AU614934B2

AU614934B2 - Vaccine containing the protein f of the aids virus

Info

Publication number: AU614934B2
Application number: AU75140/87A
Authority: AU
Inventors: Bruno Guy; Marie-Paule Kieny; Jean-Pierre Lecocq; Luc Montagnier
Original assignee: Transgene SA
Current assignee: Transgene SA; Institut Pasteur de Lille
Priority date: 1986-06-16
Filing date: 1987-06-15
Publication date: 1991-09-19
Anticipated expiration: 2007-06-15
Also published as: FR2600079B1; WO1987007642A1; ES2062990T3; PT85093A; PT85093B; KR880701285A; DK76688D0; AU7514087A; EP0253693B1; FR2600079A1; DK76688A; JPH01500962A; DE3789525T2; EP0253693A1; DE3789525D1; ATE103980T1

Abstract

Viral vector characterized in that it comprises at least one portion of the genome of a virus, a gene coding for the protein F of the virus responsible for AIDS, as well as the elements providing for the expression of said protein in cells. Said viral vector may be used as vaccine in the treatment, prevention and diagnosis of AIDS.

Description

AN PCT AU-AI-75140/87 ORGANISATION MONDIALE DE LA PROPRIETE INTELLECTUELLE Bureau international aOP~ DEMANDE INTERNATIONALE PUBLIEE EN VERTU DU TRAITE DE COOPERATION EN MATIERE DE BREVETS (PCT) (51) Classification internationafk. des brevets 4 (11) Numnro de publication Internationale,, WO 87/ 07642 C12N 15/00, 5/00, C12P 21/012pd ato trnae CO7K1,5/4, 5/06 G~i 33569 4~Da~e17 d~cembre 1987 (17.12.87) A61K 39/21, 39/2$5 41 (21) Num~ro de la dermande internationale: PCT/FR87/00219 (74) Mandataire: WARCOIN, Jacques; Cabinet Regimbeau, 26, avenue Klkber, F-751 16 Paris (FR).

(22) Date de d~p6t international: 15 juin 1987 (15.06.87) (31) Num~ro de la demnande prioritaire: 86/08698(8)Easdigs:AI

KJPKRUS

(3)Date de priorit6: 16 juin 1986 (16.06,86) PubiU~e A vec rapport de rechierche internationale.

(33) Pays de priorit6: FR A vant I'eypiration dLu d~1ai previt pour la modifcation des revendications, sera reptibli~e si de telles modifications sont repies.

(71) D~posants (pour tous les Etats d~sign~s saulf US): TRANSGENE S.A. [FR/FR]; 16, rue Henri Regnault, F-92400 Courbevoie INSTITUT PASTEUR [FR/FR]; 25, rue du Docteur-Roux, F-75015 Paris (FR),A-O.J-Z I11 FEB 1988 (72) Inventeurs; et bourg GUY, Bruno [FR/FR]; 18, rue Ste Made- leine, F-07000 Strasbourg LECOCQ, Jean-11JA i/8 Pierre (BEV,,FR]; 6, rue du Champ du Feu, F-67116 1 'I 98 Reichstett MONTAGNIER, Luc [FwR/FR]; 21, PAET OFFICE rue de Malabry, F-92350 Le Plessis-Robinson (FR), (54) Title: VACCINE CONTAINING THE PROTEIN F OF THE AIDS VIRUS (54) Titie: VACCIN, CONTENANT LA PROTEINE F DU VIRUS DU SIDA (57) Abstract Viral vector characterized in that it comprises at least one port'o:n of the genome of a virus, a gene coding for the protein F of the virus responsible for AIDS, as well as. the elements providing for the expression of said protein in cells, Said viral vector may be used as vaccine in the treatment, prevention and diagnosis of AIDS.

(57) Abr6g& Vecceur viral caract~ris6 en ce qu'll comporte au moins une partie du g~nome d'un virus, un codant pour la protilire F du virus responsable du SIDA, ainsi que les 616ments assurant l'expression de cette prot~ine dans. des cellules, Ce vecteur viral peut atre utilise' i titre de vaccin dans le traitement, la prevention et le diagnostic du SIDA.

r "IPcr ORGANISATION MONDIALE DE LA PROPRIETE INTELLECTL" LLE Bureau international DEMANDE INTERNATIONALE PUBLIEE EN VERTU DU TRAITE DE COOPERATION EN MATIERE DE BREVETS (PCT) (51) Cissification internationale des brevets 4 C12N 15/00, 5106, C12P 21/02 C07iW7 15/04, 15/06, GOIN 33/569 A61 K 29/21, 39/285 Al (11) Numiro de publicat ion internationale: WO 87/ 07642 (43) Date de publication internationale: 17 d~cembre 1987 (17,12.87) (21) Numiro de la de u"Ide Internationale: PCT/FR87/00219 (22) Date de dip~t international: 15 juin 1987 (15.06.87) (31) Numero de la demnande prioritaire: 86/08698 beau, 26, avenue K1~ber, F-751 16 Paris (FR).

(81) FEtats d~sign~s: AU, DK, JP, KR, US.

Publi~e Avec rapport de rocherche internarlonale, Avant l'expiratiion du d~tai pr~vu pour la modijcation des revendicarions, sera republi~e si de telles modiJicai-ions sont re~~ues, (32) Date de priorite: (33) Pays de priorit6: 16 juin 1936 (16.06.86) (71) Diposants (pour tous les Etats d~signks sauf US): TRANSGENE S.A. [FR/FR]; 16, rue H-enri Regnault, F-92400 Courbr 'jie INSTITUT PASTEUR 25, i-u lu Docteur-Roux, F-75015 Paris

(FR).

(72) Inveateurs; et Inventeurs/Deposants (US seulernent) KIENY, Marie- Paule [FR/FR]; 1, rue de Gascogne, F-67 100 Strasbourg GUY, Bruno [FR/FR]; 18, rue Ste Madeleine, F-67000 Strasbourg (FR) LECOCQ, Jean- Pierre [BE/FR]; 6, rue du Champ du Feu, F-67 116 Reichstett MONTAGNIER, Luc [FR/FR]; 21, rue de Malabry, F-92350 Le Plessis-Robinson (FR).

(54) Title: VACCINE CONTAINING THE PROTEIN F OF THE AIDS VIRUS (54) Titre., VACCIN, CONTENANT LA PROTEINE F DU VIRUS DU SIDA (57) Abstract Viral vector characterized in that it comprises at least one portion of the genome a vira, a gene coding for the protein F of the virus responsible for AIDS, as well as the elements providing for the e~pression o( said protein in cells, Said viral vector may be used as vaccine In the treatment, prevention and diagnosis of AIDS.

(57) Abrige' Vecteur viral caract~ris6 en ce qu'll comporte au zvoins une partie du g~nome dtuaj vit4, uin g~ne codant pour la prot~i1e -F du virus responsable du SIDA, ainsi que les 61 ments Assurant lUexpression de ceice prot ifle dang des cellules, Ce ';ecteur viral peut Wte utilis6 i titre de vaccin dans le traitement, Ia pr~vention et le diagnostic du IDA, I N.

71 WO 87/07642 PCT/FR87/00219 Vaccine containing the F protein of the AIDS virus.

The present invention relates more especially to a vaccine intended for the prevention of AIDS.

Acquired Immune Deficiency Syndrome (AIDS) is a viral condition which is now of major importance in North America, Europe and Central Africa.

