DK2867372T3 - PROCEDURE FOR DETERMINING THE EXISTENCE OF DIARRATIVE PATHOGENS - Google Patents
PROCEDURE FOR DETERMINING THE EXISTENCE OF DIARRATIVE PATHOGENS Download PDFInfo
- Publication number
- DK2867372T3 DK2867372T3 DK13809410.7T DK13809410T DK2867372T3 DK 2867372 T3 DK2867372 T3 DK 2867372T3 DK 13809410 T DK13809410 T DK 13809410T DK 2867372 T3 DK2867372 T3 DK 2867372T3
- Authority
- DK
- Denmark
- Prior art keywords
- seq
- primer
- probe
- primer pair
- dna
- Prior art date
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Description
Description
FIELD OF THE INVENTION
[0001] This invention relates to the field of detection of diarrhoea causing pathogens from patient, food or environmental samples. Particularly, the present invention provides a polymerase chain reaction (PCR) based assay method for detection of diarrhoea causing pathogens, particularly ETEC and Campylobacter species. The present invention further provides materials such as primers, primer pairs and probes for use in the method of the invention. Preferably, the method of the invention is a multiplex real-time PCR (RT-PCR) assay for rapid determination of clinically important pathogens related to traveller’s diarrhoea.
BACKGROUND OF THE INVENTION
[0002] Diarrhoea is a major health problem worldwide causing morbidity, but also mortality especially of infants in the developing countries. Diarrhoea is the most reported problem fortravellers and is commonly caused by contamination of food or water. In most cases traveller’s diarrhoea is mild and short of duration, but severe infections with abdominal pain, bloody diarrhoea and septicaemia exist.
[0003] The causes of acute diarrhoea of travellers are many and varied. In addition to classical diarrhoeal bacteria, such as Salmonella, Campylobacter, Shigella and Yersinia also diarrhoeal E. coli strains are associated with traveller’s diarrhoea, (enterohemorrgenic E. coli; EHEC, enterotoxigenic E. coli; ETEC, attaching and effacing E. coli; A/EEC or enteroaggregative E. coli; EAEC , enteropathogenic E. coli; EPEC, verocytotoxin producing E. coli; VTEC, enterohem-orrhagic E. coli; EHEC, enteroinvasive E. coli; EIEC). Salmonella infection can cause a variable clinical disease starting from a mild, subclinical infection, or lead to severe systemic infection, typhoid fever. Salmonella sp. invades the host through the colonic epithelial cells, especially M cells using a type III secretion system. They are also able to survive within phagosomes of macrophages, and evade the host immune system by several ways (Coburn et al., 2007). Campylobacter jejuni and coli are among the large Campylobacter family predominant human stool pathogens causing watery diarrhoea, fever and typically hard abdominal pain. By diagnostic means they must be dissected from the other Campylobacter species not associated with diarrhoea. They are able to invade the colonic epithelium lining and replicate intracellularly and cause apoptosis (Poly and Guerry, 2008; Alios, 2001). Yersinia enterocolitica and pseudotuberculosis harbour a virulence plasmid containing relevant adhesion and invasion proteins, such as YadA (Bottone, 1999, El Tahir et al., 2001). For Y. enterocolitica a virulence plasmid is required to cause a clinical disease, whereas Y. pseudotuberculosis has additional genomic virulence factors as well. Yersinia pestis is the plague pathogen, which harbours genomic virulence factors and three virulence plasmids which are all required to cause a clinical disease (Bottone, 1999). The traditional pathogens are also associated with late onset symptoms, such as reactive arthritis, sacroiliitis and acute anterior uveitis.
[0004] Vibrio cholerae is a highly virulent environmental pathogen living in freewaters in some of the tropical countries, especially causing epidemics in catastrophe areas. It typically causes massive watery diarrhoea leading to patient death if not sufficiently resuscitated. The essential virulence factor is cholera toxin which consists of two subunits A and B. The cholera toxin is able to bind irreversibly to the G-proteins in the colonic epithelial cells responsible for liquid and electrolyte uptake causing non-voluntary continuous secretion into gut lumen (Nelson et al., 2009).
[0005] Shigella and EIEC are genetically closely related. Both of these organisms invade the colonic epithelium mediated by the genes located in virulence plasmid pINV coding e.g. Ipa proteins and their transcription regulator invE (Lan and Reeves, 2002; Parsot, 2005). EAEC demonstrate characteristic adherence pattern to Hep-2 cells via specific fimbria encoded by genes which are located on plasmid under the regulation of AggR (Flores and Okhuysen, 2009). EPEC is characterized to possess pathogenicity island named the locus of enterocyte effacement (LEE). This island contains genes such as eae for intimate adherence of the EPEC strains to intestinal epithelial cells. EPEC is differentiated from EHEC by ability of EHEC strains to production shiga-like toxins I and II encoded by stx1 and stx2 genes. These cytotoxins cause acute inflammation in the intestine leading to abdominal pain and bloody diarrhoea. In addition, EHEC infection may lead to rare but severe, secondary complications such as haemolytic uremic syndrome (HUS) (Chen and Frankel, 2005; Karch et al., 2005). The challenge in multiplex PCR assays is to identify EHEC variants so that there is no crossreaction with Shigella/EIEC species, because the target genes expressing toxins in these bacteria are very similar. [0006] Giardiasis is an infection of the small intestine caused by Giardia lamblia (also known as G. intestinalis), a flagellate protozoan. Giardiasis is the most commonly reported pathogenic protozoan disease worldwide. Travelers are the largest risk group for giardiasis infection, especially those who travel to the developing world. Giardiasis is spread via the fecal-oral route. Most people contract the disease by ingesting contaminated water or food, or by not washing their hands after touching something contaminated with Giardia cysts. Prevalence rates for giardiasis range from 2-7% in developed countries and 20-30% in most developing countries. The CDC estimates there are an upwards of 2.5 million cases of giardiasis annually. The most common symptoms of Giardia infection include diarrhea for a duration of more than 10 days, abdominal pain, flatulence, bloating, vomiting, and weight loss. Giardiasis is traditionally diagnosed by the detection of cysts or trophozoites in the feces, trophozoites in the small intestine, or by the detection of Giardia antigens in the feces.
[0007] Currently, the routine diagnostic of diarrhoea is mostly based on traditional cultivation methods and immunoassays, which are both laborious and time consuming. They are only available for Salmonella, Campylobacter, Shigella and Yersinia species as well as enterohaemorrhagic Escherichia coli (EHEC), whereas no cultivation method for other major diarrhoeagenic E. coli species, including ETEC, EPEC, EAEC, and EIEC exists. In recent years, DNA based methods for diagnosis of diarrhoeagenic E. co//'has been published (Antikainen et al., 2009; Aranda et al., 2004; Brandal et al., 2007; Guion et al., 2008; Kimata et al., 2005; MOIIer et al., 2007; Vidal et al., 2005; Vidal et al., 2004).
[0008] ETEC causes watery diarrhoea by producing heat-labile (LT) and/or heat-stable (ST) enterotoxins [2-3], ETEC is traditionally considered the most common cause in traveller’s diarrhoea (Qadri et al., 2005). The present invention is particularly directed to improve the detection of ETEC in multiplex RT-PCR assays. The present invention provides two primer pairs and probes specific for the heat stable enterotoxin of ETEC encoded by the est gene and one primer pair and probe specific for the heat labile enterotoxin of ETEC encoded by the elt gene. These primers and probes are designed to amplify such target sequences in said genes that it renders possible efficient detection of global variants of ETEC. Further problem was that the target gene est includes multiple repetitive elements and it was difficult to find conserved regions long enough for both the primers and the probe.
[0009] The present invention is further directed to improve the detection of diarrhea causing Campylobacter species in multiplex RT-PCR assays. The invention provides primer pairs and probes for rimM gene of C. jejuni and gyrB gene of C. coli. With these primers and probes the diarrhoea causing Campylobacter can be distinctively identified from other non-pathogenic Campylobacter and other diarrhea causing pathogens. A combination of two different genomic targets was required to solve the problem.
[0010] In W02005/005659, it is dislosed a method for simultaneous screening diarrhoea causing bacteria such as E. coli groups: ETEC (enterotoxigenic E. coli), A/EEC (attaching and effacing E. coli) EPEC (enteropathogenic E. coli), VTEC (verocytotoxin producing E. coli) and EIEC (enteroinvasive E. coli)', and Shigella spp. The method is a real-time multiplex PCR assay and the template DNA is isolated directly from a stool sample. Similarily as the present invention, W02005/005659 is also directed to the problem of screening for human pathogenic E. coli'm order to provide distinction between the pathogenic E. coli groups and other diarrhoea causing pathogens. However, the target sequences in est and elt genes of ETEC are different in the present invention from the targets disclosed by W02005/005659. Moreover, the present invention is providing coverage of global ETEC variants by the use of three specific primer pairs and probes while W02005/005659 in Table 3 discloses four primer pairs for the same purpose. Table 8 of the present specification show that ETEC variants can be detected by using the three primer pairs of the present invention.
[0011] In W02005/083122, it is disclosed a method for detection and quantification of enteropathogenic bacteria in a fecal specimen, including Shigella species, Salmonella species, Campylobacter species, enterohemorrhagicEsc/7er/c/7/'a co//'orVerocytotoxin-producing Escherichia coli, Vibrio cholerae, and Clostridiumperfringens. The method is a real-time PCR assay based on TaqMan® probes.
[0012] In W02007/056463, it is disclosed a method comprising amplification of a sample with a plurality of pathogen-specific primer pairs to generate amplicons of distinct sizes from each of the pathogen specific primer pairs. The method utilizes real-time and multiplex PCR techniques. The method can be used for the detection of Salmonella species, Campylobacter species, diarrhoeagenic Escherichia coli, Vibrio cholerae, Yersinia species such as Yersinia pestis, and Giardia lamblia.
