DE60024660T2 - HUMAN RNASE H AND CORRESPONDING OLIGONUCLEOTIDE COMPOUNDS - Google Patents

Abstract

The present invention provides oligonucleotides that can serve as substrates for human Type 2 RNase H. The present invention is also directed to methods of using these oligonucleotides in enhancing antisense oligonucleotide therapies.

Description

AREA OF INVENTION

The The present invention relates to a human type 2 RNase H, now cloned, expressed and purified to electrophoretic homogeneity has been. The present invention further relates to oligonucleotide compositions, which as substrates for human RNase H1 or human type 2 RNase H can serve.

BACKGROUND THE INVENTION

RNase-H hydrolyzes RNA into RNA-DNA hybrids. This enzyme was first identified in calf thymus, but has subsequently been described in a variety of organisms (Stein, H. and Hausen, P., Science, 1969, 166, 393-395; Hausen, P. and Stein, H., Eur J. Biochem., 1970, 14, 278-283). RNase H activity appears to be ubiquitous in eukaryotes and bacteria (Itaya, M. and Kondo, K., Nucleic Acids Res., 1991, 19, 4443-4499; Itaya et al., Mol. Gen. Genet., 1991 , 227, 438-445; Kanaya, S. and Itaya, M., J. Biol. Chem., 1992, 267, 10184-101992; Busen, W., J. Biol. Chem., 1980, 255, 9,434 bis 9,443, Rong, YW and Carl, PL, 1990, Biochemistry 29, 383-389; Eder et al., Biochimie, 1993 75, 123-126). Although RNase H forms a family of proteins of different molecular weight, the nucleolytic activity and substrate requirements of the different isotypes appear to be similar. For example, all RNase Hs that have been studied so far act as endonucleases, having limited sequence specificity and requiring divalent cations (eg, Mg ²⁺ , Mn ²⁺ ) to generate cleavage products with 5'-phosphate and 3'-hydroxyl termini (Crouch, RJ and Dirksen, ML, Nuclease, Linn, SM and Roberts, RJ, eds., Cold Spring Harbor Laboratory Press, Plainview, NY 1982, 211-241).

Except her natural Role in DNA replication has also been shown to be RNase-H in capable of the RNA component cleave certain oligonucleotide RNA duplexes. While many Mechanisms for the oligonucleotide-mediated destabilization of target RNA have been suggested is the primary mechanism by which adopted it will reduce antisense oligonucleotides of target RNA levels cause this RNase H effect (Monia et al., J. Biol. Chem., 1993, 266: 13, 14,514-14,522). In vitro assays have shown that oligonucleotides that are not substrates for RNase-H are able to inhibit protein translation (Blake et al., Biochemistry, 1985, 24, 6,139 to 6,145) and that oligonucleotides are protein translation in rabbit reticulocyte extracts, the low RNase H activity have, inhibit. However, a more effective inhibition has been found in systems supported RNase H activity (Walder, R. Y. and Walder, J.A., Proc. Nat'l Acad. Sci. USA, 1988, 85, 5.011 to 5.015; Gagnor et al., Nucleic Acid Res., 1987, 15, 10,419 to 10,436; Cazenave et al., Nucleic Acid Res., 1989, 17, 4.255 to 4.273; and Dash et al., Proc. Nat'l Acad. Sci. USA, 1987, 84, 7,896 to 7,900.

oligonucleotides usually referred to as "antisense oligonucleotides", include nucleotide sequences that differ in identity and number are sufficient, a specific hybridization with a specific nucleic acid to effect. This nucleic acid or the protein (s) it encodes becomes generally referred to as the "target".

oligonucleotides are generally designed so that they either directly the mRNA coming from a preselected Genziel is transcribed, or bind to a selected DNA part of the same, whereby the amount of protein that is translated from the mRNA, or the amount of mRNA transcribed from the gene modified becomes. Antisense oligonucleotides can as research tools, diagnostic tools and therapeutic Agents are used.

The "targeting" of an oligonucleotide on the associated nucleic acid also refers to a multi-step process in the context of this invention, that usually begins with the identification of the nucleic acid sequence whose function to be modified. This may be, for example, a cellular gene (or mRNA transcribed from the gene), its expression with a specific fault or disease state, or a foreign nucleic acid from an infectious Be agent. The method of aiming also includes the determination of a location or locations within that gene, hence the oligonucleotide interaction such that the desired effect, either proof or modification of the expression of the protein.

RNase-H1 from E. coli is the best characterized member of the RNase H family. The 3-dimensional structure of E. coli RNase HI has been determined by X-ray crystallography, and the conclusions laminosic acids involved in binding and catalysis have been identified by site-directed mutagenesis (Nakamura et al., Proc. Natl. Acad Sci., USA, 1991, 88, 11,535 to 11,539; Katayanagi et al., Nature, 1990, 347, 306-309; Yang et al., Science, 1990, 249, 1398-1405; Kanaya et al., J. Biol. Chem., 1991, 266, 11,621-11,627). The enzyme has two distinct structural domains. The major domain consists of four α-helices and a large β-sheet formed by three antiparallel β-strands. The Mg ²⁺ binding site is on the β-sheet and consists of three amino acids, Asp-10, Glu-48 and Gly-11 (Katayanagi et al., Proteins: Struct., Funct., Genet., 1993, 17 , 337 to 346). This structural motif of the Mg ²⁺ binding site surrounded by β strands is similar to that in DNase I (Suck, D. and Oefner, C., Nature, 1986, 321, 620-625). It is believed that the secondary domain is the predominant binding region of the enzyme and consists of an α-helix ending in a loop. The loop region is formed by a cluster of positively charged amino acids, which are believed to electrostatically bind to the minor groove of the DNA / RNA heteroduplex substrate. Although the conformation of the RNA / DNA substrate may vary, depending on the sequence composition from the A-form to the B-form, RNA / DNA heteroduplexes generally assume an A-shaped geometry (Pardi et al., Biochemistry, 1981 , 20, 3,986 to 3,996; Hall, KB and McLaughlin, LW, Biochemistry, 1991, 30, 10606 to 10,613; Lane et al., Eur. J. Biochem., 1993, 215, 297 to 306). The entire binding interaction appears to involve a single helical turn of the substrate duplex. More recently, the binding characteristics, substrate requirements, cleavage products and effects of various chemical modifications of the substrates on the kinetic characteristics of E. coli RNase HI have been further investigated (Crooke, ST et al., Biochem. J., 1995, 312 Lima, WF and Crooke, ST, Biochemistry, 1997, 36, 390-398; Lima, WF et al., J. Biol. Chem., 1997, 272, 18.191-18.199; Tidd, DM and Worenius , HM, Br. J. Cancer, 1989, 60, 343; Tidd, DM et al., Anti-Cancer Drug Des., 1988, 3, 117.

Except the RNase-HI has been a second E. coli RNase H, RNase HII, cloned and labeled (Itaya, M., Proc. Natl. Acad. Sci. USA, 1990, 87, 8,587 to 8,591). she includes 213 amino acids, while RNase-HI 155 amino acids is long. E coli RNase HIM has only 17% homology to E. coli RNase HI. A RNase-H cloned from S. typhimurium differed of E. coli RNase HI only in 11 positions and showed a length of 155 amino acids (Itaya, M. and Kondo K., Nucleic Acids Res., 1991, 19, 4.443 to 4,449; Itaya et al., Mol. Gen. Genet., 1991, 227, 438-445). An enzyme cloned from S. cerevisae was 30% homologous to E. coli RNase HI (Itaya, M. and Kondo K., Nucleic Acids Res. 1991, 19, 4,443 to 4,449; Itaya et al., Mol. Gen. Genet., 1991, 227, 438-445). Thus, to date, no enzyme that has a clones of species other than E. coli, essential homology to E. coli RNase HII.

proteins, the RNase H activity are also from a number of viruses, other bacteria and yeast have been cloned and purified (Wintersberger, U. Pharmac. Ther., 1990, 48, 259-280). In many cases, proteins appear to be involved RNase H activity To be fusion proteins in which RNase-H and the amino or carboxyl end of the other enzyme, often a DNA or RNA polymerase are. It has been consistently found that the RNase H domain is high in Dimensions homologous to E. coli RNase HI; but as the other domains vary significantly, they vary the molecular weights and other characteristics of the fusion proteins strong.

In higher eukaryotes, two classes of RNase H have been defined based on differences in molecular weight, the effects of divalent cations, sensitivity to sulfhydryl agents, and immunological cross-reactivity (Busen et al., Eur. J. Biochem., 1977, 74, 203 to 208). RNase H type 1 enzymes have been reported to have molecular weights in the range of 68 to 90 kDa, be activated by either Mn ²⁺ or Mg ²⁺ , and are insensitive to sulfhydrylagents. In contrast, RNase H type 2 enzymes have been reported to have molecular weights in the range of 31 to 45 kDa, require Mg ²⁺ , are highly sensitive to sulfhydryl agents, and are inhibited by Mn ²⁺ (Bushen , W., and Hausen, P., Eur. J. Biochem., 1975, 52, 179-190; Kane, CM, Biochemistry, 1988, 27, 3, 187-3, 196; Busen, W., J. Biol. Chem., 1982, 257, 7106 to 7108).

An enzyme with type 2 RNase H label has been purified from human placenta to near homogeneity (Frank et al., Nucleic Acids Res., 1994, 22, pp. 2547-5254). This protein has a molecular weight of about 33 kDa and is active in a pH range of 6.5 to 10, with a pH optimum of 8.5 to 9. The enzyme requires Mg ²⁺ and is ^consumed by Mn ²⁺ and n-ethylmaleimide inhibited. The products of cleavage reactions have 3'-hydroxyl and 5'-phosphate termini.

Despite the essential information about members of the RNase family and the cloning of a Number of viral, prokaryotic and yeast genes with RNase H activity had not been cloned mammalian RNase H hitherto. This has hampered efforts to understand the structure of the enzyme (s), their distribution and the functions they can serve.

In The present invention is a human RNase H cDNA with type 2 labels and the protein that expresses them will be provided.

SHORT VERSION THE INVENTION

The The present invention provides oligonucleotides useful as substrates for human RNase-H1 can serve. These oligonucleotides are mixed sequence oligonucleotides, comprising at least two parts, wherein a first part in the Location is the cleavage of a complementary target RNA by human To support RNase-H1, and another part is not capable of such a split by supporting human RNase H1.

The present invention provides a mixed sequence oligonucleotide comprising at least 12 nucleotides and having a 3 'end and a 5' end, wherein the oligonucleotide is divided into a first part and a further part,
the first part being capable of supporting the cleavage of a complementary target RNA by human RNase H1 polypeptide,
the further part is unable to support the cleavage by RNase-H;
wherein the first part comprises at least 6 nucleotides and is arranged in the oligonucleotide such that at least one of the 6 nucleotides is 8 to 12 nucleotides from the 3 'end of the oligonucleotide.

In a preferred embodiment For example, the oligonucleotide comprises at least one CA nucleotide sequence. In another embodiment For example, the first part of the mixed sequence oligonucleotide comprises present invention Nucleotides that have a B-shape conformation geometry exhibit. In another embodiment, all nucleotides are of the first part of the oligonucleotide 2'-deoxyribonucleotides. In one more another embodiment is any of the nucleotides of the first part of the oligonucleotide 2'-F arabinonucleotide or a 2'-OH-arabinonucleotide. In yet another embodiment are the nucleotides of the first part by phosphate, phosphorothioate, Phosphorodithioat- or Boranophosphatbindungen together in one continuous sequence united. In a still further embodiment are all nucleotides of the other part of the oligonucleotide by 3'-5 'phosphodiester, 2'-5 'phosphodiester, Phosphorothioate, Sp phosphorothioate, Rp phosphorothioate, phosphorodithioate, 3'-deoxy-3'-aminophosphoroamidat-, 3'-Methylenphosphonat-, Methylene (methylimino), dimethylhydrazino, amide-3, amide-4 or Boranophosphate bonds united together in a continuous sequence.

A Yet another object of the present invention is methods to provide agents which determine the activity and / or Change levels of human RNase H1. According to this point of view are the polynucleotides and polypeptides of the present invention for biological, useful for clinical and research purposes. For example, the polynucleotides and polypeptides are for identification the interaction of human RNase H1 and antisense oligonucleotides and useful for identifying means for increasing this interaction, so that antisense oligonucleotides are more effective in inhibiting their target mRNA are.

A Still another object of the present invention is a method to predict the efficacy of an antisense therapy of a selected disease to provide measuring the content or activity of human RNase-H in a target cell of antisense therapy. In similar Way you can Oligonucleotides are screened for those oligonucleotides which are effective antisense agents by binding of the Oligonucleotide is measured to the human RNase H1.

BRIEF DESCRIPTION OF THE DRAWINGS

1 shows the effects of conditions on the activity of human RNase H1.

2 Figure 4 shows a denaturing polyacrylamide gel analysis of cleavage of a 17-mer RNA-DNA gapmer duplex by human RNase-H1.

3 shows the analysis of the cleavage of a 25mer Ras RNA with phosphodiester oligodeoxy nucleotides of different lengths hybridized by human RNase-H1.

4 Figure 4 shows the analysis of the cleavage of RNA DNA duplexes with different sequences, lengths and 3 'or 5' overhangs by human RNase H1. The sequence represented by G corresponds to SEQ ID NO: 33.

5 shows the product and processivity analysis of cleavage of 17-mer Ras RNA DNA duplexes by human RNase-H1.

6 represents the primary sequence of the human Type 2 RNase H (286 amino acids; SEQ ID NO: 1) and chicken (293 amino acids, SEQ ID NO: 2), yeast (348 amino acids; SEQ ID NO: 3) sequence comparisons ) and E. coli RNase H1 (155 amino acids; SEQ ID NO: 4) and an EST-derived mouse RNase H homolog (Genbank Accession No. AA389926 and AA518920; SEQ ID NO: 5) , Bold indicates amino acid residues identical to those in humans. "@" Indicates the conserved amino acid residues included in the E. coli RNase H1 Mg ²⁺ binding site and the catalytic center (Asp-10, Gly-11, Glu-48, and Asp-70). "*" Indicates the conserved residues included in E. coli RNase H1 for substrate binding.

DETAILED DESCRIPTION PREFERRED EMBODIMENTS

A human type 2 RNase H has now been cloned and expressed. The enzyme encoded by this cDNA is inactive to single stranded RNA, single stranded DNA and double stranded DNA. However, this enzyme cleaves the RNA in an RNA / DNA duplex and the RNA in a duplex comprising RNA and a chimeric oligonucleotide with 2'-methoxy flanks and a 5-deoxynucleotide central gap. The rate of cleavage of the RNA which forms a duplex with this so-called "deoxy-gapmer" was significantly less than that found in the complete RNA / DNA duplex.These properties are consistent with those found for E.I. coli RNase H1 (Crooke et al., Biochem J., 1995, 312, 599-608; Lima, WF and Crooke, ST, Biochemistry, 1997, 36, 390-398) Characteristics of a human type 2 RNase H protein purified from placenta since the molecular weight (32 kDa) is similar to that described by Frank et al., Nucleic Acids Res., 1994, 22, pp. 2547-5254 Thus, in accordance with one aspect of the present invention, there are provided isolated polynucleotides encoding human type 2 RNase H polypeptides having the deduced amino acid sequence of Mn ²⁺ 6 exhibit. "Polynucleotides" is intended to include any form of RNA or DNA, such as mRNA or cDNA, or genomic DNA obtained by cloning or synthetically produced by well-known chemical techniques. "DNA may be double-stranded or single-stranded coding or sense strand or the non-coding or antisense strand.

Methods for isolating a polynucleotide of the present invention by cloning techniques are well known. For example, to obtain the cDNA described in ATCC Depot no. 98,536, primers were used based on a search in the XREF database. A cDNA of about 1 kb corresponding to the terminal carboxy part of the protein was cloned by 3'-RACE. Seven positive clones were isolated by screening a liver cDNA library with this 1 kb cDNA. The two longest clones were 1,698 and 1,168 base pairs. They have the same 5 'untranslated region and protein coding sequence, but differ in the length of the 3' UTR. A single reading frame encoding a protein of 286 amino acids (calculated mass: 32,029.04 Da) has been identified ( 6 ). The proposed start codon is consistent with the translation start consensus sequence in mammals described by Kozak, M., J. Cell Biol., 1989, 108, 229-241, preceded by an in-frame stop codon. Efforts to clone cDNAs with longer 5 'UTR from both human liver and lymphocyte cDNA using 5' RACE failed, indicating that the 1698 base pair clone was full length.

In a preferred embodiment, the polynucleotide of the present invention comprises the nucleic acid sequence of the cDNA described in ATCC Depot. 98,536 is included. The depot of E. coli DH5a containing a BLUESCRIPT® ^® plasmid containing a human Type 2 RNase H cDNA contains, took place at the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland, 20852, USA, on the 4th of Sep 1997, and he was the ATCC Depot no. Assigned 98,536. The deposited material is a culture of E. coli DH5a containing a plasmid BLUESCRIPT ^® (Stratagene, La Jolla, CR) containing the full length human Type 2 RNase H cDNA. The deposit has been made in accordance with the contractual provisions of the Budapest Treaty on the International Recognition of the Deposition of Microorganisms for the Purpose of Patent Procedure. The culture becomes irrevocable after the grant of this patent and without restriction of the Öf public released. The sequence of the polynucleotide contained in the deposited material and the amino acid sequence of the polypeptide encoded thereby are critical in the event of any conflict in the sequences provided herein. However, as will be apparent to those skilled in the art after this disclosure, because of the degeneracy of the genetic code, polynucleotides of the present invention may comprise other nucleic acid sequences encoding the polypeptide of 6 and encoding derivatives, variants or active fragments thereof.

Another aspect of the present invention relates to the polypeptides encoded by the polynucleotides of the present invention. In a preferred embodiment, a polypeptide of the present invention comprises the deduced amino acid sequence of human type 2 RNase H found in 6 is provided as SEQ ID NO: 1. However, "polypeptide" is also meant to include fragments, derivatives and analogs of SEQ ID NO: 1 which retain substantially the same biological activity and / or function as human type 2 RNase H. Alternatively, polypeptides of the present invention may retain their ability to although they do not function as active RNase H enzymes in other capacities In another embodiment, polypeptides of the present invention may retain nuclease activity, but without specificity for the RNA portion of an RNA / DNA antagonist. Duplexes Polypeptides of the present invention include recombinant polypeptides, isolated natural polypeptides and synthetic polypeptides and fragments thereof which retain one or more of the activities described above.

In a preferred embodiment, the polypeptide is produced recombinantly, most preferably from the E. coli culture with ATCC Depot No. 98,536. Recombinant human RNase-H fused to histidine codons (His-tag; six histidine codons were used in the present embodiment) expressed in E. coli can be purified by chromatography with Ni-NTA followed by C4 reverse-phase chromatography. HPLC can be conveniently cleaned to electrophoretic homogeneity. The purified recombinant polypeptide of SEQ ID NO: 1 is highly homologous to E. coli RNase H and has almost 34% amino acid identity with E. coli RNase H1. In 6 For example, the protein sequences derived from human RNase H cDNA (SEQ ID NO: 1) are hybridized with those from chicken (SEQ ID NO: 2), yeast (SEQ ID NO: 3), and E. coli. RNase-HI (Genbank Accession No. 1,786,408; SEQ ID NO: 4) and an EST-derived mouse RNase H homologue (Genbank Accession No. AA389,926 and AA518,920; SEQ ID NO : 5) compared. The deduced amino acid sequence of human RNase H (SEQ ID NO: 1) has strong homology to yeast (21.8% amino acid identity), chicken (59%), E. coli RNase HI (33.6%), and the mouse -EST homologues (84.3%). They are all small proteins (<40 kDa) and their estimated pI are all 8.7 and more. Further, the amino acid residues in E. coli RNase HI believed to be involved in the Mg ²⁺ binding site, the catalytic center, and the substrate binding region are in the sequence of the cloned human RNase H (FIG. 6 ) completely preserved.

The Human Type 2 RNase H with SEQ ID NO: 1 is ubiquitously expressed. Northern blot analysis showed that the transcript was present in all tissues and cell lines except the MCR-5 line was abundant. Northern blot analysis of total RNA from human cell lines and poly-A containing human tissue RNA using the probe with the full length of 1.7 kb or a 332 nucleotide probe encoding the 5 'UTR and the coding region of human RNase H cDNA contained two strong positive bands with a length of about 1.2 and 5.5 kb and two less intense bands with an approximate length of Recognize 1.7 and 4.0 kb in most cell lines and tissues. The analysis with the 332 nucleotide probe, the 5.5 kb band revealed the 5 'UTR and part of the coding region, suggesting that this band was a pretreated or partially treated transcript or possibly an alternative represents a split transcript. Medium sized bands may be treatment intermediates represent. The 1.2 kb band represents the full-length transcripts. The longer ones Transcripts can Treatment intermediates or alternatively spliced transcripts be.

RNase-H is tested in most Cell lines expressed; only MRC5, a breast cancer cell line, showed very low levels of RNase-H. A variety of other malicious ones Cell lines, including those of bladder (T24), breast (T-47D, HS578T), lung (A549), Prostate (LNCap, DU145) and myeloid lineage (HL-60) as well as the normal endothelial cells (HUVEC) expressed RNase-H. Furthermore, all tested normal human tissue RNase-H. Again, there were larger transcripts and the 1.2 kb transcript, which is the mature mRNA for RNase-H seems to be present. Normalization based on G3PDH levels showed that expression was relatively consistent in all tested tissues was.

Southern blot analysis of EcoRI-digested human genomic DNA and various Nuclei and yeast probed with the 1.7 kb probe show that four EcoRI digestion products of human genomic DNA (2,4, 4,6, 6,0, 8,0 Kb) with the 1, 7 kb probe hybridized. The blot, which probed again with a 430 nucleotide probe corresponding to the C-terminal part of the protein, showed only a 4.6 kbp EcoRI digest that was hybridized. These data indicate that there is only one gene copy for RNase-H and that the size of the gene is more than 10 kb. Both the full-length probe and the shorter probe hybridized strongly to an EcoRI digest of yeast genomic DNA (approximately 5 kb in size), indicating a high degree of conservation. These probes also hybridized to the monkey digestion product but not to any of the other mammalian genomic DNA tested, including the mouse, which is highly homologous to the human RNase H sequence.

A recombinant human RNase H (His-tag fusion protein) polypeptide of the present invention was expressed in E. coli and purified by Ni-NTA agarose beads followed by C4 reverse-phase column chromatography. A 36 kDa protein was cogulated after renaturation and its activity measured. The presence of the His tag was confirmed by Western blot analysis with an anti-penta-histidine antibody (Qiagen, Germany). Renatured recombinant human RNase-H exhibited RNase H activity. Incubation of 10 ng of purified renatured RNase-H with RNA / DNA substrate for 2 hours resulted in the cleavage of 40% of the substrate. The enzyme also cleaved RNA in an oligonucleotide / RNA duplex in which the oligonucleotide was a gapmer with a 5-deoxynucleotide gap, but at a much slower rate than the complete RNA / DNA substrate. This is consistent with observations of E. coli RNase HI (Lima, WF and Crooke, ST, Biochemistry, 1997, 36, 390-398). It was inactive to single-stranded RNA or double-stranded RNA substrates and was inhibited by Mn ²⁺ . The molecular weight (≈36 kDa) and the inhibition by Mn ²⁺ indicate that the cloned enzyme is highly homologous to E. coli RNase HI and has characteristics similar to those of human type 2. RNase-H are assigned to match.

The Cleavage sites in the RNA in the complete RNA / DNA substrate and the Gapmer / RNA duplexes (wherein the oligonucleotide gapmer had a 5-deoxynucleotide gap); those derived from the recombinant enzyme were determined. In the complete RNA / DNA duplex was the major cleavage site near the center of the substrate, with signs of a few major split sites 3 'too the primary Cleavage site. The primary Cleavage site in the gapmer / RNA duplex was across the nucleotide adjacent to the compound of the nucleotide 2'-methoxy wing and the oligodeoxynucleotide gap, the 3'-end closest to the RNA is. Thus, the enzyme gave a major cleavage site in the middle of the RNA / DNA substrates and minor cleavages to the 3 'side of the major cleavage site. The shift of its main cleavage site to the nucleotide in apposition to the DNA 2'-methoxy compound of the 2'-methoxy wing the 5'-end of the chimeric Oligonucleotide is consistent with the observations of E. coli RNase HI (Crooke et al. Biochem. J. 312, 599-608; Lima, W.F. and Crooke, S.T. (1997) Biochemistry 36, 390-398). The fact that the enzyme is in one 5-Deoxy-Gap-duplex at a single site cleavage indicates that the enzyme is catalytic Having regions with dimensions similar to those of E. coli RNase HI are.

Accordingly, the Expression big Amounts of a purified human RNase H polypeptide of the present invention Invention useful for characterizing the activities of a mammalian form of this enzyme. Also put the polynucleotides and polypeptides of the present invention Means for identifying agents that perform the function of Amplify antisense oligonucleotides in human cells and tissues.

For example, a host cell can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention. Polynucleotides can be introduced into a host cell using any number of well-known techniques such as infection, transduction, transfection or transformation. The polynucleotide may be introduced alone or in conjunction with a second polynucleotide encoding a selectable marker. In a preferred embodiment, the host comprises a mammalian cell. Such host cells can then be used not only for the production of human type 2 RNase H, but also to identify agents that increase or decrease the levels of expression or activity of human type 2 RNase H in the cell. In these assays, the host cell would be exposed to an agent that is believed to alter the levels of expression or activity of human type 2 RNase H in the cells. The level or activity of human type 2 RNase in the cell would then be determined in the presence and absence of the agent. Assays for determining protein levels of a cell are well known to those of skill in the art, including, but not limited to, radioimmunoassays, competitive binding assays, Western blot analysis, and enzyme linked immunosorbent assays (ELISA). A method for determining the increase in the activity of the enzyme and in particular the increased cleavage of an antisense mRNA duplex can be carried out according to the teachings of Example 5. Agents identified as inducers of the content or activity of this enzyme may be useful for increasing the efficacy of antisense oligonucleotide therapies.

The The present invention also relates to prognostic assays wherein the levels of RNase in a cell type to predict efficacy an antisense oligonucleotide therapy can be used in specific target cells. Of high content RNase in a chosen Cell type is hoped that it compares to lower proportions by RNase in a chosen one Cell type with higher Effectiveness correlate, indicating a low cleavage of the mRNA Binding with the antisense oligonucleotide can result. For example showed the MRC5 breast cancer cell line compared to other malignant ones Cell types very low levels of RNase-H. Accordingly, it may be desired in this cell type to use antisense compounds in terms of their effectiveness does not depend on RNase H activity.

In similar Way you can Screen oligonucleotides to identify those the effective antisense agents are by human type 2 RNase H contacted with an oligonucleotide and the binding of the oligonucleotide to human type 2 RNase H is measured. Method for determining the binding of two molecules are well known in the art. For example, in one embodiment the oligonucleotide are radioactively labeled and the binding of the Oligonucleotide to human type 2 RNase H by autoradiography be determined. Alternatively you can Human type 2 RNase H fusion proteins with glutathione S-transferase or small peptide tags and attached to a solid phase, e.g. beads be immobilized. Labeled or unlabeled oligonucleotides, which are screened for binding to this enzyme should, can then incubate with the solid phase. Oligonucleotides that bind to the enzyme immobilized on the solid phase, can then either by capturing the bound marker or by specific Eluting the bound oligonucleotide identified from the solid phase become. Another method is to screen oligonucleotide libraries involved in binding partners. Recombinant, tagged (tagged) or labeled human type 2 RNase H is used to select from the library oligonucleotides that interact with the enzyme. Sequencing of the oligonucleotides leads to the identification of those Oligonucleotides that will be more effective as antisense agents.

The Oligonucleotides of the present invention are of a variety of nucleotides formed together via internucleotide linkages are united. Although the nucleotides in the oligonucleotides are related as a unit, the individual nucleotides belong the oligonucleotides of several types. Each of these types contributes to unique Properties of the oligonucleotide in. Nucleotides of a first type united together in a continuous sequence, the first one Part of the oligonucleotide forms. The remaining nucleotides are of at least one other type and are located in one or several remaining parts or locations within the oligonucleotide. Thus, the oligonucleotides of the invention comprise a nucleotide portion, which contributes one set of features and another part (or parts) that contributes a different set of features.

One Feature that desirable is, is the triggering of RNase H activity. To trigger of RNase H activity a part of the oligonucleotides of the invention is chosen such that he is B-shaped Has conformation geometry. The nucleotides for this B-shape part are chosen so that they specifically contain ribopentofuranosyl and arabinopentofuranosyl nucleotides. 2'-deoxy-erythro-pentafuranosyl nucleotides also exhibit B-shape geometry on and loosen RNase H activity out. Although they are not specifically excluded, such form 2'-deoxy-erythropentafuranosyl nucleotides when in the B-form part of an oligonucleotide of the invention are included, preferably not the entirety of the nucleotides this B-shape part of the oligonucleotide but should be linked to ribonucleotides or arabinonucleotides. As used herein, is in the B-shape geometry both the C2'-endo as well as the O4'-endo curl involved, and the ribo and arabinonucleotides for inclusion in the Oligonucleotide B-form part selected are, are chosen, that they are those nucleotides that have C2'-endo conformation, or those Nucleotides are the O4'-endo conformation exhibit. This is true with Berger et. al., Nucleic Acids Research, 1998, 26, 2.473 bis 2,480, which pointed out that when considering the furanose conformations, in which nucleotides and nucleotides are located, the point of view the B-shape may also be present at an O4'-endo-corrugation contribution should.

A-form nucleotides are nucleotides that have C3'-endo corrugation, also known as North or Northern Pucker. In addition to the B-form nucleotides mentioned above, the A-form nucleotides may be nucleotides with C3'-endo undulation or nucleotides located at the 3'-terminus, at the 5'-terminus or both at the 3'-terminus. as well as at the 5'-terminus of the oligonucleotide. Alternatively, the A-form nucleotides both are in a C3'-endo corrugation and are at the ends, or termini, of the oligonucleotide. When selecting nucleotides that have C3'-endo curl, or when selecting nucleotides for the 3'- or 5'-end of the oligonucleotide, account is taken of the binding affinity and nuclease resistance properties that such nucleotides must impart to the resulting oligonucleotide.

nucleotides, the for the 3'- or the 5'-terminus of Oligonucleotides of the invention are chosen are chosen so that they confer nuclease resistance on the oligonucleotide. This nuclease resistance can also be achieved through various mechanisms, including modifications the sugar parts of the nucleotide units of the oligonucleotide, modification the internucleotide linkages or modification of both the sugar and also the internucleotide bonds.

A especially useful Group of nucleotides for use to increase nuclease resistance at the termini of oligonucleotides are those which are 2'-O-alkylamino groups exhibit. The amino groups of such nucleotides may be groups which are included in physiological pH are protonated. This includes Amines, monoalkyl-substituted amines, dialkyl-substituted amines and heterocyclic amines, e.g. Imidazole. Especially useful including the lower alkylamines 2'-O-ethylamine and 2'-O-propylamine. Such O-alkylamines can also in the 3'-position of the 3'-terminus nucleotide be involved. Therefore could the 3'-terminal nucleotide both a 2'- and a 3'-O-alkylamino substituent.

