DK175554B1 - DNA construct for use in filamentous fungi - comprising promoter operative in filamentous fungi to promote transcription of coding region - Google Patents

Abstract

A novel DNA construct comprises a promoter operative in a filamentous fungus to promote transcription of a coding region when operatively associated. The promoter region naturally associated with the alcohol dehydrogeanse I (alcA) gene and the aldehyde dehydrogenase (aldA) gene of A. nidulans or naturally associated with the glucoamylase gene in Aspergillus niger may be used. The DNA construct may contain a promoter region in operative association with a signal peptide coding region and permits introduction of a region coding for a desired protein at a position 3' of and in reading frame with the signal peptide coding region. The promoter/signal construct is suitably provided with a flanking restriction site to allow precise coupling of the protein coding region to the signal peptide coding region.

Description

DK 175554 B1 i

The present invention relates to expression and expression following secretion of proteins from filamentous fungi.

One object of recombinant DNA technology is to insert DNA segments encoding 5 commercially or scientifically valuable proteins into a host cell that is readily available in an economical manner. The genes selected for insertion are usually genes encoding proteins that are produced only in limited quantities by their natural hosts, or genes that are natural for hosts that are too expensive to grow. Transferring genetic information in a controlled manner to a host capable of producing the protein either in high yield or more economically in a similar yield provides a more desirable medium for protein production.

Protein-coding genes contain promoter regions of DNA that are essentially bound to the 5 'terminus of the protein-coding region. The promoter regions contain the binding site for RNA polymerase II. RNA polymerase II effectively catalyzes the assembly of the messenger RNA that is complementary to the relevant DNA strand from the coding region. In most promoter regions, there is a nucleotide base sequence akin to the sequence, usually referred to as an MTATA box ", which sequence is usually located some distance upstream of the coding region and required for accurate transcription initiation. important or essential for the proper functioning and regulation of the coding region is also contained in the promoter region upstream from the beginning of the coding region.

Filamentous fungi, especially the filamentous ascomycetes such as Aspergillus, e.g. Aspergillus 25 niger, constitute a class of microorganisms suitable as recipients of foreign genes encoding valuable proteins. Aspergillus girls and related species are currently widely used in the industrial production of enzymes, for example, for use in the food industry. Their use is based on the secretion ability of the microorganism. Because they are well characterized and because of their wide application and approval, there is both an industrial and scientific incentive to use genetically modified and improved cells of A. niger and related species, including A. nidulans, to obtain useful proteins. .

Expression and secretion of foreign proteins from filamentous fungi has not yet been achieved. It is by no means clear that the strategies that have been successfully used in yeast will be successful in filamentous fungi such as Aspergillus. It has been found that yeast is an inappropriate system for expression of filamentous fungus genes (Pentilla et al.,

Molec. Gen. Genet. 194, 1984, pp. 494-499) and that yeast genes are not expressed in filamentous fungi. Genetic manipulation techniques have recently been developed for Aspergillus nidulans 40 and Aspergillus niger. These techniques include the incorporation of exogenously added genes into the Asperg / 7 / us genome in a form in which they are capable of being expressed.

Until now, no foreign proteins have been expressed in and secreted from filamentous fungi using these techniques. This has been due to a lack of appropriate

I DK 175554 B1 I

I _________________________2 _ _ ........ . _ _____________________. _ _ I

expression vectors and the constituents that make them up. These components include I

In Asperg / 7 / us promoter sequences as described above, the region encoding it I

In the desired product, as well as the associated sequences that may be added to guide I

the desired product to the extracellular medium. IN

I 5 I

As mentioned above, host cell expression of the foreign gene requires presence I

I of a promoter region upstream of the region encoding the protein. This I

In the promoter region is active for regulating the transcription of the coding region, I

In which it is linked, to messenger RNA, which is finally translated into the desired I

In protein product. The proteins thus produced can be categorized into two classes on the basis of I

In their destiny in relation to the host. IN

In A first class of proteins is preserved intracellularly. Extraction of the desired protein when I

it is intracellular, requires that the genetically engineered host be opened or lysed in order to

In 15 release the product for final purification. Intracellular production has several advantages. IN

In the protein product can be concentrated, i.e. pelleted, with the cell mass and if the product is I

In labile under extracellular conditions or are structurally unable to become I

secreted, this is a desirable production and purification method. IN

Another class of proteins are those proteins that are secreted from the cell. In this case, I

In this, purification is performed on the extracellular medium and not on the cell itself. Product I

You can be extracted by methods such as affinity chromatography, and continuous I

In flow fermentation is possible. Some products are also more stable extracellular and I

You benefit from extracellular purification. Studies have shown that secretion of proteins in I

25 eukaryotes are almost always dictated by a secretion signal peptide (hereinafter referred to as I)

signal peptide) usually located at the amino terminal of the protein. Signal peptides I

You have characteristic distributions, as described by G. Von Heijne in Eur. J. Biochem, I

In 1983, pp. 17-21, and will be recognized by professionals. When the signal peptide is recognized by the cell, I

it directs the protein into the secretion pathway of the cell. During secretion, I cleave

In the signal peptide off, enabling the protein in mature form to be harvested from it

In extracellular medium. IN

In both protein classes, intracellular and extracellular, are encoded by genes that contain an I

In promoter region linked to a coding region. Genes encoding extracellular I

In 35 directed proteins, different from genes encoding intracellular proteins, in that I

In genes encoding extracellular proteins, the portion of the coding region encoding I

You are closest to the promoter (which is the first part transcribed by RNA polymerase), I

I for a signal peptide. The nucleotide sequence encoding the signal peptide and as in it I

Hereinafter, the signal peptide coding region or signal sequence is itself I

In operationally part of the coding region. IN

A system has now been developed which transforms phantom fungi to express I

In a desired protein. With this system, transformation can produce a filamentous fungus that is in I

Able not only to express the protein, but also to secrete this protein, whether or not you

3 DK 175554 The B1 protein is a naturally secreted protein or not. Moreover, the quantity in which. the protein expressed is regulated according to certain aspects of the invention. It will be appreciated by those skilled in the art that the present system enables filamentous fungi to function as valuable protein sources and constitutes an alternative which in many applications is better than 5 bacterial and yeast systems.

In the present invention, the glycoamylase promoter region of A. niger is identified and isolated in a functional relationship with another, different coding region outside the cell, after which it is reintroduced into a filamentous host fungus 10 using a suitable vector. Transformed host cells express the protein from the second coding region under control of the inserted promoter region.

The second coding region may be a region that is foreign to the host species, in which case the host expresses and in some cases secretes a protein that is not naturally expressed by the given host. Alternatively, the second coding region may be a region that is natural to the host, in which case it is associated with a promoter region that is different from the promoter region with which it is naturally associated in the given host, giving modified or increased protein expression. and secretion.

