DK169134B1 - A process for expressing a protein product in Aspergillus, and a process for preparing protein products in Aspergillus oryzae - Google Patents

Description

DK 169134 B1

The present invention provides a process for producing protein products in Aspergillus oryzae.

Surprisingly, it has been found that Aspergillus oryzae produces higher yields of the gene products than other Aspergillus strains.

Up to now, a large number of 5 methods have been developed for the production of polypeptides or proteins by recombinant DNA technology. The main interest has been concentrated on bacteria and yeast, e.g. E. coli, Bacillus subtilis and Saccharomyces cerevisiae, which are well-characterized species, e.g. expression and 10 selection systems.

In addition to the aforementioned microorganisms, filamentous fungi such as Aspergillus niger are attractive candidates as host organisms for recombinant DNA vectors, being well-characterized microorganisms widely used for commercial production of enzymes. In particular, efforts have been focused on the development of transformation systems using a selection marker that allows the selection of transformants from non-transformed host organisms.

20 In recent years, selective markers for transforming Aspergillus nidulans have been described, and procedures have recently been developed for integrative transformation of the filamentous fungus Aspergillus nidulans for the purpose of investigating the genetic and molecular processes controlling fungal cell differentiation.

Transformation of A. nidulans has been demonstrated using plasmids containing the Neurospora crassa pyr-4 gene (Ballance, D.J. et al.,

Biochem.Biophys.Res.Commun., 112 (1983) 284-289), A. nidulans 30 amdS gene (Geburn, JG et al., Gene 2_6 (1983) 205-221), A. nidulans trpC gene (Yelton, MM et al., Proc.Natl.Acad.Sci. USA, 81 (1984) 1470-1474) and A. nidulans argB gene (John, MA and Peberdy J., Microb.Technol. (3 (1984) 386-389 The transformed DNA was found to be integrated into the host genome with fairly low frequencies (typically <1000 transformants / µg DNA).

Recently, transformation of Aspergillus niger 5 with the amdS gene from A. nidulans has been described (Kelly, JM and Hynes, MJ, EMBO Journal _4 (1985), 475-479), and amdS has been shown to be a potential selection marker for use in transformation of Aspergillus niger that cannot grow strongly on acetamide as the only nitrogen source. Transformation of 10 Aspergillus niger using the argB gene from Aspergillus nidulans has also been described recently (Buxton, F.P. et al., Gene _37 (1985), 207-214).

To date, no systems have been developed for the expression of foreign proteins in the filamentous fungus Aspergillus oryzae mainly due to insufficient knowledge of how to control gene expression in this fungus and due to a lack of suitable selectable genetic markers on cloning.

According to the present invention, it has now been demonstrated that the transformation technique described above can be used to achieve a high level of expression of heterologous proteins or to increase the production of homologous proteins in Aspergillus oryzae.

As used herein, the term "heterologous 25" means proteins not produced by A. oryzae, whereas "homologous proteins" means proteins produced by A. oryzae itself.

More specifically, it has been shown that selection for A. oryzae strains transformed with DNA encoding a desired protein product is possible using the marker genes used to transform A. niger and A. nidulans. Due to the phylogenetic difference between the latter fungi and A. oryzae (Raper, K.B. and Fennell, D.I. (1965) The Genus Aspergillus), this could not be predicted in any way.

3 DK 169134 B1

Thus, the present invention relates to a method for expressing a protein product in Aspergillus by (a) providing a recombinant DNA cloning vector system capable of being integrated into the genome of an Aspergillus host in one or more copies and comprising: DNA sequences encoding functions that facilitate gene expression, including a promoter, transcription start sites, and transcription termination and poly-adenylation functions, the promoter being preceded by upstream activation sequences, a suitable marker for selecting transformants; and a DNA sequence encoding the desired product; (b) transforming the Aspergillus host, which does not contain a functional gene for the selected selection marker, with the recombinant DNA cloning vector system of step a, and (c) culturing the transformed Aspergillus strain into a suitable culture medium characterized in that as Aspergillus host Aspergillus oryzae is used.

The present invention further relates to a method for producing a protein product in Aspergillus oryzae, wherein a method is transformed with an Aspergillus oryzae strain transformed with a recombinant DNA cloning vector system as described above into a suitable nutrient medium and the product is recovered from the nutrient medium.

The present invention will be further illustrated with reference to the drawing in which; 1 shows the DNA sequence of the TAKA amylase promoter and upstream promoter regions, the pre-region and the 5 'portion of the structural gene for the TAKA aryase, 4 FIG. 169134 B1 FIG. Figure 2 shows an endonuclease restriction map for plasmid pTAKA17; 3 shows the construction of plasmid p285'proC; 4a and b show the DNA sequence of prepro Rhizomu-5 cor miehei aspartate proteinase cDNA together with the deduced amino acid sequence characterized by three-letter abbreviations; 5 shows the construction of plasmid pRMP; FIG. 6 shows the endonuclease restriction map for plasmid pCAMG91; FIG. 7a shows the construction of plasmid pICAMG / Term; 7b shows the construction of plasmid p686; 8 shows the construction of plasmid pRMPAMGTerm; FIG. 9a shows the construction of plasmid pB408.3, FIG. 9b shows the construction of plasmid p778; 10 shows the construction of plasmid p719; FIG. 11 shows the construction of plasmid p777; FIG. 12 shows the sequence of prepro Rhizomucor miehei lipase cDNA together with the deduced amino acid sequence indicated 20 by three-letter abbreviations; 13a shows the construction of plasmid pB544; 13b shows the construction of plasmid p787; 14 shows the DNA sequence of a synthetic fragment RML5 ', 25 fig. 15a shows the construction of plasmid pTOC51 and FIG. 15b shows the construction of plasmid pTOC56.

The transformation technique used was a method adapted from the methods of transforming A. nidulans 30 (Ballance et al., Biochem.Biophys.Res.Commun., 112 (1983), 284-289; Auerurn et al., Gene 26 (1983) , 205-221, Yelton et al. Proc.Natl.Acad.Sci. USA 81 (1984), 1470-1474) and the similar method described by Buxton et al. (Gene _37 (1985), 207-214) by A. niger. In the method 35 of the present invention, Aspergillus oryzae is transformed with a vector system containing a selection marker capable of being incorporated into the genome of the host strain 5 but not contained in the host strain prior to transformation. Transformants can then be selected and isolated from non-transformants on the basis of the incorporated selection marker.

Preferred selection markers are argB- (A.

nidulans or A. niger), the trpC (A. nidulans), amdS (A. nidulans), or pyr4 (Neurospora crassa) genes, or the DHFR (dihydrofolate reductase or mutants thereof) gene. More preferred selection markers are the argB or amdS gene.

Wild type A. oryzae strains are usually argB + (i.e., the argB gene is functional in A. oryzae). If argB is selected as the selection marker, an argB mutant strain of A. oryzae that is defective in the gene for that marker must be used as the host organism. A. oryzae argB mutants can be prepared as described 15 by F.P. Buxton et al. (Gene 3J7 (1985), 207-214). An argB mutant is defined as a mutant having a defect in the ornithine transcarbamylase gene. On the other hand, the amdS gene can be used as a selection marker for transforming wild-type A. oryzae, as the wild-type strains do not contain this gene.

The promoter used above, which as is known, can be found upstream activating sequences and enhancer sequences, can be any DNA sequence that exhibits strong transcriptional activity in Aspergillus oryzae and can be derived from genes encoding both extracellular and intracellular proteins, such as amylases, glucoamylases, proteases, lipases, cellulases and glycolytic enzymes.

Suitable promoters can be obtained from genes for A. oryzae TAKA amylase, Rhizomucor miehei aspartate proteinase, A. niger 30 glucoamylase, A. niger neutral α-amylase, A. niger acid stable α-amylase and Rhizomucor miehei lipase. Examples of promoters from genes for glycolytic enzymes are TPI, ADH and PGK.

6 DK 169134 B1

A preferred promoter of the method of the present invention is the A. oryzae TAKA amylase promoter. The TAKA amylase is a well known α-amylase (Toda et al.,

Proc.Japan Acad. Ser. B (1982) 208-212). DNA encoding the promoter region was isolated from the TAKA amylase genome clone. The sequence of the promoter and regions above the promoter together with the pre-region and 51 end of the structural gene for TAKA amylase are illustrated in FIG. First

As described in further detail in Example 21, a DNA sequence encoding the TAKA amylase comprising the pre-region and promoter and upstream activation sequences was isolated from A. oryzae mycelium and inserted into BamHI-digested pBR322 to form pTAKA 17 ( see Fig. 2). In pTAKA 17, DNA from A. oryzae is shown as a 5.5 kb BamHI / Sau3AI -15 BamHI / Sau3AI fragment, the promoter and upstream activation sequences representing a 2.1 kb fragment starting at position 0. The determined DNA sequence of the promoter and upstream activation sequences up to the BglII cleavage site is shown in FIG. 1. The promoter ends at 20 nucleotide (-1) preceding the Met (1) codon of the TAKA amylase sequence. The nucleotide sequence encoding the pre-sequence is constituted by 63 nucleotides and the mature TAKA amylase starts at a position corresponding to nucleotide 64.

From pTAKA 17, the entire promoter sequence comprising 25 sequences above the promoter or functional parts thereof can be isolated in ways obvious to one skilled in the art. The promoter sequence may be provided with linkers for the purpose of introducing a specific restriction cleavage site which makes it easier to ligate the promoter sequence with additional DNA, e.g. the gene encoding the desired protein product, or various pre-regions (signal peptides).

