0E- 07 0.938 1 <1.0E- 12 7.13E+ 05 <1.0E- 07 0.905 8 <1.0E- 12 5.79E+ 05 <1.0E- 07 0.954 6 <1.0E- 12 4.76E+ 05 <1.0E- 07 0.951 2

When using TRBV7+TRAV38 antigens, no interaction with antibodies was observed. The best performance was shown by the TRBV9-2 and TRBV9-4 antibodies.

Example 2 Use of anti-TRBV9 monoclonal antibodies to label T-lymphocytes expressing the TCR beta chain belonging to the TRBV9 family.

Monoclonal antibodies (anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3, anti-TRBV9-4 differing in the heavy chain CDR3 sequence) were prepared as described in Example 1. labeling with fluorescein using the fluorescein isothiocyanate reagent (Sigma, USA) according to the manufacturer's protocol. The amount of fluorophores that reacted with antibody molecules was controlled by the ratio of the absorption spectrum at wavelengths

495/280 nm. Labeled antibodies were used to detect T-lymphocytes expressing the beta chain

TCR of the TRBV9 family, in the mononuclear fraction of human blood.

To obtain this fraction, peripheral blood of 5 healthy donors was used. Blood was collected in Vacuette tubes with EDTA (2x9 ml), mononuclear fraction according to the standard method described in (Kovalchuk L.V. et al. Immunology: workshop - 2010, p. 176). After isolation, the cells were transferred to phosphate buffered saline (PBS) containing 0.5% bovine serum albumin (BSA) and 2 mM EDTA. The total number of cells and their viability were determined by the trypan blue staining method as described by H.R. Lang. (Stimulation of lymphocytes M.: Medicine, 1976, p. 288).

To label T-lymphocytes in each test, an aliquot of the mononuclear fraction containing 500 thousand cells (per test) was added in PBS buffer with the addition of 0.5% bovine serum albumin (BSA) and 2 Mm EDTA antibodies anti-TRBV9-1, anti- TRBV9-2, anti-TRBV9-3, anti-TRBV9-4 to a final concentration of 5 and 0.5 ng/µl, as well as a monoclonal antibody against CD3-eFluor405 ((clone OKT3, eBioscience);) at a concentration recommended by the manufacturer.

The obtained reaction mixtures with a volume of 50 μl PBS with 0.5% BSA 2 mM EDTA were incubated at room temperature for 30 min, after which the cells were washed with PBS buffer with 0.5% BSA 2 mM EDTA and the staining results were analyzed using flow cytometry (FACSARIA III, USA, Fig. 14). It was shown that all obtained variants of monoclonal antibodies specifically recognize the fraction of CD3+ positive cells. However, the TRBV9-2 variant showed the most stable staining, which was 2.9% of the CD3-positive fraction, at both 5 ng/µl and 0.5 ng/µl antibody concentrations. Whereas other antibody variants (anti-TRBV9-2, anti-TRBV9-3, antiTRBV9-4) stained different proportions of TRBV9+ lymphocytes at the same concentrations. Also, the specificity of anti-TRBV9-2 activity was determined by the absence of weakly stained non-specific CD3-negative cells, which is present when using other options, and by a significant separation of a specific cell population from other CD3-positive TRBV9 receptor-negative lymphocytes.

Thus, it was found that the second variant (anti-TRBV9-2) showed the most efficient and highly specific staining of TRBV9+ T lymphocytes. This antibody can be used for diagnostic purposes to detect TRBV9+ T lymphocytes at a concentration of 0.6 ng/µl.

To assess the specificity of anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3, antiTRBV9-4 antibodies, blood mononuclear fractions obtained as described above from 5 peripheral blood samples were stained with anti-TRBV9-FITC antibody and anti- CD3-eFluor450 (eBioscience, USA) antibody as described above using the following ratios:

5 μl (1 μg) of anti-CD3-eFluor 450 (eBioscience, USA) and 30 ng (0.5 ng/μl) of anti-TRBV9-2 FITC were added to 3 million cells of the blood mononuclear fraction. The reaction mixtures were incubated at room temperature for 30 min, the cells were washed with PBS buffer with 0.5% BSA and sorted on a cell sorter (FACSARIA III, USA), isolating the population of CD3+TRBV9+ and CD3+TRBV9– cells. To control the quality of sorting, the CD3+TRBV9+ population was resorted, which showed that the enrichment in the target cell population was 95%.

The resulting cell fractions were placed in RLT buffer (Quagen, Germany) and RNA was isolated from them using Quiagen RNAeasy mini kit #217004 (Quagen) according to the manufacturer's protocol. cDNA was synthesized on the isolated RNA template, and fragments of the T receptor beta chain were amplified according to the protocol described by Britanova et al (J Immunol, 2016, 196 (12) 5005-5013) using the Mint cDNA synthesis kit (Evrogen, Russia). Illumina adapters (USA) were ligated to the accumulated amplicons and sequenced on the MiSeq Illumina platform according to the protocol of the sequencer manufacturer. Sequencing data was analyzed using the MiGEC, MiXCR, and VDJtools programs available on the Internet site: https://milaboratory.com. Data analysis showed that 90% of the sequences from the CD3+TRBV9+ fraction belong to the TRBV9 beta chain variable segment gene family. At the same time, no fragments containing the TRBV9 variable segment sequence were found in the CD3+TRBV9- fraction. Thus, anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3, anti-TRBV9-4 specifically bind to the beta chain of the TRBV9 family.

Example 3 Functional Activity of Antibodies

Monoclonal antibodies (anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3, anti-TRBV9-4 differing in heavy chain CDR3 sequence) were obtained as described in Example 1. Human mononuclear blood fraction was obtained as described in Example 2 .

Additionally, natural killers were isolated from a part of the mononuclear fraction using a set of reagents for the isolation of human NK cells # 130-092-657 (Miltenyi biotec, USA). Manufacturers' protocol was used. The quality of NK cell isolation was assessed by cytofluorometry (BD FACS ARIA III, USA) using labeled antibodies CD16-FITC, CD56-PE, CD3-20 041880

VioBlue. The enrichment of NK cells was 85-95%.