If the second coding region is a region encoding a protein that is normally 20 secreted, it contains a sequence of nucleotides at its 5 'terminus, i.e. a signal peptide-coding region which, after transcription and translation, will result in the presence of a signal peptide at the protein terminal of the protein product. The signal peptide can be recognized by the fungus host and the protein product can then be directed into the secretion pathway of the cell and secreted.

25

The present invention provides for the possibility of introducing foreign coding regions into filamentous fungi with promoters, allowing the host fungus to express various proteins, it also allows for the regulation of transcription of the individual genes naturally occurring therein, or foreign genes. , introduced therein, via the promoter region that has been introduced into the host along with the gene.

According to the invention, the promoter region naturally associated with the glycoamylase gene in Aspergillus niger is positively induced by starch and other sugars.

Preferred hosts of the invention are filamentous fungi of the ascomycetes class, especially Aspergillus sp., Including A. niger, A. nidulans and the like.

The present invention uses the promoter region of the Aspergillus niger glucoamylase gene to produce an appropriate vector plasmid.

40

The destination of the protein product from the coding region which has been selected for expression under the control of the promoter described above is determined by the nucleotide sequence of this coding region. If the protein product is naturally directed to the extracellular environment, as mentioned, it will inherently contain a secretion signal peptide.

I DK 175554 B1 I

I _____ ___________4 _________ __________________ I

In coding area. Protein products that are normally intracellularly lack this

In signal peptide. IN

Therefore, in this specification, it is clear that a "coding region" encodes a protein, I

In 5 either intracellularly preserved or secreted. (This "coding region" is referred to as

Sometimes in the art a structural gene, ie. the portion of a gene encoding a I

In protein.) If the protein is preserved inside the cell that produces it, the coding I is missing

In region usually a signal peptide coding region. Secretion of the protein I

Encoding within the coding domain can be a natural consequence of I

In 10 cell metabolism, in which case the coding region inherently contains an I

In signal peptide coding region that is naturally associated in translation reading frame with an I

In segment from the coding region encoding the secreted protein. In this case, I

Insertion of a signal peptide coding region is not required. IN

The invention is described in greater detail with reference to the drawing, in which:

In FIG. 1A shows the base sequence of the DNA constituting the coding region and I

In the promoter region of alcohol · the dehydrogenase I (a / cA) gene of Aspergillus nidulans, I

In FIG. 1B shows the base sequence of the DNA comprising the coding region and promoter I

In the region of the aldehyde dehydrogenase (a / c / A) gene of Aspergillus nidulans, I

In FIG. 2 shows in diagram a method for constructing the plasmid pDG6, which is I

In useful in transformation of a filamentous fungal cell, I

FIG. 3 shows a linear part of the part of FIG. 2, plasmid pDG6, I

In FIG. 4 is a diagram showing the plasmid maps of pGL1 and pGL2, I

In FIG. 5 shows a selection of synthetic linker sequences for insertion into plasmid pGL2, I

FIG. 6 shows the nucleotide sequence of a fragment of pGL2, I

FIG. 7 shows the plasmid map of pGL2B and pGL2BIFN, I

In FIG. 8 shows the nucleotide sequence of a fragment of pGU2BIFN, I

In FIG. 9 shows the plasmid pALCA1S and a method for producing it, I

In FIG. 10 shows the plasmid map of pALCA1SIFN and a method of producing them, I

In FIG. 11 shows the nucleotide sequence of a fragment of pALCA1SIFN, I

In FIG. 12 shows the plasmid map of pGL2CENDO, I

In FIG. 13 shows the nucleotide sequence of a fragment of pGL2CENDO, I

In FIG. 14 shows the plasmid map of pALCAISENDO, I

In FIG. 15 shows the nucleotide sequence of a fragment of pALCA1SENDO, I

In FIG. 16 shows the plasmid pALCAlAMY and a method for its preparation, and I

In FIG. 17 shows the nucleotide sequence of a segment of the 16 showed plasmid pALCAlAMY. IN

In the present invention, a promoter region of A. n / ger glycoamylase I is identified

gene. Methods for identifying each of the genes containing the desired I

40 promoter regions are similar, and for this reason, the manner in which the afcA gene and I are described

The promoter therein is located and identified. For this purpose, cells of the selected I are induced

In order to express the selected protein, e.g., alcA, and from these cells, messenger isolates are isolated.

In the RNA. A portion of which has not yet been identified encodes alcA. Complementary DNA I

I to the fragments are prepared from the mRNA fragments and cloned into a vector. Messenger- I

B1 RNA isolated from induced A. nidulans is size fractionated to enrich with alcA sequences, end-labeled and hybridized to the cDNA clones prepared from the alcA + strain. The clone containing the cDNA that hybridizes to alcA + mRNA contains the DNA copy of the alcA mRNA. This piece is hybridized to a total DNA gene bank of the selected Aspergillus species to isolate the selected coding region, for example, alcA and the adjacent regions. The α / dA coding region was isolated by analogous methods.

The coding region starts at the 5 'end with a codon ATG that encodes methionine along with other coding regions and proteins. If the amino acid sequence of the expressed protein 10 is known, the DNA sequence of the coding region can be readily recognized.

Immediately "upstream" of the ATG codon is the coding portion of the messenger RNA in front of which the promoter region lies.

I ftg. 1A and 1B are shown these portions of the total A. nidulans DNA sequence with 15 conventional base notations. The one shown in FIG. 1A contains the promoter region and the coding region of the a / cA gene encoding the enzyme alcohol dehydrogenase I. The embodiment of FIG. IB shows the promoter region and the region encoding the enzyme aldehyde dehydrogenase, ie. ald. (In both cases, the term "IVS" denotes intervening sequences.) The amino acid sequences of these two enzymes are known in other 20 species. From these, regions 10 and 10 'are recognizable as the coding regions. Each coding region starts at the 5 'end ("upstream") with the methionine codon ATG at 12.

The relevant amino acid sequences encoded by the protein coding region are inserted below the respective rows of FIG. 1A and 1B with the conventional abbreviations.

Immediately upstream of codon 12 is the region encoding the messenger RNA leader and promoter region, the length of which must now be determined or at least judged to contain all of the essential structural elements enabling it to function. as a promoter. In each of FIG. 1A and 1B are shown a sequence of ca. 800 bases in each case upstream of the ATG codon 12.

By analogy with other known promoters, it can be predicted that all of the functional essential elements are likely to be contained within a sequence of about length. 1000 bases, presumably within the 800 bases shown, and most likely within the first 200-300 bases, ie. back to about position 14 of FIG. 1A and 1B. An essential function of a promoter region is to provide a site for accurate transcription initiation, which is known to be a TATA cassette sequence. Such a sequence is found at 16 on the a / cA promoter sequence of FIG. 1A and at 16 'of the aldA promoter sequence of FIG. IB. Another function of a promoter region is to provide an appropriate DNA sequence that is active to regulate the gene transcription, e.g., a binding site for a regulatory molecule that enhances the gene transcription, or to render the gene active or inactive. Such regulatory regions are within the range shown in FIG. 1A and 1B showed promoter region for the alcA and a / dA genes, respectively.

