DK175613B1 - Virus vector encoding a glycoprotein from the virus responsible for AIDS, vaccine comprising the virus vector or glycoprotein, and antibody to the glycoprotein - Google Patents

Abstract

Viral vector characterized in that it comprises at least a portion of the genome of a virus, a gene coding for one of the glycoproteins (gp) of the envelope of the virus responsible for AIDS, as well as the elements providing for the expression of said glycoprotein in cells.

Description

DK 175613 B1 I

The present invention relates to a vaccine intended for the prevention of AIDS. IN

Acquired immunodeficiency syndrome (AIDS) is a viral disorder that has reached a significant level.

similar scope in North America, Europe and Central Africa.

The latest calculations indicate that approx. 1 million Americans may have been you

exposed to AIDS virus. The affected individuals exhibit a severe immune depression, and I

the disease is generally fatal. IN

10 The transmission of the disease is most often through sexual contact, although drug addicts also constitute a high-risk group; moreover, a large number of people have been infected with this virus after receiving contaminated blood or blood products.

The agent that causes this disorder is a retrovirus. Several disorders in animals 15 have been attributed to retroviruses, but it has only recently been possible to describe retroviruses affecting humans.

While retroviruses from human T cells (HTLV: human T leukemia virus) of types I and II have been reported as agents for certain adult T cell leukemia, it is the retrovirus associated with lymphadenopathies (LAV virus). , and also referred to as HTLV III virus or AIDS-related virus (ARV), now widely recognized as the responsible agent for AIDS.

The LAV retroviral genome has been characterized very extensively (Wain-Hobson et al., 1985; Ratner et al., 1985; Muesing et al., 1985; Sanchez-Pescador et al., 1985) and sequence information shows a close connection with the lentivirus I group. Lentivira, whose prototype is Visna sheep virus, is the agent of disease I with very slow progression and typically has a long incubation period. LAV and Visna viruses have many common features, especially with regard to their tropism for I 30 nerve tissue.

By analogy with other well-known retroviruses, the three most important parts of the LAV-I genome have been named gag, pole and env. The env gene sequence comprising the I gp120 and gp-41 sequence has the characteristics that might be expected for a transmembrane envelope glycoprotein and the identity of the precursor of the env1, gp160, which is constituted by the gp120 and gp41, have been confirmed by direct H sequencing of the amino acids.

Η In the following, gp41 is sometimes referred to as gp40 or gp42.

H Antibodies to the env protein gpl60 and its cleavage products gpl20 and gp41 H are usually detected in serum from AIDS patients, and the env-Qlycoprotein H is the major surface antigen of the AIDS virus.

Thus, the env protein is the most promising candidate for developing a vaccination strategy, which is why attention has been focused on this protein and the sequence encoding it.

A large number of research groups have described the expression of the env protein in bacteria. However, the absence of glycosylation and post-translational structuring may compromise the immunogenic ability of the materials synthesized by such microorganisms.

H According to the present invention, it is therefore proposed to use as an expression vector for the env protein a viral vector which allows expression of the protein in an environment which enables its glycosylation and post-translational restructuring.

Thus, the present invention relates to a viral vector which is characterized in that it comprises all or part of the env gene from the virus responsible for AIDS.

In particular, among the usable virus vectors are pox viruses, especially vaccinia virus (W).

30

Vaccinia virus is a double-stranded DNA virus that has been widely used throughout the world for the control and eradication of smallpox. Recent technical developments have made it possible to develop this virus as a cloning vector, and recombinant living viruses have made it possible to express foreign antigens and even achieve immunization against various viral or parasitic diseases.

3 DK 175613 B1

Thus, several research groups have recently demonstrated the use of this type of recombinants to express the antigen for influenza, hepatitis B and the rabies glycoprotein for immunization against these diseases (Smith et al., 1983; Panicali 5 et al., 1983; Kieny et al. , 1984).

Expression of a sequence encoding a foreign protein by vaccinia virus (VV) necessarily involves two steps: 1) the coding sequence must be placed with a VV promoter and inserted into a non-essential W-DNA segment cloned into an appropriate bacterial plasmid; 2) the W-DNA sequences located on both sides of the coding sequence should allow for in vivo homologous recombinations between the plasmid and the virus genome; a double reciprocal recombination leads to a transfer of the DNA insert from the plasmid to the viral genome in which it is propagated and expressed (Panicali and Paoletti, 1982; Mackett et al., 1982;

Smith et al., 1983; Panicali et al., 1983).

Of course, the use of this type of vector often results in a partial deletion of the virus vector genome.

More specifically, the present invention relates to a viral vector, characterized in that it comprises at least a portion of the genome of a viral vector, a gene encoding one of the glycoproteins (gp) of the envelope of the virus responsible. for AIDS, and the elements that provide expression of this glycoprotein in cells.

30 i

The invention also relates to the recombinant DNAs corresponding to these viral vectors.

It should be noted that there are 3 glycoproteins (gp) from the envelope of the virus responsible for AIDS, which proteins are designated by their mass in kD, namely gp160, gp120 and gp41; The first, the GPL60, is actually the precursor of the two

I DK 175613 B1 I

I I

In the latter proteins. These names are not yet fixed and gp41 is designated I

In sometimes gp40 or gp42, but the differences in mass make these 3 glycoproteins I

You can easily be identified by whatever designation they have. IN

I 5 "Virus responsible for AIDS" refers in particular to LAV virus, HTLV III virus I

I or ARV as well as any point mutants or partial deletions of these viruses as well as

In related viruses. IN

In the Virus vectors in the part corresponding to the virus vector genome (different from the I

In 10 viruses responsible for AIDS) can be produced from the genome of a virus of an I

In any origin. However, it is preferred to use part of I

In the genome of a pox virus and especially part of the vaccinia genome. IN

In the conditions required for expression of a heterologous protein in vaccinia virus,

I 15 has been described previously. IN

In General, in order for expression to be expressed, the gene in question must be I

You are under the control of a vaccinia gene promoter and this promoter is usually I

In the promoter of the 7.5K vaccinia protein. In addition, the coding sequence must be cloned into I

In a non-essential vaccinia gene that may serve as the marker gene. In most I

In this case, it is the TK gene. IN

Among the envelope glycoproteins that one wishes to express are the 3 I

In the above mentioned proteins, i.e. gpl60, gp41 and gpl20. IN

I 25 I

In General, it is preferable to have the complete cutting gene expressed, i.e. env- I

In the gene comprising this gene's signal sequence and transmembrane sequence. IN

In the first experiments performed with a virus vector, wherein the gene encoding I

In the total env protein, which has been cloned, has led to proposals to modify it

In gene to enhance the immunogenicity of expression products. IN

Significant secretion of the eny protein in the culture supernatants I has been observed

I (a secretion that occurs in the circulatory fluids, presumably in vivo!)

In 35 is due to poor attachment of the protein to the cell membrane; moreover, you are

It is known that the presentation of the antigens on the cell surface is very important for the induction of an immune response with the vaccinia system. Therefore, it is proposed to modify the env gene in such a way that the anchoring of the glycoprotein to the cell membrane is enhanced.

