DE60123080T2 - NUCLEAR ACIDS CODING AND USE OF LBVV (LETTUCE BIG-VEIN VIRUS) PROTEINS - Google Patents

NUCLEAR ACIDS CODING AND USE OF LBVV (LETTUCE BIG-VEIN VIRUS) PROTEINS Download PDF

Info

Publication number
DE60123080T2
DE60123080T2 DE60123080T DE60123080T DE60123080T2 DE 60123080 T2 DE60123080 T2 DE 60123080T2 DE 60123080 T DE60123080 T DE 60123080T DE 60123080 T DE60123080 T DE 60123080T DE 60123080 T2 DE60123080 T2 DE 60123080T2
Authority
DE
Germany
Prior art keywords
nucleic acid
protein
salad
lbvv
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
DE60123080T
Other languages
German (de)
Other versions
DE60123080D1 (en
Inventor
Takahide Zentsuji-shi SASAYA
Hiroki Fukuyama-shi KOGANEZAWA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inc Administrative Agency National A Jp
Original Assignee
Inc ADMINISTRATIVE AGENCY
National Agriculture and Bio Oriented Research Organization NARO
National Agriculture and Food Research Organization
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inc ADMINISTRATIVE AGENCY, National Agriculture and Bio Oriented Research Organization NARO, National Agriculture and Food Research Organization filed Critical Inc ADMINISTRATIVE AGENCY
Publication of DE60123080D1 publication Critical patent/DE60123080D1/en
Application granted granted Critical
Publication of DE60123080T2 publication Critical patent/DE60123080T2/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
    • C12N2720/00011—Details
    • C12N2720/00022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Description

FachgebietArea of Expertise

Die vorliegende Erfindung bezieht sich auf Nucleinsäuren, die Proteine des Breitadernvirus des Salats codieren, auf Proteine, die von den Nucleinsäuren codiert werden, und auf ihre Herstellung und Verwendung.The The present invention relates to nucleic acids which are proteins of the broad vein virus of the salad, proteins encoded by the nucleic acids and their production and use.

Technischer Hintergrundtechnical background

Das Breitadernvirus des Salats (LBVV; lettuce big-vein virus) ist ein Virus, das zu den Varicosaviren gehört, besteht aus zwei RNAs (7,0 kb und 6,5 kb RNA) und behält ein Hüllprotein von 48 kDa zurück. LBVV ist ein Bodenvirus, das durch Olpidum brassicae im Boden verbreitet wird, und in den USA, Australien, Neuseeland, Japan und Europa vorkommt. Da dieses Virus Salatpflanzen infiziert und deren Qualität und Ausbeute merklich reduziert, ist es ein ernstes Problem bei der Salatherstellung.The Salad ventral virus (LBVV, lettuce big-vein virus) is a Virus, which belongs to the varicosaviruses, consists of two RNAs (7.0 kb and 6.5 kb RNA) and retained a coat protein back from 48 kDa. LBVV is a soil virus that spreads in the soil through Olpidum brassicae and occurs in the US, Australia, New Zealand, Japan and Europe. Because this virus infects lettuce plants and their quality and yield noticeably reduced, it is a serious problem in salad production.

Leider wurde bisher noch nicht die Existenz eines Gens beschrieben, das Salatpflanzen resistent gegen dieses Virus macht. Zwar sind mehrere Kultursorten, wie Entrée, Sea Green und Pacific, als LBVV-resistente Kultursorten kommerziell erhältlich, doch ist ihre Resistenz gering. Es wurde also noch keine grundlegende Lösung für die durch LBVV verursachten Krankheitsschäden gefunden.Unfortunately So far, the existence of a gene has not been described Makes lettuce resistant to this virus. Although several are Cultivars like Entrée, Sea Green and Pacific, as LBVV-resistant cultivars commercially available, but their resistance is low. So it was not yet basic solution for the found by LBVV caused disease damage.

Die Aufklärung der genetischen Information des Virus ist ein wichtiger Schritt zur Verhinderung von durch das Virus verursachten Krankheitsschäden. Die Isolierung und Reinigung von LBVV sind aber aus Gründen wie der Instabilität der Viruspartikel, den Neigung der Viruspartikel, leicht miteinander zu aggregieren, und der äußerst niedrigen Konzentration des Virus in Pflanzen äußerst schwierig. Obwohl bisher zwei erfolgreiche Beispiele für die Reinigung des Virus beschrieben wurden (S. Kuwata et al. (1983), Annals of the Phytopathological Society of Japan, 49, 246–251; und H.J. Vetten et al. (1987), Journal of Phytopathology, 120, 53–59), ist die Reproduzierbarkeit gering, und die gereinigten Mengen sind äußerst niedrig. Folglich wurde in Bezug auf LBVV noch überhaupt keine genetische Information aufgeklärt.The clarification, clearing up of something the genetic information of the virus is an important step for the prevention of disease damage caused by the virus. The Isolation and purification of LBVV are but for reasons like instability the virus particle, the inclination of the virus particles, easily with each other to aggregate, and the extremely low Concentration of the virus in plants extremely difficult. Although so far two successful examples of described the purification of the virus (S. Kuwata et al. (1983), Annals of the Phytopathological Society of Japan, 49, 246-251; and H.J. Vetten et al. (1987), Journal of Phytopathology, 120, 53-59) the reproducibility is low, and the purified amounts are extremely low. As a result, there was no genetic information on LBVV at all elucidated.

Offenbarung der Erfindungepiphany the invention

Die vorliegende Erfindung wurde in Anbetracht der obigen Umstände erreicht, und Ziele der vorliegenden Erfindung bestehen darin, Proteine des Breitadernvirus des Salats (LBVV; lettuce big-vein virus) und Nucleinsäuren, die die Proteine codieren, zu isolieren und ihre Struktur aufzuklären. Außerdem besteht ein weiteres Ziel der Erfindung darin, Salatpflanzen durch Expression der Nucleinsäure oder ihrer Antisense-Nucleinsäure in Salat eine Resistenz gegen LBVV zu verleihen. Noch ein weiteres Ziel der vorliegenden Erfindung besteht überdies darin, ein Verfahren zum Diagnostizieren einer Infektion durch LBVV anzugeben, indem man die Nucleinsäure oder ein durch die Nucleinsäure codiertes Protein nachweist.The the present invention has been achieved in view of the above circumstances and objects of the present invention are proteins of the Salad ventral virus (LBVV, lettuce big-vein virus) and nucleic acids encode the proteins, isolate them and elucidate their structure. There is also a further object of the invention is lettuce plants by expression the nucleic acid or its antisense nucleic acid in lettuce to confer resistance to LBVV. Yet another one Moreover, the object of the present invention is a process to diagnose an infection by LBVV by one the nucleic acid or one through the nucleic acid coded protein detected.

LBVV ist ein RNA-Virus, und wenn eine DNA, die ein Protein des Virus codiert, oder deren Antisense-DNA in einer Pflanze exprimiert wird, können die Produktion und Funktion von LBVV-Proteinen wahrscheinlich auf dem Transcriptionsniveau oder Translationsniveau gehemmt werden (P.F. Tennant et al. (1994), Phytopathology, 84, 1359–1366; C.C. Huntley & T.C. Hall (1993), Virology, 192, 290–297; D.C. Baulcombe (1996), The Plant Cell, 8, 1833–1844).LBVV is an RNA virus, and if a DNA is a protein of the virus or whose antisense DNA is expressed in a plant, can production and function of LBVV proteins are likely to occur the level of transcription or level of translation (P. F. Tennant et al., 1994, Phytopathology, 84, 1359-1366; C.C. Huntley & T.C. Hall (1993), Virology, 192, 290-297; D.C. Baulcombe (1996), The Plant Cell, 8, 1833-1844).

Die Erfinder der vorliegenden Erfindung konzentrierten sich auf diese Idee und isolierten die Gene, die LBVV-Proteine codieren, um gegen LBVV resistenten Salat zu produzieren.The Inventors of the present invention focused on these Idea and isolated the genes that encode LBVV proteins to counter To produce LBVV resistant salad.

Insbesondere erhielten die Erfinder zuerst hochgereinigtes LBVV und unterzogen dieses dann einer SDS-Polyacrylamid-Gel-Elektrophorese, um das Hüllprotein nachzuweisen, aus dem das Virus besteht. Das nachgewiesene Hüllprotein wurde gereinigt und dann zu Peptiden zersetzt, und anschließend wurden die partiellen Aminosäuresequenzen der Peptide nach dem Edman-Verfahren bestimmt. Außerdem wurde eine RNA, die das Hüllprotein von LBVV codiert, durch Polymerase-Kettenreaktion (PCR) kloniert, wobei man Primer verwendete, die auf der Grundlage von Information aus den bestimmten Aminosäuresequenzen gestaltet wurden, und anschließend wurde die Nucleotidsequenz der RNA bestimmt.Especially The inventors first received highly purified LBVV and subjected this then an SDS-polyacrylamide gel electrophoresis to the coat protein to prove the virus is made. The proven envelope protein was purified and then decomposed to peptides, and subsequently the partial amino acid sequences the peptides determined by the Edman method. It was also an RNA that is the envelope protein encoded by LBVV, cloned by polymerase chain reaction (PCR), using primers based on information from the specific amino acid sequences and subsequently the nucleotide sequence of the RNA was determined.

Um das Gen zu bestimmen, das die volle Länge des Hüllproteins von LBVV codiert, wurden dann RNAs aus gereinigtem Virus und aus mit dem Virus infizierten Blättern, die offensichtliche Symptome der Infektion aufwiesen, hergestellt, und unter Verwendung dieser RNA-Moleküle wurden 3'RACE sowie 5'RACE durchgeführt. Als Ergebnis ist es den Erfindern nicht nur gelungen, das RNA-Molekül, das LBVV-Hüllprotein codiert, zu isolieren, sondern auch seine Primärstruktur zu bestimmen. Außerdem ist es den Erfindern mit dem Genom-Walking-Verfahren gelungen, RNA-Moleküle zu isolieren, die vier andere nichtstrukturelle Proteine von LBVV codieren, und ihre Primärstrukturen ebenfalls zu bestimmen.To determine the gene encoding the full length of the envelope protein of LBVV, RNAs were then prepared from purified virus and virus-infected leaves that had obvious symptoms of infection, and using these RNA molecules became 3'RACE as well as 5'RACE performed. As a result, the inventors have not only succeeded in the RNA molecule, the LBVV coat protein coded to isolate, but also to determine its primary structure. In addition, with the genome walking method, the inventors have been able to isolate RNA molecules encoding four other non-structural proteins of LBVV and also to determine their primary structures.

Ähnlich ist es den Erfinder auch gelungen, ein RNA-Molekül, das ein Polymerase-Protein codiert, aus hochgereinigtem LBVV zu isolieren.Similar is the inventor also succeeded in synthesizing an RNA molecule encoding a polymerase protein, from highly purified LBVV.

Das isolierte RNA-Molekül oder sein Antisense-Molekül kann durch seine Expression Salatpflanzen Resistenz gegen LBVV verleihen, und dadurch ist es möglich, die Salatproduktivität zu verbessern. Außerdem kann auch eine genetische Diagnose von LBVV durchgeführt werden, indem man auf der Grundlage von Sequenzinformationen der isolierten RNA-Moleküle einen LBVV-spezifischen Primer entwirft und verwendet. Weiterhin können auf der Grundlage der resultierenden Sequenzinformation Antiseren, die an LBVV-Proteine binden, produziert und für die serologische Diagnose von LBVV verwendet werden.The isolated RNA molecule or its antisense molecule can confer liveliness to LBVV by its expression, and that makes it possible the salad productivity to improve. In addition, can Also, a genetic diagnosis of LBVV can be performed by looking at the Basis of sequence information of isolated RNA molecules LBVV-specific primer designs and uses. Furthermore, you can the basis of the resulting sequence information Antisera, the bind to LBVV proteins, produced and for serological diagnosis used by LBVV.

Die vorliegende Erfindung wurde auf der Grundlage der obigen Ergebnisse fertiggestellt und stellt LBVV-Proteine, Nucleinsäuren, die die Proteine codieren, und deren Herstellung und Verwendung bereit.The The present invention has been accomplished on the basis of the above results completed and provides LBVV proteins, nucleic acids, the encode the proteins, and their preparation and use.