Recent estimates suggest that approximately 1 million Americans may have been exposed to the AIDS virus.

The individuals effected show severe immunosuppression and the disease is generaLLy fatal.

The transmission of the disease most frequently takes place through sexual contact, although people using narcotics intravenously also represent a high-risk group; furthermore, a large number of individuals have been infected with this virus after receiving'contaminated blood or blood products.

The causal agent of this condition is a retrovirus.

Many animal conditions have been attributed to retroviruses, but only recently has it been possible to describe retroviruses which affect humans.

Whereas type I and II.human T-cell retroviruses (HTLV: human T leukemia virus) have been implicated as the caual agent of certain T-cell leukemias in adults, the retrovirus associated with lymphadenopathy (LAV virus), which is also known as HTLV-III or AIDS-related virus (ARV), is now readily accepted as the a,gent responsible for AIDS.

The genome of several isolates of the LAV or HTLV- III retrovirus has been characterized very completely (Wain-Hobson et al., 1985; Ratner et al., 1985; Muesing et al., 1985; Sanchez-Pescador et al., 1985) and data on the genome sequence indicate a close relationship with the lentivirus group. Lentiviruses, the prototype of which is ovine Visna virus, are the agents of slowly progressing diseases which typically possess a prolonged incubation period. LAV and the Visna virus share many similarities, especially in their tropism for nerve tissue.

%V 1 1 s Y 14-- i.

2 In addition to the three portions of the genome found in aLL retroviruses and designated gag, poL and env, the LAV virus contains at Least three other genes known as Q or Sor, TAT and F or 3'orf (Wain-Hobson et aL., 1985; Arya et aL., 1986). The F gene product has been characterized by reaction with the sera of patients suffering from AIDS, and the identity of the protein confirmed by direct amino acid sequencing (ALLan et aL., 1985).

According to the authors, the F protein is recognized by 30 to 90% of patients' sera. This protein migrates on an SDS-acryLamide geL according to an apparent mulecuLar weight of between 26 and 28 kD. Some authors have demonstrated an F gene product of between 24 and 25 kD, raising the possibility of an initiation of translation at the second ATG.

The F protein is not glycosyLated, although two potential N-glycosyLation sites are present. FinaLLy, it has been demonstrated that the F protein is acylated by myristic acid. There is a tetrapeptide 'Arg Phe Asp Ser) in the F protein which is found in certain proteins involved in cell adhesion, and also in one chain of the class II HLA antigen.

Auffray (Auffray, 1986) has raised the possibility that the F protein plays a part ir the recognition and attachment of the env protein and df the LAV virus to the T4 Lymphocytes, thereby contributing to the dissemination of the, virus. Furthermore, the high variability (2 to 17%) of the F protein from one strain to another, a variability comparable to that of the envelope glycoprotein, suggests that the F protein effectively plays a part in the infection (Ratner et al., 1985).

The present invention proposes the use, as a vector for the expression of the F protein, of a viral vector enabling the protein to be expressed in an environment which will permit its post-translational restructuring.

Thus, the present invention relates to a viral vector which contains the F gene of the virus responsible for AIDS.

Among the viral vectors which may be used, poxviruses S3 should be mentioned more especially, and in particular vaccinia virus (VV).

Vaccinia virus is a double-stranded DNA virus which has been very widely used throughout the world for controlling and eradicating smallpox. Recent technical developments have enabled this virus to be developed as a cloning vector, and live recombinant viruses have made it possible to express foreign antigens and even to obtain immunizations against different viral or parasitic diseases.

Thus, several groups have recently demonstrated the use of recombinants of this type for expressing influenza and hepatitis 8 antigens and the rabies gLycoprotein, for immunization against these diseases (Smith et al., 1983; Panicali et al., 1983; Kiney et al., 1984).

The expression of a sequence coding for a foreign protein by vaccinia virus (VV) necessarily involves two stages: 1) the coding sequence must be aligned with a VV promoter, and be inserted in a nonessential segment of the VV DNA, cloned into a suitable bacterial plasmid; 2) the VV DNA sequences situated on both sides of the coding sequence must permit homologous recombinations in vivo between the plasmid and the viral genome; a double reciprocal recombination event leads to a transfer of the DNA insert from the plasmid into the viral genome in which it is propagated and expressed (Panicali and Paoletti, 1982; Mackett et al 1982; Smith et al., 1983; Panicali et al., 1983).

Naturally, the use of this type of vector frequently involves a partial deletion of the genome of the vector virus.

The present invention relates more especially to a viral vector which contains at least: a portion of the genome of a vector virus, a gene coding for the F protein of the virus responsible for AIDS, and also the elements which provide for the expression of this protein in cells.

The invention also relates to the recombinant DNAs 4 corresponding to the said viral vectors.

"Virus responsible for AIDS" is understood to designate, in particular, the LAV virus or the HTLV-III or ARV virus, as well as possible point mutants or partial deletions of these viruses, and also related viruses.

In the portion corresponding to the genome of the vector virus (different from the virus responsible for AIDS), the viral vectors may be formed from the genome of a virus of any origin. However, it will be preferable to use a portion of the genome of a poxvirus, and more especially a portion of the vaccinia genome.

The conditions necessary for the expression of a heterologous protein in vaccinia virus have been recalled above.

Generally speaking, the gene in question, for example the F gene, will, in order to be expressed, have to be under the control of a promoter of a vaccinia gene; this promoter will generally be the 7.5 K protein promoter of vaccinia. Furthermore, the coding sequence will have to be cloned into a nonessential gene of vaccinia which may, if appropriate, serve as a marker gene. In most cases, this will be the TK gene.

The native F protein does not possess an excretion signal and is not glycosylated. Modifications of this gene in order to imp-ove the immunogenicity of the expression product are proposed here.

It is proposed to modify the F gene so as to provide for its excretion out of the cell, and, moreover, for a third construction, to provide for anchoring of the protein in the membrane.

For this purpose, the gene may be modified at the level of its portion coding for the NH 2 -terminal end of the protein, by adding a signal sequence which originates from a heterologous virus, for example the signal sequence of the rabies virus gLycoprotein. This will enable the, protein to be excreted out of the cell.

It should be clearly understood that a signal sequence derived from other viral proteins may be used.

FinalLy, it may be advantageous, in respect of the t& immunogenicity of the protein, for the Latter to be anchored in the cell membrane and thus correctly presented to the host's immune system. For this reason, it is proposed, starting with the above construction (F rabies signal), to add, at the Level of the portion coding for the COOH-terminal end of the F protein, a sequence coding for the transmembrane part originating from a heterologous virus, Likewise the sequence for the rabies virus glycoprotein.

The present invention relates, in the first place, to the use of viral vectors for obtaining the protein encoded by the F gene of the LAV virus in cell cultures.

The initial stage hence involves mammalian cells which have been infected with a viral vector according to the invention, or alternatively which can contain the corresponding recombinant DNA; among these cells, human diploid cells, primary cultures and also Vero cells should be mentioned more especially. Naturally, it is possible to introduce other types of cells, as will, indeed, be 0 seen in the examples below.

The proteins thereby obtained may be used after purification for the production of vaccines.

It is also possible to envisage the direct use of the viral vectors according to the invention in order to perform a vaccination, the F protein then being produced in situ and in vivo.

The present invention also relates to the antibodies raised against the above F proteins, these antibodies being obtained by infecting a living organism with :30 a viral vector as described above ar:d recovering the antibodies induced after a specified time.