5

To this end, the env gene may be modified in the portion thereof encoding the transmembrane region to replace the argonine-like codon with a isoleucine-like codon.

It is also possible to improve the anchorage by replacing the transmembrane region of a v protein with the transmembrane region of a heterologous virus, e.g., the transmembrane region of gp from rabies virus, and / or by adding this zone to the transmembrane region of the env protein.

In addition, the protein may not be properly assembled after its expression. The signal peptide is quite atypical and can inhibit the complete secretion of the protein. For this reason, it is proposed to replace and / or add a signal sequence derived from a heterologous virus, for example the signal sequence from gp from rabies virus.

20 Finally, it appears that it is gp120 and not gp160 that is secreted by the cells. It may, on the one hand, provide a bait for the immune system and on the other, which is consistent with the latest data, attach to the T4 cells, which may cause the T4 cells to be inactivated or make them appear foreign to others. T cells.

25

Thus, it may be advantageous to obtain an env protein gp120 which cannot be secreted. This is done by modifying the env gene between the sequences encoding gp120 and gp41 to suppress the cleavage sites of the proteases located between gp120 and gp41, especially by removing the REKR site.

In the plasmids of the invention, at least one additional mutation is carried out at a site corresponding to a KKR sequence 8 amino acids downstream of the REKR sequence. The gpl60 thus obtained is no longer cleaved.

In DK 175613 B1

I 6 I

In the vectors of the invention also includes a sequence encoding gp41 without I

In the sequence corresponding to the hydrophobic N. terminal peptide thereof, the I

You assume that it may be responsible for the syncytial ability of the env protein, ie. virus I

In the ability to cause the cells to fuse and thereby achieve a giant cell or syncope

For 5 hours. IN

The present invention finally relates to viral vectors in which the extracytoplasm I

In micaceous and intracytoplasmic gp160 regions are fused in phase following deletion of the hydrophobic C-terminal peptide, allowing secretion of the glycoprotein.

In general, the virus vectors of the invention comprise a sequence encoding one I of the following proteins: I 15 - S - gp120-gp40 - (tm) - where IS is a signal peptide, I - gp120 is the glycoprotein 120, part of the link between gp120 and gp40, which lacks a cleavage site for the proteases, I - gp40 is the glycoprotein 40, and - tm is a transmembrane peptide, I 25 or for a protein of structure I - S - gp40 - tm I or I - S - gp120 - tm I 30 The signal peptide and transmembrane sequence may be derived from the virus responsible for AIDS or may be heterologous, especially from rabies or VSV virus or from any envelope virus.

Optionally, the hydrophobic N-terminal end may be lacking in B1 gp40.

In particular, the present invention relates to the use of virus vectors to produce glycoproteins encoded by the env gene from LAV virus in cell cultures. Thus, it is initially concerned with mammalian cells that have been infected with one viral vector of the invention or which may contain corresponding recombinant DNA; These cells include, in particular, diploid human cells, primary cultures and Vero cells. Of course, it is possible to use other types of cells, as shown in the examples below.

10

The glycoproteins thus obtained can, after purification, be used to prepare vaccines.

It is also possible to consider direct use of the virus vectors of the invention for performing vaccination, since the glycoproteins are then produced in situ and in vivo.

It is advantageous to contemplate the overall use of multiple vaccines administered together or separately, especially those vaccines corresponding to 20 of the vectors expressing gp120 and gp40 separately and which have undergone the modification described above. For example, it may be advantageous to use the vaccine agents derived from vectors 1136 and 1138 described below.

Finally, the present invention also relates to antibodies to the above glycoproteins, which antibodies are obtained by infection of a living organism with a virus vector as described above, and isolation of the induced antibodies after a certain period of time.

The techniques used to prepare glycoproteins, the cell cultures and vaccination techniques are identical to those currently used with the known vaccines and are not described in detail.

The invention is illustrated in more detail by the following methods and examples and with reference to the drawing, where

I DK 175613 B1 I

I 8 I

In FIG. 1 shows the effect of endo-F on the proteins synthesized by I

In the recombinants VVTGeLAV9-1 and VVTGeLAV1132 and I

In the immunoprecipitated by an anti-LAV serum. In the figure, you are

In molecular weights given in kilodaltons, and I

I 5 - P denotes the cell precipitate, I

I - S denotes the supernatant, I

I - u denotes products won without treatment,

I - e denotes products gained after treatment with endo-F. IN

In FIG. Figure 2 shows recognition of the LAV virus proteins by means of I

serum from mice vaccinated with the recombinant WTGeLAV9-1. In this I

In Figure, T denotes the case where the serum used is derived from I

In an AIDS patient. Molecular weights are given kilodaltons. IN

In FIG. Figure 3 shows immunoprecipitation of proteins synthesized by the recombinant I

vaccinia virus carrying the env. In this figure, molecular weights are I

In indicated in kilodaltons. IN

In FIG. Figure 4 shows immunoprecipitation of proteins synthesized by the recombinant I

In 20 viruses VV.TG.eLAV 1135, 1136, 1137 and 1138. I

In Virus 1135, a gp160 synthesizes, which is not seen in the culture supernatant. IN

As for the viruses 1136 and 1138, they produce the proteins I

gp120 and gp40, respectively, associated with the cell pellet. Virus I

In 1137, a protein that is slightly less than virus produces 1135 I

In 25 with a molecular weight that is similar to that expected. IN

In FIG. 5 shows the structure of env proteins synthesized by the recombinant I

In viruses.

I S signal peptide 30 H internal hydrophobic zone TM transmembrane anchorage zone I t gp120 / gp40 cleavage site In sequence derived from the rabies glycoprotein I 35 9 DK 175613 B1

METHODS

Clones: Maniatis et al., 1982.

5 Enzymes: used according to the supplier's instructions.

Localized mutaoenesis: method derived from Zoller and Smith, 1983.

Transfer to vaccine: Kieny et al., 1984. Only difference: the human 143B cells 10 replace the LMTK 'cells.

Preparation of Virus Stem Preparation: Germ-free primary chicken cells are infected with 0.01 pfu / cell for 4 days at a temperature of 37 ° C (MEM medium + 5% NCS).

Purification of virus: Purification of the above virus strain preparation is performed for 15 minutes at 2500 rpm (Rotor GSA Sorvall). Set aside the supernatant. The precipitate is taken up in RSB buffer (10 mM Tris-HCl, pH 7.4, 10 mM KCl, 1 mM MgCIV22) for 15 minutes at 4 ° C. Triturate in a homogenizer ("pots") and then spin for 15 minutes at 2500 rpm.

The supernatant is added to the previous one and then another comminution is made in the same way.

All supernatants are applied to 10 ml of 36% (w / v) sucrose pad (10 mM Tris, pH 8). Centrifugation is performed for 2 hours at 14,000 rpm (Rotor SW28, Beckman).

The precipitate is collected, separated and placed on another identical pad. Sediment # 2 is taken up in 5 ml of PBS and placed on a 20-40% sucrose gradient (10 mM Tris, pH 8) (same rotor). Centrifugation is performed for 45 minutes at 12,000 30 rpm.

The virus band is isolated. It is precipitated by centrifugation for 1 hour at 20,000 rpm. The precipitate is taken up in 10 mM Tris, pH 8.