Insbesondere stellt die vorliegende Erfindung Folgendes bereit:

  • (1) eine isolierte Nucleinsäure, die ein Protein des Breitadernvirus des Salats codiert, wobei die Nucleinsäure aus der Gruppe ausgewählt ist, die aus (a) einer Nucleinsäure, die ein Protein codiert, das die Aminosäuresequenz von einer der Sequenzen SEQ ID Nr. 2 bis 6 und SEQ ID Nr. 13 umfasst; und (b) der Nucleinsäure von (a), die den codierenden Bereich der Nucleotidsequenz von SEQ ID Nr. 1 oder 12 umfasst, besteht;
  • (2) die Nucleinsäure gemäß (1), wobei die Nucleinsäure eine RNA ist;
  • (3) die Nucleinsäure gemäß (1), wobei die Nucleinsäure eine DNA ist;
  • (4) eine DNA, die eine Sense-RNA codiert, die zu einem komplementären Strang der Nucleinsäure gemäß (2) komplementär ist;
  • (5) eine DNA, die eine Antisense-RNA codiert, die zu der Nucleinsäure gemäß (2) komplementär ist;
  • (6) eine DNA, die eine RNA mit Ribozymaktivität codiert, die spezifisch die Nucleinsäure gemäß (2) spaltet;
  • (7) einen Vektor, der die Nucleinsäure gemäß (3) umfasst;
  • (8) eine transformierte Zelle, die die Nucleinsäure gemäß (3) oder den Vektor gemäß (7) umfasst;
  • (9) ein Protein, das von der Nucleinsäure gemäß (1) codiert wird;
  • (10) einen Antikörper, der an das Protein gemäß (9) bindet;
  • (11) ein Verfahren zur Herstellung des Proteins gemäß (9), wobei das Verfahren die folgenden Schritte umfasst: (a) Kultivieren der transformierten Zelle gemäß (8); und (b) Gewinnen eines exprimierten Proteins aus der transformierten Zelle oder deren Kulturüberstand;
  • (12) einen Vektor, der die DNA gemäß einem der Punkte (4) bis (6) umfasst;
  • (13) eine transformierte Salatzelle, die die Nucleinsäure gemäß (1), die DNA gemäß einem der Punkte (4) bis (6) oder den Vektor gemäß (7) oder (12) umfasst;
  • (14) eine transformierte Salatpflanze, die die transformierte Salatzelle gemäß (13) umfasst;
  • (15) eine transformierte Salatpflanze, die ein Nachkomme oder ein Klon der transformierten Salatpflanze gemäß (14) ist;
  • (16) ein Fortpflanzungsmaterial der transformierten Salatpflanze gemäß (14) oder (15), wobei das Fortpflanzungsmaterial die Nucleinsäure gemäß (1), die DNA gemäß einem der Punkte (4) bis (6) oder den Vektor gemäß (7) oder (12) umfasst; und
  • (17) ein Verfahren zum Diagnostizieren einer Infektion, die durch das Breitadernvirus des Salats verursacht wird, wobei das Verfahren den folgenden Schritt umfasst:
Nachweisen der Nucleinsäure gemäß (1) oder Nachweisen des Proteins gemäß (9) in Salatzellen oder in Olpidium brassicae, einem Pilz, der das Breitadernvirus des Salats überträgt.In particular, the present invention provides:
  • (1) an isolated nucleic acid encoding a salad vadera protein, wherein the nucleic acid is selected from the group consisting of (a) a nucleic acid encoding a protein having the amino acid sequence of any one of SEQ ID Nos. 2 to 6 and SEQ ID NO: 13; and (b) the nucleic acid of (a) comprising the coding region of the nucleotide sequence of SEQ ID NO: 1 or 12;
  • (2) the nucleic acid according to (1), wherein the nucleic acid is an RNA;
  • (3) the nucleic acid according to (1), wherein the nucleic acid is a DNA;
  • (4) a DNA encoding a sense RNA that is complementary to a complementary strand of the nucleic acid of (2);
  • (5) a DNA encoding an antisense RNA that is complementary to the nucleic acid of (2);
  • (6) a DNA encoding an RNA having ribozyme activity which specifically cleaves the nucleic acid according to (2);
  • (7) a vector comprising the nucleic acid according to (3);
  • (8) a transformed cell comprising the nucleic acid according to (3) or the vector according to (7);
  • (9) a protein encoded by the nucleic acid according to (1);
  • (10) an antibody that binds to the protein according to (9);
  • (11) a method for producing the protein according to (9), the method comprising the steps of: (a) cultivating the transformed cell according to (8); and (b) recovering an expressed protein from the transformed cell or its culture supernatant;
  • (12) a vector comprising the DNA according to any one of (4) to (6);
  • (13) a transformed salad cell comprising the nucleic acid according to (1), the DNA according to any one of (4) to (6) or the vector according to (7) or (12);
  • (14) a transformed salad plant comprising the transformed salad cell according to (13);
  • (15) a transformed lettuce plant which is a descendant or a clone of the transformed lettuce plant according to (14);
  • (16) a propagation material of the transformed lettuce plant according to (14) or (15), wherein the propagation material comprises the nucleic acid according to (1), the DNA according to any one of (4) to (6) or the vector according to (7) or (12 ); and
  • (17) a method for diagnosing an infection caused by the vasodilator of the salad, the method comprising the step of:
Detecting the nucleic acid according to (1) or detecting the protein according to (9) in salad cells or in Olpidium brassicae, a fungus which transmits the radiolaria virus of the salad.

Die vorliegende Erfindung stellt LBVV-Proteine und Nucleinsäuren, die die Proteine codieren, bereit. Die von der vorliegenden Erfindung umfasste Nucleotidsequenz von cDNA, die LBVV-Proteine codiert und von den Erfindern isoliert wurde, ist in SEQ ID Nr. 1 gezeigt, und die Aminosäuresequenzen der von der cDNA codierten Proteine sind in SEQ ID Nr. 2 bis 6 gezeigt. Die isolierte cDNA ist eine Sequenz von 6078 Nucleotiden und codiert fünf Proteine. Protein 1 (Hüllprotein: Beispiel 1) hat eine Translationsstartstelle an Nucleotid 209 und codiert 397 Aminosäuren (der isolierte Klon wurde "LBVV-cp" genannt/SEQ ID Nr. 2); Protein 2 (Beispiel 3) hat eine Translationsstartstelle an Nucleotid 1492 und codiert 333 Aminosäuren (SEQ ID Nr. 3); Protein 3 (Beispiel 3) hat eine Translationsstartstelle an Nucleotid 2616 und codiert 290 Aminosäuren (SEQ ID Nr. 4); Protein 4 (Beispiel 3) hat eine Translationsstartstelle an Nucleotid 3842 und codiert 164 Aminosäuren (SEQ ID Nr. 5); und Protein 5 (Beispiel 3) hat eine Translationsstartstelle an Nucleotid 4529 und codiert 368 Aminosäuren (SEQ ID Nr. 6).The present invention provides LBVV proteins and nucleic acids encoding the proteins. The nucleotide sequence of cDNA encoded by the present invention and encoded by the present inventors is shown in SEQ ID NO: 1, and the amino acid sequences of the proteins encoded by the cDNA are shown in SEQ ID NOs: 2 to 6 , The isolated cDNA is a sequence of 6078 nucleotides and encodes five proteins. Protein 1 (coat protein: Example 1) has a translation start site at nucleotide 209 and encodes 397 amino acids (the isolated clone was named "LBVV-cp" / SEQ ID NO: 2); Protein 2 (example 3) has a translation start site at nucleotide 1492 and encodes 333 amino acids (SEQ ID NO: 3); Protein 3 (Example 3) has a translation start site at nucleotide 2616 and encodes 290 amino acids (SEQ ID NO: 4); Protein 4 (Example 3) has a translation start site at nucleotide 3842 and encodes 164 amino acids (SEQ ID NO: 5); and protein 5 (Example 3) has a translation start site at nucleotide 4529 and encodes 368 amino acids (SEQ ID NO: 6).

Außerdem ist die ebenfalls von der vorliegenden Erfindung umfasste Nucleotidsequenz von cDNA (Beispiel 4), die eine Polymerase von LBVV codiert und von den Erfindern isoliert wurde, in SEQ ID Nr. 12 gezeigt, und die Aminosäuresequenz des von der cDNA codierten Proteins ist in SEQ ID Nr. 13 gezeigt (der isolierte Klon wurde "LBVV-L" genannt). Die isolierte cDNA ist eine Sequenz von 6793 Nucleotiden, hat eine Translationsstartstelle an Nucleotid 337 und codiert 2040 Aminosäuren.Besides that is the nucleotide sequence also encompassed by the present invention of cDNA (Example 4) encoding a polymerase of LBVV and isolated from the inventors, shown in SEQ ID NO: 12, and the amino acid sequence of the cDNA encoded by the cDNA is shown in SEQ ID NO: 13 (the isolated clone was named "LBVV-L"). The isolated cDNA is a sequence of 6793 nucleotides, has a translation start site at nucleotide 337 and encodes 2040 amino acids.

Außerdem haben die Erfinder aufgedeckt, dass LBVV ein Negativ-Strang-RNA-Virus ist, das mehr positive Stränge als gewöhnlich in seinen Viruspartikeln enthält.Besides, have The inventors uncovered that LBVV is a negative strand RNA virus that has more positive strands as usual in its virus particles.

Dies ist das erste Beispiel für einen Nachweis der Gene und Proteinprimärstrukturen von LBVV.This is the first example of a demonstration of the genes and protein primary structures of LBVV.

Zu den Nucleinsäuren, die LBVV-cp-Protein (LBVV-Protein 1), die LBVV-Proteine 2 bis 5 oder das LBVV-L-Protein gemäß der vorliegenden Erfindung codieren, gehören eine DNA und eine RNA. Die DNA umfasst eine cDNA und eine chemisch synthetisierte DNA, und die RNA umfasst eine virale genomische RNA, mRNA und synthetische RNA. Eine Nucleinsäure der vorliegenden Erfindung kann vom Fachmann mit Hilfe von herkömmlichen Mitteln hergestellt werden. Insbesondere eine DNA des ersten Stranges kann synthetisiert werden, indem man eine reverse Transcriptionsreaktion durchführt und als Matrize Folgendes verwendet: (1) eine RNA, die durch Deproteinieren von gereinigtem Virus nach einem Verfahren wie dem SDS-Phenol-Verfahren hergestellt wird; oder (2) die Gesamtnucleinsäuren, die nach dem CTAB-Verfahren usw. aus einem virusinfizierten Blatt isoliert wurden, wobei an einen anhand der Sequenz einer Nucleinsäure der vorliegenden Erfindung gestalteten Primer oder einen statistischen Primer verwendete. Aus der nach diesem Verfahren hergestellten DNA des ersten Stranges kann eine DNA des zweiten Stranges nach dem Verfahren von Gubler & Hoffman (U. Gubler und B.J. Hoffman (1983), Gene 25, 263–269) synthetisiert werden, und die Nucleinsäure der vorliegenden Erfindung kann in verschiedenen kommerziell erhältlichen Plasmiden oder Phagemidvektoren kloniert werden. Alternativ dazu kann eine DNA, die eine RNA des Virus codiert, durch Polymerase-Kettenreaktion amplifiziert werden, wobei man einen Primer verwendet, der anhand der Sequenz einer Nucleinsäure der vorliegenden Erfindung gestaltet wurde, und die DNA des ersten Strangs als Matrize verwendet, und die Nucleinsäure der vorliegenden Erfindung kann durch TA-Klonierung unter Verwendung des pGEM®-T-Vektors usw. oder durch Klonieren in verschiedenen kommerziell erhältlichen Plasmidvektoren kloniert werden, indem man eine Restriktionsenzymstelle zu dem Primer hinzufügt.The nucleic acids encoding LBVV cp protein (LBVV protein 1), the LBVV proteins 2 to 5, or the LBVV L protein according to the present invention include a DNA and an RNA. The DNA comprises a cDNA and a chemically synthesized DNA, and the RNA comprises a viral genomic RNA, mRNA and synthetic RNA. A nucleic acid of the present invention may be prepared by those skilled in the art by conventional means. In particular, a DNA of the first strand can be synthesized by performing a reverse transcription reaction and using as a template: (1) an RNA prepared by deproteinizing purified virus by a method such as the SDS-phenol method; or (2) the total nucleic acids isolated from a virus-infected leaf by the CTAB method, etc., using a primer designed by the sequence of a nucleic acid of the present invention or a random primer. From the DNA of the first strand prepared by this method, a DNA of the second strand can be synthesized by the method of Gubler & Hoffman (U. Gubler and BJ Hoffman (1983), Gene 25, 263-269), and the nucleic acid of the present invention can be cloned in various commercially available plasmids or phagemid vectors. Alternatively, a DNA encoding an RNA of the virus can be amplified by polymerase chain reaction using a primer designed based on the sequence of a nucleic acid of the present invention using the DNA of the first strand as a template, and the nucleic acid of the present invention can be cloned by TA-cloning using the pGEM ® -T vector, etc., or by cloning in various commercially available plasmid vectors by adding a restriction enzyme site to the primer.