In the method of the present invention, the sequence from nucleotide-1144 (see Fig. 1) (representing the onset of a SalI cleavage site) to 35 nucleotide-10 has been used as an example of a well-functioning part of the promoter region. In a further embodiment of the present invention, the nucleotide sequence from DK DK 169134 B1 nucleotide -1176 to -1 was preceded by a yet to be sequenced 1.05 kb fragment from pTAKA 17. It will be apparent to one skilled in the art that various fragments may be used.

Thus, according to an embodiment of the method of the present invention, the following sequence or a functionally equivalent nucleotide sequence is used as the promoter and upstream activation sequence:

GTCGACGC ATTCCGAATA CGAGGCCTGA TTAATGATTA CATACGCCTC 10 CGGGTAGTAG ACCGAGCAGC CGAGCCAGTT CAGCGCCTAA AACGCCTTAT ACAATTAAGC AGTTAAAGAA GTTAGAATCT ACGCTTAAAA AGCTACTTAA AAATCGATCT CGCAGTCCCG ATTCGCCTAT CAAAACCAGT TTAAATCAAC TGATTAAAGG TGCCGAACGA GCTATAAATG ATATAACAAT ATTAAAGCAT TAATTAGAGC AATATCAGGC CGCGCACGAA AGGCAACTTA AAAAGCGAAA 15 GCGCTCTACT AAACAGATTA CTTTTGAAAA AGGCACATCA GTATTTAAAG CCCGAATCCT TATTAAGCGC CGAAATCAGG CAGATAAAGC CATACAGGCA GATAGACCTC TACCTATTAA ATCGGCTTCT AGGCGCGCTC CATCTAAATG TTCTGGCTGT GGTGTACAGG GGCATAAAAT TACGCACTAC CCGAATCGAT AGAACTACTC ATTTTTATAT AGAAGTCAGA ATTCATAGTG TTTTGATCAT 20 TTTAAATTTT TATATGGCGG GTGGTGGGCA ACTCGCTTGC GCGGGCAACT CGCTTACCGA TTACGTTAGG GCTGATATTT ACGTGAAAAT CGTCAAGGGA TGCAAGACCA AAGTAGTAAA ACCCCGGAAG TCAACAGCAT CCAAGCCCAA GTCCTTCACG GAGAAACCCC AGCGTCCACA TCACGAGCGA AGGACCACCT CTAGGCATCG GACGCACCAT CCAATTAGAA GCAGCAAAGC GAAACAGCCC 25 AAGAAAAAGG TCGGCCCGTC GGCCTTTTCT GCAACGCTGA TCACGGGCAG CGATCCAACC AACACCCTCC AGAGTGACTA GGGGCGGAAA TTTAAAGGGA TTAATTTCCA CTCAACCACA AATCACAGTC GTCCCCGGTA TTGTCCTGCA GAATGCAATT TAAACTCTTC TGCGAATCGC TTGGATTCCC CGCCCCTAGT CGTAGAGCTT AAAGTATGTC CCTTGTCGAT GCGATGTATC ACAACATATA 30 AATACTAGCA AGGGATGCCA TGCTTGGAGG ATAGCAACCG ACAACATCAC ATCAAGCTCT CCCTTCTCTG AACAATAAAC CCCACAG

representing the sequence from nucleotide -1144 to -10 in FIG. First

35 8 DK 169134 B1

According to a further embodiment of the method of the present invention, a promoter and upstream activation sequence having the following sequence or a functionally equivalent nucleotide sequence may be used:

AGATCTGCCC TTATAAATCT CCTAGTCTGA TCGTCGACGC ATTCCGAATA CGAGGCCTGA TTAATGATTA CATACGCCTC CGGGTAGTAG ACCGAGCAGC CGAGCCAGTT CAGCGCCTAA AACGCCTTAT ACAATTAAGC AGTTAAAGAA 10 GTTAGAATCT ACGCTTAAAA AGCTACTTAA AAATCGATCT CGCAGTCCCG ATTCGCCTAT CAAAACCAGT TTAAATCAAC TGATTAAAGG TGCCGAACGA GCTATAAATG ATATAACAAT ATTAAAGCAT TAATTAGAGC AATATCAGGC CGCGCACGAA AGGCAACTTA AAAAGCGAAA GCGCTCTACT AAACAGATTA CTTTTGAAAA AGGCACATCA GTATTTAAAG CCCGAATCCT TATTAAGCGC 15 CGAAATCAGG CAGATAAAGC CATACAGGCA GATAGACCTC TACCTATTAA ATCGGCTTCT AGGCGCGCTC CATCTAAATG TTCTGGCTGT GGTGTACAGG GGCATAAAAT TACGCACTAC CCGAATCGAT AGAACTACTC ATTTTTATAT AGAAGTCAGA ATTCATAGTG TTTTGATCAT TTTAAATTTT TATATGGCGG GTGGTGGGCA ACTCGCTTGC GCGGGCAACT CGCTTACCGA TTACGTTAGG 20 GCTGATATTT ACGTGAAAAT CGTCAAGGGA TGCAAGACCA AAGTAGTAAA ACCCCGGAAG TCAACAGCAT CCAAGCCCAA GTCCTTCACG GAGAAACCCC AGCGTCCACA TCACGAGCGA AGGACCACCT CTAGGCATCG GACGCACCAT CCAATTAGAA GCAGCAAAGC GAAACAGCCC AAGAAAAAGG TCGGCCCGTC GGCCTTTTCT GCAACGCTGA TCACGGGCAG CGATCCAACC AACACCCTCC 2 5 AGAGTGACTA GGGGCGGAAA TTTAAAGGGA TTAATTTCCA CTCAACCACA AATCACAGTC GTCCCCGGTA TTGTCCTGCA GAATGCAATT TAAACTCTTC TGCGAATCGC TTGGATTCCC CGCCCCTAGT CGTAGAGCTT AAAGTATGTC CCTTGTCGAT GCGATGTATC ACAACATATA AATACTAGCA AGGGATGCCA TGCTTGGAGG ATAGCAACCG ACAACATCAC ATCAAGCTCT CCCTTCTCTG 30 AACAATAAAC CCCACAGAAG GCATTT

representing the sequence from nucleotide -1176 to -1 in FIG.

1, this sequence being preceded by the as yet sequenced upstream region of 1.05 kb from pTAKA 17 35 (position 0 to 1.05 in Fig. 2).

9 DK 169134 B1

The terminator and polyadenylation sequences can be obtained from the same sources as the promoters. Enhancer sequences can also be inserted into the construct.

The expressed product can accumulate within the 5 cells, requiring a rupture of the cells to isolate the product. To avoid this further step and also to minimize the amount of possible degradation of the expressed product in the cells, it is preferred that the product be secreted from the cells. For this purpose, the gene for the desired product is equipped with a pregregation which ensures effective delivery of the expressed product into the secretory pathway of the cell. This pre-region, which may be a naturally occurring signal or leader peptide or functional parts thereof or synthetic sequences providing secretion, is usually cleaved from the desired product during secretion, whereby the mature product is ready for isolation from the nutrient liquid.

The pre-region can be obtained from genes for secreted proteins from arbitrary organisms.

According to the present invention, the pre-region can be obtained from a glucoamylase or amylase gene of an Aspergillus species, an amylase gene of a Bacillus species, a lipase or proteinase gene of Rhizomucor miehei, the gene for the α-factor of S. cerevisiae or the calf prochymosin gene. More preferably, the pre-region is obtained from the gene for A. oryzae TAKA amylase, A. niger neutral α-amylase, A. niger acid stable α-amylase, B. licheniformis α-amylase, maltogenic amylase from Bacillus NCIB 11837, B. stearothermophilus α -amylase or B. licheni-formis subtilisin. Effective signal sequences are the A. oryzae 30 TAKA amylase signal, Rhizomucor miehei aspartate proteinase signal and Rhizomucor miehei lipase signal.

TAKA amylase signal has the following sequence ATGATGGTCGCGTGGTGGTCTCTATTTCTGTACGGCCTTCAGGTCGCGGCACCT MetMetValAlaTrpTrpSerLeuPheLeuTyrGlyLeuGlnValAlaAlaPro 35 10

GCTTTGGCT

AlaLeuAla

The gene of the desired product that is functionally associated with promoter and terminator sequences can be incorporated into a vector containing a selection marker, or may be placed on a separate vector or plasmid capable of integration into the host strain genome . As used herein, the term "vector system" means a single vector or single plasmid or two or more vectors or plasmids that together contain the total DNA information to be integrated into the host genome.

Vectors or plasmids can be linear or closed circular molecules. According to a preferred embodiment of the present invention, A. oryzae is co-transformed with two vectors, one containing the selection marker and the other comprising the residual foreign DNA to be introduced into the host organism, including the promoter, gene for the desired product and transcription terminator, and polyadenylation sequences. .

Normally A. oryzae transformants are stable and can be grown in the absence of a selection pressure. If the transformants are found to be unstable, the selection marker can be used for selection during cultivation. The transformed cells are then grown under a selection pressure corresponding to the marker used.

The present invention provides a method for producing high yields of many different polypeptides or protein products in A. oryzae. A.

30 oryzae have for years been used on a commercial scale to produce e.g. The TAKA amylase enzyme or proteolytic enzymes, and consequently the fermentation technology for this microorganism is well developed and the microorganism is approved for use in the food industry. The present invention provides for the use of A. oryzae for the industrial production of large quantities of basically any polypeptide or protein product. Examples of such products are chymosin or prochymosin and other milk coagulation enzymes, proteases, amyloglucosidases, acid stable amylases from Aspergillus, fungal lipases or prokaryotic lipases, as well as thermostable bacterial and fungal amylases.