To assess cytotoxicity, antibodies (anti-TRBV9-1, anti-TRBV9-2, anti-TRBV9-3, or anti-TRBV9-4) were added to an aliquot of the mononuclear fraction containing 1x106 cells to a final concentration of 5 μg/ml. Remicade antibodies were used as a negative control at the same concentration as anti-TRBV9. No antibodies were added to the control cell aliquot (positive control). Also, 105 NK cells were added to all reaction mixtures. The final reaction volume was 100 μl.

The reaction mixtures were incubated at room temperature for one hour, then the cells were washed several times to remove antibodies and spread over the wells of a 96-well round bottom plate on the table.

After 6 days, cells were harvested from the wells and used for immunophenotypic analysis using flow pyrometry. The following antibodies were used to detect T lymphocytes: anti-CD3-eFluor450 (clone OKT3, eBioscience); anti-CD8-PC7 (clone SFCI21Thy2D3, Beckman Coulter, USA); our anti-TRBV9-1,2,3,4 antibodies, labeled with Fic. After staining, the cells were washed and analyzed on a BD FACSARIA III instrument. T-lymphocytes CD3+TRBV9+ in samples subjected to incubation with anti-TRBV9 antibodies of the present invention are not detected. At the same time, in the control sample without the addition of anti-TRBV9 antibodies (null-control), as well as with the addition of remicade therapeutic antibodies, the detection of double positive T lymphocytes for CD3+TRBV9+ markers is preserved, which confirms the specific elimination of TRBV9+ T cells when antibodies against TRBV9 are added. . A typical flow cytometry result is shown in Fig. 5. In an additional negative control, where non-cytotoxic anti-CD6 antibodies were used instead of the anti-TRBV9 antibodies of the present invention, the CD3+CD6+ target population did not change compared to the null control. This indicates that epitope shielding by unlabeled antibodies does not occur on day 6 and confirms the ability of anti-TRBV9 antibodies to eliminate cells carrying TCRs of the TRBV9 family.

Example 4 Establishment of a Stable Cell Line

A stable cell line producing the anti-TRBV9-2 monoclonal antibody was obtained by transfection of a suspension CHO-S cell line with vector constructs containing antibody light and heavy chains in an optimized ratio. High level clonal lines (greater than 100 mg/L) were generated using the ClonePix robotic platform (Molecular Devices). The productivity of selected clones was analyzed using the Biomek FX robotics automated system (Beckman Coulter) and the Octet RED96 analytical system (Pall Life Sciences). Serum-free media containing no proteins of animal origin were used for the cultivation of the producer. The production of the BCD085 preparation for preclinical studies was carried out in a HyClone single-use bioreactor (Thermoscientific) fermenter with a working volume of 200 L.

Example 5. Obtaining a pharmaceutical composition containing an antibody according to the invention The components of the pharmaceutical composition are shown in table. 3.

Table 3. The concentration of the components of the pharmaceutical composition

Component Concentration Anti-THBV9-2 antibody 10-50 mg/ml Citrate buffer 10 mM to pH 6.0-7.0 Sodium chloride 50-150 mM sucrose, trehalose 0.3-0.5% Water for injections up to 1 ml.

Example 6 Antibody Pharmaceutical Composition Kit

For the production of kits with a dosage form containing a composition with antiTRBV9-2 antibodies, the pharmaceutical composition obtained according to example 5 is sealed into 1 ml ampoules or syringes under sterile conditions, labeled and packaged in containers made of plastic or cardboard material.

Also, instructions for use are included in the container with the ampoule.

Example 7 Antibody Variants of the Invention

To generate mutant HV anti-TRBV9-1 sequences, site-directed mutagenesis was performed using the overlap extention of PCR products as described by Wurch et al., Methods in Molecular Biology. 12 (9), 653 - 657 (2004). For PCR, high-precision Q5 polymerase (NEB, USA) was used, according to the manufacturer's recommendations. After amplification, the obtained fragments were purified by electrophoresis in 1% agarose gel and further extraction. The DNA fragments containing mutations isolated from the gel were combined into a whole construct by the overlap extention PCR method (denaturation 95°C - 12 s; annealing 55°C - 2 min; elongation 72°C - 1 min, 8 PCR cycles). This method implies that the fragments present in the reaction mixture with sites complementary to each other are used as a matrix and a seed. Amplification of the entire construct was performed by standard PCR with the addition of primers complementary to the ends of the fragment being amplified.

- 21 041880

The resulting nucleic acids were purified on Quagen columns (Germany) using a reagent kit (# 28104) and cloned into the pFuse vector as described in Example 1. Mutant DNA sequences were verified by Sanger sequencing. Nucleotide and amino acid sequences of the obtained variable domains are shown: option 1 - in SEQ ID NO: 30 and SEQ ID

NO: 31; option 2 in SEQ ID NO: 32 and SEQ ID NO: 33.

The ability of the mutant antibodies to bind to T lymphocytes expressing the TCR beta chain belonging to the TRBV9 family was tested as described in Example 2. The changes made were shown to have no effect on binding specificity.

Sequence listing <110> CJSC BIOCAD <120> Monoclonal antibody and methods of its use <130> TCRB9.docx <160> 33 <170> Patentin version 3.5 <210> 1 <211> 5 <212> PRT <213> Artificial <220 >