The exact upstream 5 'terminus of the DNA sequence used herein as a promoter region is not critical, provided it comprises the essential functional

I DK 175554 B1 I

I____________ __________________ 6. ______________________________ - I

In sequences as described. Excess DNA sequences upstream of the 5 'terminal are I

Unnecessary but probably not harmful to the present invention. IN

I When the extension of the sequence containing all the essential functional I

I 5 elements to constitute a promoter region in a given gene have been determined by those in I

The techniques described herein are the next step to cleave the DNA chain onto an I

Conveniently downstream of the promoter region terminal and removing the protein-coding I

In region, essentially leaving a sequence comprising the promoter region and I

In sometimes part of the area encoding the messenger RNA leader. For this purpose I

In 10, appropriately located restriction sites must be located, after which the DNA I

You are treated with the appropriate restriction enzymes to perform cleavage. IN

In Restriction sites are recognizable from the one shown in FIG. 1A a / cA sequence. Upstream I

In cleavage, a location is chosen sufficiently far upstream that in the preserved part you are

You included all the essential functional sites for the promoter area. As for you

In downstream cleavage, no restriction site is exactly found at the ATG codon 12 in I

In the case of alcA: The downstream restriction site closest to it is the sequence I

In GGGCCC at 13, at which the chain can be cleaved with the restriction enzyme Apal. If desired I

You can enter the remaining nucleotides from position 13 to position 12 after such intersection I

Step by step using an exonuclease. Since the number of such nucleotides that I

I 20 must be removed, known, the effect of exonuclease can be appropriately halted when

position 12 is passed. By locating a similar restriction site downstream of I

In the methionine codon 12 in the α / dA coding region shown in FIG. IB is cut this out

In promoter area similarly for subsequent use. In many cases, you are

residual nucleotides at the 5 'terminal of the promoter region are not deleterious and do not interfere

25 substantially into the function of the promoter region when the base triplets reading frame is I

In the preserve. IN

In FIG. 2 of the drawing, the steps of a process for producing I are shown in diagram

In the plasmid pDG6, which can be used to generate Asperg / 7 / u

In the present invention. In FIG. 2, 18 is a recombinant plasmid containing the I

In endogluconase coding (cellulase) region 30 from the bacterium Cellulomonas fimi, namely a

In SamHI endoglucanase fragment from C. fimi in the known vector M13MP8. It contains you

In relevant restriction sites for fcoRI, HindlU and Sam HI as shown and others not

In shown and not relevant to the present method. Reference numeral 20 is I

In a recombinant plasmid designated p5, constructed from the known E co // plasmid I

In pBR322 and contains an A. nidulans EcoRI fragment containing a / cA-I

In the promoter region prepared as described above, together with a small portion of I

In the a / cA coding region, including the start codon ATG. It has restriction sites as shown in I

And other restriction sites not used in the present method and

I 40 therefore not shown. Plasmid p5 contains a DNA sequence 22 from the EcoRI site (3 ') to I

The I / 7 / ndIII site (5 '), which is actually part of the one shown in FIG. 1A in the upper row shown sequence I

I from position 15 (the sequence GAATTC thereby constitutes an EcoRI restriction site) to position 17. I

The sequence 22 of plasmid 20 has a length of about 2 kb

7 DK 175554 B1

Plasmids 18 and 20 are then cut with restriction enzymes EcoRI and HindIII to excise the α / cA promoter region and endoglucanase coding region 30 which are ligated to the HindIII cleaved plasmid pUC12 to form a novel construct, pDG5A, containing these sequences on pUC12 as shown in FIG. 2. The plasmid pUC12 is a known, 5 commercially available E. coli plasmid that efficiently replicates in E. coli, so that copious copies of pDG5A can be produced if desired. The new design pDG5A is isolated from the other products in the design preparation. Next, the construct pDG5A is provided with a selectable marker, so that later-acquired transformants of Aspergillus into which the construct has been successfully introduced can be selected and isolated. In the case of ArgB'-Aspergillus hosts, a ArgB gene from A. nidulans can conveniently be used for this purpose. The ArgB gene encodes the enzyme ornithine transcarbamylase, and strains containing this gene can be readily selected and isolated from ArgS 'strains by standard plating and culture techniques. ArgB strains cannot grow on a medium without arginine.

15

For incorporating a selectable marker, the construct pDG5A in this embodiment of the invention as shown in Fig. 2 can be ligated with the XbaI fragment 32 of plasmid pDG3 ATCC 53006 (cf. U.S. Patent Application No. 06 / 678,578, Buxton et al., Filed 5 December 1984), which contains the A. nidulans Arg8 + gene, using XbaI, giving the novel construct pDG6, which contains the endoglucanase coding region, the α / cA promoter sequence and the ArgS gene. The plasmid pDG6 is then used in the transformation to produce new Aspergillus mutant strains containing an endoglucanase coding region under the control of the α / cA promoter, which is described in more detail in Example 1.

In FIG. 3 is shown in linear form the diagrammatic sequence of the functional part of construct pDG6 from HindIII site 24 to HindHI site 26. It contains a / cA promoter region 22, ATG codon 12 and a small residual portion of a / cA -coding region downstream of the ATG codon as shown in FIG. 1, followed by the cellulase-coding region 30 from plasmid 18.

The plasmid pDG6 is just one example of a vector containing a filamentous fungus promoter bound to a protein-coding region that is foreign to the fungus. In another vector exemplified herein with reference to FIG. 16, designated 35 pALCAlAMY, the filamentous fungus promoter from the a / cA gene is linked to the naturally occurring sequence encoding the o-amylase enzyme, a product foreign to the transformed fungus host. The protein products of the vectors pDG6 and pALCAlAMY are expressed in both cases by the respective transformed hosts. Since the α-amylase coding region naturally contains a signal peptide coding region, this product 40 can be further secreted by the transformed host using the host secretion machinery despite its foreign relationship with the host.