The present invention is illustrated by the production of prochymosin, Rhizomucor miehei aspartate proteinase, TAKA amylase and a lipase from Rhizomucor miehei.

The genes for these enzymes were isolated from cDNA 10 libraries or genome libraries as described in further detail below.

The plasmids used as starting materials in the following examples are as follows: p285: (ATCC No. 20681) pCAMG91: Boel et al. EMBO Jornal 3 (1984), 1581-1585 pICI9R: Marsh et al. Gene 32 (1984), 481-485 pSal43: Berse et al. Gene 2J5 (1983), 109-117 John & Peberdy, Enzyme Microb.

Technol. 6 (1984), 386-389 p3SR2: J.M. Kelly and M.J. Hynes, EMBO

Journal 4 (1985), 475-479 pBR322: Bolivar F. et al., Gene 2_ (1977), 95-113 pBR327: Covarrubias L. et al., Gene 13 (1981), 25-35 pUC9, pUC13, Vieira et al., Gene Γ9 (1982), 259 and pUC19: 268 and Messing, Meth. in Enzymology 101 (1983), 20-27.

The following strains were used: A. niger: ATCC 1015, ATCC 10582 A. oryzae: ATCC 20423, IFO 4177, ATCC 1011,

ATCC 9576, ATCC 14488-11491, ATCC

11601 and ATCC 12892.

E. coli: MC1000 (Casabacan, M.J. and Cohen, 5, 169134 B1 S.N., J. Mol. Biol. U8, 179-207) (NCIB 11956)

Rhizomucor miehei: CBS 370.65

Example 1

Preparation of plasmid 285'proC containing the prochymosin gene

Preprochymosin gene from calf gastric cDNA library and inserted into the Pst I cleavage site of pBR322 by GC tailing (Chirgwin et al., Biochemistry _18 (1979), 5294 and Truelsen et al., Nucleic Acids Res. (1979), 3061) to obtain of pR26.

15 pUC9 was cut with SalI and filled with Klenow polymerase and ligated with T4 ligase. The resulting plasmid was cut with BamHI-EcoRI and the 2.7 kb fragment was ligated with a 0.47 kb BamHI-EcoRI fragment from pR26 containing the N-terminal end of the prochymosin gene to generate pUC9 '.

20 pUC9 'contains a HindIII cleavage site at the N-terminal end of the prochymosin gene. pUC13 was cut with BamHI-Narl and Narl-Xmal, and the large and small fragment, respectively, was ligated with a 0.64 kb Xmal-Bc11 fragment from pR26 containing the C-terminal end of the prochymosin gene to obtain plasmid pUCl3 '. pUC13 'contains an XbaI cleavage site at the C-terminal end of the prochymosin gene.

A 0.65 kb XmaI-XbaI fragment of pUC13 was ligated with a 0.46 kb HindIII-XmaI fragment from pUC9 'and an 11 kb XbaI-HindIII fragment from p285 to generate plasmid p285' proC, 30 which contains the prochymosin gene as shown in FIG. Third

DK 169134 Pg 13

Example 2

Cloning of the A. ory2ae TAKA amylase gene

Isolation of a partial cDNA clone 5 From A. oryzae Hw 325, grown on potato starch, mRNA was prepared according to Kaplan et al.

Biochem. 183, (1979) 181-84. A partial cDNA clone containing 1050 bp from the TAKA amylase gene was obtained by specific priming of mRNA with a 14-mer 10 oligonucleotide mixture:

A A A A

5'GG TT TC TG TT 3 '(NOR-168),

G G G G G

Which is complementary to the coding sequence for amino acids 295-299 of the TAKA amylase (Toda et al., Proc.Japan Acad. 58,

Ser. B, (1982) 208-212). A cloning procedure as described by Gubier & Hoffmann, Gene 25, (1983) 20 263-269 was used. Sequencing at the ends and in the middle of the cDNA clone showed the presence of sequences corresponding to the amino acid sequence of the TAKA amylase.

Isolation of a Genome Clone 25 Mycelium from A. oryzae Hw 325 was harvested and further processed to produce DNA according to the method used for A. niger described by Boel et al., Supra. Restriction fragments of 3 - 10 kb formed by partial digestion with Sau3A were ligated with BamHI digested, 30 dephosphorylated pBR322 (New England Biolabs). 50,000 recombinants were screened with the above-described oligonucleotide probe NOR-168, and 7 containing DNA encoding the TAKA amylase were found. A clone was selected for further use of the 2.1 kb promoter region above the mRNA-35 start. The restriction map for plasmid pTAKA 17 is shown in FIG. 2. pTAKA 17 transformed into an E. coli strain has been deposited by the Deutsche Sammlung von Microorganism (DSM), 14 DK 169134 B1

Griesebachstrasse 8, D-3400, Gottingen, on February 23, 1987 and received the landfill number DSM 4012. DSM, an international landfill authorized under the Budapest Treaty of 1977, ensures permanent landfill and public access 5, in accordance with Rules 9 and 11. of the above Treaty.

Example 3

Construction of a Rhizomucor miehei cDNA library 10 The Rhizomucor miehei phycomycete (for a morphological and taxonomic description of this species, see: Schipper, MAA on the genera Rhizomucor and Parasitella. In: Studies in mycology, Institute of the Royal Netherlands Academy of Sciences and Letters, No. 17 (1978), 15, 53-71) secrete an acidic proteinase (Rhizomucor miehei proteinase, hereafter abbreviated to RMP), which is widely used for coagulation of milk in cheese production. To obtain cDNA recombinant clones of this protein in E. coli, total RNA was extracted from homogenized R. miehei 20 mycelium as described by Boel et al. (EMBO J., 3: 1097-1102, 1984) and Chirgwin et al. (Biochemistry (Wash.), 18, 5294-5299, 1979). Poly (A) -containing RNA was obtained by two-affinity chromatography on oligo (dT) cellulose, as described by Aviv and Leder (PNAS, USA, J59, 1408-1412, 1972).

Oligo (dT) initiated complementary DNA was synthesized and double-stranded according to Gubier and Hoffman (Gene, 25, 263-269, 1983). Double-stranded cDNA was provided with tail with dCTP and terminal deoxynucleotidyltransferase as described by (Roychoudhury et al. (Nucleic Acids Res. 30, 101-106, 1976). Plasmid pBR327 was linearized with PstI and provided with dGTP. Oligo (dC) The dscDNA with tail was base paired with the oligo (dG) tail vector as described by Peacock et al., Biochem.Biophys.

Acta, 655, 243-250, 1981) and used to transform a 35 hsdR, M + derivative of E. coli MC1000 (Casadaban and Cohen, J. Mol. Biol. 138, 179-207, 1980) to form recombinant clones .

"R DK 169134 B1 15

Identification of RMP specific cDNA recombinants A mixture of 16 heptadecamer oligodeoxyribonucleotides

5 'A A A A

d (GC TCCA AA ΤΑ TA),

G G G G G

of which one is complementary to RMP mRNA in the region encoding Tyr-Tyr-Phe-Trp-Asp-Ale (Bech and Foltmann, Neth-milk Dairy J. 3J5: 275-280, 1981) was synthesized on an Applied Biosystems, Inc. DNA synthesizer and purified by polyacrylamide gel electrophoresis. About 10,000 E. coli recombinants from the Rhizomucor miehei cDNA library were transferred to Whatman 540 paper filters. The colonies were lysed and immobilized as described by Gergen et al. (Nucleic Acids

Res. 7, 2115-2135, 1979). The filters were hybridized with 32 P-labeled RMP-specific heptadecamer blend as described by Boel et al. (EMBO J.. 3, 1097-1102, 1984). Hybridization and washing of the filters were performed at 40 ° C followed by autoradiography for 24 hours with a gain screen. Miniprep plasmid DNA was isolated from a hybridizing colony of pRMP1016 by standard procedure (Birnboim and Doly, Nucleic Acids Res. 1, 1513-1523, 1979), and the DNA sequence of the 25 cDNA fragment was determined by the Maxam and Gilbert procedure (Methods Enzymol 5, 499-560, 1980). pRMP1016 was shown to contain part of the 5 'untranslated end of mRNA and then extends through the regions encoding a 69 amino acid preprion and 300 amino acids in the 30 mature portion of the RMP protein. Since pRMPl016 contained nothing

inserted fragment corresponding to the complete 3 'end of RMP

32 mRNA, the cDNA library was screened again with a P nick-translated 3 'specific restriction fragment from clone pRMP1016, thereby isolating clone pRMP2931. This clone 35 contains a portion of the 3 'untranslated region and an open reading frame of 270 triplets encoding the carboxy-terminal end of the :: RMP protein. Therefore, pRMP1016 and pRMP2931 have a significant overlap, and the combined sequence of the two clones yields the sequence of R. miehei preproMP cDNA. A total of 1416 nucleotides were sequenced between the G: C ends resulting from the cDNA cloning procedure.

5 The determined DNA sequence is shown in FIG. 4a and b together with the deduced amino acid sequence of a RMP precursor. In FIG. 4a and 4b, the horizontal lines indicate the position of a synthetic oligo mixture used for screening the cDNA library. An arrow shows the position where cleavage occurs in 10 ripening of natural RMP. The nucleotides are numbered from the first base of the starting Met codon, and the amino acids are numbered from the first amino acid residue in the mature RMP. From this cDNA sequence, it can be concluded that RMP is synthesized as a 430 amino acid precursor with a propeptide of 69 amino acids. A putative signal peptidase cleavage site (von Heijne,

Eur.J.Biochem. 133, 17-21, 1983) in this precursor could be between Ala (-48) and Arg (-47), and the mature RMP would be formed by autoproteolytic cleavage between Glu (-l) and Ala (+1). The cDNA-derived amino acid sequence of RMP is in good agreement with the previously published partial amino acid sequence (Bech and Foltmann, Neth-Milk Dairy J. 35: 275-280, 1981).