<223> HCDR1 amino acid sequence (according to Kabat nomenclature) <400> 1

Asp Tug Leu Vai His

5 <210> 2 <211> 17 < 212> PRT < 213> Artificial <220>

<223> HCDR2 amino acid sequence (according to Kabat nomenclature) <4Θ0> 2

Trp lie Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe Glu

10 15

Gly < 210> 3 < 211> 13 < 212> PRT < 213> Artificial <220>

<223> HCDR3 amino acid sequence (according to Kabat nomenclature) <400> 3

Ser Trp Arg Arg Gly Leu Arg Gly Leu Gly Phe Asp Tyr

10 < 210> 4 < 211> 13 < 212> PRT < 213> artificial

- 22 041880 <220>

<223> HCDR3 amino acid sequence (according to Kabat nomenclature) <400> 4

Ser Trp Arg Arg Gly Leu Arg Gly lie Gly Phe Asp Tyr

10 <210> 5 <211> 13 < 212> PRT < 213> Artificial <220>

<223> HCDR3 amino acid sequence (according to Kabat nomenclature) < 4ΘΘ> 5

Ser Trp Arg Arg Gly lie Arg Gly Leu Gly Phe Asp Tyr

10 < 210> 6 < 211> 13 < 212> PRT < 213> Artificial <220>

<223> HCDR3 amino acid sequence (according to Kabat nomenclature) <400> 6

Ser Trp Arg Arg Gly lie Arg Gly lie Gly Phe Asp Tyr

10 < 210> 7 < 211> 11 < 212> PRT < 213> Artificial <220>

<223> LCDR1 amino acid sequence (according to Kabat nomenclature) <400> 7

Lys Ala Ser Lys Ser He Asn Lys Tyr Leu Ala

10 < 210> 8 < 211> 7 < 212> PRT < 213> Artificial <220>

<223> LCDR2 amino acid sequence (according to Kabat nomenclature)

- 23 041880 <400> 8

Asp Gly Ser Thr Leu Gin Ser 1 5 < 210> 9 < 211> 9 < 212> PRT < 213> Artificial <220>

<223> LCDR3 amino acid sequence (according to Kabat nomenclature) <400> 9

Gin Gin His Asn Glu Tyr Pro Pro Thr

5 <210> 10 <211> 321 < 212> DNA < 213> Artificial <220>

<223> Nucleotide sequence of the light chain variable domain of antibody <400> 10

gacgtgcaga tgacccagtc cccctacaac ctggccgcct cccccggcga gtccgtgtcc 6Θ atcaactgca aggcctccaa gtccatcaac aagtacctgg cctggtacca gcagaagccc 120 ggcaagccca acaagctgct gatctacgac ggctccccc tgcagtccgg catcccctcc 180 aggttctccg gctccggctc cggcaccgac ttcaccctga ccatcagggg cctggagccc 240 gaggacttcg gcctgtacta ctgccagcag cacaacgagt accccccac cttcggcgcc 300 ggcaccaagc tggagctgaa g 321

< 210> 11 <211> 107 < 212> PRT < 213> Artificial <220>

<223> antibody light chain variable domain amino acid <400> 11

Asp Vai Gin Met Thr Gin Ser Pro Tyr Asn Leu Ala Ala Ser Pro Gly

1015

Glu Ser Vai Ser lie Asn Cys Lys Ala Ser Lys Ser He Asn Lys Tyr 20 2530

Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Pro Asn Lys Leu Leu lie 35 4045

- 24 041880

Tug Asp Gly Ser Thr Leu Gin Ser Gly lie Pro Ser Arg Phe Ser Gly

5560

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Arg Gly Leu Glu Pro 65 70 7580

Glu Asp Phe Gly Leu Tyr Tyr Cys Gin Gin His Asn Glu Tyr Pro Pro 85 9095

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100105 <210> 12 <211> 366 <212> DNA <213> Artificial <220>

<223> Нуклеотидная последовательность вариабельного домена тяжелой цепи антитела <400> 12 cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg 6© tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc 120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 180 gccgacgact tcgagggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac 240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggcc tgaggggcct gggcttcgac tactggggcc agggcgtgtt cgtgaccgtg 360 tcctcc 366 <210> 13 <211> 122 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of the variable domain of the antibody heavy chain <40©> 13

Gin 1 lie gin Leu Val Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu 5 10 15 Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 thirty Leu Valhis Trp Val Lys Gin Ala Pro Gly Lys Gly Leu Lys Trp Met 35 40 45

- 25 041880

Gly Trp lie Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 5560

Glu Gly Arg Phe Vai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn 65 70 75S0

Leu Gin lie Ser Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095

Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly Leu Gly Phe Asp Tyr Trp

100 105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser 115120 <210> 14 <211> 366 <212> DNA <213> Artificial <220>

<223> Нуклеотидная последовательность вариабельного домена тяжелой цепи антитела <400> 14 cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac18Θ gccgacgact tcgagggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg300 aggaggggcc tgaggggcat cggcttcgac tactggggcc agggcgtgtt cgtgaccgtg368 tcctcc366 <210> 15 <211> 122 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of antibody heavy chain variable domain <400> 15

Gin Not Gin Leu Vai Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu

10 15

Ser Vai Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 30

- 26 041880

Leu Vai His Trp Vai Lys Gin Ala Pro Gly Lys Gly Leu Lys Trp Met 35 4045

Gly Trp He Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 5560

Glu Gly Arg Phe Vai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn 65 70 7580

Leu Gin Ue Ser Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095

Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly lie Gly Phe Asp Tyr Trp

100 105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser 115120 <210> 16 < 211> 366 < 212> DNA < 213> Artificial <220>

<223> Nucleotide sequence of the heavy chain variable domain of antibody <400> 16

cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg 60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc 120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 180 gccgacgact tcgaggggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac 240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggca tcaggggcct gggcttcgac tactggggcc aggcgtgtt cgtgaccgtg 360

tcctcc 366 < 210> 17 < 211> 122 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of antibody heavy chain variable domain <400> 17

Gin lie Gin Leu Vai Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu

10 15

Ser Vai Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

- 27 041880

2530

Leu Vai His Trp Vai Lys Gin Ala Pro Gly Lys Gly Leu Lys Trp Met 35 4045

Gly Trp lie Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 5560

Glu Gly Arg Phe Vai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn 65 70 7580

Leu Gin He Ser Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095

Ala Arg Ser Trp Arg Arg Gly He Arg Gly Leu Gly Phe Asp Tyr Trp

100 105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser 115120 <210> 18 <211> 366 <212> DNA <213> Artificial <220>

<223> Нуклеотидная последовательность вариабельного домена тяжелой цепи антитела <400> 18 cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac180 gccgacgact tcgagggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggteetgg300 aggaggggca tcaggggcat cggcttcgac tactggggcc agggcgtgtt cgtgaccgtg360 tcctcc366 <21θ> 19 <211> 122 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of antibody heavy chain variable domain <400> 19