35

I DK 175613 B1 I

I io I

In Immunoprecipitating I

I Infection of BHK-21 cells (3 cm diameter dishes, 106 cells I) is performed

I per dish, grown in G-MEM + 10% FCS) at 0.2 pfu / cell for 18 hours. The medium dean- I

I 5 teres and replace with 1 ml medium without methionine and 10 μl! 35S-methionine I

I (Amersham) pr. Cheers. IN

After 2 hours, an excess of non-radioactive methionine is added. IN

At the end of the labeling, scraping of the infected cells, centrifugal, is performed

For 10 minutes for 1 minute in an Eppendorf centrifuge, separation of supernatant and bottom I

In the faids fractions, wash the precipitate once in PBS buffer and then immuno-I

In precipitation and gel electrophoresis (according to Lathe et al., 1980). IN

Endo-F treatment I

I 15 I

I After immunoprecipitation of the labeled proteins with an AIDS-I serum

In patient, the protein A / sepharose fraction is taken up in I

In 0.2 M Na phosphate, pH 6.1 I

0.05% SDS I

I 0.1% Nonidet P40 I

In 0.1% β-mercaptoethanol I

In 0.1% EDTA, pH 8 I

25 and boiled for 5 minutes to denature the proteins. IN

Incubation is performed for 20 hours at 37 ° C with 4 units of Endo-F per ml. ml and I

Then precipitate for 2 minutes in ice with 1/5 volume of 100% TCA. The precipitate I is washed 3 times with 80% acetone, sample buffer is added and the whole is poured into 30 on SDS gel.

11 DK 175613 B1

Determination of antibodies by ELISA assay

- LOW

Use of the ELAVIA (Pasteur-Diagnostic) test with another sheep anti-mouse antibody bound to peroxidase.

- Vaccine

96-well flat bottom plates (NUNC) are incubated for 18 hours at 37 ° C with 107 pfu wild-type vaccinia virus in carbonate buffer. The plates are then saturated with 10 0.01% gelatin. Mouse sera are then adsorbed to the plates and the rest of the procedure is performed as for LAV-ELISA.

Readings at 492 nM.

EXAMPLE 1

Construction of hybrid plasmids

The combined sizes of the various elements required for transfer of the sequence encoding the env gene to the VV genome and subsequent expression thereof are on the order of several kb. Therefore, it was considered necessary to minimize the size of the replication plasmid in E. coli. used for the construction work, to facilitate the necessary manipulations.

The HindIII (Hin-J) fragment from the VV genome contains the entire gene for thymidine kinase (TK), which has already been used previously for replacement and recombination of DNA inserted into the VV genome (Mackett et al., 1982). . It should be noted that transfer of an insert to the TK gene from the VV genome produces a virus that can be selected without TK. It was first necessary to produce a small plasmid carrying a unique HindIII site that could be used for insertion of the Hin-J-W fragment.

In addition, it was necessary to eliminate the restriction sequences unnecessary to the plasmid, so that subsequent manipulations became possible.

Construction was started from plasmid pML2 (Lusky and Botchan, 1981), which is a vector derived from plasmid pBR322 by spontaneous deletion, and in

DK 175613 B1 I

12 I

which segment between nucleotides 1089 and 2491 is lost. First you became

The pst1 sequence is eliminated by inserting the AhallI-AhallI fragment from pUC8 I

(Vieira and Messing, 1982) between two AhaW sites on pML2, with 19 base pairs becoming I

eliminated. The "linker-tailing" method (Lathe et al., 1984) was used to integrate

5 establish a HindIII linker between the Nrul and EcoRI sites treated with SI I

from this plasmid, eliminating the BamHI site. This leads to a plasmid of I

2049 base pairs carrying the functional β-lactamase gene (which communicates ampicill I)

line resistance), and further comprising an active replication initiation site in E. coli I

and a unique HindIII restriction site. IN

1 ° I

This construct was designated pTG1H. IN

The Hin-J fragment from the VV DNA carrying the TK gene has been previously cloned into an I

vector derived from pBR327 (Drillien and Spehner, 1983). This 4.6 I fragment

15 kb was re-cloned into the HindIII site of pTG1H. A clone was selected in which I

The TK gene is distal to the gene encoding ampicillin resistance. IN

This construct, pTG1H-TK, was used as a vector in the experiments below. IN

The next step was to isolate a W promoter that could be used to control expression I

the sequence of the sequence encoding the gene to be expressed. The promoter from I

an early gene encoding a protein of 7500 daltons (7.5 K) is previously associated with I

have been successfully used for an identical purpose (Smith et al., 1983) and continued

therefore with the isolation of this segment. IN

25 I

The 7.5 K gene sits on one of the smallest SalI (Sal-S) fragments from VV-I

genome, type WR (Venkatasan et al., 1981). Preferably, the small ones are cloned

fragments, the Sal-S fragment is carried by a large proportion of the clones obtained by direct I

cloning of VV DNA, type WR, digested with SalI in the plasmid pBR322. This fragment I

30 is transferred to the vector bacteriophage M13mp701 (see Kieny et al., 1983) by SalI

ning and religion, thus giving the subject M13TGSal-S. IN

In this clone, a Scal site is located in the immediate vicinity of the 7.5 I initialization ATG

K gene. Downstream of the 7.5 K gene are unique BamHI and EcoRI sites that I

35 are derived from the vector. The BamHI and Scal sites are fused with a BglII-I

B1 linker, 5'-CAGATCTG-3 ', after the ends produced by Bam HI cleavage have been filled with the Klenow fragment of E. coli polymerase. In this process, the Scal site is eliminated while the BamHI site is restored and the unique EcoRI site is displaced downstream. At the same time, the SalI (AccI) site is eliminated downstream, and the SalI-5 site upstream thus becomes unique.

This construction is referred to as M13TG 7.5 K.

Within the Hin-J fragment from W-DNA are Clal and EcoRl sites, which are separated by 10 30 base pairs (Weir and Moss, 1983). The 7.5 K promoter fragment present in M13TG 7.5 K is excised with Accl and EcoRI and cloned between the ClaI and EcoRI sites of pTG1H-TK to give pTG1H-TK-P7.5K.

This construction leads to the transfer of the unique BamHI and EcoRl sites from the vector M13 immediately downstream of the 7.5 K promoter sequence. These unique BamHI and EcoRl sites are used in the following construction.

The polylinker segment of the bacteriophage M13TG131 (Kieny et al., 1983) is excised with EcoRI and BglH and inserted between the EcoRI and BamHI sites of the plasmid 20 pTG1H-TK-P7.5K to yield pTG186 poly. In this construct, 10 restriction sites are available for cloning with a foreign gene under the control of P7.5K.

EXAMPLE 2 25

Construction of a plasmid carrying the env sequence

To get a sequence encoding env. first, the two proviral segments cloned into plasmids PJ19-6 and PJ19-13 are assembled.

30

To ensure appropriate translation of env mRNA, the nucleotide sequence around the putative translation initiation site of the env gene was modified to align with the consensus sequence of eukaryotic genes, which was performed by a controlled mutagenesis with an oligonucleotide at position 5767.