To facilitate further construction work with RMP cDNA, a HindIII linker was inserted into a Banl cleavage site just after the 3 'end of the TAA termination codon identified in clone pRMP2931 as follows: 25 µg pRMP2931 was digested with PstI two obtaining the RMPcDNA fragment. This fragment was purified by 1% agarose gel electrophoresis, electroeluted from the gel, purified with 30 phenol and chloroform extractions, and precipitated with NaCl and ethanol. This fragment encoding the 3 'half of the RMP was digested with BanI and the cohesive Ban1 restriction cleavage sites were filled with a mixture of 4 dNTPs and the Klenow fragment of E. coli DNA polymerase. To these filled ends, HindIII linkers were added in a T4 DNA ligase reaction. The ligation mixture was extracted with phenol and chloroform, and the DNA was precipitated with 4M NH 4 + acetate / ethanol. The purified DNA was digested with an excess of HindIII enzyme and a 380 bp fragment was purified on a 61 polyacrylamide gel. This fragment containing the 3 'end of the open reading frame for: RMP plus the TAA-5 termination codon was ligated to pIC19R digested with HindIII and treated with alkaline phosphatase. The ligation mixture was used to transform competent E. coli cells and transformants were selected on ampicillin-containing agar plates. Plasmid DNA was purified from the 10 transformants and correct recombinants were identified by restriction endonuclease digestion and agarose gel electrophoresis. From such a properly recombinant pRMP3 ', a 210 bp BglII / HindIII fragment was isolated by 6% polyacrylamide gel electrophoresis. This fragment contains the 31-end of 15 RMP cDNA from the BglII cleavage site at amino acids 297-299 and extends through the TAA termination codon to the inserted HindIII linker.

The 5 'portion of RMP cDNA was isolated from pRMP 1016 as a 997 bp HindIII / BglII fragment by 1% agarose gel electrophoresis. The HindIII cleavage site is located in RMP DNA at a position corresponding to residues -36 / -35 in the prosegment. This 997 bp 5 'fragment was ligated to the 210 bp 3 * fragment in pIC199 digested with HindIII and treated with phosphatase. With this ligation mixture, recombinants 25 from E. coli were obtained and a correct plasmid, pRMP, with the 5 'portion of the RMP associated with the 3' portion was identified by restriction enzyme analysis. The construction of pRMP is illustrated in FIG. 5. The pRMP does not encode the RMP pre-region and the 5 'half of the process segment.

30

Example 4

Construction of an Aspergillus Expression Vector Designed to Achieve Secretion of Active RMP 35 In this example, a plasmid for expression of RMP was constructed under the control of the glucoamylase promoter, glucoamylase signal, and glucoamylase terminator sequence. The glucoamylase promoter and terminator sequences were obtained from the genome glucoamylase gene cloned in vector pCAMG91. The construction of pCAMG91 is described by Boel et al. (EMBO Journal 3_ (1984), 1581-1585), and an endonuclease restriction map for plasmid pCAMG91 is shown in FIG. 6th

pCAMG91 was digested with SalI and PstI restriction endonucleases. From such a digested mixture, a 698 bp fragment was isolated on an agarose gel. This SalI-Pstl fragment contains the region encoding the 140 bp 10 3 'nontranslated portion of glucoamylase mRNA plus 540 bp 3' relative to the poly (A) addition site. This 3 'fragment was treated with T4 DNA polymerase to provide the restriction cleavage site with straight cut ends prior to the application of Xba I linkers and digestion with Xba I restriction enzyme. This 15 'end of the glucoamylase gene was ligated to pUCl3 linearized with XbaI to form plasmid pAMG / Term containing the poly (A) addition region of the glucoamylase gene. The construction of pAMG / Term is illustrated in FIG. 7a.

The 3 'end of the A. niger glucoamylase gene was obtained 20 as a 700 bp XbaI fragment from pAMG / Term. This terminator fragment was ligated to pIC199 digested with XbaI and treated with phosphatase. With this ligation mixture, recombinants from E. coli were obtained and a correct plasmid, pICAMG / Term, with the 5 'end of terminator fragment 25 adjacent to the HindIII cleavage site in the multiple cloning site of the pIC19R vector was identified by restriction enzyme analysis. The construction of pICAMG / Term is illustrated in FIG. 7a. From the pICAMG / Term, the glucoamylase ether miner (AMG terminator) region was isolated as a 750 bp HindIII / Clal cleavage fragment by 1% agarose gel electrophoresis. From the pCAMG91, the glucoamylase promoter (AMG promoter) was isolated along with the regions encoding the glucoamylase signal peptide, hexapeptide fragment and ampicillin resistance gene (Amp) of pBR322 as a 3.5 kb Clal / BssHII 35 fragment at 1% agarose gel. A synthetic BssHII / HindIII linker was prepared from two synthetic 31'-mer 169 DK 169134 B1 19 oligonucleotides manufactured on an Applied Biosystems Inc. DNA synthesizer. The synthetic linker has the following structure:

5 'RVSKQSESKD

CGCGTAAGTAAGCAGAGCGAGAGCAAGGATA

ATTCATTCGTCTCGCTCTCGTTCCTATTCGA

This linker was used in a ligation reaction 10 with the 3.5 kb fragment containing the glucoamylase promoter and the 750 bp fragment containing the glucoamylase terminator. The ligation mixture was used to transform E. coli and a correct recombinant, p673 was identified by restriction endonuclease cleavage. The isolated p673 is a HindIII cloning vector into which a suitable HindIII cDNA fragment can be inserted between the glucoamylase hexapeptide process segment and the glucoamylase transcription terminator region. The inserted cDNA will be under the transcriptional control of the glucoamylase promoter and the secretion of the translated fusion product will be directed by the glucoamylase signal peptide plus the glucoamylase hexapeptide segment. p673 was digested with HindIII, treated with alkaline phpsphatase and ligated to a 1.2 kb HindIII fragment purified from a digested mixture of pRMP, the ligation mixture was used to transform E. coli and a recombinant p686 with RMP cDNA inserted into proper orientation to achieve RMP expression was isolated and characterized by restriction endonuclease cleavages. p686 encodes an RMP precursor having the following structure: glucoamylase signal peptide, glucoamylase hexapropeptide, amino acids -45 to -1 of the propeptide from RMP, 361 amino acids of mature RMP. The construction of p686 is illustrated in FIG. 7b.

35 20 DK 169134 B1

Example 5 In a preferred embodiment of the present invention, the open reading frame of the preproMP is to be inserted into an expression plasmid under the control of the promoter of the A. niger glucoamylase gene or the A. oryzae TAKA amylase gene. To achieve this, a BamHI restriction endonuclease cleavage site was inserted just in front of the 5 'end of the start methionine codon of the preproRMP signal peptide as follows: pRMP1016 was digested with Ddel which cleaves in the 10 cDNA at a position corresponding to the amino acid residues Ser (- 66) and Gln (-65), and with HindIII cleaving in the cDNA at a position corresponding to the amino acid residues Lys (-36) and Leu (~ 35). The resulting 89 bp Ddel / HindIII fragment was purified on an 8% polyacrylamide gel, electroeluted and ethanol precipitated after 15 phenol and CHCl3 extractions. A synthetic DNA fragment of the following sequence was synthesized as two oligonucleotides on an Applied Biosystems Inc. DNA synthesizer:

M L F S

20 GATCCACCATGCTGTTCTC oligo 697/698

GTGGTACGACAAGGAAGT

This fragment has a BamHI cohesive end at the 5 'end of the startMet codon and a Ddel cohesive end at the 3' end. The two oligonucleotides were kinated with ATP and T4 polynucleotide kinase, base-paired to each other and then ligated to the 89 bp Ddel / HindIII RMP fragment purified from pRMP 1016 in a BamHI / HindIII digested pUC13 vector. The ligation mixture was used to transform E. coli cells and correct 30 recombinants were identified by restriction enzyme cleavages on miniprep-purified plasmids. Correct recombinant plasmids were sequenced to verify the sequence of the oligonucleotides used. Such a correct plasmid pRMP5 'was digested with BamHI and HindIII, and a 110 bp BamHI / HindIII fragment with the startMet codon, RMP signal peptide and a portion of the RMP process segment was purified by 10% polyacrylamide gel electrophoresis. The fragment was electroeluted, phenol- and CHCl4-extracted and precipitated with ethanol. The remaining portion of the open RMP reading frame and the AMG terminator sequences were obtained from plasmid p686 after digestion with EcoRI and partial HindIII digestion. Thereby, a 1.9 kb fragment was released and this fragment was purified by agarose gel electrophoresis, electroelution, phenol and CHCl 3 extraction before ethanol precipitation. This 1.9 kb fragment was ligated to the 110 bp BamHI / HindIII fragment from pRMP5 'in a pUC13 vector that had been digested with BamHI and EcoRI.

The ligation mixture was used to transform E. coli cells and correct recombinants were identified by restriction enzyme cleavages on miniprep-purified plasmids.