I DK 175554 B1 I

I _____________________8 _____________________ ________I

Thus, in identifying and isolating the promoter regions in filamentous fungi, I

In manipulating the host by transformation with vectors containing these I

In promoter regions linked to a desired coding region. IN

I 5 If the coding region of the vector requires a signal peptide coding region, or the I

In existing signal sequence must be replaced by another, preferably more efficient I

In signal peptide coding region, such signal peptide coding regions can be integrated

between the promoter and the segment encoding the secreted protein. The plasmids I

In pGL2 (Fig. 4) and pALCAlS (Fig. 9), intermediate cloning vectors which are particularly suitable for I

In 10 this purpose. Each can act as a cassette and provide a promoter, an I

In signal sequence and a restriction site downstream of the signal sequence, enabling I

In inserting a protein-coding region into the correct transcription reading frame with I

In the signal sequence. IN

In FIG. 4, plasmid pGL2 is formed from pGL1 containing promoter 40, I

In the signal sequence 42 and an initial one 46 of the glucoamylase gene, all of which were derived in I

In one segment of A. niger DNA according to methods exemplified herein. In this segment you will find

There is an SssHII restriction site near the end of, but within, the glucoamylase I site.

In the signal sequence 42, whose nucleotide sequence is shown below in diagram 1. I

I 20 I

I ~ Diagram 1 I

I 5 'ATG TCG TTC CGA TCT CTA CTC GCC CTG AGC GGC CTC GTC TGC I

25 «met set phe arg ser leu leu ala leu ser gly ley val cys I

I BssH II I

I I

ACA GGG TTG GCA AAT GTG ATT TCC AAG CGC 3 * I

I 30 thr gly leu ala asn val ile ser lys arg I

I To provide a segment downstream of the signal sequence, i.e. a linker 44 which is in I

Able to receive a protein-coding region in reading frame with signal sequence 42, I

the presence of the SssHII site within the signal sequence and the Sstl site I are utilized

In downstream therefore. In this specific embodiment, segment 46 is cut from pGL1 and I

is replaced by one selected linker out of three shown in FIG. 5 and denoted by A, B or C. Each I

The linker is capable of aligning with the BssHll end and the Sstl end. The links are also designed

40 to recover the terminal codons of the signal sequence lost by cut-out I

I of segment 46 with SssHII. Furthermore, each linker defines unique fcoRV and I

BglI / Xho / J sites within its nucleotide sequence, allowing insertion of the I

In the desired coding region of the vector pGL2. IN

9 DK 175554 B1

Selection of the appropriate linker is made with knowledge of at least the first five codons of the protein-coding region to be inserted into the linker. In order for the protein-coding region to be appreciably translated, the start of the protein-coding region must either be directly coupled to or be a specific number of nucleotides, i.e. in triplets, from the start of the signal sequence. If the protein-coding region to be inserted has one or two non-essential nucleotides (or a non-triplet factor thereof) at its 5 'region, which may be due to routine excision, one of the 5, the linkers shown thus compensate for the presence of the extra redundant nucleotides and place the start of the protein-coding region in translation reading frame with the signal sequence.

10

The amino acid residues encoded by linkers A, B and C are shown during their nucleotide sequences in FIG. 5, of which the effect of adding an additional nucleotide to the linker sequence is seen on the reading frame of the linker and finally on the inserted protein-coding region. By designing the links such that the restriction site is always downstream of the reading frame modification, ie. one, two or three adenine residues in the linkers A, B and C, respectively, the reading frame of the coding region inserted into the restriction site can be retained by appropriate linker selection.

Examples of plasmids using the plasmid pGL2 and specific linker segments A, B 20 or C are pGL2BIFN which uses the B linker and results in interferon α-2 secretion when used in filamentous fungi, eg Aspergillus sp., Transformation and pGL2CENDO, which uses the C linker and results in endoglucanase secretion when such filamentous fungi are transformed with it.

While the plasmid pGL2 uses a naturally occurring signal sequence, it is within the scope of the present invention to also use vectors containing synthetic signal sequences. An example of such a vector is pALCA1S, which, like the plasmid pGL2, forms an intermediate vector into which a protein-coding region can be inserted to form a vector capable of transforming filamentous fungi. However, in contrast to 30 pGL2, pALCA1S utilizes the a / oA promoter and utilizes a synthetic signal sequence coupled to this promoter. pALCAlS is shown in FIG. 9, which shows a diagram of its preparation and to which reference is further made in the examples. Examples of plasmids formed from pALCA1S are pALCA1SIFN which results in secretion of interferon α-2 from a filamentous fungus transformed thereby, and pALCA1SENDO which results in secretion of endoglucanase from a filamentous fungus host. In both cases, secretion is achieved despite the fact that the secreted protein is foreign to the host.

The invention is further illustrated by the following non-limiting examples.

40

Each of Examples 1 and 2 below are examples of successful transformation of a filamentous fungus host using vectors having a filamentous fungus-derived promoter coupled to naturally occurring non-fungal coding regions.

I DK 175554 B1 I

I __________________ io___________ _________________________ _____________ I

In Example 1 I

In Transformation of A nidulans Using pDG6 ATCC 53169 (Reference Example) I

I The embodiment of FIG. 2, the vector construction pDG6 was first prepared following that of FIG. 2 I

showed the scheme of procedures using standard ligation techniques and I

In restriction. Then, the construct pDG6 was introduced into Aspergillus I argS 'mutant cells

nidulans as follows: ^ I

In 10,500 ml complete medium (Cove 1966) + 0.02% arginine + 10'5% biotin in a 2 liter conical I

flask was inoculated with 105 conidia / ml of an A. nidulans argB 'strain and incubated I

I at 30 ° C and shaking at 250 rpm for 20 hours. The mycelium was harvested

through Whatman filter paper No. 54, washed with sterile deionized water and sucked dry. IN

To the Mycelium was added 50 ml of filter sterile 1.2M MgSO 4, 10mM potassium phosphate, pH 5.8, in a

In 15 flasks of flask, to which was added 20 mg Novozym 234 (Novo Enzyme Industries), 0.1 ml I

I (= 15,000 units) β-glucuronidase (Sigma) and 3 mg bovine serum albumin for each gram I

In mycelium. The cleavage was allowed to proceed at 37 ° C with light shaking for 50-70 minutes, with I

In it, periodically checked for spheroplast formation by means of a light microscope. 50 ml I

In sterile deionized water was added and the spheroplasts were separated from non-cleaved I

In 20 fragments by filtration through 30 µm nylon screens and harvested by centrifugation at 2500 L

I x g for 5 minutes in a swing out rotor in 50 ml conical I tube glass

At bottom and at room temperature. The spheroplasts were washed by resuspending and I

In centrifugation 2 times in 10 ml of 0.6M KCl. The number of spherical patches was determined with an I

hemocytometer and resuspended at a final concentration of 108 µl in ι, 2Μ I

In sorbitol, 10 mM Tris / HCl, 10 mM CaCl 2, pH 7.5. 0.4 ml aliquots were placed in plastic tubes, I

Into which was added DNA from pDG6 (total volume 40 µl in 10 mM Tris / HCl, 1 mM EDTA, pH I

8) and incubated at room temperature for 25 minutes. Aliquots of 0.4 ml, 0.4 ml and I

Then 1.6 ml of 60% PEG4000, 10 mM Tris / HCl, 10 mM CaCl 2, pH 7.5, was added to each I

stir sequentially under light but priming mixture between each addition, followed by I

For 30 further incubation at room temperature for 20 minutes. The transformed sphere patches I

was then added to appropriately enriched minimal media 1% agar overlays, plus I

or minus 0.6M KCI at 45 ° C, and was immediately poured into identical (but cold) I

In media on plates. After 3-5 days at 37 ° C, the number of growing colonies was counted (F. I

In Buxton et al., "Gene 37, 1985, pp. 207-214). The method described by Yelton et al.