Finally, the present invention relates to the detection of the antibodies raised against the above F proteins, as well as to the corresponding diagnostic method enabling AIDS in a patient to be detected in vitro on the basis of the detection of the-e antibodies in a biological sample taken from this patient.

l

X

I

Accordingly the invention provides in its broadest aspects: a viral vector for expressing protein F of the Virus HIV responsible for AIDS which comprises at least: a portion of the genome of a poxvirus and, a DNA fragment which comprises a sequence encoding protein F of the virus responsible for AIDS placed under appropriate transcriptional and translational control elements.

a culture of mammalian cells infected with said vector, a method of producing protein F of the virus responsible for AIDS which comprises: a) infecting mammalian cells with a viral vector according to any one of claims 1 to 6, b) culturing infected mammalian cells and, c) recovering protein F from the cell culture, a protein F as produced by the said method.

The techniques etployed for obtaining the F protein, the cell cultures and the vaccination techniques are mwspe/trans3 91 7 3

I

"NT O< \^rJX r 6 identical to those which are currently practiced with the known vaccines, and will not be described in detail.

The present invention will be more readily understood on reading the methods and examples which follow.

The following figures illustrate the examples: Figure 1 shows the action of tunicamycin on the proteins synthesized by the recombinants VV.TG.FLAV.1147 and VV.TG.FLAV.1145 and immunoprecipitated by means of an anci-LAV serum; in this figure, the molecular weights are given in kilodaltons, and the symbols denote the following: P the cell pellet s the supernatant the products obtained without treatment the products obtained after treatment with tunicamycin 1 VV.TG.FLAV.1145 2 VV.TG.FLAV.1147 3 wild-type vaccinia virus; SFigure 2 shows the screening of anti-LAV sera for their capacity to recognize the F protein synthesized by the recombinant virus VV.TG.FLAV.1145; the molecular weights are expressed in kilodaltons, and the symbols denote the following: 0 wild-type vaccinia virus 1 VV.TG.FLAV.1145, clone C 2 VV.TG.FtAV.1145, clone D negative control serum a, b, c, d, e sera of patients suffering from AIDS; Figure 3 shows the immunoprecipitation of the proteins synthesized by the recombinant VV.TG.1147; in this figure, the symbols denote the following: 1 wild-type vaccinia virus 2 i VV.TG.FLAV.1147 a the labelling of BHK21 cells with b the labelling of BHK21 cells with 32p04 c the labelling of BHK21 cells with C 3 H]myristic acid the molecular weights are in daltons; Figure 4 shows the immunoprecipitation of extracts of So' BHK21 cells infected with vaccinia recombinants after I f- 7 Labelling with 3 2 P0 4 in this figure, symbols denote the following: immunoprecipitation without addition of TPA immunoprecipitation with addition of TPA P cell pellet S the culture supernatant the molecular weights are in daltons; Figure 5 shows the immunoprecipitation of the proteins synthesized by the recombinant virus VV.TG.FLAV.1165 and 35 LabeLLed with C S]methionine; in this figure, the symbols denote the foLLowing: 1 the cells infected with VV.TG.FLAV. 1 145 2 the celLs infected with VV.TG.FLAV.1165 3 the ceLLs infected with VV.TG.FLAV.1147 the molecular weights are in kilodaltons; S Figures 6a and 6b show the reaction of the antibodies of mice vaccinated with the recombinant viruses with respect to the F protein produced in E.coLi and transferred onto nitrocelluLose; in Figure 6a: *strips 1 and 3 correspond to wild-type vaccinia virus strips 2, 4, 5, 8, 9 correspond to the virus VV.TG.FLAV.

1145 strips 6, 7, 8, 11, 12 correspond to the virus VV.TG.

FLAV.1147 strips 13, 14, 15 correspond to the virus VV.TG.FLAV.1146; in F-igure 6b: strips 1, 2 correspond to wild-type vaccinia virus strip 3 corresponds to the virus VV.TG.FLAV.1146 strip 4 corresponds to the virus VV.TG.FLAV.1147 strips 5, 6, 7, 8 correspond to the virus VV.TG.FLAV.

1165.

METHODS

Cloning: Maniatis et at., 1982 Enzymes: Used according to the supplier's directions Localized mutagenesis: Method derived from Zoller and Smith, 1983.

Transfer into vaccinia: Kieny et al., 1984. Only difference: human 1438 cells replace LMTK- cells.

/il -8 Preparation of the stock virus "Germ free" chick primary cells are infected at 0.01 pfu/ceLL for 4 days at a temperature of 37 0 C (MEM medium 5% NCS).

Purification of the virus A centrifugation of the above stock virus is performed for 15 minutes at 2,500 rpm (Sorvall Rotor GSA).

The supernatant is placed on one side. The peLLet is taken up in an RSB buffer (10 mM Tris-HCL pH 7.4, 10 mM KCL, 1 mM MgCL 2 for 15 minutes at 4 0 C. The suspension is subjected to grinding in a Potter, followed by centrifugation for 15 minutes at 2,500 rpm. The supernatant is added to the previous supernatant, and d second grinding is performed in the same manner.

All the supernatants are deposited on 10 mL of a 36% sucrose cushion (10 mM Tris pH Centrifugation is performed for 2 hours at 14,000 rpm (Beckman Rotur SW28).

The pellet is taken up, dispersed and placed again on a second identical cushion. The second pellet is taken up in 5 ml of PBS and loaded onto a 20-0% sucrose gradient mM Tris pH 8) (same rotor). Centrifugation is performed for 45 minutes at 12,000 rpm.

The band of virus is recoered. It is pelleted by centrifugation for 1 hour at 20,000 rpm. The pellet is taken up in 10 mM Tris PH 8.

Immunoprec ipi tat ions An infection of BHK21 cells (dishes 3 cm in diameter, 106 cell/dish, cultured In G-MEM 10% FCS) is performed at 0.2 pfu/cell for 18 hours. The medium is decanted and replaced by 1 ml of methionlne-free medium and 1 10 p1 of 3 5 S3methionine (5 mCi/300 l) (Amersham) per dish.

An excess of nonradioactive methionine is added after 2 hours.

When the labelling is complete, the infected cells are scraped off and centrifuged for 1 minute in an Eppendorf centrifuge, the supernatant and pellet fractions are separated, the pellet is washed once in PBS buffer and -~sl-~~rarrs;ail 9 immunoprecipitation is then performed in a geL (according to Lathe et al., 1980).

Immunoprecipitation of the proteins synthesized in the presence of tunicamycin After the infection of BHK21 cells as described above, 1.5 4g of tunicamycin per ml of medium is added after 18 hours, for 1 hour.

The medium is ther; decantered and replaced by 1 mL of methionine-free MEM containing 1.5 ig of tunicamycin and 10 pL of C 3 5 S methionine (Amersham). The subsequent manipulation is performed as above.

Endo-F treatment After immunoprecipitation of the labelled proteins with the serum of a patient suffering from AIDS, the pro-tein A-Sepharose fraction is taken up in: 0,2 M Na phosphate, pH 6.1 0.05 SDS 0.1 Non'idet 0.1 Beta-mercaptoethanol 0.1 EDTA, pH 8 and boiled for 5 minutes to denature the proteins.