One such correct recombinant was pRMPAMGTerm. The construction of pRMPAMGTerm is illustrated in FIG. 8th

15

Example 6

Construction of an Aspergillus Expression Vector Designed to Obtain Secretion of Active RMPi A. oryzae by 20 Aspergillus niger glucoamylase promoter • The glucoamylase promoter was isolated as follows: 25 µg of pCAMG91 was digested with EcoRI and BssHII restriction endonucleases. Following this double digestion, a 270 bp DNA fragment could be isolated by agarose gel electrophoresis.

This fragment contains part of the promoter region, the 5 'untranslated region, and the signal peptide of the glucoamylase gene (AMG gene). After electroelution of DNA from the agarose gel, the fragment was purified by phenol and CHCl3 extractions before ethanol precipitation. The 270 bp fragment was then digested with SfaNI. This enzyme has a cleavage site just before the 5 'end of the start ATG methionine codon of the glucoamylase gene. After complete digestion, DNA was treated with the large fragment (Klenow) of DNA polymerase I and all four dNTPs to form straight cut ends on DNA.

This DNA was provided with BglII linkers with DNA ligase and DNA was digested with excess BglII restriction enzyme.

After separating DNA fragments on a 10% polyacrylamide gel, a 175 bp BglII fragment could be isolated by electroelution. This fragment has a Bgm linker inserted at a position corresponding to the SfaNI restriction cleavage site just in front of the 5 'end of the 5 start methionine codon. This piece of DNA was ligated to a pIC19R vector digested with BglII and treated with alkaline phosphatase and the ligation mixture used to transform E. coli cells. Among the resulting transformants, correct plasmids were identified by 10 restriction enzyme cleavages on mini prep plasmids. Such a correct plasmid pB404.1 was digested with Nsil and BglII to release a 0.16 kb fragment containing the 5 'nontranslated region of the glucoamylase gene together with ca.

100 bp of the 3 'end of the promoter region. This fragment was purified by polyacrylamide gel electrophoresis, electrolyzed, phenol and CHCl 3 extracted and ethanol precipitated. To attach this fragment to the remaining portion of the glucoamylase promoter region of pCAMG91, the following steps were performed: 25 µg of pCAMG91 was digested with BssHII and then further partially digested with Ndel. After filling the ends of the fragment with all four dNTPs and the Klenow DNA polymerase fragment, a 1.4 kb DNA fragment was isolated on a 1% agarose gel. This fragment contains the entire promoter region together with the 5 'non-translated region 25 and the region encoding the signal peptide. The fragment was electroeluted, phenol- and CHCl4-extracted and precipitated with ethanol to concentrate DNA. After digestion with Nsil, DNA was run on a 1% agarose gel and a 1.2 kb Nde I - Nsil fragment was isolated by electroelution. This DNA 30 had been provided with straight cut ends at the Nde I cleavage site in a previous reaction and was now ligated to the 0.16 kb Nsil - BglII fragment of pB401.1 in a pIC19R vector digested with Nrul - BglII. The ligation mixture was used to transform E. coli cells and among the 35 transformants obtained, correct recombinants were identified by restriction enzyme cleavages of miniprep plasmids. Such correctly recombinant pB408.3 was digested with HindIII and BglII, and the glucoamylase (AMG) promoter was isolated as a 1.4 kb fragment on a 1% agarose gel. The fragment was electroeluted, phenol and CHCl3 extracted and ethanol precipitated. This glucoamylase promoter-5 fragment was then ligated to a 2.0 kb BamHI-EcoRI fragment from pRMPAMGTerm (see Example 5) in a pUC19 vector digested with HindIII-EcoRI. The ligation mixture was used to transform E. coli cells, and among the resulting transformants, correct recombinants were identified by 10 restriction enzyme cleavages of miniprep plasmids. Such proper recombinant p778 was grown in large dishes to isolate recombinant plasmid and the plasmid preparation was purified by CSCl / ethidium bromide centrifugation. This plasmid directs the synthesis of RMP under the control of 15 glucoamylase promoter and glucoamylase terminator sequences. Constructions of p408.3 are illustrated in FIG. 9a, and the construction of p778 is illustrated in FIG. 9b.

Example 7

Construction of an Aspergillus expression vector designed to achieve secretion of active RMP by the Aspergillus oryzae TAKA amylase promoter 50 µg of plasmid pTAKA17 (see Example 2) containing the Aspergillus oryzae TAKA amylase gene was digested with Sall. This enzyme has a restriction cleavage site in the genomic DNA at a position corresponding to amino acid residue 26 of the mature TAKA amylase. Another SalI restriction cleavage site is located approx. 1300 nucleotides 30 above this position, i.e. at the 5 'end of the upstream promoter region. After SalI digestion, this 1300 bp fragment containing the promoter was purified by agarose gel electrophoresis and DNA was purified by phenol and CHCl 2 extractions and the ethanol precipitated. DNA was then dissolved in 35 exonuclease III buffer and digested with exonuclease III according to Henikoff, S. (Gene, 2: 8: 351-359, 1984). The reaction was stopped to obtain ca. 130 bp deletions at each end of the 24 DNA. The deletion of ca. 130 bp from the SalI cleavage site in the coding portion of the TAKA amylase gene — in this way, allows the insertion of a multiple cloning linker fragment just above the starting methionine codon. The exonuclease III-5 treated DNA was digested with SI nuclease according to Henikoff, S. (Gene, 28: 351-359, 1984) and precipitated with ethanol after phenol and CHCl 2 extractions. Repair of S1 nuclease-treated DNA to obtain ligatable straight cut ends was performed with all four dNTPs and the Klenov fragment of DNA 10 polymerase I according to Henikoff, S., (Gene, 2J3: 351-359, 1984). DNA was digested with Eco RI, which cleaves one site in the 1300 bp Sall fragment to form two groups of fragments. One group was approx. 380 bp long and represented upstream regions, while the other group was approx. 620 bp long 15 and contained the promoter region. These groups of EcoRI digested products were separated on an agarose gel and the ca.

620 bp DNA fragments were electroeluted and ligated to an Eco RI / SmaI digested pUC19 vector. The ligation mixture was used to transform competent E. coli cells, 20, and miniprep plasmid DNA was isolated from the recombinants.

These deletion mutants were characterized by restriction enzyme cleavages to identify plasmids with deletion endpoints just at 5 'of the starting methionine codon. A few candidates with the desired 25 characteristics were sequenced and a mutant (p9) having 9 bp deleted at 5 'of A in the ATG methionine codon was selected for further constructs. p9 was digested with Eco RI and HindIII, and a 645 bp TAKA amylase promoter-containing fragment was isolated by agarose gel electrophoresis, phenol- and CHCl4-extracted, and precipitated with ethanol. pTAKA17 was digested with SalI and EcoRI, and a 510 bp fragment containing the TAKA amylase promoter upstream regions was isolated by agarose gel electrophoresis, phenol and CHCl4 extracted and precipitated with ethanol. These promoter regions were ligated to each other and to a pIC19R vector that had been digested with SalI and HindIII. The ligation mixture was used to transform E. coli cells, and correct, s DK 169134 B1

LO

recombinants were identified by restriction enzyme cleavages of plasmids extracted as mini prep preparations. In such a recombinant p719, the TAKA amylase promoter region of Aspergillus oryzae was found as a 1.1 kb fragment that can be excised by a number of different restriction enzymes. The construction of p719 is illustrated in FIG. 10th

From pRMPAMGTerm, the open reading frame of the preproMP and the glucoamylase terminator region (AMGTerm) was isolated as a 2 kb fragment after digestion with BamHI and 10 EcoRI. This fragment was purified by agarose gel electrophoresis, phenol and CKCl 2 extractions and then concentrated by ethanol precipitation. The promoter of the A. oryzae TAKA amylase was now isolated as a 1.1 kb fragment obtained after digestion of p719 with SalI and BamHI. This fragment was purified by agarose gel electrophoresis, phenol and CHCl 3 extractions and then precipitated with ethanol. The 1.1 kb promoter fragment was ligated to the 2 kb BamHI / EcoRI fragment from pRMPAMGTerm in a pUC19 vector that had been digested with SalI and EcoRI. The ligation mixture was used to transform E. coli cells and among the resulting transformants, correct recombinants were identified by restriction enzyme cleavages of miniprep plasmids. Such proper recombinant p777 was grown on a large scale to isolate recombinant plasmid and the plasmid preparation was purified by CsCl / ethidium bromide centrifugation. The construction of p777 is illustrated in FIG. 11th

Example 8 Construction of an Aspergillus Expression Vector Designed to Achieve Secretion of Rhizomucor miehei Lipase Under the Control of the Aspergillus oryzae TAKA Amylase Promoter

Construction and identification of a lipase cDNA clone in E.

35 coli 26 DK 169134 B1

To obtain information permitting the construction of a specific oligonucleotide probe, a partial sequence analysis was performed on purified Rhizomucor miehei lipase (Moskowitz, GJ et al., J. Agric. Food; Chem., 2j> 5 (1977), 1146- 1150). In the following text, the abbreviation RML is used for the Rhizomucor miehei lipase. The supernatant from a culture liquid of Rhizomucor miehei from which the mycelium and low molecular weight substances had been removed was subjected to anion exchange chromatography. The largest lipolytic fraction from the column was desalted and ultrafiltered before lyophilization. The lyophilized powder was then subjected to affinity chromatography. The total lipase fractions from the column were desalted and concentrated by ultrafiltration. This concentrate was then subjected to hydrophobic interaction chromatography (HIC) and the lipase from HI C purification was used for amino acid sequencing. Sequencing was performed both on the native enzyme (N-terminal sequence) and on the selected fragment obtained after proteolytic cleavage of the Armillaria mellea protease lipase. Sequence determination was performed on a gas phase sequencer (Applied

Biosystems Model 470A) as described by Thim, L. et al. (FEBS Lett., 212 (1987), 307-312).

