DK175573B1 - Use of an expression cassette leading to biochemical oxidation of steroids, such expression cassettes, - Google Patents

Abstract

Genetically engineered host cells containing new expression cassettes are provided which are able to carry out biochemical oxidations of steroids. In particular the oxidation is carried out with cells into which DNA has been introduced which encodes protein involved in the biological pathway of cholesterol to hydrocortisone. Suited host cells comprise species of $i(Bacillus), $i(Saccharomyces) or $i(Kluyveromyces). The new host cells are suited for microbiological oxidations of cholesterol, pregnenolone, progesterone, 17$g(a)-hydroxy-progesterone, and cortexolone, which are intermediates in said biological pathway. The new expression cassettes are also useful in the ultimate production of a multigenic system for a one-step conversion of cholesterol into hydrocortisone.

Description

DK 175573 B1 i

The invention relates to the use of an expression cassette in multigenic systems for carrying out multistage conversions as shown in Figure 1 of the accompanying drawing, wherein the expression cassette may function in a non-mammalian recombinant host. Furthermore, the invention relates to an expression cassette which may function in a non-mammalian recombinant host comprising a heterologous DNA encoding a protein that functions alone or in association with one or more additional proteins by catalyzing an oxidation step in the biological reaction pathway to convert hydrocortisone cholesterol, and such an expression cassette encoding at least two proteins that function alone or in association with one or more additional proteins by catalyzing at least two such oxidation steps. Further, the invention relates to a recombinant host cell and its progeny comprising cells of microorganisms, plants or animals and containing an expression cassette of heterologous DNA and a variety of methods, namely to prepare a mixture of endogenous proteins by means of a recombinant cell in a nutrient under such conditions. conditions that the enzymes can be formed and accumulate in the culture; for selective biochemical oxidation in vitro, including incubating the compound to be oxidized, in the presence of one or more proteins under conditions allowing this oxidation and an accumulation of the oxidized compound formed in the culture fluid, after which the oxidized compound is recovered; and finally, to oxidize a selected compound comprising culturing recombinant cells in the presence of the selected compound under conditions whereby the desired oxidation occurs and the oxidized compound accumulates in the culture fluid, after which the oxidized compound is recovered.

11β, 17a, 21-Trihydroxy-4-pregnen-3,20-dione (hydrocortisone) is an important pharmaceutical steroid which is used because of its pharmacological properties as a corticosteroid and as a starting compound for the preparation of several useful steroids, in particular other corticosteroids. Hydrocortisone is produced in the adrenal cortex of vertebrates and was initially obtained in 10 small amounts by a cumbersome extraction from adrenal cortex tissue. New production paths could only be developed after clarification of the structure, which consisted of a combination of steps of chemical synthesis and microbial transformations. The currently available process only provides a cheaper product because the starting compounds such as sterols, bile acids and sapogenins are readily available and inexpensive, but the process is still rather complicated. Several opportunities have been tried to improve the current processes and 20 also tried biochemical pathways.

In one experiment, an appropriate starting steroid was to be converted into an in vitro biochemical system using the isolated adrenal cortex proteins known to be responsible for the in vivo enzymatic conversion of steroids to hydrocortisone. However, the cumbersome isolation of the proteins and the high cost of the necessary cofactors appeared to be prohibitive for a large-scale economically attractive process, in another experiment one had to keep the catalyzing proteins 30 in their natural environment and allow the adrenal cortex cells to produce the desired hydrocortisone in a cell culture. However, in practice, it seemed impossible due to the low produtivity of the cells to make such a biochemical process economically attractive.

DK 175573 B1 3

The in vivo process in the adrenal cortex of mammals and other vertebrates represents a biochemical pathway that begins with cholesterol and eventually leads to hydrocortisone over various intermediates (see Figure 1).

Five eight proteins are directly involved in this pathway, five of which are enzymes, including four cytochrome P450 enzymes and the other three are electron transferring proteins.

The first step is the conversion of cholesterol 10 to 33-hydroxy-5-pregnen-20-one (pregnenolone). In this transformation, a monooxygenase reaction, three proteins are involved; side chain cleavage enzyme (P45QSCC, a heme Fe-containing protein), adrenodoxin (ADX, a Fe2S2-containing protein) and adrenodoxin reductase (ADR, a FAD-containing protein). In addition to cholesterol as a substrate, the reaction requires additional molecular oxygen and NADPH.

In the following, pregnenolone by dehydrogenation / isomerization is converted to 4-pregnen-3,20-dione (progesterone).

This reaction, catalyzed by protein 3β-hydroxysteroid dehydrogenase / isomerase (3β-HSD), requires pregnenolone and NAD +.

To obtain hydrocortisone, progesterone is then hydroxylated at three positions, these 25 conversions being catalyzed by monooxygenases. When converting progesterone to 17α-hydroxyprogesterone, two proteins are involved; steroid 17a-hydroxylase (P450-17a ^ a heme Fe-containing protein) and NADPH cytochrome P45q reductase (RED, a FAD- and FMN-containing protein). At the reaction, progesterone, molecular oxygen and NADPH are consumed.

For the conversion of 17α-hydroxyprogesterone to 17α, 2β-dihydroxy-4-pregnen-3,20-dione (cortexolone), two proteins are also required: steroid-2β-hydroxylase (P450C2i, a heme-Fe containing protein) and the above protein RED. In the reaction, 17α-hydroxyprogesterone, molecular oxygen and NADPH are consumed.

5 In the conversion of cortexolone to hydrocortisone, three proteins are involved: steroid Ιΐβ-hydroxylase (Ρ45011β, a heme-Fe-containing protein) and the aforementioned proteins ADX and ADR.

As described above, cytochrome P45Q proteins are enzymes essential for the biochemical conversion of cholesterol to hydrocortisone. These enzymes belong to a larger group of cytochrome P450 proteins (or short P450 proteins). These have been found in prokaryotes (various bacteria) and eukaryotes 15 (yeasts, molds, plants and animals). In mammals, a high level of P450 proteins is found in adrenal cortex, ovaries, testes and liver.

Many of these proteins have now been purified and well characterized, and their specific activity has been determined. In recent years, a number of review articles on this have been published, such as K. Ruckpaul and H. Rein (eds), "Cytochrome P450" and P.R.

Ortiz de Montellano (ed.) "Cytochrome P45q structure, mechanism and biochemistry". Cytochrome P45Q proteins 25 are characterized by their specific absorbance maxima at 450 nm after reduction with carbon monoxide. In prokaryotic organisms, the P450 proteins are either bound to membranes or are cytoplasmic. As far as detailed studies of bacterial Ρ450 proteins 30 (e.g., P450meg and P450cam) have been shown, a ferredoxin and a ferredoxin reductase have been implicated in the hydroxylating activity. Regarding eukaryotic organisms, two types of P450 proteins I and II are described. The two differences between these are: 1 In the case of subcellular localization, type I is located in the microsomal fraction and type II is located in the inner membrane of mitochondria; 2. As to the way in which electrons are transferred to the 50450 protein, type I will be reduced by NADPH via a P450 reductase, whereas type II will be reduced by NADPH via a ferredoxin reductase (e.g., adrenodoxin reductase) and a ferredoxin. (e.g., adrenodoxin).

According to EP-A-0281245, cytochrome 10 P450 enzymes from Streptomyces species can be prepared and used for hydroxylation of chemical compounds.

The enzymes are used in isolated form, which is a rather complicated and expensive procedure.

JP-A-62236485 (Derwent 87-331234) teaches us that it is possible to introduce genes from liver cytochrome P450 enzymes into Saccharomyces cerevisiae and to express them to obtain enzymes that can be used for their oxidizing activity.

However, in the above references there is no reference to the use of cytochrome P450 enzymes for the preparation of steroid compounds.

The invention provides a wide variety of expression cassettes for the production of proteins necessary for the construction of a multigene system for one step conversion of cheap steroid starting materials into rarer and more expensive end products, such conversion being performed in native systems by a variety of enzyme catalyzed and cofactor mediated conversions. , such as the production of hydrocortisone from 30 cholesterol. The expression cassettes of the invention are useful in the final production of multigene systems for performing these multistage conversions.

Accordingly, the above-defined use of an expression cassette is peculiar in that the expression cassette comprises a heterologous DNA coding sequence encoding a protein, acting alone or in cooperation with one or more additional proteins by catalyzing an oxidation step 5 of the biological conversion pathway from cholesterol to hydrocortisone, where this step is selected from the conversion of cholesterol to pregnelonone; conversion of pregnenolone to progesterone; conversion of progesterone to 17 '<- hydroxyprogesterone; conversion of 17o (-hydroxy-10 progesterone to cortexolone; and conversion of cortexolone to hydroxycortisone; and the host effective control sequences. The expression cassettes of the invention comprising DNA or at least two proteins catalyzing one or at least two oxidation steps, respectively, are peculiar in that this / this oxidation step is selected from the conversion of cholesterol to pregnelonone; conversion of pregnenolone to progesterone; conversion of progesterone to 17? c-hydroxy-progesterone; conversion of 17c * -hydroxyprogesterone 20 to cortexolone; and conversion to The recombinant host cell or progeny thereof according to the invention is characterized in that the expression cassette is one according to the invention, and finally the three mentioned methods according to the invention are characterized by the first and third methods. that they utilize a recombinant weather cell in accordance with the invention, and in other cases by utilizing a protein prepared by the former method.

30 7 DK 175573 B1

BRIEF DESCRIPTION OF THE DRAWING

The following abbreviations are used in all figures: R-L, EcoRI; H, HindIII; Sc, Seal; P, PstI; K, Kpnl; St, 5 Chair; Sp, SphI; X, Xba; N, Ndel; S, Narrow; Ss, SstI;

Ry, EcoRV; S-j-, SacI; B, Bam HI; Sj, SacII; Sal, Sall;

Xh, Xhol; Pv, PvuII; Bg, Bglll and M, Mlul.

Figure 1 shows a schematic overview of the proteins involved in the steps in succession during the conversion of cholesterol to hydrocortisone as it occurs in the adrenal cortex of mammals.

Figure 2 shows the construction of plasmid pGBSCC-1. The P450SCC sequences are seen in a square () ·

Figure 3 shows the insertion of a synthetically derived PstI / HindIII fragment containing the S'-P1qSCC sequences into the plasmid pTZ18R to obtain the plasmid pTZ synlead.

Figure 4 shows the construction of a full-length p450SCCcDNA of synthetic (1, ..-, ..-1) and cDNA cloning 20 (W // Å) obtained P450SCC sequences in pTZ18R to obtain pGBSCC-2.

Figure 5 shows the complete nucleotide sequence of the plasmid pBHA-i.

Figure 6 is a schematic representation of the construction of pGBSCC-3. P450SCCcDNA sequences from plasmid pGBSCC-2 were introduced into Baclllus / E. coll., the transfer plasmid pBHA-1. Filled squares are as explained in Figure 4.

Figure 7 shows the introduction of an Nde I restriction site in combination with an ATG startodon before the P45oSCC maturation site in pGBSCC-3 to obtain pGBSCC-4.

8 DK 175573 B1

Figure 8 shows a physical view of pGBSCC-5 obtained by removing E.coll sequences from plasmid pGBSCC-4.

Figure 9 shows a Western blot analyzed with antibodies to p4cjqSCC demonstrating the P450SCC expression of plasmid pGBSCC-5 introduced into B ♦ subtllls (lane c) and B. lichenlformis (lane f). Control extracts from B. subtilis and B. lichenlformis are also seen in lanes a and d, respectively. For comparative reasons, 30 ng of purified P450SCC from adrenal bark was also added to these control extracts (lane b and lane e, respectively).

Figure 10 is a schematic representation of the construction of pGBSCC-17. The coding P45qSCC DNA sequences from plasmid pGBSCC-4 were introduced into the E.coll 15 expression vector pTZ1BRN. The P450SCC sequences are seen in a square {& 77Z \) ·

Figure 11 shows the P450SCC expression of pGBSCC-17 in E. coil JM101.

(a) SDS / PAGE and Coomassie brilliant blue staining 20 of the cell protein fractions (20μ1) prepared from the E. coll control strain (lane 3) and E. coll transformants SCC-301 and 302 (lane 1 and lane 2, respectively). By comparison, 400 ng of purified bovine P45QSCC (male 4) is shown.

(B) Western blot analysis analyzed with anti-P450SCC antibodies from cell protein fractions (5μ1) prepared by the control strain E. coli JM101 (lane 2) and by the E. coll transformants SCC-301 (lane 3} and SCC-302 (lane 4) 100 ng of purified bovine P450SCC (lane 30 i) are shown for comparison.

Figure 12 shows the construction of plasmid PUCG418.

Figure 13 shows the construction of the yeast expression vector pGB950 by inserting the promoter and the multiple cloning site (pgjW) terminator from lactase into puCG418. To derive pGBSCC-6, a synthetic Sall / Xhol fragment containing an ATG start codon and the codons for the first 8 amino acids of 5 P450SCC 1 PGB950 * are inserted

Figure 14 is a schematic representation showing the construction of the yeast P450SCC expression cassette pGBSCC-7.

Figure 15 shows a Western blot assayed with antibodies specific for the protein β qSCC.

Blot A contains extracts derived from Saccharomyces cerevlsiae 273-10B transformed with pGBSCC-10 (lane 1); from S. cerevislae 273-10B as control (lane 2); from Kluyveromyces lactls CBS 2360 transformed with 15 pGBSCC-7 (lane 3) and from K. lactls CBS 2360 as control (lane 4).