[0013] In W02005/090596, it is disclosed an assay for detecting micro-organisms, and in particular bacteria, based on multigenotypic testing of bacterial DNA from human, animal or environmental samples. The method may also be utilized as a real-time multiplex PCR technique using TaqMan® probes. The method can be used for the detection of Salmonella species, Campylobacter species, diarrhoeagenic Escherichia coli, Vibrio cholerae, Yersinia species such as Yersinia pestis.
[0014] In US2004/0248148, it is disclosed a 5’ nuclease real-time polymerase chain reaction approach for the quantification of total conforms, E. coli, toxigenic E. coli Ο157Ή7, toxigenic M. aeruginosa (microcystin hepatotoxins), Giardia lamblia, and Cryptosporidium parvum. Multiplex PCR assay can also be used for simultaneous detection of two or more pathogens.
[0015] In W002/070728, it is disclosed an assay that relies on a ’multiprobe’ design in which a single set of highly conserved sequences encoded by the 16S rRNAgene serves as the primer pair, and it is used in combination with both an internal highly conserved sequence, the universal probe, and an internal variable region, the species-specific probe. The real-time system reliably identifies 14 common bacterial species.
[0016] CN101113471, CN101245384 and CN101235410 disclose PCR methods for rapid detection of diarrhoea caus ing pathogens from food samples.
[0017] Fukushima et al., 2003, disclose a real-time PCR assay for detection of 17 species of food- or waterborne pathogens directly from stool sample. The detection levels were approximately 105 pathogenic bacteria per gram of stool, therefore the protocol for stool specimens for less than 104 pathogenic bacteria per gram of stool requires an overnight enrichment step to achieve adequate sensitivity.
[0018] Hidaka et al., 2009, disclose multiplex real-time PCR for exhaustive detection of diarrhoeagenic E. coli. This method is especially for the detection of pathogenic bacteria from a food sample, such as meat sample.
[0019] Wang et al., 1997, disclose a protocol for PCR detection of 13 species of foodborne pathogens in foods. [0020] There are some commercial multiplex PCR-based diarrheal pathogen detection kits available, for example xTAP GPP from Luminex and Diarrhea ACE Detection from Seegene. Both systems use multiplex PCR as a means for amplifying certain organism-specific nucleotide sequences but the final detection relies on analysis in another separate instrument. The means used for detection has an impact on the amplicon, primer and probe design because of different requirements ofthe detection formats. Further, gene or amplicon sequences used in the present invention for the detection of ETEC or Campylobacter have not been disclosed.
[0021] The number of pathogens causing diarrhoea is large and a diarrhoea test method should optimally identify all of them. Having one PCR reaction per species can be cumbersome, since the number of samples tested is typically large. It would be optimal to detect multiple species within one reaction. In a PCR setting the most obvious alternative is ’multiplex’ PCR amplification. In multiplex PCR, several oligonucleotide sets, each designed to amplify one spe-cies/species group, are included in the same reaction vessel and each oligonucleotide set is used to amplify its respective pathogen DNA during the same PCR reaction. In this invention, we describe a PCR based method for rapid detection of clinically important pathogens related to traveller’s diarrhea, particularly ETEC and/or Campylobacter. The present invention discloses primers and probes designed for target sequences conserved in global variants of ETEC and Campylobacter. These primers and probes are compatible for use in any multiplex RT-PCR determining the presence of multiple diarrhoea causing pathogens, since the target sites are unique for ETEC and Campylobacter.
[0022] Multiplex PCR presents a challenge for quantitation of the pathogen DNA (qPCR): the different amplicons compete for the same PCR reaction components (eg. DNA polymerase and MgCI2) and this can compromise the quantitative nature ofthe reaction between and, especially, quantitative comparisons between samples. It is commonly known in the art that there is bias in the amplification efficiencies between different template amounts or lengths so that e.g. short amplicons are favoured in the expense of longer ones.
[0023] At the same time, undesired cross-reactions of multiplex set oligo combinations must be avoided. One must also remember to check mis-priming to any other sequences present in the sample.
[0024] Finding suitable primer and probe sequences for the detection of a diverse group of pathogenic microbes can be far from trivial especially when designing multiplex set ups where all amplicons and templates should be amplified with equal efficiency (e.g., Giardia). Many of the species are relatively closely related, making it challenging to locate sequences that are unique for each species. Also, as there are a significant number of global variants, it is difficult to identify globally conserved regions or a combination of minimal set of regions to detect all known variants (e.g., for EHEC, ETEC, pathogenic Yersinia, pathogenic Campylobacter and Shigella/EIEC). Some genes possess complex repetive closely related elements which is challenging from the amplicon design point of view, especially when designing amplicons for multiplex PCR. For example, due to repetitive elements and minor variants ETEC cannot be detected using only one amplicon.
[0025] The sample matrix, which in diarrhoea diagnostics is commonly a stool or food sample, is likely to contain a host of PCR inhibitors. This reduces amplification efficiency ofthe PCR reaction and thus even more careful optimization is expected from the amplicon design step to verify that all templates and copy numbers are amplified equally but also efficiently enough. Hence, oligonucleotide design enabling high PCR efficiency (optimally as close to 100% as possible) is required. The detection method used may also affect amplification efficiency and/or bias.
[0026] The present inventors have now located DNA sequence regions that are well suited for specific and sensitive amplification and quantification of diarrhoea causing pathogens, particularly ETEC and Campylobacter. Accordingly, optimal primers and quantitative PCR probes have been designed in the present invention and validated for identification and quantification of diarrhoea causing pathogens. The amplicons have been designed to be so specific that they can be combined into any multiplex sets with each other. Naturally a prerequisite to this is that all the disclosed amplicons have also been designed to amplify in the same reaction and cycling conditions.
DETAILED DESCRIPTION OF THE INVENTION
[0027] The present invention provides a polymerase chain reaction (PCR) based assay method for detection of diarrhoea causing pathogens, particularly ETEC and Campylobacter species. The present invention further provides materials such as primers, primer pairs and probes for use in the method ofthe invention. Particularly, the present invention provides a method for determining the presence of diarrhoea causing pathogens in a biological sample comprising the steps of: i) contacting the sample or nucleic acid isolated therefrom with primer pairs in a multiplex PCR assay comprising two or more separate PCR reactions, wherein the primers of said primer pairs amplify any of the amplicons as defined by SEQ ID NOS:55-72, preferably SEQ ID NOS:61-63 and 65-68, at least partly; ii) performing a polymerase chain reaction with reaction mixes obtained from step i) so that the target sequences of diarrhoea causing pathogens are specifically amplified, if said sequences are present in the sample; and iii) detecting the presence of amplified target sequences in the reaction mix, wherein the presence of any of the target sequences is indicative of the presence of diarrhoea causing pathogens in the sample.
[0028] Said biological sample can be a stool sample, a food sample, such as a meat sample, or any environmental sample. The sample may be enriched before step i).
[0029] Preferably, the primer pairs in step i) of the method are selected from the group consisting of primer pairs A) to R), more preferably G) to I) and K) to N), comprising or consisting of at least one of the following oligonucleotides: A) forward primer: 5’GCGTTCTTATGTAATGACTGCTGAAG-3’ (SEQ ID NO:1), reverse primer: 5’-AGAAATTCTTCCTACACGAACAGAGTC-3’ (SEQ ID NO:2); B) forward primer: 5’-TGCATCCAGAGCAGTTCTGC-3’ (SEQ ID NO:3), reverse primer: 5’-CGGCGTCATCGTATACACAGG-3’ (SEQ ID NO:4); C) forward primer: 5’-CCAGGCTTCGTCACAGTTGC-3’ (SEQ ID NO:5), reverse primer: 5’-CAGTGAACTACCGTCAAAGTTATTACC-3’ (SEQ ID NO:6); D) forward primer: 5’-GCTCTTCGGCACAAGTAATATCAAC-3’ (SEQ ID NO:7), reverse primer: 5’-TCTATTTTAAATTCCGTGAAGCAAAACG-3’ (SEQ ID NO:8); E) forward primer: 5’-TGGTCCATCAGGCATCAGAAGG-3’ (SEQ ID NO:9), reverse primer: 5’-GGCAGTGCGGAGGTCATTTG-3’ (SEQ ID NO:10); F) forward primer: 5’-TGTCTTTATAGGACATCCCTGATACTTTC-3’ (SEQ ID NO:11), reverse primer: 5’-TATCTACTCTTGATGCCAGAAAACTAGC-3’ (SEQ ID NO:12); G) forward primer: 5’-AAAATTGCAAAATCCGTTTAACTAATC-3’ (SEQ ID NO:13), reverse primer: 5’-GACTGACTAAAAGAGGGGAAAG-3’ (SEQ ID NO:14); H) forward primer: 5’-TCCTGAAAGCATGAATAGTAGC-3’ (SEQ ID NO:15), reverse primer: 5’-TTATTAATAGCACCCGGTACAAG-3’ (SEQ ID NO:16); I) forward primer: 5’-CCGGCAGAGGATGGTTACAG-3’ (SEQ ID NO:17), reverse primer: 5’-TTGATTGATATTCCCTGAGATATATTGTG-3’ (SEQ ID NO:18); J) forward primer: 5’-GGAAGCAATACATATCTTAGAAATGAACTC-3’ (SEQ ID NO:19), reverse primer: 5’-TCGGACAACTGCAAGCATCTAC-3’ (SEQ ID NO:20); K) forward primer: 5’-GAGTGAAAAAGATTTTGTTCAAGTTG-3’ (SEQ ID NO:21), reverse primer: 5’-AAAAGTCGCTCAGGTTATGC-3’ (SEQ ID NO:22); L) forward primer: 5’-AGTGCCTGAACCTCAATTTG-3’ (SEQ ID NO:23), reverse primer: 5’-TCGATAGGATTTTCTTCAAAATATTTAC-3’ (SEQ ID NO:24); M) forward primer: 5’-GTTTGGTACAGTTTATGGCATTTCAC-3’ (SEQ ID NO:25), reverse primer: 5’-CATGGCAATATCAACAATACTCATCTTAC-3’ (SEQ ID NO:26); N) forward primer: 5’-CAGGAGCATGAGGTTCACAGTATG-3’ (SEQ ID NO:27), reverse primer: 5’-TCTCTGGCCCCGCACAATG-3’ (SEQ ID NO:28); O) forward primer: 5’-GGGCTACAGAGATAGATATTACAGTAACTTAG-3’ (SEQ ID NO:29), reverse primer: 5’-CCACGGCTCTTCCCTCCAAG-3’ (SEQ ID NO:30); P) forward primer: 5’-TTCCGGTCGATCCTGCC-3’ (SEQ ID NO:31), reverse primer: 5’-GTTGTCCTGAGCCGTCC-3’ (SEQ ID NO:32); Q) forward primer: 5’-AGACGATCCAGTTTGTATTAG-3’ (SEQ ID NO:33), reverse primer: 5’GGCATCCTAACTCACTTAG-3’ (SEQ ID NO:34); and R) forward primer: 5’-TCTGGAAAACAATGTGTTC-3’ (SEQ ID NO:35), reverse primer: 5’-GGCATGTCGATTCTAATTC-3’ (SEQ ID NO:36).