At the Choose with regard to nuclease resistance It is important not to affect the binding affinity. Certain bonds based on phosphorus have been shown that they are the nuclease resistance increase. The phosphorothioate linkage described above increases nuclease resistance, however, also causes a loss of binding affinity. Therefore are for use in this invention when phosphorothioate internucleotide linkages other modifications are made to nucleotide units which increase binding affinity by the decreased affinity contribution to balance by the phosphorothioate bonds.

To other phosphorus-based bonds with increased nuclease resistance, which the binding affinity do not interfere belong 3'-Methylenphosphonat- and 3'-deoxy-3'-amino-phosphoroamidate linkages. Another class of bonds, the nuclease resistance contribute to the binding affinity but do not affect are of non-phosphate nature. Of these, methylene (methylimino) bonds, dimethylhydrazino bonds and amine-3 and amide-4 bonds as described (Freier and Altmann, Nucleic Acid Research, 1997, 25, 4,429-4,443).

At the Designing oligonucleotides with improved binding affinities must a number of possible Considered aspects become. It seems that an effective approach to building modified oligonucleotides with very high RNA binding affinity the combination is from two or more different types of modifications, from each of which contributes to various factors that are beneficial important for binding affinity could be.

Freier and Altmann, Nucleic Acids Research, (1997) 25: 4.429-4443, have recently published a study of the impact of structural modifications on oligonucleotides on the stability of their duplexes with target RNA. In this study, the authors reviewed a series of oligonucleotides that contained more than 200 different modifications, synthesized and their hybridization affinity and _Tm were determined to. Sugar modifications included substitutions in the 2'-position of the sugar, 3'-substitution, exchange of the 4'-oxygen, use of bicyclic sugars and replacement with four-membered rings. Several nucleobase modifications, including substitutions at the 5 or 6 position of thymine, modifications of the pyrimidine heterocycle, and modifications of the purine heterocycle have also been investigated. Also, numerous backbone modifications, including backbones carrying phosphorus, backbones bearing no phosphorus atom, backbates that were neutral, were investigated.

Four general approaches could used to target the hybridization of oligonucleotides with RNA targets to improve. This includes: Preliminary organization of the sugars and phosphates of the oligodeoxynucleotide strand to conformations that for the hybrid formation favorable Improve stacking of nucleobases by adding more polarizable ones Groups to the heterocycle bases of the nucleotides of the oligonucleotide, Enlarge the Number of H bonds, available for A-U pairing and neutralization of backbone charge, to eliminate unwanted Repulsive interactions to facilitate. We found that the first of these, preliminary organization the sugar and phosphates of the oligodeoxynucleotide strand to conformations, the for the hybrid formation favorable is a preferred method for achieving improved binding affinity. He can also be used in combination with the other three approaches become.

sugar in DNA: RNA hybrid duplexes often adopt a C3'-endo conformation. Therefore, should Modifications that determine the conformational balance of the sugar units in the single strand to shift this conformation, the antisense strand pre-organize for binding to RNA. Of the different sugar modifications, which have been studied and described in the literature the incorporation of electronegative substituents, e.g. 2'-fluoro or 2'-alkoxy, the sugar conformation to the 3'-endo- (Northern) -Wellungs conformation. This organizes an oligonucleotide into which such modifications are bound so that it has an A-shape conformation geometry having. This A-form conformation results in increased binding affinity of the oligonucleotide to a target RNA strand.

As As used herein, the terms "substituent" and "substituent group" refer to groups which attached to nucleosides of the invention. substituent are preferably selected sugar units attached, can alternatively, however, to selected ones heterocyclic base units are attached. Selected nucleosides can Substituent groups both at the heterocyclic base and at the sugar moiety, but is a single substituent group in the 2'-, 3'- or 5'-position of the sugar preferred, wherein the 2'-position is particularly preferred.

Substituent groups include fluoro, O-alkyl, O-alkylamino, O-alkylalkoxy, O-alkylaminoalkyl, O-alkylimidazole and polyethers of the formula (O-alkyl) _m wherein m is 1 to about 10. Of these polyethers, linear and cyclic polyethylene glycols (PEG) and PEG-containing groups, such as crown ethers, and those described by Ouchi et al. (Drug Design and Discovery 1992, 9, 93), Ravasio et al. (J. Org. Chem. 1991, 56, 4.329) and Delgardo et. al. (Critical Reviews in Therapeutic Drug Carrier Systems 1992, 9, 249), which are incorporated herein by reference in their entirety. Further sugar modifications are disclosed in Cook, PD, Anti-Cancer Drug Design, 1991, 6, 585-607. The fluoro, O-alkyl, O-alkylamino, O-alkylimidazole, O-alkylaminoalkyl, and alkylamino substitution are described in U.S. Patent Application Serial No. 08 / 398,901, filed March 6, 1995, respectively Oligomeric compounds containing pyrimidines nucleotide (s) having 2 'and 5' substitutions, which are incorporated herein by reference in their entirety.

Other substituent groups available for the present invention include -SR and -NR ₂ groups, wherein each R is independently hydrogen, a protecting group or substituted or unsubstituted alkyl, alkenyl or alkynyl. 2'-SR nucleosides are disclosed in U.S. Patent No. 5,670,633, issued Sept. 23, 1997, which is hereby incorporated by reference in its entirety. The incorporation of 2'-SR monomer synthons is disclosed by Hamm et al., J. Org. Chem., 1997, 62, 3.415 to 3.420. 2'-NR ₂ -nucleosides are disclosed by Goettingen, M., J. Org. Chem., 1996, 61, 6.273 to 6.281 and Polushin et al., Tetrahedron Lett., 1996, 37, 3.227 to 3.230.

worin
Z₀ O, S oder NH ist;
J eine Einfachbindung, O oder C(=O) ist;
E C₁-C₁₀-Alkyl, N(R₁)(R₂), N(R₁)(R₅), N=C(R₁)(R₂), N=C(R₁)(R₅) ist oder eine Formel III oder IV hat;

jedes R₆, R₇, R₈, R₉ und R₁₀ unabhängig Wasserstoff, C(O)R₁₁, substituiertes oder unsubstituiertes C₁-C₁₀-Alkyl, substituiertes oder unsubstituiertes C₂-C₁₀-Alkenyl, substituiertes oder unsubstituiertes C₂-C₁₀-Alkinyl, Alkylsulfonyl, Arylsulfonyl, eine chemische funktionelle Gruppe oder eine Konjugat-Gruppe ist, worin die Substituentengruppen aus Hydroxyl, Amino, Alkoxy, Carboxy, Benzyl, Phenyl, Nitro, Thiol, Thioalkoxy, Halogen, Alkyl, Aryl, Alkenyl und Alkinyl gewählt sind;
oder optional R₇ und R₈ zusammen eine Phthalimidoeinheit mit dem Stickstoffatom bilden, an welches sie angehängt sind;
oder optional R₉ und R₁₀ zusammen eine Phthalimidoeinheit mit dem Stickstoffatom bilden, an welches sie angehängt sind;
jedes R₁₁ unabhängig substituiertes oder unsubstituiertes C₁-C₁₀-Alkyl, Trifluormethyl, Cyanoethyloxy, Methoxy, Ethoxy, t-Butoxy, Allyloxy, 9-Fluorenylmethoxy, 2-(Trimethylsilyl)-ethoxy, 2,2,2-Trichlorethoxy, Benzyloxy, Butyryl, iso-Butyryl, Phenyl oder Aryl ist;
R₅ T-L ist,
T eine Bindung oder eine verbindende Einheit ist;
L eine chemische funktionelle Gruppe, eine Konjugatgruppe oder ein festes Trägermaterial ist;
jedes R₁ und R₂ unabhängig H, eine Stickstoffschutzgruppe, substituiertes oder unsubstituiertes C₁-C₁₀-Alkyl, substituiertes oder unsubstituiertes C₂-C₁₀-Alkenyl, substituiertes oder unsubstituiertes C₂-C₁₀-Alkinyl ist, worin die Substitution OR₃, SR₃, NH₃ ⁺, N(R₃)(R₄), Guanidino oder Acyl ist, worin das Acyl ein Säureamid oder ein Ester ist;
oder R₁ und R₂ zusammen eine Stickstoffschutzgruppe sind oder in einer Ringstruktur vereint sind, die optional ein weiteres Heteroatom umfasst, das aus N und O gewählt ist;
oder R₁, T und L zusammen eine chemische funktionelle Gruppe sind;
jedes R₃ und R₄ unabhängig H, C₁-C₁₀-Alkyl, eine Stickstoffschutzgruppe ist oder R₃ und R₄ zusammen eine Stickstoffschutzgruppe sind;
oder R₃ und R₄ zusammen in einer Ringstruktur vereint sind, die optional ein zusätzliches Heteroatom umfasst, das aus N und O gewählt ist;
Z₄ OX, SX oder N(X)₂ ist;
jedes X unabhängig H, C₁-C₈-Alkyl, C₁-C₈-Halogenalkyl, C(=NH)N(H)R₅, C(=O)N(H)R₅ oder OC(=O)N(H)R₅ ist;
R₅ H oder C₁-C₈-Alkyl ist;
Z₁, Z₂ und Z₃ ein Ringsystem mit etwa 4 bis etwa 7 Kohlenstoffatomen oder mit etwa 3 bis etwa 6 Kohlenstoffatomen und 1 oder 2 Heteroatomen umfassen, worin die Heteroatome gewählt sind aus Sauerstoff, Stickstoff und Schwefel und worin das Ringsystem aliphatisch, ungesättigt aliphatisch, aromatisch oder gesättigt oder ungesättigt heterocyclisch ist;
Z₅ Alkyl oder Halogenalkyl mit etwa 1 bis etwa 10 Kohlenstoffatomen, Alkenyl mit 2 bis etwa 10 Kohlenstoffatomen, Alkinyl mit etwa 2 bis etwa 10 Kohlenstoffatomen, Aryl mit 6 bis etwa 14 Kohlenstoffatomen, N(R₁)(R₂)OR₁, Halogen, SR₁ oder CN ist;
jedes q₁ unabhängig eine ganze Zahl von 1 bis 10 ist;
jedes q₂ unabhängig 0 oder 1 ist;
q₃ 0 oder eine ganze Zahl von 1 bis 10 ist;
q₄ eine ganze Zahl von 1 bis 10 ist;
q₅ 0, 1 oder 2 ist; und
vorausgesetzt dass, wenn q₃ 0 ist, q₄ größer als 1 ist.Other typical substituent groups include hydrogen, hydroxyl, C ₁ -C ₂₀ alkyl, C ₂ -C ₂₀ alkenyl, C ₂ -C ₂₀ alkynyl, halogen, amino, thiol, keto, carboxyl, nitro, nitroso, nitrile, trifluoromethyl , Trifluoromethoxy, O-alkyl, O-alkenyl, O-alkynyl, S-alkyl, S-alkenyl, S-alkynyl, NH-alkyl, NH-alkenyl, NH-alkynyl, N-dialkyl, O-aryl, S-aryl , NH-aryl, O-aralkyl, S-aralkyl, NH-aralkyl, N-phthalimido, imidazole, azido, hydrazino, hydroxylamino, isocyanato, sulfoxide, sulfone, sulfide, disulfide, silyl, aryl, heterocycle, carbocycle, intercalator, reporter molecule , Conjugate, polyamine, polyamide, polyalkylene glycol or polyether
or any substituent group having a formula I or II,

wherein
Z _{0 is} O, S or NH;
J is a single bond, O or C (= O);
EC ₁ -C ₁₀ alkyl, N (R ₁ ) (R ₂ ), N (R ₁ ) (R ₅ ), N = C (R ₁ ) (R ₂ ), N = C (R ₁ ) (R ₅ ) or has a formula III or IV;

each R ₆ , R ₇ , R ₈ , R ₉ and R _{10 is} independently hydrogen, C (O) R ₁₁ , substituted or unsubstituted C ₁ -C ₁₀ alkyl, substituted or unsubstituted C ₂ -C ₁₀ alkenyl, substituted or unsubstituted C ₂ -C ₁₀ alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups of hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl Alkenyl and alkynyl are selected;
or optionally R ₇ and R ₈ together form a phthalimido moiety with the nitrogen atom to which they are attached;
or optionally R ₉ and R ₁₀ together form a phthalimido moiety with the nitrogen atom to which they are attached;
each R _{11 is} independently substituted or unsubstituted C ₁ -C ₁₀ alkyl, trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy, 2- (trimethylsilyl) ethoxy, 2,2,2-trichloroethoxy, benzyloxy Is butyryl, iso-butyryl, phenyl or aryl;
R _{5 is} TL,
T is a bond or a linking entity;
L is a chemical functional group, a conjugate group or a solid support material;
each R ₁ and R _{2 is} independently H, a nitrogen protecting group, substituted or unsubstituted C ₁ -C ₁₀ alkyl, substituted or unsubstituted C ₂ -C ₁₀ alkenyl, substituted or unsubstituted C ₂ -C ₁₀ alkynyl wherein the substitution is OR ₃ , SR ₃ , NH ₃ ⁺ , N (R ₃ ) (R ₄ ), guanidino or acyl, wherein the acyl is an acid amide or an ester;
or R ₁ and R ₂ together are a nitrogen protecting group or are combined in a ring structure optionally comprising another heteroatom selected from N and O;
or R ₁ , T and L together are a chemical functional group;
each R ₃ and R _{4 is} independently H, C ₁ -C ₁₀ alkyl, a nitrogen protecting group, or R ₃ and R ₄ together are a nitrogen protecting group;
or R ₃ and R _{4 are taken} together in a ring structure optionally comprising an additional heteroatom selected from N and O;
Z _{4 is} OX, SX or N (X) ₂ ;
each X is independently H, C ₁ -C ₈ alkyl, C ₁ -C ₈ haloalkyl, C (= NH) N (H) R ₅ , C (= O) N (H) R ₅ or OC (= O) N (H) R ₅ is;
R _{5 is} H or C ₁ -C ₈ alkyl;
Z ₁ , Z ₂ and Z ₃ comprise a ring system of from about 4 to about 7 carbon atoms or from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein the heteroatoms are selected from oxygen, nitrogen and sulfur and wherein the ring system is aliphatic, unsaturated aliphatic, aromatic or saturated or unsaturated heterocyclic;
Z _{5 is} alkyl or haloalkyl of about 1 to about 10 carbon atoms, alkenyl of 2 to about 10 carbon atoms, alkynyl of about 2 to about 10 carbon atoms, aryl of 6 to about 14 carbon atoms, N (R ₁ ) (R ₂ ) OR ₁ , Halogen, SR ₁ or CN;
each q _{1 is} independently an integer from 1 to 10;
each q _{2 is} independently 0 or 1;
q ₃ is 0 or an integer from 1 to 10;
q _{4 is} an integer from 1 to 10;
q is ₅ , 1 or 2; and
provided that when q _{3 is} 0, q _{4 is} greater than 1.

typical Substituent groups of the formula I are described in US Pat. 09 / 130,973, filed Aug. 7, 1998, entitled "Capped 2'-Oxyethoxy oligonucleotides "disclosed by Reference is hereby incorporated in its entirety.

typical Cyclic substituent groups of the formula II are disclosed in US patent application with application number 09 / 123,108, filed on 27 July 1998, labeled "RNA Targeted 2'-Modified Oligonucleotides that are Conformationally Preorganized "are disclosed by Reference is hereby incorporated in its entirety.

Particularly preferred substituent groups include O [(CH ₂ ) _n O] _m CH ₃ , O (CH ₂ ) _n OCH ₃ , O (CH ₂ ) _n NH ₂ , O (CH ₂ ) _n CH ₃ , O (CH ₂ ) _n ONH ₂ and O (CH ₂ ) _n ON [(CH ₂ ) _n CH ₃ )] ₂ wherein n and m are from 1 to about 10.

Some preferred oligomeric compounds of the invention contain at least one nucleoside having one of the following substituent groups: C ₁ to C ₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl, Br , CN, CF ₃ , OCF ₃ , SOCH ₃ , SO ₂ CH ₃ , ONO ₂ , NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleavage group, a reporter group, an intercalator , a group for improving the pharmacokinetic properties of an oligomeric compound or a group for improving the pharmacodynamic properties of an oligomeric compound and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy [2'-O-CH ₂ CH ₂ OCH ₃ , also known as 2'-O- (2-methoxyethyl) or 2'-MOE] (Martin et al., Helv. Chim Acta, 1995, 78, 486), ie an alkoxyalkoxy group. Another preferred modification is 2'-dimethylaminooxyethoxy, ie an O (CH ₂ ) ₂ ON (CH ₃ ) ₂ group, also known as 2'-DMAOE. Typical aminooxy substituent groups are described in co-owned U.S. Patent Application Serial No. 09 / 344,260, filed June 25, 1999, entitled "Aminooxy-Functionalized Oligomers", and a U.S. Patent Application entitled "Aminooxy- Functionalized Oligomers"; Functionalized Oligomers and Methods for Making Same ", filed Aug. 9, 1999, currently identified by the Attorney Docket No. ISIS-3993, which is hereby incorporated by reference in its entirety.

Other preferred modifications include 2'-methoxy (2'-O-CH ₃ ), 2'-aminopropoxy (2'-OCH ₂ CH ₂ CH ₂ NH ₂ ) and 2'-fluoro (2'-F). Similar modifications can also be made in other positions on nucleosides and oligomers, in particular in the 3'-position of the sugar on the 3'-terminal nucleoside or in 2'-5'-linked oligomers and in the 5'-position of 5'- terminal nucleoside.

oligomers can also sugar imitations, e.g. Cyclobutyl units, instead of pentofuranosyl sugar. On typical US patents which teach the preparation of such modified sugar structures include the U.S. Patents 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627.0531 5,639,873; 5,646,265; 5,658,873; 5,670,633 and 5,700,920, some of them in the Community Owned and all of which are incorporated herein by reference and the commonly owned US patent application with reference No 08 / 468,037, filed on 5 June 1995, also incorporated herein by reference, but are not these are limited.

typical Guanidino substituent groups shown in Formula III and IV are in the co-owned US patent application 09 / 349,040 entitled "Functionalized Oligomers", filed on On July 7, 1999, incorporated herein by reference in their entirety is involved.

typical Acetamido substituent groups are disclosed in a U.S. Patent Application entitled "2'-O-Acetamido Modified Monomers and Oligomers ", filed Aug. 19, 1999, currently by Attorney Docket ISIS-4071, disclosed by reference herein is integrated in its entirety.

typical Dimethylaminoethyloxyethyl substituent groups are in an international Patent application entitled "2'-O-Dimethylaminoethyloxyethyl Modified Oligonucleotides " filed Aug. 6, 1999, currently by Attorney Docket ISIS-4045, disclosed by reference herein is integrated in its entirety.

Several 2'-substituent groups give the sugar a 3'-endo curl when incorporated. This corrugation conformation further assists in increasing the T _{m of} the oligonucleotide with its target.

The high binding affinity, those from the 2'-substitution has been attributed in part to the fact that the 2'-substitution a C3'-endo sugar curl which in turn gives the oligomer a favorable A-shaped Can give geometry. This is a reasonable hypothesis as shown was that substitution in the 2'-position by a variety of electronegative Groups (such as fluorine and O-alkyl chains) cause C3'-endo sugar curling (De Mesmaeker et al., Acc. Chem. Res., 1995, 28, 366-374; Lesnik et al., Biochemistry, 1993, 32, 7,832 to 7,838).

In addition, in 2'-substituents containing an ethylene glycol motif, a gauche Wechselwir Between the oxygen atoms to the OCCO torsion of the side chain have a stabilizing effect on the duplex (Freier et al., Nucleic Acids Research, (1997) 25: 4.429 to 4.442). Such Bauche interactions have been experimentally observed for several years (Wolfe et al., Acc. Chem. Res., 1972, 5, 102; Abe et al., J. Am. Chem. Soc., 1976, 98, 468). , This gauche effect can lead to a configuration of the side chain that is favorable for duplex formation. The exact nature of this stabilizing configuration has not yet been explained. While not wishing to be bound by theory, it is possible that retaining the OCCO twist in a single gauche configuration-rather than a random distribution recognized in an alkyl side chain-provides an entropy advantage of duplex formation.

To better understand the higher RNA affinity of 2'-O-methoxyethyl-substituted RNA and to study the conformational properties of the 2'-O-methoxyethyl substituent, a self-complementary dodecamer oligonucleotide 2'-O-MOE r (CGCGAAUUCGCG) SEQ ID NO: 13 is synthesized, crystallized, and its structure determined at a resolution of 1.7 Angstroms. The crystallization conditions used were: 2 mM oligonucleotide, 50 mM Na-Hepes, pH 6.2 to 7.5, 10.50 mM MgCl ₂ , 15% PEG 400. The crystal data showed: space group C2, cell constant a = 41.2 Å , b = 34.4 Å, c = 46.6 Å, β = 92.4 °. The resolution was 1.7 Å at -170 ° C. The current R-factor was 20% (R _free 26%).

From This crystal structure is believed to be the first crystal structure one completely modified RNA oligonucleotide analogs is. The duplex assumes an overall A-form conformation, and all Modified sugars have C3'-endo curl on. For most of the 2'-O substituents the torsion angle about the A'-B 'bond, as shown below in Structure II, the ethylene glycol linkage a gauche conformation. For 2'-O-MOE, A 'and B' of structure II below are methylene units of the ethyl moiety of the MOE; and R 'is the methoxy part.

In the crystal occupies the 2'-O-MOE RNA duplex such a general orientation that the crystallographic 2-fold rotation axis does not match the molecular 2-fold rotation axis. Of the Duplex assumes the expected A-type geometry and all 24 2'-O-MOE substituents were visible in the electron density maps at full resolution. The electron density maps as well as the temperature factors of substituent atoms show in some cases flexibility of the 2'-O-MOE substituent at.

Most of the 2'-O-MOE substituents have a gauche conformation around the CC bond of the ethyl linkage. In two cases, however, a trans conformation around the CC bond is found. Lattice interactions in the crystal include packing duplexes against each other across their small grooves. Therefore, for some residues, the conformation of the 2'-O substituent is affected by contacts to an adjacent duplex. In general, variations in the conformation of the substituents (eg, g ⁺ or g ^- around the C-C bonds) create a range of interactions between substituents, both between strands, across the minor groove, and within strands. At one site are atoms of substituents of two residues across the minor groove in van der Waals contact. Similarly, there is close contact between atoms of substituents of two adjacent residues within the strand.

Previous certain crystal structures of A-DNA duplexes were for those into the isolated 2'-O-methyl-T radicals were involved. In the crystal structures given above for the 2'-O-MOE a conserved hydration pattern was observed for the 2'-O-MOE residues. A single molecule of water can be recognize that between O2 ', O3 'and the methoxy oxygen atom of the substituent is and contact with all three between 2.9 and 3.4 Å. Furthermore are oxygen atoms of substituents on several other hydrogen bonding contacts involved. For example, the methoxy oxygen atom forms a certain 2'-O-substituents over bridging water molecule a hydrogen bond to N3 of adenosine from the opposite Strand out.

In several cases is a water molecule between the oxygen atoms O2 ', O3 'and OC' modified nucleosides locked in. 2'-O-MOE substituents with trans conformation around the C-C bond of the ethylene glycol linkage are with close contacts between OC 'and N2 of a guanosine of the opposite Stranges associated and mediated by water between OC 'and N3 (G). These Crystal structure in combination with the available thermodynamic data for duplices, contain the 2'-O-MOE modified strands, allows the further detailed structure-stability analysis of other antisense modifications.

at the extension of crystallographic structural investigations Molecular modeling experiments carried out, to further increased binding affinity of oligonucleotides with 2'-O modifications of To investigate invention. The computer simulations were sent to the the above compounds having the SEQ ID NO: 1, the 2'-O-modifications of the invention which are attached to each nucleoside of the oligonucleotide are located. The simulations were performed on the oligonucleotide in aqueous solution using the AMBER force field method (Cornell et al., J. Am. Chem. Soc., 1995, 117, 5.179 to 5.197) (modeling software package from UCSF, San Francisco, CA). The calculations were with an Indigo2 SGI device (Silicon Graphics, Mountain View, CA).

To further 2'-O modifications belonging to the invention those that have a ring structure in which a diatomic Part that corresponds to the atoms A 'and B' of structure II. The ring structure is in the 2 'position of a sugar unit one or more nucleosides attached, which are incorporated into an oligonucleotide are. The 2'-oxygen of the nucleoside binds to a carbon atom belonging to the atom A 'of structure II equivalent. These ring structures may be aliphatic, unsaturated aliphatic, be aromatic or heterocyclic. Another atom of the ring (that the atom B 'of Structure II corresponds) another oxygen atom or a sulfur or a nitrogen atom. This oxygen, sulfur or nitrogen atom is with a or more hydrogen atoms, alkyl moieties or haloalkyl moieties or is part of another chemical entity, e.g. one Ureido, carbamate, amide or amidine moiety. The rest of the ring structure restricts the rotation around the bond that unites these two ring atoms, one. This supports the positioning of the "further Oxygen, sulfur or nitrogen "(part of position R, as described above) such that the further atom is in close proximity to the 3 'oxygen atom (O3 ') of the nucleoside can be located.

The Ring structure may be further modified with a group that for modifying the hydrophilic and hydrophobic properties of the Ringes to which she attached , and thus the properties of an oligonucleotide containing the 2'-O-modifications contains the invention useful is. Other groups can to get voted, like groups that are able to accept a loaded structure e.g. an amine. This is for modifying the total charge of a Oligonucleotide that has a 2'-O-modification contains the invention especially useful. When an oligonucleotide is replaced by charged phosphate groups, e.g. phosphorothioate or phosphodiester bonds, neutralizes the Placement of a counterion at the 2'-O modification, e.g. an amine functionality, the charge in the local Locally of the nucleotide carrying the 2'-O-modification. Such a charge neutralization is the uptake, cell localization and other pharmacokinetic and alter the pharmacodynamic effects of the oligonucleotide.

Preferred ring structures of the invention for inclusion as a 2'-O-modification include cyclohexyl, cyclopentyl and phenyl rings as well as heterocyclic rings having spatial footprints similar to those of cyclohexyl, cyclopentyl and phenyl rings. Particularly preferred 2'-O-substituent groups of the invention including an abbreviation for each are listed below:
2'-O- (trans-2-methoxycyclohexyl) -2'-O- (TMCHL)
2'-O- (trans-2-methoxycyclopentyl) -2'-O- (TMCPL)
2'-O- (trans-2-ureido-cyclohexyl) - 2'-O- (TUCHL)
2'-O- (trans-2-methoxyphenyl) -2'-O- (2MP)

structural Details of duplexes in which such 2'-O-substituents were integrated using the described AMBER force field program analyzed in the Indigo2 SGI device. The simulated structure survived throughout the duration of the Simulation a stable A-shape geometry. The presence of the 2'-substitutions locked the sugars in the C3'-endo-Korformation.

The simulation for TMCHL modification revealed that the 2'-O (TMCHL) side chains interact directly with water molecules that solvate the duplex. The oxygen atoms in the 2'-O- (TMCHL) side chain are capable of entering into a water mediated interaction with the 3 'oxygen of the phosphate backbone. The presence of the two oxygen atoms in the 2'-O- (TMCHL) side chain causes favorable gauche interactions. This new modification will make the bar even higher for the rotation around the OCCO twist. The preferential preorganization into an A-type geometry increases the binding affinity of the 2'-O- (TMCHL) to the target RNA. The locked side-chain conformation in the 2'-O- (TMCHL) group produced a more favorable pocket for binding water molecules. The presence of these water molecules played a key role in keeping the side chains in the preferred gauche conformation. While not wishing to be bound by theory, the volume of the substituent, the equatorial orientation of the substituents in the cyclohexane ring, the water of hydration and the potential for trapping metal ions in the generated conformation, in addition to improved binding affinity and nuclease resistance of oligonucleotides the nucleosides are involved with this 2'-O-modification contribute.

As for the The above TMCHL modification illustrate identical ones Computer simulations of 2'-O- (TMCPL), 2'-O- (2MP) and 2'-O- (TUCHL) -modified Oligonucleotides in aqueous Solution too, that while the entire duration of the simulation a stable A-shape geometry will be saved. The presence of 2'-substitution will increase the sugar in the C3 'endo conformation lock, and the side chains are directly interacting with water molecules which solvate the duplex. The oxygen atoms in The respective side chains are capable of a through water mediated interaction with the 3 'oxygen of the phosphate backbone to create. The presence of the two oxygen atoms in the respective Side chains calls the cheap gauche interactions. By the respective modification becomes the barrier for the rotation around the respective O-C-C-O-Torinnen still further increased. The preferred preorganization into an A-type geometry is the binding affinity of the respective 2'-O-modified oligonucleotides increase to the target RNA. The locked side chain conformation in the respective modifications becomes one for binding water molecules favorable Create a bag. The presence of these water molecules plays a key role keeping the sidechains in the preferred gauche conformation. The volume of the substituent, the equatorial orientation of the Substituents in their respective rings, the water of hydration and the potential for inclusion of metal ions in the generated conformation are all improved binding affinity and nuclease resistance of oligonucleotides incorporated into the nucleosides with this respective 2'-O modification are contribute.

Preferred for use as the B-form nucleotides for eliciting RNase-H are ribonucleotides which are 2'-deoxy-2'-S-methyl, 2'-deoxy-2'-methyl, 2'-deoxy-2'- amino, 2'-deoxy-2'-mono- or -dialkylsubstituted amino, 2'-deoxy-2'-fluoromethyl, 2'-deoxy-2'-difluoromethyl, 2'-deoxy-2'-trifluoromethyl, 2'- Deoxy-2'-methylene, 2'-deoxy-2'-fluoromethylene, 2'-deoxy-2'-difluoromethylene, 2'-deoxy-2'-ethyl, 2'-deoxy-2'-ethylene and 2'-deoxyethylene Having deoxy-2'-acetylene. These nucleotides may alternatively be referred to as 2'-SCH ₃ ribonucleotide, 2'-CH ₃ ribonucleotide, 2'-NH ₂ ribonucleotide 2'-NH (C ₁ -C ₂ alkyl) ribonucleotide, 2'-N (C ₁ -C ₂ -alkyl) _2- ribonucleotide, 2'-CH ₂ F-ribonucleotide, 2'-CHF ₂ ribonucleotide, 2'-CF ₃ ribonucleotide, 2 '= CH ₂ ribonucleotide,' = CHF ribonucleotide, 2 '= CF ₂ ribonucleotide, 2'-C ₂ H ₅ ribonucleotide, 2'-CH = CH ₂ ribonucleotide, 2'-C = CH ribonucleotide. Another useful ribonucleotide is one having a ring located in a cage-like structure on the ribose ring, including 3 ', O, 4'-C-methylene ribonucleotides. Such cage-like structures will fix the ribose ring in the desired conformation.