Blot B contains extracts derived from K. lactls CBS 2360 as control (lane 1) and K ♦ lactls CBS 2360 transformed with pGBSCC-15 (lane 2), with pGBSCC-12 20 (lane 3) or with pGBSCC-7 (lane 4) ).

Blot C contains extracts derived from S. cerevislae 273-10B as control (lane 1), transformed with pGBSCC-16 (lane 2) or with pGBSCC-13 (lane 3).

Figure 16 is a schematic representation of the construction of the yeast expression vector pGBSCC-9 containing the isocytochrome Cl (cyc-1) promoter of S. cerevislae.

Figure 17 shows a construction diagram of the P450SCCcDNA containing expression vector pGBSCC-10 to S. cerevislae.

Figure 18 shows the construction of the P450SCC expression vector pGBSCC-12, in which a synthetically derived DNA fragment encoding the pre-P450SCC sequence, is inserted 5 'positioned for the mature P450SCC coding sequence.

Figure 19 shows the construction of pGBSCC-13. This P4cjqSCC expression cassette for S. cerevlsiae contains the pre-P45cSCCcDNA sequence located at the 3 'position of the cyc-1 promoter from S. cerevisiae.

Figure 20 shows a schematic representation of the construction of plasmids pGBSCC-14 and pGBSCC-15.

The latter contains the P45QSCC coding sequence 10 in the frame with the cytochrome oxidase VI precursor).

Figure 21 shows the construction of the plasmid pGBSCC-16. In this plasmid, the cytochrome oxidase VI precursor (VΔ / Ά) of S. cerevisiae joined to the coding P45qSCC sequence is positioned 3 'relative to the cyc-1 promoter.

Figure 22 shows physical mappings of the plasmids pGB17a-1 (A) and pGB17a-2 (B) containing the 3 'positioned 1.4 kb fragment and the 5' positioned 345 bp fragment (Eggsg) of P45q17cicDNA, respectively. In the 20 pGB17a-3 (C) containing the full-length P45017acDNA sequence, the position of the ATG start codon is indicated.

Figure 23 shows the mutation of pGB17a-3 by in vitro mutagenesis. The resulting plasmid pGB177-4 contains a SalI restriction site followed by optimal 25 yeast translation signals just upstream of the ATG initiation codon.

Figure 24 is a schematic overview of the construction of the yeast Ρ45ο17α expression cassette pGBl7a-5.

Figure 25 shows the mutation of pGB17a-3 by in vitro mutagenesis. The resulting plasmid pGB17a-6 contains an NdeI restriction site at the ATG initiation codon.

Figure 26 is a schematic representation of the construction of pGB17a-7. P45Q17acDNA sequences from 11 DK 175573 B1 plasmid pGB17a-6 were introduced into Bacillus / E. coli transfer plasmid pBHA-1.

Figure 27 shows a physical representation of pGB17a-8 obtained by removing E. coli sequences from the plasmid pGB17a-7.

Figure 28 shows physical mappings of pGBC2-1 and 2 containing a 1.53 Kb 3'-P450C21cDNA and a 540 bp 5'-P450C21cDNA EcoRI fragment, respectively, in the EcoRI site of the cloning vector pTZ18R.

Figure 29 shows in vitro mutagenesis by polymerase chain reaction (PCR) of pGBC21-2 to introduce EcoRV and Ndel restriction sites upstream of the P45qC21 ATG initiation codon followed by molecular cloning in the cloning vector pSP73 to obtain pGBC2-1-3.

Figure 30 is a schematic overview of the construction of pGBC21-4 containing the full-length P4gQC2lcDNA sequence.

Figure 31 is a schematic representation of the construction of pGBC21-5. The p450C21cdna sequence from plasmid pGBC21-4 was introduced into Bacillus / E. coli transfer plasmid pBHA-1.

Figure 32 shows a physical depiction of pGBC21-6 obtained by removing E. coli sequences from the plasmid pGBC2-1-5.

Figure 33 shows the mutation of pGBC21-2 by in vitro mutagenesis. The resulting plasmid pGBC21-7 contains a SalI restriction site followed by optimal yeast translation signals just upstream of the ATG initiation codon.

Figure 34 represents the construct of pGBC21-8 containing full-length P45qC21cDNA with modified flanking restriction sites suitable for cloning in the yeast expression vector.

12 DK 175573 B1

Figure 35 is a schematic representation showing construction of the yeast P450C21 expression cassette pGBC21-9.

Figure 36 shows in vitro mutagenesis by polymerase-5 chain reaction of pGBlip-1 to introduce appropriate flanking restriction sites and an ATG initiation codon on the full-length P45Q11pcDNA sequence followed by molecular cloning in Bacillus / E. coll transfer vector pBHA-1 to obtain the plasmid pGB113-2.

Figure 37 shows in vitro mutagenesis by polymerase chain reaction of pGBlip-1 to introduce appropriate flanking restriction sites and an ATG initiation codon on the full-length p45q11 £ cDNA sequence, followed by molecular cloning in the yeast expression vector pGB950 to obtain plasmid pGBllp-4.

Figure 38 is a schematic overview of the molecular cloning of the ADXcDNA sequence from a bovine adrenal cortex polyA + RNA / cDNA mixture by the polymerase chain reaction. The cDNA sequence encoding the mature ADX protein was inserted into appropriate sites on the yeast expression vector pGB95Q to obtain the plasmid pGBADX-1.

Figure 39 shows a Western blot analyzed with antibodies to ADX and demonstrates the ADX expression of plasmid pGBADX-1 in K. lactl's CBS 2360 transformants ADX-101 and 102 (lanes 4 and 5, respectively). Extracts of the control strain K. lactis CBS 2360 are seen in lane 3. For comparison reasons, 100 ng of purified adrenal cortex ADX has also been added to the gel in lane.

00 Figure 40 shows in vitro mutagenesis by polymerase chain reaction of pGBADR-1 to introduce appropriate flanking restriction sites and an ATG initiation codon on the full-length ADRcDNA sequence followed by molecular cloning in the yeast expression vector pGB950 to obtain pGBADR 2nd

The invention comprises the preparation and cultivation of cells suitable for use in large-scale biochemical production reactors and the use of these cells for the oxidation of compounds and in particular for the production of steroids as shown in FIG. 1. Each of the depicted reactions can be carried out separately and the substitution of the steps of a multistage reaction is included.

Microorganisms are preferred hosts, but other cells such as cells from plants or animals may also be used, optionally in a cell culture or in the tissue of living transgenic plants or animals.

The cells of the invention are obtained by genetic transformation of suitable receptor cells, preferably cells of suitable microorganisms, with vectors containing DNA sequences encoding proteins involved in the conversion of cholesterol to hydrocortisone, comprising side chain cleavage enzyme (P450SCC), adrenodoxin 20 (ADX), adrenodoxin reductase (ADR), 3β-hydroxysteroid dehydrogenase / isomerase (3β-HSD), steroid-17α-hydroxyase (P45017a), NADPH cytochrome P450 reductase (RED), steroid-21-hydroxylase (P45qC21), and steroid-lip-hydro -xylase (Ρ45011β). Certain host cells may already be able to produce one or more of the necessary proteins themselves at a sufficient level and must therefore only be transformed with supplemental DNA sequences. Such possible own proteins are ferredoxin, ferredoxin reductase, P45g reductase and 3β-hydroxysteroid dehydrogenase / isomerase.

For the extraction of sequences encoding proteins involved in the conversion of cholesterol to hydrocortisone, appropriate DNA sources have been selected.

14 DK 175573 B1

A suitable source of DNA extraction encoding all proteins involved in the conversion of cholesterol to hydrocortisone is vertebrate adrenal tissue, e.g. bovine adrenal tissue. It is also possible to recover relevant DNA from various microorganisms, e.g. from Pseudomonas testosterone !, Streptomyces qriseocar-neus or Brevlbacterium sterollcum for DNA encoding 3β-Ι ^ Γθχγε1βΓθ1ά dehydrogenase / isomerase, and from Curvularia lunata or Cunninghatnella blakesleeana 10 for DNA encoding γ-protein-encoding proteins cortexolone. DNA sequences encoding the proteins bovine P450SCC, bovine P45qH3 or a microbial equivalent protein, bovine adrenodoxin, bovine adenotoxin reductase, 33-hydroxysteroid dehydrogenase / 15 isomerase of bovine or microbial origin, bovine ov45θ17α, Povine Ρ45θ17α of bovine or microbial origin were isolated by the following steps: 1 2 3 4 5 6 7 8 9 10 11 1. Eukaryotic Sequences (cDNAs) 2 a. Total RNA was prepared from appropriate tissue.

3 b. PolyA + containing RNA was transcribed into 4 double-stranded cDNA and ligated into bacteriophage vectors.

6 c. The obtained cDNA library was searched with 7 32 P-labeled oligomers specific for 8 the desired cDNA or by scanning a 9 isopropyl β-D-thiogalactopyranoside (IPTG) -induced λ-gtll cDNA library. 11 of a specific (125 I-labeled) antibody.

15 DK 175573 B1 <3. CDNA inserts of positive plaque-forming units (pfu's) were inserted into appropriate vectors to determine the full length of cDNA by nucleotide sequence division.

2. Prokaryotic genes a. Genomic DNA was prepared from a suitable microorganism.

b. To obtain a DNA library, DNA fragments were cloned into appropriate vectors and transformed into a suitable coli host.

c. This DNA library was searched for with 32β-labeled oligomers specific for the relevant gene, or an IPTG-induced λ-gtll DNA library was searched using a specific (125I-labeled) antibody.

d. Plasmids were isolated from positive colonies and subcloned into the inserted DNA fragments into appropriate vectors to determine the full length of the gene.

Note: According to an improved method, the particular cDNA (eukaryotic sequences) or gene (prokaryotic sequences) were multiplied using two specific oligomers by the method known as the polymerase chain reaction (PCR) (Saiki et al. Science, 239, 487-491, 1988). Then the amplified cDNA or DNA was inserted into the appropriate vectors.

In one aspect of the invention, suitable expression cassettes are provided in which the heterologous DNA isolated by the method described above is arranged between appropriate control sequences for transcription and translation, allowing DNA

16 DK 175573 B1 can be expressed in the cells of a suitable host to obtain the desired protein or proteins. Optionally, the initiation control sequences may be followed by a secretion signal sequence.

Suitable control sequences must be introduced together with the structural DNA by means of the above expression cassettes. Expression is made possible by transforming a suitable host cell with a vector containing control sequences compatible with this host and operatively linked to the coding sequences for which expression is desired.

Alternatively, suitable control sequences found in the host genome may be used. Expression is made possible by transforming a suitable host cell with a vector containing coding sequences for the desired protein flanked by host sequences that allow homologous recombination with the host genome in a way that the host control sequences properly control the expression of the introduced DNA.

As is generally understood, the term control sequences include all DNA segments necessary to properly regulate the expression of the coding sequence to which they are operatively linked, such as operators, enhancers and, in particular, promoters and sequences which controls the translation.

The promoter may or may not be controllable by environmental influences. Suitable promoters from prokaryotes include, e.g. the trp promoter (inducible by tryptophan starvation), the lac promoter 30 (inducible by galactose analogue IPTG), the β-lactamase promoter and the phage-derived PL promoter (inducible by temperature variation). In addition, useful promoters, especially for expression in Bacillus, include those for α1-amylase, protease, Spo2, spac and 0/105 as well as synthetic promoter sequences. A preferred promoter is one as depicted in FIG. 5 and designated "Hpall". Suitable promoters for expression in yeast include the 3-phospho-glycerate kinase promoter and those for other glycolytic enzymes as well as promoters for alcohol dehydrogenase and yeast phosphatase. Furthermore, promoters for transcriptional extension factor (TEF) and lactase are also suitable. Mammalian expression systems usually employ promoters derived from viruses such as adenovirus promoters and SV40 promoters, but they also include regulators such as the heavy metal metallothionine promoter or glycocorticoid concentration. Viral insect cell expression systems are currently also considered suitable as well as expression systems based on plant cell promoters such as nopaline synthetase promoters.

Translation control sequences include a ribo-binding site (RBS) in prokaryotic systems, whereas translation into eukaryotic systems may be controlled by a nucleotide sequence containing an initiation codon such as AUG.

In addition to the necessary promoter and translation control sequences, a number of other control sequences, including those that regulate termination (e.g., to obtain polyadenylation sequences in eukaryotic systems), can be used to control expression. Certain systems contain reinforcing elements that may be beneficial, but most often not mandatory, to achieve expression.

The invention further discloses expression cassettes containing a further heterologous coding sequence encoding an enzyme that alone or in collaboration with one or more additional proteins catalyzes a second step in the reaction pathway of Figure 1.

In particular, a group of vectors called pGBSCC-n, wherein "n" is any integer between 1 and 17, has been developed for DNA encoding the P450SCC enzyme.

Another group of vectors, designated pGB17a-n, wherein "n" is any integer between 1 and 5, has been specifically developed for DNA encoding P45017ct an ~ zymet.

A further group of vectors designated pGBC21-n, where "n" is any integer between 1 and 9, has been specifically developed for DNA encoding the P450C21 enzyme.