An incubation is performed for 20 hours at 37 0

C

with 4 units of endo-F per ml, foLlowed by a precipitation for 2 minutes in ice with 1/5 vol'ume of 100% TCA. The peki t is washed 3 times with 80% acetone, the sample buffer' is added and the mixture is Loaded onto an SDS gel.

Assay of the vaccinia antibodies by the ELISA test Plates having 96 flat-bottomed holes (NUNC) are incubated for 18 hours at 37°C with 10 6 pfu wild-type vaccinia virus in carbonate buffer. The plates are then saturated with 0.01% gelatin. The mouse sera are then 64 adsorbed onto the plates and the remainder of the protccol is performed as for a conventional ELISA test.

Readings were taken at 492 nm.

EXAMPLE 1 Construction of the hybrid plasmids The combined sizes of the different elements needed for the transfer of the sequence coding for the env gene into the VV genome, and its subsequent expression, are of 141'

F

the order of severaL kb. It was hence judged necessary to minimize the size of the pLasmid for repLication in E.CoLi, used for t he construction work so as to faciditate the necessary manipuLations.

The HindilI (Hin-J) fragment of the VV genome contains the complete gene for thymidine kinlase which has aLready been used previousLy to permit the exchange and recombination of DNA inserted into the VV genome (Mackett et aL., 1982). It is important to note that the transfer of an insert into the TK gene of the VV genome creates a TK-dleficient virus which can b,4 seLected. it was necessary, in the first place, to produce a smallsized pLasmid carrying a singLe HindI site which couLd be used for the integration of the VV Hin-J fragment. In addition, it was necessary to remove the unnecessary res-* triction sequences of the pLasmid so as to permit the foL~ow ing man ipulat ions.

The construction was initiated with pLasmid pML 2 (Lusky and Botchan, 1981), which is a vector derived from pLasmid PBR322 by spont .neous det~etion in which the segment between nocLeoticles 10$9 and Z491 has been Lost.

First, the Pstlt sequence was removed by insertion of the Ahalll-Ahatil fragment of pUC8 (Vieira and Messing, 1982) between two Ahall sites of pML2 removing 19 base pairs.

The "Linker taiLing" methiod (Laithe et aL., 1984) was used in order to insert a K1indIII Linker between the Nrut site and th,e SI-treated,, EcoRt site of this nlasmidl, th,, Sl' site being removed.

This Leads to a -plasmid of 2049 ba~e pit's 1ing the f unc t iona L be ta-L ac tanase gene Oonf er rln i i tance to ampiciLLin) and containing, in addition, o'r, origin of replication which is active in E. coW and i single Hindilt restriction site.

This construction was referred to as PTGlR4.

The )41n-J f ragnient of ViV NA carrying thA TK *o-il was cLoned Ole- rehand in a vector originating f roni P4132V (Drillien and Spehner, 1983). This 4, ,-kb fragtn *4 recLoned into the Hin'01tI site of pTGIH. A c' iW selected in which the TK gene is situated 41 _1 11 respect to the gene coding for resistance tr- arnpiciLL in.

This pTG1H-TK construction was used as a vector in the foLLowing experiment.

The foL~owing stage was to isoLate a VV promoterg which couLd be -ied for controLLing the expression of the seq~uence coding for the gene to be expressed. The promoter of an earLy gene coding for a protein of 7,500 daLtons K) has a~ready been used successfuLLy for an identicaL 'ourppse (Smith et aL., 1983), and the isoLation of this segment was consequently carried out.

The 7.5 K gene is situated on one of the smaLLest SaLt fra~ments (SaL-S fragment) of th,. VV type WR genome ('enkatasan et 1981). Since smaLl fragments are cloned preferentiaLLy. a Large proportion of the cLones obtained by the direct cLoning of SaLl-cut VV type WR DNA into PU~asiid p8R324" carries the SaL-S fragment. This fragment is transferred into the vector bacteriophage M 13mp701 (Kierly et 4L., 1983) by SaLl digestion and reLigation,, thereby Leading to the phage M13TGSaL-S.

In this cLone, a Scat site is oresent in the immediate vicinity of the initiation ATG of the 7.5 K gene.

Downstream frop's the 7.5 K gene, there are situated !ingLe GamHt and EcoP~I sites originating from the vector. The BandI and Scat sites are -fused via a BgLll Linker 51- CAGATCTG-31 after the ends generated by BandI digestion hive been fiLLed with the Kienow fragment of E. coLi poLy- ,nerase. This process removes the Scat site but re-forms the BamHl site and shifts the singLe EcoRl site downstream.

At the sgame tim~e, the Sal (Accr) site downstream is r-eirtoved and the Sail site upstream hence becomes unique.

This construction is referred to as M13TG2 7.5 K.

Within the Hin-J fragment of VV DNA there are itituated Call and EcoRI sites which are separated by~ approximateLy 30 base pairs and Moss, 1983). The 7.5 K promoter fragment present in M13TG7.5K is excised with Accl and EcoRI and cloned between the CLal and EcoRt sites of pTGIH-T< to generate This construction Leads to the transfer of the B-1 41 singLe BamHl and EcoRl sites of the MIS vector immedioteLy sy I

'I

-12 downstreamn fromi the 7.5 K promoter sequence. These singLe BamHI and EcoRt sites are used in the foLLowing construction.

The poLyL inker segment of the bac ter iophage M 13TG 13 1 (Kieny et aL,1983) is excised with EcoRl and SgLII and inserted between the EcoR I and BamHl s itesof plasmid p FGlH-TK-P7,,5K, generating pTG186-poLy. In this construction, 5 singLe restriction sites are avaiLabLe for the c.Loning of a foreign gene under tne controL of P7.5K (Pstl, BamHI, SstI, Sinal, EcoRI).

EXAMPLE Z Construction of the pLasmid carrying the F sequence .In the first pLace, the env gene of LAV, surrounded by the s ignaL and transineibrane sequences for the rabies virus gLycoprotein, was insertod into a pLasmid (pTG1 134) described previousLy. The Pstl-PstI fragment of pLasmid pTG1134 is cLoned into the vector M'13mp701 in an approprilate orientation. The resuL ting bac ter iophage is M13TG169: (RS rabies signaL) (RTJI rabies transinembrane) The genomic fragment coding for the F protein is obta ined by 8smHI /H ind I I di ges tion of pLasmidc Jl19-6, a proviraL seg(Oent cLoned and described previoust..

The BamHt-HindiII fragment of pJl9-6 is cLoned into the vector Mi3TG1690 opened at t'he Kpni and HinciJl sites.

The 8amHI site is joined to the Kpnl site by a singLestranded oLigonucteotide Linker of sequence.- '-GATCGTAC-31 SG T A, C G A T' C 3' BamM Z 31A r I~ir 13 The resuLting bacteriophage is referred to as M 13 T G17O0: R PstI KpnG SstI Hindlll 8 amMHI In order to be abLe to excise excLusiveLy the F p rote in cod ing sequenc e. a BamH I s ite i s genera ted ups tre am from the translation initiation ATG, by directed mutagenesis with an oLigonucLeotide.

ATG

F

t11 M13TG170 (singLe-stranded) "-v-i ff The oLigonucteotide sequence is: 5' GAAAGGATCCTGCTATAAG 3' Ba m 32 After repair and screening of the pLaques with the 3 P-LabeLLed oligonucLeotide, the phage M13TG173 is isolated. It differs from the phage M13TG 170 only by the 6amHI site situated upstream from the initiation ATG.