Gin lie Gin Leu Vai Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu

10 15

- 28 041880

Ser Vai Lys Leu Ser Cys 20 Lys Ala Ser Gly 25 Tyr Thr Phe Thr 30 asp Tyr Leu Wai His 35 Trp Vai Lys Gin Ala Pro Gly 40 Lys gly Leu 45 Lys trp Met Gly Trp He 50 Asn Thr Tyr Thr Gly Thr Pro 55 Thr Tyr 60 Ala asp asp Phe Glu Gly Arg Phe Wai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn

Leu Gin lie Ser Asn

Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 9095

Ala Arg Ser Trp Arg Arg Gly 100 lie Arg Gly He Gly Phe Asp Tyr Trp

105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser 115120 < 210> 20 < 211> 1365 < 212> DNA < 213> Artificial <220>

<223> Nucleotide sequence of the heavy chain of the antibody aHTH-TRBV9-l <400> 20

cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg 60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc 120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 180 gccgacgact tcgaggggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac 240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggcc tgaggggcct gggcttcgac tactggggcc aggcgtgtt cgtgaccgtg 360 tcctccgcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc 420 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 480 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 540 tcctcaggac tctactccct cagcagcgtg gtgactgtgc cctctagcag cttgggcacc 600 cagacctaca tctgcaacgt gaatcacaag ccagcaaca ccaaggtgga caagaaagtt 660 gagcccccga aatcttgtga caaaactcac acatgcccac cgtgcccagc acctgaactc 720 ctggggggac cgtcagtctt ccctcttcccc ccaaaaccca aggacccct catgatctcc 780

- 29 041880

cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 840 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 900 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 960 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tccagcccc catcgagaaa 1020 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1080 cgggatgagc tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1140 agcgacatcg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg 1200 cctcccgtgc tggactccga cggctccttc ttcctctaca gcaagctcac cgtggacaag 1260 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1320 cactacacgc agaagagcct ctccctgtct CCgggtaaat gataa 1365

< 210> 21 < 211> 452 < 212> PRT < 213> Artificial <220>

< 223> Amino acid sequence of the heavy chain of the anti-TKV\/9-1 antibody < 4ΘΘ> 21

Gin Not Gin Leu Vai Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu 15 1015

Ser Vai Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 2530

Leu Vai His Trp Vai Lys Gin Ala Pro Gly Lys Gly Leu Lys Trp Met 35 4045

Gly Trp He Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 556Θ

Glu Gly Arg Phe Vai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn 65 70 7586

Leu Gin He Ser Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys

9095

Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly Leu Gly Phe Asp Tyr Trp

100 105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser Ala Ser Thr Lys Gly Pro

115 120125

- 30 041880

Ser Vai Phe Pro Leu Ala Pro Ser Ser

130 135

Lys Ser Thr Ser Gly Gly Thr 140

Ala Ala Leu Gly Cys Leu Vai Lys Asp 145 150

Tyr Phe Pro Glu Pro Vai Thr

155 160

Vai Ser Trp Asn Ser Gly Ala Leu Thr

165

Ser Gly Vai His Thr Phe Pro

170 175

Ala Vai Leu Gin Ser Ser Gly Leu Tyr

180 185

Ser Leu Ser Ser Vai Vai Thr

190

Vai Pro Ser Ser Ser Leu Gly Thr Gin

195 200

Thr Tyr lie Cys Asn Vai Asn

205

His Lys Pro Ser Asn Thr Lys Vai Asp

210 215

Lys Lys Vai Glu Pro Lys Ser

220

Cys Asp Lys Thr His Thr Cys Pro Pro

225 230

Cys Pro Ala Pro Glu Leu Leu

235 240

Gly Gly Pro Ser Vai Phe Leu Phe Pro

245

Pro Lys Pro Lys Asp Thr Leu

250 255

Met lie Ser Arg Thr Pro Glu Vai Thr

260 265

Cys Vai Vai Vai Asp Vai Ser

270

His Glu Asp Pro Glu Vai Lys Phe Asn

275 280

Trp Tyr Vai Asp Gly Vai Glu 285

Vai His Asn Ala Lys Thr Lys Pro Arg

290 295

Glu Glu Gin Tyr Asn Ser Thr

300

Tyr Arg Vai Vai Ser Vai Leu Thr Vai 305 310

Leu His Gin Asp Trp Leu Asn

315 320

Gly Lys Glu Tyr Lys Cys Lys Vai Ser

325

Asn Lys Ala Leu Pro Ala Pro

330 335 lie Glu Lys Thr lie Ser Lys Ala Lys

340 345

Gly Gin Pro Arg Glu Pro Gin

350

Vai Tyr Thr Leu Pro Pro Ser Arg Asp

355 360

Glu Leu Thr Lys Asn Gin Vai

365

Ser Leu Thr Cys Leu Vai Lys Gly Phe

370 375

Tyr Pro Ser Asp lie Ala Vai

380

Glu Trp Glu Ser Asn Gly Gin Pro Glu

Asn Asn Tyr Lys Thr Thr Pro

- 31 041880

385 390 395400

Pro Vai Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr 4Θ5 410415

Vai Asp Lys Ser Arg Trp Gin Gin Gly Asn Vai Phe Ser Cys Ser Vai 420 425430

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu 435 440445

Ser Pro Gly Lys 450 <210> 22 <211> 1365 <212> DNA <213> Artificial <220>

<223> Nucleotide sequence of the heavy chain of the antibody aHTn-TRBV9-2 <400> 22

cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg 60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc 120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 1S0 gccgacgact tcgaggggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac 240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggcc tgaggggcat cggcttcgac tactggggcc aggcgtgtt cgtgaccgtg 360 tcctccgcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc 420 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 480 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 540 tcctcaggac tctactccct cagcagcgtg gtgactgtgc cctctagcag cttgggcacc 600 cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caagaaagtt 660 gagcccccga aatcttgtga caaaactcac acatgcccac cgtgcccagc acctgaactc 720 ctggggggac cgtcagtctt ccctcttcccc ccaaaaccca aggacccct catgatctcc 780 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 840 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 900 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 960 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tccagcccc catcgagaaa 1020 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1080