35

I DK 175613 B1 I

I I

In plasmids P319-13 and P319-6, HindIII fragments from LAV

In the genome, the nucleotides comprise 1258-1698 and 1698-9173, respectively. IN

An EcoRl-KpnI fragment from PJ19-13 (containing the initiation ATG from env) was

5 inserted into the phage M13TG130 and a controlled mutagenesis with an oligopoly I was performed.

In nucleotide (with the sequence 5'CTCTCA7TGTCACTGCAG-TCTGCTCTTTC) to introduce

At a Pst I site upstream of the env translation initiation codon (position 5767) and for I

In replacing G at position -3 with A. The mutated fragment was then inserted between the Eco RI and KpnI sites of the plasmid pTG1-POLY (which is a mini plasmid of I10 2; 1 kb corresponding to pTGIH). but contains a polylinker segment from M13TG131).

The KpnI-HindIII fragment from P319-13 was then cloned into the same plasmid (between KpnI and HindIII), followed by a HindIII-XhoI fragment from P319-6 (between HindIII and SalI) to give a complete env. coding sequence flanked by two 15 Pst I sites (plasmid pTG1124).

Introduction of these two PstI restriction sites allows for easier manipulation of the I DNA from the env gene during subsequent construction. As indicated above, expression of a heterologous protein in vaccinia virus requires that the coding sequence I 20 be paired with a vaccinia promoter sequence and inserted into a nonessential vaccinia DNA segment. This DNA, located on both sides, enables H recombination with the vaccinia genome in vivo by a double reciprocal recombination that transfers the coding sequence and the accompanying promoter to the vaccinia genome.

25

For this purpose, the above PstI-Pstl fragment was cloned into the PstI site of I pTG186-POLY. Thereby a plasmid designated pTG1125 is obtained.

In the plasmid pTG186-POLY can be formed from the plasmid pTG188 digested with PstI

In 30 and relegated by T4 ligase.

The plasmid pTG188 was deposited on June 20, 1985, at the Collection Nationale de I Cultures de Microorganisms de l'Institut Pasteur, 28, rue du Docteur Roux, 75015 in Paris, France, with the following number: I 35 DK 175613 B1 15 E. coli 5K pTG188: No. I 458.

Transmission of the coding sequence for the env gene and the companion. promoter for the vaccinia genome is performed as follows.

EXAMPLE 3

Cloning in vaccinia virus to form W.TG.e LAV 9-1 10

The one by Smith et al. (1983) strategy builds on in vivo replacement of the wild-type virus genome with a plasmid carrying an insertion into the VV-TK gene, thereby inactivating the TK gene carried by the virus. TK 'viruses can be selected by plating on a cell line (TK negative) in the presence of 5-bromodeoxyuridine 15 (5BUDR) (Mackett et al., 1982). Thymidine kinase phosphorylates 5BUDR to 5'-monophosphate, which is then converted to triphosphate. This compound is an analogue of dTTP, and its incorporation into the DNA blocks the proper development of the virus. Nevertheless, a TK1 / 4 virus can replicate its DNA in the normal way, and this leads to virus zones that are visible in a similar TK cell line.

20

Vaccinia viruses are propagated in the cytoplasm of the infected cells and not in their nucleus.

Therefore, it is not possible to utilize the host DNA's replication and transcription machinery, and the virion must have the components to express its genome. Purified W-DNA is not infectious.

25

To prepare recombinants, it is necessary to simultaneously carry out cell infection with the VV virion and a transfection with the cloned DNA segment of interest. However, the production of recombinants is limited to the small portion of cells competent for transfection with DNA. Therefore, it was necessary to implement an indirect "congruence" strategy to reduce background noise from non-recombinant progenitor viruses, which was performed by using as a live infectious virus a heat-sensitive (ts) vaccine mutant that cannot reproduce by a non-recombinant -permissive temperature of 39.5 ° C (Drillien and Spehner, 1983) When the cells are infected with a ts mutant under non-permissive conditions and transfected with 35 DNA from a wild-type virus, the virus multiplication occurs only in the cells that are In the case of the transfection, in which there is a recombination I between the wild-type virus DNA and the ts virus genome, no virus will be multiplied in the other cells p despite being infected. a recombinant plasmid containing a vaccinia DNA fragment such as pTG1125 is incorporated into the transfection mixture at an appropriate concentration with wild-type DNA, it is also possible to achieve its participation in the homologous gene. combination with the vaccinia DNA in the competent cells.

Monolayers of primary chicken embryo fibroblast cells (CEF) are infected at 33 ° C with W-10 Copenhagen ts7 (0.1 pfu / cell) and transfected with a calcium phosphate coprecipitate of wild-type W-Copenhagen virus DNA (50 ng / 106 cells) and the recombinant I plasmid (50 ng / 106 cells).

After 2 hours of incubation at a temperature that does not allow the development of the ts-I virus (39.5 ° C), the cells are again incubated for 48 hours at 39.5 ° C. Dilutions of I ts + virus are used to re-infect a monolayer of human 143 B cells at 37 ° C, in which cells are then incubated in the presence of 5BUDR (150 µg / ml). Different TK 'virus plaques are obtained from the cells that have received the recombinant plasmid, whereas the control cultures without plasmid do not have visible plaques. The TK virus is then subcloned into another selection in the presence of 5BUDR. 1 I 35

A correct double reciprocal recombination between the hybrid plasmid pTG1125 and the I W genome leads to replacement of the insert-carrying TK gene with the TK-I gene of the virus, thus recombinants are purified from TK \ I 25 I DNAs. the various recombinant TK 'viruses are digested with HindIII and subjected to electrophoresis on agarose gel. The DNA fragments are transferred to a nitroceilulose RIter according to the Southern technique (1975). The filter is then hybridized with the I piasmid pTG1125, which is nick-translated with 32P. After washing the filter 30, this is fluorographed and bands of 3.85, 2.9 and 0.8 kb are visible by autoradiography, when the vaccinia virus has incorporated the LAV env. One of these recombinants, In W.TG.eLAV 9 * 1, was selected for the following studies.

EXAMPLE 4

Env protein synthesized from a recombinant vaccinia LAV virus 5 To detect the expression of the LAV env gene from the hybrid vaccinia virus, rodent cells, BHK21, which are grown in a G-MEM medium + 10% fetal calf serum are infected. with the recombinant mentioned, VV.TG.eLAV 9-1.

A fresh semiconfluent monolayer (106 cells) is infected with 0.2 pfu / cell and incubated for 18 hours.

The medium is then removed and a medium of low methionine content (1 ml per 106 cells) is added enriched with 10 μΙ / ml of 35 S-methionine. The cells are incubated at 37 ° C and the labeled proteins are collected by centrifugation. After partitioning and supernatant, the proteins are incubated with a serum of an AIDS patient.

The proteins that react with the serum are isolated by adsorption on a protein A / sepharose resin and plated by electrophoresis on an SDS-polyacrylamide gel and autoradiographed according to a technique described by Lathe et al., 1980.

