DK164456B - Insulin precursor, DNA sequence which encodes it, replicatable expression agent which contains such a DNA sequence, and a process for preparing the insulin precursor - Google Patents

Description

in

DK 164456 B

The present invention relates to novel insu-1 precursors which can be used for the preparation of human insulin or insulins which exhibit a built-in protracted or accelerated action. The invention further relates to DNA sequences encoding such insulin precursors, a replicable expression agent containing them, and a method for producing these precursors.

In severe or chronic cases, the disease is usually treated with injection preparations containing insulin, e.g. pig insulin, bovine insulin or human insulin.

A variety of methods for biosynthetic production of human insulin are known. Common to all of them is that the DNA strand encoding the entire proinsulin, for a modified form thereof or for the A and B chains, is separately inserted into a replicable plasmid containing a suitable promoter. By transforming this system into a given host organism, a product can be produced which in a manner known per se can be converted to authentic human insulin, cf. EP-PS No. 85,083 and EP-PS No. 88,117.

Some known methods for biosynthesis of proinsulin or similar insulin precursors and their conversion to insulin are described below.

Proinsulin can be prepared biosynthetically using the method described in the specification for European Patent Application No. 121,884. In this method, the gene encoding proinsulin is inserted into the yeast strain, and after culture of the transformed yeast strain, proinsulin can be isolated from the culture medium, after which proinsulin can be converted to insulin in a manner known per se. However, the proinsulin yields obtained in this way are not sufficiently high for commercial production.

2

DK 164456 B

Insulin precursors of the formula BXA, wherein B and A represent the B and A chain of human insulin, respectively, and X represents a pole peptide containing at least two amino acid residues, preferably between 6 and 35 amino acid residues, are known from the specification of DK patent application no. 5284/87. The precursors can be enzymatically cleaved to human insulin by treatment with trypsin and carboxypeptidase B in the presence of certain metal ions.

From the disclosure of EP patent application No. 195,691 there are known closely related insulin precursors of the formula BXYA, wherein B and A respectively represent the B and A chains of human insulin, cross-linked through sulfur bridges as in human insulin, and X and Y each represent a lysine. - or arginine residue, as well. a process for preparing the precursors. These precursors can be cleaved enzymatically to human insulin by treatment with trypsin and carboxypeptidase B. In addition, they can be degraded by tryptic cleavage to des-B30 insulin, but a considerable amount of 20 AoArgdes (B30) insulin is formed if continued cleavage only slowly.

It is an object of the invention to provide novel insulin precursors which are formed in high yields in yeast and which can further be converted to human insulin or insulin analogues with minimal formation of undesirable by-products.

The insulin precursors of the invention are characterized in that they have the amino acid sequence B (1-29 ί-ί ^^ - Χχ-Αί 1-21) 30 wherein B (l-29) is the first 29 amino acid residues in the human insulin B chain starting from The N-terminal, A (1-21) is the 21 amino acid residues in the human insulin A chain, Χχ means a peptide bond or an amino acid residue, X2 is Glu or Asp, 3

DK 164456 B

and Y2 is independently Lys or Arg, where there are sulfur bridges between positions A6 and All, A7 and B7 and A20 and B19, respectively, and wherein one or more of the 5 amino acid residues in chains B (1-29) and A (1- 21), if desired, has been replaced by another amino acid residue.

The invention is based on the surprising realization that the insulin precursors of the invention are either produced in a very large yield, as compared to the compound B-Lys-Arg-A known in the specification of the specification of the patent application, or in digestion. of the insulin precursors of the invention with trypsin, des-B (30) insulin is obtained in high yields under very low or no formation of A0-Arg-des-B (30) insulin or A0-Lys-des-B ( 30) insulin or both.

Insulin precursors are also described in DK Patent Application No. 1257/86. However, these known insulin precursors do not have an acidic amino acid in place of X2, as is the case with the insulin precursors of the invention.