A further group of vectors designated 15 pGBIIIp-n, wherein "n" is any integer between 1 and 4, has been specifically developed for DNA encoding the Ρ45011β enzyme.

According to a further aspect of the invention, suitable host cells have been selected which accept 20 vectors of the invention and allow the introduced DNA to be expressed. When culturing the transformed host cells, the proteins involved in the conversion of cholesterol to hydrocortisone are found in the cell contents. One can detect the presence of the desired DNA by DNA hybridization methods, its transcription by RNA hybridization, its expression by immunological assays, and its activity by ascertaining the presence of oxidized products after incubation with the starting compound in 30 vitro or in vivo.

Transformed microorganisms are preferred hosts, especially bacteria (more preferably Escherichia col i and Bacillus and Streptomyces species) and yeast species DK 175573 B1 19 (such as Saccharomyces and Kluyveromyces ♦) Other suitable host organisms are found among plants and animals including insects from which they are used. isolated cells in a cell culture, such as COS cells, C ^ 27 cells, 5 CHO cells, and Spodoptera frupplperda (Sfg) cells. Alternatively, a transgenic plant or animal may be used.

A particular type of recombinant host cells are those in which two or more expression cassettes 10 of the invention have been introduced, such as pGBSCC / ADX-1, or which have been transformed with an expression cassette encoding at least two heterologous proteins, allowing the cell to produce at least two proteins involved in the reaction pathway of FIG. First

An important feature of the invention is that the novel cells produced are not only capable of producing proteins involved in the oxidative conversion of steroids that eventually lead to hydrocortisone, but also to utilize these proteins. instead of the desired oxidative conversion of the corresponding substrate compound added to the culture liquid. Steroids are preferred substrates. The cells transformed with heterologous DNA are particularly suitable for culturing with the steroids mentioned in FIG. 1, including other sterols, such as β-cortosterol. As a result, oxidized steroids are obtained.

Depending on the presence in the host cell of different heterologous DNA encoding proteins involved in the reaction pathway of FIG. 1, several biochemical conversions are possible including side chain cleavage of a sterol and / or oxidative modifications on C11, C17, C3 and C21. For this reason, the expression cassettes of the invention are useful in constructing a multigenic system capable of performing successive intracellular transformations of the many steps of the sequence shown in FIG. l. It may be necessary to insert expression cassettes into the desired host, which together encode 5 the desired proteins. In some cases, one or more of the proteins involved in the reaction pathway may already be present in the host as a natural protein that exerts the same activity. Eg. ferredoxin, ferredoxin reductase and P450 reductase 10 may already be present in the host. In these circumstances, only the remaining enzymes must be provided by recombinant transformation.

As an alternative to biochemical conversions in vivo, the proteins involved in converting cholesterol to hydrocortisone are collected, purified as needed and used for in vitro conversion of steroids into a cell-free system, e.g. immobilized on a column. Alternatively, the more or less purified mixture containing one or more enzymes for the pathway as such can be used for the steroid conversion. An example of a host contains DNA encoding two heterologous proteins, namely the enzyme P450SCC and the protein ADX needed for the production of pregnenolone. When compared to a host of only P450SCC DNA, the yield of pregnenolone in a cell-free extract after the addition of ADR, NADPH and cholesterol is significantly improved.

The invention provides expression cassettes necessary for constructing a one-step production process for several useful steroids.

Starting from cheap and readily available starting compounds, it is particularly suitable for the production of hydrocortisone and intermediate compounds. The invention makes the traditional costly chemical reactions obsolete. The intermediates do not need to be isolated. Apart from the new host cells, the very processes used to grow these cells by the steroid conversions are analogous to biotechnological processes which are well known.

The invention is further illustrated by the following examples.

Example 1

Molecular cloning of a full-length cDNA encoding the bovine cytochrome P450 side chain cleavage enzyme (P450SCC).

General cloning techniques as well as DNA and RNA assays have been used as described in the manual of T. Maniatis et al., Molecular Cloning, Cold Spring Harbor Laboratory, 1982. Unless otherwise indicated, all DNA modifying enzymes, molecular cloning agents, were used. coli and E. coli strains obtained commercially and used using the manufacturer's instructions. Materials and apparatus for separating and purifying DNA and RNA were used, following the manufacturer's instructions.

Adrenal bark tissues of bovine kidney free bovine kidneys were prepared which were frozen in liquid nitrogen.

ISLAND

gene and stored at -80 C.

From this frozen bovine adrenal cortex, total cellular RNA was prepared as described by Auffrey 30 µg Rougeon (Eur. J. Biochem. 107, 303-314, 1980). Adrenal poly A + RNA was obtained by heating the total RNA sample to 65 ° C before polyA selection on oligo (dT) chromatography.

B1 DNAs complementary to polyA + RNA from bovine adrenal cortex were synthesized as follows:

10 µg of polyA + RNA treated with methylmercury hydroxide was neutralized with β-mercaptoethanol. This mixture was adjusted to 50 mM Tris / HCl (pH 8.3 at

42 ° C), 40 mM KCl, 6 mM MgCl 2, 10 mM DTT, 3000 U

RNasin / ml, 4 mM Na4P207, 50 µg actinomycin D / ml, 0.1 mg

oligo (dT12_18) / ml, 0.5 mM dATP, 0.5 mM dTTP, 0.25 mM

dCTP and 400 µCi α 32 P-dCTP / ml, all in a final volume of 10 100 µl. The mixture was kept on ice for 10 min, heated for 2 min to 42 ° C and synthesis started by adding 150 U AMV reverse transcriptase (Anglian Biotechnology Ltd.); incubation was performed for 1 hour at 42 ° C.

Synthesis of the second strand was performed, adding DNA polymerase and RNase H according to Gubier and Hoffman (Gene, 25, 263-269, 1983). After treatment of ds DNA with T4 DNA polymerase (BRL) to obtain blunt ends, the EcoRI linkers 20 (Biolabs Inc.) were ligated to the ds DNA fragments. After digestion with EcoRI (Boehringer), double-stranded DNA fragments were separated from the many EcoRI linkers by Biogel AIS m (Bio-Rad) chromatography. Approximately 200 ng of EcoRI linker containing double stranded cDNA with 10 µg EcoRI digested and calf phosphate (Boehringer) treated λ-gtll vector DNA (Promega) was ligated using T4 DNA ligase (Boehringer) as described by Huynh et al. (In: "DNA cloning techniques: A practical approach", pages 49-78, Oxford IRL press, 1985). Phages obtained after in vitro packaging of the ligation mixture were used to infect the coli Y1090 host {Promega).

From this cDNA library, approximately 106 plaque-forming units (pfu's) were searched with a 32P end-marker synthetic oligomer SCC-1 (5'-GGC TGA CGA AGT CCT GAG ACA CTG GAT TCA GCA CTGG-3 ) specific for bovine P450SCC DNA sequences as described by Morohashi et al.

(Proc. Natl. Acad. Sci. USA, 81, 4647-4651, 1984). Six hybridizing PFUs were obtained and further purified by two further series of infection, flattening and hybridization. The P450SCCcDNA EcoR1 inserts were subcloned into the EcoRI site of pTZ18R (Pharmacia). The clone pGBSCC-1 (Figure 2), containing 10 the largest EcoRI insert (1.4 kb) derived from the λ-gtil SCC-54 clone, was further analyzed by restriction enzyme mapping and sequence breakdown.

Sequence data revealed that the pGBSCC-1 EcoRI insert was identical to the nucleotide sequence of 15 sCCcDNA between positions 251 and 1824 on the P450SCCcDNA map, as described by Morohashi et al.

The remaining 5'-P450SCCcDNA nucleotides were synthetically derived by cloning a 177 bp Pst / HindIII fragment at the appropriate sites on pTZ18R to obtain 20 pTZ / synlead as shown in Figure 3, which in addition to the nucleotides encoding it mature P450SCC protein from positions 118 to 273 as disclosed by Morohashi et al., further contained restriction sites for Seal, Avr11 and Stul without affecting the calculated amino acid sequence 25 of the P450scc protein.

Full length P45qSCCcDNA was constructed by molecular cloning in E.coll JM101 (ATCC 33876) of a ligation mixture containing the 1372 bp HindIII / KpnI pGBSCC-1 fragment, the 177 bp 30 pst / HindIII pTZ / synlead fragment and pTZ19R DNA digested with PstI and KpnI.

The plasmid obtained, pGBSCC-2, which contained all the nucleotide sequences encoding the mature bovine, is shown in Figure 4.

Example 2 Construction, transformation and expression of P450SCC in the bacterial host Bacillus subtills.

To obtain expression of cytochrome p450scc in a Bacillus host, P450SCCcDNA sequences 10 were transferred to an E.coll / Baclllus transfer vector pBHA-1.

Figure 5 shows the nucleotide sequence of the transfer plasmid pBHA-1. The plasmid consists of positions 11-105 and 121-215: bacteriophage FD terminator (double); positions 221-307: a portion of plasmid pBR322 (namely, positions 2069-2153); positions 313-768: baked riophage F1, replication origo (namely positions 5482-5943); positions 772-2571: a portion of plasmid pBR322, namely, replication origins and the β-lactamase gene; positions 2572-2685: transposon TN903, complete gene; positions 2719-2772: tryptophan terminator (double); positions 2773-3729: transposon Tn9, the chloramphenicol acetyltransferase gene. The nucleotides at positions 3005 (A), 3038 (C), 3302 (A) and 3409 (A) differ from the wild-type cat coding sequence. These 25 mutations were introduced to eliminate NcoI, Ball,

EcoRI and PvuII sites: Positions 3730-3804: multiple cloning site; positions 3807-7264: a portion of plasmid pUBHO containing Bacillus "Hpall" promoter, the replication function and kanamycin resistance gene 30 (EcoRI-PvuII fragment) McKenzie et al., Plasmid 15, 93-103, 1986 and McKenzie et al., Plasmid 17 , 83-85, 1987); positions 7267-7331: multiple cloning site The fragments were composed by known cloning technique, DK 175573 B1 25, for example, by filling in sticky ends with Klenow, adapter cloning, etc. All data came from Genbank, National Nucleic Acid Sequence Data Bank, NIH, USA.

pGBSCC-3 was derived by molecular cloning in 5 coli JM101 of the KpnI / Sphl P45qSCCcDNA insert from pGBSCC-2 (described in Example 1) at appropriate sites on pBHA-1 as shown in Figure 6.

By molecular cloning in E.coll JM101, the methion initiation codon could be introduced by exchanging the 10 Stul / Sphl fragment of pGBSCC-3 with a synthetically derived SphI / StuX fragment.

SPH 1 STU 1 CATATGATCAGTACTAAGACCCCTAGG GTACGTATACTAGTCATGATTCTGGGGATCC NDE 1 15 containing an Ndel site at the ATG initiation codon.

The obtained plasmid pGBSCC-4 is shown in Figure 7. The "Hpa II" Bacillus promoter upstream of P450SCCCDNA sequences was introduced by digesting pGBSCC-4 with the restriction enzyme NdeI, separation of the E. coli portion of the transfer plasmid by agarose gel electrophoresis, and subsequent religation. Bacillus subtills 1A40 (BGSC 1A40) competent cells. Neomycin-resistant colonies were analyzed to obtain the plasmid pGBSCC-5 (Figure 8). Bovine P450SCC expression was studied by preparing a cell protein fraction of a culture grown overnight at 37 C in TSB medium (Gibco) containing 10 μρ / πιΐ neomycin. Cells from 100 μΐ culture containing approximately 5x106 cells were harvested by centrifugation and suspended in 10 mM Tris / HCl pH 7.5. Lysing was performed by adding 1 mg / ml lysozyme and subsequent incubation for 15 minutes at 37 ° C. After treatment with 0.2 mg of DNase / ml for 5 minutes at 37 ° C, the mixture was adjusted to 1x SB buffer, as described by Laemmli, Nature 227, 680-685, 1970, at a final volume of 200 μΐ. . After heating in 5

ISLAND

Minutes to 100 ° C, 15 μΐ of the mixture was subjected to a 7.5% SDS / polyacrylamide gel electrophoresis. As shown in Figure 9 (lane c), a 53 kDa band could be detected after immunoblotting the gel probed with P45qSCC specific antibodies.

Specific bovine P450SCC antibodies could be obtained by immunizing rabbits with purified P450SCC protein isolated from bovine adrenal tissue.

Example 3 Expression of P45oscc 1 bacterial host Bacillus llchenlformls.

Expression of bovine p450scc1 - llchenlformls was performed by transforming the plasmid pGBSCC-5 into the appropriate host strain B. llchenlformls T5 (CBS 470.83).

A cell protein fraction prepared as described in Example 2 from a culture grown overnight in tryptone soybean (TSB) medium (Oxoid) containing 10 pg / ml neomycin was analyzed by SDS / PAGE and Western blot.

As shown in Figure 9 (lane f), a 53 kDa protein band could be visualized after incubation of the nitrocellulose filter with antibodies specific for bovine P450SCC. A transformant, SCC-201 was further assayed for in vivo activity of P450SCC (see Example 11).

DK 175573 B1 27

Example 4

Expression of P450SCC in the bacterial host Escherichia coll.

5 (a) Construction of the expression cassette.