Also, for use as the B-form nucleotides for inducing RNase-H are arabinonucleotides which are 2'-deoxy-2'-cyano, 2'-deoxy-2'-fluoro, 2'-deoxy-2'-chloro, 2'-deoxy-2'-bromo, 2'-deoxy-2'-azido, 2'-methoxy, and the unmodified arabinonucleotide (containing a 2'-OH which projects up to the base of the nucleotide) prefers. These arabino nucleotides can alternatively referred to as 2'-CN arabino nucleotide, 2'-F arabino nucleotide, 2'-Cl arabino nucleotide, 2'-Br arabino nucleotide, _2'-N3 -Arabinonukleotid, 2'-O-CH ₃ -Arabinonukleotid and arabinonucleotide.

Such Nucleotides are over Phosphorothioate, phosphorodithioate, boranophosphate or phosphodiester bonds with each other connected; particularly preferred is the phosphorothioate linkage.

Illustrative for the B-form nucleotides for use in the invention is a 2'-S-methyl (2'-SMe) nucleotide, that turns into C2'-endo conformation located. It can with 2'-O-methyl (2'-OMe) nucleotides which are in a C3'-endo conformation. Especially suitable for use in comparing these two nucleotides are molecular dynamics studies using an SGI computer [Silicon Graphics, Mountain View, CA] and the AMBER modeling software package for computer simulations [UCSF, San Francisco, CA].

Ribose conformations in C2'-modified nucleosides containing S-methyl groups were investigated. To understand the influence of 2'-O-methyl and 2'-S-methyl groups on the conformation of nucleosides, we evaluated the relative energies of 2'-O- and 2'-S-methylguanosine together with normal deoxyguanosine and riboguanosine from both C2'-endo and C3'-endo conformations using quantum mechanical abinitio calculations. All structures were fully optimized at the HF / 6-31G * level and the single-point energies with electron correlation were obtained at the MP2 / 6-31G * // HF / 6-31G * level. As shown in Table 1, the C2'-endo conformation of deoxyguanosine is estimated to be 0.6 kcal / mole more stable than the C3'-endo conformation in the gas phase. The conformational preference of the C2'-endo to the C3'-endo conformation appears to be less dependent on the electron correlation, as shown by the MP2 / 6-31G * // HF / 6-31G * values, which also show the same difference in energy predict. For riboguanosine the opposite trend is noted. At the HF / 6-31G * and MP2 / 6-31G * // HF / 6-31G * levels, the C3'-endo form of riboguanosine is approximately 0.65 and 1.41 kcal / mol more stable than the C2'-endo form.

Table 1 Relative energies * of the C3'-endo and C2'-endo conformations of typical nucleosides

• * Energies in kcal / mol relative to the C2'-endo conformation

table 1 contains also the relative energies of 2'-O-methylguanosine and 2'-S-methylguanosine in C2'-endo- and C3 'endo conformation. These data show that the electronic nature of the C2 'substitution is a has a significant effect on the relative stability of these conformations. Substitution with the 2'-O-methyl group increases the preference the C3'-endo conformation (in Compared to riboguanosine) by about 0.4 kcal / mol on both the HF / 6-31G * as well as the MP2 / 6-31G * // HF / 6-31G * level. In contrast, the 2'-S-methyl group returns the Trend around. The C2'-endo conformation is about 2.6 kcal / mol cheaper at the HF / 6-31G * level, while the same difference at the MP2 / 6-31G * // HF / 6-31G * level is reduced to 1.41 kcal / mol is. For comparison, and also for the accuracy of the molecular mechanical force field parameters to judge for the 2'-O-methyl and 2'-S-methyl substituted Nucleosides were used, we have the gas phase energies of the nucleosides calculated. The results given in Table 1 show that the calculated relative energies of these nucleosides are qualitative well match the ab initio calculations.

additional Calculations were also performed to determine the effect of solvation on the relative stability of nucleoside conformations. The estimated solvation effect below Using HF / 6-31G * geometries confirmed that the relative energetic Preference of the four nucleosides in the gas phase also in the aqueous Phase is preserved (Table 1). Solvation effects were also under Use of Molecular Dynamics Simulations of Nucleosides in Explicit Water examined. On the basis of these trajectories, the prevalence the C2'-endo conformation at Deoxyriboguanosine and 2'-S-methylriboguanosine be while Riboguanosine and 2'-O-methylriboguanosine prefer the C3'-endo conformation. These results are in good agreement with the available NMR results for 2'-S-methylribonucleosides. NMR studies of the sugar corrugation equilibrium using vicinal spin-coupling constants have shown that the conformation of the sugar ring in 2'-S-methylpyrimidine nucleosides Average S-character> 75 whereas the corresponding purine analogs have an S-corrugation on average> 90 % [Fraser, A., Wheeler, P., Cook, P.D. and Sanghvi, Y. S., J. Heterocycl. Chem., 1993, 30, 1277-2287]. It was determined, that the 2'-S-methyl substitution in deoxynucleoside of sugar conformation compared with deoxyribonucleosides gives more conformational strength.

Structural features of DNA: RNA, OMe_DNA: RNA and SMe_DNA: RNA hybrids were also studied. The mean RMS deviation of the DNA: RNA structure from the starting hybrid coordinates shows that the structure is stabilized over the duration of the simulation with an approximate mean RMS deviation of 1.0 Å. This deviation is partly due to inherent differences in averaged Structures (ie, the initial conformation) and structures in thermal equilibrium. The changes in the sugar well conformation at three of the central base pairs of this hybrid are in good agreement with the observations made in previous NMR studies. The sugars in the RNA strand retain very stable geometries in the C3'-endo conformation with nearly 0 ° ring-wave values. In contrast, the sugars of the DNA strand show significant variability.

The mean RMS deviation of OMe_DNA: RNA is opposite to the starting A-form conformation about 1.2 Å, while the SMe_DNA: RNA opposite the starting hybrid conformation shows a slightly larger deviation (about 1.8 Å). The SMe_DNA strand also shows a greater variance of the RMS deviation, suggesting that the S-methyl group has structural variations can cause. Preserve the sugar corrugations of the RNA complements while the entire simulation C3'-endo-curl. However, as expected from the nucleoside calculations, they will noted significant differences in the curl of the OMe_DNA and SMe_DNA strands, the former being a C3'-endo and the latter adopt a C1'-exo / C2'-endo conformation.

Also is for all three hybrid structures have been carried out an analysis of the helical parameters, to further label the duplex conformation. Three of the more important Axis-base pair parameters through which the different shapes Duplices differ, X-displacement, Propeller twist and pitch are given in Table 2. A X-displacement of near zero is usually typical for a B-form duplex. while a negative shift, which is a direct measure of the deviation of the helix from the helix axis, the conformation of the structure appears more A-shaped leaves. In A-form duplexes, these values typically vary from -4 Å to -5 Å. At the Comparing these values from all three hybrids shows the SMe_DNA: RNA hybrid the biggest deviation from the A-form value, the OMe_DNA: RNA shows the smallest, and the DNA: RNA is in between. A similar one Trend is also evident when the tilt and propeller rotation values be compared with the parameters of the ideal A-shape. These results are further characterized by an analysis of the backbone and the glycosidic Torsion angle of the hybrid structures supported. Glycosidic angles (X) For example, A-shape geometries are typically in the Near -159 °, while B-shape values near from -102 °. It has been found that these angles in the OMe_DNA, DNA or SMe_DNA strand -162 °, -133 ° or -108 °. All RNA complements assume an X-angle of almost -160 °. In addition, "crankshaft" transitions have also been added the backbone torsions the central UpU stages of the RNA strand detected in the SMe_DNA: RNA and DNA: RNA hybrids. Such transitions suggest that local conformational can enter a less favorable one To eliminate overall conformation. Overall, the show Results that the degree of A character in the series OMe_DNA: RNA> DNA: RNA> SMe_DNA: RNA decreases, the last two compared with A and B shape geometries in stronger Dimensions intermediate conformations accept.

Table 2 Mean helical parameters, derived from the last 500 ps of the simulation duration (recognized A and B shape values are given for comparison)

The stability of C2'-modified DNA: RNA hybrids was determined. Although the overall stability of the DNA: RNA hybrids depends on several factors, including sequence dependencies and purine content in the DNA or RNA strands, DNA: RNA hybrids are usually less stable than RNA: RNA duplexes and, in some cases, even less stable as DNA: DNA duplexes. Available experimental data attribute the lowered stability of DNA: RNA hybrids largely to its intermediate conformational nature between DNA: DNA (B family) and RNA: RNA (A family) duplexes. The overall thermodynamic stability of nucleic acid duplicates may be due to several factors, including conformation of the backbone, base-pairing, and stacking interactions. Although it is difficult to establish the individual thermodynamic contributions to the overall stabilization of the duplex, it is reasonable to argue that the major factors affecting the increased stability of hybrid favor better stacking interactions (electrostatic [π] - [π] interactions) and more favorable groove dimensions for hydration. It has been shown that the C2'-S-methyl substitution destabilizes the hybrid duplex. The noticeable differences in the rise values in the three hybrids may provide some explanation. While the 2'-S-methyl group has a strong influence on decreasing the base stacking due to high rise values (≈ 3.2 Å), the 2'-O-methyl group makes the whole structure more compact with a slope value similar to that of A-form. Duplices is equal (≈ 2.6 Å). Despite its overall A-shaped structural features, the SMe_DNA: RNA hybrid structure has an average slope of 3.2 Å, which is quite similar to that of B family duplexes. Indeed, it can be noted that some local base levels (CG levels) have unusually high slope values (even up to 4.5 Å). Therefore, the greater destabilization of 2'-S-methyl-substituted DNA: RNA hybrids can be attributed in part to weak stacking interactions.

It It has been postulated that RNase-H binds to the minor groove of RNA: DNA hybrid complexes bind what is an intermediate of the small furrow between ideal A and B shape geometry requires interactions between the sugar phosphate backbone atoms and to optimize the RNase-H. A thorough examination of the averaged Structures of hybrid complexes using computer simulations reveals one significant variation of the width dimensions of the small furrow, such as shown in Table 3. While the O-methyl substitution compared to the normal DNA: RNA complex to one slight increase in Width of the small furrow leads, leads the S-methyl substitution into a general contraction (approx 0.9 Å). These changes are most likely due to the preferential sugar curling sensed by the antisense strands which is either A- or B-shaped Single-strand conformations effected. Except for changes in the small furrow also point out the results to possible ones Differences in spatial Shape of the small furrow. The O-methyl group points into the small furrow, whereas the S-methyl group away, to the big furrow directed. Essentially, the S-methyl group is due to the C2'endo curl through the bases into the big one Furrow reversed.

Table 3 Width of the minor groove, averaged over the last 500 ps of the simulation duration

Except the Modifications described above may include the nucleotides of the oligonucleotides of the invention have a variety of other modifications, provided these other modifications have the characteristics described above do not significantly affect. Therefore, you can Nucleotides incorporated in the oligonucleotides of the invention are sugars, the naturally occurring sugars or modified sugars. To typical modified Belonging to sugars Carbocyclic or acyclic sugars, sugars with substituent groups in its 2'-position, Sugar with substituent groups in its 3'-position and sugars having substituents in place of one or more hydrogen atoms of sugar. Others changed Base units and altered Sugar units are disclosed in U.S. Patent No. 3,687,808 and the PCT application PCT / US89 / 02323.

Modified base units or altered sugar units include other modifications consistent with the spirit of this invention. Such oligonucleotides are best described as structurally distinct from, yet functionally interchangeable with, naturally occurring or synthetic wild-type oligonucleotides. All such oligonucleotides are encompassed by this invention provided that they function effectively to provide the structure of a desired RNA or RNA Imitate DNA strands. One class of typical base modifications includes tricyclic cytosine analog, termed "G-clamp" (Lin et al., J. Am. Chem Soc, 1998, 120, 8.531) .This analog forms four hydrogen bonds to a complementary guanine (G) within helix, by simultaneously targeting the Watson-Crick and Hoogsteen surfaces of G. When incorporated into phosphorothioate oligonucleotides, this G-clamp modification dramatically increases the antisense potency in cell culture The oligonucleotides of the invention may also include phenoxazine-substituted bases of the type disclosed by Flanagan et al., Nat. Biotechnol 1999, 17 (1), 48 to 52. Further modifications may also be made in other positions in the oligonucleotide, especially in the 3'-position For example, in a further modification of the oligonucleotides of the invention, the chem include binding to the oligonucleotide of one or more moieties or conjugates which increase the activity, cell distribution or cell uptake of the oligonucleotide. Such moieties include lipid moieties such as a cholesterol moiety (Letsinger et al., Proc Natl Acad Sci USA, 1989, 86, 6,553), cholic acid (Manoharan et al., Bioorg. Med. Lett., 1994, 4, 1053), a thioether, eg, hexyl-S-trityl thiol (Manoharan et al., Ann. NY Acad Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Lett., 1993, 3, 2,765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533), an aliphatic chain, eg dodecanediol or undecyl radicals (Saison-Behmoaras et al., EMBO J , 1991, 10, 111; Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al., Biochimie, 1993, 75, 49), a phospholipid, eg, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3.651; Shea et al., Nucl. Acids Res., 1990, 18 , 3.777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969) or adamantaneacetic acid (M Anoharan et al., Tetrahedron Lett., 1995, 36, 3.651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1.264, 229) or an octadecylamine or hexylamino-carbonyl-oxycholesterol unit (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923), but are not limited thereto.

human RNase-H1 has a strong positional preference for cleavage on, i. it cleaves 8 to 12 nucleotides from the 5 'RNA: 3' DNA terminus of the Duplex. Within the preferred cleavage site, the enzyme has a moderate sequence preference where GU is a preferred dinucleotide. The RNA: DNA duplex minimum length, the Splitting supports, is 6 base pairs, and the RNA: DNA minimum "gap size" that supports cleavage is 5 base pairs.

Properties purified human RNase H1

The effects of different reaction conditions on the activity of human RNase H1 were assessed ( 1 ). The optimum pH for the enzyme was 7.0 to 8.0 in both Tris-HCl and phosphate buffers. At pH's above 8.0, enzyme activity was reduced. However, this could be due to the instability of the substrate or to effects on the enzyme or both. To assess the potential contribution of changes in ionic strength to the activities observed at different pH values, two buffers, NaHPO ₄ and Tris-HCl, were tested at pH 7.0 and gave the same enzyme activity, although ionic strengths were different. The enzyme activity was increased by increasing the ionic strength ( 1B ) and by N-ethylmaleamide ( 1C ) inhibited. The enzyme activity increased when the temperature was raised from 25 to 42 ° C ( 1D ). Mg ²⁺ stimulated enzyme activity, the optimal concentration being 1 mM. In higher concentrations, Mg ^{2+ was} inhibitory ( 1E ). In the presence of 1 mM Mg ^2+, Mn ^{2+ was} inhibitory at all concentrations tested ( 1F ). The purified enzyme was quite stable and easy to handle. In fact, the enzyme could be boiled and rapidly or slowly cooled without significant loss of activity ( 1D ). The initial rates of cleavage were investigated simultaneously for four duplex substrates. The initial rate of cleavage for a phosphodiester DNA: RNA duplex was 1050 ± 203 pmol·l ^-1 · min ^-1 (Table 4A). The initial rate of cleavage in a phosphorothioate oligodeoxynucleotide duplex was about four times greater than that of the same duplex containing a phosphodiester antisense oligodeoxynucleotide (Table 4A). The initial rates for 17-mer and 20-mer substrates with different sequences were the same (Table 4B). However, when a 25-mer heteroduplex containing the 17mer sequence at the center of the duplex was digested (RNA 3), the rate was 50% higher. Interestingly, the Km of the enzyme in the 25-mer duplex was 40% lower than that of the 17-mer, while the Vmax were the same for both duplexes (see Table 6), suggesting that with the increase in length a large number of cleavage sites is available, resulting in an increase in the number of productive binding interactions between the enzyme and the substrate. As a result, the longer duplex requires a lower substrate concentration to achieve a nip speed equal to that at the shorter duplex.

To better characterize the substrate specificity of human RNase H1, duplexes were examined in which the antisense oligonucleotide was modified in the 2'-position. As previously described for E. coli RNase H1, human RNase H1 was unable to cleave substrates with 2 'modifications at the cleavage site of the antisense DNA strand or the sense RNA strand (Table 5) ). For example, the initial rate of cleavage of a duplex containing a phosphorothioate oligodeoxynucleotide and its complement was 3,400 pmol.l- ¹ min- ¹ while that of its 2'-propoxymodified analog was undetectable (Table 5). A duplex comprising a fully modified 2'-methoxy antisense strand also did not support cleavage (Table 5). The placement of 2'-methoxy modifications around a central region of oligodeoxynucleotides reduced the initial rate (Table 5). The smaller the central oligodeoxynucleotide "gap" was, the lower the initial rate was, and the smallest "gapmer" at which the cleavage could be measured was a 5-deoxynucleotide gap. These data are highly consistent with observations previously reported for E. coli RNase H1, except that the minimum gap size for the bacterial enzyme was 4 deoxynucleotides.

The Km and the Vmax of human RNase-H1 for three substrates are in Table 6 shown. The Km values for all three substrates were much lower than those of E. coli RNase H1 (Table 6). As previously stated for E. coli RNase H1, the Km was at one Phosphorothioate containing duplex lower than that in one Phosphodiester duplex. The Vmax of the human enzyme was 30-fold lower than that of the E. coli enzyme. The Vmax in the phosphorothioate-containing Substrate was lower than the phosphodiester duplex. This is probably by inhibiting the enzyme at higher concentrations due to excess single-stranded phosphorothioate oligonucleotide, since the initial rate of cleavage in a phosphorothioate-containing Duplex indeed larger than where the phosphodiester was (Table 4).

Binding affinity and specificity

Around the binding affinity to assess human RNase H1 became a competitive cleavage assay applied, with increasing concentrations of non-cleavable substrates were added. Using this approach, the ki is formal equivalent to the ki for the competing substrates. Lineweaver-Burk analyzes showed that of the investigated non-cleavable substrates, all inhibitors, shown in Table 7 were competitive (data not shown). A duplex containing a phosphodiester oligodeoxynucleotide, hybridized with a phosphodiester 2'-methoxy oligonucleotide because the non-cleavable substrate as DNA: RNA most similar is seen. Table 7 shows the results of these studies and compares them to previously reported results for the E. coli enzyme those under similar Conditions performed were. It is clear that the affinity of the human enzyme too its DNA: RNA-like substrate (DNA: 2'-O-Me) was substantially larger than that of the E. coli enzyme, which consistent with the differences in Km (Table 6).

E. coli RNase H1 has about the same affinity to RNA: RNA, RNA: 2'-O-Me- and DNA: 2'-O-Me duplexes on (Table 7). The human enzyme has similar binding properties but is more capable between different duplexes. For example, the Kd for RNA: RNA about 5-fold lower than the Kd for DNA: 2'-O-Me. This is further by the Kd for the RNA: 2'-F duplex shown. The Kd in the DNA: 2'-F duplex was light greater than the one at the RNA: 2'-F duplex and the RNA: RNA duplex, but much lower than other duplexes. Thus both can Enzymes as double-stranded, RNA-binding Proteins are considered. However, human RNase H1 is something less specific to duplicates compared to single-stranded Oligonucleotides as the E. coli enzyme. The enzyme bound to single-stranded RNA and DNA 20 fold less well than an RNA: RNA duplex, while the E. coli enzyme to single-stranded DNA nearly 600-fold less than an RNA: RNA duplex band (Table 7). The affinity a single-stranded one Phosphorothioate oligodeoxynucleotide to both enzymes was in significant proportion to the affinity to the natural Substrate and causes the inhibition of enzymes by members of these Class of oligonucleotides. It is noteworthy that human RNase-H1 has the greatest affinity for one stranded Phosphorothioate oligodeoxynucleotide had. Thus, this non-cleavable substrate is a very effective one Inhibitor of the enzyme, and excess phosphorothioate antisense drug in cells could strongly inhibiting effect.

Local and Sequence preference in cleavage

2 shows the cleavage pattern for RNA in duplex with its phosphorothioate oligodeoxynucleotide and the pattern for several gapmers. In the parent duplex RNA cleavage was performed on a single major site, with side cleavage at multiple sites 3 'to this major cleavage site being 8 nucleotides from the 5' terminus of the RNA. Note that the preferred site was a GU dinucleotide. The cleavage of several "gapmers" was slower and the major cleavage site was in a different position than the parent duplex, and in contrast to the observations we made for E. coli RNase H1, the main Cleavage site in gapmer treated with human RNase H1 in the nucleotide added to the nucleotide that the first 2'-methoxy nucleotide in the wing hybridized with the 3 'part of the RNA, is adjacent.

To assess the location and sequence specificities of human RNase H1, cleavage of substrates shown in FIG 3 and 4 , examined. In 3 For example, the sequence of RNA under the sequencing gels is shown, and the length and position of the complementary phosphodiester oligodeoxynucleotide are indicated by the solid line below the RNA sequence. This figure shows several important properties of the enzyme. First, the major cleavage site was consistently 8 to 9 nucleotides from the 5 'RNA: 3' DNA terminus of the duplex, regardless of whether single stranded 5 'or 3' RNA overhangs were present. Second, the enzyme, such as E. coli RNase H1, was able to cleave single-stranded regions of RNA adjacent to the 3 'terminus of an RNA: DNA duplex. Third, the minimum duplex length that supports each cleavage was about 6 nucleotides. RNase protection assays were used to confirm that the shorter duplexes were fully hybridized under the assay conditions so that the differences noted were not due to hybridization failure. To ensure that the 6-nucleotide duplex was fully hybridized, the reactions were performed at a DNA: RNA ratio of 50: 1 (data not shown). Fourth, the figure shows that for duplexes smaller than the nine base pairs, the smaller the duplex, the smaller the cleavage rate. Fifth, the preferred cleavage site was on a GU dinucleotide.

The location and sequence specificities are in 4 further investigated. That the enzyme has low sequence preference is shown by comparing the rates and sites of cleavage at duplexes A, C and D. In all cases, the preferred site of cleavage, regardless of sequence, was 8 to 12 nucleotides from the 5 'RNA: 3' DNA terminus of the duplex. Comparison of the cleavage pattern at Duplices A and B shows that cleavage occurred at nucleotide positions 8 through 12, even when RNA overhangs were present, as well as in 3 shown. Cleavage of duplex F showed that the cleavage site was retained even when 5 'and 3' DNA overhangs were present. In a longer substrate, duplex G, the major cleavage site was still 8 to 12 nucleotides from the terminus of the duplex. However, minor cleavage sites were detected throughout the RNA, suggesting that this substrate might support the binding of more than one enzyme molecule per substrate, but that the preferred site was close to the 5 'RNA: 3' DNA terminus. Finally, optimal cleavage appeared to occur when a GU dinucleotide was 8 to 12 nucleotides from the 5 'RNA: 3' DNA terminus of the duplex.

In order to address both the mechanism of cleavage and the processivity of cleavage, the cleavage of 5'-labeled and 3'-labeled substrates was compared ( 5 ). Line C shows that CIP treatment before and after digestion with human RNase H1 resulted in a change in the mobility of the digested fragments, suggesting that human RNase H1 generates cleavage products with 5'-phosphates. Thus, it is similar in this respect to E. coli RNase H1. A second puzzling observation is that the addition of pC to the 3 'end of the RNA caused a change in the position of the preferred cleavage site (A to B or C). The four cleavage sites in the center of the duplex, which were detected with a 5'-phosphate-labeled RNA, were detected in 3'-pC-labeled substrates. However, the major cleavage site shifted from base pair 8 to base pair 12. Interestingly, the sequence was GU in both locations. Therefore, it is conceivable that the enzyme would select a position 8 to 12 nucleotides from the 5'-RNA: 3'-DNA terminus, then cleave at a preferred dinucleotide such as GU. Third, this figure shows, taking into account the cleavage patterns, in 3 and 4 shown that this enzyme has minimal processivity in either the 5 'or 3' direction. At no point in the course of the experiment, using any substrate, have we observed a pattern consistent with processivity. The possibility of failure, in 3 and 4 Determining processivity due to processivity in the 3 'to 5' direction is indicated by the results in 5 locked out. This, in turn, is very different from observations previously described for E. coli RNase H1.

General Properties of the activity human RNase H1

The present invention also describes the characteristics of human RNase H1 that have been characterized. Since the protein under investigation is a His-tag fusion protein and denatured and withdrawn It is possible that the activity of the enzyme in its native state is greater than we found. Of course, the basic properties are likely to reflect the basic properties of the native enzyme. Numerous studies have shown that a His tag does not interfere with protein folding and crystallization, kinetic and catalytic properties, or nucleic acid binding properties because it is very small (a few amino acids) and its pK value is nearly neutral. In the present invention, the His-tag fusion protein is shown to behave like other RNase-H. It specifically cleaved the RNA strand into RNA: DNA duplexes, yielding cleavage products with 5'-phosphate termini ( 5 ) and was influenced by divalent cations ( 1 ). The optimal conditions for human RNase H1 were similar to but not identical to those for E. coli RNase H1. For the human enzyme, the Mg ²⁺ optimum was 1 mM, and 5 mM Mg ^{2+ was} inhibitory. In the presence of Mg ²⁺ , both enzymes were inhibited by Mn ²⁺ . The human enzyme was inhibited by n-ethylmaleimide and was quite stable, easy to handle and did not form multimeric structures ( 1 ). The ease of handling, denaturation, refolding and stability under various conditions suggest that the human RNase H1 was active as a monomer and has a relatively stable preferred conformation.

investigations the structure and enzymatic activities of a number of mutants of E. coli RNase H1 have recently led to a hypothesis, to explain the effects of divalent cations, activation / attenuation model called. The effects of divalent cations on human RNase H1 are complex and consistent with the proposed activation / mitigation model. The amino acids, which were proposed to be included in both cation binding sites to be conserved in human RNase H1.

Positions and sequence preferences and processivity

The location and sequence specificity of human RNase H1 differ significantly from those of E. coli RNase H1. Although none of the enzymes has significant sequence specificity ( 2 to 5 this manuscript), the human enzyme has remarkable site specificity. The 2 to 4 show that human RNase H1 preferentially cleaved 8 to 12 nucleotides 3 'from the 5' RNA: 3 'DNA terminus of a DNA: RNA duplex, whether 5' or 3 'RNA or DNA Overhangs were available. The method by which a position is selected and then preferably cleaved within that position on the duplex of a given dinucleotide must be relatively complex and affected by the sequence. It is clear that the dinucleotide, GU, is a preferred sequence. In 3 For example, all the duplexes contained a GU sequence near the optimal position for the enzyme, and in all cases the preferred cleavage site was GU. Also, in Duplices A and B, a second GU was also split, albeit at a very slow speed. The third cleavage site in duplexes A and B was a GG dinucleotide, 7 base pairs from the 3 'RNA: 5' DNA terminus. Thus, the data suggest that the enzyme has a strong positional preference and, within the appropriate location, a slight preference for GU dinucleotides.

The strong positional preference exhibiting human RNase H1, suggests that the enzyme may shift its position in the duplex over the 5'-RNA: 3'-DNA terminus sets. Interestingly, the in vitro cleavage pattern is that in the Enzyme was detected with its proposed role in vivo compatible, namely during removal of RNA primers the DNA replication of the subsequent strand. The average length of the RNA primer is in the range of 7 to 14 nucleotides. Consequently Synthesis of the following strand gives rise to chimeric sequences, which are shown in 7 to 14 ribonucleotides at the 5 'terminus with adjacent ones Extensions of DNA extending in the 3 'direction exist. The Positional preference found in human RNase H1 (i.e., 8 to 12 residues from the 5 'terminus of the RNA) would suggest that that the cleavage of the chimeric Followed by RNase-H1 at the RNA: DNA junction or in their vicinity would. It has been shown that removing residual ribonucleotides following RNase H digestion by the endonuclease FEN1 he follows.

4 provides additional insight into the position and sequence preferences of the enzyme. When a GU dinucleotide was present in the correct position in the duplex, it was preferentially cleaved. When a GU dinucleotide was absent, AU as well as other dinucleotides were cleaved. In duplex G, both a GU and a GG dinucleotide were present within the preferred location, and in this case the GG dinucleotide was cleaved somewhat more than the GU nucleotide. It is clear that further duplexes with different sequences must be investigated before final conclusions can be drawn regarding the roles of different sequences within the preferred cleavage sites.

In 5 the 3'-terminus of the RNA was labeled with ³² pC. In this case, the same four nucleotides were cleaved as in 5'-labeling of the RNA ( 5 , Panels B and C). However, the GU, which was closer to the 3'-terminus of the RNA, was cleaved at least as fast as the 5'-GU. Interestingly, differences in the cleavage pattern were also observed in assays on the partially purified enzyme when the 5'-labeled substrates were compared to 3'-labeled substrates. A possible explanation for this observation is that the presence of a 3'-phosphate on an oligonucleotide substrate affects the sensing mechanism that the enzyme uses to select preferred positions for cleavage.

In a duplex comprising RNA attached to a chimeric oligonucleotide having a Oligodeoxynucleotide center flanked by 2'-modified nucleotide wings is attached, was cleavage by human RNase-H1 directed to the DNA: RNA portion of the duplex, as in E. coli RNase H1 was observed. Within this region are the preferred cleavage sites of the human enzyme but different from those of E. coli RNase H1. E. coli RNase H1 preferably cleaved on the ribonucleotide attached to the first 2'-modified nucleotide in the wing of the antisense oligonucleotide was attached to the 3 'end of the RNA. In contrast, split the human enzyme is preferably more central Places within the gap, until the gap was reduced to 5 nucleotides. Furthermore, the minimum gap size was for the human Enzyme 5 nucleotides, whereas that for E. coli RNase H1 4 nucleotides amounted to. These differences in behavior vary Structures of enzymes and their interactions with substrate close, need further investigation.

Although E. coli RNase H1 degrades the heteroduplex substrate in a predominantly distributive manner, the enzyme has moderate 5'-3 'processivity. In contrast, human RNase H1 shows no 5'-3 'or 3'-5' processivity, suggesting that the human enzyme hydrolyzes the substrate in an exclusively distributive manner. The lack of processivity found in human RNase H1 may be an effect of significantly higher binding affinity (Table 7), thereby reducing the ability of the enzyme to move on the substrate. Alternatively, human RNase H1 appears to fix its position on the substrate to the 5 'RNA: 3' DNA terminus, and this strong positional preference can prevent cleavage of the substrate in a processive manner ( 5 ). Despite the fact that both enzymes are metal-dependent endonucleases which give cleavage products with 5'-phosphates ( 5 ), and both can cleave single-stranded 3 'RNA overhangs ( 5 ), these enzymes thus have significant differences.