[0030] Preferred amplicons amplified in target organisms are listed in Table 6. However, a person skilled in the art knows that these amplicon sequences naturally vary in related strains. This minor variation can be taken into account while designing primers suitable to amplify said amplicons in the method of the present invention. Preferably, at least 20, 25, 30 or 35 nucleotides long sequence of each of the target amplicons selected from the group consisting of SEQ ID NOS:55-72, preferably SEQ ID NOS:61-63 and 65-68, are amplified in the method.
[0031] The method of the invention is characterized in that the presence of the amplified target sequence, i.e. the product, of each of primer pairs A) to R) in the PCR reaction in step iv) indicates the presence of diarrhoea causing pathogens in the sample in the following way: the product of primer pair A) or B) indicates the presence of EHEC; the product of primer pair C) indicates the presence of EHEC/EPEC; the product of primer pair D) indicates the presence of Salmonella; the product of primer pair E) or F) indicates the presence of Shigella/E\EC', the product of primer pair G), H), or I) indicates the presence of ETEC; the product of primer pair J) indicates the presence of EAEC; the product of primer pair K) indicates the presence of Campylobacter jejuni; the product of primer pair L) indicates the presence of Campylobacter coli; the product of primer pair M) indicates the presence of Yersinia enterocoliticalpseudotuberculosis', the product of primer pair N) indicates the presence of Yersinia pseudotuberculosislpestis; the product of primer pair O) indicates the presence of Vibrio cholerae: the product of primer pair P) indicates the presence of Giardia lamblia; the product of primer pair Q) indicates the presence of Entamoeba histolytica; and the product of primer pair R) indicates the presence of Cryptosporidium sp.
[0032] Preferably, each primer of said primer pairs is less than 35, 40, 45, 50 or 55 nucleotides long, and more preferably, less than 50 nucleotides long. Each of the present primers can also be defined as consisting of at least 10 contiguous nucleotides present in one primer sequence selected from the group consisting of SEQ ID NOS:1-36. [0033] One specific embodiment of the invention is to perform said method as a real-time polymerase chain reaction and in that case nucleic acid probes comprising or consisting of the following sequences are specifically used with each of primer pairs A) to R), preferably G) to I) and K) to N). - the probe for primer pair A): 5’-TCCATGATARTCAGGCAGGACACTACTCAACCTTCC-3’ (SEQ ID NO:37) - the probe for primer pair B): 5’-TTGTCACTGTCACAGCAGAAGCCTTACGC-3’ (SEQ ID NO:38) - the probe for primer pair C): 5’-AGATTAACCTCTGCCGTTCCATAATGTTGTAACCA-3’ (SEQ ID NO:39) - the probe for primer pair D): 5’-CCAAACCTAAAACCAGTAAAGGCGAGCAGC-3’ (SEQ ID NO:40) - the probe for primer pair E): 5’-TCACTCCCGACACGCCATAGAAACGCATTT-3’ (SEQ ID NO:41) - the probe for primer pair F): 5’-ACAAACAGCAAAAGAGCATAGCATCCGAGAACT-3’ (SEQ ID NO:42) - the probe for primer pair G): 5’-CAAATATCCGTGAAACAACATGAC-3’ (SEQ ID NO:43) - the probe for primer pair H): 5’-AGGATTACAACACAATTCACAGCAGT-3’ (SEQ ID NO:44) - the probe for primer pair I): 5’-AGCAGGTTTCCCACCGGATCACCA-3’ (SEQ ID NO:45) - the probe for primer pair J): 5’-TCCGTATATTATCATCAGGGCATCCTTTAGGCGT-3’ (SEQ ID NO:46) - the probe for primer pair K): 5’-AAGACCCACAGTTTTACCAAGTTTT-3’ (SEQ ID NO:47) - the probe for primer pair L): 5’-AACTTGGCTCTTCTTATGTGCGT-3’ (SEQ ID NO:48) - the probe for primer pair M): 5’-CCTGGATAAGCGAGCGACGTATTCTCTATGC-3’ (SEQ ID NO:49) - the probe for primer pair N): 5’-AAACCAAAGCCGCCCACACCACAG-3’ (SEQ ID NO:50) - the probe for primer pair O): 5’-AACCTGCCAATCCATAACCATCTGCTGCTG-3’ (SEQ ID NO:51) - the probe for primer pair P): 5’-ACGAAGCCATGCATGCCCGCT-3’ (SEQ ID NO:52) - the probe for primer pair Q): 5’-ACAAAATGGCCAATTCATTCAATGAA-3’ (SEQ ID NO:53) - the probe for primer pair R): 5’-CCTCCTAATCCAGAATGTCCTCCAG-3’ (SEQ ID NO:54) [0034] The melting temperature, Tm, of some of the probes (such as probes for primer pairs G), Η), K) and L)) is preferably increased at least 5 degrees °C by addition of modified nucleotides. The amount of modified nucleotides in one probe is 1,2, 3 or preferably 4. The underlined nucleotides in the above list are modified nucleotides each increasing the Tm of the probe. The modified nucleotide can be a LNA nucleotide (Exiqon A/S), minor groove binder (MGB™), SuperBase, or Peptide Nucleic Acid (PNA) or any other modification increasing the Tm of the probe.
[0035] Preferably, the above probes comprise the sequences as defined and are less than 40, 45, 50 or 55 nucleotides long, and more preferably, less than 50 nucleotides long. Each ofthe present probes can also be defined as consisting of at least 10 contiguous nucleotides present in one probe sequence selected from the group consisting of SEQ ID NOS:37-54.
[0036] The method ofthe invention is based on multiplex PCR technique, wherein primer pairs are divided into separate PCR reactions. As a general guideline the multiplex assay should be designed so that the most frequently appearing pathogens (e.g. Antikainen et al, 2009) are in different multiplex reactions.
[0037] In one embodiment, the invention provides nucleotide primers comprising or consisting of any of the primer sequences from primer pairs G) to I) and K) to N) as defined above.
[0038] In another embodiment, the invention provides nucleotide primer pairs com prising orconsisting ofthe sequences from any of primer pairs G) to I) and K) to N) as defined above.
[0039] In a further embodiment, the invention provides nucleotide probes comprising or consisting of any ofthe probe sequences as defined above.
[0040] The present invention is preferably directed to a method for determining the presence of diarrhoea causing pathogens in a sample, wherein the presence of at least pathogens ETEC, Campylobacter jejuni, and Campylobacter coli \s checked in said sample. Further target pathogens may be Yersinia enterocoliticalpseudotuberculosis, and Yersinia pseudotuberculosislpestis.
[0041] The present invention is further directed to the use of nucleotide primers, primer pairs or probes as defined above for determining the presence of diarrhoea causing pathogens in a sample.
[0042] The present invention also provides kits for the detection ofthe presence of diarrhoea causing pathogens in a sample. Such a kit comprises primer pairs selected from the group consisting of primer pairs A) to R), preferably G) to I) and K) to N), as defined above. The kit may further comprise a probe selected from the probes as defined above. The use ofthe primer pairs and probes are described above and in the Example below. Preferably, said kit comprises means for a real-time polymerase chain reaction, such as labelled probes, polymerase enzymes, buffers and nucleotides. Preferably, said kit is for the detection ofthe presence of at least pathogens ETEC, Campylobacter jejuni, and Campylobacter coli in a sample.
[0043] The present invention is further described in the following example, which is not intended to limit the scope of the invention.
EXAMPLE
Materials and methods [0044] Patient samples. Control stool samples were cultured at HUSLAB for Salmonella, Yersinia, Shigella, Campylobacter and EHEC with standard biochemical methods. A total of 146 travellers were recruited in Travel Clinic (Medicity, Helsinki, Finland) to participate in this study during six month period. The age ranged from 1 to 72 (mean 39.2 years); 84 (57.5%) were females and 62 (42.5%) were males. The travel destinations were Europe in 7.5%, Asia in 32.9%, Africa in 44.5%, Australia in 1.4% and America in 13.7% of cases.