To obtain a suitable expression vector in the E. coll host bovine P450SCC host, pTZ18R was mutated by position-directed mutagenesis as described by Zoller 10 and Smith (Methods in Enzymology 100, 468-500, 1983);

Zoller and Smith (Methods in Enzymology 154, 329-350, 1987) and Kramer and Fritz (Methods in Enzymology 154, 350-367, 1987). Plasmids of strains for in vitro mutagenesis experiments were obtained from Pharmacia Inc.

A synthetically derived oligomer of the sequence was used: 51-CAG G AA ACA CAT ATG ACC ATG ATT-3 '

I_I

Ndel 20 to form an Ndel restriction site by the ATG initiation codon of the lac Z gene of pTZ18R.

The resulting plasmid pTZ18RN was digested with NdeI and KpnI, and the Ndei / κρηΙ DNA fragment from pGBSCC-4 containing full-length SCCcDNA was inserted by molecular cloning as shown in Figure 10.

The transcription of P450SCC sequences in the derived plasmid pGBSCC-17 will be driven by the E. coli lac promoter. 1 (b) Expression of P450SCC in host E. coll JM101.

PGBSCC-17 was introduced into E.coll JM101 competent cells by selecting ampicillin resistant colonies. The expression of cytochrome P450SCC was studied by preparing a cell protein fraction (described in Example 2) of the transformants SCC-301 and 302 from a culture grown overnight at 37 ° C in 2 x TY medium (containing per ml). liter of deionized water: Bacto tryptone 5 (Difco), 16 g; yeast extract (Difco), 10 g and NaCl, 5 g) containing 50 µg / ml ampicillin.

Protein fractions were analyzed by SDS / PAGE stained with Coomassie brilliant blue (Figure 11A) or by Western blot, using antibodies specific for bovine P450SCC (Figure 11B) as probes. Both assays show a protein of the expected length (Figure 11A, lanes 1 and 2 and Figure 11B, lanes 3 or 4) for transformers SCC-301 and SCC-302, respectively, not found in E. coli JM101 control strain 15 (Figure 11A , lane 3 and Figure 11B, lane 2).

Example 5

Construction, transformation and expression of P450SCC 20 in the yeast Kluyveromyces lactls.

(a) Introduction of the geneticin resistance marker into pUC19.

A DNA fragment comprising the Tn5 gene (Reiss et al., EMBO J., 3, 3317-3322, 1984) was inserted, which transfers resistance to geneticin under the control of the alcoholic hydrogenase I (ADHI) promoter of S. cerevi strain. , in a similar manner as described by Bennetzen and Hall (J. Biol. Chem., 257, 3018-3025, 1982) in the Smal site at pUC19 (Yanisch-Perron et al., Gene, 33, 103-119, 1985). . The obtained plasmid pUCG418 is shown in Figure 12.

E. coli containing pUCG418 was deposited at the Centraal Bureau vor Schimmelcultures with depository no. CBS 872.87.

(b) Construction of the expression cassette.

A vector comprising pUCG418 5 (described in Example 5 (a)), intersected with Xbal and HindIII, the Xbal-Sall fragment of pGB901 containing lactase promoter (see JA van den Berg et al., Continuation in part of US patent application SN 572,414: "Kluyveromyces as a host strain") and synthetic DNA comprising part of the 3 'non-coding region of the K. lactis lacta gene. This plasmid pGB950 is seen in Figure 13.

You cut through pGB950 with Sall and Xhol and inserted synthetic DNA: 15 SAL 1 STU 1 XHO 1

TCGACAAAAATGATCAGTACTAAGACTCCTAGGCCTATCGATTC

GTTTTTACTAGTCATGATTCTQAGGATCCGGATAGCTAAGAGCT

to obtain plasmid pGBSCC-6 as shown in Figure 13.

The StuI-EcoRI fragment was isolated from pGBSCC-2 (see Example 1) containing the P45qSCC coding region and filled the adhesive end using Klenow DNA polymerase. This fragment was inserted into pGBSCC-6 cut with Stul. The plasmid containing the fragment in the correct orientation was called pGBSCC-7 (see Figure 14).

(c) Transformation of K. lactis.

K. lactis strain CBS 2360 was grown in 100 ml of 30 YEPD medium (1% yeast extract, 2% peptone, 2% glucose monohydrate) containing 2.5 ml of a 6.7% (w / w) yeast. trogen base (Difco laboratories) solution to an OD610 of about 7. Cells were collected from 10 ml of this culture by centrifugation, washed with TE buffer (10 mM Tris-HCl pH 7.5; 0.1 mM EDTA) and suspended in 1 ml of TE buffer. To this was added an equal volume of 0.2 ml of lithium acetate and the mixture was incubated for 1 hour at 30 ° C in a water bath with shaking. 15 µg of pGBSCC-7 was cut at the unique SadI site in the lactase promoter, precipitated with ethanol and resuspended in 15 μΐ TE buffer. This DNA preparation was added to 100 µl of the pre-incubated cells and allowed to incubate for an additional 30 minutes, an equal volume of 70% PEG4000 was added and the mixture was incubated for 1 hour at the same temperature, then allowed to stand. a heat shock of 5 mi-

ISLAND

nuts at 42 C. Now add 1 ml of YEPD medium and 15 incubate the cells for 1½ hours with shaking in a 0 water bath at 30 C. Finally, the cells are centrifuged, resuspended in 300 µl of YEPD and spread on agar plates containing 15 ml of YEPD agar with 300 µg / ml of geneticin which was plated 1 hour 20 before use with 15 ml of YEPD agar without G418. The colonies were grown for 3 days at 30 ° C.

(d) Analysis of the transformants.

The transformants and control strain 25 CBS 2360 were grown in YEPD medium for about 64 hours at 30 ° C. The cells were centrifuged, resuspended in a physiological saline solution to a value of 0D61Q of 300 and shredded by shaking with glass beads for 3 minutes on a Vortex shaker at the highest speed. Cell debris was centrifuged for 10 minutes at 4500 rpm in a Hearaeus Christ minifuge GL. 40 µl samples were taken from the supernatants for immunoblot analysis (see Figure 15A, lane 3 and Figure 15B, lane 4).

31 DK 175573 B1

The results show that a protein of the expected length is expressed in K. lactis cells transformed with pGBSCC-7. The transformant was designated K. lactis SCC-101.

5

Example 6

Construction, transformation and expression of p450scc in the yeast Saccharomyces cerevlsiae.

10 (a) Construction of the expression cassette.

To delete the lactase promoter, pGB950 (see Example 4 (b)) was cut with Xbal and Sall, filled the sticky ends using Klenow DNA polymerase, and then ligated. In the plasmid pGBSCC-8 obtained, the XbaI site is destroyed, but the SalI site is maintained.

The Sall fragment was isolated from pGB161 (see J.A. van den Berg et al., EP 96430) containing the isocytochrome CI (eye 1) promoter from S. cerevisiae and partially digested with XhoI. A 670 bp XhoI-SalI fragment was isolated and cloned into the SalI site of pGBSCC-8. In the selected plasmid pGBSCC-9, the Sall site between the eye 1 promoter and the 3 'non-coding region of the lactase gene is maintained (Figure 16) (HindIII 25 partially digested).

The SalI-HindIII fragment from pGBSCC-7 containing the P450SCC coding region of pGBSCC-9 was intersected with SalI and HindIIi inserted. X the plasmid pGBSCC-10 obtained, the P450SCC coding region 30 is located downstream of the eye 1 promoter (Figure 17).

32 DK 175573 B1 (b) Transformation of S. cerevlsiae.

S. cerevlsiae strain D273-10B (ATCC 25657) was grown in 100 ml of YEPD overnight at 30 ° C, then diluted (1: 10000) in fresh medium and grown to an OD610 6. The cells from 10 ml of the culture were from centrifuged and suspended in 5 ml TE buffer. Again, the cells were centrifuged, suspended in 1 ml TE buffer and 1 ml 0.2 M lithium acetate added. The cells were incubated for 1 hour with shaking in a water bath at 30 ° C. 15 µg pGBSCC-10 was cut at the unique Mlu I site of the eye 1 promoter, precipitated with ethanol and resuspended in 15 µl TE, this DNA preparation was added to 100 µl of the preincubated yeast cells and incubated for 30 minutes at shaking 30 ° C. After adding 115 µl of a 70% PEG4000 solution, the incubation was prolonged by 60 minutes without shaking. The cells were then subjected to a heat shock 0 of 5 minutes at 42 ° C, 1 ml of YEPD medium 0 was added and then incubated for 1½ hours at 30 ° C in a water bath without shaking. Finally, the cells were centrifuged, suspended in 300 µl YEPD and dispersed on YEPD agar plates containing geneticin (300 µg / ml).

0

The colonies were grown for 3 days at 30 ° C.

(C) Analysis of the transformants.

Transformants and control strain were grown in YEPL medium (1% yeast extract, 2% bactopeptone, 3.48% K 2 HPO 4 and 2.2% of a 90% L- (+) lactic acid solution; before sterilization, the pH was adjusted to 6.0 using a 25% ammonia solution) for 64 hours at 30 ° C.

The further analysis was performed as in Example 5 (d).

The immunoblot analysis shows the expression of P45oscc in S. cerevlsiae (Figure 15A, lane 1).

33

Example 7 DK 175573 B1

Construction, transformation and expression of pre-P450SCC coding DNA in the yeast Kluyveromyces lactis.

5 (a) Construction of the expression cassette.

Plasmid pGB950 (see Example 5 (b)) is cut with SalI and xhol and synthetic DNA inserted:

WILL I

10 TCGACAAAAAJOTTtXXrrCGAGGTTTCO ^ ITGAGATCCGCTTTGCriTAAGCXrrTGTCC

GTTTTTACAACCXIAGCTOCAAACGGTAACTCTAGGCGAAACCAATTCCGAACAGG

ACCAATCnTGTTCX ^ CTGTTCXn'GAAGGTTGGGGTCACCACAGAGTTGGTACTGGTGAAGG

TGGTTAGAAC ^ ^ GGTGACAACCACTTCX AACCCCAGTGGTGTCTCAACCATGACCACTTCC

STD 1 XHO 1

λ 5 TGCTGGTATCAGTACTAAGACTCCTAGGCCTATCXSATrC

ACGACCATAGTCATGATXCTGAGGATCCGGATAGCTAAGAGCT

to obtain the plasmid pGBSCC-11 (Figure 18). Similarly, as described in Example 5 (b), the P450SCC coding region from pGBSCC-2 was inserted into pGBSC-11, which was cut with Stul. The plasmid containing the fragment in proper orientation was called pGBSCC-12 (Figure 18).

(b) Transformation of K. lactis and analysis of the transformants.

Transformation of K. lactis with pGBSCC-12 was performed as described in Example 5 (c). The transformants were analyzed as described in Example 5 (d).

The analysis showed production of P450SCC in K. lactis (Figure 30 15B, lane 3).

DK 175573 B1 34

Example 8

Construction, transformation and expression of pre-P45oSCC coding DNA in the yeast Saccharomyces cerevislae.

5 (a) Construction of the expression cassette.

The SalI-HindIII (HindIII partially digested) fragment was inserted from pGBSCC-12 containing the pre-P45oSCC boiling region of pGBSCC-9 which was cut with SalI and HindIII. The resulting plasmid was named pGBSCC-13 (Figure 19).

(b) Transformation of S. cerevislae and analysis of the transformants.

15 S. cerevisiae strain D273-10B was transformed

with pGBSCC-13 as described in Example 6 (b). The transformants were analyzed as described in Example 5 (c). The result shown in Figure 15C (lane 3) demonstrates expression of P450SCC in S. cerevisiae. A 20 transformant SCC-105 was further analyzed for in vitro activity of P45qSCC (see Example 12).

Example 9 Construction, transformation and expression in Kluyveromyces lactis of P450SCC sequences fused with the pre-region of Saccharomyces cerevislae cytochrome oxidase VI. 1 (a) Construction of the expression cassette.

Plasmid pGB950 (see Example 6 (b)) with Sall and Xhol is cut and synthetic DNA inserted: DK 175573 B1 35

WILL I

tcgacaaaaatgttgtctcgagctatcttcagaaacccagttatcaacagaactttgtt

GTTTTTACAACAGAGCTCGATAGAAGTCTTrGGGTCAATAGTTGTCTTGAAACAA

GAGAGCTAGACCAGGTGCTTACCACGCTACTAGATTGACTAAGAACACTTTCATCCAATC

CTCTC ^ TCTCGTCCACGAATGGTGCGATGATCTAACTGATTCTTGTGAAAGTAGGTTAG

5 STU 1 XHO 1

CAGAAAGTACATCAGTACTAAGACTCCTAGGCCTATCGATTC GTCTTTCATGTAGTCATGATTCTGAGGATCCGGATAGCTAAGAGCT

to obtain the plasmid pGBSCC-14.

The amino acid sequence of the cytochrome oxidase vi (COX 10 VI) sequence was taken from an article by Wright et al. (J. Biol. Chem., 259, 15401-15407, 1984). Synthetic DNA was checked using preferred yeast codons. The p450SCC coding region from pGBSCC-2 was inserted into pGBSCC-14 cut with Stul * · * in a similar manner as described in Example 5 (b). The plasmid containing the P450SCC coding sequence in the frame with the COX VI precursor was named pGBSCC-15 (Figure 20). 1 (b) Transformation of K. lactis and analysis of the transformants.

Transformation of K. lactis with pGBSCC-15 was performed as described in Example 5 (c). The transformants were analyzed as described in Example 5 (d).