It It has been proposed that E. coli RNase-H1 be considered in terms of RNA of the substrate should have "binding directionality", such that the primary Binding region of the enzyme several nucleotides 5 'to the catalytic center arranged is. this leads to splice sites from the 5 'RNA: 3' DNA end of a duplex are delineated and that cleavage sites on the 3 'RNA: 5' DNA end of the duplex and in 3 'single-strand overhangs. The human enzyme behaves completely analogous. Therefore, we draw the conclusion that human RNase-H1 probably has the same binding directionality as the E. coli enzyme having.

substrate binding

From RNA: RNA duplexes have been shown to have an A-form conformation accept. Many 2'-modifications shift the sugar conformation into a 3'-endo corrugation that is characteristic of RNA. consequently when hybridized with RNA, the resulting duplex is of the "A" form, and this manifests itself in a more stable duplex. 2'-F Oligonucleotides have duplex-forming properties similar to those of RNA most similar whereas 2'-methoxy oligonucleotides Duplices with an intermediate conformation between DNA: RNA and RNA: RNA duplexes result.

The results, shown in Table 7, show that human RNAse H1, like the E. coli enzyme, is a protein that binds to double-stranded RNA. In addition, it has some ability to distinguish between different A-form duplexes (Table 7). The observation that the Kd in an RNA: 2'-F duplex is similar to that in an RNA: RNA duplex suggests that the 2'-hydroxy group is not required for binding to the enzyme. However, we can not rule out the possibility that bulkier 2 'modifications, such as 2'-methoxy or 2'-propyl, could sterically inhibit binding of the enzyme and alter the AF property of the duplex. The human enzyme has a significantly greater affinity for all oligonucleotides than the E. coli enzyme, and this is reflected by a lower Km for cleavable substrates (Tables 6 and 7). In addition, the higher binding affinity found in human RNase-H1 may account for 20 times lower Vmax compared to the E. coli enzyme. In this case, assuming that the E. coli and the human enzyme are similar Ka Thus, increasing the binding affinity would result in a lower turnover rate and ultimately a lower Vmax.

It It is believed that the major substrate binding site is E. coli RNase H1 is a cluster of lysines believed to be attached to the Bind phosphates of the substrate. It is believed that the interaction between the binding surface of the enzyme and the substrate within the minor groove. This region is highly conserved in the human enzyme. Furthermore eukaryotic enzymes contain an extra-N-terminal region variable length, the one abundance at basic amino acids contains. This region is homologous to a double-stranded RNA binding motif, and indeed It has been shown that S. cerevasiae RNase H binds to double-stranded RNA binds. The N-terminal extension is longer in human RNase H1 as in the S. cerevasiae enzyme and seems a complete one ds RNA binding motif to match. As a result, the reinforced binding can be human RNase H1 to various nucleic acids by the presence of this additional Bindungsortes be conditional.

As as used herein, the term "alkyl" includes - is but not limited on - straight-chain, branched-chain and cyclic unsaturated hydrocarbon groups, including, but not limited on, methyl, ethyl and Isopropyl groups. Alkyl groups of the present invention may be substituted be. Typical alkyl substituents are disclosed in U.S. Patent No. 5,212,295 in column 12, lines 41 to 50, which are hereby incorporated by reference is integrated in its entirety.

Alkenyl groups are according to the invention straight-chain, branched-chain and cyclic hydrocarbon groups, containing at least one carbon-carbon double bond, and alkynyl groups are straight-chain, branched-chain and cyclic Hydrocarbon groups containing at least one carbon-carbon triple bond contain. Alkenyl and alkynyl groups of the present invention can be substituted.

aryl groups are substituted and unsubstituted aromatic, cyclic units, including, but not limited on, phenyl, naphthyl, anthracyl, phenanthryl, pyrenyl and Xylyl. Alkaryl groups are those in which an aryl moiety connects an alkyl moiety having a core structure, and aralkyl groups are those in which an alkyl moiety has an aryl moiety a core structure connects.

Generally The term "hetero" refers to an atom that is a other than carbon is, preferably, but not exclusively, N, O or S. Accordingly, designated the term "heterocyclic Ring "a ring system based on carbon with one or more heteroatoms (i.e. Non-carbon atoms). Preferred heterocyclic rings belong for example imidazole, pyrrolidine, 1,3-dioxane, piperazine, morpholine rings, but are not limited to these. As used herein, the term "heterocyclic ring" also refers to a ring system with one or more double bonds and one or more heteroatoms. Preferred heterocyclic rings include, for example, the pyrrolidine ring; but they are not limited to these.

Oligonucleotides of the invention which are hybridizable with a target nucleic acid preferably comprise from about 5 to about 50 nucleosides. More preferred is that such compounds comprise from about 8 to about 30 nucleosides, with 15 to 25 nucleosides being particularly preferred. As used herein, a target nucleic acid is any nucleic acid that can hybridize to a complementary nucleic acid-like compound. Further, in the context of this invention, "hybridization" is intended to mean hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding between complementary nucleobases. "Complementary," as used herein, refers to the ability to be precise Pairing between two nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds. "Complementary" and "specifically hybridizable," as used herein, refers to the exact pairing or sequence complementarity of a first with a second nucleic acid-type oligomer containing nucleoside subunits. For example, if a nucleobase in a particular position of the first nucleic acid is capable of hydrogen bonding to a nucleobase in the same position of the second nucleic acid, then the first nucleic acid and the second nucleic acid in that position are considered to be complementary to each other. The first and second nucleic acids are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can hydrogen bond with each other. Thus, "specifically hybridizable" and "complementary" are terms used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between a compound of the invention and a target RNA molecule. It is understood that an oligomeric compound of the invention is not 100% com needs to be complementary to its target RNA sequence in order to be specifically hybridizable. An oligomeric compound is specifically hybridizable when the binding of the oligomeric compound to the target RNA molecule interferes with the normal mode of action of the target RNA causing a loss of utility, and a sufficient degree of complementarity is present to prevent nonspecific binding of the oligomeric compound Non-target sequences under conditions where specific binding is desired, ie, under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions under which the assays are performed ,

As used herein, "human Type 2 RNase H "and" human RNase-H1 "on the same human RNase H enzyme. Accordingly, these terms are meant to be interrelated be used interchangeably.

The Oligonucleotides of the invention can be used in diagnosis, therapeutics and as research reagents and Kits are used. You can in pharmaceutical compositions by incorporation of a suitable pharmaceutically acceptable diluent or carrier used become. You can also be used to treat organisms that are a disease exhibit, by the unwanted Production of a protein is characterized. The organism should be contacted with an oligonucleotide having a sequence which is able to specifically hybridize to a strand of nucleic acid, the for the unwanted Protein encoded. Treatments of this type can be made on a variety of organisms be made of unicellular prokaryotic and eukaryotic Organisms to multicellular eukaryotic organisms. Any organism that uses DNA-RNA transcription or RNA-protein translation as one fundamental part of his hereditary, metabolic or cellular control used is for the therapeutic invention and / or prophylactic treatment susceptible. Apparently, different types Organisms, such as e.g. Bacteria, yeast, protozoa, algae, all plants and all higher ones Including animal forms warmblooded Animals, to be treated. Furthermore, each cell can be multicellular Eukaryotes are treated as having both DNA RNA transcription in them Also, RNA protein translation as essential components of their cell activity are involved. In addition, many of the organelles (e.g., mitochondria and chloroplasts) of eukaryotic cells also transcriptional and Translational mechanisms included. Thus, single cells, cell populations or organelles also in the definition of organisms that treated with therapeutic or diagnostic oligonucleotides can, be included.

The following non-limiting Examples are provided to further further the present invention illustrate.

EXAMPLES

EXAMPLE 1

5'-O-DMT-2'-O- (2-methoxyethyl) -5-methyluridine and 5'-O-DMT-3'-O- (2-methoxyethyl) -5-methyluridine

2 ', 3'-O-dibutylstannylene-5-methyluridine (345 g) (made according to Wagner et al., J. Org. Chem., 1974, 39, 24) was prepared in the presence of Tetrabutylammonium iodide (235 g) in DMF (3 L) at 70 ° C with 2-methoxyethyl bromide (196 g) alkylated; It was a mixture of 2'-O- and 3'-O- (2-methoxyethyl) -5-methyluridine (150 g) in an isomeric ratio of almost 1: 1. The mixture was treated with DMT chloride (110 g, DMT-Cl) in pyridine (1 L) to give a mixture of 5'-O-DMT nucleosides. After normal work-up, the isomers were purified by silica gel column chromatography separated. The 2'-isomer eluted first, followed by the 3 'isomer.

EXAMPLE 2

5'-O-DMT-3'-O- (2-methoxyethyl) -5-methyluridine 2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

5'-O-DMT-3'-O- (2-methoxyethyl) -5-methyluridine (5 g, 0.008 mol) was dissolved in CH ₂ Cl ₂ (30 mL) and to this solution was added under argon diisopropylaminotetrazolide (0.415 g ) and 2-cyanoethoxy-N, N-diisopropyl phosphoramidite (3.9 ml). The reaction mixture was stirred overnight. The solvent was evaporated and the residue was applied to a silica column and eluted with ethyl acetate to give 3.75 g of the title compound.

EXAMPLE 3

5'-O-DMT-3'-O- (2-methoxyethyl) -N ⁴ -benzoyl-5-methylcytidine

5'-O-DMT-3'-O- (2-methoxyethyl) -5-methyluridine (15 g) was treated under argon with 150 ml of anhydrous pyridine and 4.5 ml of acetic anhydride and stirred overnight. The pyridine was evaporated and the residue was partitioned between 200 mL of saturated NaHCO ₃ solution and 200 mL of ethyl acetate. The organic layer was dried (anhydrous MgSO ₄ ) and evaporated to give 16 g of 2'-acetoxy-5'-O- (DMT) -3'-O- (2-methoxyethyl) -5-methyluridine. To an ice-cold solution of triazole (19.9 g) in triethylamine (50 ml) and acetonitrile (150 ml) was added dropwise 9 ml of POCl ₃ with mechanical stirring. After the addition, the ice bath was removed and the mixture was stirred for 30 minutes. The 2'-acetoxy-5'-O- (DMT) -3'-O- (2-methoxyethyl) -5-methyluridine (16 g in 50 mL CH ₃ CN) was added dropwise to the above solution with the acceptor Piston was kept at ice bath temperatures. After 2 h, TLC indicated a faster moving nucleoside, C-4 triazole derivative. The contents of the reaction flask were evaporated and the nucleoside partitioned between ethyl acetate (500 ml) and NaHCO ₃ (500 ml). The organic layer was washed with saturated NaCl solution, dried (anhydrous MgSO ₄ ) and evaporated to give 15 g of C-4 triazole nucleoside. This compound was then dissolved in a 2: 1 mixture of NH ₄ OH / dioxane (100 ml: 200 ml) and stirred overnight. TLC indicated the disappearance of the starting material. The solution was evaporated and dissolved in methanol; 9.6 g of 5'-O- (DMT) -3'-O- (2-methoxyethyl) -5-methylcytidine crystallized out. 5'-O-DMT-3'-O- (2-methoxyethyl) -5-methylcytidine (9.6 g, 0.015 mol) was dissolved in 50 ml of DMF and treated with 7.37 g of benzoic anhydride. After stirring for 24 h, DMF was evaporated and the residue was loaded onto a silica column and eluted with 1: 1 hexane / ethyl acetate to give the desired nucleoside.

EXAMPLE 4

5'-O-DMT-3'-O- (2-methoxyethyl) -N ⁴ -benzoyl-5-methylcytidine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

5'-O-DMT-3'-O- (2-methoxyethyl) -N ⁴ -benzoyl-5-methylcytidine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite was prepared from the above nucleoside Use of the Phosphitylierungsvorschrift given for the corresponding 5-methyluridine derivative obtained.

EXAMPLE 5

N ⁶ -Benzoyl-5'-O- (DMT) -3'-O- (2-methoxyethyl) adenosine

A solution of adenosine (42.74 g, 0.16 mol) in dry dimethylformamide (800 ml) at 5 ° C was washed with sodium hydride (8.24 g, 60% in oil, washed 3 times with Hexanes, 0.21 mol). After stirring for 30 minutes, the mixture was stirred for 20 2-methoxyethyl bromide (0.16 mol) was added. The reaction mixture was 8 h at 5 ° C touched, then filtered through Celite. The filtrate was concentrated under reduced pressure The reaction was concentrated by evaporation, followed by coevaporation with toluene (2 × 100 ml). The residue was adsorbed on silica gel (100 g) and chromatographed (800 g, chloroform-methanol 9: 14: 1). Selected fractions were added concentrated and the residue was a mixture of 2'-O- (2- (methoxyethyl) adenosine and 3'-O- (2-methoxyethyl) adenosine in relation to from 4: 1.

The above mixture (0.056 mol) in pyridine (100 ml) was evaporated to dryness under reduced pressure. The residue was redissolved in pyridine (560 ml) and cooled in an ice-water bath. Trimethylsilyl chloride (36.4 mL, 0.291 mol) was added and the reaction stirred at 5 ° C for 30 min. Benzoyl chloride (33.6 mL, 0.291 mol) was added and the reaction was allowed to warm to 25 ° C for 2 h and then cooled to 5 ° C. The reaction mixture was diluted with cold water (112 ml) and, after stirring for 15 min, concentrated ammonium hydroxide (112 ml) was added. After 30 minutes, the reaction mixture was concentrated under reduced pressure (below 30 ° C), followed by coevaporation with toluene (2 x 100 mL). The residue was dissolved in ethyl acetate-methanol (400 ml, 9: 1) and the undesired silyl by-products were removed by filtration. The filtrate was concentrated under reduced pressure and then chromatographed on silica gel (800 g, 9: 1 chloroform-methanol). Selected fractions were pooled, concentrated under reduced pressure and dried at 25 ° C / 0.2 mm Hg for 2 hours to give pure N ⁶ -benzoyl-2'-O- (2-methoxyethyl) adenosine and pure N ⁶ -benzoyl -3'-O- (2-methoxyethyl) adenosine.

A solution of N ⁶ -benzoyl-3'-O- (2-methoxyethyl) adenosine (11.0 g, 0.285 mol) in pyridine (100 mL) was evaporated under reduced pressure to an oil. The residue was redissolved in dry pyridine (300 mL) and DMT-Cl (10.9 g, 95%, 0.31 mol) added. The mixture was stirred for 16 h at 25 ° C and then poured onto a solution of sodium bicarbonate (20 g) in ice-water (500 ml). The product was extracted with ethyl acetate (2 x 150 ml).

The organic layer was washed with brine (50 ml) over sodium sulfate (powdered) and evaporated under reduced pressure (below 40 ° C). The residue was on silica gel (400 g, ethyl acetate-acetonitrile-triethylamine 99: 1: 195: 5: 1) Chromatograph. Selected Fractions were pooled, concentrated under reduced pressure and at 25 ° C / 0.2 dried dried to give 16.8 g (73%) of the title compound as a foam. The TLC shows homogeneity.

EXAMPLE 6

[N ⁶ -benzoyl-5'-O- (DMT) -3'-O- (2-methoxyethyl) adenosine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

The title compound was prepared in the same manner as the 5-methyl-cytidine and 5-methyl-uridine analogues of Examples 2 and 4 starting from the title compound of Example 5. Purification using ethyl acetate-hexanes-triethylamine 59: 40: 1 as the chromatography eluant gave a 67% yield of the title compound as a solid foam. The TLC showed homogeneity. ³¹ P-NMR (CDCl ₃ , H ₃ PO ₄ h) δ 147.89; 148,36 (diastereomers).

EXAMPLE 7

5'-O- (DMT) -N ² -isobutyryl-3'-O- (2-methoxyethyl) guanosine

A. 2,6-diaminopurine riboside

Guanosine hydrate (100 g, 0.35 mol, Aldrich), hexamethyldisilazane (320 mL, 1.52 mol, 4.4 eq.), Trimethylsilyl trifluoromethanesulfonate (8.2 mL.) Were added to a 2 L stainless steel Parr bomb ) and toluene (350 ml). The bomb was capped and partially submerged in an oil bath (170 ° C, 150 ° C internal temp., 150 psi) for 5 days. The bomb was cooled in a dry ice / acetone bath and opened. The contents were transferred to a flask with methanol (300 ml) and the solvent evaporated under reduced pressure. Aqueous methanol (50%, 1.2 L) was added. The resulting brown suspension was refluxed for 5 hours. The suspension was concentrated under reduced pressure to half the volume to remove most of the methanol. Water (600 ml) was added and the solution heated to reflux, treated with charcoal (5 g) and filtered hot through celite. The solution was allowed to cool to 25 ° C. The resulting precipitate was collected, washed with water (200 ml) and dried for 5 hours at 90 ° C / 0.2 mm Hg to yield 87.4 g (89%) of a light brown crystalline solid; Mp 247 ° C (shrinks), 255 ° C (dec., Lit. (1) mp 250-252 ° C); TLC homogeneous (R _f 0.50, isopropanol-ammonium hydroxide-water 16: 3: 1); PMR (DMSO), δ 5.73 (d, 2, 2-NH ₂ ), 5.78 (s, 1, H-1), 6.83 (br s, 2.6-NH ₂ ).

B. 2'-O- (2-methoxyethyl) -2,6-diaminopurine riboside and 3'-O- (2-methoxyethyl) -2,6-diaminopurine riboside

To a solution of 2,6-diaminopurine riboside (10.0 g, 0.035 mol) in dry dimethylformamide (350 ml) at 0 ° C under an argon atmosphere was sodium hydride (60% in oil, 1.6 g, 0.04 mol). After 30 minutes, 2-methoxyethyl bromide (0.44 mol) in a Portion was added and the reaction mixture stirred at 25 ° C for 16 h. methanol (10 ml) was added and the mixture was added under reduced pressure an oil (20 g) concentrated. The crude product containing the 2 '/ 3' isomers in a relationship 4: 1, was chromatographed on silica gel (500 g, 4: 1 chloroform-methanol). The appropriate fractions were pooled and concentrated under reduced pressure Compressed to a semi-solid (12 g). This was with methanol (50 ml) to give a white hygroscopic solid. The solid was at 40 ° C / 0.2 dried for 6 h and gave a pure 2'-product and the pure 3'-isomer, which by means of NMR confirmed were.

C. 3'-O-2- (methoxyethyl) guanosine

3'-O- (2-Methoxyethyl) -2,6-diaminopurine riboside (0.078 mol) was added with rapid stirring in monobasic sodium phosphate buffer (0.1 M, 525 mL, pH 7.3 to 7.4) at 25 ° C solved. Adenosine deaminase (Sigma type II, 1 unit / mg, 350 mg) was added and the reaction mixture was stirred at 25 ° C for 60 hours. The mixture was cooled to 5 ° C and filtered. The solid was washed with water (2 x 25 mL) and dried at 60 ° C / 0.2 mm Hg for 5 h to give 10.7 g of a first amount of material. A second amount of material was obtained by concentrating the mother liquors under reduced pressure to 125 ml, cooling to 5 ° C, collecting the solid, washing with cold water (2 x 20 ml) and drying as above to give 6.7 g of additional material in total 15.4 g (31% of guanosine hydrate) of dark yellow solid; TLC purity 97%.

D. N ² -isobutyryl-3'-O-2- (methoxyethyl) guanosine

To a solution of 3'-O-2- (methoxyethyl) guanosine (18.1 g, 0.0613 mol) in pyridine (300 mL) became trimethylsilyl chloride (50.4 ml, 0.46 mol). The reaction mixture was for 16 h at 25 ° C touched. Isobutyryl chloride (33.2 mL, 0.316 mol) was added and the reaction mixture 4 h at 25 ° C touched. The The reaction mixture was diluted with water (25 ml). After stirring for 30 minutes Ammonium hydroxide (concentrated, 45 ml) was added until a pH was reached by 6. The mixture was placed in a water bath for 30 minutes touched and then evaporated under reduced pressure to an oil. The oil was suspended in a mixture of ethyl acetate (600 ml) and water (100 ml), until there is a solution formed. The solution was 17h at 25 ° C leave. The resulting precipitate was collected, with Ethyl acetate (2 x 50 ml) and dried at 60 ° C / 0.2 mm Hg for 5 hours to give 16.1 g (85%) of a light brown solid; TLC purity 98%.

E. 5'-O- (DMT) -N ² -isobutyryl-3'-O- (2-methoxyethyl) guanosine

A solution of N ² -isobutyryl-3'-O-2- (methoxyethyl) guanosine (0.051 mol) in pyridine (150 ml) was evaporated to dryness under reduced pressure. The residue was redissolved in pyridine (300 ml) and cooled to 10 to 15 ° C. DMT-Cl (27.2 g, 95%, 0.080 mol) was added and the reaction was stirred at 25 ° C for 16 h. The reaction mixture was concentrated under reduced pressure to an oil, dissolved in a minimum of methylene chloride and placed on a silica gel column (500 g). The product was eluted with a gradient of methylene chloride-triethylamine (99: 1) to methylene chloride-methanol-triethylamine (99: 1: 1). Selected fractions were pooled, concentrated under reduced pressure and dried at 40 ° C / 0.2 mm Hg for 2 hours to yield 15 g (15.5% of guanosine hydrate) of light brown foam; TLC purity 98%.

EXAMPLE 8

[5'-O- (DMT) -N ² -isobutyryl-3'-O- (2-methoxyethyl) guanosine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

The protected nucleoside of Example 7 (0.0486 mol) was placed in a dry 1 L round bottom flask containing a Teflon stir bar. The flask was purged with argon. Anhydrous methylene chloride (400 ml) was cannulated into the flask to dissolve the nucleoside. Previously vacuum-dried N, N-diisopropylaminohydrotetrazolide (3.0 g, 0.0174 mol) was added under argon. With stirring, bis-N, N-diisopropyl-aminocyanoethyl phosphoramidite (18.8 g, 0.0689 mol) was added via syringe over 1 min (no heat evolution detected). The reaction mixture was stirred under argon for 16 h at 25 ° C. After TLC confirmed the completeness of the reaction, the reaction mixture was transferred to a separatory funnel (1 L). The reaction flask was rinsed with methylene chloride (2 x 50 mL). The combined organic layer was washed with saturated aqueous sodium bicarbonate (200 ml) and then with brine (200 ml). The organic layer was dried over sodium sulfate (50 g, powdered) for 2 hours. The solution was filtered and concentrated under reduced pressure to a viscous oil. The resulting phosphoramidite was purified by silica gel flash chromatography (800 g, ethyl acetate-triethylamine 99: 1). Selected fractions were pooled, concentrated under reduced pressure and dried at 25 ° C / 0.2 mm Hg for 16 h to give 18.0 g (46%, 3% guanosine hydrate) of TLC homogeneous solid foam. ³¹ P-NMR (CDCl ₃ , H ₃ PO ₄ h) δ 147.96; 148.20 (diastereomers).

EXAMPLE 9 5'-O-DMT-3'-O- (2-methoxyethyl) -5-methyl-uridine-2'-O-succinate

5'-O-DMT-3'-O- (2-methoxyethyl) thymidine was first succinylated in the 2'-position. Thymidine nucleoside (4 mmol) was reacted with 10.2 ml of dichloroethane, 615 mg (6.14 mmol) of succinic anhydride, 570 μl (4.09 mmol) of triethylamine and 251 mg (2.05 mmol) of 4-dimethylaminopyridine. The reactants were vortexed until dissolved and placed in a 55 ° C heating block for about 30 minutes. The completeness of the reaction was checked by thin layer chromatography (TLC). The reaction mixture was washed three times with cold 10% citric acid, followed by three washes with water. The organic phase was removed and dried under sodium sulfate. Succinylated nucleoside was dried overnight under P ₂ O ₅ in a vacuum oven.

EXAMPLE 10

5'-O-DMT-3'-O-methoxyethyl-5-methyl-uridine-2'-O-succinoyl to LCA-CPG

5'-O-DMT-3'-O- (2-methoxyethyl) -2'-O-succinyl-thymidine was coupled to controlled pore glass (CPG). 1.09 g (1.52 mmol) of the succinate was used together with 4-dimethylaminopyridine (DMAP), 2,2'-dithiobis (5-nitropyridine) (dTNP), triphenylphosphine (TPP) and acid prewashed CPG (porous Glass) in a vacuum oven. After about 24 hours, DMAP (1.52 mmol, 186 mg) and acetonitrile (13.7 ml) were added to the succinate. The mixture was stirred under an argon atmosphere using a magnetic stirrer. In a separate flask, dTNP (1.52 mmol, 472 mg) was dissolved under argon in acetonitrile (9.6 ml) and dichloromethane (4.1 ml). This reaction mixture was then added to the succinate. In another separate flask, TPP (1.52 mmol, 399 mg) was dissolved in acetonitrile (37 ml) under argon. This mixture was then added to the succinate / DMAP / dTNP reaction mixture. Finally, to the main reaction mixture was added 12.23 g acid prewashed LCA-CPG (loading = 115.2 μmol / g), vortexed briefly and attached to the shaker for about 3 hours. The mixture was removed from the shaker after 3 hours and the loading checked. A small sample of CPG was washed with copious amounts of acetonitrile, dichloromethane and then ether. The initial loading was found to be 63 μmol / g (3.9 mg CPG was cleaved with trichloroacetic acid, the absorbance of liberated trityl cation was read at 503 nm in a spectrophotometer to determine the loading). The entire CPG sample was then washed as described above and dried overnight in a vacuum oven under P ₂ O ₅ . The following day, the CPG was capped with 25 ml CAPA (tetrahydrofuran / acetic anhydride) and 25 ml CAP B (tetrahydrofuran / pyridine / 1-methylimidazole) for about 3 hours on the shaker, filtered and washed with dichloromethane and ether. The CPG was dried overnight under P ₂ O ₅ in a vacuum oven. After drying, 12.25 g of CPG were isolated with a final loading of 90 μmol / g.

EXAMPLE 11

3'-O-methoxyethyl-5-methyl-N-benzoyl-cytidine-2'-O-succinate

5'-O-DMT-3'-O- (2-methoxy) ethyl-N-benzoyl-cytidine was first succinylated at the 2'-position. Cytidine nucleoside (4 mmol) was reacted with 10.2 ml dichloroethane, 615 mg (6.14 mmol) succinic anhydride, 570 ul (4.09 mmol) triethylamine, and 251 mg (2.05 mmol) 4-dimethylaminopyridine. The reactants were vortexed until dissolved and placed in a 55 ° C heating block for about 30 minutes. The completeness of the reaction was checked by thin layer chromatography (TLC). The reaction mixture was washed three times with cold 10% citric acid, followed by three washes with water. The organic phase was removed and dried under sodium sulfate. The succinylated nucleoside was dried overnight under P ₂ O ₅ in a vacuum oven.

EXAMPLE 12

5'-O-DMT-3'-O-methoxyethyl-5-methyl-N-benzoyl-cytidine-2'-O-succinoyl to ZCA-CPG

5'-O-DMT-3'-O- (2-methoxyethyl) -2'-O-succinyl-N ⁴ -benzoyl-cytidine was coupled to porous glass (CPG). 1.05 g (1.30 mmol) of the succinate was combined overnight with 4-dimethylaminopyridine (DMAP), 2,2'-dithiobis (5-nitropyridine) (dTNP), triphenylphosphine (TPP) and acid prewashed CPG (porous Glass) in a vacuum oven. The following day, DMAP (1.30 mmol, 159 mg) and acetonitrile (11.7 ml) were added to the succinate. The mixture was "mixed" under argon using a magnetic stirrer In a separate flask, dTNP (1.30 mmol, 400 mg) was dissolved under argon in acetonitrile (8.2 mL) and dichloromethane (3.5 mL) In another separate flask, TPP (1.30 mmol, 338 mg) was dissolved under argon in acetonitrile (11.7 mL) and this mixture was then added to the succinate / DMAP / dTNP reaction mixture 10.46 g acid prewashed LCA-CPG (loading = 115.2 μmol / g) was added to the main reaction mixture, vortexed briefly, and attached to the shaker for about 2 hours A portion was removed from the shaker after 2 hours and a small sample of CPG was washed with copious amounts of acetonitrile, dichloromethane, and then with ether to find that the initial loading was 46 μmol / g (3.4 mg CPG were cleaved with trichloroacetic acid). The absorbance of liberated trityl cation was read at 503 nm in a spectrophotometer to determine the loading. The entire CPG sample was then washed as described above and dried overnight under P ₂ O ₅ in a vacuum oven. The following day, the CPG was capped with 25 ml of CAP A (tetrahydrofuran / acetic anhydride) and 25 ml of CAP B (tetrahydrofuran / pyridine / 1-methylimidazole) on a shaker for about 3 hours. The material was filtered and washed with dichloromethane and ether. The CPG was dried overnight under P ₂ O ₅ in a vacuum oven. After drying 10.77 g CPG were isolated with a final loading of 63 .mu.mol / g.

EXAMPLE 13

5'-O-DMT-3'-O-methoxyethyl-N ⁶ -benzoyl-adenosine-2'-O-succinate

5'-O-DMT-3'-O- (2-methoxyethyl) -N ⁶ -benzoyl-adenosine was first succinylated in the 2'-position. 3.0 g (4.09 mmol) of the adenosine nucleoside were mixed with 10.2 ml of dichloroethane, 615 mg (6.14 mmol) of succinic anhydride, 570 μl (4.09 mmol) of triethylamine and 251 mg (2.05 mmol). 4-dimethylaminopyridine reacted. The reactants were vortexed until dissolved and placed in a 55 ° C heating block for about 30 minutes. The completeness of the reaction was checked by thin layer chromatography (TLC). The reaction mixture was washed three times with cold 10% citric acid, followed by three washes with water. The organic phase was removed and dried under sodium sulfate. Succinylated nucleoside was dried overnight under P ₂ O ₅ in a vacuum oven.

EXAMPLE 14

5'-O-DMT-3'-O- (2-methoxyethyl) -N ⁶ -benzoyl-adenosine-2'-O-succinoyl attached to LCA-CPG

Following succinylation, 5'-O-DMT-3'-O- (2-methoxyethyl) -2'-O-succinyl-N ⁶ -benzoyl-adenosine was coupled to porous glass (CPG). 3.41 g (4.10 mmol) of the succinate were co-overnight with 4-dimethylaminopyridine (DMAP), 2,2'-dithiobis (5-nitro-pyridine) (dTNP), triphenylphosphine (TPP) and acid prewashed CPG (porous glass) dried in a vacuum oven. The following day, DMAP (4.10 mmol, 501 mg) and acetonitrile (37 ml) were added to the succinate. The mixture was "mixed" under argon using a magnetic stirrer In a separate flask, dTNP (4.10 mmol, 1.27 g) was dissolved under argon in acetonitrile (26 ml) and dichloromethane (11 ml) In another separate flask, TPP (4.10 mmol, 1.08 g) was dissolved under argon in acetonitrile (37 mL) and this mixture was then added to the succinate / DMAP / dTNP reaction mixture acid prewashed LCA-CPG (loading = 115.2 μmol / g) was added to the main reaction mixture, briefly vortexed and attached to the shaker for about 20 hours, removed from the shaker after 20 hours, and the loading was checked. A small sample of CPG was washed with copious amounts of acetonitrile, dichloromethane, and then with ether to find that the initial loading was 49 μmol / g (2.9 mg of CPG was cleaved with trichloroacetic acid.) The absorption of liberated tritylkatio n was read at 503 nm in a spectrophotometer to determine the loading. The entire CPG sample was then washed as described above and dried overnight under P ₂ O ₅ in a vacuum oven. The following day, the CPG was capped with 50 ml of CAP A (tetrahydrofuran / acetic anhydride) and 50 ml of CAP B (tetrahydrofuran / pyridine / 1-methylimidazole) on the shaker for about 1 hour. The material was filtered and washed with dichloromethane and ether. The CPG was dried overnight under P ₂ O ₅ in a vacuum oven. After drying, 33.00 g of CPG were obtained with a final loading of 66 μmol / g.