- 32 041880

cgggatgagc tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1140 agcgacatcg ccgtggagtgggagagcaat gggcagccgg agaacaacta caagaccacg 1200 cctcccgtgc tggactccga cggctccttc ttcctctaca gcaagctcac cgtggacaag 1260 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1320 cactacacgc agaagagcct ctccctgtct ccgggtaaat gataa 1365

< 210> 23 < 211> 452 < 212> PRT < 213> Artificial <220>

<223> Anti-TKVU9-2 antibody heavy chain amino acid sequence <40θ> 23

Gin He Gin Leu Vai Gin Ser Gly Pro Glu Leu Arg Glu Pro Gly Glu

1015

Ser Vai Lys Leu Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 2530

Leu Vai His Trp Vai Lys Gin Ala Pro Gly Lys Gly Leu Lys Trp Met 35 4045

Gly Trp He Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe

5560

Glu Gly Arg Phe Vai Phe Ser Leu Glu Ala Ser Ala Ser Thr Ala Asn 65 70 7580

Leu Gin He Ser Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095

Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly lie Gly Phe Asp Tyr Trp

100 105110

Gly Gin Gly Vai Phe Vai Thr Vai Ser Ser Ala Ser Thr Lys Gly Pro

115 120125

Ser Vai Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr

130 135140

Ala Ala Leu Gly Cys Leu Vai Lys Asp Tyr Phe Pro Glu Pro Vai Thr

145 150 155160

Vai Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Vai His Thr Phe Pro

165 170175

- 33 041880

Ala

Vai

Leu

gin

180

Ser

gly

Leu

Tyr

185

Ser

Leu

Ser

Ser

Val

190

Vai

Thr

Vai

Pro

Ser

195

Ser

Ser

Leu

gly

Thr

200

gin

Thr

Tyr lie

Cys

205

Asn

Vai

Asn

His

Lys

210

Pro

Ser

Asn

Thr

Lys 215

Vai

asp

Lys

Lys

Val

220

Glu

Pro

Lys

Ser

Cys

225

asp

Lys

Thr

His

Thr

230

Cys

Pro

Pro

Cys

Pro

235

Ala

Pro

Glu

Leu

Leu 240

gly

gly

Pro

Ser

Val

245

Phe

Leu

Phe

Pro

Pro

250

Lys

Pro

Lys

asp

Thr

255

Leu

Met

He

Ser

Arg

260

Pro

Glu

Vai

Thr

265

Cys

Vai

Vai

Vai

Asp 270

Vai

Ser

His

Glu

asp

275

Pro

Glu

Vai

Lys

Phe

280

Asn

trp

Tyr

Vai

asp

285

gly

Vai

Glu

Vai

His

290

Asn

Ala

Lys

Thr

Lys 295

Pro

Arg

Glu

Glu

gin

300

Tyr

Asn

Ser

Thr

Tyr

305

Arg

Vai

Vai

Ser

Val

310

Leu

Thr

Vai

Leu

His

315

gin

asp

trp

Leu

Asn

320

gly

Lys

Glu

Tyr

Lys 325

Cys

Lys

Vai

Ser

Asn

330

Lys

Ala

Leu

Pro

Ala

335

Pro

He

Glu

Lys

Thr

340

He

Ser

Lys

Ala

Lys 345

gly

gin

Pro

Arg

Glu

350

Pro

gin

Vai

Tyr

Thr

355

Leu

Pro

Pro

Ser

Arg

360

asp

Glu

Leu

Thr

Lys 365

Asn

gin

Vai

Ser

Leu 370

Thr

Cys

Leu

Val

Lys 375

gly

Phe

Tyr

Pro

Ser

380

asp

He

Ala

Vai

Glu

385

trp

Glu

Ser

Asn

Gly 390

gin

Pro

Glu

Asn

Asn

395

Tyr

Lys

Thr

Thr

Pro

400

Pro

Val

Leu

asp

Ser

405

asp

gly

Ser

Phe

Phe 410

Leu

Tyr

Lys

Leu 415

Thr

Val

asp

Lys

Ser

420

Arg

trp

gin

gin

Gly 425

Asn

Val

Phe

Ser

Cys 430

Ser

Val

- 34 041880

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu

435 440 445

Ser Pro Gly Lys 450 <210> 24 <211> 1365 <212> DNA <213> Artificial <220>

<223> Anti-TKVU9-3 antibody heavy chain nucleotide sequence <400> 24

cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg 60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc 120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 180 gccgacgact tcgaggggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac 240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggca tcaggggcct gggcttcgac tactggggcc aggcgtgtt cgtgaccgtg 360 tcctccgcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc 420 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 480 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 540 tcctcaggac tctactccct cagcagcgtg gtgactgtgc cctctagcag cttgggcacc 600 cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caagaaagtt 660 gagcccccga aatcttgtga caaaactcac acatgcccac cgtgcccagc acctgaactc 720 ctggggggac cgtcagtctt ccctcttcccc ccaaaaccca aggacccct catgatctcc 780 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 840 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 900 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 960 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tccagcccc catcgagaaa 1020 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1080 cgggatgagc tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1140 agcgacatcg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg 1200 cctcccgtgc tggactccga cggctccttc ttcctctaca gcaagctcac cgtggacaag 1260 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1320 cactacacgc agaagagcct ctccctgtct ccgggtaaat gataa 1365

- 35 041880 < 210> 25 < 211> 452 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of the heavy chain of the aHTH-TRBV9-3 antibody <400> 25