This general feature of the insulin precursors of the invention assists in achieving high expression and in particular, no or almost no by-products are formed in the cleavage of the insulin precursors, which results in a higher overall yield and easier purification, even in the cases where the expression level of a single insulin precursor according to the invention should be "only" equal to that of the compound B-Lys-Arg-A = B (1-29) -Thr preferred in the specification for DK patent application 1257/86 -Lys-Arg-A (1-21), which gives a much higher yield than the other precursors mentioned in the description of Ans. 1257/86.

Results of comparison experiments are given in the table below, which clearly shows that the insulin precursors of the invention are prepared in surprisingly high yields and that their cleavage proceeds 4

DK 164456 B

without the formation of by-products.

Connection Fermt.udb Column Δg Arg-des peptide between% of yield in% (B30) ins.

B (l-29) and fig. of of electricity. Displays A (1-2) Thr-Lys precursor des (B30)

Arg ins.prec.

Ala-Lys-Arg 50 52 40

Ser-Lys-Arg 55 50 22

Gly-Ser-Lys-Arg 50 50 37

Asp-Asp-Lys-Arg * 172 47 0 * according to the invention.

Preferred precursors of the invention are those of formulas B (1-29) -Asp-Lys-Arg-A (1-21) and B (1-29) -Glu-Lys-Arg-A (1-21).

Des-B (30) insulin can be converted to e.g. human insulin in a manner known per se by enzymatically catalyzed semi-synthetic methods.

The precursors may also be converted to human insulin by the e.g. from U.S. Patent No. 4,343,898 to known transpeptidation methods.

Insulins in which one or more of the amino acid residues in the B (1-29) and A (1-21) chains are replaced by another 15 amino acid residues may be, for example, the insulin derivatives known from the specification for International Patent Application WO 86/05497 with protracted effect. In these insulin derivatives which exhibit protracted action, one or more of the amino acid residues at positions A4, A17, 5

DK 164456 B

B13 and B21 are replaced by an amino acid residue having an uncharged side chain, e.g. an alkyl ester or an amide. Other insulin analogues which may be prepared in accordance with the present invention are the insulins disclosed in the specification of European Patent Applications Nos. 194,864 and Nos. 214,826.

The insulin precursors of the invention may be prepared by expressing a DNA sequence encoding an insulin precursor of the invention in a suitable expression system, preferably in a yeast expression system.

The DNA sequence of the invention is characterized in that it encodes an insulin precursor of the invention.

The DNA sequence encoding the insulin precursors of the invention can be prepared from a DNA sequence encoding an insulin precursor B (1-30) -Lys-Arg-A (1-21) by in vitro mutagenization or by oligonucleotide synthesis of the entire DNA sequence.

The replicable expression agent of the invention is peculiar in that it contains a DNA sequence of the invention.

The method of the invention is characterized in that a yeast strain transformed with a replicable expression medium containing a DNA sequence encoding the insulin precursor of the above formula is grown in a suitable culture medium and the insulin precursor is recovered from the culture medium.

The resulting insulin precursor can be converted to human insulin or insulin analogues in known manner.

In order to obtain excretion to the culture medium, the DNA sequence encoding the insulin precursors may be

DK 164456 B

bound with another DNA sequence encoding a yeast functional peptide. Excretion may be achieved by inserting the yeast MFal -1 or the sequence (Kur Jan & 5 Herskowitz, Cell 30, 933-943, 1982) or portions thereof into the expression agent. A preferred construct utilizes the DNA sequence which encodes the entire MFal leader sequence including the dibasic LysArg site but without

Glu-Ala-Glu-Ala, which is the substrate for the yeast protease DPAP 10 (dipeptidylaminopeptidase). In this way, an efficient secretion of insulin precursors is achieved with the correct N-terminal. Other suitable leader sequences are synthetic yeast leader peptides described in the disclosure of International Patent Application WO 89/02463.