Eine Nucleinsäure der vorliegenden Erfindung kann auch für die Herstellung eines rekombinanten Proteins oder für die Herstellung von gegen LBVV resistentem Salat verwendet werden.A nucleic acid The present invention can also be used for the production of a recombinant Protein or for the production of LBVV resistant salad can be used.

Ein rekombinantes Protein wird gewöhnlich hergestellt, indem man eine DNA, die ein Protein der vorliegenden Erfindung codiert, in einen geeigneten Expressionsvektor einfügt, den Vektor in eine geeignete Zelle einführt, die transformierten Zellen kultiviert, die Zellen das rekombinante Protein exprimieren lässt und das exprimierte Protein reinigt. Ein rekombinantes Protein kann auch als Fusionsprotein mit anderen Proteinen exprimiert werden, so dass es sich leicht reinigen lässt, zum Beispiel als Fusionsprotein mit maltosebindendem Protein in Escherichia coli (New England Biolabs, USA, Vektor-pMAL-Reihe), als Fusionsprotein mit Glutathion-5-Transferase (GST) (Amersham Pharmacia Biotech, Vektor-pGEX-Reihe) oder mit Histidin markiert (Novagen, pET-Reihe). Die Wirtszelle unterliegt keiner Einschränkung, solange die Zelle für die Expression des rekombinanten Proteins geeignet ist. Es ist möglich, neben der oben erwähnten E. coli Hefen oder verschiedene Tier-, Pflanzen- oder Insektenzellen zu verwenden, indem man den Expressionsvektor ändert. Ein Vektor kann nach einer Vielzahl von dem Fachmann bekannten Verfahren in eine Wirtszelle eingeführt werden. Zum Beispiel kann ein Transformationsverfahren unter Verwendung von Calciumionen (Mandel, M. und Higa, A. (1970), Journal of Molecular Biology, 53, 158–162, Hanahan, D. (1983), Journal of Molecular Biology, 166, 557–580) verwendet werden, um einen Vektor in E. coli einzuführen. Ein in Wirtszellen exprimiertes rekombinantes Protein kann nach bekannten Verfahren aus den Wirtszellen oder ihrem Kulturüberstand isoliert und gereinigt werden. Wenn ein rekombinantes Protein als Fusionsprotein mit maltosebindendem Protein oder anderen Partnern exprimiert wird, kann das rekombinante Protein leicht durch Affinitätschromatographie gereinigt werden.One recombinant protein becomes common prepared by adding a DNA containing a protein of the present Invention, inserted into a suitable expression vector, the Vector into a suitable cell, the transformed cells cultured, the cells express the recombinant protein and the expressed protein cleans. A recombinant protein can also be expressed as a fusion protein with other proteins, so it is easy to clean, for example as a fusion protein with maltose binding protein in Escherichia coli (New England Biolabs, USA, vector pMAL series), as a fusion protein with glutathione-5-transferase (GST) (Amersham Pharmacia Biotech, vector pGEX series) or with histidine marked (Novagen, pET series). The host cell is not subject to any restriction as long as the cell for the expression of the recombinant protein is suitable. It is possible, besides the above mentioned E. coli yeasts or various animal, plant or insect cells to use by changing the expression vector. A vector can after a variety of methods known in the art in a host cell introduced become. For example, a transformation method using of calcium ions (Mandel, M. and Higa, A. (1970), Journal of Molecular Biology, 53, 158-162, Hanahan, D. (1983), Journal of Molecular Biology, 166, 557-580) to introduce a vector into E. coli. An expressed in host cells Recombinant protein can be isolated from the host cells by known methods or their culture supernatant be isolated and cleaned. When a recombinant protein as Fusion protein with maltose binding protein or other partners The recombinant protein can be easily expressed by affinity chromatography getting cleaned.

Das resultierende Protein kann verwendet werden, um einen Antikörper herzustellen, der an das Protein bindet. Zum Beispiel kann ein polyklonaler Antikörper hergestellt werden, indem man Immuntiere, wie Kaninchen, mit einem gereinigten Protein der vorliegenden Erfindung oder einem Teil davon immunisiert, nach einer bestimmten Zeit Blut abnimmt und Gerinnsel entfernt. Ein monoklonaler Antikörper kann hergestellt werden, indem man Myelomzellen mit den antikörperbildenden Zellen von Tieren, die mit dem obigen Protein oder einem Teil davon immunisiert sind, fusioniert, eine monoklonale Zelle, die einen gewünschten Antikörper exprimiert (Hybridom), isoliert und den Antikörper aus der Zelle gewinnt. Der erhaltene Antikörper kann verwendet werden, um ein Protein der vorliegenden Erfindung zu reinigen oder nachzuweisen. Der Antikörper der vorliegenden Erfindung umfasst Antiserum, polyklonalen Antikörper, monoklonalen Antikörper und ein Fragment davon.The resulting protein can be used to produce an antibody that binds to the pro tein binds. For example, a polyclonal antibody may be prepared by immunizing immune animals, such as rabbits, with a purified protein of the present invention or a portion thereof, withdrawing blood after a period of time, and removing clots. A monoclonal antibody can be prepared by fusing myeloma cells with the antibody-forming cells of animals immunized with the above protein or a part thereof, isolating a monoclonal cell expressing a desired antibody (hybridoma) and removing the antibody from the Cell wins. The resulting antibody can be used to purify or detect a protein of the present invention. The antibody of the present invention comprises antiserum, polyclonal antibody, monoclonal antibody and a fragment thereof.

Im Falle der Herstellung von LBVV-resistentem Salat sollte eine DNA, die die Produktion und Funktion von LBVV-Proteinen reprimiert, in Salatzellen eingeführt werden, und die resultierenden transformierten Salatzellen sollten regeneriert werden.in the In the case of the production of LBVV-resistant salad, a DNA, which represses the production and function of LBVV proteins, in Salad cells introduced and the resulting transformed salad cells should be be regenerated.

Eine DNA, die eine RNA codiert, welche mit einem der beiden Stränge (Sense-Strang oder komplementärer Strang) einer LBVV-Proteine codierenden RNA hybridisiert, kann als DNA verwendet werden, die die Produktion und Funktion der LBVV-Proteine reprimiert.A DNA encoding an RNA which is linked to one of the two strands (sense strand or complementary strand) hybridizing to an LBVV protein-encoding RNA can be used as DNA which represses the production and function of LBVV proteins.

Beispiele für eine DNA, die eine RNA codiert, welche mit einem viralen genomischen Sense-Strang und mit mRNAs hybridisiert, sind eine DNA, die eine Antisense-RNA codiert, die zu dem Transcriptionsprodukt einer von den Erfindern isolierten DNA, die das in einem der Sequenzen SEQ ID Nr. 2 bis 6 und SEQ ID Nr. 13 beschriebene Protein codiert (vorzugsweise einer DNA, die einen codierenden Bereich der in SEQ ID Nr. 1 oder SEQ ID Nr. 12 beschriebenen Nucleotidsequenz umfasst), komplementär ist. Hier bedeutet der Ausdruck "komplementär" auch "nicht vollständig komplementär", solange die Produktion von LBVV-Proteinen effektiv gehemmt werden kann. Die transcribierte RNA weist vorzugsweise 90% oder mehr Komplementarität und am meisten bevorzugt 95% oder mehr Komplementarität zu der RNA, die das Ziel-LBVV-Protein codiert, auf. Hier bezieht sich der Ausdruck "Komplementarität" auf den Prozentanteil der Zahl von Nucleotiden, die komplementäre Basenpaare bilden, bezogen auf die Gesamtzahl von Basenpaaren in einem Bereich, wo die beiden Sequenzen einander entsprechen, und zwar in dem Fall, dass die Sequenzen so aneinander ausgerichtet werden, dass die Zahl von komplementären Basenpaaren maximiert ist.Examples for one DNA encoding an RNA that carries a viral genomic DNA Sense strand and hybridized with mRNAs are a DNA that is a Antisense RNA coding for the transcription product one of DNAs isolated from the inventors which have the sequence shown in one of the sequences SEQ ID Nos. 2 to 6 and SEQ ID NO. 13 described protein (preferably a DNA having a coding region of SEQ ID NO: 1 or SEQ ID NO. 12 described nucleotide sequence) is complementary. Here The term "complementary" also means "not completely complementary" as long as the production of LBVV proteins can be effectively inhibited. The transcribed RNA preferably has 90% or more complementarity and most preferably, 95% or more complementarity to the RNA encoding the target LBVV protein. Here refers the Expression "complementarity" on the percentage the number of nucleotides forming complementary base pairs on the total number of base pairs in an area where the two Sequences correspond to each other, in the case that the sequences be aligned so that the number of complementary base pairs is maximized.

Die von den Erfindern isolierte DNA, die eine Sense-RNA codiert, die zu einem komplementären RNA-Strang, der das in einem der Sequenzen SEQ ID Nr. 2 bis 6 und SEQ ID Nr. 13 beschriebene Protein codiert (vorzugsweise einer RNA, die einen codierenden Bereich der in SEQ ID Nr. 1 oder SEQ ID Nr. 12 beschriebenen Nucleotidsequenz umfasst), komplementär ist, kann als DNA verwendet werden, die eine RNA codiert, die mit einem komplementären Strang viraler genomischer RNA hybridisiert. Hier bedeutet der Ausdruck "komplementär" auch "nicht vollständig komplementär", solange die Produktion von LBVV-Proteinen effektiv gehemmt werden kann. Die transcribierte Sense-RNA weist vorzugsweise 90% oder mehr Komplementarität und am meisten bevorzugt 95% oder mehr Komplementarität zu der RNA (komplementärer Strang), die das Ziel-LBVV-Protein codiert, auf.The DNA isolated from the inventors and encoding a sense RNA, the to a complementary RNA strand, which is in one of the sequences SEQ ID Nos. 2 to 6 and SEQ ID Nos. 13 protein (preferably an RNA containing a coding region described in SEQ ID NO: 1 or SEQ ID NO: 12 Nucleotide sequence) is complementary, can be used as DNA which encodes an RNA that has a complementary strand viral genomic RNA hybridizes. Here the term "complementary" also means "not completely complementary" as long as the production of LBVV proteins can be effectively inhibited. The transcribed Sense RNA preferably has 90% or more complementarity and am most preferably 95% or more complementarity to the RNA (complementary strand), the the target LBVV protein coded, up.

Um die Expression des Zielgens effektiv zu hemmen, sollten die oben beschriebenen Antisense- und Sense-DNAs wenigstens 15 Nucleotide, vorzugsweise wenigstens 100 Nucleotide und besonders bevorzugt wenigstens 500 Nucleotide lang sein. Diese DNAs sind im Allgemeinen kürzer als 5 kb und vorzugsweise kürzer als 2,5 kb.Around To effectively inhibit the expression of the target gene, the above described antisense and sense DNAs at least 15 nucleotides, preferably at least 100 nucleotides, and more preferably at least 500 nucleotides long. These DNAs are generally shorter than 5 kb and preferably shorter than 2.5 kb.

Außerdem ist es wahrscheinlich, dass eine DNA, die ein Ribozym codiert, das wenigstens einen der Stränge einer RNA, der LBVV-Proteine codiert, spaltet, als DNA verwendet werden kann, die die Produktion der LBVV-Proteine reprimiert.Besides that is it is likely that a DNA encoding a ribozyme, at least one of the strands an RNA encoding LBVV proteins, used as DNA which represses the production of LBVV proteins.