ATG F

TGA

11 I' I 1/ (M13TG173) B amHI SstZ The introdclLtion of this site enables the BamHI- SstI fragment whi c~i contains the F gene to be cloned into the pTG186-paLy transfer pLasmid, opened at the BarnHI and SstI sites and whose construction has been dlescribed above.

As hV35 been stated, the expression of a heterot~ogovs 4 protein in vaccinia virus requires that the coding sequence be al igned with a promoter sequence of vacc inia and ,e inserted in a nonessentiaL segment of ",he vac~ir'ia DNA.

This DNA, situated on both sides, permits recombination w ith the vaccinia genome in vivo by a doule retiprocaL recombination eve-nt vhich transfers ti,) coding sequence and the accompanying promoter into the vac~rinia genome.

The resuiting- pLasniid is pLasmid pTG1147.

The transfer of the F gene coding seqvence and of 14 the accompanying promoter into the vaccinia genome is accomplished as foLLows: EXAMPLE 3 Cloning into vaccinia virus to generate VV.TG.FLAV.1147 The strategy described by Smith et aL., 1983, rests on the in vivo exchange between a plasmid carrying an insert in the VV TK gene and the wiLd-type viral genome, so as to inactivate the TK gene carried by the virus. The TK viruses can be seLected by plating on a ceLL Line (TK negative) in the presence of (Mackett et at., 1982). Thymidine kinase phosphory- Lates the 5BUDR to 5'-monophosphate, whizh is then converted to triphosphat(, This compound is a Lower dTTP analog and its incorporation into DNA blocks the correct development of the virus. A TK virus can nevertheless replicate its DNA normally, ant it leads to viral plaques which are visible in a cell line which is also TK.

Vaccinia virus reproduces in the cytoplasm of infected cells rather than in their nucleus. For this reason, it is not possible to make use of the machinery for replication and transcription of the host's DNA, and it is neessary for the virion to possess the components for the expression of its genome. Purified VV DNA is non-infectious.

In order to gencrate the recombinants, it is necess.ary to perfojre the cellular infection with the VV virion simultaneously with a t ansfection with the cloned DNA segment which is of interest.. However, the generation of the recobinants is Limitid to the small proportion of cells which are competent fTr transfection with DNA. For this reason, it was necessary to empLoy an indirect strategy of t"congruence" in order o reduce the background due to the non-recombinant pdrent viruses. This was accomplished by using, as live infectious virus, a temperaturesensitive (ts) mutant of vpacinia which is incapable of reproduction at a non-pormissive temperature o 39.50C (Drillien and Spehknr, 1983). When tJe cotls are infected with a ts mutant under non-permissiv/ canditions and 15 transfected with the DNA of a wild-type virus, viral multiplication will take place only in the cells which are competent for transfection and in which a recombination between.the wild-type DNA and genome of the ts virus has taken place; no virus will multiply in the other cells, in spite of the fact that they have been infected. If a recombinant plasmid containing a vaccinia DNA fragment, such as pTG1147, is included in the transfection mixture, at the appropriate concentration, with the wild-type DNA, it is also possible to procure its participation in the homologous recombination with the vaccinia DNA in the competent cells.

Monolayers of primary cells of chick embryo fibroblasts (CEF) are infected at 33 0 C with VV-Copenhagen ts7' (0.1 pfu/cell) and transfected with a calcium phosphate coprecipitate of the DNA of the VV-Copenhagen wild-type virus (50 ng/10 6 cells) and the recombinant plasmid ng/10 6 cells).

After incubation for 2 hours at a temperature which does not permit the growth of che ts virus (39.5 0 the cells are again incubated for 48 hours at 39.5 0 C. Dilutions of ts+ virus are used for reinfecting a monolayer of 1438-TK- human cells at 370C, which are then incubated in the presence of 5BUDR (150 pg/ml). Various plaques of TK virus are obtained from these cellL which have received the recombinant plasmid, while the control cultures without plasmid do not show visible plaques. The TK- viruses are then subcloned by means of a second selection in the presence of A correct double reciprocal recombination event between the hybrid plasmid pTG1147 and the VV genome leads to the exchange of the TK gene carrying the insert with the TK gene of the virus, the recombinants thereby becoming

TK.

The DNAs purified from the different TK recombinant viruses are digested with HindI11 and subjected to agarose gel electrophoresis. The DNA fragments are transferred onto a nitrocellulose filter according to the technique described by Southern (1975). The filter is then hybridized "i 16 with pLasmid pTG1147, nick-translated with 32P. After the fiLter has been washed, the Latter is fluorographed and 3.85-, 2.9- and 0.8-kb bands are visible on the autoradiograph when the vaccinia virus has incorporated the F gene of the LAV. One of these recombinants, VV.TG.FLAV.1147, was selected for the foLLowing study.

EXAMPLE 4 F protein synthesized using a recombinant vaccinia-LAV virus In order to demonstrate the expression of the F gene of LAV using the hybrid vaccinia virus, BHK21 rodent cells, which are cultured in a G-MEM medium 10% foetal calf serum, are infected with the said VV.TG.FLAV.1147 recombinant.

A fresh semi-confluent monolayer (106 cells) is infected with 0.2 pfu/cell and incubated for 18 hours.

The medium is then removed, and a medium having a low methionine content and supplemented with 10 pL/mL of

C

3 5 S methionine (5 mCi/300 ul) is added (1 ml per 106 cells). The cells are incubated at 37 0 C and the Labelled proteins are collected by centrifugation. After separation into pellet and supernatant, the proteins are incubated with a serum belonging to patients suffering from AIDS.

The proteins which react with the' serum are recovered by adsorption oL protein A-Sepharose resin, spread by electrophoresis on an SDS-polyacrylamide gel and autoradiographed according to a technique described by Lathe et al., 1980. The oradiographs show that some sera of patients suffering 1@ AIDS specifically, bind two proteins of the infected cell extracts. The apparent molecular weights of 25.5 and 27 kD suggest equivalence with the F protein identified by the sera of patients suffering from AIDS in an authentic F protein preparation and in extracts of cells infected with the LAV virus.

The sequence coding for F leads to an approximately 23-kD primary translation product, whereas the F protein obtained by the above method possesses an apparent molecular weight of between 25 and 27 kD. This heterogeneity may be attributed to a modification (acylation) and/or due Xr. S i (P U? r rO? 1 1 d C~: i 17 to the fact that two ATG's may be used for initiating the translation of F.

EXAMPLE Construction of pTG1145 Plasmid pTG1145 contains the F gerne, of which the portion coding for the NH2-terminaL end of the protein has been placed in phase with the rabies glycoprotein signal sequence. The constructions are derived from the phage M13TG170 described earlier.

The 5' portion of the F gene is placed in phase with the rabius glycoprotein signal sequence by means of an oligonucLeotide-generated deletion.

The first four amino acids of the rabies glycoprotein are retained in order to promote good cleavage of the signaL peptide.

Phe Gly Lys Phe Pro Ile ly Gl 2 La TrP Ser LYS 3' TTT GGG AAA TTC CCT ATT GGT GGC AAG TGG TCA AAA end of first 4 F the amino acids (the initiation ATG is rabies of the rabies deleted) signal glycoprotein The oLigonucleotide used for generating the Loop has the sequence: TTYTGACCACTTGCCACCAATAGGGAATTTCCCAAA 3' The phage M13TG171 is thereby obtained. The rabies signal (RS) of the rabies glycoprotein, fused with the F gene, is then transferred into plasmid pTG186-poly.