. The result (Figure 15B, lane 2) shows that P450SCC is expressed.

36

Example 10 DK 175573 B1

Construction, transformation and expression in Saccharomyces cerevisiae of P450SCC sequences fused with the pre-region of cytochrome oxidase VI of Saccharomyces cerevisiae.

(a) Construction of the expression cassette.

The SalI-Hindm (HIndm partially digested) fragment was inserted from the pGBSCC-15 containing the coding region of the P45QSCC fused to the COX VII precursor of pGBSCC-9, which was cut with SalI and HindIII. The resulting plasmid was named pGBSCC-16 (Figure 21).

(B) Transformation of S. cerevisiae and analysis of the transformants.

S. cerevisiae strain D273-10B was transformed with pGBSCC-16 as described in Example 6 (b). The transformants were analyzed as described in Example 6 (c). The result, shown in Figure 15C (lane 2), shows the priming of P45QSCC in S. cerevisiae.

Example 11 25

In vivo activity of P450SCC in Bacillus licheniformis SCC-201.

B. licheniformis SCC-201 was obtained as described in Example 3. The organism was inoculated into 100 ml of medium A. Medium A consisted of:

DK 175573 B1 I

37

Calcium chloride hexahydrate 1 g

Ammonium sulfate 5 g j

Magnesium chloride hexahydrate 2.25 g j

Manganese sulphate, tetrahydrate 20 mg 5 Cobalt chloride, hexahydrate 1 mg j

Citric acid, monohydrate 1.65 g

Distilled water 600 ml

Stock solution of trace elements 1 ml

Anti-foam (SAG 5693) 0.5 mg! 10

The storage solution of trace elements contained per. In the still water:

CuSO4.5H2 O 0.75 g H 2 BO 2 0.60 g Kl 0.30 g

FeSO4 (NH4) 2SO4.2H2O 27 g

ZnSO4.7H2O 5 g

Citric acid, H 2 O 15 g

MnSO 4, H 2 O 0.45 g Na 2 MoO 4, H 2 O 0.60 g H 2 SO 4 (96%) 3 ml

After sterilization and cooling to 30 ° C, 60 g of maltose monohydrate dissolved in 200 ml of distilled water (sterilized 20 minutes at 120 ° C), 200 ml of 1M potassium phosphate buffer (pH 6.8) were added to complete the medium. sterilized for 20 minutes 0 at 120 ° C, 1.7 g of yeast nitrogen base (Difco) dissolved in 100 ml of distilled water (sterilized by membrane filtration).

The culture was grown for 64 hours at 37 ° C and then 2 ml of this culture was used to inoculate 100 ml of medium A containing 10 mg of cholesterol.

38 DK 175573 B1

Cholesterol was added as a solution containing 10 mg of cholesterol; Tergitol / ethanol (1: 1 v / v), 0.75 ml and Tween 80, 20 μΐ. The culture was grown for 48 hours at 37 ° C, then extracted with 100 ml of 5 dichloromethane. The mixture was separated by centrifugation and the organic layer was used. The extraction procedure was repeated twice and the 3 x 100 ml dichloromethane fractions were combined. The dichloromethane was evaporated by vacuum distillation and the 10 dried extract (about 450 mg) of pregnenolone was analyzed using a gas chromatography-mass spectrometer combination.

GC-MS analysis.

A certain amount was extracted from the dried extract and silylated by adding a mixture of pyridine-bis (trimethylsilyl) trifluoroacetamide and trimethylchlorosilane. The silylated sample was analyzed by a GL-MS-DS combination (Carlo Erba MEGA 20 5160-Finnigan MAT 311A-Kratos DS 90) in the selected ion mode. Gas chromatography was performed under the following 0 conditions: injection needle with movable needle at 300 ° C: column M.cpsil29 0.25 inner diameter df 0.2 µm driven at 300 ° C isothermal; direct import into MS source.

The samples were analyzed by following the ions m / z 298 from pregnenolone at a resolution of 800. From the measurements it was evident that in the case of the host strain B. llchenlformis T5 no pregnenolone (detection limit 1 picogram) was detected, whereas 30 easily in the case of B. licheniformis SCC-201 could follow a production of pregnenolone.

39

Example 12 DK 175573 B1

In vitro activity of P450SCC obtained from Saccharomyces cerevisiae SCC-105.

5

S. Cerevisiae SCC-105 obtained as described in Example 8 was inoculated into 100 ml of medium B. Medium B contained per ml. 1 distilled water: yeast extract 10 g 10 Bactopeptone (Oxoid) 20 g Lactic acid (90%) 20 g

Dicalium Phosphate 35 g pH = 5.5 (adjusted with 25% w / w ammonia) This culture was grown for 48 hours at 30 ° C and was then used to inoculate a fermentation vessel containing medium C. Medium C consisted of: Yeast extract 100 g Bactopeptone (Oxoid) 200 g Lactic acid (90%) 220 ml

Dicalium hydrogen phosphate 35 g

Distilled water 7800 ml of pH was adjusted to a value of 6.0 with 25% ammonia and the fermentation vessel and medium sterilized (1 hour, 120 ° C).

After cooling, 2.4 g of geniticin dissolved in 25 ml of distilled water were sterilized by membrane filtration 30 and added to the medium. The inoculated mixture was grown with stirring (800 rpm) in the reaction vessel at 30 ° C, passing sterile air through the culture herb at 300 l / h and automatically maintaining pH at 6.0 at 6.0 ° C. 4N H2 SO4 and 5% NH 4 OH (5% NH 4 OH in distilled water; sterilized by membrane filtration). After 48 hours, a lactic acid feed (90%, sterilized by membrane filtration) was started at a rate of 20 g / h. The fermentation was then continued for 40 hours, after which the cells were centrifuged (4000 g, 15 minutes).

The centrifuge precipitate was washed with 0.9% (w / w)

Nacl followed by centrifugation (4000 g, 15 minutes); The centrifuge precipitate was washed with phosphate buffer (50 mM, pH = 7.0) and the cells again centrifuged (4000 g,

15 minutes). The centrifuge precipitate was taken up in phosphate buffer (50 mM, pH = 7.0) to obtain a suspension containing 0.5 g wet weight / ml. This suspension was processed in a Dyno mill (Willy A. Bacho-fen Maschinenfabrik, Basel, CH). Non-disintegrated cells were centrifuged (4000 g, 15 minutes). The I

cell-free extract (2250 ml, 15-20 mg protein / ml) was stored at -20 ° C.

The P450SCC was purified by the following procedure. From 50 ml of thawed cell-free extract, a crude membrane fraction was precipitated by ultracentrifugation (125000 g, 30 minutes) and resuspended in 50 ml of 75 mm potassium phosphate solution (pH 7.0) containing 1% sodium cholate. This dispersion was kept under gentle stirring for 1 hour at 0 ° C and then centrifuged (125000 g, 60 minutes). To the supernatant thus obtained containing solubilized membrane proteins was added (NH 4) 2 SO 4 (30% w / v), maintaining pH 30 at 7.0 by adding small amounts of a 6N NH 4 OH solution. The suspension was kept under stirring for 20 minutes at 0 ° C, after which a fraction of precipitated proteins was collected by centrifugation (15000 g, 10 for 41 minutes). The centrifuge precipitate was again suspended to a volume of 2.5 ml with 100 mM potassium phosphate buffer (pH 7.0) containing 0.1 mM dithiothreitol and 0.1 mM EDTA. This suspension was eluted over a gel-5 filtration column (PD10, Pharmacia) to obtain 3.5 ml of a salt protein fraction (6 mg / ml) assayed for P450SCC activity.

The P45qSCC activity was determined by an assay based essentially on a method of Doering (Methods Enzymology, 15, 591-596, 1969). The assay mixture consisted of the following solutions:

Solution A (natural P45qSCC electron donating system): a 10 mM potassium phosphate buffer (pH 7.0), containing 3 mM EDTA, 3 mM phenylmethylsulfonyl fluoride 15 (PMSF), 20 µM adrenodoxin, and 1 µM adrenodoxin reductase (electron carrier; ), 1 mM NADPH (electron donor) and 15 mM glucose-6-phosphate and 8 units / ml glucose-6-phosphate dehydrogenase (NADPH regenerating system).

Solution B (substrate): a micelle solution of 37.5 µM cholesterol (double radiolabelled with [26.27-14C] cholesterol (40 Ci / mol) and [7 α-3HJ cholesterol (400 Ci / mol)) in 10% (v / v) Tergitol NP40 / ethanol (1: 1, v / v).

The assay was started by mixing 75 µl of solution A with 50 µl of solution B and 125 µl of the coarsely purified P450SCC fraction (or buffer as a reference). The mixture was kept under gentle stirring at 30 ° C. Samples of 50 µl were taken after 0, 30 and 180 ΟΛ minutes and diluted with 100 µl water. To the diluted sample was added 100 µl methanol and 150 µl chloroform. After extraction and centrifugation (5000 g, 2 minutes), the chloroform layer was collected and dried. The dry residue was dissolved in 50 μΐ acetone containing 0.5 mg of a steroid mixture (cholesterol, pregnenolone and progesterone (1: 1: 1, w / w / w)), then 110 μΐ concentrated formic acid and 0 5 heated the suspension for 15 minutes to 120 C. Then the ratio 14C / 3H was determined by double-labeled liquid scintillation counting. This ratio is a direct measure of the side-chain cleavage reaction, with the 14C-labeled side chain evaporating from the mixture as isocoprilic acid during heating.

Using this assay, the P450SCC fraction roughly purified from S. cerevisiae SCC-105 was found to exhibit side-chain cleavage activity.

During 3 hours of incubation, 45% of the cholesterol had been converted. One could identify the reaction product as pregnenolone by thin layer chromatography.

Example 13 Molecular cloning of a full length cDNA encoding bovine cytochrome p450 steroid 17a-hydroxylase (P45017a) ·

They selected approx. 106 pfu's of the bovine biny-25 rebark cDNA library described in Example 1 for p45017acDNA sequences, were searched with two 32P end-labeled synthetic oligomers specific for P45017acDNA. Oligomer 17α-1 (5′-AGT GGC CAC TTT GGG ACG CCC AGA GAA TTC-3 ′) and oligomer 17a-2 (5′-GAG GCT 30 CCT GGG GTA CTT GGC ACC AGA GTG CTT GGT-3 ′) are complementary to the bovine P45017acDNA sequence, as described by Zuber et al. (J. Biol. Chem., 261, 2475-2482, 1986) from positions 349 to 320 and 139 to 104, respectively.

DK 175573 B1 43

Selection with oligomer 17α-1 yielded approximately 1500 hybridizing pfu's. Several hybridizing PFUs were selected, purified, and scaled up for preparative phage DNA isolation. The EcoRI 5 inserts were cloned from the recombinant λ-gtll DNA * into the EcoRI site of pTZ18R. A clone, pGB17a-1, was further characterized by restriction endonuclease mapping and DNA sequencing. Plasmid pGB17a-1 contains a 1.4 kb EcoRI insert thick complementary to the 3 'portion of P45017a from the EcoRI site at position 320 to the polyadenylation site at position 1721 as described by Zuber et al.

A map of pGB17a-l is shown in Figure 22A.

Eight hybridizing pfu's were obtained by scanning the cDNA library of oligomer 17ct-2. After purification, amplification of recombinant phages and isolation of recombinant λ-gtll DNAs, EcoRI inserts were cloned into the EcoRI site of pTZ18R. These EcoRI inserts range in length from 270 20 kp to 1.5 kbp. Only one clone, namely pGB17a-2, containing a 345 bp EcoRI fragment, was investigated by nucleotide sequence breakdown and compared with the published P45017acDNA sequence of Zuber et al. As shown in Figure 22B, the P45017acDNA 25 begins the sequence of pGB17a-2 72 bp upstream of the assumed AUG start codon at position 47 and shows completely homologous to the 5 'portion of P45017acDNA until the EcoRI site at position 320 as described by Zuber et al.

A full-length bovine P45q17ocDNA was constructed by molecular cloning in E.coll JM101 of a ligation mixture containing a partial EcoRI digest product of pGB17a-1 and the 345 bp EcoRI fragment of pGB17ct-2. The clone pGB17a-3 obtained contains a full length bovine P45017acDNA ° 9 is shown in Figure 22C.

Example 14 5

Construction and transformation of a full length p45017acDNA clone into the yeast Kluyveromyces lactls.

(a) Construction of the expression vector.

To obtain a suitable expression vector in yeast hosts for bovine P45017a, pGB17a-3 was mutated by position-directed mutagenesis as described by Zoller and Smith, (Methods in Enzymol., 100, 468-500, 1983); Zoller and Smith, (Methods in Enzymol., 154, 329-350, 1987) and Kramer and Fritz, (Methods in Enzymol., 154, 350-367, 1987). Plasmids and strains for in vitro mutagenesis experiments were obtained from Pharmacia Inc.

As shown in Figure 23, 9 bp was modified just upstream of the ATG initiation codon to obtain a 20 SalI restriction site and optimal yeast translation signals using the synthetic oligomer 17α-3.

SAL 1 5 '- TCTTTGTCCTGACTGCTGCCAGTCGACAAAAATGTGGCTGCTC- 3 * 1 2 3 4 5 6

The resulting plasmid pGB17a-4 was digested with 2

Sall and Smal; The DNA fragment containing P4gQ17acDNA in 3 full length was separated by gel electrophoresis, isolate 4, and transferred by molecular cloning in E. coli JM101 5 to the vector pGB950 (see Example 5) first digested with XhoI got adhesive ends filled with Klenow DNA polymerase and then digested with SalI to obtain the plasmid pGB17a-5 as depicted in Figure 24.