The expression or expression of the desired DNA sequence is under the control of a DNA sequence which is a promoter for transcription and which is positioned correctly relative to the DNA sequence being expressed. In the preferred embodiment, the GAPDH (glyceraldehyde-3-phosphate dehydrogenase) promoter is used. As the terminator for the transcription, the terminator sequence from the MFα1 gene is used.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the plasmid pYGAIC3, and FIG. 2 shows the yeast vector pAB24.

The invention is further illustrated in the following examples.

7

DK 164456 B

1. Description of a DNA Sequence Encoding a Transcription Signal, a Secretion Signal, and the B-LysArg-A Insulin Precursor

5 The expression cassette contained in the BamHI restriction fragment of plasmid pYGAIC3 as shown in FIG. 1, has a length of 1112 base pairs and contains essentially the following (listed in order starting at the 5 'end): The GAPDH promoter (Travis et al., J. Biol.

10 Chem., 260, 4384-4389, 1985) followed by the coding region consisting of the 83 N-terminal amino acids of the MFal leader sequence encoded by the wild-type yeast DNA sequence as described by Kurjan & Herskowitz (loc. Cit. ) followed by the two codons AAA and AGA for Lys and Arg and again followed by the coding region for B (1-30) -LysArg-A (1-21), which is a synthetically produced gene using preferred yeast codons. . After two stop codons, a Sall restriction site is found and the remainder of the sequence consists of MFal sequences containing the terminator region. The expression cassette is made using standard techniques.

2. Preparation of DNA Sequences Encoding a Secretion Signal and for Modified Insulin Precursors DNA Sequences encoding insulin precursors of the invention are constructed from the expression cassette described above. The method used is "site directed in vitro mutagenises" described by Zoller & Smith, DNA, Vol. 3, No. 5, 479-488 (1984). The procedure is described in detail in Example 1 and briefly follows: Isolated from the expression plasmid, the insulin precursor sequence is inserted into a single-stranded, circular M13 bacteriophage vector. For the single-stranded vector, a chemically synthesized complementary DNA strand is canceled. The DNA strand contains the desired sequence 35 surrounded by sequences that are completely homologous to 8

DK 164456 B

insulin sequences on the circular DNA. Then, in vitro, the primer is extended throughout the length of the circular genome by biochemical pathway using Klenow polymerase. Hereby, a double stranded molecule is obtained, one strand having the desired sequence. This strand will cause the formation of single-stranded phages grown in Escherichia coli.

In this way, double-stranded DNA is obtained with the desired sequence. From this double stranded DNA can be isolated a restriction fragment which is reinserted into the expression vector. In this way, insulin precursor sequences listed below are constructed together with the primers used for the preparation.

H3: B (1-29) -LeuAspLysArg-A (1-21) 15 - 5'CAACAATACCTCTCTTGTCCAACTTTGGAGTG3 'H5: B (1-29) -AspLysArg-A (1-21) 51CAACAATACCTCTCTTGTCCTTTGGAGTG3' H5: -GluLysArg-A (1-21) 5'CAACAATACCTCTCTTTTCCTTTGGAGTG3 '20 H8: B (1-29) -LeuGluLysArg-A (1-21) 5'CAACAATACCTCTCTTTTCCAACTTTGGAGTG3'

experimental

The region between the B and A chains of insulin precursors can be modified by in vitro mutagenization, as described in the 25 main features by Zoller & Smith, DNA, Vol. 3, No. 6, 479-488 (1984). In this example, a slightly modified form of Zoller & Smith's method is used.

Example 1 9

DK 164456 B

Construction of an expression piasmid / which can be used in the preparation of B (1-29) -GluLysArg-A (1-21) (= H6): Isolation of restriction fragment containing the expression cassette

The expression cassette contained in the expression plasmid pYGAIC3 in a BamHI restriction fragment as shown in FIG. 1, is isolated as follows: The expression plasmid is incubated with the restriction endonuclease BamHI. The following reaction conditions are used: 20 µg plasmid, 50 units Bam HI, 100 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM MgCl 2, and 1 mM DTT in a reaction volume of 100 µl. The temperature is 37 ° C and the reaction time is 2 hours. The two DNA fragments are separated on a 1% low-melting agarose gel and the desired fragment isolated by standard techniques.