RML was digested with Armillaria mellea protease as described by Moody et al. (FEBS Lett. 172 (1984), 142-25 148) with the one exception that the ratio of enzyme to substrate was 1:40 (mol: mol). The obtained fragments were separated by HPLC and the UV absorption was monitored at 280 nm and 214 nm. To identify suitable fragments for constructing oligonucleotide probes, only peptides with a high ratio of 280 nm to 214 nm were sequenced, as these fragments contain Trp and / or Tyr.

The following N-terminal sequence was found using native RML: 35 27 DK 169134 B1 5 10 15

Ser-Ile-Asp-Gly-Gly-Ile-Arg-Ala-Ala-Thr-Ser-Gln-glu-Ile-Asn-25

Glu-Leu-Thr-Tyr-Tyr-Thr-X-Leu- (Ser) - (Ala) -.

5

One of the isolated fragments from the proteolytic cleavage had the sequence: Arg-Thr-Val-Ile-Pro-Gly-Ala-Thr-Trp-Asp-X-Ile-His, and this fragment was used for the synthesis of a specific oligonucleotide probe.

The Rhizomucor miehei cDNA library of Example 3 constructed for the isolation of aspartate protease (RMP) recombinants from this organism was also used for the identification of lipase-specific recombinants. A mixture of oligonucleotides was synthesized on an Applied 15 Biosystems Inc. DNA synthesizer. The mixture having the following structure:

A

5 'TCCCANGTNGCNCC 3' 430/431

20 G

is complementary to RiML mRNA in a region encoding the amino acids Gly-Ala-Thr-Trp-Asp. This pentapeptide was identified as a segment from an amino acid sequence obtained from proteolytic fragments of purified RML protein (see above).

The Rhizomucor miehei cDNA library was screened 32 with the mixture of β-kinase lipase oligonucleotides as described in connection with the screening of the RMP-specific mixture. Hybridization and the first washing of the filters were performed at 43 ° C. After autoradiography, the filters were washed at 47 ° C. Colonies showing strong hybridization were isolated and the cDNA inserted into the corresponding plasmids was sequenced to identify RML-specific 35 recombinants. Two such recombinants p353.7 and p353.16 had inserted fragments of ca. 1.2 kb. The DNA sequence obtained from these two recombinants started in the middle of the DK 169134 B1 28 signal peptide (see Fig. 12) and extends through the poly-A end. In this region, a long open reading frame could be identified. Since the two recombinants do not contain the sequence of the 5 'portion of the signal peptide with its starting methionine codon, 5 a synthetic oligonucleotide (584) 5' CGAGAGGGGATGAGGGGTGG 3 '584 was synthesized.

This oligonucleotide 584 is complementary to RML mRNA in the region encoding an amino acid sequence Pro-Pro-Leu-Ile-Pro-Ser-Arg found in the propeptide region (see Figure 12). After oligo 584 was kinated to highly specific activity with o T4 polynucleotide kinase and β - ATP, it was used in a primer extension reaction to Rhizomucor miehei mRNA with AMV reverse transcriptase according to published procedures (Boel, E.

, Et al., PNAS, USA, 80, 2866-2869, 1983). The products of the primer extension reaction were electrophoresed on a 10% polyacrylamide / urea gel and two cDNA products were isolated. These two cDNAs, one 150 nucleotides long and the other 160 nucleotides long, were both electroeluted and sequenced by the chemical sequencing procedure for DNA sequencing. Both cDNA fragments yielded readable sequences extending from the primer region up to a position 9 nucleotides 5 'of the starting methionine codon.

The sequence confirmed the sequence obtained from lipase recombinant cDNA plasmids. The length of the two cDNA products from the primer extension shows that the 5 'end (CAP site) of lipase mRNA is located approx. 5 or 15 nucleotides above the 5 'end of the first A nucleotide shown in FIG. 12. A microheterogeneity at the 5 'end of fungal mRNA is very common. By combining the sequence obtained from the two cloned cDNA fragments p353.7 and p353.16 with the sequence from the primer extension assay, the amino acid sequence of the RML precursor can be determined. The DNA sequence and corresponding amino acid sequence of the RML precursor are shown in FIG. 12. In FIG. 12, the horizontal lines indicate the position of synthetic oligonucleotides used for cDNA synthesis and for screening cDNA libraries. An arrow indicates the position at which cleavage occurs during the maturation of the native RML. The nucleotides are numbered from the first base of the startMet codon and the amino acids are numbered from the first amino acid residue in the mature native RML. This RML is encoded by an open reading frame 5 extending from the startMet codon and through 363 codons before reaching a stop codon. In this precursor, the first 24 amino acid residues constitute a typical hydrophobic signal peptide. According to von Heyne's rules (Eur. J. Biochem. 133, 17-21, 1983), the signal peptide will be cleaved from the following propeptide by means of signal peptidase cleavage between the Ala and Val residues at positions -71 and -70, respectively.

Since the N-terminal amino acid sequence analysis of purified RML obtained from the culture supernatant of Rhizomucor miehei identified Ser-Ile-Asp-Gly-Gly-Ile-Arg as the N-terminal end of the active RML enzyme, the propeptide consists of the RML precursor of the next 70 amino acid residues in the precursor. Starting with this N-terminal Ser residue, the mature RML extends through 269 residues before reaching the termination codon. In this mature 29500 dalton enzyme, a lipase substrate binding site is located around amino acid residue Ser (144), which is conserved in a number of lipases. At the 3 'end of RML mRNA, 104 nucleotides were localized as an untranslated region between the TAA stop codon and the poly (A) end.

Twenty-three nucleotides above the 5 'end of this poly (A) terminus, 25 found a repetitive structure consisting of 7 AT base pairs, while no typical eukaryotic polyadenylation signal could be identified.

In a preferred embodiment of the present invention, a number of changes were made to the RML cDNA. These alterations involve removal of G: C tails added to cDNA during the cloning and introduction of restriction endonuclease cleavage sites at the 5 'end and 3' end of the open reading frame. A number of suitable restriction cleavage sites were also introduced into the signal peptide and propeptide regions of the cDNA.

B1 p353.16 was digested with FnuDII and an 880 bp DNA fragment (from the 3 'end of RML cDNA) was isolated by agarose gel electrophoresis. The fragment was electroeluted, phenol- and CHCl4-extracted and precipitated with ethanol.

This 3 'end of RML cDNA was then ligated to a pUC19 vector that had been cleaved with SmaI and treated with alkaline phosphatase. The ligation mixture was used to transform competent E. coli cells and among the resulting transformants, correct recombinants were identified by restriction enzyme cleavage of miniprep plasmids.

Such a suitable recombinant p435.2 was digested with Ban11 and HinduI, and a 0.69 kb fragment was isolated by agarose gel electrophoresis. The fragment was electroeluted, phenol- and CHCl4-extracted and precipitated with ethanol. This fragment of 15 RML cDNA now contained a substantial portion of the multiple pUC19 cloning site associated with its 3 'nontranslated region.

The 51-end of RML cDNA was recovered using synthetic oligonucleotides to introduce appropriate restriction cleavage sites. The DNA sequence of the synthetic 20 fragment (RML 5 ') is shown in FIG. 14. The position of introduced restriction cleavage sites and the unified fragments of the individually synthesized oligonucleotides is indicated by horizontal and vertical / horizontal lines, respectively. The resulting fragment (RML 5 ') was purified as a 150 bp fragment on a 2% agarose gel, electroeluted, phenol- and CHCl4-extracted and precipitated with ethanol before further ligation reactions.

p353.7 was digested with BanI and BanII, and a 387 bp RML fragment was purified by 10% polyacrylamide gel electrophoresis. The fragment was electroeluted, phenol- and CHCl4-extracted before ethanol precipitation, and then ligated to the synthetic RML 5 'fragment and the 0.69 kb BanIII / HindIII fragment from p435.2 in a BamHI / HindIII digested pUC13 vector. The ligation mixture was used to transform competent E. coli cells, and among the resulting transformants, correct recombinants were identified by restriction enzyme cleavages 3 in DK 169134 B1 on mini prep plasmids. In such properly recombinant pB544, the synthetic moiety was sequenced to confirm the expected structure. The construction of pB544 is illustrated in FIG. 13a. From pB544, prepro-RML cDNA was isolated as a 1.2 5 kb Bam HI fragment by agarose gel electrophoresis. An expression vector based on the promoter of the Aspergillus oryzae TAKA amylase gene and the terminator of the Aspergillus niger glucoamylase gene were prepared as follows: p719 (see Example 7) was digested with SalI and BamHI. The resulting 1.1 kb TAKA amylase promoter fragment was purified by agarose gel electrophoresis. plCAMG / Term (see Example 4) was digested with BamHI and EcoRI. The resulting 0.75 kb glucoamylase terminator fragment was purified by agarose gel electrophoresis. After phenol and CHCl 3 extractions, these two fragments were precipitated with ethanol and ligated to a SalI / EcoRI digested pUC19 vector. The ligation mixture was used to transform E. coli cells and among the resulting transformants, correct recombinants were identified by restriction enzyme cleavage of miniprep plasmids.