45 DK 175573 B1 (b) Transformation of K. lactis.

15 µg of pGB17a-5 cut at the unique SacII site of the lactase promoter was used to transform K. lactis strain CBS 2360 as described in Example 5. The transformants were analyzed for the presence of integrated pGB17a-5 sequences in the host genome by Southern analysis. One transformant, 17ct-10l, containing at least three copies of pGB17a-5 in the genomic host DNA, was further analyzed for in vivo activity of P45Q17a (see Example 16).

Example 15

Construction and transformation of £ 45017 ° in the bacterial hosts Bacillus subtilis and Bacillus llcheniformis.

(a) Construction of the expression vector.

To obtain a suitable expression vector in Bacillus hosts for bovine £ 450170, pGB17a-320 was mutated by position-directed mutagenesis as described in Example 14.

As shown in Figure 25, an NdeI restriction site was introduced by the ATG initiation codon using the synthetic oligomer 17α-4: 25 S'-GCT GCC ACC CAG AQC ATA TG, T GGC TGC TCC T-3 '

Nde

The obtained plasmid pGB 17a-6 was partially digested with EcoRI: The full length DNA fragment containing P45017acDNA was separated by gel electrophoresis, isolated and ligated to EcoRI digested pBHA-1 DNA as shown in Figure 26. The ligate was molecularly cloned by transferring the ligation mixture into E. coli JM101 to obtain pGB17a-7.

(b) Transformation of B. subtilis and B. licheniformis.

The "Hpall" Bacillus promoter was introduced upstream of the P45q17c <cDNA sequences by digesting pGB17a-6 with the restriction enzyme NdeI, separating the E.coll portion of the transfer plasmid by agarose gel electrophoresis, and then religating and transforming B. sub-10 to 1A40 ( BGSC 1A40) competent cells. Neomycline-resistant colonies were analyzed to obtain plasmid pGB17a-8 (Figure 27).

Transformation of host B. lichenlformls T5 (CBS 470.83) with pGB17a-8 was also performed. Plasma mass 15 remains stable in the appropriate Bacillus host as can be seen by restriction analysis of pGB17a-8, even after many generations.

Example 16 20

In vivo activity of P45017a in Kluyveromyces lactls 17a-101.

K. lactls I7a-101 were obtained as described in Example 14. This organism was inoculated into 100 ml of medium D. Medium D contained per ml. liter of distilled water: Yeast extract (Difco) 10 g

Bactopeptone (Oxoid) 20 g Dextrose 20 g

After sterilization and cooling to 30 ° C, 2.68 g of ferric rye base (Difco) dissolved in 40 ml of distilled water (sterilized by membrane filtration) and 50 mg of neomycin dissolved in 1 ml of distilled water (sterilized by membrane filtration) were added. to the medium. Then 50 mg of progesterone dissolved in 1.5 ml of dimethylformamide was added to 100 ml of medium and the culture was grown for 120 hours at 30 ° C, then 50 ml of culture herb was extracted with 50 ml of dichloromethane. The mixture was centrifuged and the organic solvent layer separated. Dichloromethane was evaporated by vacuum distillation 10 and the dried extract (about 200 mg) was taken up in 0.5 ml of chloroform. This extract contained I7a-hydroxyprogesterone, as shown by thin-layer chromatography. The structure of the compound could be confirmed by H-NMR and 13C-NMR. NMR analysis also showed that the ratio of 7α-hydroxyprogesterone / progesterone in the extract was approximately 0.3.

Example 17 Molecular cloning of a full length cDNA encoding bovine cytochrome P450 steroid 21 hydroxylase (P450C2l).

Approximately 106 pfu's of the bovine adrenal cortex cDNA library, prepared as described in Example 1, were hybridized with a 32P end-labeled oligo C21-1.

This oligo, which contained the sequence 5'- GAT GAT GCT GCA GGT AAG CAG AGA GAA TTC-3 ', is a specific probe for the bovine P450C21 gene located downstream of the EcoRl site of p450C21 cDNA, sequenced as described by 30 Yoshioka et al. (J. Biol. Chem., 261, 4106-4109, 1986).

From this search, one hybridizing pfu was obtained. The EcoRl insert in this recombinant λ-gtll DNA was subcloned into the EcoRl site of pTZ1BR

DK 175573 B1 48 to obtain a construct named pGBS2l-i. As shown in Figure 28, this plasmid contains a 1.53 kb EcoR1 insert that is complementary to the P450C21cDNA sequences from the EcoR1 site at position 489 to the polyadenylation site as described by Yoshioka et al., As shown by nucleotide sequence splitting.

To isolate the remaining 5 'portion (490 bp) of P45qC21cDNA, a new bovine adrenal cortical cDNA library was prepared by the procedure described in Example 1 with only one modification. As a primer for the synthesis of the first cDNA strand, an additional oligomer was added to C21-2. Oligomer C21-2 with the nucleotide sequence 5'- AAG GAG AGA GAA TTC-3 'is located downstream of the EcoRI site on P450C21cDNA from positions 504 to 490.

A search of this cDNA library with a 32P end-labeled oligomer C21-3 containing the P450C21 specific sequence 5'-CTT CCA CCG GCC CGA TAG CAG GTG AGC GCC ACT GAG-31 (positions 72-37) yielded approximately 20 hybridizing pfu 'is. The EcoRl insert was subcloned from only one recombinant λ-gtll DNA into the EcoRI site of pTZ18R to obtain a construct known as pGBC21-2.

This plasmid (Figure 28) contains a 540 bp insert 25 complementary to the P450C21CDNA sequences for position -50 to the EcoR1 site at position 489, as shown by nucleotide sequence splitting.

49

Example 18 DK 175573 B1

Construction of a P450C21cDNA Bacillus expression vector and transformation into the bacterial hosts Bacillus 5 subtilis and Bacillus llchenlformls.

(a) Construction of the expression vector.

To construct a full-length P450C21cDNA with flanking sequences specific for the Bacil-10 loop expression vector pBHA-1, the 5 'portion of the F45qC21 gene was first modified by the polymerase chain reaction (PCR) method with pGBC21-2 as template. and two specific P45QC21 oligomers as primers. Oligomer C21-4 (5 'CTG ACT GAT ATC CAT ATG GTC CTC GCA GGG CTG 15 CTG-3') contains 21 nucleotides complementary to C21 sequences from positions 1-21, and 18 additional bases to obtain a EcoRV restriction site and an NdeI restriction site at the ATG initiation codon.

Oligomer C21-5 (5'-AGC TCA GAA TTC CTT CTG GAT 20 GGT CAC-31) are 21 bases complementary to the minus strand upstream of the EcoRI site at position 489.

PCR was performed as described by Saiki et al (Science 239, 487-491, 1988) with minor modifications.

PCR was performed in a volume of 100 µl containing: 50 µM KCl, 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl 2, 0.01% (w / v) gelatin, 200 µM each of dNTP , 1 µM of each of the C21 primers and 10 ng of pGBC2i-2 template. After denaturation (7 minutes at 100 ° C) and addition of 2 units of Tag polymerase (Cetus), the reaction mixture was allowed to undergo 25 amplification cycles (each: 2 minutes at 55 ° C, 3 'at 72 ° C, 1 minute at 94 ° C) in a DNA amplifier apparatus (Perkin-Elmer).

In the last cycle, denaturing was excluded.

A schematic overview of this P450C21cDNA amplification is shown in Figure 29.

50 DK 175573 B1

The amplified fragment was digested with Ecorv and EcoRl and inserted by molecular cloning at appropriate sites on pSP73 (Promega). The plasmid obtained is designated pGBC21 -3. As shown in Figure 30, the 3'-P450C21 5 EcoRl fragment from pGBC21-1 was inserted in proper orientation in the EcoRl site of pGBC21-3. The resulting vector pGBC21-4 was digested with EcoRV and Kpnl (Kpnl is found at the multiple cloning site of pSP73), and the fragment containing P450C21cDNA full-length was isolated by gel electrophoresis and inserted into the relevant sites on pBHA. 1 by molecular cloning. The resulting plasmid pGBC21-5 is illustrated in Figure 31.

(b) Transformation of Bacillus.

The "Hpall" Bacillus promoter was introduced upstream of the P450C21cDNA gene by digesting pGBC21-5 with the restriction enzyme NdeI, separation of the E. coli portion of the transfer plasmid by agarose gel electrophoresis, and a subsequent religation and transformation of 20 B. subtilis 1 A40 (BGS). 1 A40) competent cells. Neomycin-resistant colonies were analyzed to obtain PGBC21-6 (Figure 32).

Transformation of the host B. licheniformis T5 (CBS 470.83) with pGBC21-6 was also performed. Plasmid 25 remains stable in both Bacillus hosts, as can be seen by restriction analysis.

51

Example 19 DK 175573 B1

Construction of a P450C21cDNA yeast expression vector and transformation into the yeast host Kluyverornyces lactis.

5 (a) Construction of the expression vector.

To obtain a suitable expression vector in yeast hosts for bovine P450C21, pGBC21-2 was mutated by position-directed mutagenesis as described in Example 14.

For this mutation, oligomer C21-6 (S'-CCT CTG CCT GGG TCG ACA AAA ATG GTC CTC GCA GGG-3 ') was used to obtain a SalI restriction site and optimal yeast translation signals upstream of the ATG initiation codon, as shown in Figure 33.

The SalI / EcoR1 DNA fragment from the derived plasmid pGBC21-7 was ligated to the 3'-P450C21 EcoRI fragment from pGBC21-1 and inserted by molecular cloning at the relevant sites on pSP73 as shown in Figure 34.

The resulting pGBC21-8 was cut with SalI 20 and EcoRV (the EcoRV site is located at the multiple cloning site of pSP73), and the DNA fragment containing P4g0C21cDNA full-length was inserted into the yeast expression vector pGB950. The resulting pGBC21-9 is shown in Figure 35.

, 25th

(b) Transformation of K. lactis.

15 µg of pGBC21-9 was digested with SacII and transformation of K. lactis CBS 2360 was performed as described in Example 5 (c).

52

Example 20 DK 175573 B1

Molecular cloning of full-length cDNA encoding bovine cytochrome Ρ450 steroid ΐΐβ-hydroxylase (Ρ450ΐΐβ).

5

A bovine adrenal cortex cDNA library was prepared as described in Example 1 with one modification.

An additional F450118-specific primer (oligomer 11β-1) with the nucleotide sequence 5'-GGC AGT GTG CTG ACA CGA-3 '10 was added to the reaction mixture by the synthesis of the first strand cDNA. Oligomer 11β-1 is found just downstream of translation stop codon from positions 1530 to 1513. Nucleotide sequences and positions on the map of said P4501 oligomers all derive from the ΐΐ450ΐΐβοϋΝΑ 15 sequence data described by Morohashi et al. (J. Biochem.

102 (3), 559-568, 1987). The cDNA library was searched with a 32P-labeled oligomer 11β-2 (5'-CCG CAC CCT GGC CTT TGC CCA CAG TGC CAT-3 '), and this is found at the S' end of Ρ45011βοϋΝΑ from positions 36 to 1.

Scanning with oligomer 11β-2 yielded 6 hybrid pfu's. These were further purified and analyzed with oligomer 11β-3 (5'-CAG CTC AAA GAG AGT CAT CAG CAA GGG GAA GGC TGT-3 ', positions 990 to 955).

Two out of six showed a positive hybridization signal 25 with 32 P-labeled oligomer 11β-3.

The EcoRI inserts from both ΐΐβ-λ-gtII recombinants were subcloned into the EcoRI site of pTZ18R. A clone with an EcoRI insert of 2.2 kb (ρΟΒΙΙβ-Ι) was further analyzed by restriction enzyme mapping and shown in Figure 36. ρσΒΙΙβ-ΐ contains all coding P4c128cDNA sequences as determined by Morohashi et al.

53

Example 21 DK 175573 B1

Construction of a P450C21cDNA Bacillus expression vector and transformation into the bacterial hosts Bacillus 5 subtilis and Bacillus llcheniformls.

(a) Construction of the expression vector.

A full-length P450lipcDNA with modified flanking sequences was obtained for Bacillus expression vector pBHA-1 by the PCR method (described in Example 18), using pGB118-1 as template and two specific P450llp oligomers as primers.

Oligomer 11β-4 (5 '-TTT GAT ATC GAA TTC CAT ATG GGC ACA AGA GGT GCT GCA GCC-3') contains 21 bases, complementary to the mature P450lipcDNA sequence from positions 72 to 93, and 21 bases to obtain of EcoRV, EcoRI and Ndel restriction sites and an ATG initiation codon.

Oligomer 11β-5 (5'-TAA CGA TAT CCT CGA GGG TAC 20 CTA CTG GAT GGC CCG GAA GGT-3) contains 21 bases complementary to the minus P450lipcDNA strand upstream of the translation stop codon at position 1511, and 21 bases to obtain restriction sites for EcoRV, Dhol and KpnI.

After PCR amplification with the above template and the above-mentioned P45Q118 primers, the amplified fragment (1.45 kb) was digested with EcoRI and KpnI and inserted by molecular cloning into the Bacillus expression vector pBHA-1 intersected with EcoRI and. 30 KpnI to obtain the vector pGBlip-2 (see Figure 36).