Ligation to the vector M13mpl8

The isolated restriction fragment is ligated to the bacteriophage vector M13mp18 cut with the restriction endonuclease BamHI in the following reaction mixture: Fragment 0.2 µg / vector 0.02 / µg, 50 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 10 mM DTT and 1 mM ATP in a volume of 20 / hr. 5/10 of this mixture is transformed into E. coli strain JM101 using standard technique. The presence of the fragment in the vector as well as the orientation of the fragment is determined by restriction enzyme mapping on double stranded M13 DNA isolated from the transformants.

Isolation of single-stranded (ss) DNA (template):

From the transformant described above, ss DNA is isolated

10

DK 164456 B

using the method described by Messing & Vieira in Gene, 19, 269-276 (1982).

5 * Phosphorylation of the mutagenization primer: 5 The mutagenization primer is phosphorylated at the 5 'end in a 30 μΐ reaction mixture containing 70 mM Tris-HCl, pH 7.0, 10 mM MgCl2, 5 mM DTT, 1 mM ATP, 100 pmol oligonucleotide and 3.6 units of T4 polynuoleotide kinase. The reaction is carried out for 30 minutes at 37 ° C. Then, enzyme 10 is inactivated by incubating the mixture for 10 minutes at 65 ° C.

Template cancellation and mutagenization primers:

Template and primer cancellation is performed in a 10 μΐ volume containing 0.5 pmol of template, 4 pmol of primer, 20 mM Tris-HCl, pH 7.5, 10 mM MgCl 2, 50 mM NaCl and 1 mM DTT 15 by heating to 65 ° C for 10 minutes and then cool to 0 ° C.

Extension / ligation reaction:

To the reaction mixture prepared above is added 10 μΐ of the following mixture: 0.3 mM dATP, 0.3 mM dCTP, 0.3 mM 20 dGTP, 0.3 mM TTP, 1 mM ATP, 20 mM Tris-HCl, pH 7, 5, 10 mM MgCl2, 10 mM DTT, 3 units of T4 DNA ligase and 2.5 units of Klenow polymerase.

Then, the reaction is carried out for 16 hours at 16 ° C. Transformation of JM101: 25 The reaction mixture formed above is transformed into various dilutions into CaCl2-treated E. coli JM101 cells using standard techniques and plating in 2 x YT top agar on 2 x YT agar plates. (2 x YT = tryptone 16 g / l, yeast extract 10 g / l, NaCl 5 11

DK 164456 B

g / L. 2 x YT top agar = 2 x YT added 0.4% agarose and heated under pressure. 2 x YT agar plates = 2 x YT added 2% agar and heated under pressure). The plates are incubated overnight at 37 ° C.

Identification of positive clones:

For identification, plaque lifter hybridization is described, which is described in more detail below: a nitrocellulose filter is applied to a plate having a suitable plaque density, so that the filter is wetted with liquid from the plate. The filter is then immersed in the following solutions: 1.5 M NaCl, 0.5 M NaOH for 30 seconds, 1.5 M NaCl, 0.5 M Tris-HCl, pH 8.0 for 1 minute, 2 x SSC (0, 3 M NaCl, 0.03 M sodium citrate) until subsequent drying. The filter is then dried on 15 3MM paper and heated in a vacuum cabinet for at least 2 hours at 80 ° C.

51-32p Labeling of the Mutagenization Primer:

The mutagenization primer of the sequence 5'CAACAATACCTCTCTTTTCCTTGGAGTG3 '20 is radiolabeled at the 5' end in a reaction volume of 50 μΐ containing 70 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 5 mM DTT, 10 pmol oligonucleotide . The reagents are heated to 37 ° C and the reaction is started by adding 3.5 units of T4 polynucleotide kinase. The mixture 25 is incubated at 37 ° C for 30 minutes, then the enzyme is inactivated by heating to 100 ° C for 3 minutes.