[0045] Total nucleic acids were purified from the stool samples with NucliSENS kit using easyMAG platform as described in Antikainen et al., 2009. Briefly, stool swabs were suspended to 100 μΙ of Tris-EDTA buffer and purified by the general method of easyMAG platform and eluted to the volume of 25 μΙ. Eluate (0.5 μΙ) was used as a template in PCR. [0046] Alternatively, the swaps can be suspended directly into lysis buffer. The samples are eluted to a volume of 100 ul and 2 ul of eluate is used as a template in PCR. This protocol is suitable for fully automated, integrated sample preparation and PCR plate setup steps. Identification ofthe isolates. Faecal samples positive in PCR for Salmonella, Shigella, Yersinia, Campylobacter and EHEC were cultured and identified with normal diagnostics methods. Since for diarrhoeal E. coli strains no cultivation based routine method exists, positive samples were analysed by previously developed multiplex-PCR (Antikainen et al., 2009).
[0047] From those samples of which isolation of bacterial strains was unsuccessful, corresponding genes were separately amplified and sequenced in Sequence Core Facility in Haartman Institute (Helsinki, Finland) using primers listed in Table 1. Sequences were identified by Basic Local Alignment Search Tool (BLAST, http://blast.nc-bi.nlm.nih.gov/Blast.cgi).
[0048] Design ofthe Real-Time-PCR. PCR was designed to identify specific virulence genes, species specific genes, or species specific regions within established universal genes (Table 1). Real-Time PCR primers and probes were designed with Allele ID and Beacon Designer software (Palo Alto, CA) to recognize correct target genes and their global variants, including BLAST search and secondary structure prediction using NCBI data base. RT-PCR was performed on Mx3005P detection system (Agilent Technologies, Garden Grove, CA) and thermocycling conditions were 95°C for 15 min, 40 cycles of 94°C for 1 min and 60°C for 1 min. Fluorescence was recorded at each annealing step. The 20-μΙ reaction contained 1 x Qiagen Multitect NoROX master mix (Qiagen, Hilden, Germany), 1 μΙ of primer/probe mix (Tables 1 and 2) and 0.5 μΙ of template DNA.
[0049] Specificity of the PCR. The analytical specificity of the PCR was analysed by using 249 bacterial strains as positive controls including Salmonella, Shigella, Campylobacter, Yersinia and Vibrio strains as well as diarrhoeal E. coli strains (Tables 1 and 2). The strains were originated from the Helsinki University Hospital Laboratory (HUSLAB), the National Institute of Health and Welfare (THL), and as a kind gift from M. Alexander Schmidt and Inga Benz (Westfalische Wilhelms-Universitat, Miinster, Germany), from Isabel Scaletsky (Universidade Federal de Såo Paulo, Brazil) as well as from Lin Thorstensen Brandal (The Norwegian Institute of Public Health, Norway). As negative controls, 243 bacterial strains from all major genera were used as described in Antikainen et al., 2009.
[0050] For PCR analysis, bacterial cells were collected to 100 μΙ of water, boiled for 15 minutes, centrifuged one minute 13 000 rpm and the supernatant (0.5 μΙ) was used in PCR reactions or bacterial DNA was purified with NucliSENS kit using easyMAG automatic nucleic acid purification platform as described by the manufacturer (bioMérieux, Marcy I’Etoile, France).
[0051] Analytical sensitivity of the PCR. To analyze sensitivity for clinical use, a mixtureof DNAs containing all templates purified by easyMAG for each amplicon were diluted 10-fold and analyzed by PCR. In addition, the amplification of each reporter was separately analysed in 10-fold dilutions using boiled bacterial mass. Shortly, bacteria were grown on agar plates, collected to TE buffer and the viable count (colony forming unit (CFU)) was determined. Bacteria were diluted 10-folds and boiled for 15 minutes, centrifuged one minute 13 000 rpm and the supernatant (0.5 μΙ) was used in PCR reactions.
[0052] Clinical sensitivity and specificity. The clinical specificity and sensitivity was analysed with clinical samples (n=119) known to be positive for Salmonella, Shigella, Campylobacter, Yersinia or EHEC by routine cultivation method in HUSLAB. In addition, 65 culture negative samples were analysed.
Results [0053] Validation ofthe Real-Time-PCR method. The Real-Time PCR assay was optimized and validated using the reference strains including 249 positive strains and 243 strains belonging to other major genera (Table 5). All positive control strains were correctly identified and no false positive amplification was obtained. Thus, the assay achieved 100% analytical specificity.
[0054] The clinical specificity and sensitivity was analyzed from faecal samples obtained from routine diagnostics. The routine samples positive in Salmonella (n=50), Campylobacter (n=50), Yersinia (n=4) and Shigella (n=6) as well as EHEC (n=9) were analysed in PCR and all but one gave correct amplification (Table 5). In addition, 64 culture negative samples were analysed and none were positive for Salmonella, Campylobacter, Yersinia or Shigella. Diarrhoeal E. coli strains could not be identified with this method since no cultivation method exists. Thus, the clinical sensitivity of the assay was 99.2% and clinical specificity was 100%.
[0055] Analytical sensitivity of PCR was defined by 10-fold dilutions of the template DNA mixture analyzed by PCR. The sensitivity with 40 amplification cycles was 0.1 ng/ml for EHEC and Salmonella and for others the sensitivity was 1 ng/ml. In addition, the sensitivity was measured from DNA obtained with boiling the bacterial strain. In that assay, the limit of detection was 5-50 CFU per reaction. These results represent the lowest concentration required for correct identification (>90% positive).
[0056] Clinical validation ofthe PCR. The real time PCR method was utilized in the analysis of the faecal samples of 146 travellers before and after the trip abroad. The data is presented in Tables 3 and 4. All samples were positive with the internal control; no PCR inhibition was detected. Ofthe pre-trip samples, only three (2.1 %) were positive and those were positive for EAEC. From these samples, the E. coli strain giving congruent PCR result was isolated. The most common findings were diarrhoeagenic E. co//'strains (EPEC; 41.1%, EAEC; 38.4%, ETEC; 18.5%, EHEC; 7.5%), followed by Campylobacter (4.1 %), Salmonella (2.1%) and Shigella/E\EC (1.4%).
[0057] All samples positive in Campylobacter, Yersinia, Shigella, Salmonella or EHEC were confirmed as positive either by cultivation or by sequencing of the PCR product Two or more findings were found from 45 patients.
[0058] Secretion of diarrhoeagenic E. coli species. The kinetics of DEC was studied from 60 patients with no trip abroad in two months follow-up period. The same finding was found in seven out of 60 samples (four times EAEC, two times EPEC), different finding than previously was found from five patients, but all of these had travelled abroad during the follow-up period, whereas the other follow-up samples were negative. This kinetics is in line with other Enterobac-teriaceae pathogens previously described.
[0059] A norovirus was detected in 5,5% patients suggesting that bacteria are predominant pathogens in traveller’s diarrhoea.
Discussion [0060] This is the first systematic follow-up study analyzing all major pathogens associated with traveller’s diarrhoea using the new molecular methods. The study design allowed the inventors to follow the consequences of travelling to the tropical countries case by case as a normal sample prior to the trip was available. The most important achievement of the study was that all the major pathogens within the patient group were able to be identified using straight-forward modern methods, which eliminates inherent biases in comparison to results from different studies. As expected in high hygiene countries, such as Finland, there was a very low prevalence of diarrhoeal pathogens in the healthy individuals (2.1%). In a striking contrast, the inventors were able to identify a pathogen in 74% of symptomatic patients which is probably the best estimate of patients with traveller’s diarrhoeal to date which confirms that virtually all the pathogens are imported, and they do not belong to normal flora of Finnish patients. All the diarrhoeal pathogens were more frequent in the symptomatic patients than asymptomatic individuals, including all the diarrhoeagenic E. coli species suggesting that they all are relevant diarrhoeal pathogens, and not just reflecting a disturbance in normal flora. Of the samples from symptomatic patients, 26% were negative in all studied bacterial pathogens. This study is in line with other recent studies suggesting that diarrhoeagenic E. co//'species are the most predom inant bacterial pathogens in the patients with traveller’s diarrhoea.
[0061] The study covers all the major bacterial pathogens, excluding Aeromonas sp, Plesiomonas, enterotoxigenic Bacteroidesfragilis,Arcobacterand DAEC. Their relative proportion is low based on previous studies, and their pathogenic role and incidence is not fully understood yet (von Graevenitz, 2007). The Real-Time PCR method recognizes virulence genes or species specific genes of the pathogens. For example to identify the virulent EAEC, aggR gene was chosen since it is the best characterized gene contributing to aggregative pattern and diarrhoeal symptoms (Monteiro et al., 2009); (Huang et al., 2007; Mohamed et al., 2007). To cover all the possible clinically relevant target species, it was necessary to screen multiple different target genes and their conserved regions for optimal sensitivity and specificity of the assay. For example it was impossible to detect the pathogenic species among Yersinia and Campylobacter families using only one primer-probe set. The assay sensitivity and specificity were high, app. 100%, compared to independent reference methods suggesting that it could be possible to replace stool culture as primary screening method to traveller’s diarrhoea. In any case, the high proportion of DEC in the patients with diarrhoea suggests that at least they should be analyzed by the method capable to identify DEC, such as PCR.
[0062] The assay design allows identification of 13 pathogens simultaneously using control samples in optimal conditions.The inventors were able to identify up to four different pathogens from one patient sample demonstrating that multiple pathogens can be identified in parallel. This is in line with the fact that there are often multiple pathogens causing the disease. Nevertheless, a typical PCR reaction inherently favours the most abundant target. A false negative result is most likely when there are one or two highly abundant pathogens among with one very low copy pathogen within the same multiplex reaction. This option must be controlled by other methods, and/or re-sampling and a warning reported when applying this assay to any diagnostic purpose. To minimize the risk for false negative results, the multiplex composition was designed so that the most frequent pathogens were in the different multiplex reactions.