Gin lie Gin Leu Vai Gin Ser Gly 1 5

Pro Glu Leu Arg Glu Pro Gly Glu

15

Ser Vai Lys Leu Ser Cys Lys Ala 20

Ser Gly Tyr Thr Phe Thr Asp Tyr 25 30

Leu Vai His Trp Vai Lys Gin Ala

40

Pro Gly Lys Gly Leu Lys Trp Met 45

Gly Trp He Asn Thr Tyr Thr Gly

55

Thr Pro Thr Tyr Ala Asp Asp Phe 60

Glu Gly Arg Phe Vai Phe Ser Leu 65 70

Glu Ala Ser Ala Ser Thr Ala Asn

80

Leu Gin He Ser Asn Leu Lys Asn 85

Glu Asp Thr Ala Thr Tyr Phe Cys

95

Ala Arg Ser Trp Arg Arg Gly lie

100

Arg Gly Leu Gly Phe Asp Tyr Trp 105 HO

Gly Gin Gly Vai Phe Vai Thr Vai

115 120

Ser Ser Ala Ser Thr Lys Gly Pro

125

Ser Vai Phe Pro Leu Ala Pro Ser

130 135

Ser Lys Ser Thr Ser Gly Gly Thr

140

Ala Ala Leu Gly Cys Leu Vai Lys 145 150

Asp Tyr Phe Pro Glu Pro Vai Thr

155 160

Vai Ser Trp Asn Ser Gly Ala Leu

165

Thr Ser Gly Vai His Thr Phe Pro

170 175

Ala Vai Leu Gin Ser Ser Gly Leu

180

Tyr Ser Leu Ser Ser Vai Vai Thr

185 190

Vai Pro Ser Ser Ser Leu Gly Thr

195 200

Gin Thr Tyr He Cys Asn Vai Asn

205

His Lys Pro Ser Asn Thr Lys Vai

210 215

Asp Lys Lys Vai Glu Pro Lys Ser

220

- 36 041880

Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu

225 230 235240

Gly Gly Pro Ser Vai Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu

245 250255

Met He Ser Arg Thr Pro Glu Vai Thr Cys Vai Vai Vai Asp Vai Ser

260 265270

His Glu Asp Pro Glu Vai Lys Phe Asn Trp Tyr Vai Asp Gly Vai Glu

275 280285

Vai His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr

290 295300

Tyr Arg Vai Vai Ser Vai Leu Thr Vai Leu His Gin Asp Trp Leu Asn

305 310 315320

Gly Lys Glu Tyr Lys Cys Lys Vai Ser Asn Lys Ala Leu Pro Ala Pro

325 330335 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin

340 345350

Vai Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Vai

355 360365

Ser Leu Thr Cys Leu Vai Lys Gly Phe Tyr Pro Ser Asp lie Ala Vai

370 375380

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro

385 390 395400

Pro Vai Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr

405 410415

Vai Asp Lys Ser Arg Trp Gin Gin Gly Asn Vai Phe Ser Cys Ser Vai

420 425430

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu

435 440445

Ser Pro Gly Lys

450 <210> 26 <211> 1365 <212> DNA

- 37 041880 <213> Artificial <220>

<223> Nucleotide sequence of the anti-TIV\/9-4 antibody heavy chain <400> 26

cagatccagc tggtgcagtc cggccccgag ctgagggagc ccggcgagtc cgtgaagctg 60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc 120 cccggcaagg gcctgaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 180 gccgacgact tcgaggggcag gttcgtgttc tccctggagg cctccgcctc caccgccaac 240 ctgcagatct ccaacctgaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggca tcaggggcat cggcttcgac tactggggcc aggcgtgtt cgtgaccgtg 360 tcctccgcct ccaccaaggg cccatcggtc ttccccctgg caccctcctc caagagcacc 420 tctgggggca cagcggccct gggctgcctg gtcaaggact acttccccga accggtgacg 480 gtgtcgtgga actcaggcgc cctgaccagc ggcgtgcaca ccttcccggc tgtcctacag 540 tcctcaggac tctactccct cagcagcgtg gtgactgtgc cctctagcag cttgggcacc 6ΘΘ cagacctaca tctgcaacgt gaatcacaag cccagcaaca ccaaggtgga caagaaagtt 660 gagcccccga aatcttgtga caaaactcac acatgcccac cgtgcccagc acctgaactc 720 ctggggggac cgtcagtctt ccctcttcccc ccaaaaccca aggacccct catgatctcc 780 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 840 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc gcgggaggag 900 cagtacaaca gcacgtaccg tgtggtcagc gtcctcaccg tcctgcacca ggactggctg 960 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tccagcccc catcgagaaa 1020 accatctcca aagccaaagg gcagccccga gaaccacagg tgtacaccct gcccccatcc 1080 cgggatgagc tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1140 agcgacatcg ccgtggagtg ggagagcaat gggcagccgg agaacaacta caagaccacg 1200 cctcccgtgc tggactccga cggctccttc ttcctctaca gcaagctcac cgtggacaag 1260 agcaggtggc agcaggggaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1320 cactacacgc agaagagcct ctccctgtct ccgggtaaat gataa 1365

< 210> 27 < 211> 452 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of an antibody heavy chain