Hybridization with radioactive primer for nitrocellulose filters:

The dried filters are prehybridized for 2 hours at 65 ° C in 50 ml of a solution of the following composition: 0.9 M NaCl,

DK 164456B

12 0.09 M sodium citrate, 0.2% bovine serum albumin, 0.2% Ficoll, 0.2% polyvinylpyrrolidone, 0.2% sodium dodecyl sulfate (SDS), and 50 μg / ml salmon sperm DNA. Then, one half of the labeling reaction mixture is added as a probe to 15 ml of fresh pre-hybridization buffer in which the filter is left overnight at 37 ° C with gentle shaking. After hybridization, the filter is washed at 30 ° C for 3 x 15 minutes in 0.3 M NaCl, 0.03 M sodium citrate and autoradiographed. After 10 washes in the same buffer at 60 ° C and further autoradiography, plague containing DNA sequences complementary to the mutagenization primer are identified. The mutation rate is 43%.

Purification of double stranded M13 phage DNA: 15 After erasing a positive clone and re-identifying positive plaque by hybridization, one of the positive clones is used to infect E. coli strain JM101.

Ca. 10® phages and 5 colonies of JM101 are grown for 5 hours in 5 ml of 2 x YT medium. Then, double-stranded circular DNA from the cell pellet is purified using the method described by Birnboim & Doly, Nucleic Acids Res., 2, 1513 (1979).

Isolation of a restriction fragment containing a modified BA transition: The above DNA preparation (about 5 μg) is cleaved with 10 units of restriction endonuclease BamHI in 60 μΐ 100 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 and 1 mM DTT for 2 hours at 37 ° C. The DNA products are separated by electrophoresis on an agarose gel and the desired fragment is purified from the gel using standard techniques.

Ligation to the yeast vector pAB24:

The isolated restriction fragment is ligated to the yeast vector 13

DK 164456 B

pAB24 shown in FIG. 2 cut with the restriction endonuclease BamHI in the following reaction mixture: Fragment 0.2 μg, vector 0.02 μg, 50 mM Tris-HCl, pH 7.4, 10 mM MgCl2 and 10 5 mM DTT, 1 mM ATP in a volume of 20 μΐ . 5 μΐ of this reaction mixture is used for transformation of E. coli strain MC1061 in which the modified expression piasmid is identified and propagated. The plasmid is designated pYGAB-H6-A and has the same sequence as pYGAIC3, except for the altered region.

Transformation of yeast:

Transformation of the expression piasmid to the yeast strain Saccharomyces cerevisiae JC482ApepALeu cir ° (a, his4, ura37 leu2, cir °) is performed as described by Η. In Two et al., J. Bact., Vol. 153, No. 1, 163-168 (1983). The transformed cells are plated on SC-ura medium (0.7% Yeast Nitrogen Base, 2.0% glucose, 0.5% casamino acids, 2.0% agar) for selection of plasmid-containing cells.

Example 2 Construction of Expression Plasmid Usable in the Preparation of B (1-29) -LeuAspLysArg-A (1-21) (-H3)

The same procedure as described above in Example 1 is used except that the mutagenization primer used has the sequence 5'CAACAATACCTCTCTTGTCCAACTTTGGAGTG3 'and, after hybridization, a wash temperature of 63 ° C is used. The final plasmid is designated pYGAB-H3-A and has the same sequence as pYGAIC3, except for the modified portion.

DK 164456 B

14

Example 3

Construction of an Expression Plasmid Usable in the Preparation of B (1-29) -AspLysArg-A (1-21) (= H5) 5 The same procedure as described above in Example 1 is used except that the mutagenization primer has the sequence 5 * CAACAATACCTCTCTTGTCCTTTGGAGTG3 'and that, after hybridization, a wash temperature of 61 ° C is used. The final plasmid is designated pYGAB-H5-A and has the same sequence as pYGAIC3, except for the modified moiety.