[0063] An internal positive control was tested with each sample to monitor presence of putative PCR inhibitors, but no inhibition was detected. This suggests that the semi-automated DNA extraction process is of sufficient quality, and it is suitable for stool pathogen analysis.
[0064] Taken together, this study is line with the other recent studies suggesting that diarrhoeagenic E. coli species are the predominant stool pathogens in traveller’s diarrhoeae. Applying the new Real-Time PCR technology, they can be now successfully screened, among with the other stool pathogens, directly from stool samples.
Table 3. Findings before and after the trip abroad.
Table 4. Findings after trip abroad with or without symptoms.
Table 5. A summary of known positive control strains and samples.
Table 6. Amplicons (5’->3’) amplified in target organisms. EHEC stx1
GCGTTCTTATGTAATGACTGCTGAAGATGTTGATCTTACATTGAACTGGGGAAGGTTGAGTAGTG
TCCTGCCTGATTATCATGGACAAGACTCTGTTCGTGTAGGAAGAATTTCT (SEQ ID NO:55) EHEC stx2 TGCATCCAGAGCAGTTCTGCGTTTTGTCACTGTCACAGCAGAAGCCTTACGCTTCAGGCAGATACA GAGAGAATTTCGTCAGGCACTGTCTGAAACTGCTCCTGTGTATACGATGACGCCG (SEQ ID NO:56) EHEC / EPEC eae CCAGGCTTCGTCACAGTTGCAGGCCTGGTTACAACATTATGGAACGGCAGAGGTTAATCTGCAGA GTGGTAATAACTTTGACGGTAGTTCACTG (SEQ ID NO:57)
Salmonella invA
GCTCTTCGGCACAAGTAATATCAACGGTACAGTCTCTGTAGAGACTTTATCGAGATCGCCAATCA GTCCTAACGACGACCCTTCTTTTTCCTCAATACTGAGCGGCTGCTCGCCTTTGCTGGTTTTAGGTTT G G CG G CG CTACGTTTTG CTTC ACG G AATTTAAAATAG A (SEQ ID NO:58)
Shigella / EIEC ipaH TGGTCCATCAGGCATCAGAAGGCCTTTTCGATAATGATACCGGCGCTCTGCTCTCCCTGGGCAGG GAAATGTTCCGCCTCGAAATTCTGGAGGACATTGCCCGGGATAAAGTCAGAACTCTCCATTTTGT GGATGAGATAGAAGTCTACCTGGCCTTCCAGACCATGCTCGCAGAGAAACTTCAGCTCTCCACTG CCGTGAAGGAAATGCGTTTCTATGGCGTGTCGGGAGTGACAGCAAATGACCTCCGCACTGCC (SEQ ID NO:59)
Shigella / EIEC invE TGTCTTTATAGGACATCCCTGATACTTTCAGAAAATTAAGACCAATACCAAGTTCTCGGATGCTAT GCTCTTTTGCTGTTTGTATATCGTTTGCTAGTTTTCTGGCATCAAGAGTAGATA (SEQ ID NO:60) ETEC est AAAATTGCAAAATCCGTTTAACTAATCTCAAATATCCGTGAAACAACATGACGGGAGGTAACATG AAAAAGCTAATGTTGGCAATTTTTATTTCTGTATTATCTTTCCCCTCTTTTAGTCAGTC (SEQ ID NO:61) ETEC est TCCTGAAAGCATGAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCGGGTG CTATTAATAA (SEQ ID NO:62) ETEC elt
CCGGCAGAGGATGGTTACAGATTAGCAGGTTTCCCACCGGATCACCAAGCTTGGAGAGAAGAAC CCTGGATTCATCATGCACCACAAGGTTGTGGAAATTCATCAAGAACAATTACAGGTGATACTTGT AATGAGGAGACCCAGAATCTGAGCACAATATATCTCAGGGAATATCAATCAA (SEQ ID NO:63) EAEC aggR GGAAGCAATACATATCTTAGAAATGAACTCATATTTCTTGAGAGAGGAATAAATATATCAGTAAG ATTGCAAAAGAAGAAATCAACAGTAAATCCATTTATCGCAATCAGATTAAGCAGCGATACATTAA GACGCCTAAAGGATGCCCTGATGATAATATACGGAATATCAAAAGTAGATGCTTGCAGTTGTCCG A (SEQ ID NO:64)
Campylobacter jejuni rimM GAGTGAAAAAGATTTTGTTCAAGTTGCAAAACTTGGTAAAACTGTGGGTCTTAAGGGTTATGTAA AATTGCATAACCTGAGCGACTTTT (SEQ ID NO:65)
Campylobacter coli gyrB (continued) AGTGCCTGAACCTCAATTTGAAGGACAAACTAAAGGAAAACTTGGCTCTTCTTATGTGCGTCCTAT AGTTTCAAAAGCAAGTTTTGAATATCTTAGTAAATATTTTGAAGAAAATCCTATCGA (SEQ ID NO:66)
Yersinia enterocolitica Ipseudotuberculosis virF GTTTGGTACAGTTTATGGCATTTCACCACGCGCCTGGATAAGCGAGCGACGTATTCTCTATGCTCA CCAATTACTTCTTAATTGTAAGATGAGTATTGTTGATATTGCCATG (SEQID NO:67)
Yersinia pseudotuberculosis Ipestis rumB CAG G AG CATG AG GTTC ACAGTATGTGG G ATCTGTTCTGTG GTGTGG G CGG CTTTGGTTTAC ATTG TGCGGGGCCAGAGA (SEQ ID NO:68)
Vibrio cholerae ctx GGGCTACAGAGATAGATATTACAGTAACTTAGATATTGCTCCAGCAGCAGATGGTTATGGATTGG CAGGTTTCCCTCCGGAGCATAGAGCTTGGAGGGAAGAGCCGTGG (SEQID NO:69)
Giardia lamblia 18S rRNA gene TTCCGGTCGATCCTGCCGGAATCCGACGCTCTCCCCAAGGACACAAGCCATGCATGCCCGCGCAC CCGGGAGGCGGCGGACGGCTCAGGACAAC (SEQ ID NO:70)
Entamoeba histolytica 18S rRNA gene AGACGATCCAGTTTGTATTAGTACAAAATGGCCAATTTATTTAAATGAATTGAGAAATGACATTCT AAGTGAGTTAGGATGCC (SEQ ID N0:71)
Cryptosporidium sp. cowp TCTGGAAAACAATGTGTTCAATCAGACACAGCTCCTCCTAATCCAGAATGTCCTCCAGGCACTATA CTGGAGAATGGCACATGTAAATTAATTCAACAAATTGATACCGTTTGTCCTTCTGGTTTTGTTGAA GAAGGAAATAGATGTGTTCAATATCTCCCTGCAAATAAAATCTGTCCTCCTGGATTCAATTTGTCA GGACAACAATGTATGGCACCAGAATCAGCTGAATTAGAATCGACATGCC (SEQ ID NO:72)
Table 7. Primers and a probe for Oryza sativa, terminal flower gene control CTAATCCCAGCAACCCAACC (SEQ ID NO:73) CTAATCAATGTGAGACATATGATAGAAATC (SEQ ID NO:74) CCTGCACTGGTAAGCTATG (SEQ ID NO:75)
Table 8. Distribution of ETEC toxin variants in control strains and patient samples. The results show that all ETEC variants are detected by at least one of the present primer pairs.
REFERENCES
[0065]
Alios, B.M. (2001). Campylobacter jejuni Infections: update on emerging issues and trends. Clin. Infect. Dis. 32, 1201-1206.
Antikainen, J., Tarkka, E., Haukka, K., Siitonen, A., Vaara, M., and Kirveskari, J. (2009). New 16-plex PCR method for rapid detection of diarrhoeagenic Escherichia coli directly from stool samples. Eur. J. Clin. Microbiol. Infect. Dis. 28, 899-908.
Aranda, K.R., Fagundes-Neto, U., and Scaletsky, I.C. (2004). Evaluation of multiplex PCRs for diagnosis ofinfection with diarrhoeagenic Escherichia coli and Shigella spp. J. Clin. Microbiol. 42, 5849-5853.
Bottone, E.J. (1999). Yersinia enterocolitica: overview and epidemiologic correlates. Microbes Infect. 1,323-333.
Brandal, L.T., Lindstedt, B.A., Aas, L., Stavnes, T.L., Lassen, J., and Kapperud, G. (2007). Octaplex PCR and fluorescence-based capillary electrophoresis for identification of human diarrhoeagenic Escherichia coli and Shigella spp. J. Microbiol. Methods 68, 331-341.
Chen, H.D., and Frankel, G. (2005). Enteropathogenic Escherichia coli: unravelling pathogenesis. FEMS Microbiol. Rev. 29, 83-98.
Coburn, B., Grassl, G.A., and Finlay, B.B. (2007). Salmonella, the host and disease: a brief review. Immunol. Cell Biol. 85, 112-118.
Flores, J., and Okhuysen, P.C. (2009). Enteroaggregative Escherichia coli infection. Curr. Opin. Gastroenterol. 25, 8-11.
El Tahir Y, Skurnik M. (2001) YadA, the multifaceted Yersinia adhesin. Int J Med Microbiol. 291:209-218.
Guion, C.E., Ochoa, T. J., Walker, C.M., Barletta, F., and Cleary, T.G. (2008). Detection of diarrhoeagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR. J. Clin. Microbiol. 46, 1752-1757.
Huang, D.B., Mohamed, J.A., Nataro, J.P., DuPont, H.L., Jiang, Z.D., and Okhuysen, P.C. (2007). Virulence characteristics and the molecular epidemiology of enteroaggregative Escherichia coli isolates from travellers to developing countries. J. Med. Microbiol. 56, 1386-1392.
Karch, H., Tarr, P.I., and Bielaszewska, M. (2005). Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol. 295, 405-418.