35 ("Proc. Natl. Acad. Sci. USA 81, 1980, pp. 1370-1374) was also used.

In the Colonies were divided into two groups. Threonine (11.9 g / L) and fructose (1 g / L) were added

I to the incubation medium in one group to induce the cellulase gene incorporated therein. IN

No inducer was added to the other group which was deactivated by cultivation on I

In 40 minimal media with glucose as the only carbon source. Both groups were analyzed

I for general protein production using a BioRad Assay followed by culture, filtration I

I to separate the mycelium, freeze drying, milling and protein extraction with 20 mM Tris / HCl I

I at pH 7. I

11 DK 175554 B1

To test for cellulase formation, plates of agar medium containing cellulase (9 g / liter, carboxymethyl cellulose) and small pieces of fiberglass filter material isolated from each other were prepared and 75 μ9 total protein from one of the transconjugants was added to each of the filters. The plates were incubated overnight at 37 ° C. The filters were then ironed 5 and the plates stained with congo red to determine the locations where cellulase had been present in the total protein on the filters, as evidenced by cellulase degradation in the agar medium below. The plates were decolorized by washing with 5M NaCl in water to detect visible differences.

10 Of four transformants Induced with threonine and fructose, three showed clear presence of cellulase in the total protein product. The uninduced glucose-deactivated transformants showed no evidence of cellulase production.

Three control transformants were also made from the same vector system and strains, but 15 omitting the promoter sequence. None of them produced cellulase with or without inducers. The presence of the C / 7m β -endoglucanase coding region was verified by the fact that medium from threonine-induced transformed strains exhibited reactivity with a monoclonal antibody grown against C. ffm / endoglucanase. This monoclonal antibody showed no cross-reactivity with endogenous A. nidulans proteins in 20 control strains.

Example 2 Transformation of A. nidulans using pALCAlAMY ATCC 53380 (Reference Example)

The vector construct pALCAlAMY was prepared as shown in FIG. 16 using routine standard ligation and restriction techniques. Referring to FIG. 16, the vector containing a W / ncfIII EcoRI segment in which the A. nidulans alcohol dehydrogenase I promoter 22 is located (as described previously) was cut at the EcoR1 site to insert the coding region of wheat α The amylase gene 72 contained in an EcoRI-EcoRI fragment defined on plasmid p501 (cf. S. J. Rothstein et al., "Nature 308, 1984, pp. 662-665). Since wheat α-amylase is a natural secreted protein 35, its coding region 72 contains a signal peptide coding region 76 and a segment 78 encoding mature, secreted α-amylase. Ligation of the coding region 72 contained in the EcoR1 EcoRI segment of p501 within that of EcoRI cleaved site in pALCA1 gives the plasmid pALCAlAMY, in which the "AlcA promoter 22 is operatively linked to the α-amylase coding region. The correct orientation of the α-40 amylase-coding region derived from p50l in pALCAlAMY is confirmed by sequencing across the ligation site according to standard procedures. The nucleotide sequence of the link between the promoter region and the coding region is shown in FIG. 17th

in

I DK 175554 B1 I

I _____________________12 ____________________________ I

A. nidulans can be transformed by the procedure described in Example 1, with samples of I

In extracellular medium, glass fiber filter papers applied to 1% of

In soluble starch agar. The filters are removed after 8 hours at 37 ° C and reversed on I

In beaker containing solid iodine (in a 50 ° C hot water bath). Clear spots are signs of I

In 5 starch degradation, while the other starch turns deep purple, confirming I

In the presence of secreted α-amylase. IN

In Examples 3-12 below, vectors are provided which introduce into the vector

In a secretion signal peptide coding region to obtain secretion of a foreign protein from I

In 10 a filamentous fungus transformed with the whole vector. IN

In Example 3 I

Preparation of the plasmid pGL2, an intermediate vector I

Source of promoter and signal peptide sequence I

The Giucoamylase gene from A. niger was isolated by examination of a gene bank originating in I

I from DNA available in a strain of this microorganism deposited with I

In the ATCC under the deposit number 22343. The study was conducted using I

In oligonucleotide probes made with Biosearch oligonucleotide synthesis equipment and with I

Knowing the published amino acid sequence of the glucoamylase protein. The data for I

In the amino acid sequence was "back-translated" to nucleotide sequence data and the probes were

In 25 synthesized. The particular gene bank under investigation was one with Sau3A partially cleaved I

In product of the above described A. niger DNA cloned into the SamHI site of the commercial I

In available plasmid pUC12, which is both viable and replicable in E. coti. IN

In a tf / ncfIII-fig / II DNA piece containing the giucoamylase gene was subcloned into pUC12. IN

Then, the location of the desired promoter region, the signal peptide-coding I, became

In region and the protein-coding region for glucoamylase identified in pUC12 I

In containing the subcloned fragment. The £ coRI / £ coRI fragment (see Fig. 4) showed that I

You include a long, open translation reading frame when sequenced, and I

In the sequence data were analyzed using sequence analysis programs from I

In 35 Wisconsin University. IN

In FIG. 6, results of analysis of the nucleotide sequence of part of the region of I are shown

In the giucoamylase gene between the 5 'EcoRI site and the 3' SssHII site within HindIII-BgU1-1

In the fragment. This region contains the glucoamylase promoter and the signal peptide I

In 40 coding range. IN

Within this fragment, i.e. at nucleotides 97-102, there is a "TATA box" 48 which I

You provide a site required by many eukaryotic promoter regions to exactly I

In transcription initiation (presumably an RNA polymerase II binding site). Accordingly, I

The presence of at least part of the promoter region is confirmed. Further, by analogy with other known promoter regions, it can be predicted that all of the functional essential elements are likely to be contained within a sequence of length pi. 1000 bases and most likely within the first 200 bases upstream of the start codon for the coding region, i.e. nucleotides 206-208 or "ATG" 49, the codon for methionine. Thus, the promoter and transcript leader end at nucleotide 205. The identity of the beginning of the promoter region is less important, although the promoter region must contain the RNA polymerase Π binding site and all the other elements required for it to function. Thus, while the βcoRI-βCORI segment is thought to constitute the entire promoter region of the glucoamylase gene, the plasmid used in plasmid pGL2 contains this fragment in the much larger H / ncfIII-SamHI / Bg / II segment, ensuring that the entire promoter range is properly included in the resulting plasmid.