3hth-TRBV9-4 < 4ΘΘ> 27

- 38 041880

Gin He Gin Leu Vai Gin Ser Gly

5

Pro Glu Leu Arg Glu Pro Gly Glu

15

Ser Vai Lys Leu Ser Cys Lys Ala 20

Ser Gly Tyr Thr Phe Thr Asp Tyr 25 30

Leu Vai His Trp Vai Lys Gin Ala

40

Pro Gly Lys Gly Leu Lys Trp Met

Gly Trp lie Asn Thr Tyr Thr Gly

55

Thr Pro Thr Tyr Ala Asp Asp Phe 60

Glu Gly Arg Phe Vai Phe Ser Leu 65 70

Glu Ala Ser Ala Ser Thr Ala Asn

80

Leu Gin He Ser Asn Leu Lys Asn 85

Glu Asp Thr Ala Thr Tyr Phe Cys

95

Ala Arg Ser Trp Arg Arg Gly He 100

Arg Gly lie Gly Phe Asp Tyr Trp

105 110

Gly Gin Gly Vai Phe Vai Thr Vai

115 120

Ser Ser Ala Ser Thr Lys Gly Pro

125

Ser Vai Phe Pro Leu Ala Pro Ser

130 135

Ser Lys Ser Thr Ser Gly Gly Thr

140

Ala Ala Leu Gly Cys Leu Vai Lys

145 150

Asp Tyr Phe Pro Glu Pro Vai Thr

155 160

Vai Ser Trp Asn Ser Gly Ala Leu

165

Thr Ser Gly Vai His Thr Phe Pro

170 175

Ala Vai Leu Gin Ser Ser Gly Leu

180

Tyr Ser Leu Ser Ser Vai Vai Thr

185 190

Vai Pro Ser Ser Ser Leu Gly Thr

195 200

Gin Thr Tyr He Cys Asn Vai Asn

205

His Lys Pro Ser Asn Thr Lys Vai

210 215

Asp Lys Lys Vai Glu Pro Lys Ser

220

Cys Asp Lys Thr His Thr Cys Pro 225 230

Pro Cys Pro Ala Pro Glu Leu Leu

235 240

Gly Gly Pro Ser Vai Phe Leu Phe 245

Pro Pro Lys Pro Lys Asp Thr Leu

250 255

Met lie Ser Arg Thr Pro Glu Vai

Thr Cys Vai Vai Vai Asp Vai Ser

- 39 041880

260 265270

His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu

275 280285

Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Tyr Asn Ser Thr

290 295300

Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn

305 310 315320

Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro

325 330335 lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin

340 345350

Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val

355 360365

Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val

370 375380

Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro

385 390 395400

Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr

405 410415

Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val

420 425430

Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu

435 440445

Ser Pro Gly Lys

450 <210> 28 <211> 639 <212> DNA <213> Artificial <220>

< 223> Нуклеотидная последовательность легкой цепи антитела анти-ТИВУ9 < 400> 28 gacgtgcaga tgacccagtc cccctacaac ctggccgcct cccccggcga gtccgtgtcc60 atcaactgca aggcctccaa gtccatcaac aagtacctgg cctggtacca gcagaagccc12Θ ggcaagccca acaagctgct gatctacgac ggctccaccc tgcagtccgg catcccctcc180

- 40 041880

aggttctccg gctccggctc cggcaccgac ttcaccctga ccatcagggg cctggagccc 240 gaggacttcg gcctgtacta ctgccagcag cacaacgagt accccccac cttcggcgcc 300 ggcaccaagc tggagctgaa gcgaactgtg gctgcaccat ctgtcttcat cttcccgcca 360 tctgatgagc agttgaaatc tggaactgcc tctgtcgtgt gcctgctgaa taacttctat 420 cccagagagg ccaaagtaca gtggaaggtg gataacgccc tccaatcggg taactcccag 480 gagagtgtca cagagcagga cagcaaggac agcacctaca gcctcagcag caccctgacg 540 ctgagcaaag cagactacga gaaacacaaa gtctacgcct gcgaagtcac ccatcagggc 600 ctgtcctcgc ccgtcacaaa gagcttcaac aggggagag 639

<210> 29 <211> 214 < 212> PRT < 213> Artificial <220>

<223> Light chain amino acid sequence of an anti-HBEC antibody <400> 29

Asp Vai Gin Met Thr Gin Ser Pro Tyr Asn Leu Ala Ala Ser Pro Gly 15 1015

Glu Ser Vai Ser He Asn Cys Lys Ala Ser Lys Ser He Asn Lys Tyr 20 2530

Leu Ala Trp Tyr Gin Gin Lys Pro Gly Lys Pro Asn Lys Leu Leu lie 35 4045

Tyr Asp Gly Ser Thr Leu Gin Ser Gly lie Pro Ser Arg Phe Ser Gly 50 5560

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Arg Gly Leu Glu Pro 65 70 7580

Glu Asp Phe Gly Leu Tyr Tyr Cys Gin Gin His Asn Glu Tyr Pro Pro 85 9095

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Vai Ala Ala

100 105110

Pro Ser Vai Phe lie Phe Pro Ser Asp Glu Gin Leu Lys Ser Gly

115 120125

Thr Ala Ser Vai Vai Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala

130 135140

Lys Vai Gin Trp Lys Vai Asp Asn Ala Leu Gin Ser Gly Asn Ser Gin

- 41 041880

145 150 155 160

Glu Ser Vai Thr Glu 165 gin asp Ser Lys Asp 170 Ser Thr Tyr Ser Leu 175 Ser Ser Thr Leu Thr 180 Leu Ser Lys Ala Asp 185 Tyr Glu Lys His Lys 190 Vai Tyr Ala Cys Glu Vai Thr His gin gly Leu Ser Ser Pro Vai Thr Lys Ser

195 2ΘΘ 205

Phe Asn Arg Gly Glu Cys

210 <210> 30 <211> 333 <212> DNA <213> Artificial <220>

<223> Nucleotide sequence of the antibody heavy chain variant <400> 30

cagatccagt tggtgcagtc cggccccgag ctgaagggc ccggcgagtc cgtgaagatc 60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc 120 cccggcaagg gcatcaagtg gatgggctgg atcaacacct acaccggcac ccccacctac 180 gccgacgact tcgaggggcag gttcgtgttc tccatcgagg cctccgcctc caccgccaac 240 ctgcagatct ccaacatcaa gaacgaggac accgccacct acttctgcgc caggtcctgg 300 aggaggggcc tgaggggcct gggcttcgac tac 333

< 210> 31 < 211> 111 < 212> PRT < 213> Artificial <220>

<223> Amino acid sequence of antibody heavy chain variant <400> 31

Gin lie Gin Leu 1 Wai Gin 5 Ser Gly Pro Glu Leu Lys Glu Pro Gly Glu 10 15 Ser Vai Lys lie Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 25 thirty Leu Wai His Trp Wai Lys Gin Ala Pro Gly Lys Gly He Lys Trp Met

40 45

-

Claims (23)