Ein Ribozym ist ein RIVA-Molekül, das katalytische Aktivitäten aufweist. Es gibt viele Ribozyme mit verschiedenen Aktivitäten. Die Erforschung der Ribozyme als RNA-spaltende Enzyme ermöglichte die Gestaltung eines Ribozyms, das RNA ortsspezifisch spaltet. Während einige Ribozyme des Gruppe-I-Intron-Typs oder die in RNase P enthaltene M1RNA aus 400 Nucleotiden oder mehr bestehen, haben andere, die zum Hammerhead-Typ oder Haarnadeltyp gehören, eine Akti vitätsdomäne von etwa 40 Nucleotiden (Makoto Koizumi und Eiko Ohtsuka (1990), Tanpakushitsu Kakusan Kohso (Nucleic acid, Protein and Enzyme) 35: 2191–2200).One Ribozyme is a RIVA molecule, the catalytic activities having. There are many ribozymes with different activities. The Research on ribozymes as RNA-cleaving enzymes enabled the design of a ribozyme that cleaves RNA site-specifically. While some Group I intron type ribozymes or those contained in RNase P. M1RNA consists of 400 nucleotides or more, others have belong to Hammerhead type or hairpin type, an activity domain of about 40 nucleotides (Makoto Koizumi and Eiko Ohtsuka (1990), Tanpakushitsu Kakusan Kohso (Nucleic Acid, Protein and Enzyme) 35: 2191-2200).

Die Selbstspaltungsdomäne eines Ribozyms des Hammerhead-Typs spaltet auf der 3'-Seite von C15 der Sequenz G13U14C15. Die Bildung eines Nucleotidpaars zwischen U14 und A auf der neunten Position gilt als wichtig für die Ribozymaktivität. Weiterhin hat sich gezeigt, dass die Spaltung auch dann erfolgt, wenn das Nucleotid auf der 15. Position A oder U anstelle von C ist (M. Koizumi et al. (1988), FEBS Letters, 228: 228–230). Wenn die Substratbindungsstelle des Ribozyms so gestaltet ist, dass sie komplementär zu den der Zielstelle benachbarten RNA-Sequenzen ist, kann man ein restriktionsenzymartiges RNA-spaltendes Ribozym schaffen, das die Sequenz UC, UU oder UA innerhalb der Ziel-RNA erkennt (M. Koizumi et al. (1988), FEBS Letters, 239: 285; Makoto Koizumi und Eiko Ohtsuka (1990), Tanpakushitsu Kakusan Kohso (Protein, Nucleic acid and Enzyme), 35: 2191–2200; M. Koizumi et al. (1989), Nucleic Acids Research, 17: 7059–7071). Zum Beispiel im LBVV-cp-Gen, in den Genen von LBVV-Protein 2 bis 5 oder im LBVV-L-Gen (SEQ ID Nr. 1 oder 12) gibt es eine Menge von Stellen, die als Ribozym-Angriffspunkt verwendet werden können.The self-cleavage domain of a hammerhead-type ribozyme cleaves on the 3 'side of C15 of the sequence G13U14C15. The formation of a nucleotide pair between U14 and A at the ninth position applies as important for ribozyme activity. Further, it has been found that cleavage occurs even when the nucleotide at the 15th position is A or U instead of C (Koizumi, M., et al., (1988), FEBS Letters, 228: 228-230). If the substrate binding site of the ribozyme is designed to be complementary to the RNA sequences adjacent to the target site, one can create a restriction enzyme-like RNA-cleaving ribozyme which recognizes the sequence UC, UU or UA within the target RNA (Koizumi, M.W. et al., (1988), FEBS Letters, 239: 285, Makoto Koizumi and Eiko Ohtsuka (1990), Tanpakushitsu Kakusan Kohso (Protein, Nucleic Acid and Enzyme), 35: 2191-2200, Koizumi, M. et al. , Nucleic Acids Research, 17: 7059-7071). For example, in the LBVV cp gene, in the genes of LBVV protein 2 to 5, or in the LBVV L gene (SEQ ID NO: 1 or 12), there are a lot of sites that can be used as a ribozyme target ,

Das Ribozym des Haarnadeltyps ist für die vorliegende Erfindung ebenfalls geeignet. Ein Ribozym des Haarnadeltyps findet sich zum Beispiel im Minusstrang der Satelliten-RNA des Tabakringfleckenvirus (J. M. Buzayan, Nature 323: 349–353 (1986)). Von diesem Ribozym wurde auch gezeigt, dass es RNA zielspezifisch spaltet (Y. Kikuchi und N. Sasaki (1992), Nucleic Acids Research, 19: 6751–6775; Yo Kikuchi (1992), Kagaku To Seibutsu (Chemistry and Biology) 30: 112–118).The Hairpin type ribozyme is for the present invention also suitable. A hairpin type ribozyme is found, for example, in the minus strand of the satellite RNA of the tobacco ring-spotted virus (J.M. Buzayan, Nature 323: 349-353 (1986)). This ribozyme has also been shown to specifically cleave RNA (Y. Kikuchi and N. Sasaki (1992), Nucleic Acids Research, 19: 6751-6775; Kikuchi (1992), Kagaku To Seibutsu (Chemistry and Biology) 30: 112-118).

Das zur Spaltung der Zielstelle gestaltete Ribozym wird mit einem Promotor, wie dem Blumenkohlmosaikvirus-35S-Promotor, und mit einer Transcriptionsterminationssequenz fusioniert, so dass es in Pflanzenzellen transcribiert wird. Wenn jedoch zusätzliche Sequenzen an das 5'-Ende oder das 3'-Ende der transcribierten RNA angefügt wurden, kann die Ribozymaktivität verloren gehen. In diesem Fall kann man ein zusätzliches Trimm-Ribozym platzieren, das in cis die Funktion ausübt, auf der 5'- oder 3'-Seite des Ribozymteils ein Stück abzuschneiden, um den Ribozymteil genau aus der transcribierten RNA, die das Ribozym enthält, herauszuschneiden (K. Taira et al. (1990), Protein Eng. 3: 733–738; A.M. Dzaianott und J.J. Bujarski (1989), Proc. Natl. Acad. Sci. USA 86: 4823–4827; C.A. Grosshands und R.T. Cech (1991), Nucleic Acids Research, 19: 3875–3880; K. Taira et al. (1991), Nucleic Acid Research, 19: 5125–5130). Mehrere Stellen innerhalb des Zielgens können gespalten werden, indem man diese Struktureinheiten in Tandem-Anordnung bringt und dadurch größere Wirkungen erreicht (N. Yuyama et al., Biochem. Biophys. Res. Commun. 186: 1271–1279 (1992)). Durch Verwendung solcher Ribozyme ist es möglich, die Transcriptionsprodukte des Zielgens in der vorliegenden Erfindung spezifisch zu spalten und dadurch die Expression des Gens zu reprimieren.The ribozyme designed to cleave the target site is labeled with a promoter, such as the cauliflower mosaic virus 35S promoter, and with a transcription termination sequence fused so that it is transcribed in plant cells. If however additional Sequences to the 5 'end or the 3'-end the transcribed RNA added may be, the ribozyme activity get lost. In this case, one can place an additional trim Ribozyme, that performs the function in cis, on the 5'- or 3 'side of the ribozyme part one piece cut off the ribozyme part exactly from the transcribed one RNA containing the ribozyme, Taira et al (1990), Protein Eng 3: 733-738; A.M. Dzaianott and J.J. Bujarski (1989), Proc. Natl. Acad. Sci. USA 86: 4823-4827; C.A. Grosshands and R.T. Cech (1991), Nucleic Acids Research, 19: 3875-3880; K. Taira et al. (1991), Nucleic Acid Research, 19: 5125-5130). Multiple sites within the target gene can be cleaved by one brings these structural units in tandem arrangement and thereby greater effects (Yuyama N. et al., Biochem., Biophys. Res. Commun. 1271-1279 (1992)). By using such ribozymes, it is possible to Transcription products of the target gene in the present invention specifically to cleave and thereby repress the expression of the gene.

Vektoren, die für die Transformation von Salatzellen verwendet werden, unterliegen keiner Einschränkung, solange der Vektor in den Zellen eine insertierte DNA exprimieren kann. Zum Beispiel können Vektoren verwendet werden, die Promotoren für die konstitutive Genexpression in Salatzellen (z.B. Blumenkohlmosaikvirus-35S-Promotor) sowie Promotoren, die durch exogene Reize induzierbar sind, umfassen. Beispiele für geeignete Vektoren schließen den binären pBI-Vektor ein. Die "Salatzelle", in die der Vektor eingeführt werden soll, umfasst verschiedene Formen von Salatzellen, wie kultivierte Zellsuspensionen, Protoplasten, Blattabschnitte und Kallus.vectors the for The transformation of salad cells used are subject no restriction, as long as the vector in the cells express an inserted DNA can. For example, you can Vectors are used, the promoters for constitutive gene expression in salad cells (e.g., cauliflower mosaic virus 35S promoter) and promoters, which are inducible by exogenous stimuli include. Examples of suitable Close vectors the binary pBI vector. The "salad cell" into which the vector introduced To be, includes various forms of salad cells, such as cultured Cell suspensions, protoplasts, leaf sections and callus.

Ein Vektor kann nach bekannten Verfahren in Salatzellen eingeführt werden, wie nach dem Polyethylenglycolverfahren, Polykation-Verfahren, Elektroporation, Agrobacterium-vermittelte Übertragung und Teilchenbeschuss. Zum Beispiel ist das in der Literatur (S.Z. Pang et al. (1996), The Plant Journal, 9, 899–909) beschriebene Verfahren zu bevorzugen.One Vector can be introduced into salt cells by known methods, as by the polyethylene glycol method, polycation method, electroporation, Agrobacterium-mediated transmission and particle bombardment. For example, in the literature (S.Z. Pang et al. (1996), The Plant Journal, 9, 899-909) to prefer.

Die Regeneration einer Salatpflanze aus transformierten Salatzellen kann nach dem Fachmann bekannten Verfahren je nach Art der Salatzellen durchgeführt werden. Beispiele für zu bevorzugende Regenerationsverfahren sind in der Literatur beschrieben (S. Enomoto et al. (1990), Plant Cell Reports, 9, 6–9). Sobald eine transformierte Salatpflanze, in deren Genom die DNA der vorliegenden Erfindung eingeführt ist, erhalten wurde, ist es möglich, Nachkommen der Pflanze durch geschlechtliche Fortpflanzung zu gewinnen. Alternativ dazu können auch Pflanzen durch Massenproduktion aus Fortpflanzungsmaterialien (zum Beispiel Samen, Knollen, Kallus, Protoplasten usw.) gewonnen werden, die von der Pflanze oder Nachkommen oder Klonen davon erhalten wurden. Die vorliegende Erfindung umfasst Pflanzenzellen, die mit der DNA der vorliegenden Erfindung transformiert sind; Pflanzen, die diese Zellen umfassen; Nachkommen und Klone der Pflanzen; und Fortpflanzungsmaterialien der Pflanzen und ihrer Nachkommen und Klone.The Regeneration of a salad plant from transformed salad cells can according to methods known in the art depending on the type of salad cells carried out become. examples for preferable regeneration methods are described in the literature (Enomoto, S., et al., (1990), Plant Cell Reports, 9, 6-9). Once a transformed salad plant, in whose genome the DNA of the present Invention introduced is, has been, it is possible To acquire offspring of the plant through sexual reproduction. Alternatively, you can also plants by mass production from reproductive materials (For example, seeds, tubers, callus, protoplasts, etc.) won get from the plant or offspring or clones of it were. The present invention includes plant cells that are associated with the DNA of the present invention are transformed; Plants, comprising these cells; Offspring and clones of plants; and reproductive materials the plants and their descendants and clones.

Außerdem gibt die vorliegende Erfindung ein Verfahren zum Diagnostizieren einer Infektion mit LBVV an. Eine Ausführungsform des diagnostischen Verfahrens der vorliegenden Erfindung umfasst das Nachweisen einer LBVV-RNA oder einer RNA, die das virale Protein codiert, unter Verwendung eines Primers oder einer Sonde. Als Sonde oder Primer kann eine Nucleinsäure verwendet werden, die wenigstens 15 Nucleotide umfasst, die zu einer DNA, die das in einer der Sequenzen SEQ ID Nr. 2 bis 6 und 13 beschriebene LBVV-Protein codiert, homolog oder komplementär ist. Die Nucleinsäure ist vorzugsweise eine Nucleinsäure, die spezifisch mit einer DNA hybridisiert, die das in einer der Sequenzen SEQ ID Nr. 2 bis 6 und 13 beschriebene LBVV-Protein codiert.In addition, the present invention provides a method for diagnosing an infection with LBVV. An embodiment of the diagnostic method of the present invention comprises detecting an LBVV RNA or an RNA encoding the viral protein using a primer or a probe. As a probe or primer, a nucleic acid comprising at least 15 nucleotides homologous or complementary to a DNA encoding the LBVV protein described in any of SEQ ID NOs: 2 to 6 and 13 can be used. The nucleic acid is preferably a nucleic acid, the speci fish hybridized with a DNA encoding the LBVV protein described in any of SEQ ID NOs: 2 to 6 and 13.