For this purpose, the Pstl-PstI fragment of M13TG171 is cLoned into the pTG186-poly, opened at the PstI site.

The resulting plasmid is designated pTG1145. The F gene fused with the rabies signal is transferred into.vaccinia as described above.

EXAMPLE 6 Construction of pTG1146 In this plasmid, the sequence coding for the I" 'I 18 transmembrane region of the rabies gLycoprotein (RTM) is fused with the end of the F gene. The TGA (stop) codon of the F gene is included in the deletion Loop generated by the oLigonucLeotide, whose sequence is as follows: TGCACTCAGTAATACATAGCAGTTCTTGAAGTACTC 3' Glu Tyr Phe Lys Asn Cys Tyr Val Leu Leu Ser ALa GAG TAC TTC AAG AAC TGC TAT GTA TTA CTG AGT GCA

RTM

The phage M13TG172 is thereby obtained.

The F gene, fused upstream with the rabies signal and downstream with the rabies transmembrane portion, is' transferred into p asmid pTG186-poLy.

For this purpose, PstI-PstI fragment of M13TG172 is cLoned into pLasmid pTG186-poLy, opened with PstI, to generate pLasmid pTG1146.

EXAMPLE 7 Immunoprecipitation of the proteins synthesized by the recombinant viruses VV.TG.FLAV.1145 and 1146 Working as described above for plasmid pTG1147, the hybrid vaccinia vectors corresponding to the different plasmids prepared above are obtained.

These viraL vectors will be referred to, respectively, as: VV.TG.FLAV.1145 VV.TG.FLAV.1146 The proteins obtained as' described above are tested by immunoprecipitation (Figure The immunoprecipitates obtained with the product of VV.TG.FLAV.1145 reveal a protein whose apparent molecular weight is in the region of 28 kD. The protein demonstrated in the culture medium supernatant has a higher apparent molecular weight.

It appears that the F gene product is effectively excreted into the culture supernatant.

Since the diffuse appearance of the autoradiographic signal suggests the existence of glycosylation, a manipulation of Labelling with C 35Smethionine in the

T*

19 presence of tunicamycin was performed. In the presence of tunicamycin, a protein having an apparent moLecuLar weight of 26 kD, distinctly Less than that observed earlier, is obtained. This indicates that the product of the virus VV.TG.PLAV.1145 is glycosylated. The presence of the signal peptide and of potential N-gLycosylation sites brought about a glycosylation of the F protein. Since the difference in molecular weight between the glycosylated and the unglycosylated protein is 2 kD, it is probable that only one of the two glycosylation sites is used.

The same experiment performed with the virus VV.TG.FLAV.1147 shows that the product of this virus is not glycosylated.

The immunoprecipitates obtained with the product' of VV.TG.FLAV.1146 reveal a protein having an apparent molecular weight higher (34 kD) than those previously observed. This result could be expected, since the F gene is fused with the terminal portion of the rabies glycoprotein, including the transsembrane portion of the latter.

It was also demonstrated, by labelling with C 3 5

S-

methionine in the,presence of tunicamycin, that the product of VV.TG.FLAV.1146 is glycosylated. The excretion observed is less than that seen with VV.TG.FLAV.1145, indicating that the protein is, indeed, anchored at the surface of the cells.

This is confirmed by immunofluorescence according to a technique described previously. The surface of the cells appears distinctly fluorescent with respect to a negative control, which demonstrates the presence of the F protein at the cell surface.

"i EXAMPLE 8 Demonstration of anti-F antibodies in mice vaccinated with the viruses VV.TG.FLAV.1145, 1146 and 1147 7-Week-old male Balb/c and C57/81 mice are vaccinated by subcutaneous injection of 5x10 7 pfu or by scarification of the base of the tail and application of 2x10 7 pfu of virus VV.TG.FLAV per animaL. They receive a booster injection with the same dose after 2 weeks, and undergo blood sampling at the time of the booster as well i'" 20 as 2 and 4 weeks after the booster. Tests are performed for the presence in their sera of antibodies directed towards determinants of LAV virus and of vaccinia virus.

ALL the vaccinated animaLs give sera capable of reacting with vaccinia virus in an ELISA test.

Immunoprecipitation or "Western blotting" techniques were used. These methods make possibLe to demonstrate antibodies capabLe of reac ing with proteins of the LAV virus that are undenatured or denatured with SDS in an electrophoresis geL and transferred onto a nitroceLluLose membrane. In this experiment, the nitrocellulose membranes employed are obtained by transfer of the proteins present in a cell extract infected with LAV virus according to known techniques. These membranes are cut into strips and each strip is incubated with the serum of the vaccinated mice (diluted 1/20). 12 5 I-Labelled protein A enables the LAV virus proteins which have bound mouse antibodies to be visualized.

Cell extracts infected with LAV virus and labelled with C 3 5 S]cysteine were used for the immunoprecipitation experiments.

Several sera give a specific reaction with a protein having a molecular weight of about 27 kD, corresponding to the F protein.

It shouLd be noted that the sera of a few mice produce, in "Western blotting", signals corresponding to uniden.tified proteins of the LAV virus preparation which is bound to the membranes.

EXAMPLE 9, Myristylation of the F protein It has been shown that BHK21 cells infected with the VV.TG.FLAV.1147 recombinant express a protein similar to the native F protein and which takes two forms having apparent molecular weights of 25 and 27 kO in SDS-polyacrylamide gel electrophoresis (Figure 3).

Since the F protein synthesized by cells infected with the wild-type HIV are myristylated (Allan et al., 1985), the existence of a similar post-translational mod- S ification was investigated on the molecule synthesized by

I

21 the recombinant virus, by LabeLLing with.tritiated myristic acid.

A Lawn of BHK21 ceLLs (106 ceLLs/dish) is infected with the recombinant virus (at 0.2 pfu/ceLL); 12 hours after infection, 100 pCi/ml of C3 H myristic acid (Amersham) is added in MEM medium supplemented with 5 mM sodium pyruvate.

After 4 hours' incubation, the labelled proteins are harvested and immunoprecipitated with a serum of patients suffering from AIDS. The proteins which have reacted with the antibodies are recovered by adsorption on a protein A-Sepharose resin and separated by SDS-polyacryLamide gel electrophoresis.

Autoradiography of the gel shows that only the form having an apparent molecular weight of 25 kD is myristyLated; the 27-kD form is not seen (Figure 3).

The expression ol the F protein by the recombinant vaccinia virus hence makes it possible to obtain a myristyLation of the molecuLe which is similar to that of the native moLecule synthesized by the HIV virus.

The myristate is probably responsibLe for the attachment of the moLecuLe in intracellular membranes, as observed for other myristylated proteins (Gould et aL., 1985).

I r 22 TABLE 1 Comparison.of the sequences of the F protein of HIV-1 and HIV-2 (Guyader et aL., 1987) and of the protein in their N-terminaL portion, and of the intracytoplasmic Portion close to the membrane of the EGF receptor V G W T V G jWS L(S S

I'S

IQ FIS K H S M P Ni G A F4

P

SIS !LP to P.S C R R S 13 ;jr V LRK L FRq 77 qS.Hl V I T I- M& A E PA A I

E

S L 1 E PP 0 U CRE F HIV- EGF rva The site of phosPhorylati6n by protein kinase C of FHIV-1, pp60src and EGFrec is indicated. by the arrow, Myr =myristic acid; tm transmeibrane portion of the EGFrec proteiln.