Kimata, K., Shima, T., Shimizu, M., Tanaka, D., Isobe, J., Gyobu, Y., Watahiki, M., and Nagai, Y. (2005). Rapid categorization of pathogenic Escherichia coli by multiplex PCR. Microbiol. Immunol. 49, 485-492.
Lan, R., and Reeves, P.R. (2002). Escherichia coli in disguise: molecular origins of Shigella. Microbes Infect. 4, 1125-1132.
Mohamed, J.A., Huang, D.B., Jiang, Z.D., DuPont, H.L., Nataro, J.P., Belkind-Gerson, J., and Okhuysen, P.C. (2007). Association of putative enteroaggregative Escherichia coli virulence genes and biofilm production in isolates from travelers to developing countries. J. Clin. Microbiol. 45, 121-126.
Monteiro, B.T., Campos, L.C., Sircili, M.P., Franzolin, M.R., Bevilacqua, L.F., Nataro, J.P., and Elias, W.P. (2009). The dispersin-encoding gene (aap) is not restricted to enteroaggregative Escherichia coli. Diagn. Microbiol. Infect. Dis. 65, 81-84.
Mijller, D., Greune, L, Heusipp, G., Karch, H., Fruth, A., Tschape, H., and Schmidt, M.A. (2007). Identification of unconventional intestinal pathogenic Escherichia coli isolates expressing intermediate virulence factor profiles by using a novel single-step multiplex PCR. Appl. Environ. Microbiol. 73, 3380-3390.
Nelson, E.J., Harris, J.B., Morris, J.G.,Jr, Calderwood, S.B., and Camilli, A. (2009). Cholera transmission: the host, pathogen and bacteriophage dynamic. Nat. Rev. Microbiol. 7, 693-702.
Parsot, C. (2005). Shigella spp. and enteroinvasive Escherichia coli pathogenicity factors. FEMS Microbiol. Lett. 252, 11-18.
Poly, F., and Guerry, P. (2008). Pathogenesis of Campylobacter. Curr. Opin. Gastroenterol. 24, 27-31.
Qadri, F., Svennerholm, A.M., Faruque, A.S., and Sack, R.B. (2005). Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin. Microbiol. Rev. 18,465-483.
Vidal, M., Kruger, E., Duran, C., Lagos, R., Levine, M., Prado, V., Toro, C., and Vidal, R. (2005). Single multiplex PCR assay to identify simultaneously the six categories of diarrhoeagenic Escherichia coli associated with enteric infections. J. Clin. Microbiol. 43, 5362-5365.
Vidal, R., Vidal, M., Lagos, R., Levine, M., and Prado, V. (2004). Multiplex PCR for diagnosis of enteric infections associated with diarrhoeagenic Escherichia coli. J. Clin. Microbiol. 42, 1787-1789. von Graevenitz, A. (2007). The role of Aeromonas in diarrhoea: a review. Infection 35, 59-64.
SEQUENCE LISTING
[0066] <110> Mobidiag Oy <120> Method for determining the presence of diarrhoea causing pathogens <150> FI 20125730 <151> 2012-06-27 <150> US 61/664,959 <151> 2012-06-27 <160> 75 <170> BiSSAP 1.0 <210> 1 <211> 26
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..26 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 1 gcgttcttat gtaatgactg ctgaag 26 <210> 2 <211> 27
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..27 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 2 agaaattctt cctacacgaa cagagtc 27 <210> 3 <211> 20
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 3 tgcatccaga gcagttctgc 20 <210> 4 <211> 21
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..21 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400>4 cggcgtcatc gtatacacag g 21 <210> 5 <211> 20
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 5 ccaggcttcg tcacagttgc 20 <210> 6 <211> 27
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..27 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 6 cagtgaacta ccgtcaaagt tattacc 27 <210> 7 <211> 25
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..25 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 7 gctcttcggc acaagtaata tcaac 25 <210> 8 <211> 28
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..28 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 8 tctattttaa attccgtgaa gcaaaacg 28 <210> 9 <211> 22
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..22 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400>9 tggtccatca ggcatcagaa gg 22 <210> 10 <211> 20
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 10 ggcagtgcgg aggtcatttg 20 <210> 11 <211> 29
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..29 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 11 tgtctttata ggacatccct gatactttc 29 <210> 12 <211> 28
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..28 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 12 tatctactct tgatgccaga aaactagc 28 <210> 13 <211> 27
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..27 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 13 aaaattgcaa aatccgttta actaatc 27 <210> 14 <211> 22
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..22 <223> /mol_type="DNA" /note-A PCR primer" /organism-Artificial Sequence" <400> 14 gactgactaa aagaggggaa ag 22 <210> 15 <211> 22
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..22 <223> /mol_type="DNA" /note-A PCR primer" /organism-Artificial Sequence" <400> 15 tcctgaaagc atgaatagta gc 22 <210> 16 <211> 23
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..23 <223> /mol_type="DNA" /note-A PCR primer" /organism-Artificial Sequence" <400> 16 ttattaatag cacccggtac aag 23 <210> 17 <211> 20
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note-A PCR primer" /organism-Artificial Sequence" <400> 17 ccggcagagg atggttacag 20 <210> 18 <211> 29
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..29 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 18 ttgattgata ttccctgaga tatattgtg 29 <210> 19 <211> 30
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..30 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 19 ggaagcaata catatcttag aaatgaactc 30 <210> 20 <211> 22
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..22 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 20 tcggacaact gcaagcatct ac 22 <210> 21 <211> 26
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..26 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 21 gagtgaaaaa gattttgttc aagttg 26 <210> 22 <211> 20
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 22 aaaagtcgct caggttatgc 20 <210> 23 <211> 20
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 23 agtgcctgaa cctcaatttg 20 <210> 24 <211> 28
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..28 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 24 tcgataggat tttcttcaaa atatttac 28 <210> 25 <211> 26
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..26 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 25 gtttggtaca gtttatggca tttcac 26 <210> 26 <211> 29
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..29 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 26 catggcaata tcaacaatac tcatcttac 29 <210> 27 <211> 24
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..24 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 27 caggagcatg aggttcacag tatg 24 <210> 28 <211> 19
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1 ..19 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 28 tctctggccc cgcacaatg 19 <210> 29 <211> 32
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..32 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 29 gggctacaga gatagatatt acagtaactt ag 32 <210> 30 <211> 20
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 30 ccacggctct tccctccaag 20 <210> 31 <211> 17
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..17 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 31 ttccggtcga tcctgcc 17 <210> 32 <211> 17
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..17 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 32 gttgtcctga gccgtcc 17 <210> 33 <211> 21
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..21 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 33 agacgatcca gtttgtatta g 21 <210> 34 <211> 19
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..19 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 34 ggcatcctaa ctcacttag 19 <210> 35 <211> 19
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..19 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 35 tctggaaaac aatgtgttc 19 <210> 36 <211> 19
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1 ..19 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 36 ggcatgtcga ttctaattc 19 <210> 37 <211> 36
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..36 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 37 tccatgatar tcaggcagga cactactcaa ccttcc 36 <210> 38 <211> 29
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..29 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 38 ttgtcactgt cacagcagaa gccttacgc 29 <210> 39 <211> 35
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..35 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 39 agattaacct ctgccgttcc ataatgttgt aacca 35 <210> 40 <211> 30
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..30 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 40 ccaaacctaa aaccagtaaa ggcgagcagc 30 <210> 41 <211> 30
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..30 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 41 tcactcccga cacgccatag aaacgcattt 30 <210> 42 <211> 33
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..33 <223> /mol_ type-’DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 42 acaaacagca aaagagcata gcatccgaga act 33 <210> 43 <211> 24