Gly Trp He Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 5560 Glu Gly Arg Phe Vai Phe Ser He Glu Ala Ser Ala Ser Thr Ala Asn 65 70 7580 Leu Gin He Ser Asn He Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095 Ala Arg Scr Trp Arg Arg Gly Leu Arg Gly Leu Gly Phe Asp Tyr 100 105110 <210> 32 <211> 333 <212> DNA <213> Artificial <220> <223> Nucleotide sequence of the severe variable domain variant цепи антитела <400> 32 cagatccagt tggtgcagtc cggccccgag ataaaggagc ccggcgagtc cgtgaagatc60 tcctgcaagg cctccggcta caccttcacc gactacctgg tgcactgggt gaagcaggcc120 cccggcaagg gcatcaagtg gatgggctgg atcaacacct acaccggcac ccccacctac180 gccgacgact tcgagggcag gttcgtgttc tccatcgagg cctccgcctc caccgccaac24Θ ctgcagatct ccaacatcaa gaacgaggac accgccacct acttctgcgc caggtcctgg3ΘΘ aggaggggcc tgaggggcct gggcttcgac tac333 <210> 33 <211> 111 < 212 > PRT < 213> Artificial <220> < 223> Amino acid sequence of the antibody heavy chain variable domain variant < 400> 33 Gin lie Gin Leu Vai Gi n Ser Gly Pro Glu lie Lys Glu Pro Gly Glu 1) a heavy chain having an amino acid sequence selected from the group of SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27; 1) a heavy chain having an amino acid sequence at least 90% identical to a sequence selected from the group of SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27; 1) a heavy chain variable domain containing the amino acid sequences of HCDR 13, where HCDR 1 has the amino acid sequence of SEQ ID NO: 1, HCDR 2 has the amino acid sequence of SEQ ID NO: 2, HCDR 3 has an amino acid sequence selected from the group SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6; 1. A monoclonal antibody or antigen-binding fragment thereof that specifically binds to the beta chain region of the TRBV9 family of the human T cell receptor, comprising: 2) a light chain having the amino acid sequence of SEQ ID NO: 29. 2) a light chain having an amino acid sequence at least 90% identical to the sequence of SEQ ID NO: 29. 2. A monoclonal antibody or antigen-binding fragment according to claim 1, where the variable do- - 43 041880 men heavy chain has an amino acid sequence at least 90% identical to the amino acid sequence selected from the group SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 2) a light chain variable domain containing the amino acid sequences LCDR 1-3, where LCDR 1 has the amino acid sequence of SEQ ID NO: 7, LCDR 2 has the amino acid sequence of SEQ ID NO: 8, LCDR 3 has the amino acid sequence of SEQ ID NO: 9. 3. The monoclonal antibody or antigen-binding fragment thereof according to claim 2, wherein the heavy chain variable domain has an amino acid sequence selected from the group of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19. 4. The monoclonal antibody or antigen-binding fragment thereof according to claim 1, wherein the light chain variable domain has an amino acid sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 11. 5. The monoclonal antibody or antigen-binding fragment thereof according to claim 4, wherein the light chain variable domain has the amino acid sequence of SEQ ID NO: 11. 6. Monoclonal antibody or antigen-binding fragment according to claim 1, including: 7. Monoclonal antibody according to claim 6, including: 8. Monoclonal antibody according to any one of claims 1 to 7, which is a full length IgG antibody. 9. The monoclonal antibody of claim 8, wherein the antibody is of a human isotype selected from the group IgG1, IgG2, IgG3, IgG4. 10. A nucleic acid that encodes an antibody or antigen-binding fragment thereof according to any one of claims 1 to 9 that specifically binds to the beta region of the TRBV9 family of the human T cell receptor. 11. Expression vector containing the nucleic acid according to claim 10. 12. A method for obtaining a host cell for obtaining an antibody or antigen-binding fragment according to any one of claims 1 to 9, including co-transformation of the cell with a vector according to claim 11 containing a nucleic acid according to claim 10. 13. A host cell for producing an antibody or antigen-binding fragment thereof according to any one of claims 1 to 9, containing a nucleic acid according to claim 10. 14. A method for producing an antibody or its antigen-binding fragment according to any one of claims 1 to 9, which consists in cultivating the host cell according to claim 13 in a culture medium under conditions that ensure the production of said antibody, followed by isolation and purification of the resulting antibody. 15. A pharmaceutical composition for the prevention or treatment of a disease or disorder mediated by the beta chain region of the TRBV9 family of the human T-cell receptor, comprising an effective amount of an antibody or an antigen-binding fragment thereof according to any one of claims 1 to 9, in combination with one or more pharmaceutically acceptable excipients. 15 1015 Ser Vai Lys lie Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr 20 2530 Leu Vai His Trp Vai Lys Gin Ala Pro Gly Lys Gly lie Lys Trp Met 3S 4045 Gly Trp He Asn Thr Tyr Thr Gly Thr Pro Thr Tyr Ala Asp Asp Phe 50 5560 Glu Gly Arg Phe Vai Phe Ser He Glu Ala Ser Ala Ser Thr Ala Asn 65 7Θ 758Θ Leu Gin He Ser Asn He Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 9095 Ala Arg Ser Trp Arg Arg Gly Leu Arg Gly Leu Gly Phe Asp Tyr 100 105110 CLAIM 16. The pharmaceutical composition according to claim 15, wherein said disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma. 17. Pharmaceutical composition for the prevention or treatment of a disease or disorder mediated by a human T-cell receptor carrying a beta chain of the TRBV9 family, containing an effective amount of an antibody or an antigen-binding fragment according to any one of claims 1 to 9 and an effective amount of at least one another therapeutically active compound. 17, SEQ ID NO: 19. 18. The pharmaceutical composition according to claim 17, wherein said disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma. 19. Pharmaceutical composition according to any one of claims 17-18, wherein the other therapeutically active compound is selected from small molecule, antibody, or steroid hormones. 20. A method for inhibiting the biological activity of a T cell receptor whose beta chain belongs to the TRBV9 family in a subject in need of such inhibition, comprising administering to the subject an effective amount of an antibody or antigen-binding fragment thereof according to any one of claims 1 to 9. 21. A method of treating a disease or disorder mediated by a human T-cell receptor carrying a beta chain of the TRBV9 family, comprising administering to a subject in need of such treatment, an antibody or antigen-binding fragment thereof according to any one of claims 1 to 9 or a pharmaceutical composition according to claim 15 in a therapeutically effective amount. 22. A method of treating a disease or disorder according to claim 21, wherein the disease or disorder is selected from the group: ankylosing spondylitis, celiac disease, T-cell leukemia, T-cell lymphoma. 23. The use of an antibody or antigen-binding fragment according to any one of claims 1-9 or far- -