The autoradiographs show that the serum of the AIDS patient specifically binds three proteins from the infected cell extracts (the result is identical to or similar to that obtained with other patient sera). The approximate molecular weights of 160, 120 and 41 kD suggest equivalence to the gp160, gp120 and gp41 bands identified by sera from AIDS patients in a preparation of authentic gnv glycoprotein and in cell extracts infected with LAV. -virus. This observation that three proteins are expressed from the recombinant vector carrying only the sequence encoding the LAV env gene supports the hypothesis that gp120 and gp41 are formed by proteolytic cleavage of the primary gp160 translation product.

The sequence encoding env. leads to a primary translation product of approx.

90 kD, while the env precursor obtained by the above method has an approximate molecular weight of approx. 160 kD. This difference can be attributed to a very significant glycosylation. By cleavage with endoglycosidase F, which eliminates the glycosyl groups, it has been shown that there was a good correlation between the

I DK 175613 B1 I

I 18 I

In products won according to the present invention and the expected I

In products (Fig. 1). IN

EXAMPLE 5 I

I Detection of anti-env antibodies in mice vaccinated with the virus I

I VV.TC.eLAV 9-1 'I

In 10 5 week old male Balb / c mice are vaccinated by subcutaneous injection with 5x107 pfu I

In VV.TG.eLAV 9-1 virus per animals. They receive another injection at the same dose I

After 2 weeks and blood is taken 1, 2 and 4 weeks after the second injection. You are looking for

In the presence of antibodies directed against LAV virus and vaccinia virus detergent I

In minants in their serum. IN

I 15 I

In All vaccinated animals give sera that can react with vaccinia virus in an ELISA-I

In test. In contrast, the response in the EL1SA test against LAV virus is weak and only reproducible

To a lesser extent. To improve the sensitivity of the tests, a "western I" was used

In this technique, antibodies capable of detecting antibodies can be detected

I react with the LAV virus proteins after being denatured with SDS in I

In an electrophoresis seal and transferred to a nitrocellulose membrane. In this experiment they are

I used nitrocellulose membranes from a LAV-BLOT kit sold by I

In the Diagnostic Pasteur and to which the LAV virus proteins are already attached. These I

In membranes, cut into bands and each band incubated with serum from the vaccine I

In 25 prepared mice (1/20 dilution). Another antibody (sheep antimus) bound to peroxidase I

You make it possible to visualize the LAV virus proteins that have bound rhus antigen

substances. IN

In Several sera (12/27), a specific reaction with a protein with a molecular weight I gives

In 30 of approx. 160 kD corresponding to gp160 from env (Fig. 2). In a certain number of sera an I is also seen

In reaction with the protein gp41. It should be noted that the sera of some mice are known to you

In Western blot, signals corresponding to unidentified proteins in LAV virus prepress I

In the ration attached to the membranes. IN

I 35 I

EXAMPLE 6

Construction of PTG1128 This plasmid pTG1128 is identical to plasmid pTG1125 except that the sequence encoding the transmembrane zone has been mutated to replace arginine with isoleucine, which has been done to enhance the attachment of the protein to the cell membrane.

The HindIII-BamHI fragment from pTG1124 containing the env transmembrane zone described in Example 2 is inserted into the phage M13TG131 after cleavage with HindIII-BamHI. This gives the phage Ml3TG154.

In this subject M13TG154, a localized mutagenesis is then performed to replace the arginine-encoding codon with an isoleucine-encoded codon. For this purpose, the following oligonucleotide is used: 5 'GGTTTAATAATAGTTTT 3'.

This yields the phage M13TG155, the sequences having been mutated as follows:

Gly Leu Arg Ile Val

Original sequence: GGT TTA AGA ATA GTT

Mutated sequence: GGT TTA ATA ATA GTT

25 Ile

The thus mutated Bam HI-HindIII fragment is transferred from M13TG155 to the plasmid pTG1124 at the corresponding sites, giving the plasmid pTG1127, which reconstitutes the gny gene as before except that the codon for arginine 30 is replaced by an isoleucine codon.

As described in Example 1, the Pstl-Pstl fragment from pTG1127 is cloned into the Pstl site of plasmid pTG186-POLY to yield plasmid pTG1128.

DK 175613 B1 I

I 20 I

EXAMPLE 7 I

Construction of the plasmid PTG1130 I

In this plasmid, the sequence encoding the rabies glycoprotein I is fused

In the transmembrane zone, with the beginning of the sequence encoding the hydrophobic I

In part of the env glycoprotein. IN

The transmembrane zone of the Rabies glycoprotein is derived from a BamHI-Pst I fragment of I

In the phage M13TGRG151. IN

This fragment is cloned into phage M13TG154 between the Bam HI and Pst I sites (see I

In the previous example). This gives the subject M13TG156. IN

Then, a localized mutagenesis on M13TG156 is performed to merge in phase I

In the env and rabies sequences with an oligonucleotide, forming a loop I

I 5 'GCTGTGGTATATAAAATATGTATTACTGAGTG 3' I

I Tyr Leu Lys Ile Phe Gly Lys Tyr Val I

I 20 TAT ATA AAA ATA TTC ------ GGG AAG TAT GTA I

I x. X ---

I tm env * · -r tm rabies I

Thus, this gives the subject M13TG157. IN

I 25 I

In the Rabies glycoprotein transmembrane zone (tm), which has just been merged with I

In the eny gene, it is then transferred to the plasmid pTG1 124

For this purpose, the HindIII-BgIII fragment of M13TG157 is cloned into pTGil24, wherein I

In Hindlll-BamHI cleavage (this breaks down BamHI and BglII-I

In the places). IN

The BlgII site of M13TG157 is derived from the rabies gp fragment: I

I 35 I

I DK 175613 B1 I 21 I BamHI Bglu I I-V77 // S // Λ -— ^ I t.n. In this way, plasmid pTGl126 is obtained.

As before, the PstI-Pstl fragment from pTG1126 is cloned into the Pstl site of pTG186-I POLY to generate the plasmid pTG1130.

I 10 I EXAMPLE 8 I Construction of PTG1131 I 15

The purpose of constructing this plasmid is to merge the signal sequence from I

In the env gene and signal sequence from the rabies glycoprotein. IN

In the Rabies glycoprotein signal sequence, the plasmid pTG155 PRO in Form I is removed

In 20 of a BgHI-HindIII fragment cloned into the PstI-HindW sites of M13TG130 by I

Using a single-stranded adapter with the following sequence:

I 5 'GATCTGCA 3' I This gives the phage M13TG158.

I 25 I Transfer of the eny signal peptide to M13TG158 is then performed to fuse the latter with the gene encoding the signal peptide from the rabies glycoprotein.