Der Primer oder die Sonde kann markiert sein, falls notwendig. Beispiele für Marker schließen einen radioaktiven Marker ein.Of the Primer or probe may be labeled if necessary. Examples for markers shut down a radioactive marker.

Bei dieser Diagnose wird zum Beispiel eine Testprobe aus Salat, von dem man annimmt, dass er mit dem Breitadernvirus des Salats infiziert sein könnte, aus Olpidium, das das Virus beherbergt, oder aus Boden, der das Virus enthält, hergestellt, und mit der Probe wird eine PCR unter Verwendung des obigen Primers oder ein Northern-Blotting unter Verwendung der obigen Sonde durchgeführt.at For example, this diagnosis will be a test sample of salad, from it is believed that it infects with the broad-veined salads virus could be, from Olpidium, which harbors the virus, or from soil that contains the virus Contains virus, and the sample is subjected to PCR using the sample the above primer or Northern blotting using the above Probe performed.

Eine weitere Ausführungsform des diagnostischen Verfahrens der vorliegenden Erfindung ist ein Verfahren, das durch das Nachweisen von LBVV-Proteinen unter Verwendung von Antikörper gekennzeichnet ist. Der bei dieser Diagnose verwendete Antikörper kann zum Beispiel durch Synthetisieren eines Peptids unter Verwendung des antigenen Bereichs, der aufgrund der resultierenden Aminosäuresequenzen (eine der Sequenzen SEQ ID Nr. 2 bis 6 und 13) angenommen wird, durch Binden des Peptids an ein Trägerprotein, wie KLH oder BSA, und durch Immunisieren von Kaninchen mit diesem Protein hergestellt werden. Außerdem kann der Antikörper auch durch Markieren von LBVV-Proteinen mit Histidin unter Verwendung des QIAexpress-Typ-IV-Kits (QIAGEN), durch Exprimieren des markierten Proteins in E. coli und durch Immunisieren von Kaninchen mit dem resultierenden Protein produziert werden. Der Antikörper kann gegebenenfalls markiert werden. Beispiele für Marker schließen einen Enzymmarker ein. Anstatt den Antikörper selbst direkt zu markieren, kann der Antikörper außerdem auch über eine Substanz, wie Protein A, die an den Antikörper bindet, markiert werden, wobei anschließend das Zielprotein nachgewiesen wird.A another embodiment of the diagnostic method of the present invention is a A method used by detecting LBVV proteins using of antibodies is marked. The antibody used in this diagnosis can for example, by synthesizing a peptide using of the antigenic region due to the resulting amino acid sequences (one of the sequences SEQ ID No. 2 to 6 and 13) is assumed, by binding the peptide to a carrier protein, such as KLH or BSA, and by immunizing rabbits with this protein become. In addition, can the antibody also by labeling LBVV proteins with histidine using of the QIAexpress type IV kit (QIAGEN) by expressing the labeled Protein in E. coli and by immunizing rabbits with the resulting protein are produced. The antibody can optionally marked. Examples of markers include one Enzyme marker. Instead of directly marking the antibody itself, can the antibody Furthermore also over labeling a substance, such as protein A, that binds to the antibody, subsequently the target protein is detected.

Bei dieser Diagnose wird eine Testprobe zum Beispiel aus Salat, von dem man annimmt, dass er mit dem Breitadernvirus des Salats infiziert sein könnte, aus Olpidium, das das Virus beherbergt, oder aus Boden, der das Virus enthält, hergestellt, und dann wird mit der Probe ein ELISA oder ein Western-Blotting unter Verwendung des obigen Antikörpers durchgeführt.at This diagnosis will be a test sample, for example, from lettuce, from it is believed that it infects with the broad-veined salads virus could be, from Olpidium, which harbors the virus, or from soil that contains the virus Contains virus, and then the sample is ELISA or Western blotted performed using the above antibody.

Beste Methode zur Durchführung der ErfindungBest method to carry out the invention

Die vorliegende Erfindung wird im Folgenden anhand der Beispiele ausführlich erläutert, soll aber nicht auf diese beschränkt sein.The The present invention will be explained in detail below with reference to the examples but not limited to these be.

[Beispiel 1] Klonierung des Hüllproteingens des Breitadernvirus des Salats (LBVV)[Example 1] Cloning of the coat protein gene of the Broad-veined Salivary Virus (LBVV)

Eine Probe von kontaminiertem Boden aus einem Salatfeld (Kultursorte: Cisco) in der Präfektur Kagawa in Japan, das im Jahre 1997 charakteristische Breitadernsymptome zeigte, wurde genommen. Das Virus wurde in Ruhesporen in trockenem Boden gehalten, der im Labor aufbewahrt wurde. Cisco, eine Salat-Kultursorte, wurde für die Virusreinigung verwendet, und das Virus wurde durch reguläre Übertragung in Boden eingeimpft.A Sample of contaminated soil from a lettuce field (cultivar: Cisco) in the prefecture Kagawa in Japan, which in 1997 characteristic broad-vein symptoms showed was taken. The virus was found in rest spores in dry Soil kept in the laboratory. Cisco, a salad cultivar, was for the Virus cleansing was used, and the virus was transmitted through regular transmission inoculated in soil.

Die Virusreinigung wurde durchgeführt, indem man das Verfahren von Kuwata et al. (S. Kuwata et al. (1983), Annals of the Phytopathological Society of Japan, 49, 246–251) modifizierte. Der erste Schritt des Sedimentierens von Virionen durch Zentrifugation bei niedriger Geschwindigkeit wurde weggelassen. Die Virusfraktion wurde durch Behandeln mit 1% Triton-X und 1% Brij-35 und anschließende Cs2SO4-Dichtegradientenzentrifugation erhalten. Als das nach diesem Reinigungsverfahren erhaltene gereinigte Virus einer SDS-Polyacrylamid-Elektrophorese unterzogen wurde, wurde nur eine einzige Bande bei 48 kDa nachgewiesen. Da durch Elektronenmikroskopie außerdem nur Haufen von LBVV-Partikeln beobachtet wurden, während andere Verunreinigungen nicht beobachtet wurden, wurde angenommen, dass das resultierende Virus eine beträchtlich hohe Reinheit hat.Virus purification was performed by following the procedure of Kuwata et al. Kuwata et al (1983), Annals of the Phytopathological Society of Japan, 49, 246-251). The first step of sedimenting virions by low speed centrifugation was omitted. The virus fraction was obtained by treatment with 1% Triton-X and 1% Brij-35 followed by Cs 2 SO 4 density gradient centrifugation. When the purified virus obtained by this purification procedure was subjected to SDS-polyacrylamide electrophoresis, only a single band at 48 kDa was detected. In addition, since only heaps of LBVV particles were observed by electron microscopy while other impurities were not observed, it was considered that the resulting virus has a considerably high purity.

Nach der Behandlung des gereinigten Virus mit Proteinase-K-SDS wurde eine Extraktion der viralen Nucleinsäure durch Phenol/Chloroform und Ethanolfällung durchgeführt. Die gereinigte virale Nucleinsäure wurde nach Denaturierung mit Dimethylsulfoxid zur Synthese der cDNA des ersten Stranges verwendet. Poly(A)+-RNA wurde aus dem virusinfizierten Salatblatt isoliert, das offensichtliche Breitadernsymptome zeigte, wobei man den Dynabeads®-mRNA-DIRECTTM-Kit (Dynal®) verwendete. Eine Synthese der cDNA des ersten Strangs wurde durchgeführt, indem man eine reverse Transcriptionsreaktion mit SUPER-SCRIPTTM-II-RNase-H–-Reverser-Transcriptase (Gibco BRL) unter Verwendung eines statistischen Primers oder eines Oligo-dT-BamHI-Primers durchführte.After treatment of the purified virus with proteinase K-SDS, extraction of the viral nucleic acid by phenol / chloroform and ethanol precipitation was performed. The purified viral nucleic acid was used after denaturation with dimethylsulfoxide for the synthesis of the cDNA of the first strand. Poly (A) + - RNA was isolated from the virus-infected lettuce leaf, which showed obvious big-vein symptoms in which was used the Dynabeads ® mRNA DIRECT ™ kit (Dynal ®). A synthesis of the first strand cDNA was carried out by a reverse transcription reaction with SUPER SCRIPT TM-II RNase H - -Reverser transcriptase (Gibco BRL) carried out using a statistical primer or an oligo dT-BamHI primer ,

Die Bestimmung der internen Aminosäuresequenzen des LBVV-Hüllproteins wurde in der unten beschriebenen Weise durchgeführt. Nachdem gereinigtes LBVV einer 12,5%-SDS-Polyacrylamid-Elektrophorese unterzogen worden war, wurden die Polypeptide auf eine Nitrocellulosemembran übertragen, und die interessierende Bande wurde ausgeschnitten, und dann erfolgte eine Carboxy methylierung und Behandlung mit Lysyl-Endopeptidase. Nach der Behandlung wurden 38 Peptidfragmente des LBVV-Hüllproteins durch Umkehrphasen-HPLC erhalten, und die Aminosäuresequenzen von mehreren internen Peptidfragmenten wurden bestimmt.The Determination of Internal Amino Acid Sequences of the LBVV envelope protein was carried out in the manner described below. After purified LBVV 12.5% SDS polyacrylamide electrophoresis, the polypeptides were transferred to a nitrocellulose membrane, and the band of interest was cut out, and then made a carboxy methylation and treatment with lysyl endopeptidase. After treatment, 38 peptide fragments of the LBVV envelope protein obtained by reverse phase HPLC, and the amino acid sequences of several internal Peptide fragments were determined.

Ein 5LB111-Primer (GARWSITGGGAYGAYGARWSIAC/SEQ ID Nr. 7) und 3LB171-Primer (GCRTCDATRTARTCIACICCIGG/SEQ ID Nr. 8) wurden auf der Grundlage von ESWDDESTIAMP und NLEVPGVDYIDA der resultierenden Aminosäuresequenzen gestaltet. Unter Verwendung dieser Primer und von Takara-Taq (Takara) wurde eine PCR durchgeführt, und es wurde ein PCR-Produkt von 274 bp erhalten. Das resultierende PCR-Produkt wurde unter Verwendung von pGEM®-T Easy Vector Systems (Promega) kloniert, und seine Nucleotidsequenz wurde bestimmt.A 5LB111 primer (GARWSITGGGAYGAYGARWSIAC / SEQ ID NO: 7) and 3LB171 primer (GCRTCDATRTARTCIACICCIGG / SEQ ID NO: 8) were designed based on ESWDDESTIAMP and NLEVPGVDYIDA of the resulting amino acid sequences. Using these primers and Takara-Taq (Takara), PCR was performed and a PCR product of 274 bp was obtained. The resulting PCR product was cloned using pGEM ® -T Easy Vector Systems (Promega), and its nucleotide sequence was determined.