54 DK 175573 B1 (b) Transformation of Bacillus.

The "Hpall" Bacillus promoter upstream of the P45011PcDNA sequences was introduced by digesting pGBII3-2 with NdeI, separation of the E.coll portion of the 5 transfer plasmid by agarose gel electrophoresis, and subsequent religation (as described in Example 18) and transformation of B. subtills 1A40 ( BGSC 1A40) competent cells. Neomycin-resistant colonies were analyzed and plasmid pGB118-3 was obtained. The derived plasmid pGBlip-3 was also transferred to the B. licheniferous host strain T5 (CBS 470.83).

Example 22 Construction of a P450110cDNA yeast expression vector and transformation to the yeast host Kluyveromyces lactis.

(a) Construction of the expression cassette.

Full-length P45q113cDNA was obtained with modified flanking sequences for the yeast expression vector pGB950 by the PCR method (described in Example 18) with pGBII (3-1 as template and two specific P1β1-lip oligomers as primers).

Oligomer 11 (3-6 (S'-CTT CAG TCG ACA ΑΑΑ ATG GGC '25 ACA AGA GGT GCT GCA GCC-3 ') contains 21 bases complementary to the mature P45q11P cDNA sequence from positions 72 to 93, and 18 additional bases for obtaining a SalI restriction site, an optimal yeast translation signal and an ATG Initiation codon.

Oligomer 11β-5 is described in Example 21 (a). After PCR amplification with the above template and the above-mentioned P45Q11B primers, the amplified fragment (1.45 kb) was digested with SalI and Xhol DK 175573 B1 55 and inserted by molecular cloning into the yeast expression vector pGB950 cut with SalI, to obtain the vector pGBlip-4 (Figure 37).

5 (b) Transformation of K. lactls.

15 µg of pGBllp-4 was cut at the unique SadI site of the lactase promoter and transformation of K. lactis CBS 2360 was performed as described in Example 5 (c).

Example 23

Molecular cloning and construction of full-length cDNA encoding bovine adrenodoxin (ADX) and subsequent transformation and expression of ADXcDNA in the yeast Kluy-15 veromyces lactis.

(a) Molecular cloning of ADX.

A full length ADXcDNA with 5 * and 3 'flanking sequences modified to the yeast expression vector pGB950 was directly obtained from a bovine adrenal cortex mRNA / cDNA assembly (for detailed description see Example 1) by amplification using the PCR method (see Example 18).

To amplify ADXcDNA, two synthetic oligomer primers were synthesized.

Oligomer ADX-1 (5'-CTT CAG TCG ACA AAA ATG AGC AGC TCA GAA GAT AAA ATA-3 ') contained 21 bases complementary to the 5' end of mature ADXcDNA sequence, as described by Okamura et al. (Proc. Natl. Acad. Sci.

30, USA, 82, 5705-5709, 1985) from positions 173 to 194. The oligomer ADX-1 contains at the 5 'end 18 additional nucleotides to obtain the Sall restriction site, an optimal yeast translation signal and an ATG initiation codon.

DK 175573 B1, 56

The oligomer ADX-2 (5'-TGT AAG GTA CCC GGG ATC CTT ATT CTA TCT TTG AGG AGT T-3 ') is complementary to the 3' end of the minus strand of ADXcDNA from positions 561 to 540 and contains additional nucleotides to dan-5 restriction sites for BamHI, SmaI and KpnI.

PCR was performed as described in Example 18 with 1 μΜ of each ADX primer and 10 μΐ mRNA / cDNA mixture (as described in Example 1) as template.

A schematic overview of this ADXcDNA formulation is shown in Figure 38.

The amplified fragment contains a full length ADXcDNA sequence with modified flankings, and this was characterized by restriction site analysis and nucleotide sequence division.

(B) Construction of the expression vector.

The amplified ADXcDNA fragment was digested with SalI and SmaI and inserted by molecular cloning into the yeast expression vector pGB950, which was cut with SalI and EcoRV. The derived plasmid pGBADX-1 is shown in Figure 38.

(c) Transformation of K. lactis.

15 μρ of pGBADX-1 was cut at the unique 25 SacII site of the lactase promoter and transformation of K. lactis CBS 2360 was performed as described in Example 5 (c).

(d) Analysis of the transformants.

Two transformants ADX-101 and ADX-102 and control strain CBS 2360 were selected for further analysis. The strains were grown in YEPD medium for ca. 64 hours at 30 C. The total cellular protein was isolated as described in Example 5 (d). From the supernatants, samples of 8 μΐ were taken for immunoblot analysis (see Figure 39, lanes 3, 4 and 5).

The results show that a waiting length protein (14 kDa) is expressed in K. lactl cells transformed with pGBADX-1.

The in vitro ADX activity of transformant ADX-102 is described in Example 24.

Example 24

In vitro activity of adrenodoxin obtained from Kluyveromyces lactis ADX-102.

13 K. lactis ADX-102 obtained as described in Example 23 was grown and the control strain K. lactis CBS 2360 in 100 ml of YEPD medium (1% yeast extract, 2% peptone, 2% glucose, monohydrate) containing 2, 5 ml of a 6.7% (w / w) yeast nitrogen base (Difco laboratories) solution and 100 mg l-1 of geneticin (G418 sulfate; Gibco 0

Ltd.) / for 56 hours at 30 C. The cells were centrifuged (4000 g, 15 minutes), resuspended in physiological saline solution and washed with a phosphate buffer (pH 7.0, 50 mM). After centrifugation (4000 g, 15 ml nuts), the centrifuge precipitate was suspended in a phosphate buffer (pH 7.0, 50 mM) to obtain a suspension containing 0.5 g wet weight of cells per ml. ml. The cells were crushed using a Braun MSK Homogenizer (6 x 15 seconds, 0.45-0.50 mm 30 glass beads). Non-disrupted cells were removed by centrifugation (4000 g, 15 minutes). The cell-free extract (40 mg protein / ml) was stored at -20 ° C.

ADX activity, ie electron transfer capacity from adrenodoxin reductase to cytochrome P450ssc '58 DK 175573 B1 in the cell-free extracts was determined by a p45oSSC activity assay. The assay mixture consisted of the following solutions:

Solution A (natural P450SSC electron donating system with the exception of ADX): a 50 mM potassium phosphate buffer (pH 7.0) containing 3 mM EDTA, 2 µM adrenodo-xine reductase (purified from bovine adrenal cortex), 1 mM NADPH (electron donor) , 15 mM glucose-6-phosphate and 16 units / ml glucose-6-phosphate dehydrogenase (NADPH re-generating system).

Solution B (substrate and enzyme): a micelle solution of 75 µM cholesterol (double radiolabelled with [26.27-14C] cholesterol (40 Ci / mol) and [7a-3H] cholesterol (400 Ci / mol)) and 1 , 5 µM P45qSSC (purified from 15 bovine adrenal cortex) in 10% (v / v) Tergitol NP 40 / ethanol (1: 1, v / v).

The assay was started by mixing 7 µl of solution A with 50 µl of solution B and 125 µl of cell-free extract or 125 µl of a callum phosphate buffer (50 20 mM, pH 7.0) containing 10 µm ADX (purified from bovine adrenal cortex) . The mixture was kept under gentle stirring.

ISLAND

ring at 30 ° C and took samples after 15 minutes of incubation, diluting these with 100 µl water. From each sample, substrate and product or 25 products were extracted with 100 µl methanol and 150 µl chloroform. After centrifugation (5000 g, 2 minutes), the chloroform layer was collected and dried, then the dried residue was dissolved in 50 µl acetone containing 0.5 mg of a steroid mixture (cholesterol, pregnenolone and progesterone (1: 1: 1, w)). (w / w)), after which 110 µl of concentrated formic acid was added and the suspension heated to 0 to 120 ° C for 15 minutes. The ratio * 4c / 3H was then determined by double-labeled liquid scintillation counting. The ratio is a direct measure of the side chain cleavage reaction, evaporating the 14C-labeled side chain from the mixture as isocaprylic acid during heating. In this assay, ADX electron carrier activity could be readily demonstrated in the cell-free extract of K. lactis ADX-102. In assays with cell-free extracts from K. lactis ADX-102 or with purified ADX, the side chain of cholesterol was cleaved within 15 minutes with a yield of 50%, whereas in the assay with cell-free extracts from the control strain K. lactis CBS 2360 could detect any kind of side chain cleavage.

Example 25 15

Molecular cloning and construction of full-length cDNA encoding bovine adrenodoxine oxidoreductase (ADR), and subsequent transformation of ADRcDNA into the yeast Kluyvero myces lactis.

(A) Molecular cloning of adrenodoxine oxidoreductase.

A bovine adrenal cortex cDNA library was prepared as described in Example 1 with a modification.

An additional ADR specific primer (oligomer ADR-1) with the nucleotide sequence 5'-GGC TGG GAT CTA GGC-3 'was added to the reaction mixture for the synthesis of the first strand of cDNA. Oligomeric ADR-1 is found just downstream of translation stop codon from positions 1494 to 1480. Nucleotide sequences and positions on the map of said 30 ADR oligomers all derive from the ADRcDNA sequence data described by Nonaka et al., Biochem. Biophys. Res. Comm.

145 (3), 1239-1247, 1987.

The obtained cDNA library was searched with a 32P-labeled oligomeric ADR-2 (5 '-CAC CAC ACA GAT CTG GGG GGT CTG CTC CTG TGG GGA-3').

60 DK 175573 B1

Four hybridizing PFUs could be identified, which were then purified. However, only one pfu also showed a positive signal with oligomeric ADR-3 (5 '-TTC CAT CAG CCG CTT CCT CGG GCG AGC GGC CTC 5 CCT-3') found in the center of ADRcDNA (positions 840 to 805). ADRcDNA inserts (approximately 2 kb) were molecularly cloned into the EcoRI site of pTZ18R.

The resulting plasmid pGBADR-1 contains full-length ADRcDNA, as can be seen in restriction enzyme mapping and nucleotide sequence division. A physical mapping of pGBADR-1 is shown in Figure 40.

(b) Construction of the expression cassette.

A full-length ADRcDNA with modified flanking sequences for yeast expression vector pGB950 was obtained by the PCR method (see Example 18) with pGBADR-1 as template and two specific ADR oligomers as primers.

Oligomer ADR-4 (5'-CGA GTG TCG ACA AAA ATG TCC

20 ACA CAG GAG CAG ACC-3 ') contains 18 bases complementary to the mature ADRcDNA sequences from positions 96 to 114 and 18 bases for introducing SalI restriction site, an optimal yeast translation signal and an ATG initiation codon.

Oligomeric ADR-5 (5 '-CGT GCT CGA GGT ACC TCA GTG

CCC CAG CAG CCG CAG-3 ') contains 18 bases complementary to the minus strand of ADRcDNA upstream of the translation stop codon at position 1479, and 15 bases to obtain KpnI and XhoI restriction sites for molecular cloning in various expression vectors.

After amplification with the above mentioned templates and ADR primers, the amplified fragment (1.4 kb) was digested with SalI and XhoI and inserted by molecular cloning into the yeast expression vector pGB950 cut with SalI and XhoI.

The derived plasmid pGBADR-2 is illustrated in Figure 40.

5 (c) Transformation of K. lactis.

15 µg of pGBADR-2 was cut at the unique SacII site of the lactase promoter and the transformation of K. lactis CBS 23 60 was performed as described in Example .10 5 (c).

Example 26

Molecular cloning of a full-length cDNA encoding 15 bovine NADPH cytochrome P45Q reductase (RED).

The bovine adrenal cortex cDNA library described in Example 1 was searched with a 32P-labeled synthetic oligomer 5'-TGC CAG TTC GTA GAG CAC ATT GGT GCG 20 TGG CGG GTT AGT GAT GTC CAG GT-3 'specific for a conserved amino acid region in rat, swine and rabbit RED as described by Katagari et al. (J. Biochem., 100, 945-954, 1986) and Murakami et al. (DNA, 5, 1-10, 1986).

Thereby, five hybridizing PFUs were obtained and further characterized by restriction enzyme mapping and nucleotide sequence division. A full length REDcDNA was inserted into expression vectors and transformed into appropriate hosts as mentioned in Examples 2, 3 and 6.

DK 175573 B1 62

Example 27

Construction, transformation and expression of an expression cassette encoding the proteins P45QSSC and 5 ADX in the yeast Kluyveromyces lactis.

(a) Construction of the expression cassette.

The expression cassette pGBADX-1 (see Example 23) was digested with SacII and HindIII (partially) and filled 10 adhesive ends using Klenow DNA polymerase. The DNA fragment comprising a portion of the lactase promoter (still functioning), the coding ADX sequence and the lactase terminator were separated and isolated by agarose gel electrophoresis and then inserted into 15 pGBSCC-7 first linearized by XbaI digestion (see Example 5 ( b)) and had adhesive ends filled using Klenow DNA polymerase. The construction was carried out in such a way as to obtain a unique restriction site (SacII) necessary to transfer the plasmid to K. lactis.

This unique SacII restriction site is found in the lactase promoter sequence flanking the SCC sequence, with the SacII restriction site in the lactase promoter flanking the ADX sequence being destroyed by the fill-in gene.