As the amino acid sequence of mature glucoamylase is known (cf. Svensson et al., 15 Characterization of two forms of glucoamylase from Aspergillus niger, Carlsberg Res.

Commun. 47, 1982, pp. 55-69), a nucleotide sequence of the signal peptide can be accurately determined. The signal peptide-coding region of genes encoding secreted proteins is known to start with the methionine residue encoded by the ATG codon 49. Determination of a sufficiently large initial portion of the nucleotide sequence 3 'after the ATG codon provides 20 information, based on which amino acid sequence of this moiety can be determined. By comparing this amino acid sequence with the published amino acid sequence, the signal peptide can be identified as the portion of the glucoamylase gene which has no counterpart in the published sequence with which it was compared. The glucoamylase signal peptide coding region defined herein has been previously confirmed by this method.

The above methods confirmed that the W / nc / III-BamHI / Bg / II fragment resulting from partial Sau3A cleavage and incorporated into pUC12 contained the following elements of the glucoamylase gene: an initial, perhaps irrelevant, section , The promoter region, the signal peptide coding region, and the remaining portion of the coding region. This fragment, inserted into the plasmid pUC12 by cleavage with HindIII and Bamhl / BglII and ligation, is shown schematically in FIG. 4 as the plasmid pGL1. This plasmid contains all the elements necessary for replication and the like, so that it remains selectable and replicable in E. coli.

B) Construction of the plasmid pGL2

Using pGL1 as a precursor, as shown in FIG. 4, the plasmid vector pGL2 is produced. The restriction site SssHII near the 3 'end of signal sequence 42 40 is used in conjunction with the unique downstream Ssfl site for insertion of a synthetic linker sequence A, B or C as defined in FIG. Thus, pGL1 is cleaved with both BssHII and Sst, removing the initial portion of the giucoamylase coding region 46 contained therein. Then, a selected sequence of the synthetic linker A-C sequences inserted and ligated to be surrounded by BssHIl / Sstl compatible ____ is inserted and ligated.

I DK 175554 B1 I

I _____________14 _______________________________ I

ends, producing the plasmid pGL2. Depending on which of the three linker sequences, I

In use, i.e. A, B or C, the resulting plasmid is identified as I, respectively

In pGL2A, pGL2B or pGL2C. IN

The synthetic linker sequences identified herein are each provided with unique EcoRV and I

In Eg / II restriction sites as shown in FIG. 5 in which a desired protein I can be inserted

In coding area. After insertion, the resulting plasmid can be used to I

In transforming a host, e.g., A. niger, A. nidulans and the like. The presence of I

In the promoter region and the signal peptide coding region, both recognized by the host, I

I 10 provides a means by which expression of the protein coding region and I

In secretion of the protein thus expressed is made possible. IN

In Example 4 I

I 15 I

I Use of the plasmid pGL2 to produce pGL2BIFN I

An example of the utility of the plasmid pGL2 is described below under I

Referring to FIG. 7, schematically showing the construction of the plasmid pGL2BIFN from I

In 20 pGL2B. IN

The plasmid pGL2B is prepared as described generally for pGL2 with the exception of I

In that the embodiment of FIG. 5, the synthetic linker sequence "B" is specifically inserted. IN

Accordingly, in the reference numeral 44 is changed in FIG. 7 to "44B '\ To provide an I

At 25 opening in the vector pGL2B, the plasmid is cut with EcoRV at the site inside linker 44B. IN

In the Cut, blunt ends result, which can be ligated to a fragment flanked by I

At blunt ends, using ligases known to be useful for this specific I

In purpose. IN

In the embodiment of FIG. 7, a fragment 60 containing the coding I is inserted

In the region of human interferon α-2 to form pGL2BIFN. A Ddel-BamHI fragment 60 I

Specifically, in the coding region for human interferon α-2 was excised

In the plasmid pN5H8 (not shown) on the basis of this gene's known sequence and restriction map. IN

In plasmid pN5H8, the known plasmid pAT153 combines with the interferon gene at an I

In SamHI place. The interferon gene therein is described by Siocomb et al., "High level expression of I

An interferon a-2 gene cloned into phage M13mp7 and subsequent purification with an I

monoclonal antibody ”, Proceedings of the National Academy of Sciences USA 79, 1982, p

I 5455-5459. IN

I 40 I

To join the adhesive ends of the interferon fragment in the cleaved EcoRV site of I

In pGL2B, the Odel and SamHI adhesive ends are filled using reverse transcriptase I

I and ligated by an appropriate ligase using standard techniques. IN

15 DK 175554 B1

The advantage of selecting the linker sequence B for insertion into pGL2 is shown in FIG. 8, which shows the reading frame of the interferon α-2 coding region and its relationship to the restored signal peptide sequence with respect to nucleotide sequence and amino acid sequence, if appropriate.

5

FIG. 8 shows part of the promoter region 40 5 'relative to the signal sequence associated with an I

part of the glucoamylase signal peptide sequence 42, beginning with the methionine codon ATG at 49 and ending with the lysine codon AAG at 50. Although the signal peptide coding region extends one residue further, i. to the CGC codon for arginine at 52, this latter residue is in fact comprised of the synthetic linker sequence 44B, which is engineered to compensate for the loss of the arginine residue during cutting and ligation to insert the linker sequence. In this way, the genetic sequence of the signal is not disturbed.

Similarly, the linker sequence provides for insertion of the interferon α-2 coding region without altering its reading frame. Referring to FIG. 7 and 8, cleavage of the linker sequence 44B with EcoRV results in linker fragments 44B 'and 44B "having blunt ends. Excision of the interferon α-2 coding region at the Odel site results after filling in the adhesive ends formed by the enzyme at the desired end. nucleotide sequence without damaging the sequence of this coding region. area 60. If the linker A shown in Figure 5 had been selected which carries one nucleotide less than linker B, then the entire reading frame would have been displaced by one nucleotide, which would result in a meaningless sequence. B, codons are made available between the signal peptide sequence and the interferon coding region, which does not alter the reading frame of the t coding region when the IF α-2 fragment with blunt ends is oriented correctly. The correct orientation is selected by sequencing clones with 30 inserts across the ligation compound.

Example 5 Expression and secretion from A. nidulans transformed with pGL2BIFN ATCC 53371

The plasmid pGL2BIFN was cotransformed, i.e. with a plasmid containing the arg £ J + gene as described in more detail in U.S. Patent Application No. 678,578 of December 5, 1984, in an argS 'strain of A. nidulans with a separate plasmid containing a selectable argB-40 marker. arg8 * transformants were selected, of which 18 out of 20 contained 1-100 copies of the human interferon α-2 coding region (detected by Southern blot analysis).