For this purpose, cloning of the PstI fragment treated with SI-30 nuclease and then with Klenow and KpnI is performed in M13TG158 digested with HindIII treated with Klenow-KpnI: 35

DK 175613 B1 I

22 I

EcoRI Kpnl Pst * / HindIII ° Pst * / BglII * I

M13 TGi30 - | -1 —- EZZZD - ^ - \ n // rihi- I

signal signal I

env rabies I

This yields the plasmid M13TG159. IN

10 I

In the KpnI-Pstl block of M13TG159, transfer to M13TG131 to form the plasmid I

M13TG160. IN

In Pst ^ Bgl11 Hind / Pst * K - EcoRI

In M13 TGI 31-ZZZZZZZZ ^ - * - ViTTTt / X - (- 1-

In signal signal I

In rabies env I 20> -—> I A localized mutagenesis on the M13TG160 allows in phase fusion of the env- I sequences and the rabies glycoprotein (forming a loop). This is due to the oligonucleotide I 25 5 'GACCCACAATTTTTCTGTAATAGGGAATTTCCCAAA 3' I Signal rabies env

Cys Phe {Gly Lys Phe Pro Ile Tyr Thr Gin Lys Leu M 5 'TGT TTT GGG AAA TTC CCT ATT TAC --- ACA__G AA AAA TTG 3 x I 35 This gives the phage M13TG161.

23 DK 175613 B1

The PvuII-Kpnl fragment from M13TG161 is then cloned into pTGH26 digested with EcoRI treated with Klenow-Kpnl (the PvuII site of M13TG161 originates from M13 in the region located upstream of the polylinker). This yields the plasmid pTGH29.

5

By cloning the PstI-Pstl fragment from pTG1129 into plasmid pTGl86-POLY digested with PstI, plasmid pTG1131 is obtained.

EXAMPLE 9

Preparation of the plasmid PTG1132

By cloning the Pstl-Pstl fragment from pTG1128 at the Pstl site of M13TG131, plasmid M13TG162 is obtained.

A localized mutagenesis is then carried out by the oligonucleotide 5 'ATT CCCACT GCTTAGTATTC ATT CTGCACCACT C 3' 20

This makes it possible to place a stop codon at the end of gp120. The sequences won are as follows:

R E K R I

Original sequence s CAG ^ VGA GAA ^ AAA GCA GTG

Presumed cleavage site in gpl20 N E Y xxx

Mutated sequence: CAG AAT GAA TAC TAA GCA GTG

This gives the subject M13TG168.

I DK 175613 B1 I

I 24 I

By re-cloning the PstI fragment from M13TG168 into the PstI site pi pTG186-POLY, I

In the plasmid pTG1132. IN

EXAMPLE 10 I

Construction of the plasmid PTG1133 I

I By localized mutagenesis on M13TG162 using the following oligonucleotide I

I 5 'ATTCCCACTGCTTG GTGTTCATTGTGC ACCACTC 3' I

You get a bacteriophage where a potential cleavage site that separates gp120 and gp40 has been broken down.

The modified sequences are as follows:

I 15 I

In Original Sequence. CAG AGA G AA AAA AGA * GCA GTG I

In record I

In cleavage site I

I '20 I

In Mutant Sequence - CAG AAT GAA CAC CAA GCA I

I N E H Q I

I 25 This gives the subject M13TG165. IN

I By re-cloning the Pstl-Pstl fragment from M13TG165 into pTG186-POLY at the Pstl site I

The plasmid pTGl 133. is obtained

I 30 I

I 35 I

EXAMPLE 11 25

Construction of the plasmid pTG1134 DK 175613 B1 5 By cloning the Pstl-Pstl fragment from pTG1131 at the Pstl site of M13TG131, the phage M13TG163 is obtained.

A localized mutagenesis on M13TG163 is performed to break down the same cleavage site in gp120 as above. For this purpose, the oligonucleotide 10 5 'ATTCCCACTGCTTGATGTTCATTCTGCACCACTC 3' is used.

This allows the sequences to be modified as follows:

R E K R

15 Original sequence: CAG AGA GAA AAA AGA ^ GCA GTG

Mutated sequence: CAG AAT GAA CAT CAA GCA

N E H Q

Under these conditions, the subject M13TG166 is obtained.

By re-cloning the Pstl-Pstl fragment in this phage M13TG166 at the Pstl site of pTG186-POLY, plasmid pTGl 134 is obtained.

EXAMPLE 12

Immunoprecipitation of proteins synthesized by recombinant VV.TG. eLAV viruses 30

Proceeding as described above for plasmid pTG1125, the hybrid vaccinia vectors corresponding to the different plasmids prepared above are obtained.

These virus vectors have the following designations:

I DK 175613 B1 I

I 26 1

In W.TG. eLAV 1128 I

In W.TG. eLAV 1130 I

In W.TG. eLAV 1131 I

In W.TG. eLAV 1132 I

In 5 W.TG. eLAV 1133 I

In W.TG. eLAV 1134 I

The proteins obtained as described above are tested by immunoprecipitation (Fig. 3). IN

In all the immunoprecipitates, the virus 9-1 produces an immunoprecipitate

In accordance with gpl60, gpl20 and gp41. IN

The same applies to viruses 1128. I

Virus 1530 also shows a gp160 and a gp120. IN

The protein corresponding to gp41 has slightly lower weight due to the modification of I

At its C-terminal end. IN

I Virus 1131 has a spectrum that is essentially identical to that available for Virus I

I 1130. I

Of course, Virus 1132 has no protein similar to gp41. The 105 kD protein that I

You are present in the precipitate is an isoform of gp120 (different glycosylation). IN

I 25 I

In the case of virus 1133, this has proteins 160, 120 and 41, but I

In the bands corresponding to proteins 120 and 41 are slightly weaker than in the other spectra. IN

The same applies to virus 1134, where gp41 also has a lower molecular weight but I

I 30 for which it is clear that the cleavage occurred with a slower kinetics than for I

In the viruses W.TG. 1125 (9-1) to 1131. I

I 35 I

Construction of the plasmid dT61135 27 DK 175613 B1 EXAMPLE 13 5 The secretion kinetics performed on viruses VV.TG.eLAV1133 and 1134 show that although the kinetics of cleavage between gpl20 and gp40 are slower, however, cleavage occurs. Examination of the DNA sequence from the env gene shows a second potential cleavage site (KRR) 8 amino acids downstream of the first cleavage site. Therefore, it seems important to mutate this second site to obtain a recombinant vaccinia virus expressing only gp160.

By localized mutagenesis on M13TG166 by the following oligonucleotide 5 'ATTCTGCACCACGTGATTCTGTGCCTTGGTGGGT 3' a phage is obtained in which the second cleavage site is modified. The modified 15 sequences are as follows:

Original sequence: GCA AAG AGA AGA GTG

A K R R V

t potential cleavage site

Mutated sequence: GCA CAG AAT CAC · GTG

A Q N Η V

The PstI-Pstl fragment of the obtained phage (M13TG181) is cloned into pTG186-POLY at the Pstl site to generate the plasmid pTG1135.

EXAMPLE 14

Construction of plasmid PTG1139 The C-terminal portion of the env synthesized by the recombinant vaccinia vector W.TG.eLAV1135 is a sequence derived from the rabies glycoprotein. Therefore, it may also be useful to have another recombinant in which this C-terminal portion is replaced with the C-terminal portion of the LAV virus eny gene.

35

I DK 175613 B1 I

I 28 I

For this purpose, the same mutagenesis as I, is carried out on the subject M13TG165

I was performed (see Example 13) on the phage M13TG166 to give the phage I

In M13TG184. IN

In the 5 Pstl-Pstl fragment of M13TG184, the clone is then cloned into plasmid pTG186-POLY to I

In formation of the plasmid pTG1 139.