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..24 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 43 caaatatccg tgaaacaaca tgac 24 <210> 44 <211> 26
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..26 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 44 aggattacaa cacaattcac agcagt 26 <210> 45 <211> 24
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..24 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 45 agcaggtttc ccaccggatc acca 24 <210> 46 <211> 34
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..34 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 46 tccgtatatt atcatcaggg catcctttag gcgt 34 <210> 47 <211> 25
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..25 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 47 aagacccaca gttttaccaa gtttt 25 <210> 48 <211> 23
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..23 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 48 aacttggctc ttcttatgtg cgt 23 <210> 49 <211> 31
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..31 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 49 cctggataag cgagcgacgt attctctatg c 31 <210> 50 <211> 24
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..24 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 50 aaaccaaagc cgcccacacc acag 24 <210> 51 <211> 30
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..30 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 51 aacctgccaa tccataacca tctgctgctg 30 <210> 52 <211> 21
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..21 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 52 acgaagccat gcatgcccgc t 21 <210> 53 <211> 26
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..26 <223> /mol_type="DNA" /note="A PCR primer" /organism-Artificial Sequence" <400> 53 acaaaatggc caattcattc aatgaa 26 <210> 54 <211> 25
<212> DNA <213> Artificial Sequence <220> <221 > source <222> 1..25 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Artificial Sequence" <400> 54 cctcctaatc cagaatgtcc tccag 25 <210> 55 <211> 115
<212> DNA <213> Escherichia coli <220> <221 > source <222> 1..115 <223> /mol_type="DNA" /organism-'Escherichia coli" <400> 55 gcgttcttat gtaatgactg ctgaagatgt tgatcttaca ttgaactggg gaaggttgag 60 tagtgtcctg cctgattatc atggacaaga ctctgttcgt gtaggaagaa tttct 115 <210> 56 <211> 121
<212> DNA <213> Escherichia coli <220> <221 > source <222> 1..121 <223> /mol_type="DNA" /organism-'Escherichia coli" <400> 56 tgcatccaga gcagttctgc gttttgtcac tgtcacagca gaagccttac gcttcaggca 60 gatacagaga gaatttcgtc aggcactgtc tgaaactgct cctgtgtata cgatgacgcc 120 g 121 <210> 57 <211> 94
<212> DNA <213> Escherichia coli <220> <221 > source <222> 1..94 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Escherichia coli" <400> 57 ccaggcttcg tcacagttgc aggcctggtt acaacattat ggaacggcag aggttaatct 60 gcagagtggt aataactttg acggtagttc actg 94 <210> 58 <211> 170
<212> DNA <213> Salmonella <220> <221 > source <222> 1..170 <223> /mol_type="DNA" /organism-'Salmonella" <400> 58 gctcttcggc acaagtaata tcaacggtac agtctctgta gagactttat cgagatcgcc 60 aatcagtcct aacgacgacc cttctttttc ctcaatactg agcggctgct cgcctttgct 120 ggttttaggt ttggcggcgc tacgttttgc ttcacggaat ttaaaataga 170 <210> 59 <211> 257
<212> DNA <213> Shigella <220> <221 > source <222> 1..257 <223> /mol_type="DNA" /organism-'Shigella" <400> 59 tggtccatca ggcatcagaa ggccttttcg ataatgatac cggcgctctg ctctccctgg 60 gcagggaaat gttccgcctc gaaattctgg aggacattgc ccgggataaa gtcagaactc 120 tccattttgt ggatgagata gaagtctacc tggccttcca gaccatgctc gcagagaaac 180 ttcagctctc cactgccgtg aaggaaatgc gtttctatgg cgtgtcggga gtgacagcaa 240 atgacctccg cactgcc 257 <210> 60 <211> 120
<212> DNA <213> Shigella <220> <221 > source <222> 1..120 <223> /mol_type="DNA" /organism-'Shigella" <400> 60 tgtctttata ggacatccct gatactttca gaaaattaag accaatacca agttctcgga 60 tgctatgctc ttttgctgtt tgtatatcgt ttgctagttt tctggcatca agagtagata 120 <210> 61 <211> 124
<212> DNA <213> Escherichia coli <220> <221 > source <222> 1..124 <223> /mol_type="DNA" /organism-'Escherichia coli" <400> 61 aaaattgcaa aatccgttta actaatctca aatatccgtg aaacaacatg acgggaggta 60 acatgaaaaa gctaatgttg gcaattttta tttctgtatt atctttcccc tcttttagtc 120 agte 124 <210> 62 <211> 76
<212> DNA <213> Escherichia coli <220> <221 > source <222> 1..76 <223> /mol_type="DNA" /organism-'Escherichia coli" <400> 62 tcctgaaagc atgaatagta gcaattactg ctgtgaattg tgttgtaatc ctgcttgtac 60 egggtgetat taataa 76 <210> 63 <211> 181
<212> DNA <213> Escherichia coli <220> <221 > source <222> 1..181 <223> /mol_type="DNA" /organism-'Escherichia coli" <400> 63 ccggcagagg atggttacag attagcaggt ttcccaccgg atcaccaagc ttggagagaa 60 gaaccctgga ttcatcatgc accacaaggt tgtggaaatt catcaagaac aattacaggt 120 gatacttgta atgaggagac ccagaatctg agcacaatat atctcaggga atatcaatca 180 a 181 <210> 64 <211> 196
<212> DNA <213> Escherichia coli <220> <221 > source <222> 1..196 <223> /mol_type="DNA" /organism-'Escherichia coli" <400> 64 ggaagcaata catatcttag aaatgaactc atatttcttg agagaggaat aaatatatca 60 gtaagattgc aaaagaagaa atcaacagta aatccattta tcgcaatcag attaagcagc 120 gatacattaa gacgcctaaa ggatgccctg atgataatat acggaatatc aaaagtagat 180 gcttgcagtt gtccga 196 <210> 65 <211> 89
<212> DNA <213> Campylobacter <220> <221 > source <222> 1..89 <223> /mol_type="DNA" /organism-'Campylobacter" <400> 65 gagtgaaaaa gattttgttc aagttgcaaa acttggtaaa actgtgggtc ttaagggtta 60 tgtaaaattg cataacctga gcgactttt 89 <210> 66 <211> 123
<212> DNA <213> Campylobacter <220> <221 > source <222> 1..123 <223> /mol_type="DNA" /organism-'Campylobacter" <400> 66 agtgcctgaa cctcaatttg aaggacaaac taaaggaaaa cttggctctt cttatgtgcg 60 tcctatagtt tcaaaagcaa gttttgaata tcttagtaaa tattttgaag aaaatcctat 120 cga 123 <210> 67 <211> 112
<212> DNA <213> Yersinia <bacteria> <220> <221 > source <222> 1..112 <223> /mol_type="DNA" /organism-'Yersinia <bacteria>" <400> 67 gtttggtaca gtttatggca tttcaccacg cgcctggata agcgagcgac gtattctcta 60 tgctcaccaa ttacttctta attgtaagat gagtattgtt gatattgcca tg 112 <210> 68 <211> 79
<212> DNA <213> Yersinia <bacteria> <220> <221 > source <222> 1..79 <223> /mol_type="DNA" /organism-'Yersinia <bacteria>" <400> 68 caggagcatg aggttcacag tatgtgggat ctgttctgtg gtgtgggcgg ctttggttta 60 cattgtgcgg ggccagaga 7 9 <210> 69 <211> 109
<212> DNA <213> Vibrio cholerae <220> <221 > source <222> 1..109 <223> /mol_type="DNA" /organism-'Vibrio cholerae" <400> 69 gggctacaga gatagatatt acagtaactt agatattgct ccagcagcag atggttatgg 60 attggcaggt ttccctccgg agcatagagc ttggagggaa gagccgtgg 109 <210> 70 <211> 94
<212> DNA <213> Giardia lamblia virus <220> <221 > source <222> 1..94 <223> /mol_type="DNA" /organism-'Giardia lamblia virus" <400> 70 ttccggtcga tcctgccgga atccgacgct ctccccaagg acacaagcca tgcatgcccg 60 cgcacccggg aggcggcgga cggctcagga caac 94 <210> 71 <211> 83
<212> DNA <213> Entamoeba <220> <221 > source <222> 1..83 <223> /mol_type="DNA" /organism-'Entamoeba" <400> 71 agacgatcca gtttgtatta gtacaaaatg gccaatttat ttaaatgaat tgagaaatga 60 cattctaagt gagttaggat gcc 83 <210> 72 <211> 247
<212> DNA <213> Cryptosporidium <220> <221 > source <222> 1..247 <223> /mol_type="DNA" /organism-'Cryptosporidium" <400> 72 tctggaaaac aatgtgttca atcagacaca gctcctccta atccagaatg tcctccaggc 60 actatactgg agaatggcac atgtaaatta attcaacaaa ttgataccgt ttgtccttct 120 ggttttgttg aagaaggaaa tagatgtgtt caatatctcc ctgcaaataa aatctgtcct 180 cctggattca atttgtcagg acaacaatgt atggcaccag aatcagctga attagaatcg 240 acatgcc 247 <210> 73 <211> 20
<212> DNA <213> Oryza sativa <220> <221 > source <222> 1..20 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Oryza sativa" <400> 73 ctaatcccag caacccaacc 20 <210> 74 <211> 30
<212> DNA <213> Oryza sativa <220> <221 > source <222> 1..30 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Oryza sativa" <400> 74 ctaatcaatg tgagacatat gatagaaatc 30 <210> 75 <211> 19
<212> DNA <213> Oryza sativa <220> <221 > source <222> 1 ..19 <223> /mol_type="DNA" /note="A PCR primer" /organism-'Oryza sativa" <400> 75 cctgcactgg taagctatg 19
REFERENCES CITED IN THE DESCRIPTION
This list of references cited by the applicant is for the reader’s convenience only. It does not form part of the European patent document. Even though great care has been taken in compiling the references, errors or omissions cannot be excluded and the EPO disclaims all liability in this regard.
Patent documents cited in the description • WO 2005005659 A [0010] · CN 101113471 [0016] • WO 2005083122 A [0011] · CN 101245384 [0016] • WO 2007056463 A [0012] · CN 101235410 [0016] • WO 2005090596 A [0013] · FI 20125730 [0066] • US 20040248148 A[0014] · US 61664959 B[0066] • WO 02070728 A [0015]
Non-patent literature cited in the description • ALLOS, B.M. Campylobacter jejuni Infections: up- · GUION, C.E.; OCHOA, T.J. ; WALKER, C.M.; date on emerging issues and trends. Clin. Infect. Dis., BARLETTA, F. ; CLEARY, T.G. Detection of diar- 2001, vol. 32, 1201-1206 [0065] rhoeagenic Escherichia coli by use of melting-curve • ANTIKAINEN, J.; TARKKA, E. ; HAUKKA, K. ; Sil- analysis and real-time multiplex PCR. J. Clin. Micro- TONEN, A. ; VAARA, M. ; KIRVESKARI, J. New bioi, 2008, vol. 46, 1752-1757 [0065] 16-plex PCR method for rapid detection of diarrhoea- · HUANG, D.B.; MOHAMED, J.A. ; NATARO, J.P ; genic Escherichia coli directly from stool samples. DUPONT, H.L. ; JIANG, Z.D. ; OKHUYSEN, P.C.