I DK 175554 B1 I

I ____ _______16 _______________________________________ I

Several transformants were grown in starch medium to induce glucoamylase I

In the promoter, and the extracellular medium was analyzed for human IF α-2 under I

Using a CellTech IF α-2 assay kit. IN

In 5 All transformants exhibited some degree of synthesis and secretion of analyzable protein. To I

In controls, the host strain (not transformed) and one argB + transformant without I

In detectable human IF α-2 DNA, no detectable synthesis of IF α-2 protein showed. In one I

separate experiment showed transformation of A niger and not A nidulans with pGL2BIFN during I

Using mutatis mutandis the same procedure as described above that A. niger was in I

Able to secrete IF α-2. IN

I Although the promoter and signaling regions of pGL2BIFN. descended from A. niger, they are detected I

thus being operative in biting A. nidulans and A. niger. IN

In the present invention, promoter regions other than I can be used

In the glucoamylase promoter region. Suitable for use are the promoter regions for alcohol-I

In the dehydrogenase I gene and the aldehyde dehydrogenase gene shown in FIG. 1A and 1B. IN

EXAMPLE 6 I

Construction of the plasmid pALCA1S, ATCC 53368, an intermediate vector (reference example) I

For use in the present example, the a / cA promoter was used, which promoter I

25 was contained in a 10.3 kb plasmid pDG6 deposited with ATCC in the host E. coli I

In JM83 under deposit number 53169. A plasmid map of pDG6 is shown in FIG. 2 and for I

For convenience, FIG. 9, to which reference is made to illustrating yet another embodiment of I

Using the a / cA promoter. IN

30 pDG6 in its W / ndlll-fcoRI (first occurrence) comprises promoter region 22 of I

the a / cA gene and a small 5 'portion of the a / cA coding region 3' of the start codon, which portion I

I is ligated to the endoglucanase coding region 30. The pDG6 further comprises a multiple I

At cloning site 62 downstream of the C. f / m / '- endoglucanase coding region 20. I

In order to recover the α / cA promoter region 22, pDG6 was cut with "Pst I and" XhoI, which I

In most of the endoglucanase coding region 30.1, a second step was removed

In linearized plasmid 64, cut in one direction in a controlled manner with exonuclease I

I III (which will cut back from Xhol but not Pstt cleaved DNA ends), followed by I

In pruning with the nuclease SI. The cut back was arranged so that the enzyme I

In 40, nucleotides removed to a position 50 bases 5 'relative to the alcA ATG codon, which I

You leave the TATA box and messenger RNA start site intact. IN

After cutting back, vector 66 was religated (recirculated) to give vector 68, I

carrying Sa / I-XbaI restriction sites immediately downstream of promoter region 22. I

17 DK 175554 B1

Cleavage of the vector 68 by Saf1 / Xba1 allows insertion of a signal peptide-coding region at a suitable location in the vector.

The particular signal peptide coding region used in the present example was synthesized to recover a characteristic signal peptide coding region identified by standard procedures as described by G. Von Heijne in Fur. J.

Biochem., 1983, pp. 17-21. The synthetic signal was manipulated to give a 5 'flanking sequence complementary to a Sa / I cleavage site and a 3 * flanking sequence, allowing ligation with the XbaI restriction sequence.

10

The sequence of the synthetic secretion signal 68 is shown below:

Will I j

TCGACATGTACCGGTTCCTCGCCGTCATCTCGGCCTTCCTCGCCACTGCCTTCGCCAAG

1 --------- + --------- + · --- in ----- + --------- + -------- - + --------- + 59 GTACATGGCCAAGGAGCGGCAGTAGAGCCGGAAGGAGCGGTGACGGAAGCGGTTC Me tTy r Ar gPh eLe uAl a Va 1 II eSe r Al aPh eLe uAl alti r Al aPh eAl aLy s

Xba I T

oO ------ 64

AGATC

SerArg

The secretion signal itself begins with Met and ends with the fourth occurrence of Ala, which is shown by the arrow.

Upon generation, the synthetic sequence 68, which acts as a signal, is cloned into the Sa / I-XbaI site of the vector 70 to give the plasmid pALCA1S which contains the a / cA promoter region 22 and the synthetic peptide signal coding region 68. that the signal peptide coding region inserted upstream of the multiple cloning site 62 is significant, the site 62 enabling cloning of a variety of protein-coding segments into this plasmid.

Thus, pALCAlS is a valuable embodiment of the present invention. EXAMPLE 7

Construction of the plasmid pALCA1SIFN

I DK 175554 B1 I

I _________________ ________________18__. ____ _____________________________ I

As an example of the utility of pALCA1S, reference is made to FIG. 10, showing I

In the preparation of pALCAlSIFN. This plasmid comprises the promoter region 22 of the α / cA gene and I

In the synthetic signal peptide-coding region 68, both derived from pALCA1S (Fig. 9). IN

In addition, it contains the coding region 60 encoding human interferon α-2 I

In 5 derived from pGL2BIFN. IN

To obtain the protein-coding segment, pGL2BIFN is digested with Eco RI and digested I

In part with BglU (due to the presence of internal Bg / 11 site is). Inserting it I

In protein-coding region, pALCA1S is digested with BamH1 and EcoRI, which I

10 are both available in the multiple cloning site 62, as well as ligation of this coding I

In area therein, giving pALCAlSIFN. IN

In the nucleotide sequence of the resulting plasmid from a site 1170 nucleotides downstream of I

In HindIII to EcoRI is shown in FIG. 11, with the relevant sites for restriction endonuclease I

In cleavage is shown. It can be seen from sheet 3 of FIG. 11, that the IP α-2 coding region 60 is in I

In correct reading frame with the synthetic signal peptide coding region 68. I

EXAMPLE 8 I

I 20 I

In Expression and secretion from A. nidulans transformed with the plasmid pALCA1SIFN I

In the plasmid pALCA1SIFN prepared as described above, cotransformed I

I with A. nidulans to provide a selectable argB marker, the arg5 + transformants I

I 25 was selected and examined for the presence of the human interferon α-2 coding I

In area after which they were grown on a threonine-containing medium to induce alcA-1

In the promoter in the same manner as described in Example 3. The extracellular medium I

I was assayed for human IF-2 using a CellTech IF α-2 assay kit. 11 out of 1

In 20 transformants, secretion of interferon induced in the presence of threonine and I showed

In 30 disabled in the presence of glucose. IN

EXAMPLE 9 I

I 35 pGL2CENDO - ATCC 53372 I

In accordance with the methods described in the foregoing examples, I

In there, a vector plasmid designated pGL2CENDO was constructed from the plasmid pGL2C I

In ATCC 53367, analogously to pGL2BIFN shown in FIG. 7, but containing it

In 40 endoglucanase coding region instead of the interferon α-2 coding region and below I

Using the synthetic linker sequence "C" (Fig. 5) instead of the linker sequence "B".