In Example 15 I

Construction of the plasmid pTG1136 I

You also want a recombinant vaccinia virus that expresses gp120 alone. IN

In This gp120 was in contrast to that obtained with virus I

In W.TG.eLAV1132, be provided with a C-terminal anchoring area. IN

I 15 I

I For this purpose, by localized mutagenesis, the sequences corresponding to I are eliminated

In gp40, in the phage M13TG181 by the following oligonucleotide: I

I 5 'TGCACTCAGTAATACATACACGTGATTCTGTGCCTT 3' I

I This oligonucleotide allows for phase fusion of the gp120 sequences (with the I

In 2 modified cleavage sites) and the sequences of the rabies glycoprotein trans I

In membrane zone I

I KAQ6IHVV F Y VLL I

I AAG GCA CAG AAT CAC GTG GTG TTCITAT GTA TTA CTG I

I gpl20 TM rabies I

I 30 I

In This, the subject gives M13TG182. The PstI-Pstl fragment from M13TG182 is then inserted

Next in the PstI site of pTGl86-POLY to generate the plasmid pTGl 136.

I 35 I

Construction of the plasmid PTG1137 EXAMPLE 16 29 DK 175613 B1 5 Little is known about the role of the hydrophobic zone found at the N-terminal portion of gp40. This zone of the env protein could be responsible for the ability to induce syncytia formation.

It therefore seems interesting to produce a gp160 which does not contain this sequence.

To this end, in the phase sequences upstream and downstream of the portion encoding this hydrophobic peptide, the phage M13TG181 is fused by the following oligonucleotide: 15 'CAATAATTGTCTGGCCTGCACGTGATTCTGTGCCTT 3'

This allows the phage M13TG183 to be obtained by performing the following fusion:

20 AAG GCA CAG AAT CAC GTG GTG - GTA CAG GCC AGA CAA

KAQ NHVV VQARQ

gp120 hydrophilic portion 25 'of gp40

The Pstl-Pstl fragment from M13TG183 is re-cloned into the Pstl site of pTG186-POLY to generate the plasmid pTG1137.

30 35

I DK 175613 B1 I

I 30 I

EXAMPLE 17 I

IN

Construction of the plasmid pTG1138 I

In addition to recombinant viruses expressing gp160 or gp120, it may be useful

In producing a recombinant vaccinia virus expressing only gp40. IN

For this purpose, the sequences encoding the signal peptide are merged with the codons

In the same sequences of gp40 on the phage M13TG163 using the following oligonucleotide: I

I 10 I

I 5 'CAATAATTGTCTGGCCT G AATAG GG AATTT CC C A A A 3' I

This makes it possible to prepare the phage M13TG180, which comprises the following fusion:

I 15 TGT TTT GGG AAA TTC -f— C AG GCC AG A C AA I

In 'CF.GKP.QARQ' I

In signal gp40 (hydrophilic part) I

I 20 from I

rabies-gp I

In the Pstl-Pstl fragment of M13TG180, the Pstl site of pTG186-POLY is inserted into I

In formation of the plasmid pTG1 138. I

I 25 I

In Example 18 I

Construction of the plasmid PTG1162 I

As in the case of gp160 (plasmid pTG1139), it may also be important to advise I

In over a recombinant virus expressing a gp40 in which the anchoring zone and I

In the intracytoplasmic zone, sequences of the env from the LAV virus and not the

In similar sequences from the rabies glyco protein. IN

DK 175613 B1 31

To achieve this, the HindIII-BgII fragment of M13TG180 is replaced by the HindIII-BgII fragment of M13TG165 to give the phage M13TG190.

Plasmid pTG1162 is obtained by cloning the Pstl-Pstl fragment from phage M13TG190 at the S Pstl site of plasmid pTGl86-POLY.

EXAMPLE 19 Construction of the plasmid PTG1163

It also appears to be important to obtain a recombinant vaccinia virus that synthesizes a non-cleaved gp160 that is secreted into the medium. This protein could in fact be used as a killed vaccine for adjuvants or incorporated into liposomes or ISCOMS (Morein et al., Nature (1984) 308. 5958, pp. 457-460).

To this end, the bacteriophage M13TG194 is constructed in which the sequences encoding the extracytoplasmic and intracytoplasmic regions are fused in phase 20 in the bacteriophage M13TG184 by the following oligonucleotide: 5 'TCCCTGCCTAACTCTATTTI I IATATACCACAGCA

The PstI-PstI fragment of M13TG194 is then cloned into the PstI site of pTG186-POLY, yielding pTG1163.

The recombinant proteins thus obtained, and in particular the non-cleavable gp160, can be used in diagnostic kits to detect potential antibodies present in the blood of patients who have been in contact with the virus. These tests may be performed by methods known to those skilled in the art, for example, by ELISA, RIPA, "Western Blot" (immune imprint).

These proteins can also be used to prepare hybridomas and monoclonal antibodies designed to detect the presence of virus in samples.

35

I DK 175613 B1 I

I 32 I

I The various plasmids and M13 phages are particularly described in the following publications and I

In patent applications: I

In M13TG131: Kieny et al., 1983 I

I 5 M13TGRG151: WO 83/04052 I

I pTG155 PRO: FR 84 06499 I

In M13TG130: Kieny et al., 1983. I

In the following plasmids, November 16, 1984 was deposited in Collection National I

In 10 the Cultures de Microorganisms de l'Ihstitut Pasteur and are described in GB 84 I

I 29099: I

In PJ 19-6: CNCM No. 366-1 I

In PJ 19-13: CNCM No. 367-1. IN

I 15 I

The plasmid pTGH25 was deposited on June 6, 1986 in the same institution in the form of I

transformed bacterium: I

In E. colt 1106 / pTG1125 with the number 1-557. IN

I 20 I

IN REFERENCES

1. Drillien, R., Spehner, D. (1983) Virology 131, 385-393.

In 2. Kieny, M.P., Lathe, R. and Lecocq, J.P. 1983. New versatile cloning and 25 sequencing vectors based on bacteriophage M13. Gene 26: 91-99.

3. Kieny, M.P., Lathe, R., Drillieh, R., Spehner, D., Skory, S., Schmitt, D., I Wiktor, T., Koprowski, H. and Lecocq, J.P. 1984. Expression of rabies virus I glycoprotein from a recombinant vaccinia virus. Nature 312: 163-166.

In 4. Lathe, R., Hirth, P., Dewilde, M., Harford, N. and Lecocq, J.P. 1980. Cell-free synthesis of biologically active heat-stable enterotoxin of Escherichia coli I from a cloned gene. Nature 284: 473-474.

In 5. Lathe, R., Kieny, M.P., Schmitt, D., Curtis, P., Lecocq, J.P. (1984) J. Mol.

In Appl. Genet. 2, 331-342.

In 6. Lathe, R., Kieny, M.P., Skory, S. and Lecocq, J.P. (1984) DNA 3,173-182.

I 35 7. Lusky, M., Botchan, M. (1981) Nature 293. 79-81.