Example 4

Construction of an expression plasmid which can be used in the preparation of B (1-29) -LeuGluLysArg-A (1-21) (= H8)

The same procedure as described above in Example 1 is used except that the mutagenization primer used has the sequence 5'CAACAATACCTCTCTTTTCCAACTTTGGAGTG3 ', and that, after hybridization, a wash temperature of 63 ° C is used. The final plasmid is designated pYGAB-H8-A and has the same sequence as pYGAIC3, except for the modified portion.

Example 5 15

DK 164456 B

Cultivation of yeast strain transformed with an expression plasmid encoding insulin precursors of the invention

Saccharomyces cerevisiae strains transformed with the prepared piasmids are used.

Each strain is grown on Petri plates containing minimal medium without uracil for 48 hours at 30 ° C. 100 ml of 10 shake flasks containing minimal medium without uracil + 5 g / l casamino acids + 10 g / l succinic acid + 30 g / l glucose, pH 5.0, are then seeded with a single colony from the Petri plate. The shake flasks are shaken for 72 hours at 30 ° C in an incubator at 180 rpm.

A concentration of approx. 5 g / l cell solids.

Example 6

Isolation of precursor from culture supernatant

After centrifugation, 5 L of culture supernatant is sterilized by filtration and adjusted to a conductivity of 8 20 mS and pH 4.5 by addition of distilled water and 5 N hydrochloric acid. The supernatant is then loaded onto a column (2.6 x 6.7 cm) packed with Pharmacia "FFS Sepharose" ® equilibrated with 10 column volume buffer (50 mM acetic acid in 50% ethanol adjusted to pH 4.0 with 25 NaOH ). The supernatant is added to the column at a rate of 5.3 ml / min. using a pump and the column is washed with 5 column volumes of buffer. After washing the column, the insulin precursor is eluted with a linear NaCl gradient from 0 to 350 mM in 30 column volumes of the same buffer at a rate of 25 ml / h and 10 ml fractions are collected. Precursor containing fractions 16

DK 164456 B

are identified by UV absorption measurement and RP-HPLC analysis and pooled. The combined fractions are desalted on a column packed with "Sephadex" ® G25 5 adjusted with 1 M acetic acid. The precursor is then isolated by freeze-drying.

Identification of isolated insulin precursors

Samples of the freeze-dried precursors are hydrolyzed in 6 M hydrochloric acid at 110 ° C in molten glass vials and analyzed for amino acid composition using an "LKB Alpha plus" amino acid analyzer. Furthermore, samples of insulin precursors are analyzed by amino acid sequencing on an automatic amino acid sequencing apparatus (Applied Bio System model 477A) with on-line HPLC-15 identification of amino acids.

The results confirm that the compound peptides are consistent with the sequences given.

Cleavage of insulin precursor with trypsin to des (B30) insulin 20 The precursor is dissolved at a concentration of 2 mg / ml in 50 mM Tris, 20% ethanol adjusted to pH 10.0 with 1 M hydrochloric acid. The reaction is started by adding 400 mg of drained Sepha rose gel containing 0.3 mg of immobilized trypsin. The reaction is carried out at 4 ° C with gentle shaking for usually 12 hours. The reaction is quenched by filtration of the mixture. The fermentation yields, expressed as a percentage of the yield of the closely related known insulin precursor B (1-29) -Thr-Lys-Arg-A (1-21), are listed in the table below together with the cleavage efficiency of precursors of the invention and by-product formation.

17

DK 164456 B

Table

Compound Fermentation Cleavage A0Arg Des Peptide Between Ring Yield Yield in% (B30) Incubated B (1-29) and in% of Yield of Precursin or α (1-21) -

Thr-Lys-Arg (B30) Insulin Precursor Thr-Lys-Arg_100_70_27% _

Leu-Asp-Lys-Arg 64 84 0

Leu-Asp-Lys-Lys 53 80 0

Leu-Glu-Lys-Arg_64_76_ 0

Asp-Lys-Arg 166 77 0 15 Glu-Lys-Arg_286_78_ 10

It can be seen from the above table that by converting the insulin precursors of the invention substantially greater yields of des- (B30) insulin are obtained by enzymatic cleavage than is the case with the closely related known precursor B (1-29) -Thr-Lys -Arg-A (1-21). In addition, the preferred insulin precursors are expressed in much larger yields in yeast.