EXAMPLE 15

5'-O-DMT-3'-O- (2-methoxyethyl) -N ² -isobutyryl-guanosine-2'-O-succinate

5'-O-DMT-3'-O- (2-methoxyethyl) -N ² -isobutyryl-guanosine was succinylated in the 2'-sugar position. 3.0 g (4.20 mmol) of the guanosine nucleoside were mixed with 10.5 ml of dichloroethane, 631 mg (6.30 mmol) of succinic anhydride, 585 μl of 4.20 mmol of triethylamine and 257 mg (2.10 mmol) of 4 -Dimethylaminopyridine reacted. The reactants were vortexed until dissolved and placed in a 55 ° C heating block for about 30 minutes. The completeness of the reaction was checked by thin layer chromatography (TLC). The reaction mixture was washed three times with cold 10% citric acid, followed by three washes with water. The organic phase was removed and dried under sodium sulfate. The succinylated nucleoside was dried overnight under P ₂ O ₅ in a vacuum oven.

EXAMPLE 16

5'-O-DMT-3'-O-methoxyethyl-N ² -isobutyryl-guanosine-2'-O-succinoyl attached to LCA-CPG

Following succinylation, 5'-O-DMT-3'-O- (2-methoxyethyl) -2'-O-succinyl-N ² -benzoyl-guanosine was coupled to porous glass (CPG). 3.42 g (4.20 mmol) of the succinate were combined overnight with 4-dimethylaminopyridine (DMAP), 2,2'-dithiobis (5-nitro-pyridine) (dTNP), triphenylphosphine (TPP) and acid prewashed CPG (porous glass) dried in a vacuum oven. The following day, DMAP (4.20 mmol, 513 mg) and acetonitrile (37.5 ml) were added to the succinate. The mixture was "mixed" under argon using a magnetic stirrer In a separate flask, dTNP (4.20 mmol, 1.43 mg) was dissolved under argon in acetonitrile (26 ml) and dichloromethane (11 ml) In another separate flask, TPP (4.20 mmol, 1.10 g) was dissolved under argon in acetonitrile (37.5 mL) and this mixture was then added to the succinate / DMAP / dTNP reaction mixture 33.75 g acid prewashed LCR-CPG (loading = 115.2 μmol / g) was added to the main reaction mixture, vortexed briefly and attached to the shaker for about 20 hours, removed from the shaker after 20 hours, and Charge was checked A small sample of CPG was washed with copious amounts of acetonitrile, dichloromethane and then ether to find that the initial loading was 64 μmol / g (3.4 mg CPG was cleaved with trichloroacetic acid) released Trity The cation was read at 503 nm in a spectrophotometer to determine the loading. The entire CPG sample was then washed as described above and dried overnight under P ₂ O ₅ in a vacuum oven. The following day, the CPG was capped with 50 ml of CAP A (tetrahydrofuran / acetic anhydride) and 50 ml of CAP B (tetrahydrofuran / pyridine / 1-methylimidazole) on the shaker for about 1 hour. The material was filtered and washed with dichloromethane and ether. The CPG was dried overnight under P ₂ O ₅ in a vacuum oven. After drying, 33.75 g of CPG were isolated with a final loading of 72 μmol / g.

EXAMPLE 17

5'-O-DMT-3'-O- [hexyl- (6-phthalimido)] uridine

2 ', 3'-O-Dibutyl-stannylene-uridine was prepared according to the procedure of Wagner et. al., J. Org. Chem., 1974, 39, 24. This compound was dried under vacuum over P ₂ O _{5 for} 12 hours. To a solution of this compound (29 g, 42.1 mmol) in 200 ml of dry DMF was added (16.8 g, 55 mmol) of 6-bromohexyl phthalimide and 4.5 g of sodium iodide, and the mixture was allowed to stand for 16 hours Heated to 130 ° C under argon. The reaction mixture was evaporated, coevaporated once with toluene, and the gummy tar residue was applied to a silica column (500 g). The column was washed with 2 L of EtOAc, followed by elution with 10% methanol (MeOH): 90% EtOAc. The product, 2'- and 3'-isomers of O-hexyl-6-N-phthalimidouridine, eluted as an inseparable mixture (R _f = 0.64 in 10% MeOH in EtOAc). The isomer ratio according to ¹³ C-NMR was about 55% 2'-isomer and about 45% 3'-isomer. The combined yield was 9.2 g (46.2%). This mixture was dried under vacuum and re-evaporated twice with pyridine. It was dissolved in 150 ml of anhydrous pyridine and treated with 7.5 g of DMT-Cl (22.13 mmol) and 500 mg of dimethylaminopyridine (DMAP). After 2 hours, thin layer chromatography (TLC, 6: 4 EtOAc: hexanes) indicated complete disappearance of the starting material and good separation between the 2'- and 3'-isomers (R _f = 0.29 for the 2'-isomer and 0.12 for the 3'-isomer). The reaction mixture was quenched by the addition of 5 mL of CH ₃ OH and evaporated under reduced pressure. The residue was dissolved in 300 ml CH ₂ Cl ₂ , washed successively with saturated NaHCO ₃ solution, followed by saturated NaCl solution. It was dried over Mg ₂ SO ₄ and evaporated to give 15 g of a brown foam which was purified on silica gel (500 g) to give 6.5 g of the 2'-isomer and 3.5 g of the 3'-isomer.

EXAMPLE 18

5'-O-DMT-3'-O- [hexyl- (6-phthalimido)] uridine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

5'-DMT-3'-O- [hexyl- (6-phthalimido)] uridine (2 g, 2.6 mmol) was dissolved in 20 mL anhydrous CH ₂ Cl ₂ . To this solution was added diisopropylaminotetrazolide (0.2 g, 1.16 mmol) and 2.0 ml of 2-cyanoethyl-N, N, N ', N'-tetraisopropylphosphoramidite (6.3 mmol), and it was stirred overnight , TLC (1: 1 EtOAc / hexane) indicated complete disappearance of the starting material. The reaction mixture was transferred with CH ₂ Cl ₂ and washed with saturated NaHCO ₃ solution (100 ml) followed by saturated NaCl solution. The organic layer was dried over anhydrous Na ₂ SO ₄ and evaporated to give 3.8 g of a crude product which was purified in a silica column (200 g) using 1: 1 hexane / EtOAc and 1.9 g (1.95 mmol, 74% yield) of the desired phosphoramidite.

EXAMPLE 19

Preparation of 5'-O-DMT-3'-O- [hexyl (6-phthalimido)] uridine-2'-O-succinoyl-aminopropyl-CPG

Succinylated and capped aminopropyl porous glass (CPG, pore diameter 500 Å, aminopropyl-CPG, 1.0 gram prepared according to Damha et al., Nucl. Acids Res. 1990, 18, 3.813) was added to 12 ml of anhydrous pyridine in one 100 ml round bottom flask. 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide (DEC, 0.38 grams, 2.0 mmol), triethylamine (TEA, 100 μL, distilled over CaH ₂ ), dimethylaminopyridine (DMAP, 0.012 grams, 0.1 mmol) and nucleoside 5'-O-DMT-3'-O- [hexyl- (6-phthalimido)] uridine (0.6 grams, 0.77 mmol) was added under argon and the mixture was mechanically shaken for 2 hours. Additional nucleoside (0.20 grams) was added and the mixture was shaken for 24 hours. The CPG was filtered off and washed successively with dichloromethane, triethylamine and dichloromethane. The CPG was then dried under vacuum, suspended in 10 ml of piperidine and shaken for 15 minutes. The CPG was filtered off, washed thoroughly with dichloromethane and again dried under vacuum. The level of loading (determined by spectrophotometric assays of the DMT cation in 0.3 M p-toluenesulfonic acid at 498 nm) was about 28 μmol / g. The 5'-O- (DMT) -3'-O- [hexyl (6-phthalimido) uridine-2'-O-succinyl-aminopropyl porous glass was used to synthesize the oligomers using the standard phosphoramidite chemistry conditions DNA synthesizer ABI 380B A four-base oligomer, 5'-GACU * -3 ', was used to confirm the structure of the 3'-O-hexylamine inserter introduced into the oligonucleotide by NMR. As expected, ¹ H NMR detected a multiplet signal between 1.0 and 1.8 ppm.

EXAMPLE 20

5'-O-DMT-3'-O- [hexylamino] -uridine

5'-O- (DMT) -3'-O- [hexyl- (6-phthalimido)] uridine (4.5 grams, 5.8 mmol) is dissolved in 200 ml of methanol in a 500 ml flask. Hydrazine (1 mL, 31 mmol) is added to the reaction mixture with stirring. The mixture is heated in an oil bath at 60 to 65 ° C and heated under reflux for 14 hours. The solvent is evaporated in vacuo and the residue is dissolved in dichloromethane (250 ml) and extracted twice with an equal volume of NH ₄ OH. The organic layer is evaporated to yield the crude product whose NMR indicates that it is not completely pure. R _f = 0 in 100% ethyl acetate. The product is used without further purification in subsequent reactions.

EXAMPLE 21

3'-O- [propyl- (3-phthalimido)] - adenosine

To a solution of adenosine (20.0 g, 75 mmol) in dry dimethylformamide (550 mL) at 5 ° C was added sodium hydride (60% oil, 4.5 g, 112 mmol). After one hour, N- (3-bromopropyl) phthalimide (23.6 g, 86 mmol) was added and the temperature raised to 30 ° C and maintained for 16 hours. Ice is added and the solution is evaporated under vacuum to a gum. The gum was partitioned between water and ethyl acetate (4 x 300 mL). The organic phase was separated, dried and evaporated in vacuo and the resulting gum chromatographed on silica gel (95/5 CH ₂ Cl ₂ / MeOH) to give a white solid (5.7 g) of 2'-O- (propylphthalimide ) adenosine. The fractions containing the 3'-O- (propylphthalimido) adenosine were chromatographed a second time on silica gel using the same solvent system.

Crystallization of the 2'-O- (propylphthalimido) adenosine fractions from methanol gave a crystalline solid, m.p. 123-124 ° C. ¹ H-NMR (400 MHz: DMSO-d ₆ ) δ 1.70 (m, 2H, CH ₂ ), 3.4-3.7 (m, 6H, C _{5 '} , CH ₂ , OCH ₂ , Phth CH _2), 3.95 (q, 1H, C _{4 'H),} 4.30 (q, 1H, C _5' H), 4.46 (t, 1H, _{C2 'H),} 5.15 (d , 1H, C _{3 '} OH), 5.41 (t, 1H, C _5' OH), 5.95 (d, 1H, C _{1 '} H) 7.35 (s, 2H, NH ₂ ), 7, 8 (brs, 4H, Ar), 8.08 (s, 1H, C ₂ H) and 8.37 (s, 1H, C ₈ H). Anal. calculated C ₂₁ H ₂₂ N ₆ O _6: C, 55.03; H, 4,88; N, 18,49. Found: C, 55.38; H, 4.85; N, 18.46.

Crystallization of the 3'-O- (propylphthalimido) adenosine fractions from H ₂ O gave an analytical sample, mp 178-179 ° C. ¹ H-NMR (400 MHz: DMSO-d ₆ ) δ 5.86 (d, 1H, H-1 ').

EXAMPLE 22

3'-O- [propyl- (3-phthalimido)] - N ⁶ -benzoyl-adenosine

3'-O- (3-propylphthalimide) adenosine is treated with benzoyl chloride in a manner that is functional by Gaffney et al., Tetrahedron Lett. 1982, 23, 2.257. Purification of the crude material by chromatography on silica gel (Ethyl acetate-methanol) gives the title compound.

EXAMPLE 23

3'-O- [Propyl- (3-phthalimido)] - 5'-O-DMT-N ⁶ -benzoyl-adenosine

To a solution of 3'-O- (propyl-3-phthalimido) -N ⁶ -benzoyladenosine (4.0 g) in pyridine (250 ml) is added DMT-Cl (3.3 g). The reaction mixture is stirred for 16 h. The reaction mixture is added to ice / water / ethyl acetate, the organic layer is separated, dried and concentrated in vacuo, the resulting gum is chromatographed on silica gel (ethyl acetate-methanol-triethylamine) to give the title compound.

EXAMPLE 24

3'-O- [Propyl- (3-phthalimido)] - 5'-O-DMT-N ⁶ -benzoyl-adenosine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

3'-O- (Propyl-3-phthalimido) -5'-O-DMT-N ⁶ -benzoyladenosine is treated with (β-cyanoethoxy) chloro-N, N-diisopropyl) aminophosphine in a manner analogous to the procedure of Seela , et al., Biochemistry 1987, 26, 2.233. Chromatography on silica gel (EtOAc / hexane) gives the title compound as a white foam.

EXAMPLE 25

3'-O- (Aminopropyl) -adenosine

A solution of 3'-O- (propyl-3-phthalimide) adenosine (8.8 g, 19 mmol), 95% ethanol (400 ml) and hydrazine (10 ml, 32 mmol) is stirred for 16 h at room temperature. The reaction mixture is filtered and the filtrate concentrated under vacuum. It's going to be water (150 ml) and acidified to pH 5.0 with acetic acid. The aqueous solution is washed with EtOAc (2 × 30 ml), and the aqueous Phase is concentrated in vacuo to give the title compound as a HOAc salt.

EXAMPLE 26

3'-O- [3- (N-trifluoroacetamido) propyl] adenosine

A solution of 3'-O- (propylamino) adenosine in methanol (50 ml) and triethylamine (15 ml, 108 mmol) is washed with Ethyl trifluoroacetate (18 mL, 151 mmol). The reaction mixture is stirred for 16 h and then concentrated under vacuum, and the resulting gum becomes on silica gel (9/1, EtOAc-MeOH) and gives the Title compound.

EXAMPLE 27

N ⁶ -dibenzoyl-3'-O- [3- (N-trifluoroacetamido) propyl] adenosine

3'-O- [3- (N-trifluoroacetamido) propyl] adenosine becomes according to example 22 using a Jones modification treated with Working up tetrabutylammonium fluoride instead of ammonium hydroxide is used. The crude product is purified using silica gel chromatography (EtOAc / MeOH 1/1) to give the title compound.

EXAMPLE 28

N ⁶ -dibenzoyl-5'-O-DMT-3'-O- [3- (N-trifluoroacetamido) propyl] adenosine

DMT-Cl (3.6 g, 10.0 mmol) is added to a solution of N ⁶ - (dibenzoyl) -3'-O- [3- (N-trifluoroacetamido) propyl) adenosine in pyridine (100 mL) at room temperature and stirred for 16 h. The solution is concentrated in vacuo and chromatographed on silica gel (EtOAc / TEA 99/1) to give the title compound.

EXAMPLE 29

N ⁶ -dibenzoyl-5'-O-DMT-3'-O- [3- (N-trifluoroacetamido) propyl] adenosine 2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

A solution of N ⁶ - (dibenzoyl) -5'-O- (DMT) -3'-O- [3- (N-trifluoroacetamido) propyl] adenosine in dry CH ₂ Cl ₂ is treated with bis-N, N-diisopropylamino cyanoethyl phosphite (1.1 eq.) and N, N-diisopropylaminotetrazolide (catalytic amount) at room temperature for 16 h. Concentrate the reaction under vacuum and chromatograph on silica gel (EtOAc / hexane / TEA 6/4/1) to give the title compound.

EXAMPLE 30

3'-O- (Butylphthalimido) adenosine

The title compound is prepared according to Example 21 using N- (4-bromobutyl) phthalimide instead of 1-bromopropane. Chromatography on silica gel (EtOAc / MeOH) gives the title compound; ¹ H-NMR (200 MHz, DMSO-d ₆ ) δ 5.88 (d, 1H, C ₁ H).

EXAMPLE 31

N ⁶ -benzoyl-3'-O- (butylphthalimido) -adenosine

The Benzoylation of 3'-O- (butylphthalimide) adenosine according to example 22 gives the title compound.

EXAMPLE 32

N ⁶ -Benzoyl-5'-O-DMT-3'-O- (butylphthalimido) -adenosine

The title compound is prepared from 3'-O- (butylphthalimide) -N ⁶ -benzoyladenosine according to Example 22.

EXAMPLE 33

N ⁶ -Benzoyl-5'-o-DMT-3'-O- (butylphthalimido) -adenosine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

The title compound is prepared from 3'-O- (butylphthalimide) -5'-O-DMT-N ⁶ -benzoyladenosine according to Example 24.

EXAMPLE 34

3'-O- (Pentylphthalimido) adenosine

The title compound is prepared according to Example 21 using N- (5-bromopentyl) phthalimide. The crude from the extraction is chromatographed on silica gel using CHCl ₃ / MeOH (95/5) to give a mixture of the 2 'and 3' isomers. The 2'-isomer is recrystallized from EtOH / MeOH 8/2. The mother liquor is rechromatographed on silica gel to give the 3 'isomer. 2'-O- (pentylphthalimido) adenosine: mp 159-160 ° C. Anal. calculated for C ₂₃ H ₂₄ N ₆ O _5: C, 57.26; H, 5:43; N, 17.42. Found: C, 57.03; H, 5:46; N, 17,33. 3'-O- (pentylphthalimido) adenosine: ¹ H-NMR (DMSO-d ₆ ) δ 5.87 (d, 1H, H-1 ').

EXAMPLE 35

N ⁶ -Benzoyl-3'-O- (pentylphthalimido) -adenosine

The Benzoylation of 3'-O- (pentylphthalimido) adenosine will according to the way of working Example 22 gives and gives the title compound.

EXAMPLE 36

N ⁶ -Benzoyl-5'-O-DMT-3'-O- (pentylphthalimido) -adenosine

The title compound is prepared from 3'-O- (pentylphthalimide) -N ⁶ -benzoyladenosine according to the procedure of Example 23. Chromatography on silica gel (ethyl acetate, hexane, triethylamine) gives the title compound.

EXAMPLE 37

N ⁶ -Benzoyl-5'-O-DMT-3'-O- (pentylphthalimido) -adenosine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

The title compound is prepared from 3'-O- (pentylphthalimide) -5'-O- (DMT) -N ⁶ -benzoyladenosine according to the procedure of Example 24 to give the title compound.

EXAMPLE 38

3'-O- (Propylphthalimido) uridine

A solution of the uridine-tin complex (48.2 g, 115 mmol) in dry DMF (150 mL) and N- (3-bromopropyl) phthalimide (46 g, 172 mmol) was heated to 130 ° C for 6 h. The crude product was chromatographed directly on silica gel (CHCl ₃ / MeOH 95/5). The isomer ratio of 2 'to 3' of the purified mixture was 81/19. The 2'-isomer was recovered by crystallization from MeOH. The filtrate was rechromatographed on silica gel using CHCl ₃ / MeOH (95/5) to give the 3 'isomer as a foam. 2'-O- (Propylphthalimide) uridine: Analyte sample recrystallized from MeOH, mp 165.5-166.5 ° C, ¹ H-NMR (200 MHz, DMSO-d ₆ ) δ 1.87 (m, 2H, CH ₂ ), 3.49-3.65 (m, 4H, C _{2 '} H), 3.80-3.90 (m, 2H, C _3' H ₁ C _{4 '} H), 4.09 (m, 1H, C _{2 '} H), 5.07 (d, 1h, C _3' OH), 5.16 (m, 1H, C _{5 '} OH), 5.64 (d, 1H, CH =), 7, 84 (d, 1H, C _{1 '} H), 7.92 (bs, 4H, Ar), 7.95 (d, 1H, CH =), and 11.33 (s, 1H, ArNH). Anal. calcd C ₂₀ H ₂₁ N ₃ H ₈ , C, 55.69; H, 4.91; N, 9,74. Found: C, 55.75; H, 5:12; N, 10.01. 3'-O- (Propylphthalimide) uridine: ¹ H-NMR (DMSO-d ₆ ) δ 5.74 (d, 1H, H-1 ').

EXAMPLE 39

3'-O- (Aminopropyl) -uridine

The Title compound is according to the procedure prepared from Example 25.

EXAMPLE 40

3'-O- [3- (N-trifluoroacetamido) propyl] -uridine

3'-O- (propylamino) uridine will according to the way of working of Example 26 to give the title compound.

EXAMPLE 41

5'-O-DMT-3'-O- [3- (N-trifluoroacetamido) propyl] -uridine

3'-O- [3- (N-trifluoroacetamido) propyl] uridine will according to the way of working of Example 28 to give the title compound.

EXAMPLE 42

5'-O-DMT-3'-O- [3- (N-trifluoroacetamido) propyl] -uridine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

5'-O- (DMT) -3'-O- [3- (N-trifluoroacetamido) propyl] uridine will according to the way of working of Example 29 to give the title compound.

EXAMPLE 43

3'-O- (Propylphthalimido) -cytidine

The Title compounds were according to the procedure of Example 21.

2'-O- (Propylphthalimide) cytidine: ¹ H-NMR (200 MHz, DMSO-d ₆ ) δ 5.82 (d, 1H, C ₁ H).

3'-O- (Propylphthalimide) cytidine: ¹ H-NMR (200 MHz, DMSO-d ₆ ) δ 5.72 (d, 1H, C ₁ H).

EXAMPLE 44

3'-O- (Aminopropyl) -cytidine

3'-O- (propylphthalimide) cytidine will according to the way of working of Example 25 to give the title compound.

EXAMPLE 45

3'-O- [3- (N-trifluoroacetamido) propyl] -cytidine

3'-O- (propylamino) cytidine will according to the way of working of Example 26 to give the title compound.

EXAMPLE 46

N ⁴ -Benzoyl-3'-O- [3- (N-trifluoroacetamido) propyl] -cytidine

3'-O- [3- (N-trifluoroacetamido) propyl] cytidine will according to the way of working of Example 27 to give the title compound.

EXAMPLE 47

N ⁴ -Benzoyl-5'-O-DMT-3'-O- [3- (N-trifluoroacetamido) propyl] -cytidine

N ⁴ - (Benzoyl) -3'-O- [3- (N-trifluoroacetamido) propyl] -cytidine is treated according to the procedure of Example 28 to give the title compound.

EXAMPLE 48

N ⁴ -Benzoyl-5'-O-DMT-3'-O- [3- (N-trifluoroacetamido) propyl] -cytidine-2'-O- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

N ⁴ - (Benzoyl) -5'-O- (DMT) -3'-O- [3- (N -trifluoroacetamido) propyl] cytidine is treated according to the procedure of Example 29 to give the title compound.

EXAMPLE 49

General Working methods for the oligonucleotide synthesis

Oligonucleotides were synthesized in a Nucleic Acid Synthesis System Perseptive Biosystems Expedite 8901. Several 1 μmol syntheses were performed for each oligonucleotide. Trityl groups were removed with trichloroacetic acid (975 μl for one minute), followed by acetonitrile washing. All Stan dard amidites (0.1 M) were coupled twice per cycle (the total coupling time was about 4 minutes). All new amidites were dissolved in dry acetonitrile (100 mg amidite / 1 mL acetonitrile) to give about 0.08 to 0.1 M solutions. The total coupling time was about 6 minutes (105 μl supplied amidite). 1-H-tetrazole in acetonitrile was used as the activating agent. Excess amidite was washed away with acetonitrile. (1S) - (+) - (10-camphorsulfonyl) oxaziridine (CSO, 1.0 g CSO / 8.72 mL dry acetonitrile) was used to oxidize phosphodiester bonds (4 minute wait step), whereas 3H-1 , 2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent, 3.4 g Beaucage reagent / 200 ml acetonitrile) was used to oxidize phosphorothioate bonds (1-minute waiting step). Unreacted functionalities were capped with a 50:50 mixture of tetrahydrofuran / acetic anhydride and tetrahydrofuran / pyridine / 1-methylimidazole. The trityl yields were monitored by the trityl monitor for the duration of the synthesis. The final DMT group was left intact. The oligonucleotides were deprotected in 1 ml of 28.0 to 30% ammonium hydroxide (NH ₄ OH) for about 16 hours at 55 ° C. Oligonucleotides were also made on a larger scale (20 μmol / synthesis). Trityl groups were removed with just over 8 ml of trichloroacetic acid. All standard amidites (0.1 M) were coupled twice per cycle (13-minute coupling step). All new amidites were also coupled four times per cycle, but the coupling time was increased to about 20 minutes (feeding 480 μl amidite). The oxidation times remained the same, but the oxidizer supply increased to about 1.88 ml per cycle. Oligonucleotides were deprotected in 5 ml of 28.0 to 30% NH ₄ OH for about 16 hours at 55 ° C.

Table I 3'-O- (2-methoxyethyl) -containing, 2'-5'-linked oligonucleotides

• ¹ All starred nucleosides contain 3'-O- (2-methoxyethyl).

EXAMPLE 50

General working method for purification of oligonucleotides

Following the cleavage and deprotection steps, crude oligonucleotides (such as those synthesized in Example 49) were prepared using 0.45 μm nylon acrodisc gas Filtered by Gelman filtered from the CPG. Excess NH ₄ OH was evaporated in a Savant AS160 Automatic Speedvac. Crude yield was measured in a Hewlett Packard diode array spectrophotometer 8452A at 260 nm. Raw samples were then analyzed in a Hewlett Packard mass spectrometric electrospray mass spectrometer (MS) and in a Beckman P / ACE 5000 system by capillary gel electrophoresis (CGE). Trityl on oligonucleotides were purified by preparative reverse phase high performance liquid chromatography (HPLC). The HPLC conditions were as follows: Waters 600E with detector 991; Column Waters Delta Pak C4 (7.8 × 300 mm); Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; B: 100% acetonitrile; Flow rate 2.5 ml / min; Gradient: 5% B during the first five minutes, with a linear increase from B to 60% during the next 55 minutes. Larger oligo yields from the larger 20 μmol syntheses were purified on larger HPLC columns (Waters Bondapak HC18HA) and the flow rate was increased to 5.0 ml / min. Appropriate fractions were collected and solvent dried off in Speedvac. The oligonucleotides were detritylated in 80% acetic acid for about 45 minutes and lyophilized again. Free trityl and excess salt were removed by adding the detritylated oligonucleotides through Sephadex G-25 (size exclusion chromatography) and collecting appropriate samples using a Pharmacia fraction collector. The solvent was again evaporated in a Speedvac. The purified oligonucleotides were then analyzed for purity by CGE, HPLC (flow rate 1.5 ml / min, Waters Delta Pak C4 column, 3.9 x 300 mm) and MS. The final yield was determined by means of a spectrophotometer at 260 nm.

Table II Physical characteristics of 3'-O- (2-methoxyethyl) -containing 2'-5'-linked oligonucleotides

• ² conditions: Waters 600E with detector 991; Waters C4 column (3.9 x 300 mm); Solvent A: 50 mM TEA-Ac, pH 7.0; B: 100% acetonitrile; Flow rate 1.5 ml / min; Gradient: 5% B during the first five minutes, with a linear increase from B to 60% during the next 55 minutes.

EXAMPLE 51

Studies of T _m modified oligonucleotides

Oligonucleotides synthesized in Examples 49 and 50 were evaluated for relative ability by their melting temperature (T _m ), their complementary nucleic acids to bind. The melting temperature (T _m ), a characteristic physical property of double helices, refers to the temperature (in degrees Celsius) at which 50% helical (hybridized) to ball forms (unhybridized) are present. T _m is measured using the UV spectrum to determine the formation and decay (melting) of the hybridization complex. Base stacking, which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity). Thus, a reduction in UV absorption indicates a higher T _m . The higher the T _m , the greater the strength of the bonds between the strands.

Selected test oligonucleotides and their complementary nucleic acids were incubated at a standard concentration of 4 μM for each oligonucleotide in buffer (100 mM NaCl, 10 mM sodium phosphate, pH 7.0, 0.1 mM EDTA). The samples were heated to 90 ° C and the initial absorbance was monitored using a Guilford Response II spectrophotometer (Corning). The samples were then cooled slowly to 15 ° C, and then the change in absorbance at 260 nm was monitored while heating during the heat denaturation process. The temperature was raised by 1 ° C / absorbance reading and the denaturation profile analyzed by forming the first derivative of the melting curve. The data were also analyzed using a two-state linear regression analysis to determine the T _m = s. The results of these tests for some of the oligonucleotides of Examples 49 and 50 are shown in Table III below.

Table III T _m analysis of oligonucleotides

• ¹ All starred nucleosides contain 3'-O- (2-methoxyethyl).

EXAMPLE 52

NMR experiments on modified Oligonucleotides, comparison of 3 ', 5'- with 2 ', 5' internucleotide bonds and 2'-substituents with 3'-substituents by NMR

The 400 MHz ¹ H spectrum of oligomer d (GAU ₂ * CT), where U ₂ * = 2'-O-aminohexyluridine, showed 8 signals between 7.5 and 9.0 ppm corresponding to the 8 aromatic protons , In addition, the anomeric proton of U * appears as a doublet at 5.9 ppm with J _{1 ', 2'} = 7.5 Hz, indicating C2'-endo sugar curl. The corresponding 2'-5'-bound isomer shows a similar structure with J _{1 ', 2'} = 3.85 Hz at 5.75 ppm, indicating an RNA type sugar well at the new site of modification suitable for hybridization with a mRNA target is favorable. The proton spectrum of oligomer d (GACU ₃ *), where U ₃ * = 3'-O-hexylamine, showed the expected 7 aromatic proton signals between 7.5 and 9.0 ppm and the anomeric proton doublet at 5.9 ppm with J _{1 ', 2'} = 4.4 Hz. This indicates a C3'-endo curl of the 3'-O-alkylamino compounds to a greater extent compared to their 2'-analogues. The ³¹ P NMR of these oligonucleotides showed the expected 4 and 3 signals from the internucleotide phosphate bonds for d (GAU * CT) and d (GACU *), respectively. 3'-5'-bonded versus 2'-5'-bonded have different retention times and consequently different lipophilicity in RP-HPLC, indicating a possibly different degree of interaction with cell membranes.

EXAMPLE 53

T _m analysis of 2 ', 5'-linked oligonucleotides compared to 3', 5'-linked oligonucleotides

thermal Meltings were standardized according to Working methods in the literature carried out. The oligonucleotide identity is like follows: Oligonucleotide A is a normal 3'-5'-bound Phosphodiester oligodeoxyribonucleotide with the sequence d (GGC TGU * CTG CG) (SEQ ID NO: 16), where the * designates the attachment site of a 2'-amino-compound. Oligonucleotide B is a normal 3'-5'-linked phosphodiester oligoribonucleotide with the sequence d (GGC TGU * CTG CG), where the * the mounting location of a 2'-amino Binders features. All ribonucleotides of the oligonucleotides except that bearing the * substituent are 2'-O-methyl ribonucleotides. The oligonucleotide C has 2'-5 'binding in the * position additionally to a 3'-amino linker in this place. The remainder of the oligonucleotide is a phosphodiester oligodeoxyribonucleotide with the sequence d (GGC TGU * CTG CG). The underlying oligonucleotide (no 2'-amino linker) was not involved in the investigation.