Such a properly recombinant p775 was digested with BamHI and treated with alkaline phosphatase. The 1.2 kb BamHI RML prepro cDNA fragment from pB544 was ligated to this p775 vector and transformed into E. coli. A recombinant p787 with RML prepro cDNA inserted in the correct orientation between the promoter and the terminator was identified by restriction enzyme cleavages on mini prep plasmids extracted from E. coli transformants. p787 plasmid DNA was grown on a large scale and the plasmid preparation was purified by CsCl / ethidium bromide centrifugation. The construction of p787 is illustrated in FIG.

13b.

Example 9

Transforming Aspergillus oryzae (General Procedure) 35 100 ml YPD (Sherman et al., Methods in Yeast

Genetics, Cold Spring Harbor Laboratory, 1981) was seeded with spores of A. oryzae, IFO 4177 or argB mutants thereof, and incubated with shaking at 37 ° C for two ca. days.

The mycelia were harvested by filtration through miracle cloth and washed with 200 ml of 0.6 M MgSO 4. The mycelium was suspended in 15 ml 1.2 M MgSO 4, 10 mM NaH 2 PO 4, pH = 5.8. The suspension was cooled on ice and 1 ml of buffer containing 120 mg of Novozym® 234, batch 1687. After 1 minute, 1 ml of 12 mg / ml of BSA (Sigma type H25) was added and the incubation was continued under gentle stirring for 1.5 - 2.5 hours at 37 ° C until a large number of protoplasts were visible in a sample examined under a microscope.

The suspension was filtered through miracle cloth, the filtrate was transferred to sterile tubes and coated with 5 ml of 0.6 M sorbitol, 100 mM Tris-HCl, pH = 7.0. Centrifuge for 15 minutes at 1000 g and protoplasts were collected 15 from the top of the MgSO 2 pad. 2 volumes of STC (1.2 M sorbitol, 10 mM Tris-HCl pH = 7.5, 10 mM CaCl 2) were added to the protoplast suspension and the mixture was centrifuged for 5 minutes at 1000 g. The protoplast pellet was resuspended in 3 ml. STC and the repeller. This was repeated. Finally, the 20 protoplasts were resuspended in 0.2 - 1 ml of STC.

100 μΐ of the protoplast suspension was mixed with 5-25 μg of the DNA in 10 μΐ STC. The protoplasts from argB strains were mixed with pSal43 DNA (a plasmid carrying an A. nidulans argB gene) and protoplasts from argB + 25 strains were mixed with p3SR2 (a plasmid carrying an A. nidulans amdS gene). The mixture was allowed to stand at room temperature for 25 minutes and 0.2 ml of 60% PEG 4000 (BDH 29576), 10 mM CaCl2 and 10 mM Tris-HCl pH = 7.5 were added and carefully mixed (twice). finally, 0.85 ml of the same solution was added and mixed thoroughly. The mixture was left at room temperature for 25 minutes, centrifuged for 15 minutes at 2500 g, and the pill resuspended in 2 ml of 1.2 M sorbitol. After further sedimentation, the protoplasts were spread on appropriate 35 plates. Protoplasts from argB strains transformed with pSal43 were spread on minimal plates (Cove,

Biochem, Biophys.Acta 113 (1966) 51-56) with glucose and 33 DK 169134 B1 urea as carbon and nitrogen source respectively and containing 1.2 M sorbitol for osmotic stabilization. Protoplasts from the argB strains transformed with p3SR2 were spread on minimal plates (Cove, Biochem. Biophys. Acta 113 - (1966) 51-56) 5 containing 1.0 M sucrose, pH = 7.0, 10 mM acetamide as a nitrogen source and 20 mM CsCl to inhibit background growth. After incubation for 4-7 days at 37 ° C, the spores were taken up, suspended in sterile water and spread to single colonies. This procedure was repeated and the spores from a single colony after the second re-isolation were stored as a specific transformant.

Example 10 Expression of TAKA Amylase in a Wild Type A. Oryzae Strain pTAKA 17 was transformed into A. oryzae IFO 4177 by cotransformation with p3SR2 containing the A. nidulans amdS gene as described Example 9. Protoplasts prepared as described were incubated with a mixing equal 20 amounts of pTAKA 17 and p3SR2 using approx. 5 pg of each. 9 transformants which could use acetamide as the sole source of nitrogen were re-isolated twice. After growth on YPD (Sherman et al., 1981) for three days, the culture supernatants were analyzed by SDS-PAGE. The gels were stained with coomassie 25 brilliant blue R. The best transformants produced 10-20 times more amylase than non-transformed IFO 4177. A transformant was selected for further studies and grown in a 2 liter Kieler fermentation container of 4% soybean flour, glucose was added during growth. The culture was stirred vigorously during fermentation. Under these conditions, IFO 4177 gave approx. 1 g / l and the transformant approx. 12 g / l amylase determined by enzyme activity. Enzyme activity was measured as the ability to break down starch (Cereal Chemistry 3j5 (1939), 712-723). The starch used was Merck Amylum 35 solubilized B.6 and the sample was carried out at pH 4.7 and at 37 ° C. No β-amylase was added.

DK 169134 Pg 34

Example 11

Expression of RMP in A. oryzae p777 from Example 7 or p778 from Example 6 was transformed into IFO-4177 by the cotransformation with p3SR2 in the manner described in Example 9. Transformants were selected and re-insulated as described in Example 9.

Transformants were grown for three days in YPD and the supernatants analyzed by SDS-PAGE followed by Western blotting and ELISA. The supernatants of 10 transformants of both p777 and p778 contained from 50 - 150 mg / l protein that reacts with RMP antibody. The proteinase was overglycosylated in comparison with R. miehei-produced proteinase. Two forms were seen, one of which was thought to be the proform and the other to be cleaved off of mature proteinase. Two transformants of p778 and three transformants of p777 were grown in a fermentation vessel as described above for the TAKA amylase transformants. The two transformants of p778 yielded ca. 0.2 g / l and 0.4 g / l, and the three transformants of p777 yielded ca. 0.5 g / l, 2.4 g / l and 3.3 g / l of 20 RMP determined as milk coagulation activity by

The Kunitz method (Kunitz M., Jour. Gen. Physiol. 1É5 (1935), 459-466), assuming that the specific activity of recombinant RMP is the same as that of the Rhizomucor miehei enzyme. (This has been confirmed later). SDS-PAGE and 25 SDS-PAGE followed by Western blotting and ELISA showed that there was only one form of RMP when grown on a large scale. This RMP was also overglycosylated under these growth conditions. The amount of protein seen on gels_ corresponds well to the amount determined from enzyme activity.

30 RMP was purified from the culture liquid supernatant by affinity chromatography and size exclusion chromatography.

The N-terminal sequence of the purified recombinant RMP was determined using a gas phase sequencer as described by Thim et al. (FEBS Lett, 1987 under 35 printing).

35 DK 169134 B1

Two forms of recombinant RMP were found, showing that the cleavage at the N-terminal end is heterogeneous. One form has the following N-terminal sequence: Ala-Asp-Gly-Ser-Val-Asp-Thr-Pro-Gly-Tyr-, and the other form 5 has the following N-terminal sequence: Gly-Ser-Val-Asp -Thr-Pro-Gly-Tyr-Tyr-Asp-. Such heterogeneous cleavage at the N-terminal end is also described for native RMP from Mucor miehei (Paquet, D. et al., Neth. Milk.Dairy J., 35 (1981), 358-360). Since the heterogeneous cleavage of the recombinant RMP 10 corresponds well with the cleavage of native RMP, it has been demonstrated in the present invention that A. oryzae is capable of cleaving recombinant RMP in the correct region.

15

Example 12

Construction of an expression plasmid for production of prochymosin in A. oryzae

The construct contains the prochymosin gene immediately preceded by the signal peptide sequence of the A. oryzae TAKA amylase gene under the control of the A. oryzae TAKA amylase promoter. The construct further contains the terminator of the A. niger glucoamylase gene plus an E. coli replicon.

An approx. 430 bp Bam HI / Xmal fragment from p285 'proC 25 (see Example 1) and a synthetic oligomer of the following sequence

AATTCCAGCTGCCGCGGCCGAGATCACCAG

GGTCGACGGCGCCGGCTCTAGTGGTCCTAG

30 were inserted into EcoRI-Xmal cut pUC19 plasmid to generate plasmid pToC50a.

pToC50a was cut with Eco RI-SacII and the large fragment containing pUC19 and the 5 'end of the prochymosin gene (prochymosin') was isolated. This fragment was ligated to a 0.6 kb EcoRI-Banl fragment from pTAKA 17 and the following synthetic oligomer 36 DK 169134 B1

GCACCTGCTTTGGC

GACGAAAC (KFN 280/281) 5 - After transformation, a plasmid pToC51 containing the 5 'portion of the prochymosin gene (prochymosin') associated with the signal sequence of the A. oryzae TAKA amylase gene (preTAKA) was isolated and preceded by ca. 500 bp upstream TAKA amylase sequences. The construction of pToCS1 is illustrated in FIG. 15a.

pR26 was digested with HinfI, treated with the large fragment (Klenow) of DNA polymerase I and the four dNTPs, and cut with Xmal. A 750 bp fragment containing the 3 'end of the prochymosin gene was isolated. For the purpose of inserting a HindIII cleavage site at the 31-end of this fragment, pUC9 was digested with Xmal / HincII, and the large fragment was ligated to the 750 bp fragment containing the 3 'end of the prochymosin gene.

A 5.6 kb EcoRI-ClII fragment from pTAKA 17 was isolated and ligated to a 2.6 kb Clα-HindIII fragment from the same plasmid plus a 0.7 kb EcoRI-HindIII fragment from pICAMG / Term (see Example 4) containing the A. niger glucoamyla signal terminator and the polyA site. The resulting plasmid is shown in FIG. 15b as pToC52.