Um die volle Länge des Hüllproteingens von LBVV zu bestimmen, wurden 3'RACE oder 5'RACE unter Verwendung einer RNA aus dem gereinigten Virus oder einer Poly(A)+-RNA aus dem LBVV-infizierten Blatt durchgeführt. Im Falle von 3'RACE wurde ein 891-bp-PCR-Produkt unter Verwendung einer Poly(A)+-RNA aus dem LBVV-infizierten Blatt erhalten, wobei man den Oligo-dT-BamHI-Primer und den 5LB171-Primer (AAYYTIGARGTICCIGGIGTIGA/SEQ ID Nr. 9) verwendete. Im Falle von 5'RACE wurde ein 760-bp-PCR-Produkt mit dem 5'RACE System for Rapid Amplification of cDNA Ends, Version 2.0 (Gibco BRL), erhalten, wobei man eine RNA aus gereinigtem Virus oder eine Poly(A)+-RNA aus dem LBVV-infizierten Blatt verwendete und den 3LB5R4-Primer (GTTTTTGACCCTGATAG/SEQ ID Nr. 10) und 3LB5R5-Primer (GTCGACTCTAGACACTTGTTGTTTGTCGTG/SEQ ID Nr. 11) verwendete. Die resultierenden PCR-Produkte wurden unter Verwendung von pGEM®-T Easy Vector Systems (Promega) kloniert, und die Nucleotidsequenzen wurden für wenigstens sechs Klone oder mehr bestimmt. Außerdem wurden das 500- und das 700-bp-PCR-Produkt aus dem Bereich in der Nähe des Hüllproteingens unter Verwendung von gegenseitig überlappenden virusspezifischen Primern umkloniert. Wenigstens drei Klone wurden aus jedem Bereich sequenziert, und die Nucleotidsequenz des Hüllproteingens wurde bestätigt.To determine the full length of the coat protein gene of LBVV, 3'RACE or 5'RACE were performed using RNA from the purified virus or poly (A) + RNA from the LBVV-infected leaf. In the case of 3'RACE, an 891 bp PCR product was obtained using a poly (A) + RNA from the LBVV infected leaf, using the oligo dT BamHI primer and the 5LB171 primer (AAYYTIGARGTICCIGGIGTIGA / SEQ ID NO: 9). In the case of 5'RACE, a 760 bp PCR product was obtained with the 5'RACE System for Rapid Amplification of cDNA Ends, Version 2.0 (Gibco BRL), using RNA from purified virus or a poly (A). Used + LBVV-infected leaf + RNA and used the 3LB5R4 primer (GTTTTGACCCTGATAG / SEQ ID NO: 10) and 3LB5R5 primer (GTCGACTCTAGACACTTGTTGTTTGTCGTG / SEQ ID NO: 11). The resulting PCR products were cloned using the pGEM ® -T Easy Vector Systems (Promega), and the nucleotide sequences were determined for at least six or more clones. In addition, the 500 and 700 bp PCR products were recloned from the region near the coat protein gene using mutually overlapping virus-specific primers. At least three clones were sequenced from each region and the nucleotide sequence of the coat protein gene was confirmed.

Eine Sequenz von 1425 Nucleotiden wurde unter Verwendung des obigen Verfahrens bestimmt. Dieses Gen hatte eine Translationsstartstelle bei Nucleotid 209 und codierte 397 Aminosäuren (siehe SEQ ID Nr. 1).A Sequence of 1425 nucleotides was determined using the above procedure certainly. This gene had a translation start site at nucleotide 209 and encoded 397 amino acids (see SEQ ID NO: 1).

[Beispiel 2] Herstellung von transformiertem Salat[Example 2] Production of transformed salad

(1) Sterilisierung und Kultivierung von Salatsamen(1) sterilization and Cultivation of salad seeds

Salatsamen wurden mehrere Sekunden lang in 70% Ethanol eingetaucht, und dann erfolgte eine Behandlung während 15 Minuten in einer Sterilisationslösung (10% Natriumhypochlorit, 0,05% Tween-20). Dann wurden die Samen mit sterilisiertem Wasser abgespült, auf Hyponex-Agar-Medium (hergestellt durch Auflösen von 3,0 g Hyponex-Pulver, 10,0 g Saccharose und 8,0 g Agar in einem Liter destilliertem Wasser und dann Einstellen des pH-Werts auf 5,8 mit 1 N NaOH) in einer Pflanzenbox ausgesät und etwa 2 Wochen lang unter Lichtbedingungen bei 25 bis 28°C wachsen gelassen, bis das echte Blatt etwa 5 cm erreichte.lettuce seeds were immersed in 70% ethanol for several seconds, and then There was a treatment during 15 minutes in a sterilization solution (10% sodium hypochlorite, 0.05% Tween-20). Then the seeds were sterilized with water rinsed, on Hyponex agar medium (prepared by dissolving 3.0 g Hyponex powder, 10.0 g of sucrose and 8.0 g of agar in one liter of distilled water and then adjusting the pH to 5.8 with 1 N NaOH) in one Seeded plant box and grow under light conditions at 25 to 28 ° C for about 2 weeks left until the real leaf reached about 5 cm.

(2) Kultivierung von und Impfung mit Agrobacterium(2) cultivation of and Vaccination with Agrobacterium

Agrobacterium wurde in flüssiges YEB-Medium (hergestellt durch Auflösen von 1,0 g Hefeextrakt, 5,0 g Rinderextrakt, 5,0 g Pepton, 5,0 g Saccharose und 0,5 g MgSO4·7H2O in einem Liter destilliertem Wasser und dann Einstellen des pH-Werts auf 7,0 mit 1 N NaOH), das 250 μg/ml Streptomycin, 5 μg/ml Rifampicin und 50 μg/ml Kanamycin umfasste, eingeimpft und dann über Nacht bei 28°C unter Schütteln kultiviert. Dann wurde die Agrobacterium-Kulturflüssigkeit in frischem YEB-Medium (das die oben genannten Antibiotika enthielt) subkultiviert und zusätzlich einen Tag lang bei 28°C unter Schütteln kultiviert.Agrobacterium was distilled into liquid YEB medium (prepared by dissolving 1.0 g of yeast extract, 5.0 g of bovine extract, 5.0 g of peptone, 5.0 g of sucrose and 0.5 g of MgSO 4 .7H 2 O in one liter Water and then adjusting the pH to 7.0 with 1N NaOH) containing 250 μg / ml streptomycin, 5 μg / ml rifampicin and 50 μg / ml kanamycin, and then cultured overnight at 28 ° C with shaking , Then, the Agrobacterium culture liquid was subcultured in fresh YEB medium (containing the above-mentioned antibiotics) and further cultured for one day at 28 ° C with shaking.

Die jungen Salatpflanzen, bei denen das echte Blatt auf etwa 5 cm gewachsen war, wurden auf Kunststoff-Petri-Schalen übergeführt, das echte Blatt wurde in Stücke geschnitten, die etwa 5 mm maßen, und die Stücke der Blätter wurden 1 Minute lang in zehnfach verdünnte Agrobacterium-Kulturflüssigkeit eingetaucht. Dann wurden die Stücke auf Medium nach Murashige & Skoog (MS-Medium) (pH 5,8), das 3% Saccharose, 0,5 ppm Benzyladeninphosphat (BAP), 0,1 ppm Naphthalinessigsäure (NAA) und 0,8% Agar umfasste, in 15 bis 20 Stücken/Platte angeordnet und 2 Tage lang bei 25°C unter Bedingungen von 2000 lux cokultiviert. Nach dem Cokultivieren wurden die Stücke 7 Tage lang unter sterilen Bedingungen in MS-Medium (pH 5,8) kultiviert, das 3% Saccharose, 0,5 ppm BAP, 0,1 ppm NAA, 250 μg/ml Carbenicillin und 0,8% Agar umfasste.The young lettuce plants in which the true leaf had grown to about 5 cm were transferred to plastic petri dishes, the true leaf was cut into pieces measuring about 5 mm, and the pieces of the leaves became ten-fold for 1 minute dipped Agrobacterium culture fluid. The pieces were then placed on Murashige & Skoog (MS medium) medium (pH 5.8), 3% sucrose, 0.5 ppm benzyl adenine phosphate (BAP), 0.1 ppm naphthaleneacetic acid (NAA) and 0.8% agar arranged, arranged in 15 to 20 pieces / plate and cocultured for 2 days at 25 ° C under conditions of 2000 lux. To in the coculture, the pieces were cultured for 7 days under sterile conditions in MS medium (pH 5.8) containing 3% sucrose, 0.5 ppm BAP, 0.1 ppm NAA, 250 μg / ml carbenicillin and 0.8% Agar included.

(3) Selektion und Kultivierung von Transformanten(3) selection and cultivation of transformants

Nach einer sterilen Kultur wurden die Stücke auf MS-Medium (pH 5,8), das 3% Saccharose, 0,5 ppm BAP, 0,1 ppm NAA, 250 μg/ml Carbenicillin, 50 mg/ml Kanamycin und 0,8% Agar umfasste, übertragen und bei 25°C unter Bedingungen von 2000 lux kultiviert. Die Stücke wurden etwa alle 2 Wochen subkultiviert, und eine Regeneration wurde nach etwa 2 bis 3 Monaten aus denjenigen Pflanzen beobachtet, die mit Agrobacterium geimpft worden waren.To a sterile culture, the pieces were placed on MS medium (pH 5.8), 3% sucrose, 0.5 ppm BAP, 0.1 ppm NAA, 250 μg / ml carbenicillin, 50 mg / ml kanamycin and 0.8% agar, transferred and incubated at 25 ° C under conditions of 2000 lux cultivated. The pieces were subcultured about every 2 weeks, and a regeneration was observed after about 2 to 3 months from those plants that were inoculated with Agrobacterium.

Die redifferenzierten Individuen wurden auf MS-Medium (pH 5,8), das 3% Saccharose, 0,3 ppm BAP, 500 μg/ml Carbenicillin und 0,8% Agar umfasste, übertragen und etwa alle 2 Wochen subkultiviert. Wenn die redifferenzierten Individuen eine Größe von etwa 3 cm erreichten, wurden Schnittstücke davon eingefügt und in 1/2-faches Agarmedium, das 500 μg/ml Carbenicillin enthielt, gepflanzt und Wurzeln bilden gelassen.The Redifferentiated individuals were on MS medium (pH 5.8), the 3% sucrose, 0.3 ppm BAP, 500 μg / ml Carbenicillin and 0.8% agar included, transferred and approximately every 2 weeks subcultured. When the redifferentiated individuals are a size of about Reached 3 cm, cuts were inserted from it and into 1/2-fold agar medium containing 500 μg / ml Carbenicillin contained, planted and allowed to form roots.

(4) Salatakklimatisierung und Probenahme von Samen(4) salad acclimatization and sampling of seeds

In dem Stadium, in dem die redifferenzierten Individuen Wurzeln gebildet hatten und die Schösslinge bis 1 bis 2 cm gewachsen waren, wurden die Schösslinge abgeschnitten, und die Schnittstücke wurden in Vermiculit, das in eine 500-fach verdünnte wässrige Lösung von Hyponex eingetaucht worden war, gepflanzt und Wurzeln bilden gelassen. Die Pflanzen wurden akklimatisiert, indem man den Deckel der Pflanzenbox allmählich öffnete und so für Belüftung sorgte. Nachdem sich die Pflanzen ausreichend akklimatisiert hatten, wurden sie in einem geschlossenen Treibhaus (maximale Lufttemperatur: 30°C, natürlicher Lichtrhyth mus) dauerhaft in Polypot gepflanzt, der Kureha-Gartenerde (Kureha engei baido) umfasste. Dann ließ man sie schießen und blühen, und es wurden Samenproben genommen.In the stage in which the redifferentiated individuals formed roots had and the saplings up 1 to 2 cm were grown, the shoots were cut off, and the cut pieces were dipped in vermiculite into a 500-fold diluted aqueous solution of Hyponex had been planted and allowed to form roots. The plants were acclimated by gradually opening the lid of the plant box and so for ventilation provided. After the plants had sufficiently acclimated, they were kept in a closed greenhouse (maximum air temperature: 30 ° C, more natural Lichtrhyth mus) permanently planted in Polypot, the Kureha garden soil (Kureha nahi baido) included. Then they were let shoot and flower, and semen samples were taken.

[Beispiel 3] Klonierung des LBVV-RNA2-Gens[Example 3] Cloning of the LBVV RNA2 gene

Eine Probe von kontaminiertem Boden aus einem Salatfeld (Kultursorte: Cisco) in der Präfektur Kagawa in Japan, das im Jahre 1997 charakteristische Breitadernsymptome zeigte, wurde genommen. Das Virus wurde in Ruhesporen in trockenem Boden gehalten, der im Labor aufbewahrt wurde. Cisco, eine Salat-Kultursorte, wurde für die Virusreinigung verwendet, und das Virus wurde durch reguläre Übertragung in Boden eingeimpft.A Sample of contaminated soil from a lettuce field (cultivar: Cisco) in the prefecture Kagawa in Japan, which in 1997 characteristic broad-vein symptoms showed was taken. The virus was found in rest spores in dry Soil kept in the laboratory. Cisco, a salad cultivar, was for the Virus cleansing was used, and the virus was transmitted through regular transmission inoculated in soil.