Example 7

Isolation of des (B30) insulin from reaction mixture The reaction mixture is filtered and isoelectric precipitation and freeze drying is performed.

Dissolve 50 mg of freeze-dried substance in 2 ml of buffer (20 mM Tris, 7 M urea, adjusted to pH 8.1 with 1 M NaOH) and put on a column (1.6 x 20 cm) packed with Pharmacia 30 "FFQ-Sepharose "® anion exchanger set with 10 column volume buffer. The column is then eluted with a linear NaCl gradient from 0 to 50 mM NaCl in 10 column volumes of the same buffer at a rate of 10 ml per ml. hour. Fractions of 5 ml are collected. The positive fractions are identical 18

DK 164456 B

are fixed by UV absorption measurement and RP-HPLC analysis and pooled. Des-B (30) insulin is typically obtained in a 75% yield after a final desalination on a column 5 packed with "G25 Sephadex" ® in 1 M acetic acid and freeze drying.

The identity of the compound is confirmed by amino acid analysis as described in Example 6.

The amount of insulin precursor and of des (B30) insulin 10 is determined by RP-HPLC analysis as described by B.S. Welinder / F. H. Andresen: Proceedings of the FDA-USP Workshop on Drugs and Reference Standards for Insulin, Somatotropins and Thyroid-Axis Hormones, Bethesda, Maryland, May 19-21, 163-176 (1982).

The buffer system consists of an A buffer (0.125 M ammonium sulfate 22.5% (v / v) acetonitrile adjusted to pH 4.0 with sulfuric acid) and a B buffer (0.125 M ammonium sulfate 45% acetonitrile adjusted to pH 4.0 with sulfuric acid). A Hibar Lichrosorp RP-18 column, 5 μ, 250 x 4 20 mm, is used which is eluted at a rate of 1.5 ml per ml. minute. Samples containing des (B30) insulin are eluted with a gradient system recommended by Welinder and Andresen (1982), whereas samples containing insulin precursors are eluted with a linear gradient from 0 to 35% B buffer with a 25% increase of 1% per day. minute. The concentration is determined by comparison with a standard solution of the authentic insulin precursor.

Claims (7)

19 DK 164456 B Insulin precursor, characterized in that it has the amino acid sequence Insulin precursor according to claim 1, characterized in that it has the formula B (1-29) -Asp-Lys-Arg-A (1-21). Insulin precursor according to claim 1, characterized in that it has the formula B (1-29) -Glu-Lys-Arg-A (1-21). Insulin precursor according to any one of claims 1-3, characterized in that one or more of the glutamic acid residues at positions A4, Al7, B13 and B21 are replaced by another amino acid residue with uncharged side chain. DNA Sequence, characterized in that it encodes an insulin precursor according to any one of claims 1-4. B (1-29) -X1 -X2-Y2-Y1-A (1-21) where B (1-29) is the first 29 amino acid residues in the human insulin B chain starting from the N-terminal, A (l-21) are the 21 amino acid residues in the A chain of human insulin, Χχ means a peptide bond or an amino acid residue, X2 is Glu or 10 Asp, and Υχ and Y7 are independently Lys or Arg, where there are sulfur bridges between the positions A6 and All, A7 and B7 and A20 and B19, and wherein one or more of the amino acid residues in chains B (1-29) and A (1-21), if desired, is replaced by another amino acid residue. Replicable expression agent, characterized in that it contains a DNA sequence according to claim 5. 20 DK 164456 B Process for producing an insulin precursor according to one of claims 1-4, characterized in that a yeast strain transformed with a replicable expression agent according to claim 6 is grown in a suitable culture medium and that the insulin precursor is recovered from the culture medium.