In Bam HI fragment containing the C. fimi endoglucanase coding region 30 was inserted into

In the Bg / II site of pGL2C. A. nidulans transformants were prepared with this I

In vector plasmid and showed starch-regulated secretion of cellulase, analyzed as I

19 DK 175554 B1 described in Example 1. The map of the vector plasmid pGL2CEND0 is shown in FIG. 12 in the drawing, where 30 denotes the endoglucanase coding region (the endoglucanase coding region of Cellulomonas fimi, described in connection with Fig. 2 and Example 1), 42 denotes the signal peptide coding region of the glucoamylase gene, and 40 denotes 5 the promoter region of the glucoamylase gene. The nucleotide sequence is shown in FIG. 13 and exemplifies that the use of linker sequence C (Fig. 5) preserves the reading frame for the signal peptide coding region 42 and endoglucanase coding region 30.

EXAMPLE 10

Construction of the plasmid pALCA1SENDO ATCC 53370 (In accordance with the methods described in the preceding examples, a vector plasmid named pALCA1SENDO was constructed by combining the EcoRI linearized plasmid pALCA1S as described in Example 5 (Fig. 9) with an EcoRI fragment from the plasmid pDG5B (see Fig. 2) (pDG5 with the reverse orientation of the HindIII fragment in pUC12) and containing the endoglucanase coding region 30. The pALCA1SENDO map is shown in Fig. 14 and the nucleotide sequence of its relevant region is shown in Figs. Figure 15. In these figures, the promoter region originates from alcA reference numeral 22, the synthetic signal peptide coding region has reference numeral 68, and the endoglucanase coding region has reference numeral 30.

EXAMPLE 11

Expression and secretion of A. nidulans transformed with pALCAlSENDO and pGL2CENDO

A. nidulans was cotransformed with a selectable argB * marker and the plasmid 30 pALCA1SENDO or pGL2CENDO prepared as described above. Of the obtained cotransformants, several varying levels of cellulase secretion (i.e., endoglucanase) exhibited, which were assessed on carboxymethyl cellulose plates and the monoclonal antibody assay systems described in Example 1. Both plasmid transformants exhibited secretion regulated by the bound promoter. The plasmid pGL2CENDO was induced with starch and pALCA1SENDO was induced with threonih.

EXAMPLE 12

40 Expression and secretion from A. niger transformed with pGL2CENDO

A. niger was cotransformed with a selectable argB * marker and the plasmid pGL2CENDO.

Several of the transformants showed varying levels of endoglucanase secretion, which

I DK 175554 B1 I

I ________________________ 20. ________________________ I

I was judged as described in Example 1. This secretion was induced by I

In the presence of starch in the medium. IN

EXAMPLE 13 I

Increased copy number of regulatory genes

In I Aspergillus niduians, the a / cA promoter is activated in the presence of the appropriate I

In 10 induces such as ethanol under the action of the gene product of alcR, the positive regulatory I

In gene for alcA. IN

Multicopy transformants (containing multiple α / cA promoters) suggest that alcR-I

In the gene product, the promoter function limits the various a / cA promoters that require I

15 stimulation. IN

Increasing the copy number of the alcR gene increases the expression of alcR and alleviates this

In situation. The proof of this is as follows:

In 20 Transformers with multiple copies of the a / cA promoter fused to their own coding region I

I (ADH I) on a multi-copy a / cfl background (which has been shown to overproduce alcR-I

In messenger RNA) does not grow well on ethanol. This is probably due to the rapid I

In the accumulation of aldehydes, the product of ADH degradation of ethanol. ADH activity in I

In these tribes is high. The increased ADH activity due to increased copy capital is probably I

In the reason for these observations. IN

In Multiple Copy Transformants of the a / cA Promoter Fused to Interferon α-2 on an I

In multi-copy a / cR background, significantly higher levels of secreted interferon. In these I

In strains, many more of the a / cA promoters, unlike those with single-copy alcR, I

In 30 access to the α / cR regulatory protein. IN

Thus, in preferred embodiments of the present invention, means for I

In introducing a coding region into a filamentous fungus host which, when transformed, I

will secrete the desired protein. Particularly useful melem plasmids for this purpose are I

In 35 pALCA1S and pGL2 (A, B or C). IN

Useful transformation vectors formed from these plasmids include:

pALCAlSIFN, pGL2BIFN, pALCAlSENDO and pGL2CENDO. Cultures of these and others, herein 1

The said plasmids are currently kept in a permanently viable state in the laboratories of I

40 Allelix Inc., 6850 Goreway Drive, Mississauga, Ontario, Canada. The plasmids will be maintained

In this state during the entire processing period of the present patent application and will in

During this period be available to experts. After issuing a patent on the present I

In application, these plasmids will be available without restriction from ATCC-I

5 DK 175554 B1 21 deposit authority, recognized under the Budapest Treaty. The deposit numbers of the various landfills are shown in the table below:

Plasmid Host Deposit # Date of deposit pDG6 E. coli JM83 53169 June 7, 1985 pGL2A "53365 December 16, 1985 10 pGL2B" 53366 December 16, 1985 pGL2C "53367 December 16, 1985 pALCAlS" 53368 December 16, 1985 pALCAlSENDO "53370 December 16 1985 pALCAlSIFN "53369 December 16, 1985 15 pGL2BIFN" 53371 December 16, 1985 PGL2CENDO "53372 December 16, 1985 pALCAlAMY" 53380 December 20, 1985

Claims (4)

A method for producing a polypeptide in a filamentous fungus host cell, wherein said method comprises culturing a host cell in a culture medium comprising starch; In I (b), where the host cell contains one or more copies of a DNA construct; II (c) wherein the DNA construct comprises: In I (i) a regulated DNA promoter region derived from the glycoamylase gene of II Aspergillus niger, which promoter region contains a DNA sequence that is active II in regulating gene transcription, wherein the sequence makes the gene positive II induced by starch; and II (ii) a DNA encoding a polypeptide operatively in association with the promoter, wherein the DNA encodes a polypeptide foreign to the promoter; In I (d), where the host cell is grown under conditions under which the presence of starch I induces the transcription-promoting function of the promoter; and optionally recovering the polypeptide from the medium. I I 20 I The method of claim 1, wherein the host cell is Aspergillus nidulans. IN The method of claim 1, wherein the host cell is Aspergillus niger. I I 25 Use of a DNA construct as defined in any of the preceding two claims for transformation of a filamentous fungal host cell and expression of an II protein under conditions wherein the host cell is cultured under conditions under which the presence of starch induces the transcriptional promoter. function of the II promoter contained in the DNA construct. I I 30 I