EXAMPLE PhosphoryLa tion of the F protein the F protein is nmyristy~ated (ExampLe 9) and is thus anchored in the membrane in contact with other memp brane oroteins. Sequence simitLarities exist between F and the protein pp60src (Gauld et aL., 1985), which are aLso myristyLated# and with the EGF receptor (Ulirich et aL.0 1984) in its intracytopLasmic portion cLose to the membrane (Table since the Latter two proteins are phosphoryLated by proteirn kinase C at a site close to the membrane, the possibility that such a modification existed S At, in the ,ase of F was investigated. There is effqctiveLy 77 C_ 3 23 a consensus site for phosphorylation by protein kinase C at the threonine 15 of F (Woodgett et aL., 1986).

A Lawn of 8HK21 ceLLs (106 cell/dish) is infected with the VV.TG.1147 recombinant (0.1 pfu/cell); 12 hours after infection, 100 pCi/ml of 3 2 p0 4 (Amersham) is added in MEM medium without phosphate. After 4 hours' incubation, immunoprecipitation and gel eLectrophoresis are performed as described in ExampLe 4.

Figure 3 shows that the 25-kD protein which is myristylated is also phosphorylated. This protein is rsolvved into two bands: P25-1 and PZ5-2. If the phorbol ester 12-tetradecanoylphorboL 13-acetate (TPA) is added to the culture med ium 10 minutes before immunoprecipitation, a very marked increase in the phosphorylation is observec for P25-1. This is in agreement with a phosphorylation by protein kinase C, whose activity is very stronglyincreased by TPA (Figure 4).

Many isolates of HIV possess an F gene in which the threonine 15 is replaced by an alanine (Ratner et al., 1985). The F protein of such isolates is hence theoretically incapable of phosphorylation. To verify this point, a recombinant exprOssing an F protein having an alanine at position 15 was constricted.

The P25-2 may correspond either to a form of F phosphorylated on an amino acid other than the Thr15, or to a ceLL protein immunoprecipitated with F.

EXAMPLE 11 Construction of plasmid pTG1191 Plasmid pTG1191 contains' the F gene originating from plasmid pJ19-6 but in which the threonine at position is replaced by an alanine. The constructions are derived from the phage M13TG170 described above (Example The threonine-alanine mutation is accomplished by means of the oligonucleotide having the following sequence: 5' TCTTTCCCTCACTGCAGGCCATCC 3' The phage M13TG1151 is thereby obtained. The F-Ala Oene is then transferred into plasmid pTG186-poly.

For this purpose, the BamHI-SstI fragment of M13TG1151 is cloned into pTGI86-poly, opened at the same sites. The 4' _i e U: 1 3 _L 24 resulting plasmid is designated pTG1191. The transfer of the F-ALa gene into vaccinia is performed as described above.

EXAMPLE 12 Immunoprecipitation of the proteins synthesized by the recombinant virus VV.TG.FLAV.1151 By working as described above for plasmid pTG1147, the viraL vector VV.TG.FLAV.1191 is obtained.

The proteins obtained are examined by immunoprecipitation after labelling with, C 35 S]methionine as described above. The proteins obtained and visualized on SDS gel are identical to those induced by the VV.TG.FLAV.1147 recombinant (not shown).

If Labelling is performed with 3 2 P0 4 as described above, the P25-1 form induced by the VV.TG.FLAV.1147 recombinant is no longer seen. Furthermore, the addition of TPA.

to the medium does not modify the phosphorylation of the P25-2 form (Figure 4).

These results show that the site of phosphorybation by protein kinase C is the threonine 15. The fact that the F protein of some isolates is incapable of phosphory- Lation by PKC may imply that these isolates have a biological activity which is different. In effect, phosphory- Iation by PKC generally constitutes a regulation of the activity of its substrates (see revue by Nishizuka, 1986).

EXAMPLE 13 Construction of plasmid PTG1165 It was shown that the Immunogenicity of the F protein was increased if the latter was coupled C-terminally to a hydrophobic region (VV.TG.FLAV.1146 recombinant).

However, the conformation of the protein was evidently incorrect, since the latter is then very poorly recognized by antibodies of seropositive individuals. The construction of a recombinant virus expressing the F protein coupled N-terminally to a hydrophobic peptide was hence undertaken. This peptide would thus play the part of myristic acid, while providing for more secure anchoring of the protein in the cell membrane. This recombinant was constructed from the VV.TG.FLAV.1145 recombinant described rtri above. The present example hence reLates to the use of a viraL vector -ing a more immunogenic F protein t'an the lvnmodlifi', roc- .in and having a conformation similar to the nati, tein.

P~asi,.id pTG1165 hence contains the F gene, of which the portion coding for tre NH2-terminaL errd of the prot.4in was P~aced in phase with the signal sequkence of the rabies gLycoprqtein,. this signal rjequence being mutat d in order to atboL ish the in vivo cleavage between the hydrophobic sign!al peptidle and rht. F protein, lhe cons",ructions are derived from the ph'ge M13TG171 described above (Examp~e The cLeavage site is situated between the terminaL gLycine of the signal peptide and N-terminal Lysine of the rabies gLycoprotein. in order to 3bolsh the c~eavage, the gLycine qituated at -1 from the cleavage site was mutated to tryptophan, the phenVLaLanine at -2 was mutated to isoLeucine and the praline at -S to Leucine. These mutations were, carried out by means of the oligonucLeotidle having the foLowing sequen~ce; AGGGAATTTCCATAAACACAATAGAAAAACCAG 3' The phage M13TG1107 is thereby obtained. The mtwtatred signal sequence of the rabies gLycoprotein, fused with tho F gen'e, is then transler'red into pLasmid pTG 186-poLy For thi-4 purpose, the PstI-PstI fragment of M13TG1107 is cLoned into pTG186-poly, opened at the PstL site. The resultinog pLasruid 'is designated pTG1165. The F gene fused with the mutated rabies signal sequence is transferred -into vai~cinia as dles-cribed above.

EXAMPLE 14 Immnunoprecipitation of the proteins synthesized by the recombinant virus VV.TG.FLAV.1165 By working as desribed for plasmid pTGI147, the recombinant vaccinia virus corresponding to plasmid PTG1165, and designated VV.TG.FLAV.1,165, is obtained. The proteins obtained as described above are tested by immunoprecipitation (Figure The immdnoprecipitates obtained with the product x~idSQN. of VV.TG.FLAV.1165 reveaL a protein whose apparent moLecuiar 0;

I.

26 weight is 26,000 daLtons. The protein is absent in the 35* culture supernatants. A manipulation of C S methionine Labelling in the presence of tunicamycin indicates that the protein obtained is not glycosylated.

EXAMPLE Demonstration of anti-F antibodies in mice vaccinated with viruses VV.TG.FLAV.1165 7-Week-old female Balb/C mice are vaccinated by scarification at the base of the tail, as dee 'ibed in Example 8. The detection of the antibodies zcomplished by the "Western bLotting" technique. The F protein produced in E. coLi is transferred onto nitrocellulose, and strips are cut and incubated with the sera of the vaccinated animals (Figure 6a). The reaction observed is approxim-, ately 3 to 5 tines as strong for the VV.TG.FLAV.1165 recombinant as for the VV.TG.FLAV.1147 recombinant, and equivalent to that of the VV.TG.FLAV.11)6 recombinant (Figure 6b). However, th6 use of the VV.TG.FLAV.1165 recombinant is preferable, since the protein synthesized is fully recognized by antibodies of seropositive individuals, and its confirination is hence correct. The VV.TG.FLAV.1165 recombinant appears to be the best candidate for a vaccine against the F protein.