25 pToC52 was cut with HindIII and partially with EcoRI, and a 6.4 kb fragment was isolated. This was ligated to a 0.9 kb EcoRI-Xmal fragment from pToC51 and a 0.7 kb XmaI-HindIII fragment from pUC9'PC containing the 3 'portion of the prochymosin gene (' prochymosin). The resulting plasmid is designated pToC56 and is shown in FIG. 15b.

37 DK 169134 B1

Example 13

Expression of prochymosin in A. oryzae pToC56 was transformed into A. oryzae IFO 4177 or an argB mutant thereof by cotransformation with either 5 p3SR2 (amdS gene) or pSal43 (argB gene). Transformants growing on selective media were re-isolated twice as described in Example 9.

The transformants were grown for three days on YPD and the prochymosin content of the supernatants was analyzed by ELISA on a Western blot after SDS-PAGE. The transformants produced 1-10 mg / l of an immunoreactive prochymosin size protein in the supernatants. No other immunoreactive proteins could be detected in the supernatants.

15

Example 14

Expression in RML in A. oryzae p787 from Example 8 was transformed into IFO-4177 by cotransformation with p3SR2 in the manner described in Example 9. The transformants were selected and re-insulated as described in Example 9.

Supernatants from YPD cultures of the transformants grown for three days were analyzed by SDS-PAGE followed by Western blotting and ELISA. The best transformant produces 25 mg / l of a protein of the same size as mature RML.

The lipase activities in the supernatants were measured as the ability to cleave tributyrin (NOVO method AF 95.1 / 3-GB).

The measurement confirmed that 2 mg / l of active lipase was present in the supernatants.

Claims (7)

38 DK 169134 B1 A method for expressing a protein product in Aspergillus by (a) providing a recombinant DNA cloning vector system capable of integration into the genome of an Aspergillus host in one or more copies and comprising: DNA sequences encoding for functions that facilitate gene expression, including a promoter, transcription start sites and transcription termination and poly-adenylation functions, the promoter being preceded by upstream activation sequences, a suitable marker for selecting transformants; and a DNA sequence encoding the desired product; (b) transforming the Aspergillus host, which does not contain a functional gene for the selected selection marker, with the recombinant DNA cloning vector system from step a, and (c) culturing the transformed Aspergillus strain into a suitable culture medium, characterized in that Aspergillus host Aspergillus oryzae is used. Method according to claim 1, characterized in that the selection marker is obtained from the gene for A. nidulans or A. niger argB, A. nidulans trpC, A. nidulans amdS, Neurospora crassae Pyr4 or DHFR. 39 DK 169134 B1 Method according to claim 1, characterized in that the promoter and upstream activation sequences are obtained from a gene encoding an extracellular or intracellular protein such as an amylase, a glucoamylase, a protease, a lipase, a cellulase or a glycolytic. enzyme, preferably from a gene for A. oryzae TAKA amylase, Rhizomucor miehei aspartate proteinase, A. niger neutral α-amylase. A. niger acid stable α-amylase, A. niger glucoamylase or Rhizomucor miehei lipase. 10 Method according to claim 3, characterized in that the promoter is the A. oryzae TAKA amylase promoter or functional parts thereof. 5. A method according to claim 4, characterized ne in that the promoter and upstream activating sequences have the following sequence: GTCGACGC ATTCCGAATA CGAGGCCTGA TTAATGATTA CATACGCCTC 20 CGGGTAGTAG ACCGAGCAGC CGAGCCAGTT CAGCGCCTAA AACGCCTTAT ACAATTAAGC AGTTAAAGAA GTTAGAATCT ACGCTTAAAA AGCTACTTAA AAATCGATCT CGCAGTCCCG ATTCGCCTAT CAAAACCAGT TTAAATCAAC TGATTAAAGG TGCCGAACGA GCTATAAATG ATATAACAAT ATTAAAGCAT TAATTAGAGC AATATCAGGC CGCGCACGAA AGGCAACTTA AAAAGCGAAA 25 GCGCTCTACT AAACAGATTA CTTTTGAAAA AGGCACATCA GTATTTAAAG CCCGAATCCT TATTAAGCGC CGAAATCAGG CAGATAAAGC CATACAGGCA GATAGACCTC TACCTATTAA ATCGGCTTCT AGGCGCGCTC CATCTAAATG TTCTGGCTGT GGTGTACAGG GGCATAAAAT TACGCACTAC CCGAATCGAT AGAACTACTC ATTTTTATAT AGAAGTCAGA ATTCATAGTG TTTTGATCAT 30 TTTAAATTTT TATATGGCGG GTGGTGGGCA ACTCGCTTGC GCGGGCAACT CGCTTACCGA TTACGTTAGG GCTGATATTT ACGTGAAAAT CGTCAAGGGA TGCAAGACCA AAGTAGTAAA ACCCCGGAAG TCAACAGCAT CCAAGCCCAA GTCCTTCACG GAGAAACCCC AGCGTCCACA TCACGAGCGA AGGACCACCT CTAGGCATCG GACGCACCAT CCAATTAGAA GCAGCAAAGC GAAACAGCCC 35 AAGAAAAAGG TCGGCCCGTC GGCCTTTTCT GCAACGCTGA TCACGGGCAG 40 DK 169134 B1 CGATCCAACC AACACCCTCC AGAGTGACTA GGGGCGGAAA TTTAAAGGGA TTAATTTCCA CTCAACCACA AATCACAGTC GTCCCCGGTA TTGTCCTGCA GAATGCAATT TAAACTCTTC TGCGAATCGC TTGGATTCCC CGCCCCTAGT CGTAGAGCTT AAAGTATGTC CCTTGTCGAT GCGATGTATC ACAACATATA 5 AATACTAGCA AGGGATGCCA TGCTTGGAGG ATAGCAACCG ACAACATCAC ATCAAGCTCT CCCTTCTCTG AACAATAAAC CCCACAG or a functional equivalent nucleotide sequence or AGATCTGCCC TTATAAATCT CCTAGTCTGA TCGTCGACGC ATTCCGAATA 10 CGAGGCCTGA TTAATGATTA CATACGCCTC CGGGTAGTAG ACCGAGCAGC CGAGCCAGTT CAGCGCCTAA AACGCCTTAT ACAATTAAGC AGTTAAAGAA GTTAGAATCT ACGCTTAAAA AGCTACTTAA AAATCGATCT CGCAGTCCCG ATTCGCCTAT CAAAACCAGT TTAAATCAAC TGATTAAAGG TGCCGAACGA GCTATAAATG ATATAACAAT ATTAAAGCAT TAATTAGAGC AATATCAGGC 15 CGCGCACGAA AGGCAACTTA AAAAGCGAAA GCGCTCTACT AAACAGATTA CTTTTGAAAA AGGCACATCA GTATTTAAAG CCCGAATCCT TATTAAGCGC CGAAATCAGG CAGATAAAGC CATACAGGCA GATAGACCTC TACCTATTAA ATCGGCTTCT AGGCGCGCTC CATCTAAATG TTCTGGCTGT GGTGTACAGG GGCATAAAAT TACGCACTAC CCGAATCGAT AGAACTACTC ATTTTTAT AT 20 AGAAGTCAGA ATTCATAGTG TTTTGATCAT TTTAAATTTT TATATGGCGG GTGGTGGGCA ACTCGCTTGC GCGGGCAACT CGCTTACCGA TTACGTTAGG GCTGATATTT ACGTGAAAAT CGTCAAGGGA TGCAAGACCA AAGTAGTAAA ACCCCGGAAG TCAACAGCAT CCAAGCCCAA GTCCTTCACG GAGAAACCCC AGCGTCCACA TCACGAGCGA AGGACCACCT CTAGGCATCG GACGCACCAT 25 CCAATTAGAA GCAGCAAAGC GAAACAGCCC AAGAAAAAGG TCGGCCCGTC GGCCTTTTCT GCAACGCTGA TCACGGGCAG CGATCCAACC AACACCCTCC AGAGTGACTA GGGGCGGAAA TTTAAAGGGA TTAATTTCCA CTCAACCACA AATCACAGTC GTCCCCGGTA TTGTCCTGCA GAATGCAATT TAAACTCTTC TGCGAATCGC TTGGATTCCC CGCCCCTAGT CGTAGAGCTT AAAGTATGTC 30 CCTTGTCGAT GCGATGTATC ACAACATATA AATACTAGCA AGGGATGCCA TGCTTGGAGG ATAGCAACCG ACAACATCAC ATCAG5bcet of a CCCTTCTCTG 17 (DSM 4012). 41 DK 169134 B1 5 PATENT REQUIREMENTS Method according to claim 1, characterized in that the vector system further contains a pre-region which provides secretion of the expressed product in the culture fluid and can be obtained from a glucoamylase or an amylase gene from an Aspergillus species, an amylase gene from a Bacillus species, a lipase. - or the proteinase gene from Rhizomucor miehei, the gene for the α-factor of S. cerevisiae or the calf prochymosin gene, the pre-region being preferably obtained from the gene for A. oryzae TAKA amylase, A. niger neutral α-amylase, 10 A. niger acid stable α-amylase, B. licheniformis α-amylase, the maltogenic amylase from Bacillus NCIB 11837, B. stearothermophilus α-amylase or B. licheniformis subtilisin. Process for producing a protein product in Aspergillus oryzae, characterized in that an Aspergillus oryzae strain transformed with a recombinant DNA cloning vector system as described in claim 1 is grown in a suitable culture medium and the product is recovered from the culture medium.