Table IIIa

The 2'-5 'bonds showed a higher one Melting temperature compared an RNA target compared to a DNA target.

EXAMPLE 54

Snake venom phosphodiesterase and liver homogenate experiments for oligonucleotide stability

The The following oligonucleotides were prepared according to the procedure of Example 49 synthesized.

TABLE IV Modified oligonucleotides synthesized to assess stability

• ¹ All starred nucleosides contain 3'-O- (2-methoxyethyl). All nucleosides with a # contain 2'-O- (2-methoxyethyl).

The Oligonucleotides were used according to the procedure of Example 50 and analyzed for structure.

Table V Properties of Modified Oligonucleotides

• ¹ All starred nucleosides contain 3'-O- (2-methoxyethyl). All nucleosides with a # contain 2'-O- (2-methoxyethyl).
• ² conditions: Waters 600E with detector 991; Waters C4 column (3.9 x 300 mm); Solvent A: 50 mM TEA-Ac, pH 7.0; B: 100% acetonitrile; Flow rate 1.5 ml / min; Gradient: 5% B during the first five minutes, with a linear increase from B to 60% during the next 55 minutes.

EXAMPLE 55

3'-O-aminopropyl modified oligonucleotides

Following the above-described procedures for the synthesis of oligonucleotides, modified 3'-amidites were used in addition to the conventional amidites to prepare the oligonucleotides listed in Tables VI and VII. Nucleosides to be used include N ⁶ -benzoyl-3'-O-propylphthalimido-A-2'-amidite, 2'-O-propylphthaloyl-A-3'-amidite, 2'-O-methoxyethyl-thymidine-3'-amidite (RIC, Inc.), 2'-O-MOE-G-3'-amidite (RI Chemical), 2'-O-methoxyethyl-5-methylcytidine-3'-amidite, 2'-O-methoxyethyl-adenosine 3'-amidite (RI Chemical) and 5-methylcytidine-3'-amidite. 3'-Propylphthalimido-A and 2'-Propylphthalimido-A were used as the LCA-CPG solid support. The required quantities of the amidites were added to dried vials, dissolved in acetonitrile (unmodified nucleosides were made into 1 M solutions and modified nucleosides at 100 mg / ml) and connected to the appropriate ports in a Millipore-Expedite ^™ nucleic acid synthesis system. Solid support resin (60 mg) was used in each column for 2 x 1 μmol scale synthesis (2 columns were used for each oligo). The synthesis was carried out using the coupling protocol IBP-PS (1 μmol) for phosphorothioate backbones and CSO-8 for phosphodiester. Trityl reports indicated normal coupling results.

To In the synthesis, the oligonucleotides were acidified for about 16 h at 55 ° C with conc. Ammonium hydroxide (aq) containing 10% solution of 40% methylamine (aq) deprotected. Then they were using a Savant AS160 Automatic SpeedVac evaporated (to remove ammonia) and filtered to the CPG resin to remove. The raw samples were analyzed by MS, HPLC and CE. Then they were in a Waters 600E HPLC system with a detector 991 using a preparative Pillar Waters C4 (Alice C4 Prep.) And the following solvents A: 50 mM TEA-Ac, pH 7.0, and B: acetonitrile using the AMPREP2 @ method cleaned. After purification, the oligonucleotides became dry evaporated and then while about 30 minutes with 80% acetic acid detritylated at room temperature. Then they were evaporated. The Oligonucleotides were prepared in conc. Dissolved ammonium hydroxide and then through a column containing Sephadex G-25 using water as the solvent and a fraction collector Pharmacia LKB SuperFrac were used. The resulting purified oligonucleotides were evaporated and analyzed by MS, CE and HPLC.

Table VI Oligonucleotides bearing aminopropyl substituents

• ¹ All underlined nucleosides carry a 2'-O-methoxyethyl substituent; Internucleotide bonds in PS / PO oligonucleotides are indicated by subscripts> s = and> o =, respectively; A * = 3'-aminopropyl-A; A * = 2'-aminopropyl-A; C = 5-methyl-C

Table VII Aminopropyl modified oligonucleotides

EXAMPLE 56

In vivo stability modified oligonucleotides

The in vivo stability selected modified oligonucleotides synthesized in Examples 49 and 55 were in BALB / c mice certainly. Following a single intravenous administration of 5 mg / kg Oligonucleotide were drawn at different time intervals blood samples and analyzed by CGE. For every one tested Oligonucleotide were 9 male BALB / c mice (Charles River, Wilmington, MA) weighing about 25g. in the Following a one-week The mice received acclimatization a single tail vein injection of oligonucleotide (5 mg / kg), administered in phosphate buffered saline (PBS), pH 7.0. At every Group became a retrobulbar (either after 0.25, 0.5, 2 or 4 h after administration) and one terminal Blood collection (either 1, 3, 8 or 24 hours after administration). The terminal blood collection (about 0.6 to 0.8 ml) was carried out by means of Cardiac puncture following ketamine / xylazine anesthesia. The blood was in transferred an EDTA-coated collection tube and centrifuged to plasma to obtain. In conclusion, each mouse's liver and kidneys taken. Plasma and tissue homogenates were used for analysis around the intact oligonucleotide content using CGE. All samples were taken after recovery immediately frozen on dry ice and stored at -80 ° C until analysis.

The CGE analysis showed the relative nuclease resistance 2 ', 5'-bound Oligomers vs. ISIS 11061 (Table III, Example 51) (uniform 2'-deoxyphosphorothioate oligonucleotide, targeted to mouse c-Raf). Due to the nuclease resistance the 2 ', 5'-bond in combination with the fact that 3'-methoxyethoxy substituents are present and for ensure further nuclease protection, it was found that the oligonucleotides ISIS 17176, ISIS 17177, ISIS 17178, ISIS 17180, ISIS 17181 and ISIS 21415 were more stable in plasma, but ISIS 11061 (Table III) Not. Similar Observations were made on kidney and liver tissues.

This suggests that 2 ', 5' bonds with 3'-methoxyethoxy substituents in plasma, kidney and liver provide excellent nuclease resistance to 5 'exonucleases and 3' exonucleases. Thus oligonucleotides having longer pot lives can be built into their structure by incorporating both the 2 ', 5'-bond and the 3'-methoxyethoxy motifs. It has also been found that the 2 ', 5'-phosphorothioate bonds are more stable than 2', 5'-phosphodiester bonds. In 4 Figure 12 is a plot of the percentage of full-length oligonucleotide remaining intact in plasma one hour after administration of an intravenous bolus of 5 mg / kg oligonucleotide.

In 5 For example, a plot of the percentage of full-length oligonucleotide is shown remains intact in tissue 24 hours after administration of an intravenous bolus of 5 mg / kg oligonucleotide.

In 6 CGE traces of test oligonucleotides and a standard phosphorothioate oligonucleotide are shown in both mouse liver samples and mouse kidney samples after 24 hours. As is evident by these tracks, the oligonucleotides of the invention have a greater amount of intact oligonucleotide than the standard shown in Table A. The oligonucleotide shown in Table B had a substituent of the invention at each of the 5 'and 3' ends of a phosphorothioate oligonucleotide, whereas the phosphorothioate oligonucleotide shown in Table C has a substituent on the 5 th and 3 'ends of a phosphorothioate oligonucleotide 'End and two at the 3' end. The oligonucleotide of panel D has a substituent of the invention incorporated into a 2 ', 5'-phosphodiester bond at both its 5' and 3 'ends. Although it is less stable than the oligonucleotide shown in panels B and C, it is more stable than the complete standard phosphorothioate oligonucleotide of panel A.

EXAMPLE 57

Control of the c-Raf message in bEND cells using modified oligonucleotides

Around the activity to detect some of the oligonucleotides, was an in vitro cell culture assay used with which the cellular Extent c-Raf expression is measured in bEND cells.

Cells and reagents

The bEnd.3 cell line, a brain endothelioma, was developed by Dr. med. Werner Risau (Max Planck Institute) received. Opti-MEM, Trypsin-EDTA and High glucose DMEMs were purchased from Gibco-BRL (Grand Island, NY) based. Dulbecco's PBS was purchased from Irvine Scientific (Irvine, CA). based. Sterile tissue culture plates with 12 wells and facsflow solution were used from Becton Dickinson (Mansfield, MA). Ultra-pure formaldehyde was purchased from Polysciences (Warrington, PA). NAP-5 columns were from Pharmacia (Uppsala, Sweden).

Oligonucleotide treatment

cell were plated in 12-well plates with DMEM containing 4.5 g / L glucose and 10% FBS, grown to about 75 confluency. The cells were thrice with Opti-MEM, preheated to 37 ° C, washed. The Oligonucleotide was labeled with a cationic lipid (Lipofectin reagent, GIBCO / BRL) and in a row to the desired Diluted concentrations and for a 4 hour incubation at 37 ° C transferred to the washed cells. The Media were then removed and used for Northern blot analysis of mRNA for Replaced with normal growth media for 24 hours.

Northern blot analysis

For determination of mRNA levels by Northern blot analysis, total RNA was assayed 24 h after the start of oligonucleotide treatment by the guanidinium isothiocyanate procedure (Monia et al., Proc. Natl. Acad Sci., USA, 1996, 93, 15.481 to 15,484) from cells. Total RNA was isolated by centrifuging the cell lysates on a CsCl pad. Northern blot analysis, RNA quantification and normalization for G # PDH mRNA levels were performed according to a procedure described (Dean and McKay, Proc. Natl. Acad Sci., USA, 1994, 91, 11, 762 to 11, 766). carried out. In bEND cells, the 2-, 5-linked 3'-O-methoxyethyl oligonucleotides showed a decrease in c-Raf message activity as a function of concentration. The fact that these modified oligonucleotides retained activity promises decreased dosing frequency in these oligonucleotides, which also show increased in vivo nuclease resistance. All 2 ', 5'-linked oligonucleotides retained the activity of the parent 11061 oligonucleotide (Table III) and further enhanced activity. A graph of the effect of the oligonucleotides of the present invention on c-Raf expression (as compared to the control) in bEND cells is in 7 shown.

EXAMPLE 58

Synthesis of MMI-containing oligonucleotides

a. Bis-2'-O-methyl-MMI devices

The synthesis of dimeric MMI building blocks (ie R = CH ₃ ) has been previously described (see, eg, Swayze et al., Synlett 1997, 859; Sanghvi et al., Nucleosides & Nucleotides 1997, 16, 907; Swayze et al., Nucleosides & Nucleotides 1997, 16, 971; Dimock et al., Nucleosides & Nucleotides 1997, 16, 1. 629). In general, 5'-O- (4,4'-dimethoxytrityl) -2'-O-methyl-3'-C-formyl-nucleosides with 5'-O- (N-methylhydroxylamino) -2'-O-methyl- 3'-O-TBDPS nucleosides using 1 equivalent of BH ₃ -pyridine / 1 equivalent of pyridinium para-toluenesulfonate (PPTS) condensed in 3: 1 MeOH / THF. The resulting dimeric MMI blocks were then deprotected in the bottom of the sugar with 15 equivalents of Et ₃ N-2HF in THF. Thus, the T * G ^{iBu dimer} unit was synthesized and phosphitylated to give T * G (MMI) phosphoramidite. In a similar manner, A ^BZ * T (MMI) dimer was synthesized, succinylated and attached to porous glass.

b. Oligonucleotide Synthesis

Oligonucleotides were synthesized in a Nucleic Acid Synthesis System Perseptive Biosystems Expedite 8901. Several 1 μmol syntheses were performed for each oligonucleotide. Solid A * _MMI T-carrier was added to the column. Trityl groups were removed with trichloroacetic acid (975 μl for one minute), followed by acetonitrile washing. The oligonucleotide was constructed using a modified thioate protocol. Standard amidites were added in this protocol over a period of 3 minutes (210 μl). The T * _MMI G amidite was double coupled using 210 μl for a total of 20 minutes. The amount of oxidizer, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent, 3.4 g Beaucage reagent / 200 ml acetonitrile) was 225 μl (one minute wait step). The unreacted nucleosides were capped with a 50:50 mixture of tetrahydrofuran / acetic anhydride and tetrahydrofuran / pyridine / 1-methylimidazole. The trityl yields were monitored during the synthesis by means of the tritylmonitor. The final DMT group was left intact. After synthesis, the contents of the synthesis cartridge (1 μmol) were transferred to a Pyrex vial and the oligonucleotide was separated from the porous glass (CPG) using 5 ml of 30% ammonium hydroxide (NH ₄ OH) for about 16 hours at 55 ° C. cleaved.

c. Oligonucleotide Purification

After the deprotection step, samples were filtered from the CPG using 0.45 μm nylon aerodisc syringe filters. Excess NH ₄ OH was evaporated in a Savant AS160 Automatic SpeedVac. Crude yield was measured in a Hewlett Packard diode array spectrophotometer 8452A at 260 nm. The raw samples were then analyzed in a Hewlett Packard mass spectrometric electrospray mass spectrometer (MS). The trityl on oligonucleotides were purified by preparative reverse phase high performance liquid chromatography (HPLC). The HPLC conditions were as follows: Waters 600E with detector 991; Column Waters Delta Pak C4 (7.8 × 300 mm); Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; B: 100% acetonitrile; Flow rate 2.5 ml / min; Gradient: 5% B during the first five minutes, with a linear increase from B to 60% during the next 55 minutes. Fractions containing the desired product (retention time = 41 min for DMT-ON-16314, retention time = 42.5 min for DMT-ON-16315) were collected and the solvent was dried away in the SpeedVac. The oligonucleotides were detritylated in 80% acetic acid for about 60 minutes and lyophilized again. Free trityl and excess salt were removed by adding the detritylated oligonucleotides through Sephadex G-25 (size exclusion chromatography) and collecting appropriate samples using a Pharmacia fraction collector. The solvent was again evaporated in a Speedvac. The purified oligonucleotides were then analyzed for purity by CGE, HPLC (flow rate 1.5 ml / min, Waters Delta Pak C4 column, 3.9 x 300 mm) and MS. The final yield was determined by means of a spectrophotometer at 260 nm.

The synthesized oligonucleotides and their physical characteristics are shown in Tables VIII and IX, respectively. All starred Nucleosides contain MMI binding.

Table VIII ICAM-1 oligonucleotides containing MMI dimers synthesized for in vivo nuclease and pharmacological studies

Table IX Physical characteristics of MMI oligomers synthesized for pharmacological and in vivo nuclease studies

HPLC conditions: Waters 600E with detector 991; pillar Waters C4 (3.9 × 300 mm); solvent A: 50 mM TEA-Ac, pH 7.0; B: 100% acetonitrile; Flow rate 1.5 ml / min; Gradient: 5% B during the first five Minutes with a linear increase from B to 60% during the next 55 minutes.

EXAMPLE 59

Synthesis of Sp-terminal oligonucleotide

a. 3'-O-t-butyldiphenylsilyl-thymidine (1)

5'-O-Dimethoxytritylthymidine is silylated with 1 equivalent of t-butyldiphenylsilyl chloride (TBDPSCl) and 2 equivalents of imidazole in solvent DMF at room temperature. The 5'-protecting group is removed by treatment with 3-dichloroacetic acid in CH ₂ Cl ₂ .

b. 5'-O-Dimethoxytrityl-thymidine-3'-O-yl-N, N-diisopropylamino (S-pivaloyl-2-mercaptoethoxy) phosphoramidite (2)

5'-O-Dimethoxytrityl-thymidine is treated with bis (N, N-diisopropylamino) -S-pivaloyl-2-mercaptoethoxyphosphoramidite and tetrazole in CH ₂ Cl ₂ / CH ₃ CN as described by Guzaev et al., Bioorganic & Medicinal Chemistry Letters 1998, 8, 1123, to give the title compound.

c. 5'-O-dimethoxytrityl-2'-deoxy-adenosine-3'-O-yl-N, N-diisopropylamino (5-pivaloyl-2-mercaptoethoxy) phosphoramidite (3)

5'-O-dimethoxytrityl-N-6-benzoyl-2'-deoxy-adenosine is phosphitylated as in the previous example to the desired amidite to obtain.

d. 3'-Ot-butyldiphenylsilyl-2'-deoxy-N ₂ -isobutyryl-guanosine (4)

5'-O-dimethoxytrityl-2'-deoxy-N ₂ -isobutyryl-guanisine is silylated with TBDPSC1 and imidazole in DMF. The 5'-DMT is then removed with 3% DCA in CH ₂ Cl ₂ .

e. T _(Sp) G dimer and T _(S) phosphoramidite

Compounds 4 and 2 are condensed using 1H-tetrazole in solvent CH ₃ CN (1: 1 equivalent), followed by sulfurization using Beaucage reagent (see, eg, Iyer et al., J. Org. Chem. 1990, 55 , 4,693). The dimers (TG) are separated by column chromatography and the silyl group is deprotected using t-butylammonium fluoride / THF to give Rp and Sp dimers of TSG. Small amounts of these dimers are completely deprotected and treated with either P1 nuclease or snake venom phosphodiesterase. The R isomer is resistant to P1 nuclease and is hydrolyzed by SVPD. The S isomer is resistant to SVPD and is hydrolyzed by P1 nuclease. The Sp isomer of the fully protected T _S G dimer is phosphitylated to give DMT-T-Sp-G phosphoramidite.

f. A _S T dimer and solid support containing A _SP T dimer

Compounds 3 and 1 are condensed using 1H-tetrazole in solvent CH ₃ CN followed by sulfurization to give AT dimers. The dimers are separated by column chromatography and the silyl group is deprotected with TBAF / THF. The configuration assignments are made generally as in the previous example. The Sp isomer is then attached to porous glass according to standard procedures to give DMT-A _SP -T-CPG oligomerization with chirally pure Sp-dimer units at the termini.

G. Oligonucleotide Synthesis

The oligonucleotide having the sequence T * GC ATC CCC CAG GCC ACC A * T is synthesized, wherein T * G and A * T represent chiral Sp dimer blocks described above. DMT-A _SP -T-CPG is introduced into the synthesis column and the next 16b residues are prepared using standard phosphorothioate protocols and 3H-1,2-benzodithiol-3-one 1,1-dioxide as the sulfurizing agent built up. After building this 18 mer unit followed by final detritylation, the chiral Sp dimer phosphoramidite of 5'-DMT-T _SP is -G amidite is coupled to give the desired antisense oligonucleotide. This compound is then deprotected in 30% NH ₄ OH for 16 hours and the oligomer purified in an HPLC column and desalted in a Sephadex G-25 column. The final oligomer has a diastereomeric mixture of Rp and Sp configuration at the 5'-terminus and the 3'-terminus Sp configuration and the inner part.

EXAMPLE 60

Assessment of in vivo stability of MMI-capped Oligonucleotides, mouse experiment procedure

For each tested Oligonucleotide were 9 male BALB / c mice (Charles River, Wilmington, MA) which weighed about 25 grams (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923). In connection to a 1-week Acclimation was given to mice a single tail vein injection of oligonucleotide (5 mg / kg), that in phosphate buffered saline (SBS), pH 7.0. Each group had a retrobulbar (either after 0.25, 0.5, 2 or 4 h after administration) and a terminal blood sample (either 1, 3, 8 or 24 hours after administration). The terminal Blood collection (about 0.6 to 0.8 ml) was carried out by means of cardiac puncture following ketamine / xylazine anesthesia. The blood was in transferred an EDTA-coated collection tube and centrifuged to plasma to obtain. In conclusion, each mouse's liver and kidneys taken. Plasma and tissue homogenates were used for analysis around the intact oligonucleotide content using CGE. All samples were taken after recovery immediately frozen on dry ice and stored at -80 ° C until analysis.

The Capillary gel electrophoretic analysis showed the relative nuclease resistance MMI-capped oligomers compared to ISIS 3082 (common 2'-Desoxyphosphorothioat). Due to the durability of the MMI binding to nucleases It was found that compound 16314 was stable in plasma, 3082 not. However, Compound 16314 showed in kidney and liver also a degree of degradation. This indicates that while 3'-exonuclease in Plasma is important, 5'-exonucleases or endonucleases in tissues. To between these two options to differentiate, the data from 16315 were analyzed. In plasma as well as in tissues (liver and kidney) the connection was to several Stable (1, 3 and 24 h). The fact that no degradation demonstrated that 5'-exonucleases and 3'-exonucleases predominate in tissues and endonucleases are not active. It is also a single one Binding (MMI or Sp-thioate binding) as a gatekeeper against nucleases sufficient.

Control of ICAM-1 expression cells and reagents

The bEnd.3 cell line, a brain endothelioma, was the kind gift of Dr. Ing. Werner Risau (Max Planck Institute). Opti-MEM, trypsin-EDTA and high-glucose DMEM were purchased from Gibco-BRL (Grand Island, NY). Dulbecco's PBS was purchased from Irvine Scientific (Irvine, CA). Sterile tissue culture plates with 12 wells and facsflow solution were purchased from Becton Dickinson (Mansfield, MA). Ultra-pure formaldehyde was purchased from Polysciences (Warrington, PA). Recombinant human TNF-α was purchased from R & D Systems (Minneapolis, MN). Mouse interferon-γ was purchased from Genzyme (Cambridge, MA). Fraction V, BSA was purchased from Sigma (St. Louis, MO). The mouse ICAM-1 PE, VCAM-1 FITC, hamster IgG FITC and rat IgG _2a PE antibodies were purchased from Pharmingen (San Diego, CA). Zeta-Probe nylon blotting membrane was purchased from Bio-Rad (Richmond, CA). QuickHyb solution was obtained from Stratagene (La Jolla, CA). A cDNA tag kit, Prime a genes, was purchased from ProMega (Madison, WI). NAP-5 columns were purchased from Pharmacia (Uppsala, Sweden).

Oligonucleotide treatment

cell were plated in 12-well plates with DMEM containing 4.5 g / L glucose and 10% FBS bred to 75% confluency. The cells were thrice with Opti-MEM, preheated at 37 ° C, washed. Oligonucleotide was premixed with Opti-MEM and in a number to the desired Diluted concentrations and for a 4-hour Incubation at 37 ° C transferred to washed cells. media were removed and by normal growth media with or without 5 ng / ml TNF-α and Replaced 200 U / ml interferon-γ, for Northern blot analysis of mRNA for 2 hours or for flow cytometry Analysis of cell surface protein expression overnight incubated.

Flow cytometry

To the oligonucleotide treatment, the cells by means of a short Treatment with trypsin-EDTA (1 to 2 min) detached from the plates. The Cells were in polystyrene tubes from 12 × 75 mm transferred and washed with 2 BSA, 0.2% sodium azide in DPBS at 4 ° C. The cells were centrifuged at 1000 rpm in a Beckman GPR centrifuge, and the supernatant was then decanted off. ICAM-1, VCAM-1 and the control antibodies were at 1 μg / ml to 0.3 ml of the above buffer. The antibodies were linked to the cells while 30 minutes at 4 ° C in the dark with gentle stirring incubated. The cells were washed again as above and then in 0.3 ml of FacsFlow buffer with 0.5% of extremely pure formaldehyde again suspended. The cells were analyzed in a Becton-Dickinson FACScan. The results are given as a percentage of the control expression, which was calculated as follows: [((CAM expression for oligonucleotide-treated, Cytokine-induced cells) - (basal CAM expression)) / ((cytokine-induced CAM expression) - (basal CAM expression))] × 100. The experiments involving cationic lipids were both basal and cytokine-treated control cells 4 hours with lipofection in the absence of oligonucleotides treated.

The Results show the following: 1) Isis 3082 showed an expected Dose response (25 to 200 nM); 2) Isis 13001 lost its ability To inhibit ICAM-1 expression, as expected from a mismatch compound, thus proving an antisense mechanism; 3) 3'-MMI capped oligomer 16314 improved the activity of 3082 and was almost doubled at a concentration of 200 nM as active as 3082; 4) 5'- and 3'-MMI-capped Oligomer is the most potent compound and is at concentrations of 100 and 200 nM almost 4 to 5 times more effective than the parent compound.

Consequently increased improved nuclease resistance the potency of antisense oligonucleotides.

EXAMPLE 61

control the H-Ras expression

Antisense oligonucleotides targeting the H-Ras message were tested for their ability to inhibit the production of H-Ras mRNA in T-24 cells. For these assays, T-24 cells were plated on 6-well plates and then treated with various increasing concentrations of oligonucleotide in the presence of cationic lipid (Lipofectin, GIBCO) in the ratio of 2.5 μg / ml Lipofectin per 100 nM oligonucleotide. The oligonucleotide treatment was carried out for 4 hours in serum-free media. Eighteen hours after treatment, total RNA was recovered and analyzed by Northern blot for H-Ras mRNA and control gene G3PDH. The data is in 8th and 9 in bar graphs as a percentage of control normalized for the G3PDH signal. As can be seen, the oligonucleotide with a single MMI bond in each of the flanking regions showed significant reduction in H-Ras mRNA.

EXAMPLE 62

5-Lipoxygenase Analysis and assays

A. Therapeutics

to therapeutic application is an animal that was suspected that it had an illness caused by an excessive or abnormal supply at 5-lipoxygenase, by administering a compound treated the invention. The average expert can be the optimal Easily determine dosages, dosing methods and repetition rates. Such treatment will generally continue until either a cure is effected or a reduction of the disease state achieved. For some diseases is a long-term treatment probably.

B. Research reagents

The Oligonucleotides of the invention are also used as research reagents useful when used to 5-lipoxygenase mRNA in crude cell lysates or in partially purified or fully purified RNA preparations split or modify in another way. This application of Invention is, for example, by lysing cells by means of Standard procedure, optimal extraction of the RNA and subsequent treatment the same having a composition in concentrations ranging from e.g. about 100 to about 500 ng per 10 mg total RNA in a buffer, which consists for example of 50 mm of phosphate, pH in the range from about 4 to 10, at a temperature of about 30 to about 50 ° C. The cleaved 5-lipoxygenase RNA can by means of agarose gel electrophoresis and hybridization with radioactive labeled DNA probes or analyzed by other standard methods become.

C. Diagnostics

The Oligonucleotides of the invention are also used in diagnostic applications useful in particular for determining the expression of specific mRNA species in different tissues or the expression of abnormal or Mutant RNA species. In this example, the macromolecules would, while they are target an abnormal mRNA because it complements the abnormal sequence do not hybridize with normal mRNA. Tissue samples can be homogenized and RNA are extracted by standard methods. The crude homogenate or the extract can be treated, for example, for cleavage the target RNA too cause. The product can then be hybridized with a solid support containing a bound oligonucleotide that is complementary to a Region on the 5'-side the split location is. Both the normal and the abnormal 5 'region of the mRNA would to the solid support tie. The 3'-region the abnormal RNA that is cleaved would not be bound to the carrier and therefore be separated from the normal mRNa.

Modified mRNA species are for 5-lipoxygenase; however, one of ordinary skill in the art will appreciate that the present invention is not so limited and generally applicable. It is expected that the inhibition or modification of the production of the enzyme 5-lipoxygenase has significant therapeutic benefits in the treatment of disease. To the effectiveness of Zu An assay or series of assays is required.

D. In vitro assays

at the cell assays for 5-lipoxygenase is preferably the human promyelocytic Leukemia cell line HL-60 used. These cells can caused by various known agents, in either to differentiate a monocytic or a neutrophilic cell. It is known that treatment of the cells with 1.3% dimethyl sulfoxide, DMSO, which promotes differentiation of cells in neutrophils. It has now been found that basal HL-60 cells do not detectable levels of 5-lipoxygenase protein synthesize or leukotrienes (a successor of 5-lipoxygenase) secrete. The differentiation of cells with DMSO causes an appearance of 5-lipoxygenase protein and leukotriene biosynthesis 48 hours after the addition of DMSO. Therefore, the induction of 5-lipoxygenase protein synthesis as a test system used for the analysis of oligonucleotides involved in 5-lipoxygenase synthesis intervene in these cells.

A second assay for oligonucleotides makes use of the fact that 5-lipoxygenase is a "suicide" enzyme because it inactivates itself upon reacting with substrate, treating differentiated HL-60 or other cells, 5-lipoxygenase with 10 μM A23187, a calcium ionophore, promotes the translocation of 5-lipoxygenase from the cytosol to the membrane with subsequent activation of the enzyme, following activation and several catalysis, the enzyme becomes catalytically inactive, thus inactivating treatment of the cells Calcium ionophore endogenous 5-lipoxygenase The cells take about 24 hours to recover from the A23187 treatment, as measured by their ability to synthesize leukotriene B _4. Macromolecules directed against 5-lipoxygenase can be detected using The following quantitative assays are tested for activity in two HL-60 model systems d from the most direct measurement of inhibition of 5-lipoxygenase protein synthesis in intact cells to further downstream events, such as the measurement of 5-lipoxygenase activity in intact cells. A direct effect that oligonucleotides can exert on intact cells and that can be easily quantified is the specific inhibition of 5-lipoxygenase protein synthesis. To carry out this technique, cells can be labeled with ³⁵ S-methionine (50 μCi / ml) for 2 hours at 37 ° C to label newly synthesized protein. The cells are extracted to solubilize the entire cell proteins, and the 5-lipoxygenase is immunoprecipitated with 5-lipoxygenase antibody, followed by elution of protein A-Sepharose beads. The immunoprecipitated proteins are separated by SDS-polyacrylamide gel electrophoresis and subjected to autoradiography. The amount of immunoprecipitated 5-lipoxygenase is quantified by means of scanning densitometry.

One The result predicted from these experiments would be as follows. The amount of 5-lipoxygenase protein immunoprecipitated from control cells would, would normalized to 100. Treatment of cells with 1 μM, 10 μM and 30 μM of the macromolecules of the invention while 48 hours would the immunoprecipitated Reduce 5-lipoxygenase by 5%, 25% and 75% of the control.

The measurement of 5-lipoxygenase enzyme activity in cell homogenates could also be used to quantify the amount of enzyme present that is capable of synthesizing leukotrienes. A radiometric assay for quantifying 5-lipoxygenase enzyme activity in cell homogenates using reverse-phase HPLC has now been developed. The cells are disrupted by sonication in a buffer containing protease inhibitor and EDTA. The cell homogenate is centrifuged at 10,000 g for 30 minutes and the supernatants are analyzed for 5-lipoxygenase activity. Cytosolic proteins are incubated with 10 μM ¹⁴ C-arachidonic acid, 2 mM ATP, 50 μM free calcium, 100 μg / ml phosphatidylcholine, and 50 mM Bis-Tris buffer, pH 7.0, at 37 ° C for 5 min. The reactions are quenched by the addition of an equal volume of acetone and the fatty acids extracted with ethyl acetate. The substrate and reaction products are separated by reverse phase HPLC in a Novapak Cl8 column (Waters Inc., Millford, MA). Radioactive peaks are detected using a Beckman Model 171 radiochromatographic detector. The amount of arachidonic acid converted to di-HETEs and mono-HETEs is used as a measure of 5-lipoxygenase activity.