Die Virusreinigung und RNA-Reinigung wurden gemäß Beispiel 1 durchgeführt. Die Synthese von cDNA und Bestimmung der Nucleotidsequenz erfolgten im Einklang mit dem Verfahren von C.F. Fazeli & M.A. Rezaian (Journal of General Virology, 81, 605–615) unter Verwendung eines Genom-Walking-Verfahrens, bei dem die Sequenz verlängert wird, indem man einen Primer für die Stromabwärtsrichtung synthetisierte. Zuerst wurde auf der Grundlage von Beispiel 1 ein virusspezifischer 5LB5R3-Primer (AGCTCTGAACAACGACATG/SEQ ID Nr. 16) hergestellt, und eine erste cDNA wurde mit SUPERSCRIPTTM-II-RNase-H–-Reverser-Transcriptase unter Verwendung einer RNA aus dem gereinigten LBVV als Matrize synthetisiert. Dann wurde eine zweite cDNA mit einem Klenow-Fragment (Takara) unter Verwendung des universellen Primers dN6 (5'-GCCGGAGCTCTGCAGAATTCNNNNNN-3'/SEQ ID Nr. 14) synthetisiert. Nach der Entfernung von überschüssigem Primer mit dem GlassMax DNA Isolation Spin Cartridge System (Gibco BRL) wurden eine PCR durchgeführt, wobei man den virusspezifischen Primer und einen universellen Primer (5'-GCCGGAGCTCTGCAGAATTC-3'/SEQ ID Nr. 15) verwendete, und das resultierende PCR-Produkt wurde unter Verwendung von pGEM®-T Easy Vector Systems kloniert. Dann wurde die Nucleotidsequenz bestimmt. Dann wurde dasselbe Verfahren viermal wiederholt, wobei bis zu 5177 Nucleotide bestimmt wurden. Die Bestimmung des 3'-Terminus von RNA2 wurde durch 5'RACE durchgeführt (Anmerkung: da gereinigte LBVV-RNA sowohl einen positiven Strang als auch einen negativen Strang enthält, kann nicht nur der 5'-Terminus, sondern auch der 3'-Terminus durch 5'RACE bestimmt werden), und eine Sequenz von 6078 Nucleotiden wurde bestimmt, die Gene für fünf Proteine umfasste, die von LBVV codiert wurden (SEQ ID Nr. 1). Weiterhin wurden die 500- bis 700-bp-Produkte von RNA2 unter Verwendung von gegenseitig überlappenden virusspezifischen Primern umkloniert. Wenigstens drei Klone wurden aus jedem Bereich sequenziert, und die Nucleotidsequenz von RNA2 wurde bestätigt.Virus purification and RNA purification were carried out according to Example 1. Synthesis of cDNA and determination of nucleotide sequence were carried out in accordance with the method of CF Fazeli & MA Rezaian (Journal of General Virology, 81, 605-615) using a genome walking method in which the sequence is extended by synthesized a primer for the downstream direction. First, a virus-specific 5LB5R3 primer (. AGCTCTGAACAACGACATG / SEQ ID NO: 16) was prepared on the basis of Example 1, and a first cDNA was SUPERSCRIPT ™ -II RNase H - purified from the -Reverser transcriptase using a RNA LBVV synthesized as a template. Then, a second cDNA with a Klenow fragment (Takara) was synthesized using the universal primer dN6 (5'-GCCGGAGCTCTGCAGAATTCNNNNNN-3 '/ SEQ ID NO: 14). After removal of excess primer with the GlassMax DNA Isolation Spin Cartridge System (Gibco BRL), PCR was performed using the virus-specific primer and a universal primer (5'-GCCGGAGCTCTGCAGAATTC-3 '/ SEQ ID NO: 15), and the resulting PCR product was cloned using pGEM ® -T Easy Vector Systems. Then the nucleotide sequence was determined. Then the same procedure was repeated four times, determining up to 5177 nucleotides. The determination of the 3'-terminus of RNA2 was performed by 5'RACE (note: since purified LBVV-RNA contains both a positive strand and a negative strand, not only the 5'-terminus but also the 3'-terminus 5'RACE), and a sequence of 6078 nucleotides was determined that comprised genes for five proteins encoded by LBVV (SEQ ID NO: 1). Furthermore, the 500- to 700-bp products of RNA2 were recloned using mutually overlapping virus-specific primers. At least three clones were sequenced from each region and the nucleotide sequence of RNA2 was confirmed.

Eine Sequenz von 6078 Nucleotiden wurde unter Verwendung des obigen Verfahrens bestimmt. Dieses Gen codierte fünf Proteine. Protein 1 (Hüllprotein: Beispiel 1) hatte eine Translationsstartstelle an Nucleotid 209 und codierte 397 Aminosäuren (SEQ ID Nr. 2), Protein 2 hatte eine Translationsstartstelle an Nucleotid 1492 und codierte 333 Aminosäuren (SEQ ID Nr. 3), Protein 3 hatte eine Translationsstartstelle an Nucleotid 2616 und codierte 290 Aminosäuren (SEQ ID Nr. 4), Protein 4 hatte eine Translationsstartstelle an Nucleotid 3842 und codierte 164 Aminosäuren (SEQ ID Nr. 5), und Protein 5 hatte eine Translationsstartstelle an Nucleotid 4529 und codierte 368 Aminosäuren (SEQ ID Nr. 6). Als die Homologie der Aminosäuresequenzen mit anderen Viren verglichen wurde, wurde nur Protein 1 (Hüllprotein) als homolog zu dem Nucleocapsidprotein (Hüllprotein) von Viren, die zur Familie Rhabdoviridae gehören, beobachtet.A sequence of 6078 nucleotides was determined using the above procedure. This gene encoded five proteins. Protein 1 (coat protein: Example 1) had a translation start site at nucleotide 209 and encoded 397 amino acids (SEQ ID NO: 2), protein 2 had a translation start site at nucleotide Protein 3 had a translation start site at nucleotide 2616 and encoded 290 amino acids (SEQ ID NO: 4), protein 4 had a translation start site at nucleotide 3842 and encoded 164 amino acids (SEQ ID NO: 4). 5) and protein 5 had a translation start site at nucleotide 4529 and encoded 368 amino acids (SEQ ID NO: 6). When the homology of the amino acid sequences was compared with other viruses, only protein 1 (coat protein) was observed to be homologous to the nucleocapsid protein (coat protein) of viruses belonging to the family Rhabdoviridae.

[Beispiel 4] Klonierung des LBVV-Polymerase-Gens[Example 4] Cloning of the LBVV polymerase gene

Eine Probe von kontaminiertem Boden aus einem Salatfeld (Kultursorte: Cisco) in der Präfektur Kagawa in Japan, das im Jahre 1997 charakteristische Breitadernsymptome zeigte, wurde genommen. Das Virus wurde in Ruhesporen in trockenem Boden gehalten, der im Labor aufbewahrt wurde. Cisco, eine Salat-Kultursorte, wurde für die Virusreinigung verwendet, und das Virus wurde durch reguläre Übertragung in Boden eingeimpft.A Sample of contaminated soil from a lettuce field (cultivar: Cisco) in the prefecture Kagawa in Japan, which in 1997 characteristic broad-vein symptoms showed was taken. The virus was found in rest spores in dry Soil kept in the laboratory. Cisco, a salad cultivar, was for the Virus cleansing was used, and the virus was transmitted through regular transmission inoculated in soil.

Die Virusreinigung wurde in derselben Weise wie bei dem Verfahren zur Virusreinigung von Beispiel 1 durchgeführt. Die Extraktion von hochreiner LBVV-RNA wurde in der unten beschriebenen Weise durchgeführt. Nach der Behandlung des gereinigten Virus mit Proteinase-K-SDS wurde sie mit Phenol/Chloroform extrahiert und mit Ethanol gefällt. Nachdem die virale Nucleinsäure dann mit DNase behandelt und mit dem RNaid® Kit (BIO 101) weiter gereinigt worden war, wurde eine 7,3-kb-RNA von zwei LBVV-RNAs durch Elektrophorese auf 1% Agarose-Gel (SeaPlaque GTG Agarose, FMC) isoliert und für die Synthese von cDNA verwendet. Die Synthese von cDNA wurde nach dem Verfahren von P. Froussard (Nucleic Acids Research, 20, 2900) durchgeführt. Kurz gesagt, eine erste cDNA wurde mit der SUPERSCRIPTTM-II-RNase-H–-Reversen-Transcriptase unter Verwendung des universellen Primers dN6 (5'-GCCGGAGCTCTGCAGAATTCNNNNNN-3'/SEQ ID Nr. 14) durchgeführt. Dann wurde eine zweite cDNA mit einem Klenow-Fragment synthetisiert, eine PCR wurde unter Verwendung eines universellen Primers (5'-GCCGGAGCTCTGCAGAATTC-3'/SEQ ID Nr. 15) durchgeführt, und das resultierende PCR-Produkt wurde unter Verwendung von pGEM®-T Easy Vector Systems kloniert. Dann wurde die Nucleotidsequenz bestimmt.Virus purification was carried out in the same manner as in the virus purification method of Example 1. The extraction of high purity LBVV RNA was performed in the manner described below. After treating the purified virus with proteinase K-SDS, it was extracted with phenol / chloroform and precipitated with ethanol. After the viral nucleic acid was then treated with DNase and with the RNaid ® Kit (BIO 101) was further purified, a 7.3 kb RNA of two LBVV RNA by electrophoresis on 1% agarose gel (SeaPlaque GTG agarose, FMC) and used for the synthesis of cDNA. The synthesis of cDNA was carried out according to the method of P. Froussard (Nucleic Acids Research, 20, 2900). Briefly, a first cDNA was created using the SUPERSCRIPT ™ -II RNase H - performed -Reversen transcriptase using the universal primer dN6 (5'-GCCGGAGCTCTGCAGAATTCNNNNNN-3 '/ SEQ ID NO. 14). Then, a second cDNA was synthesized with a Klenow fragment, a PCR was performed using a universal primer (5'-GCCGGAGCTCTGCAGAATTC-3 '/ SEQ ID NO. 15) carried out, and the resulting PCR product was performed using pGEM ® - T Easy Vector Systems cloned. Then the nucleotide sequence was determined.

Acht partielle LBVV-Polymerase-Gen-Fragmente von etwa 500 bp wurden erhalten. Beide Enden des Polymerase-Gens wurden durch 5'RACE aufgefüllt, und die Lücken zwischen den Fragmenten wurden durch RT-PCR aufgefüllt, wodurch eine Sequenz von 6793 Nucleotiden bestimmt wurde, die das Polymerase-Gen in voller Länge (SEQ ID Nr. 12) enthielt. Weiterhin wurden die 500- bis 700-bp-PCR-Produkte des Polymerase-Gens unter Verwendung von gegenseitig überlappenden virusspezifischen Primern umkloniert. Wenigstens drei Klone wurden aus jedem Bereich sequenziert, und die Nucleotidsequenz des Polymerase-Gens wurde bestätigt.eight partial LBVV polymerase gene fragments of about 500 bp were obtained. Both ends of the polymerase gene were filled in by 5'RACE, and the gaps between the fragments were filled in by RT-PCR, yielding a sequence of 6793 nucleotides was determined that the polymerase gene in full Length (SEQ ID No. 12). Further, the 500 to 700 bp PCR products were used of the polymerase gene using mutually overlapping recloned virus-specific primers. At least three clones were from each region, and the nucleotide sequence of the polymerase gene was confirmed.

Dieses Gen codierte 2040 Aminosäuren mit einer Translationsstartstelle an Nucleotid 337 (SEQ ID Nr. 13). Als die Homologie der Aminosäuresequenz mit anderen Viren verglichen wurde, wurde bestätigt, dass das Protein homolog zu den Polymerasen von Viren ist, die zur Ordnung Mononegavirales gehören, insbesondere von Viren, die zur Familie der Rhabdoviridae gehören, und vier Motive beibehalten hat, die als verantwortlich für die Polymerase-Aktivität gelten.This Gene encoded 2040 amino acids with a translation start site at nucleotide 337 (SEQ ID NO: 13). As the homology of the amino acid sequence was compared with other viruses, it was confirmed that the protein was homologous to the polymerases of viruses that is responsible for the order Mononegavirales belong, in particular viruses belonging to the family Rhabdoviridae, and has retained four motifs that are considered responsible for the polymerase activity.