33 I

DK 175613 B1 I

8. Mackett, M., Smith, G.L. and Moss, B. 1982. Vaccinia virus: a selectable

eukaryotic cloning and expression vector. Proc. Natl. Acad. Sci. USA 22: I

From 7415 to 7419. IN

9. Maniatis, T., Fritsch, E.F., Sambrook, J. 1982. Molecular cloning: a I

5 laboratory manual. Cold Spring Harbor Lab, N.Y. IN

10. Muesing, M.A., Smith, D.H., Cabradilla, C.D., Benton, C.V., I

Lasky, L.A. and Capon, D J. 1985. Nucleic acid structure and I

expression of the human AIDS / lymphadenopathy retrovirus. Nature 313: I

450-458. IN

10 11. Brass and Vieras, Gene 19, 1982, pp. 269-276.

12. Panicali, D. and Paoletti, E. 1982. Construction of poxviruses as cloning vectors: Insertion of the thymidine kinase gene from herpes simplex virus into the DNA of infectious vaccinia virus. Proc. Natl. Acad. Sci. USA 22: 4927-4931.

13. Panicali, D., Davis, S. W., Weinberg, R. L., Paoletti, E. (1983) Proc. Natl.

Acad. Sci. USA 80, 5364-5368.

14. Ratner, L., Haseltine, W., Pat area, R., Livak, K.J., Starcich, B., Josephs, S.F.,

Doran, E.R., Rafalski, J.A., Whitehorn, E.A., Baumeister, K., Ivanoff, L.,

Petterway Jr., S. R., Pearson, M. L., Lautenberger, J. A., Papas, T. S., Ghrayeb, I. 20 J., Chang, N. T., Gallo, R. C. and Wong-Staal, F. Complete nucleotide sequence of the AIDS virus, HTLV-III. 1985. Nature 313: 277-284.

In 15. Sanchez-Pescador et al., 1985. Science 227: 484-492.

In 16. Smith, G. L., Mackett, M., Moss, V. (1983) Nature 302. 490-495.

In 17. Smith, G. L., Murphy, 8. R., Moss, B. (1983) Proc. Natl. Acad.

In Sci. United States §Q, 7155-7159.

In 18. Venkatesan, S., Baroudy, B.M., Moss, B. (1981) Cell 125, 805-813.

In 19. Wain-Hobson, S., Sonigo, P., Danos, 0., Cole, S. and Alizon, M. Nucleotide In Sequence of the AIDS Virus, LAV. 1985. Cell 4JS,: 9-17.

In 20. Weir, J.P., Moss, B. (1983) J. Virol. 46, 530-531.

I 30 21. Zoller, M.J. and Smith, M. (1983). Oligonucleotide-directed muta-genesis of I DNA fragments cloned into M13 vectors. I: Methods in Enzymology (Wu,

Grossman, Moldave, ed.) 100: 468-500.

Claims (30)

A virus vector, characterized in that it contains at least: 5. a portion of the genome of a virus, - a sequence encoding the signal sequence of the precursor of the gp160 glycoprotein from the envelope of the virus causing AIDS, or a signal sequence from a heterologous virus, - the sequence of the gene encoding the gp160 glycoprotein from the envelope of the virus that causes AIDS, the gene encoding gp160 does not contain the protease cleavage site with the sequence REKR, - and also the elements that ensure the expression of this glycoprotein in cells. Virus vector according to claim 1, characterized in that the gene for gp160 encodes a gp160 which does not contain the protease cleavage sites of the sequence REKR and I KRR. Virus vector according to claim 1, characterized in that the REKR sequence is replaced by Virus vector according to claim 2, characterized in that the REKR and KRR sequence are I replaced by the NEHQ and QNH sequences respectively. Virus vector according to any one of claims 1-4, characterized in that the part of the genome of a virus is part of the genome of a pox virus. Virus vector according to claim 5, characterized in that the pox virus is the vaccinia virus. Virus vector according to any one of claims 1-6, characterized in that it does not contain the sequence encoding the transmembrane region of the native gp160. Virus vector according to any one of claims 1-7, characterized in that the sequence encoding the C-terminal hydrophobic peptide corresponding to the natural gp160 has been mutated to replace the Arg codon with an Ile codon. Virus vector according to claim 7, characterized in that it contains a sequence which encodes a transmembrane region from a heterologous virus, in particular from rabies virus. The virus vector of claim 7, characterized in that it does not contain a sequence encoding a transmembrane anchor region. Virus vector according to any one of claims 1-10, characterized in that the DNA sequence encoding gp160 is under the control of a promoter of a pox virus gene. The virus vector according to claim 10, characterized in that the promoter is a promoter of a vaccinia virus gene. The virus vector of claim 12, characterized in that the DNA sequence encoding gp160 is under the control of the promoter of the 7.5 K protein of vaccinia virus. 20 Virus vector according to any one of claims 11-13, characterized in that the sequence encoding gp160 is cloned into the TK gene of vaccinia virus. Virus vector according to any one of claims 1-7 and 9-14, characterized in that the C-terminal hydrophobic peptide in gp160 is deleted. A recombinant DNA corresponding to a virus vector according to any one of claims 1-15. Culture of mammalian cells infected with a viral vector according to any one of claims 1-15, or containing a DNA according to claim 16. A method for producing envelope glycoproteins from the virus causing AIDS, characterized in that cells of claim 17 are cultured and in that the glycoprotein produced is isolated. _____ I DK 175613 B1 I I 36 I 19. Non-cleavable gp160 coat glycoprotein from the virus causing AIDS and II which can be obtained in particular by using the method of claim 18. II. , characterized in that it does not contain the protease cleavage site with the II sequence REKR of the natural gp160 glycoprotein. IN 20 NEHQ sequence. Non-cleavable gp160 glycoprotein according to claim 20, characterized in that it does not contain the I10 in the protease cleavage site having sequences REKR and KRR of the natural I1 gp160 glycoprotein. IN Non-cleavable gp160 glycoprotein according to claim 20 or 21, characterized in that the IREKR sequence is replaced by the NEHQ sequence. I 15 Non-cleavable gp160 glycoprotein according to claim 20 or 21, characterized in that the I RECR and KRR sequence of the natural gp160 are replaced by the NEHQ and QNH sequences, respectively. I 20 Glycoprotein according to any one of claims 20-23, characterized in that it does not contain the trans-human anchor region of the natural gp160. Glycoprotein according to claim 24, characterized in that it contains the transmembrane region of rabies virus. I 25 Glycoprotein according to claim 24, characterized in that the C-terminal hydrophobic I peptide corresponding to the transmembrane region of gp160 is modified, with the arginine residue being replaced by an isoleucine residue. I 30 Glycoprotein according to claim 24, characterized in that it contains no transmembrane anchor region. Glycoprotein according to any one of claims 22-25 or 27, characterized in that the C-terminal hydrophobic peptide of the natural gp160 is deleted. I 35 DK 175613 B1 I Vaccine, characterized in that it consists of a virus vector according to any one of claims 1-13 and / or a glycoprotein according to any one of claims I 19-28. IN An antibody generated against the envelope glycoproteins of the virus causing I AIDS, according to any one of claims 19-28, with the exception of the I antibodies produced against the natural gp160 glycoproteins. IN