A predicted result for the 72-hour treatment of DMSO-differentiated HL-60 cells with effective macromolecules of the invention at 1 μM, 10 μM and 30 μM would be as follows. Control cells oxidize 200 pmol arachidonic acid / 5 min / 10 ⁶ cells. Cells treated with 1 μM, 10 μM and 30 μM of an active oligonucleotide would oxidize 195 pmol, 140 pmol and 60 pmol arachidonic acid / 5 min / 10 ⁶ cells, respectively.

One quantitative, competitive, enzyme-linked immunosorbent assay (ELISA) for measuring total 5-lipoxygenase protein in cells been developed. Human 5-lipoxygenase expressed in E. coli and by extraction, Q-Sepharose, hydroxyapatite and reverse phase HPLC purified, is considered a standard and as the primary antigen used to coat microtiter plates. Purified 5-lipoxygenase (25 ng) is about Night at 4 ° C bound to the microtiter plates. The wells are 90 min long with 5% goat serum, diluted in 20 mM Tris-HCl buffer, pH 7.4, in the presence of 150 mM NaCl (TBS) blocked. Cell extracts (0.2% Triton X-100, 12,000 g during 30 min) or purified 5-lipoxygenase were diluted at 1: 4,000 of polyclonal 5-lipoxygenase antibody in a total volume of 100 μl in the microtiter wells for Incubated for 90 min. The antibodies are immunized by immunizing rabbits with purified human recombinant 5-lipoxygenase produced. The wells are treated with TBS containing 0.05% Tween 20 contains (TBST), then washed with 100 μl a 1: 1000 dilution of peroxidase-conjugated goat anti-rabbit IgG (Cappel Laboratories, Malvern, PA) for 60 minutes at 25 ° C incubated. The wells are washed with TBST and the amount peroxidase labeled second antibody by development with Tetramethylbenzidine determined.

Predicted results of such an assay using a 30-mer oligonucleotide at 1 μM, 10 μM and 30 μM would be 30 ng, 18 ng and 5 ng 5-lipoxygenase per 10 ⁶ cells, respectively, with untreated cells containing approximately 34 ng of 5-lipoxygenase.

A net inhibitory effect of 5-lipoxygenase biosynthesis is a reduction in the levels of leukotrienes released from stimulated cells. DMSO-differentiated HL-60 cells release leukotriene B4 when stimulated with calcium ionophore A23187. Leukotriene B4 released into the cell medium can be quantified by radioimmunoassay using commercial diagnostic kits (New England Nuclear, Boston, MA). Leukotriene B4 production can be detected in HL-60 cells 48 hours after the addition of DMSO to differentiate the cells into a neutrophil cell. Cells (2 x 10 ⁵ cells / ml) will be treated with increasing concentrations of the macromolecule for 48 to 72 hours in the presence of 1.3% DMSO. The cells are washed and resuspended to a concentration of 2 x 10 ⁶ cells / ml in Dulbecco's phosphate buffered saline containing 1% delipidated bovine serum albumin. The cells are stimulated with 10 μM calcium ionophore A23187 for 15 min and the amount of LTB4 produced by 5 x 10 ⁵ cells is determined by radioimmunoassay as described by the manufacturer.

Using this assay, an oligonucleotide directed to the S-LO mRNA would likely give the following results. The cells will be treated in the presence of 1.3% DMSO for 72 hours with either 1 μM, 10 μM or 30 μM of the macromolecule. It would be expected that the amount of LTB ₄ produced by 5 x 10 ⁵ cells would be about 75 pg, 50 pg and 35 pg respectively, with untreated differentiated cells producing 75 pg of LTB ₄ .

E. In Vivo Assay

The inhibition of production of 5-lipoxygenase in the mouse can be demonstrated according to the following procedure. Topical application of arachidonic acid results in the rapid production of leukotriene B ₄ , leukotriene C ₄ and prostaglandin E ₂ in the skin, followed by edema and cell infiltration. Certain inhibitors of 5-lipoxygenase have been known to exhibit activity in this assay. In the assay, 2 mg of arachidonic acid is applied to a mouse ear with the contralateral ear serving as a control. The polymorphonuclear cell infiltrate is analyzed by myeloperoxidase activity in homogenates taken from a biopsy 1 hour after arachidonic acid administration. The edematous reaction is quantified by measuring ear thickness and wet weight of a punch biopsy. Measurement of leukotriene B ₄ produced in biopsy specimens is performed as a direct measure of 5-lipoxygenase activity in the tissue. Oligonucleotides are topically applied to both ears 12 to 24 hours prior to the administration of arachidonic acid to allow optimal activity of the compounds. Both ears are pretreated for 24 hours with either 0.1 μmol, 0.3 μmol, or 1.0 μmol of the macromolecule before loading with arachidonic acid. The values are expressed as the mean for three animals per concentration. The inhibition of polymorphonuclear cell infiltration for 0.1 μmol, 0.3 μmol and 1 μmol is expected to be about 10%, 75% and 92% of the control activity, respectively. The inhibition of edema is expected to be about 3%, 58% and 90%, respectively, while it would be expected that the inhibition of leukotriene B ₄ production would be about 15%, 79% and 99%, respectively.

EXAMPLE 63

5'-O-DMT-2'-deoxy-2'-methylene-5-methyl-uridine-3 '- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite

2'-deoxy-2'-methylene-3 ', 5'-O- (tetraisopropyl-disiloxane-1,3-diyl) -5-methyluridine is performed following the procedures for the corresponding uridine derivatives (Hansske, F., Madej, D., Robins, M. J. Tetrahedron (1984) 40, 125; Matsuda, A .; Takenusi, K .; Tanaka, S .; Sasaki, T .; Ueda, T., J. Med. Chem. (1991) 34, 812; see also Cory, A.H .; Samano, V .; Robins, M.J .; Cory, J.G., 2'-Deoxy-2'-methylene derivatives of adenosine, guanosine, tubercidin, cytidine and uridine as inhibitors of L1210 cell growth in culture. Biochem. Pharmacol. (1994), 47 (2), 365 to 71).

It is treated with 1 M TBAF in THF to give 2'-deoxy-2'-methylene-5-methyluridine to surrender. It is dissolved in pyridine and treated with DMT-Cl and stirred 5'-O-DMT-2'-deoxy-2'-methylene-5-methyluridine to surrender. This compound is reacted with 2-cyanoethyl-N, N-diisopropylphosphoramidite and diisopropylaminotetrazolide. In a similar The corresponding N-6-benzoyladenosine, N-4-benzoylcytosine, Synthesized N-2-isobutyrylguanosine phosphoramidite derivatives.

EXAMPLE 63

Synthesis of 3'-O-4'-C-methylene ribonucleoside

5'-O-DMT-3'-O-4'-C-methylene-uridine and 5-methyluridine according to the procedure by Obika et al. (Obika et al., Bioorg. Med. Chem. Lett. (1999) 9, 515-518). The amidites are prepared using the instructions described above involved in oligonucleotides.

EXAMPLE 64

Synthesis of 2'-methylene phosphoramidites

5'-O-DMT-2 '- (methyl) -3'-O- (2-cyanoethyl-N, N-diisopropylamine) -5-methyl uridine phosphoramidite, 5'-O-DMT-2' - (methyl) -N-6-benzoyladenosine (3'-O-2-cyanoethyl-N, N-diisopropylamino) phosphoramidite; 5'-O-DMT-2 '- (methyl) -N2-isobutyrylguanosine-3'-O- (2 -cyanoethyl-N, N-diisopropylamino) phosphoramidite and 5'-O-DMT-2 '- (methyl) -N-4-benzoyl-cytidine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite were due to the phosphitylation of the corresponding nucleosides receive. The nucleosides were synthesized according to the procedure, those of Iribarren, Adolfo M .; Cicero, Daniel O .; Nine, Philippe J., Resistance to degradation by Nucleases of (2'S) -2'-deoxy-2'-C-methyloligonucleotides novel potential antisense probes. Antisense Res. Dev., (1994), 4 (2), 95 to 98; Schmit, Chantal; Bevierre, Marc-Olivier; De Mesmaeker, Alain; Altmann, Karl-Heinz, "The effects of 2'-and 3'-alkyl substituents on oligonucleotide hybridization and stability ", Bioorg. Med. Chem. Lett. (1994), 4 (16), 1,969 to 1,974.

The Phosphitylation is performed using the bisamidite procedure.

EXAMPLE 65

Synthesis of 2'-S-methyl phosphoramidites

5'-O-DMT-2'-S- (methyl) -3'-O- (2-cyanoethyl-N, N-diisopropylamine) -5-methyl-uridine-phosphoramidite, 5'-O-DMT-2 ' -S (methyl) -N-6-benzoyladenosine (3'-O-2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5'-O-DMT-2'-S- (methyl) -N2- isobutyryl-guanosine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite and 5'-O-DMT-2'-5- (methyl) -N-4-benzoyl-cytidine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) -phosphoramidite obtained by phosphitylation of the corresponding nucleosides. The nucleosides were prepared according to the procedure synthesized by Fraser et al. is described (Fraser, A .; Wheeler, P .; Cook, P. D .; Sanghvi, Y.S., J. Heterocycl. Chem. (1993) 31, 1.277 to 1.287). The phosphitylation is under use carried out the bisamidite procedure.

EXAMPLE 66

Synthesis of 2'-O-methyl-β-D-arabinofuranosyl Compounds

2'-O-methyl-β-D-arabinofuranosyl-thymidine-containing oligonucleotides were used in the procedures of Gotfredson et. al. (Gotfredson, CH et al., Tetrahedron Lett. (1994) 35, 6,941-6,944; Gotfredson, CH et al., Bioorg. Med. Chem. (1996) 4, 1217-1225). 5'-O-DMT-2'-ara (O-methyl) -3'-O- (2-cyanoethyl-N, N-diisopropylamine) -5-methyl uridine phosphoramidite, 5'-O-DMT-2 ' -ara- (O-methyl) -N-6-benzoyladenosine (3'-O-2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5'-O-DMT-2'-ara- (O-methyl) -N2-isobutyryl-guanosine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) -phosphoramidite; and 5'-O-DMT-2'-ara- (O-methyl) -N-4-benzoyl-cytidine 3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidites are obtained by the phosphitylation of the corresponding nucleosides. The nucleosides are obtained according to the procedure described by Gotfredson, CH et. al. described Tetrahedron Lett. (1994) 35, 6,941 to 6,944; Gotfredson, CH et. al., Bioorg. Med. Chem. (1996) 4, 1217-1225. The phosphitylation is carried out using the bisamidite procedure.

EXAMPLE 67

Synthesis of 2'-fluoro-β-D-arabinofuranosyl compounds

2'-fluoro-β-D-arabinofuranosyl oligonucleotides The procedures of Kois, P. et al., Nucleosides Nucleotides 12, 1093, 1993 and Damha et al., J. Am. Chem. Soc., 120, 12.976, 1998 and listed therein Bibliography following performed. 5'-O-DMT-2'-ara- (fluoro) -3'-O- (2-cyanoethyl-N, N-diisopropylamine) -5-methyluridinphosphoramidit, 5'-O-DMT-2'-ara- (fluoro) -N-6-benzoyl adenosine (3'-O-2-cyanoethyl-N, N-diisopropylamino) phosphoramidite, 5'-O-DMT-2'-ara- (fluoro) -N2-isobutyryl-guanosine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite and 5'-O-DMT-2'-ara (fluoro) -N-4-benzoylcytidine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidites are due to the phosphitylation of the corresponding nucleosides receive. The nucleosides are synthesized according to the procedure, those of Kois, P. et al., Nucleosides Nucleotides 12, 1093, 1993 and Damha et al., J. Am. Chem. Soc., 120, 12.976, 1998 is. Phosphitylation is accomplished using the bisamidite procedure carried out.

EXAMPLE 68

Synthesis of 2'-hydroxyl-β-D-arabinofuranosyl compounds

2'-hydroxyl-β-D-arabinofuranosyl oligonucleotides become the working methods of Resmini and Pfleiderer, Helv. Chim. Acta, 76, 158, 1993; Schmit et al., Bioorg. Med. Chem. Lett. 4, 1,996, 1994 Resmini, M .; Pfleiderer, W. Synthesis of arabinonucleic acid (tANA). Bioorg. Med. Chem. Lett. (1994), 16, 1,910; Resmini, Matthias; Pfleiderer, W. Nucleosides, Part LV, Efficient synthesis of arabinoguanosine building blocks (Helv Chim Acta, (1994), 77, 429-434; Damha et al., J. Am. Chem. Soc., 1998, 120, 12.976, and references cited therein following performed.

5'-O-DMT-2'-ara (hydroxy) -3'-O- (2-cyanoethyl-N, N-diisopropylamine) -5-methyluridine-phosphoramidite, 5'-O-DMT-2'-ara - (hydroxy) -N-6-benzoyl-adenosine (3'-O-2-cyanoethyl-N, N-diisopropylamino) -phosphoramidite, 5'-O-DMT-2'-ara- (hydroxy) -N2-isobutyryl guanosine 3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite and 5'-O-DMT-2'-ara- (hydroxy) -N-4-benzoyl cytidine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidites be by means of phosphitylation of the corresponding nucleosides receive. The nucleosides are synthesized according to the procedure, those of Kois, P. et al., Nucleosides Nucleotides 12, 1093, 1993 and Damha et al., J. Am. Chem. Soc., 120, 12.976, 1998 is. Phosphitylation is accomplished using the bisamidite procedure carried out.

EXAMPLE 69

Synthesis of difluoromethylene compounds

5'-O-DMT-2'-deoxy-2'-difluoromethylene-5-methyluridine-3 '- (2-cyanoethyl-N, N-diisopropyl-phosphoramidite), 5'-O-DMT-2'-deoxy- 2'-difluoromethylene-N-4-benzoyl-cytidine, 5'-O-DMT-2'-deoxy-2'-difluoromethylene-N-6-benzoyl-adenosine and 5'-O-DMT-2'-deoxy- 2'-difluoroethylene-N ₂ -isobutyrylguanosine are synthesized following the procedures described by Usman et al. (U.S. Patent No. 5,639,649, June 17, 1997).

EXAMPLE 70

Synthesis of 5'-O-DMT-2'-deoxy-2'-β- (O-acetyl) -2'-α-methyl-N6-benzoyl-adenosine-3 '- (2-cyanoethyl-N, N- diisopropyl phosphoramidite

5'-O-DMT-2'-deoxy-2'-β- (OH) -2'-α-methyl-adenosine is the compound 5'-3'-protected 2'-ketoadenosine (Rosenthal, Sprinzl and Baker, Tetrahedron Lett. 4,233, 1970; see also with nucleic acid related compounds. A convenient way to synthesize 2'- and 3'-ketone nucleosides is from Hansske et al., Dep. Chem., Univ. Alberta, Edmonton, Can., Tetrahedron Lett. (1983) 24 (15), 1589-1592.) By Grigand addition of McMgI in the solvent THF synthesized, followed by the separation of the isomers. This is 2-β- (OH) protected as acetate. The 5'-3'-acetal group is removed, the 5'-position dimethoxytrityliert, the N-6 position is benzoylated and then the 3'-position phosphitylated to give 5'-O-DMT-2'-deoxy-2'-β- (O-acetyl) -2'-α-methyl-N6- benzoyladenosine-3 '- (2-cyanoethyl-N, N-diisopropyl) phosphoramidite to surrender.

EXAMPLE 71

Synthesis of 5'-O-DMT-2'-α-ethynyl-N6-benzoyl-adenosine-3'- (2-cyanoethyl-N, N-diisopropyl-phosphoramidite

5'-O-DMT-2'-deoxy-2'-β- (OH) -2'-α-ethynyl-adenosine is the compound 5'-3'-protected 2'-ketoadenosine (Rosenthal, Sprinzl and Baker, Tetrahedron Lett. 4,233, 1970) by Grigand addition of ethynyl-MgI in the solvent THF synthesized, followed by the separation of the isomers. The 2'-β- (OH) is synthesized by Robins's Deoxygenation procedure (Robins et al., J. Am. Chem. Soc. (1983), 105, 4059-4655). The 5'-3'-acetal group is removed, the 5'-position dimethoxytritylated, the N-6 position is benzoylated and then the 3'-position phosphitylated to give the title compound.

EXAMPLE 72

2'-O- (Guajacolyl) -5-methyluridine

2-Methoxyphenol (6.2 g, 50 mmol) was added slowly with stirring to a solution of borane in tetrahydrofuran (1 M, 10 mL, 10 mmol) in a 100 mL bomb. Upon dissolution of the solid, hydrogen gas evolved. O-2,2'-Anhydro-5-methyluridine (1.2 g, 5 mmol) and sodium bicarbonate (2.5 mg) were added and the bomb capped, placed in an oil bath and heated to 155 ° C for 36 hours heated. The bomb was cooled to room temperature and opened. The crude solution was concentrated and the residue was partitioned between water (200 ml) and hexanes (200 ml). The excess phenol was extracted into hexanes. The aqueous layer was extracted with ethyl acetate (3 × 200 ml) and the combined organic layer was washed once with water, dried over anhydrous sodium sulfate and concentrated. The residue was purified by silica gel flash column chromatography using methanol: methylene chloride (1/10, v / v) as the eluent. The fractions were collected, the target fractions were concentrated to give 490 mg of pure product as a white solid. R _f = 0.545 in CH ₂ Cl ₂ / CH ₃ OH (10: 1). MS / ES for C ₁₇ H ₂₀ N ₂ O ₇ , 364.4; found 364.9.

EXAMPLE 73

5'-Dimethoxytrityl-2'-O- (2-methoxyphenyl) -5-methyluridine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite

2'-O- (guaiacolyl) -5-methyl-uridine is treated with 1.2 equivalents of dimethoxytrityl chloride (DMT-Cl) in pyridine to afford the 5'-O-dimethoxytritylated nucleoside. After evaporation of the pyridine and work-up (CH ₂ Cl ₂ / saturated NaHCO ₃ solution), the compound is purified in a silica gel column. The 5'-protected nucleoside is dissolved in anhydrous methylene chloride and under an argon atmosphere, N, N-diisopropylaminohydrotetrazolide (0.5 equivalent) and bis-N, N-diisopropylamino-2-cyanoethylphosphoramidite (2 equivalents) are added via syringe for 1 min added thereto. The reaction mixture is stirred at room temperature for 16 hours under argon and then placed on a silica column. Elution with hexane: ethyl acetate (25:75) gives the title compound.

EXAMPLE 74

5'-Diatethoxytrityl-2'-O- (2-methoxyphenyl) -5-methyluridine-3'-O-succinct

The 5'-protected nucleoside of Example 73 is treated with 2 equivalents of succinic anhydride and 0.2 equivalents of 4-N, N-dimethylaminopyridine in pyridine. After 2 hours, the pyridine is evaporated, the residue is dissolved in CH ₂ Cl ₂ and washed three times with 100 ml of 10% citric acid solution. The organic layer is dried over anhydrous MgSO ₄ to give the desired succinate. The succinate is then attached to porous glass (CPG) using well-established procedures (Pon, RT, Solid phase supports for oligonucleotide synthesis, in Protocols for Oligonucleotides and Analogs, S. Agrawal (Ed.), Humana Press: Totawa, NJ, 1993 , 465 to 496).

EXAMPLE 75

5'-dimethoxytrityl-2'-O- (trans-2-methoxycyclohexyl) -5-methyluridine

2'-3'-O-Dibutylstannyl-5-methyluridine (Wagner et al., J. Org. Chem., 1974, 39, 24) is prepared at 70 ° C in DMF with trans-2-methoxycyclohexyl-tosylate alkylated. In this reaction, a 1: 1 mixture of 2'-O- and 3'-O- (trans-2-methoxycyclohexyl) -5-methyluridine receive. After evaporation of the solvent DMF, the crude mixture dissolved in pyridine and treated with dimethoxytrityl chloride (DMT-Cl) (1.5 eq.). The resulting Mixture is purified by silica gel flash column chromatography to make the title connection.

EXAMPLE 76

5'-dimethoxytrityl-2'-O- (trans-2-methoxycyclohexyl) -5-methyluridine-3'-O- (2-cyanoethyl-N, N-diisopropylamino) phosphoramidite

5'-dimethoxytrityl-2'-O- (trans-2-methoxycyclohexyl) -5-methyluridine according to the above phosphitylated to the required To give phosphoramidite.

EXAMPLE 77

5'-dimethoxytrityl-2'-O- (trans-2-methoxycyclohexyl) -5-methyluridine-3'-O- (succinyl-amino) -CPG

5'-dimethoxytrityl-2'-O- (trans-2-methoxycyclohexyl) -5-methyluridine succinylated and attached to porous glass attached, around the fixed carrier to give bound nucleoside.

EXAMPLE 78

Trans-2-ureido-cyclohexanol

Trans-2-amino-cyclohexanol (Aldrich) is combined with triphosgene in methylene chloride (1/3 equivalent) treated. To the resulting solution Ammonium hydroxide is in excess to give the title compound after work-up.

EXAMPLE 79

2'-O- (trans-2-Uriedo-cyclohexyl) -5-methyluridine

Trans-2-Uriedo-cyclohexanol (50 mmol) is stirred to a solution of borane in tetrahydrofuran (1 M, 10 mL, 10 mmol) in a 10 mL bomb given. When loosening the reactant evolves hydrogen gas. The bomb will be 02,2'-Anhydro-5-methyluridine (5 mmol) and sodium bicarbonate (2.5 mg) are added and they are locked. Then she will for 72 h at 140 ° C heated. The bomb is cooled to room temperature and opened. The raw material became worked up as illustrated above, followed by cleaning by means of Silica gel flash column chromatography to make the title connection.

EXAMPLE 80

5'-O- (dimethoxytrityl) -2'-O- (trans-2-uriedo-cyclohexyl) -3'-O- (2-cyanoethyl-N, N, -diisopropyl) uridine phosphoramidite

2'-O- (trans-2-Uriedo-cyclohexyl) -5-methyluridine follows the procedures outlined in Example 2 are at the 5'-OH tritylated and at the 3'-OH phosphitylated to give the title compound.

EXAMPLE 81

5'-O-dimethoxytrityl-2'-O- (trans-2-uriedo-cyclohexyl) -5-methyl-3'-O- (succinyl) -amino CPG uridine

5'-O-dimethoxytrityl-2'-O- (trans-2-uriedo-cyclohexyl) -5-methyluridine succinylated and attached to CPG as illustrated above.

EXAMPLE 82

2'-O- (trans-2-methoxy-cyclohexyl) adenosine

Trans-2-methoxycyclopentanol, trans-2-methoxy-cyclohexanol, trans-2-methoxy-cyclopentyl tosylate and trans-2-methoxycyclohexyl tosylate are prepared according to the procedures given (Roberts, D.D., Hendrickson, W., J. Org. Chem., 1967, 34, 2.415 to 2.417; J. Org. Chem., 1997, 62, 1.857 to 1.859). A solution of adenosine (42.74 g, 0.16 mol) in dry dimethylformamide (800 ml) at 5 ° C is prewashed with sodium hydride (8.24 g, 60% in oil, three times with hexanes, 0.21 mol). After stirring for 30 minutes trans-2-methoxycyclohexyl tosylate (0.16 mol) was added over 20 minutes at 5 ° C. The reaction mixture is stirred at room temperature for 48 h and then filtered through Celite. The filtrate is concentrated under reduced pressure Concentrated by evaporation, followed by coevaporation with toluene (2 × 100 ml), to make the title connection.

EXAMPLE 83

N ⁶ -benzoyl-2'-O- (trans-2-methoxycyclohexyl) adenosine

A solution of 2'-O- (trans-2-methoxy-cyclohexyl) adenosine (0.056 mol) in pyridine (100 ml) is added under reduced pressure Dry evaporated. The residue is redissolved in pyridine (560 ml) and in an ice-water bath cooled. Trimethylsilyl chloride (36.4 ml, 0.291 mol) is added and the Reaction mixture stirred at 5 ° C for 30 minutes. Benzoyl chloride (33.6 ml, 0.291 mol) is added and the reaction mixture is allowed to stand for 2 hours at 25 ° C heat leave and then to 5 ° C cooled. The reaction mixture is washed with cold water (112 ml) and after stirring for 15 minutes concentrated ammonium hydroxide (112 ml). After 30 minutes, the reaction mixture concentrated under reduced pressure (below 30 ° C), followed by co-evaporation with toluene (2 × 100 ml). The residue is dissolved in ethyl acetate-methanol (400 ml, 9: 1) and the undesirable Silyl by-products are removed by filtration. The filtrate is concentrated under reduced pressure and purified by silica gel flash column chromatography (800 g, Chloroform / methanol 9: 1). Selected fractions are merged concentrated under reduced pressure and at 25 ° C / 0.2 mm Hg for 2 dried to give the title compound.

EXAMPLE 84

N ⁶ -Benzoyl-5'-O- (dimethoxytrityl) -2'-O- (trans-2-methoxycyclohexyl) adenosine

A solution of N ⁶ -benzoyl-2'-O- (trans-2-methoxycyclohexyl) adenosine (0.285 mol) in pyridine (100 ml) is evaporated under reduced pressure to an oil. The residue is redissolved in dry pyridine (300 ml) and 4,4'-dimethoxy-triphenylmethyl chloride (DMT-Cl, 10.9 g, 95%, 0.31 mol) added. The mixture is stirred for 16 h at 25 ° C and then poured onto a solution of sodium bicarbonate (20 g) in ice-water (500 ml). The product is extracted with ethyl acetate (2 x 150 ml). The organic layer is washed with brine (50 ml), dried over sodium sulfate (powdered) and evaporated under reduced pressure (below 40 ° C). The residue is chromatographed on silica gel (400 g, ethyl acetate-hexane 1: 1). Selected fractions were combined, concentrated under reduced pressure and dried at 25 ° C / 0.2 mm Hg to give the title compound.

EXAMPLE 85

[N ⁶ -benzoyl-5'-O- (4,4'-dimethoxytrityl) -2'-O- (trans-2-methoxycyclohexyl) adenosine-3'-O-yl] -N, N-diisopropylaminocyanoethoxyphosphoramidite

Phosphitylation of N ⁶ -benzoyl-5'-O- (dimethoxytrityl) -2'-O- (trans-2-methoxycyclohexyl) adenosine was performed as illustrated above to give the title compound.

EXAMPLE 86

General ways of working for, synthesis of chimeric C3'-endo and C2'-endo-modified oligonucleotides

oligonucleotides be in a nucleic acid synthesis system PerSeptive Biosystems Expedite 8901 synthesized. For each Oligonucleotide are carried out several 1 mmol syntheses. Of the 3'-end nucleoside containing solid carriers gets into the column brought in. Trityl groups are removed with trichloroacetic acid (975 ml while one minute) followed by an acetonitrile wash. The oligonucleotide is using a modified diester (P = O) or thioate (P = S) rule built up.

Phosphodiester provision

All Standard amidites (0.1 M) will be used during a 1.5-minute timeframe coupled and give 105 ul Material. All new amidites are dissolved in dry acetonitrile (100 mg amidite / 1 ml acetonitrile) about 0.08 to 0.1 M solutions to surrender. The 2'-modified amidites (both ribo and arabino monomers) are made using 210 μl while doubly coupled for a total of 5 minutes. The total coupling time is about 5 minutes (210 ml Amidite). 1-H-tetrazole in acetonitrile is used as the activating agent used. Excess amidite is washed away with acetonitrile. (1S) - (+) - (10-camphorsulfonyl) oxaziridine (CSO, 1.0 g CSO / 8.72 ml dry acetonitrile) is used for oxidation (3-minute wait step), which is about 375 μl Oxidizing agent supplies. Standard amidites are over a period of 3 minutes (210 μl).

Phosphorothioate provision

The 2'-modified amidite is double coupled using 210 μl for a total of 5 minutes. The amount of oxidizer, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent, 3.4 g Beaucage reagent / 200 ml acetonitrile) is 225 μl (one minute wait step). The unreacted nucleoside is capped with a 50:50 mixture of tetrahydrofuran / acetic anhydride and tetrahydrofuran / pyridine / 1-methylimidazole. The trityl yields were monitored by the trityl monitor for the duration of the synthesis. The final DMT group was left intact. After synthesis, the contents of the synthesis cartridge (1 mmole) are transferred to a Pyrex vial and the oligonucleotide eluted using the 30% ammonium hydroxide (NH ₄ OH, 5 mL) for about 16 hours at 55 ° C from the porous glass (CPG ) cleaved.

Oligonucleotide Purification

After the deprotection step, samples are filtered off the CPG using Gelman 0.45 μm nylon acrodisc syringe filters. Excess NH ₄ OH is evaporated in a Savant AS160 Automatic Speedvac. Crude yield is measured in a Hewlett Packard diode array spectrophotometer 8452A at 260 nm. The raw samples are then analyzed in a Hewlett Packard mass spectrometric electrospray mass spectrometer (MS). Trityl on oligonucleotides are purified by preparative reverse phase high performance liquid chromatography (HPLC). The HPLC conditions are as follows: Waters 600E with detector 991; Column Waters Delta Pak C4 (7.8 × 300 mm); Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; Solvent B: 100% acetonitrile; Flow rate 2.5 ml / min; Gradient: 5% B during the first five minutes, with a linear increase from B to 60% during the next 55 minutes. Fractions containing the desired product / s (retention time = 41 minutes for DMT-ON-16314, retention time = 42.5 minutes for DMT-ON-16315) are collected and the solvent is dried away in the SpeedVac. The oligonucleotides are detritylated in 80% acetic acid for about 60 minutes and lyophilized again. Free trityl and excess salt are removed by placing the detritylated oligonucleotides through Sephadex G-25 (size exclusion chromatography) and collecting appropriate samples using a Pharmacia fraction collector. The solvent is again evaporated in a Speedvac. The purified oligonucleotides are then purified by CGE, HPLC (Flow rate 1.5 ml / min, column Waters Delta Pak C4, 3.9 x 300 mm) and MS analyzed for purity. The final yield is determined by means of a spectrophotometer at 260 nm.

EXAMPLE 87

Fast amplification of 5 'cDNA end (5'-RACE) and 3'-cDNA end (3'-RACE)

An Internet search in the XREF database at the National Center for Biotechnology Information (NCBI) revealed a 361 base pair (bp) human expressed sequenced tag (bp) (EST, GenBank Accession No. H28861), which was transformed into yeast RNase H (RNH1 Protein Sequenced Tag (EST, GenBank Accession No. Q04740) and its chicken homolog (Accession No. D26340). Three sets of oligonucleotide primers encoding the human RNase H EST sequence were synthesized. The sense primers were ACGCTGGCCGGGAGTCGAAATGCTTC (H1: SEQ ID NO: 6), CTGTTCCTGGCCCACAGAGTCGCCTTGG (H3: SEQ ID NO: 7), and GGTCTTTCTGACCTGGAATGRGTGCAGAG (H5: SEQ ID NO: 8). The antisense primers were CTTGCCTGGTTTCGCCCTCCGATTCTTGT (H2: SEQ ID NO: 9), TTGATTTTCATGCCCTTCTGAAACTTCCG (H4; SEQ ID NO: 10), and CCTCATCCTCTATGGCAAACTTCTTAAATCTGGC (H6; SEQ ID NO: 11). The human RNase H 3 'and 5' cDNAs derived from the EST sequence were amplified by polymerase chain reaction (PCR) using human liver or leukemia cell line (lymphoblastic, Molt-4) marathon -Ready cDNA as templates, H1 or H3 / AP1 and H4 or H6 / AP2 as a primer (Clontech, Palo Alto, CA). The fragments were subjected to agarose gel electrophoresis and transferred to nitrocellulose membrane (Bio-Rad, Hercules CA) for confirmation by Southern blot using ³² P-labeled H2 and H1 probes (for 3 'and 5' RACE respectively). Products) according to procedures described by Ausubel et al., Current Protocols in Molecular Biology, Wiley and Sons, New York, NY, 1988. The confirmed fragments were excised from the agarose gel and purified by gel extraction (Qiagen, Germany), then subcloned into Zero Blunt vector (Invitrogen, Carlsbad, CA) and DNA sequenced.