Eur. J. Clin. Microbiol. Infect. Dis., 2009, vol. 28, Virulence characteristics and the molecular epidemi- 899-908 [0065] ology of enteroaggregative Escherichia coli isolates • ARANDA, K.R. ; FAGUNDES-NETO, U.; SCALET- from travellers to developing countries. J. Med. Micro- SKY, I.C. Evaluation of multiplex PCRs for diagnosis bioi., 2007, vol. 56, 1386-1392 [0065] of infection with diarrhoeagenic Escherichia coli and · KARCH, H. ; TARR, P.l. ; BIELASZEWSKA, M. En-Shigella spp. J. Clin. Microbiol., 2004, vol. 42, terohaemorrhagic Escherichia coli in human medi- 5849-5853 [0065] cine. Int. J. Med. Microbiol., 2005, vol. 295, 405-418 • BOTTONE, E.J. Yersinia enterocolitica: overview [0065] and epidemiologic correlates. Microbes Infect., 1999, · KIMATA, K. ; SHIMA, T. ; SHIMIZU, M. ; TANAKA, vol. 1, 323-333 [0065] D. ; ISOBE, J. ; GYOBU, Y. ; WATAHIKI, M. ; NA- • BRANDAL, L.T.; LINDSTEDT, B.A. ; AAS, L. ; GAI, Y. Rapid categorization of pathogenic Es- STAVNES, T.L. ; LASSEN, J. ; KAPPERUD, G. Oc- cherichia coli by multiplex PCR. Microbiol. Immunol., taplex PCR and fluorescence-based capillary elec- 2005, vol. 49, 485-492 [0065] trophoresis for identification of human diarrhoeagen- · LAN, R. ; REEVES, P.R. Escherichia coli in disguise: ic Escherichia coli and Shigella spp. J. Microbiol. molecular origins of Shigella. Microbes Infect., 2002,
Methods, 2007, vol. 68, 331-341 [0065] vol. 4, 1125-1132 [0065] • CHEN, H.D. ; FRANKEL, G. Enteropathogenic Es- · MOHAMED, J.A. ; HUANG, D.B. ; JIANG, Z.D. ; cherichia coli: unravelling pathogenesis. FEMS DUPONT, H.L. ; NATARO, J.P. ; BELKIND-GER-
Microbiol. Rev., 2005, vol. 29, 83-98 [0065] SON, J. ; OKHUYSEN, P.C. Association of putative • COBURN, B. ; GRASSL, G.A. ; FINLAY, B.B. Sal- enteroaggregative Escherichia coli virulence genes monella, the host and disease: a brief review. Immu- and biofilm production in isolates from travelers to nol. Cell Biol., 2007, vol. 85, 112-118 [0065] developing countries. J. Clin. Microbiol., 2007, vol. • FLORES, J. ; OKHUYSEN, P.C. Enteroaggregative 45, 121-126 [0065]
Escherichia coli infection. Curr. Opin. Gastroenterol., · MONTEIRO, B.T.; CAMPOS, L.C.; SIRCILI, M.P.; 2009, vol. 25, 8-11 [0065] FRANZOLIN, M.R. ; BEVILACQUA, L.F. ; NA- • EL TAHIR Y ; SKURNIK M. YadA, the multifaceted TARO, J.P. ; ELIAS, W.P. The dispersin-encoding
Yersinia adhesin. Int J Med Microbiol., 2001, vol. 291, gene (aap) is not restricted to enteroaggregative Es- 209-218 [0065] cherichia coli. Diagn. Microbiol. Infect. Dis., 2009, vol. 65, 81-84 [0065] • MIJLLER, D. ; GREUNE, L. ; HEUSIPP, G. ; · QADRI, F. ; SVENNERHOLM, A.M. ; FARUQUE, KARCH, H. ; FRUTH, A. ; TSCHAPE, H. ; A.S. ; SACK, R.B. Enterotoxigenic Escherichia coli SCHMIDT, M.A. Identification of unconventional in- in developing countries: epidemiology, microbiology, testinal pathogenic Escherichia coli isolates express- clinical features, treatment, and prevention. Clin. ing intermediate virulence factor profiles by using a Microbiol. Rev., 2005, vol. 18, 465-483 [0065] novel single-step multiplex PCR. Appl. Environ. · VIDAL, M. ; KRUGER, E. ; DURAN, C. ; LAGOS, Microbiol., 2007, vol. 73, 3380-3390 [0065] R. ; LEVINE, M. ; PRADO, V. ; TORO, C. ; VIDAL, • NELSON, E.J. ; HARRIS, J.B.; MORRIS, J.G..JR ; R. Single multiplex PCR assay to identify simultane- CALDERWOOD, S.B. ; CAMILLI, A. Cholera trans- ously the six categories of diarrhoeagenic Es- mission: the host, pathogen and bacteriophage dy- cherichia coli associated with enteric infections. J. namic. Nat. Rev. Microbiol., 2009, vol. 7, 693-702 Clin. Microbiol., 2005, vol. 43, 5362-5365 [0065] [0065] · VIDAL, R. ; VIDAL, M. ; LAGOS, R. ; LEVINE, M. ; • PARSOT, C. Shigella spp. and enteroinvasive Es- PRADO, V. Multiplex PCR for diagnosis of enteric cherichia coli pathogenicity factors. FEMS Microbiol. infections associated with diarrhoeagenic Es-
Lett., 2005, vol. 252, 11-18 [0065] cherichia coli. J. Clin. Microbiol., 2004, vol. 42, • POLY, F. ; GUERRY, P. Pathogenesis of Campylo- 1787-1789 [0065] bacter. Curr. Opin. Gastroenterol., 2008, vol. 24, · VON GRAEVENITZ, A. The role of Aeromonas in 27-31 [0065] diarrhoea: a review. Infection, 2007, vol. 35, 59-64 [0065]
Claims (15)
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261664959P | 2012-06-27 | 2012-06-27 | |
| FI20125730 | 2012-06-27 | ||
| PCT/FI2013/050716 WO2014001648A1 (en) | 2012-06-27 | 2013-06-27 | Method for determining the presence of diarrhoea causing pathogens |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| DK2867372T3 true DK2867372T3 (en) | 2019-04-08 |
Family
ID=65991998
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| DK13809410.7T DK2867372T3 (en) | 2012-06-27 | 2013-06-27 | PROCEDURE FOR DETERMINING THE EXISTENCE OF DIARRATIVE PATHOGENS |
Country Status (3)
| Country | Link |
|---|---|
| DK (1) | DK2867372T3 (en) |
| ES (1) | ES2716575T3 (en) |
| TR (1) | TR201903763T4 (en) |
-
2013
- 2013-06-27 TR TR2019/03763T patent/TR201903763T4/en unknown
- 2013-06-27 ES ES13809410T patent/ES2716575T3/en active Active
- 2013-06-27 DK DK13809410.7T patent/DK2867372T3/en active
Also Published As
| Publication number | Publication date |
|---|---|
| ES2716575T3 (en) | 2019-06-13 |
| TR201903763T4 (en) | 2019-04-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2013283152B2 (en) | Method for determining the presence of diarrhoea causing pathogens | |
| Liu et al. | Rapid and sensitive detection of Salmonella in chickens using loop-mediated isothermal amplification combined with a lateral flow dipstick | |
| Chen et al. | A real-time quadriplex PCR assay for the diagnosis of rectal lymphogranuloma venereum and non-lymphogranuloma venereum Chlamydia trachomatis infections | |
| CN104531898A (en) | Multiplex PCR based primer pair and kit for detecting multiple intestinal pathogens | |
| Løbersli et al. | Molecular differentiation of Shigella spp. from enteroinvasive E. coli | |
| Fan et al. | Rapid and sensitive Salmonella typhi detection in blood and fecal samples using reverse transcription loop-mediated isothermal amplification | |
| JP2015039320A (en) | Simultaneous detection method of multiple bacteria and/or simultaneous quantitative method of multiple bacteria | |
| CN103468811A (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| KR20120100890A (en) | An assay for determining a molecular risk assessment of a complex polymicrobial sample suspected to contain an ehec | |
| JP5961171B2 (en) | Method for detecting toxin-producing Clostridium difficile | |
| AU2008292946B2 (en) | Detection of bacteria belonging to the genus Campylobacter by targeting cytolethal distending toxin | |
| JP2014027956A (en) | Detection of bacterium of campylobacter species by targeting cell distending toxin | |
| DK2867372T3 (en) | PROCEDURE FOR DETERMINING THE EXISTENCE OF DIARRATIVE PATHOGENS | |
| Alishahi et al. | Facile and rapid detection of Vibrio cholerae by multiplex PCR based on ompU, ctxA, and toxR genes | |
| WO2020170823A1 (en) | Broad-spectrum method for determining shigella o-serogroup using pcr method | |
| Kawano et al. | Relationship between stx genotype and Stx2 expression level in Shiga toxin-producing Escherichia coli O157 strains | |
| CN107110864B (en) | Method for detecting the presence of highly virulent strains of clostridium difficile | |
| Bielawska-Drózd et al. | Development of Real-Time PCR Assay for Detection of Vibrio cholerae. | |
| Ikeuchi et al. | Development of detection methods by multiplex real-time PCR for highly pathogenic Yersinia enterocolitica, low pathogenic Yersinia enterocolitica, and Yersinia pseudotuberculosis based on SYBR Green and TaqMan probes | |
| Sangdee et al. | Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection | |
| RU2734636C1 (en) | Method for indication and identification of strains of the plague pathogen by their belonging to the species yersinia pestis, to subspecies, biovars, phylogenetic branches and by the presence of genes of pathogenicity main factors by the dna-chip method | |
| Ahmed et al. | Studying the importance of VacA gene of Helicobacter pylori in identifying the pathogenicity of strains by comparing it with the disease status of the subjects | |
| US20200002750A1 (en) | Methods for detecting c. canimorsus capsular serotypes in a sample | |
| Abdul-Aziz et al. | ISOLATION AND MOLECULAR IDENTIFICATION OF CAMPYLOBACTER SPECIES ISOLATED FROM HUMANS AND SLAUGHTERED BROILER-CHICKENS AT KERBALA RETAIL POINTS | |
| Han | Antimicrobial Susceptibility, Genotypic Characterization, and Molecular Detection of Vibrio parahaemolyticus and Vibrio vulnificus from Louisiana Oysters |