The obtained expression cassette pGBSCC / ADX-1 contains both the coding sequence for SCC and for ADX, and they are both driven by the lactase promoter. 1 (b) Transformation of K. lactis.

Transformation of K. lactis CBS 2360 was performed as described in Example 5 (c) with 15 µg pGBSCC / ADX-1, linearized at the unique SacII restriction site. Man 63 DK 175573 B1 selected a transformant (SCC / ADX-101) for SCC and ADX expression studies.

(c) Analysis of the transformant K. lactis SCC / ADX-101.

Cellular protein fractions from cultures of SCC / ADX-101 and the control strain CBS 2360 were prepared as described in Example 5 (d) and analyzed by SDS / PAGE and Western blot. Problems were probed with antibodies specific for SCC 10 and ADX, respectively. When compared to the control strain, the cellular protein fraction of the transformant SCC / ADX 101 exhibits two additional expected length bands (53 and 14 kDa, respectively), showing expression of both proteins SCC and ADX. Expression levels for both proteins in the transformant SCC / ADX-101 are comparable to levels observed in transformants expressing only one protein (for SCC see Figure 15A, lane 3, and for ADX Figure 39, lane 5).

In vitro SCC and ADX activity of transformant SCC / ADX-101 are described in Example 28.

Example 28

In vitro activity of P450SSC and adrenodoxin obtained from 25 Kluyveromyces lactis SCC / ADX-101.

K. lactis SCC / ADX-101 obtained as described in Example 27 and control strain K. lactis SCC-101 as described in Example 5 (d) in YEPD medium 30 (1% yeast extract, 2% peptone, 2% glucose, monohydrate) were grown. ) containing 100 mg of l "1 geneticin (G418 sulfate; Gibco Ltd.), for 72 hours at 30 ° C. The cells were centrifuged (4000 g, 15 minutes), suspended in a physiologic solution.

brine and washed with a phosphate buffer (pH

7.5, 75 mM). After centrifugation (4000 g, 15 minutes), the pellet was suspended in a phosphate buffer (pH

7.5, 75 mM) to obtain a suspension containing 0.5 g wet cell weight per ml. ml. The cells were disrupted using Braun MSK Homogenizer (6 x 15 seconds, 0.45-0.50 mm glass beads). Whole cells were removed by centrifugation (4000 g, 15 minutes).

Assay was performed for the activity of the P45qSSC / ADX protein complex in the cell-free extracts, determining the side-chain cleavage reaction in cholesterol in the presence of NADPH and ADR. The assay mixture consisted of the following solutions:

Solution A (natural P450SSC electron donating system with the exception of ADX): a 50 mM potassium phosphate buffer (pH 7.0) containing 3 mM EDTA, 2 µM adrenodo-xine reductase (purified from bovine adrenal cortex), 1 mM NADPH (electron donor) , 15 mM glucose-6-phosphate and 16 units / ml glucose-6-phosphate dehydrogenase (NADPH 20 regeneration system).

Solution B (substrate): a micelle solution of 37.5 µM cholesterol (double radiolabelled with [26.27-14C] cholesterol (40 Ci / mol) and [7a-3H] cholesterol (400 Ci / mol)) in 10% ( v / v) Tergitol NP 40 / ethanol (1: 1, v / v).

The assay was started by mixing 75 µl of solution A with 50 µl of solution B and with 125 µl of cell-free extract. The mixture was kept under gentle stirring at 30 ° C and samples were taken after 60 minutes of incubation and diluted with 100 µl water. From a sample, substrate and product or products were extracted with 100 µl methanol and 150 µl chloroform. After centrifugation (5000 g, 2 minutes), the chloroform layer was collected and dried. The dried residue was dissolved in 50 μΐ acetone containing 0.5 mg of a steroid mixture (cholesterol, pregnenolone and progesterone (1: 1: 1, 5 w / w / w)), then 110 μΐ concentrated formic acid was added.

0

The suspension was heated to 120 ° C for 15 minutes. Then the ratio of 14C / 3H was determined by double labeled liquid scintillation counting. This ratio is a direct measure of the side-chain cleavage reaction, with the 14C-labeled side chain evaporating from the mixture as isocaprylic acid during heating.

Using this assay, cholesterol side chain cleavage activity was detected in the K. lactis SCC / adx-101 cell-free extract, whereas no activity in the K. lactis SCC-101 cell-free extract was detected.

HPLC analysis could identify the reaction product and produced a cell-free extract 20 of K. lactis SCC / ADX-101 as a pregnenolone.

··

Claims (27)

66 DK 175573 B1 Use of an expression cassette in multigenic systems for carrying out multiple-step conversions as shown in Figure 1, wherein the expression cassette can function in a non-mammalian recombinant host, characterized in that the expression cassette comprises a heterologous DNA coding sequence encoding a protein, acting alone or in collaboration with one or more additional proteins, by catalyzing an oxidation step in the biological pathway of cholesterol to hydrocortisone, this step being selected from: the conversion of cholesterol to pregnenolone; the conversion of pregnenolone to progesterone; Conversion of progesterone to I7o: -hydroxy-progesterone; the conversion of 17α-hydroxyprogesterone to cor-texolone; and the conversion of cortexolone to hydrocortisone, as well as the host effective corresponding control sequences. Use according to claim 1, characterized in that the protein is selected from: side chain cleavage enzyme (P450SCC); Adrenodoxin (ADX); adrenodoxin reductase (ADR); 3/3 hydroxy teroid dehydrogenase / isomerase (3/3 HSD); steroid 17a; hydroxylase (P4sol7 "); NADPH cytochrome P450 reductase (RED); steroid-21-hydroxylase (P450C2D; and steroid 11/3-hydroxylase (P450II) - 67 DK 175573 B1 Use according to claim 2, characterized in that the heterologous DNA coding sequence is of bovine origin. Use according to claim 3 of the expression cassette 5 pGBSCC-5, characterized in that the heterologous DNA encodes the enzyme P4s0SCC and that the expression cassette shown in Figure 8 functions in Bacillus species. Use according to claim 3 of the expression cassette 10 pGBSCC-17, characterized in that the heterologous DNA encodes the enzyme P4S0SCC and that the expression cassette shown in Figure 10 functions in E. coli. Use according to claim 3 of an expression cassette, characterized in that the heterologous DNA encodes the enzyme P450SCC and that the expression cassette operating in Kluy-veromyces lactis is selected from pGBSCC-7 shown in Figure 14, pGBSCC-12 shown in Figure 12 and pGBSCC-15 shown in Figure 20; or 20 that the expression cassette operating in Saccharomyces cerevisiae is selected from pGBSCC-10 shown in Figure 17, pGBSCC-13 shown in Figure 19 and pGBSCC-16 shown in Figure 21. Use according to claim 3 of the expression cassette pGB17or-5, characterized in that the heterologous DNA encodes the enzyme P45t> 17a and that the expression cassette shown in Figure 24 functions in Kluy-veromyces lactis Use according to claim 3 of an expression cassette pGB17o1 -8, characterized in that the heterologous DNA encodes the enzyme P4S017cx and that the expression cassette shown in Figure 27 functions in Bacillus species. 68 DK 175573 B1 Use according to claim 3 of an expression cassette pGBII / 3-4, characterized in that the heterologous DNA encodes the enzyme Ρ45ο11 / 3 and that the expression cassette shown in Figure 37 functions in Kluyveromyces lactis. An expression cassette capable of functioning in a non-mammalian recombinant host comprising a heterologous DNA encoding a protein that functions alone or in association with one or more additional proteins 10 by catalyzing an oxidation step in the biological reaction pathway to convert cholesterol to hydrocortisone, characterized in that it is selected from: the conversion of cholesterol to pregnenolone; The conversion of pregnenolone to progesterone; the conversion of progesterone to 17α-hydroxyprogesterone; the conversion of 17α-hydroxyprogesterone to corte-xolone; and the conversion of cortexolone to hydrocortisone; and the corresponding control sequences that are effective in this host, characterized in that the protein is selected from: s chain chain end enzyme (P450SCC); Adrenodoxin (ADX); adrenodoxin reductase (ADR); 3 β-hydroxysteroid dehydrogenase / somerase (3 β-HSD); steroid 17α-hydroxylase (P4SO17a); NADPH cytochrome P4S0 reductase (RED); steroid-21-hydroxylase (P450C21); and steroid 11/3 hydroxylase (P4 SO1); 69 and that the heterologous DNA encodes at least one additional protein from this group of proteins. The expression cassette of claim 10, which can function in a non-mammalian recombinant host, comprising a heterologous DNA encoding a protein that functions alone or in association with one or more additional proteins by catalyzing an oxidation step in the biological pathway for the conversion of cholesterol to hydrocortisone, wherein this step 10 is selected from: the conversion of cholesterol to pregnenolone; the conversion of pregnenolone to progesterone; the conversion of progesterone to 17α-hydroxyprogesterone; Converting 17α-hydroxyprogesterone to cortexolone; and the conversion of cortexolone to hydrocortisone, and the corresponding control sequences that are effective in this host, characterized in that the protein is selected from: id chain spliced end enzyme (P45oSCC); adrenodoxin (ADX); adrenodoxin reductase (ADR); 3/3-hydroxy s t ero in ddehydr ogene s e / i s ome race (3/3 Expression cassette according to claim 10 or 11, characterized in that the heterologous DNA encodes bovine P450SCC and bovine ADX. An expression cassette capable of functioning in a non-mammalian recombinant host comprising a heterologous DNA encoding at least two proteins that act alone or in association with one or more additional proteins by catalyzing at least two oxidation steps, characterized in that they are 10 selected from: the conversion of cholesterol to pregnenolone; the conversion of pregnenolone to progesterone; the conversion of progesterone to 17β-hydroxy-progesterone; The conversion of 17α-hydroxyprogesterone to cortexolone; and the conversion of cortexolone to hydrocortisone, and the effective control sequences in the host. The expression cassette of claim 13, which can function in a non-mammalian recombinant host, comprising a heterologous DNA encoding at least two proteins that act alone or in conjunction with a plurality of additional proteins by catalyzing at least two oxidation steps where these are selected. among: 25 the conversion of cholesterol to pregnenolone; the conversion of pregnenolone to progesterone, the conversion of progesterone to 17of-hydroxyprogest eron; the conversion of 17ar-hydroxyprogesterone to cortexolone; and the conversion of cortexolone to hydrocortisone, and the host effective control sequences, characterized in that the heterologous DNA encoding the second protein has its own effective control sequence. Expression cassette according to claim 13 or 14, characterized in that the protein is selected from among: side chain cleavage enzyme (P450SCC); adrenodoxin (ADX); adrenodoxin reductase (ADR); 3β-hydroxysteroid dehydrogenase / isomerase (3β-10 HSD); steroid 17α-hydroxylase (Ρ45ο17α); NADPH cytochrome P45o reductase (RED); steroid-21-hydroxylase (P45oC21); and steroid 11β-hydroxyl ase (P450II). The expression cassette of claim 15, characterized in that the coding heterologous DNA sequence is of bovine origin. The recombinant host cell and its progeny comprising cells of microorganisms, plants or animals 20 and containing a heterologous DNA expression cassette, characterized in that the expression cassette is one of claims 10-16. A recombinant host cell and its progeny 25 according to claim 17, characterized in that the host is a microorganism. A recombinant host cell and its progeny according to claim 18, characterized in that the host is a species of Saccharomyces, Kluyveromyces or Bacillus or is Escherichia col i. 72 DK 175573 B1 Recombinant host cell and its progeny according to any one of claims 17-19, characterized in that it contains at least two expression cassettes according to any one of claims 10-16. A process for preparing a mixture of endogenous proteins by means of a recombinant cell in a nutrient under conditions such that the enzymes can be formed and accumulated in the culture, characterized in that as a recombinant cell, a recombinant host cell according to claim 20. A method of selective biochemical oxidation in vitro comprising incubating the compound to be oxidized in the presence of one or more proteins under conditions allowing this oxidation and an accumulation of the oxidized compound in the culture liquid, recovering the oxidized compound, characterized in that the proteins are prepared by the method of claim 21. A method of oxidizing a selected compound, comprising culturing recombinant cells in the presence of the selected compound under conditions whereby the desired oxidation occurs and the oxidized compound accumulates in the culture fluid, then recovering the oxidized compound, characterized by using recombinant host cells 30 according to any one of claims 17-20. 73 DK 175573 B1 The method according to claim 22 or 23, characterized in that the oxidation is selected from: cleavage of the side chain of a sterol compound 5 to obtain pregnelonone; conversion of pregnelonone to progesterone; conversion of progesterone to 17n-hydroxy progesterone; conversion of 17α-hydroxy progesterol to cortexolone; and conversion of cortexolone to hydrocortisone. Process according to claim 24, characterized in that the oxidation is cleavage of the side chain in a sterol compound to obtain 15 pregnelonone. HSD); steroid 17af hydroxylase (P45017a); NADPH cytochrome P450 reductase (RED); steroid-21-hydroxylase (P450C21); and steroid 11 β-hydroxylase (Ρ45011); 30, characterized in that the heterologous DNA encoding the additional protein is an additional heterologous DNA with its own effective control sequences that for a protein in this group of proteins. 70 DK 175573 B1 Process according to claim 24, characterized in that the oxidation is a 17α-hydroxylation of progesterone. The process according to claim 24, characterized in that at least one of the oxidations mentioned in claim 21 is carried out with the same substrate molecule.