Gewerbliche Anwendbarkeitcommercial applicability

Gemäß der vorliegenden Erfindung wurden Nucleinsäuren isoliert, die Proteine von LBVV codieren, und ihre Primärstruktur wurde aufgeklärt. Es wurde daher möglich, eine Salatpflanze, die Resistenz gegen das Virus aufweist, zu produzieren, indem man die Nucleinsäure oder ihre Antisense-Nucleinsäure in Salat exprimiert. Außerdem wurde es möglich, eine Diagnose einer Infektion mit LBVV vorzunehmen, indem man die Nucleinsäure oder ein davon codiertes Protein nachweist.According to the present Invention have been nucleic acids isolated, which encode proteins of LBVV, and their primary structure was enlightened. It has therefore become possible to produce a salad plant that has resistance to the virus, by taking the nucleic acid or their antisense nucleic acid expressed in lettuce. Furthermore it became possible make a diagnosis of an infection with LBVV by using the nucleic acid or a protein encoded by it.

Sequenzprotokoll

Figure 00230001
sequence Listing
Figure 00230001

Figure 00240001
Figure 00240001

Figure 00250001
Figure 00250001

Figure 00260001
Figure 00260001

Figure 00270001
Figure 00270001

Figure 00280001
Figure 00280001

Figure 00290001
Figure 00290001

Figure 00300001
Figure 00300001

Figure 00310001
Figure 00310001

Figure 00320001
Figure 00320001

Figure 00330001
Figure 00330001

Figure 00340001
Figure 00340001

Figure 00350001
Figure 00350001

Figure 00360001
Figure 00360001

Figure 00370001
Figure 00370001

Figure 00380001
Figure 00380001

Figure 00390001
Figure 00390001

Figure 00400001
Figure 00400001

Figure 00410001
Figure 00410001

Figure 00420001
Figure 00420001

Figure 00430001
Figure 00430001

Figure 00440001
Figure 00440001

Figure 00450001
Figure 00450001

Figure 00460001
Figure 00460001

Figure 00470001
Figure 00470001

Figure 00480001
Figure 00480001

Figure 00490001
Figure 00490001

Figure 00500001
Figure 00500001

Figure 00510001
Figure 00510001

Figure 00520001
Figure 00520001

Figure 00530001
Figure 00530001

Figure 00540001
Figure 00540001

Figure 00550001
Figure 00550001

Figure 00560001
Figure 00560001

Figure 00570001
Figure 00570001

Figure 00580001
Figure 00580001

Figure 00590001
Figure 00590001

Figure 00600001
Figure 00600001

Figure 00610001
Figure 00610001

Figure 00620001
Figure 00620001

Figure 00630001
Figure 00630001

Claims (17)

Isolierte Nucleinsäure, die ein Protein des Breitadernvirus des Salats codiert, wobei die Nucleinsäure aus der Gruppe ausgewählt ist, die aus (a) einer Nucleinsäure, die ein Protein codiert, das die Aminosäuresequenz von einer der Sequenzen SEQ ID Nr. 2 bis 6 und SEQ ID Nr. 13 umfasst; und (b) der Nucleinsäure von (a), die den codierenden Bereich der Nucleotidsequenz von SEQ ID Nr. 1 oder 12 umfasst, besteht.Isolated nucleic acid, which is a protein of the broad vein virus of the salad, the nucleic acid being selected from the group consisting of from (a) a nucleic acid, which encodes a protein containing the amino acid sequence of one of the sequences SEQ ID NOs: 2 to 6 and SEQ ID NOs: 13; and (b) the nucleic acid of (a) comprising the coding region of the nucleotide sequence of SEQ ID No. 1 or 12, consists. Isolierte Nucleinsäure gemäß Anspruch 1, wobei die Nucleinsäure eine RNA ist.An isolated nucleic acid according to claim 1, wherein the nucleic acid is a RNA is. Isolierte Nucleinsäure gemäß Anspruch 1, wobei die Nucleinsäure eine DNA ist.An isolated nucleic acid according to claim 1, wherein the nucleic acid is a DNA is. DNA, die eine Sense-RNA codiert, die zu einem komplementären Strang der Nucleinsäure gemäß Anspruch 2 komplementär ist.DNA encoding a sense RNA leading to a complementary strand the nucleic acid according to claim 2 complementary is. DNA, die eine Antisense-RNA codiert, die zu der Nucleinsäure gemäß Anspruch 2 komplementär ist.A DNA which encodes an antisense RNA corresponding to the nucleic acid of claim 2 complementary is. DNA, die eine RNA mit Ribozymaktivität codiert, die spezifisch die Nucleinsäure gemäß Anspruch 2 spaltet.DNA encoding an RNA with ribozyme activity, specifically the nucleic acid according to claim 2 splits. Vektor, der die Nucleinsäure gemäß Anspruch 3 umfasst.Vector comprising the nucleic acid according to claim 3. Transformierte Zelle, die die Nucleinsäure gemäß Anspruch 3 oder den Vektor gemäß Anspruch 7 umfasst.Transformed cell containing the nucleic acid according to claim 3 or the vector according to claim 7 includes. Protein, das von der Nucleinsäure gemäß Anspruch 1 codiert wird.A protein encoded by the nucleic acid of claim 1. Antikörper, der an das Protein gemäß Anspruch 9 bindet.Antibody, to the protein according to claim 9 binds. Verfahren zur Herstellung des Proteins gemäß Anspruch 9, wobei das Verfahren die folgenden Schritte umfasst: (a) Kultivieren der transformierten Zelle gemäß Anspruch 8; und (b) Gewinnen eines exprimierten Proteins aus der transformierten Zelle oder deren Kulturüberstand.Process for the preparation of the protein according to claim 9, the method comprising the following steps: (A) Culturing the transformed cell according to claim 8; and (B) Recovering an expressed protein from the transformed cell or their culture supernatant. Vektor, der die DNA gemäß einem der Ansprüche 4 bis 6 umfasst.Vector containing the DNA according to one of claims 4 to 6 includes. Transformierte Salatzelle, die die Nucleinsäure gemäß Anspruch 1, die DNA gemäß einem der Ansprüche 4 bis 6 oder den Vektor gemäß Anspruch 7 oder 12 umfasst.Transformed salad cell containing the nucleic acid according to claim 1, the DNA according to a the claims 4 to 6 or the vector according to claim 7 or 12 includes. Transformierte Salatpflanze, die die transformierte Salatzelle gemäß Anspruch 13 umfasst.Transformed salad plant that transformed the Salad cell according to claim 13 includes. Transformierte Salatpflanze, die ein Nachkomme oder ein Klon der transformierten Salatpflanze gemäß Anspruch 14 ist.Transformed salad plant, which is a descendant or a clone of the transformed lettuce plant according to claim 14. Fortpflanzungsmaterial der transformierten Salatpflanze gemäß Anspruch 14 oder 15, wobei das Fortpflanzungsmaterial die Nucleinsäure gemäß Anspruch 1, die DNA gemäß einem der Ansprüche 4 bis 6 oder den Vektor gemäß Anspruch 7 oder 12 umfasst.Reproductive material of the transformed salad plant according to claim 14 or 15, wherein the propagating material is the nucleic acid according to claim 1, the DNA according to a the claims 4 to 6 or the vector according to claim 7 or 12 includes. Verfahren zum Diagnostizieren einer Infektion, die durch das Breitadernvirus des Salats verursacht wird, wobei das Verfahren den folgenden Schritt umfasst: Nachweisen der Nucleinsäure gemäß Anspruch 1 oder Nachweisen des Proteins gemäß Anspruch 9 in Salatzellen oder in Olpidium, einem Pilz, der das Breitadernvirus des Salats überträgt.Method for diagnosing an infection that caused by the Broad vein virus of the salad, wherein the Method comprises the following step: Detecting the nucleic acid according to claim 1 or detecting the protein according to claim 9 in salad cells or in Olpidium, a fungus that transmits salads ventral virus.
DE60123080T 2000-05-22 2001-05-22 NUCLEAR ACIDS CODING AND USE OF LBVV (LETTUCE BIG-VEIN VIRUS) PROTEINS Expired - Fee Related DE60123080T2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
JP2000154440 2000-05-22
JP2000154440 2000-05-22
JP2001065339 2001-03-08
JP2001065339 2001-03-08
PCT/JP2001/004268 WO2001090362A1 (en) 2000-05-22 2001-05-22 Nucleic acids encoding lettuce big-vein virus proteins and utilization thereof

Publications (2)

Publication Number Publication Date
DE60123080D1 DE60123080D1 (en) 2006-10-26
DE60123080T2 true DE60123080T2 (en) 2007-05-03

Family

ID=26592560

Family Applications (1)

Application Number Title Priority Date Filing Date
DE60123080T Expired - Fee Related DE60123080T2 (en) 2000-05-22 2001-05-22 NUCLEAR ACIDS CODING AND USE OF LBVV (LETTUCE BIG-VEIN VIRUS) PROTEINS

Country Status (6)

Country Link
US (2) US7279335B2 (en)
EP (1) EP1312677B1 (en)
JP (1) JPWO2001090362A1 (en)
DE (1) DE60123080T2 (en)
ES (1) ES2272474T3 (en)
WO (1) WO2001090362A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004009817A1 (en) 2002-07-18 2004-01-29 National Agriculture And Bio-Oriented Research Organization Nucleic acid encoding mirafiori lettuce virus protein and utilization thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5684226A (en) * 1994-01-06 1997-11-04 Harris Moran Seed Company Multiple disease resistance in lettuce
WO2004009817A1 (en) 2002-07-18 2004-01-29 National Agriculture And Bio-Oriented Research Organization Nucleic acid encoding mirafiori lettuce virus protein and utilization thereof

Also Published As

Publication number Publication date
DE60123080D1 (en) 2006-10-26
JPWO2001090362A1 (en) 2004-03-04
EP1312677A4 (en) 2004-09-22
WO2001090362A1 (en) 2001-11-29
US7279335B2 (en) 2007-10-09
EP1312677A1 (en) 2003-05-21
US20040014032A1 (en) 2004-01-22
US20070264690A1 (en) 2007-11-15
EP1312677B1 (en) 2006-09-13
ES2272474T3 (en) 2007-05-01

Similar Documents

Publication Publication Date Title
DE69535563T2 (en) TRANSGENIC PLANTS EXPRESSING DNA CONSTRUCTS CONTAINING SEVERAL VIRUS RESISTANT GENES
DE3650507T2 (en) Protection of plants against virus infection
DE68923728T2 (en) Insect-resistant lettuce plants.
DE69028479T2 (en) Genetic manipulations with recombinant DNA containing sequences derived from RNA viruses
DE68915282T2 (en) EXPRESSION CASSETTE FOR PLANTS.
DE3786898T2 (en) TRANSFORMATION AND EXPRESSION OF A FOREIGN GENE IN -i (BRASSICA) SPECIES.
DE69735171T2 (en) Disease resistance in Vitis
DE4317845A1 (en) Deoxyribonucleic acids
DD298949A5 (en) ALPHA-AMYLASE-CODING DNA SEQUENCES OF DICOTYLEDONE PLANTS, PROCESS FOR THEIR PREPARATION AND THEIR USE
Lambert et al. Identification of genes whose transcripts accumulate rapidly in tomato after root-knot nematode infection
DE4203441C1 (en) RNA and DNA molecules to create virus resistance
DE69925778T2 (en) Transcription factor for controlling the phenylpropanoid biosynthesis pathway
DE69114275T2 (en) REGENERATION AND GENETIC TRANSFORMATION OF THE BEET.
EP0479180A2 (en) Virus resistant plants, method for their production
DE69921025T2 (en) Rice gene resistant to rice blight
DE69007370T2 (en) Transgenic plants of the species cucumis melo.
EP0927262A1 (en) Nematode-resistant gene
DE69731221T2 (en) RESISTANCE TO NEMATODES AND / OR LEAF LÄUSE
EP0418695A1 (en) Regulatory DNA sequence
DE4003045A1 (en) VIRUS / HERBICIDE RESISTANCE GENES, METHOD FOR THEIR PRODUCTION AND THEIR USE
DE69726175T2 (en) METHOD FOR INDICATING VIRUS RESISTANCE IN A PLANT
CA2512644A1 (en) Gene resistant to aphis gossypii
DE60123080T2 (en) NUCLEAR ACIDS CODING AND USE OF LBVV (LETTUCE BIG-VEIN VIRUS) PROTEINS
EP0428881B1 (en) RNA with endonuclease and antisense activity, its production and use
DE69738108T2 (en) PLANT GENOME CONTAINING CHICOREE GENES AND A DNA ENCODING MALE STERILITY AND ITS USE

Legal Events

Date Code Title Description
8327 Change in the person/name/address of the patent owner

Owner name: INCORPORATED ADMINISTRATIVE AGENCY, NATIONAL A, JP

8364 No opposition during term of opposition
8339 Ceased/non-payment of the annual fee