0 -j Deposition of strains representing the invention: The phage M13mp701 and plasmid pTG1134 are described, in Patent Application No. 86/05,043 of 8th April 1986.

Plasmid pJ19-6 was depos.ited on 16th November 1984 at the Collection Nationale de Cultures de Microorganismes 30 (National Collection of Microorganism Cultures) of the Institut Pasteur under No.366-I and is descFibed in British Patent No. 84/29,099.

The following strain was deposited on 6th June 1986 at the Collection Nationale de Cultures de Microorganismes (National Collection of Microorganism Cultures) of the Institut Pasteur: E. coli transformed by pTG1147 under No. 1-561.

-27-

REFERENCES

1. ALLan J.S. CoLigan Lee McLane M.F., Kanki Groopman J E. and Essex M. 1985) Science 230, 810-813.

2. Auffray C. (1986) C.R. Acad. Sc. Paris 302 series III, No. 8, 287-' 92, 3. Arya K.S. and GaLLo R.C. (1986) Proc. Nati. Acad.

Sci. USA 83, 2209-2213.

4. D r iLL ie n R a Od Spehne r D 1983 V iroLogy 13 1, 385-393 5. GouLd Woodgett Cooper 8uss J.E., ShaLLoway O.F. and Hunter T. CeLL 42, 849-857 (1985) 6. Guyader 11., Guerneau Sonigo CLaveL F., Montagnier L. and AL izon M. Nature 328, 662-669 1987).

7. Kieny Lathe R. and Lecocq 1983, Gene 26I 8. Kieny Lathe DriLL jen Spehner Skory S. Schmitt D Wiktor Koprawsk'i H. and Lecocq J.P.

(1984) Nature 312: 163-166.

9. l"a th e Hirth DewiLde Harford N. and Lecocq 1980, Nature 284 :473-474.

L at h E Kieny Schmitt Curtis P. and Lecocq J .P 1984) J. Mat. AppL. Genet., voL. 2, 331-342.

11 La t he R K ieny M P Skory and Lecocq J P 1984) DNA, voL. 3, 173-182.

12. Lusky M. and Botchan M. '(1981) Nature 293? 79-81.

13. Mackett M.0 Smith G.L. and Mcoss B. (1982) Proc, Nati.

Acad. Sci. USA 79 7415-7419.

14. Maniatis Fritsch E.F. ancd Sambrook J 19,92) CoLd Spring Harbor Lab. N.Y.

Muesing Smith CabradiLLa Benton C.V., 1A Lasky L.A. and Capon D.J. (1985) Nature 313 450-458.

16. Messing et Vieras, Gene 19, (1982) 269-276.

17. Nishlzoka (1986) Scicnce 233, 305-312.

18. Pan'icaLi D. and PaoLett-i E. (1982) Proc. Nati,. Acad.

Sci. USA 79 4927-4931.

19. ParticaLi Davis Weinberg R.L. and PaoLetti E.

(1983) Proc. Nati. Acad. Sci. USA 80, 5364-5368.

Ratner HaseLtine W, Patarca Livak K.J., 28- Starcich Josephs Doran RafaLski J.A., Whitehorn Baumeister Ivanoff Petterway JP. Pearson Lautenberger Papas T.S., Ghrayeb Chang GaLLo R.C. and Wong-StaaL F,.

(1985) 313 :277-284.

21. Ratner Stracich Joseph Hahn B.H., Reddy E.P. Livak Petterway Pearson M.L., HaseLtine Arya K.S. and Wong-StaaL F. (1985) NucLeic Acids Research, 13, 8219-8229.

22. Sanchez-Pescador et aL. (1985) Science, 227 :484-492.

23. Smith Mackett M. and Moss V. (1983) Nature 302 490-495.

24. Smith Murphy B.R. and Moss B. (1983) Proc. NatL.

Acad. Sci. USA 80', 7155-7159.

25. ULLrjch et aL. Nature 309 :418-425 (1984).

26. Venkatesan Baroudy S.M. and Moss B. (1981) CeLL 125 :805-813.

27. Wain-Hobson Sonigo Danos CoLe S. and ALizon M. (1985) CeLL 40 :9-17.

28. Weir Moss B. (1983) J. ViroL. 46 '/30-537.

29. Woodgett Gould K.L. and Hunter T. Eur. J. Biochem.

161 :177-184 (1986).

ZoLLer M.J. and Smith M. (19811) Methods in EnzymoLogy (Wu, Grossman, MoLdave, eds.),100 :468-500.

Claims

1. A viral vector for expressing protein F of the virus HIV responsible for AIDS which comprises at least: a portion of the genome of a poxvirus and, a DNA fragment which comprises a sequence encoding protein F of the virus responsible for AIDS placed under appropriate transcriptional and translational control elements.

2. A viral vector according to claim 1 in which the portion of the genome of a poxvirus is a portion of the genome of a vaccinia virus.

3. A viral vector according to claim 1 or 2 in which the DNA fragment also comprises a sequence encoding a signal peptide and a sequence encoding a transmembrane peptide.

4. A viral vector according to any one of claims 1 to 3 in which the DNA fragment comprises from the 5' end: the signal sequence encoding the signal peptide of the rabies virus glycoprotein, the sequence encoding F of the virus responsible for AIDS and, the signal sequence encoding the transmembrane peptide of I I .11 i-~j the rabies virus glycoprotein.

A viral vector according to any one of claims 2 to 4 in which the DNA fragment is placed under the control of the promoter of the gene encoding protein 7.5K of a vaccinia virus.

6. A viral vector according to claim 5 in which the DNA mwspe/trans3 91 7 3 T,2"4iz CZ, r I F 30 fragment comprising a sequence encoding protein F of the virus responsible for AIDS, under the control of the promoter of the gene encoding protein 7.5K of a vaccinia virus, is inserted into the TK gene of a vaccinia virus.

7. A culture of mammalian cells infected with a viral vector according to any one of claims 1 to 6.

8. A method of producing protein F of the virus responsible for AIDS which comprises: a) infecting mammalian cells with a viral vector according to any one of claims 1 to 6. b) culturing infected mammalian cells and, c) recovering protein F from the cell culture by standard techniques.

9. Protein F as produced by the process according to claim *94~ *r 8.

10. Protein terminal end

11. Protein F according to claim 9 which is linked at its C- to a transmembrane peptide. F according to claim 9 which is linked at its N- terminal end to a signal peptide and at its a transmembrane peptide.

12. A viral vector according to any one substantially as hereinbefore described.

13. A culture according to claim 7 hereinbefore described.

14. A method according to claim 8 hereinbefore described. Protein F according to any one of mwspe/trans3 C-terminal end to of claims 1 to 6 substantially substantially as claims 9 to 11 91 7 3 31 substantially as hereinbefore described. DATED this 3 July 1991 CARTER SNITH BEADLE Fellows Institute of Patent Attorneys of Australia Patent Attorneys for the Applicant: TRINSGENE S.A. .6.6 6* 6*6 S 6 **S 6*6S** 6656 S S S *6 6 665 awspe/trans3 91 7 3