EXAMPLE 88

Searching the cDNA library, DNA sequencing and sequence analysis

A Lambda phage Uni ZAP library of human liver cDNA (Stratagene, La Jolla, CA) was identified as being specific using the RACE products Probes searched. The positive cDNA clones were inserted into the pBluescript phagemid (Stragene, La Jolla, CA) of lambda phage and DNA sequencing with an automatic DNA sequencer (Applied Biosystems, Foster City, Calif.) By Retrogen Inc. (San Diego, CA). The overlapping Sequences were constructed using the assembler programs of MacDNASIS v3.0 (Hitachi Software Engineering America, South San Francisco, CA) and combined. The protein structure and subsequence analysis were using the program of MacVector 6.0 (Oxford Molecular Group Inc., Campbell, CA). A homology search was carried out via internet e-mail in the NCBI database.

EXAMPLE 89

Northern blot and Southern blot analysis

Total RNA from various human cell lines (ATCC, Rockville, MD) was prepared according to procedures described by Ausubel et al., Current Protocols in Molecular Biology, Wiley and Sons, New York, NY, 1988, and the formaldehyde agarose gel Electrophoresis and transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA). Northern blot hybridization was in QuickHyb buffer (Stratagene, La Jolla, CA) with ³² P-labeled probe from RNase H cDNA full length clone or primer H1 / H2 PCR-generated, N-terminal 322- Base RNase H cDNA fragment was performed at 68 ° C for 2 hours. The membranes were washed twice with 0.1% SSC / 0.1% SDS for 30 minutes and subjected to autoradiography. Southern blot analysis was performed in 1X pra-hybridization / hybridization buffer (BRL, Gaithersburg, MD) with a ³² P-labeled C-terminal restriction enzyme PstI / PvuII fragment of 430 bp or a 1.7- Full-length kb cDNA probe was performed at 60 ° C for 18 hours. The membranes were washed twice with 0.1 SSC / 0.1% SDS for 30 minutes at 60 ° C and subjected to autoradiography.

EXAMPLE 90

expression and purification of the cloned RNase protein

The cDNA fragment encoding the full RNase H protein sequence was amplified by PCR using 2 primers, one of which was a restriction enzyme NdeI site adapter and six histidine (His-tag) codons and N-terminal 22 contains -bp protein coding sequence. The fragment was cloned into expression vector pET17b (Novagen, Madison, WI) and confirmed by DNA sequencing. The plasmid was transfected into E. coli BL21 (DE3) (Novagen, Madison, WI). The bacteria were grown in M9ZB medium at 32 ° C and harvested when the OD _{600 of} the culture reached 0.8 according to procedures described by Ausubel et al., Current Protocols in Molecular Biology, Wiley and Sons, New York, NY , 1988. Cells were lysed in 8 M urea solution, and recombinant protein was partially purified with Ni-NTA agarose (Qiagen, Germany). Further purification was by C4 reverse phase chromatography (Beckman, System Gold, Fullerton, CA) with 0.1% TFA / water and 0.1 TFA / acetonitrile with a gradient from 0% to 80% in 40 minutes as described by Deutscher, MP, Guide to Protein Purification, Methods in Enzymology 182, Academic Press, New York, NY, 1990. The recombinant proteins and control samples were collected, lyophilized and subjected to 12% SDS-PAGE as described by Ausubel et al. (1988) Current Protocols in Molecular Biology, Wiley and Sons, New York, NY. The purified protein and control samples were resuspended in 6M urea solution containing 20mM Tris-HCl, pH 7.4, 400mM NaCl, 20% glycerol, 0.2mM PMSF, 5mM DTT, 10μg / ml aprotinin and leupeptin refolded by dialysis with decreasing urea concentration of 6 M to 0.5 M and DTT concentration of 5 mM to 0.5 mM as described by Deutscher, MP, Guide to Protein Purification, Methods in Enzymology 182, Academic Press, New York, NY, 1990. The refolded proteins were concentrated (10X) using Centricon (Amicon, Danvers, MA) and subjected to the RNase H activity assay.

EXAMPLE 91

RNase H activity assay

³² P-end labeled 17-mer RNA, GGGCGCCGTCGGTGTGG (SEQ ID NO: 12), described by Lima, WF and Crooke, ST, Biochemistry, 1997, 36, 390-398, was gel purified as described by Ausubel et al ., Current Protocols in Molecular Biology, Wiley and Sons, New York; NY, 1988, and to its complementary 17-mer oligodeoxynucleotide in a ten-fold excess or a 5-base DNA gapmer, ie, a 17-mer oligonucleotide having a central portion of 5 deoxynucleotides (the "gap") Attachment was performed in 10mM Tris-HCl, pH 8.0, 10mM MgCl ₂ , 50mM KCl and 0.1mM DTT to one of three different substrates (a) single-stranded (ss) RNA probe, (b) complete RNA / DNA duplex and (c) RNA / DNA gapmer duplex Each of these substrates was incubated with protein samples at 37 ° C for 5 minutes to 2 Hours were incubated under the same conditions used in the ring-forming operation and the reactions were terminated by adding EDTA according to the procedures described by Lima, WF and Crooke, ST, Biochemistry, 1997, 36, 390-398.

The Reaction mixtures were separated by TCA centrifugation, and the supernatant was determined by liquid scintillation counting (Beckman LS6000IC, Fullerton, CA). An aliquot of the reaction mixture was also denaturing (8 M urea) acrylamide gel electrophoresis according to procedures Lima, W.F. and Crooke, S.T., Biochemistry, 1997, 36, 390-398 and Ausubel et al., Current Protocols in Molecular Biology, Wiley and Sons, New York, NY, 1988.

EXAMPLE 92

Effects of phosphorothioate substitution and the substrate length on digestion by human RNase H1 (see Table 4)

Oligoribonucleotides were pre-annealed to complementary antisense oligodeoxynucleotides at 10 nM and 20 nM, respectively, and subjected to digestion by human RNase H1. The 17-mer (RNA # 1) and 25-mer (RNA # 3) RNA sequences are derived from Harvy RAS oncogene 51, and the 25-mer RNA contains the 17-mer sequence. The 20mer sequence (RNA # 2) is derived from the core protein coding sequence of human hepatitis C virus (52). Initial rates were determined as described in "Materials and Methods", Figure 1A: Comparison of initial rates of cleavage of an RNA: phosphodiester (P = O) and an RNA: phosphorothioate (P = S) duplex, and Figure 1B: Comparison of duplices of different sequences and lengths.

EXAMPLE 93

Effects of 2'-substitution and the deoxy gap size on the Rates of digestion by human RNase-H1 (see Table 5)

Substrate duplexes were hybridized and initial rates determined as described in Table 4 and described in "Materials and Methods." The 17-mRNA is the same as that used in Table 4 and the 20-mRNA (UGGUGGGCAAUGGGCGUGUU (SEQ ID NO: 20), RNA # 4, is derived from the sequence of protein kinase C-zeta (53) The 17-mer and 20-mer PS oligonucleotides were complete deoxy phosphorothioate containing no 2 'modifications -, 5-, 4- and 3-deoxy-gap oligonucleotides were 17-mer oligonucleotides with a central part consisting of nine, seven, five and four deoxynucleotides flanked on both sides by 2'-methoxynucleotides (see also 2 ). Boxed boxes indicate the position of the 2'-methoxy-modified residues. Sequence in dashed boxes indicates the position of the 2'-propoxy-modified radicals.

EXAMPLE 94

Kinetic constants RNase H1 cleavage of RNA: DNA duplexes (see Table 6)

The RNA: DNA duplexes in Table 4 were used to obtain Km and Vmax of to determine human and E. coli RNase H1 as described in the section "Materials and methods ".

EXAMPLE 95

Binding constants and specificity of RNasen-H (see Table 7)

The K _d were determined as described in "Materials and Methods." The K _d for E. coli RNase H1 was derived from previously reported data (21) The Competing Substrates (Compound Inhibitors) Used in the Binding Study are classified into two categories: single-stranded (ss) oligonucleotides and oligonucleotide duplexes, all with the 17-mer sequence as in Table 4 (RNA No. 1) .The single-stranded oligonucleotides include: ssRNA, ssDNA, ss fully modified 2 'Methoxy Phosphodiester Oligonucleotide (ss 2'-O-Me) and ss Complete Phosphorothioate Deoxyoligonucleotide (ssDNA, P = S) The duplex substrates include: DNA: DNA duplex, RNA: RNA duplex, DNA: fully modified 2' Fluoro or fully modified 2'-methoxy oligonucleotide (DNA: 2'-F or 2'-O-Me), RNA: 2'-F or -2'-O-Me duplex. The dissociation constants are from ≥ 3 slopes derived from the Lineweaver-Burk and / or Augustisson analysis Estimated errors for the Dissoci Ation constants are 2-fold. Specificity is defined by dividing the Kd for a duplex by the K _d for an RNA: RNA duplex.

Table 4 A

B

Table 5

• * Table legend for sequence

Table 6

Table 7

MODES

OPERATION 1

ICAM-1 expression

Oligonucleotide treatment from HUVECs

Cells were washed three times with Opti-MEM (Life Technologies, Inc. preheated to 37 ° C. Oligonucleotides were premixed with 10 g / ml Lipofectin (Life Technologies, Inc.) in Opti-MEM, in-line to the desired concentrations diluted and applied to the washed cells treated (no oligonucleotides) control cells were also treated with Lipofectin. The cells were incubated for 4 hours at 37 ° C, after which the medium was removed and replaced with standard growth medium with or without 5 mg / ml TNF-α (R & D Systems). Incubation at 37 ° C was continued until the indicated times.

Quantification of ICAM-1 protein expression by means of fluorescence-activated cell sorter

Cells were removed from the plate surfaces by brief trypsinization with 0.25% trypsin in PBS. The trypsin activity was quenched with a solution of 2% bovine serum albumin and 0.2% sodium azide in PBS (+ Mg / Ca). The cells were pelleted by centrifugation (1000 rpm, Beckman GPR centrifuge), resuspended in PBS and stained with 3 L / 10 ⁵ cells of the ICAM-1 specific antibody, CD54-PE (Pharmingin). The antibodies were incubated with the cells for 30 minutes at 4 ° C in the dark with gentle stirring. The cells were washed by centrifugation and then resuspended in 0.3 ml FacsFlow buffer (Becton Dickinson) with 0.5% formaldehyde (Polysciences). The expression of the ICAM-1 on the cell surface was then determined by flow cytometry using a Becton Dickinson FACScan. The percentage of control ICAM-1 expression was calculated as follows: [(value for oligonucleotide-treated ICAM-1) - (value for basal ICAM-1) / (value for untreated ICAM-1) - (value for basal ICAM 1)] (Baker, Brenda, et al., 2'-O- (2-Methoxy) ethyl-modified Anti-intercellular Adhesion Molecule 1 (ICAM-1) Oligonucleotides Selectively Increase the ICAM-1 mRNA Level and Inhibit Formation of the ICAM-1 Translation Initiation Complex in Human Umbilical Vein Endothelial Cells, The Journal of Biological Chemistry, 272, 11994 to 12000, 1997).

The ICAM-1 expression chimeric C3'-endo and C2'-endomodified Oligonucleotides of the invention are obtained by reducing the ICAM-1 levels measured in treated HUVEC cells. It is believed, that the oligonucleotides by means of the RNase-H cleavage mechanism Act. Suitable control oligonucleotides with mixed sequence are used as controls. They have the same base composition like the test sequence on.

sequences which are the chimeras C3'-endo (2'-MOE) and C2'-endo modifications (one of the following Modifications: 2'-S-Me, 2'-Me, 2'-ara-F, 2'-ara-OH, 2'-ara-O-Me), as listed in Table X below, are prepared and tested in the above assay. SEQ ID NO: 14, on c-Raf targeting oligonucleotide is used as a control.

Table X Oligonucleotides containing chimeric 2'-O- (2-methoxyethyl) and 2-S (methyl) modifications

All nucleosides in bold are 2'-O- (2-methoxyethyl); subscript s indicates a phosphorothioate bond; underlined nucleosides indicate 2'-S-Me modification; superscript m at C (C ^m ) indicates a 5-methyl-C.

Table XI Oligonucleotides containing chimeric 2'-O- (2-methoxyethyl) and 2'-O- (methyl) modifications

All nucleosides in bold are 2'-O- (2-methoxyethyl); subscript s indicates a phosphorothioate bond; underlined nucleosides indicate 2'-methyl modification; superscript m at C (C ^m ) indicates a 5-methyl-C.

Table XII Oligonucleotides containing chimeric 2'-O- (2-methoxyethyl) and 2'-ara (fluoro) modifications

All nucleosides in bold are 2'-O- (2-methoxyethyl); subscript s indicates a phosphorothioate bond; underlined nucleosides indicate 2'-ara (fluoro) modification; superscript m at C (C ^m ) indicates a 5-methyl-C.

Table XIII Oligonucleotides containing chimeric 2'-O- (2-methoxyethyl) and 2'-ara (OH) modifications

All nucleosides in bold are 2-O- (methoxyethyl); subscript s indicates a phosphorothioate bond; underlined nucleosides indicate 2'-ara (OH) modification; superscript m at C (C ^m ) indicates a 5-methyl-C.

Table XIV Oligonucleotides containing chimeric 2'-O- (2-methoxyethyl) and 2'-ara (OMe) modifications

All nucleosides in bold are 2-O- (methoxyethyl); subscript s indicates a phosphorothioate bond; underlined nucleosides indicate 2'-ara (OMe) modification; superscript m at C (C ^m ) indicates a 5-methyl-C.

OPERATION 2

Enzymatic degradation of 2'-O-modified oligonucleotides

Three Oligonucleotides incorporating the modifications at the 3 'end which are shown in Table 2 below are synthesized. These modified oligonucleotides are the action of snake venom phosphodiesterase exposed.

Oligonucleotides (30 nanomoles) are dissolved in 20 ml of buffer containing 50 mM Tris-HCl pH 8.5, 14 mM MgCl ₂ and 72 mM NaCl. To this solution are added 0.1 unit of snake venom phosphodiesterase (Pharmacia, Piscataway, NJ), 23 units of nuclease P1 (Gibco LBRL, Gaithersberg, MD) and 24 units of calf intestinal phosphatase (Boehringer Mannheim, Indianapolis, IN), and the reaction mixture is incubated at 37 ° C for 100 hours. HPLC analysis is performed using a Waters model 715 automatic injector, a Model 600E pump, a Model 991 detector, and a 4.6 x 250 mm nucleoside / nucleotide column from Alltech (Alltech Associates, Inc., Deerfield, IL ) carried out. All analyzes are carried out at room temperature. The solvents used are A: water and B: acetonitrile. The analysis of the nucleoside composition is carried out with the following gradient: 0 to 5 min, 2% B (isocratic); 5 to 20 minutes, 2% B to 10% B (linear); 20 to 40 minutes, 10% B to 50% B. The integrated area per nanomole is determined using nucleoside standards. Relative nucleoside ratios are calculated by converting integrated areas to molar values and comparing all values with thymidine, which is set to its expected value for each oligomer.

Table XV Relative nuclease resistance of 2'-modified chimeric oligonucleotides

OPERATION 3

General working method to judge chimeric C3'-endo and C2'-endo-modified Oligonucleotides targeting Ha-Ras

Various Types of human tumors, including sarcomas, neuroblastomas, leukemia and lymphomas, contain active oncogenes of the Ras gene family. Ha-Ras is a family of small molecular weight GTPases whose Function is it, by transfer of signals to regulate cell proliferation and differentiation, which leads to a constitutive activation of Ras, and are high Percentage of different cancers associated with humans. Therefore Ras is an attractive target for therapeutic anti-cancer strategies represents.

The parent sequence (SEQ ID NO: 27) in Table XV is a 20-base phosphorothioate oligodeoxynucleotide designed to initiate the translation region of human Ha-Ras and, based on screening assays, a potent isotype-specific inhibitor of Ha-Ras in Cell culture (IC50 = 45 nm). Treatment of cells in vitro with this sequence results in a rapid reduction in Ha-rasmRNA and protein synthesis and inhibition of proliferation of cells containing an activating Ha-Ras mutation. When administered in doses of 25 mg / kg or smaller by daily intraperitoneal injection (IP), this sequence has potent antitumor activity in a variety of tumor xenograft models, whereas mismatch controls have no antitumor activity. It has been demonstrated that this sequence is active against a variety of tumor types, including lung, breast, bladder and pancreas, in mouse xenograft studies (Cowsert, LM Anti-cancer drug design, 1997, 12, 359-371). A second generation analog with SEQ ID NO: 27 in which the 5 'and 3' terminus ("wings") of the sequence are modified with 2'-methoxyethyl (MOE) modification and retain the backbone as a phosphorothioate (Table XV, control gapmer with MOE control), has an IC ₅₀ of 15 nm in cell culture assays, thus a 3-fold improvement in efficacy is found in this chimeric analogue, due to the improved nuclease resistance of the 2 'antibody. This sequence will increase the duration of the antisense effect in vitro, which will be related to the frequency of administration of this drug to cancer patients, and this sequence is currently being assessed in Ras-dependent tumor models (Cowsert, LM Anti-cancer drug design , 1997, 12, 359-371) The parent compound, SEQ ID NO: 27, is in Phase I clinical trials of solid tumors by systemic infusion.

Antisense oligonucleotides with the 2'-Me modification are prepared in the manner described and in the assays mentioned above checked, about the activity to determine.

Ha-ras antisense oligonucleotides with chimeras C3'-endo and C2'-endo modifications and their controls

Table XV Ha-Ras antisense oligonucleotides with chimeric C3'-endo and C2'-endo modifications and their controls

All underlined sequence parts are 2'-Me.

OPERATION 7

In vivo nuclease

The in vivo nuclease resistance chimeric C3'-endo and C2'-endo-modified Oligonucleotide is expressed in mouse plasma and tissues (kidney and liver) examined. For this purpose, the c-Raf oligonucleotide series SEQ ID NO: 32, and the following five oligonucleotides used in are listed in the table below their relative nuclease resistance assessed.

Table XVI Examination of in vivo nuclease resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-S-Me) -modified oligonucleotides with and without nuclease-resistant caps (2 ') 5'-phosphate or phosphorothioate bond with 3'-O-MOE at cap ends)

Table XVII Study of in vivo nuclease resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-Me) modified oligonucleotides with and without nuclease-resistant caps (2'-5 ' Phosphate or phosphorothioate bond with 3'-O-MOE at cap ends)

Table XVIII Study of in vivo nuclease resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-ara-F) -modified oligonucleotides with and without nuclease-resistant caps (2 ') 5'-phosphate or phosphorothioate bond with 3'-O-MOE at cap ends)

Table XIX Investigation of in vivo nuclease resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-ara-OH) -modified oligonucleotides with and without nuclease-resistant caps (2 ') 5'-phosphate or phosphorothioate bond with 3'-O-MOE at cap ends)

Table XX Examination of in vivo nuclease resistance of chimeric C3'-endo (2'-O-MOE) and C2'-endo (2'-ara-OMe) -modified oligonucleotides with and without nuclease-resistant caps (2'-ol) 5'-phosphate or phosphorothioate bond with 3'-O-MOE at cap ends)

OPERATION 8

animal studies on in vivo nuclease resistance

For each oligonucleotide to be tested, 9 male BALB / c mice (Charles River, Wilmington, Mass.) Weighing about 25 g are used (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923). , Following a one-week acclimation, the mice receive a single tail vein injection of oligonucleotide (5 mg / kg) administered in phosphate buffered saline (PBS), pH 7.0. The final concentration of oligonucleotide in the dosing solution for the PBS formulations is (5 mg / kg). Each group will receive a retrobulbar blood sample (either at 0.25, 0.5, 2 or 4 h post-dose) and a terminal blood sample (either 1, 3, 8 or 24 hours after administration). The terminal blood sample (about 0.6 to 0.8 ml) is taken by cardiac puncture following ketamine / xylazine anesthesia. The blood is transferred to an EDTA coated collection tube and centrifuged to obtain plasma. Finally, each mouse's liver and kidneys will be taken. Plasma and tissue homogenates will be used for analysis to determine the intact oligonucleotide content by CGE. All samples are immediately frozen on dry ice after collection and stored at -80 ° C until analysis.

OPERATION 9

RNase H studies with chimeras C3'-endo and C2'-endo-modified oligonucleotides with and without nuclease resistant cut

Labeling oligonucleotides with ³² P

The oligoribonucleotide (sense strand) was labeled with ³² P at the 5 'end using [ ³² P] ATP, T4 polynucleotide kinase and standard procedures (Ausubel, FM, Brent, R., Kingston, RE, Moore, DD , Seidman, JG, Smith, JA and Struhl, K., in Current Protocols in Molecular Biology, John Wiley, New York (1989)). The labeled RNA was purified by electrophoresis on 12 denaturing PAGE (Sambrook, J., Frisch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Plainview (1989)). The specific activity of the labeled oligonucleotide was about 6,000 cpm / fmol.

Determination of RNase H cleavage patterns

Hybridization reaction mixtures containing 750 nM antisense oligonucleotide, 500 nM sense oligoribonucleotide and 100,000 cpm ³² P-labeled sense oligoribonucleotide were dissolved in 120 μl reaction buffer [20 mM Tris-HCl (pH 7.5), 20 mM KCl, 10 mM MgCl ₂ , 0.1 mM DTT]. The reaction mixtures were heated to 90 ° C for 5 min and 1 unit inhibit-ACE was added. The samples were incubated overnight at 37 ° C. The hybridization reaction mixtures were incubated at 37 ° C with 1.5 x 10.8 ^-8 mg E. coli RNase H enzyme for initial rate determinations and then deleted at specific times. Samples were analyzed by trichloroacetic acid (TCA) assays or by denaturing polyacrylamide gel electrophoresis as described above [Crooke, ST, Lemonidis, KM, Neilson, L., Griffey, R., Lesnik, EA, and Monia, BP, Kinetic characteristics of Escherichia coli RNase H1: cleavage of various antisense oligonucleotide RNA duplexes, Biochem J, 312, 599 (1995); Lima, WF and Crooke, ST, Biochemistry, 36, 390-398, 1997.

Of the Professional will understand that many changes and modifications in the preferred embodiments of the invention can be made and that such changes and modifications can be made without leaving the thought to remove the invention. Therefore, it is intended that the appended claims all such equivalents Variations include, in the true spirit and scope of the invention lie.

SEQUENCE LISTING

Claims (33)

A mixed sequence oligonucleotide comprising at least 12 nucleotides and having a 3 'end and a 5' end and divided into a first one Part and another part, being the first part able is the cleavage of a complementary target RNA by human RNase H1 polypeptide to support; in which the further part is unable to cleave through the RNase H1 to support; in which the first part comprises at least 6 nucleotides and in the oligonucleotide is arranged so that at least one of the 6 nucleotides 8 bis 12 nucleotides from the 3 'end the oligonucleotide is located; and the first part at least one 5'-CA-3 'nucleotide sequence comprising 8 to 12 nucleotides from the 3 'end of the oligonucleotide is. The oligonucleotide of claim 1, comprising about 12 to about 50 nucleotides. The oligonucleotide of claim 1, comprising about 12 to about 25 nucleotides. A mixed sequence oligonucleotide comprising at least 12 nucleotides and having a 3 'end and a 5' end and divided into a first one Part and another part, being the first part able is the cleavage of a complementary target RNA by human RNase H1 polypeptide to support in which the further part is unable to cleave through the RNase H1 to support; in which: of the first part comprises at least 6 nucleotides and in the oligonucleotide is arranged so that at least one of the 6 nucleotides 8 bis 12 nucleotides from the 3 'end the oligonucleotide is located; the first part at least one 5'-CA-3 'nucleotide sequence comprising 8 to 12 nucleotides from the 3 'end of the oligonucleotide is; and each of the nucleotides of the first part has a B-shape conformation geometry and they are united together in a continuous sequence. A mixed sequence oligonucleotide comprising at least 12 nucleotides and having a 3 'end and a 5' end and divided into a first part and another part, said first part being capable of cleaving a complementary target RNA to support human RNase H1 polypeptide, the remainder being incapable of supporting cleavage by human RNase H1; wherein: the first part comprises at least 6 nucleotides and in which oligonucleotide is arranged such that at least one of the 6 nucleotides is 8 to 12 nucleotides from the 3 'end of the oligonucleotide; the first part comprises at least one 5'-CA-3 'nucleotide sequence located 8 to 12 nucleotides from the 3' end of the oligonucleotide; and each of the nucleotides of the first part independently is a 2'-deoxyribonucleotide, 2'-SCH ₃ ribonucleotide 2'-NH ₂ ribonucleotide, a 2'-NH (C ₁ -C ₂ alkyl) ribonucleotide, a 2'-N (C ₁ -C ₂ alkyl) ₂ ribonucleotide, a 2'-CF ₃ - Ribonucleotide, a 2 '= CH ₂ ribonucleotide, a 2' = CHF ribonucleotide, a 2 '= CF ₂ ribonucleotide, a 2'-CH ₃ ribonucleotide, a 2'-C ₂ H ₅ ribonucleotide, a 2 'Is -CH-CH ₂ ribonucleotide or a 2'-C-CH ribonucleotide. The oligonucleotide of claim 1, wherein each of the nucleotides of the first part is a 2'-deoxyribonucleotide. A mixed sequence oligonucleotide comprising at least 12 nucleotides and having a 3 'end and a 5' end and divided into a first part and another part, said first part being capable of cleaving a complementary target RNA support human RNase H1 polypeptide, the remainder being incapable of supporting cleavage by RNase H1; wherein: the first part comprises at least 6 nucleotides and in which oligonucleotide is arranged such that at least one of the 6 nucleotides is 8 to 12 nucleotides from the 3 'end of the oligonucleotide; the first part comprises at least one 5'-CA-3 'nucleotide sequence located 8 to 12 nucleotides from the 3' end of the oligonucleotide; and each of the nucleotides of the first part independently is a 2'-CN arabinonucleotide, a 2'-Cl arabinonucleotide, a 2'-Br-arabinonucleotide, a 2'-N ₃ arabinonucleotide, a 2'-OH-arabinonucleotide 2'-O-CH ₃ arabinonucleotide or a 2'-dehydro-2'-CH ₃ arabinonucleotide. The oligonucleotide of claim 7, wherein each of the nucleotides of the first part is independently a 2'-F arabinonucleotide, a 2'-OH arabinonucleotide or a 2'-O-CH ₃ arabinonucleotide. An oligonucleotide according to claim 7, wherein each of the nucleotides independent of the first part a 2'-F-arabinonucleotide or a 2'-ON-arabinonucleotide is. An oligonucleotide according to claim 1, wherein the nucleotides of the first part are linked together in the continuous sequence by phosphate, phosphorothioate, phosphorodithioate or borane phosphate bonds. The oligonucleotide of claim 1, wherein the further moiety includes a plurality of nucleotides, wherein at least some of the nucleotides comprise a 2'-substituent group, wherein each substituent group is independently hydroxyl, C ₁ -C ₂₀ alkyl, C ₂ -C ₂₀ alkenyl, C ₂ -C ₂₀ alkynyl, halogen, amino, thiol, keto, carboxyl, nitro, nitroso, nitrile, trifluoromethyl, trifluoromethoxy, O-alkyl, O-alkenyl, O-alkynyl, S-alkyl, S-alkenyl, S- Alkynyl, NH-alkyl, NH-alkenyl, NH-alkynyl, N-dialkyl, O-aryl, S-aryl, NH-aryl, O-aralkyl, S-aralkyl, NH-aralkyl, N-phthalimido, imidazole, azide, Hydrazine, hydroxylamine, isocyanate, sulfoxide, sulfone, sulfide, disulfide, silyl, aryl, heterocycle, carbocyclic ring, intercalator, reporter molecule, conjugate, polyamine, polyamide, polyalkylene glycol, or polyether; or each substituent group has a formula I or II:

wherein Z _{0 is} O, S or NH; J is a single bond, O or C (= O); E is C ₁ -C ₁₀ alkyl, N (R ₁ ) (R ₂ ), N = C (R ₁ ) (R ₂ ), or has a formula III or IV;

each R ₆ , R ₇ , R ₈ , R ₉ and R _{10 is} independently hydrogen, C (O) R ₁₁ , substituted or unsubstituted C ₁ -C ₁₀ alkyl, substituted or unsubstituted C ₂ -C ₁₀ alkenyl, substituted or unsubstituted C ₂ -C ₁₀ alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl Alkenyl and alkynyl; or optionally, R ₇ and R ₈ together form a phthalimido moiety with the nitrogen atom to which they are attached; or optionally, R ₉ and R ₁₀ together form a phthalimido moiety with the nitrogen atom to which they are attached; each R _{11 is} independently substituted or unsubstituted C ₁ -C ₁₀ alkyl, trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy, 2- (trimethylsilyl) ethoxy, 2,2,2-trichloroethoxy, benzyloxy Is butyryl, isobutyryl, phenyl or aryl; each R ₁ and R _{2 is} independently H, a nitrogen protecting group, substituted or unsubstituted C ₁ -C ₁₀ alkyl, substituted or unsubstituted C ₂ -C ₁₀ alkenyl, substituted or unsubstituted C ₂ -C ₁₀ alkynyl, wherein the substitution OR ₃ , SR ₃ , NH ₃ ⁺ , N (R ₃ ) (R ₄ ), guanidino or acyl, wherein the acyl is an acid amide or an ester; or R ₁ and R ₂ together are nitrogen protecting groups or are combined in a ring structure optionally comprising an additional heteroatom selected from N and O; or R ₁ , T and L together are a chemical functional group; each R ₃ and R _{4 are} independently H, C ₁ -C ₁₀ alkyl, a nitrogen protecting group, or R ₃ and R ₄ together are a nitrogen protecting group; or R ₃ and R _{4 are} joined in a ring structure optionally comprising an additional heteroatom selected from N and O; Z _{4 is} OX, SX, or N (X) ₂ ; each X is independently H, C ₁ -C ₉ alkyl, C ₁ -C ₉ haloalkyl, C (= NH) N (H) R ₅ , C (= O) N (H) R ₅ or OC (= O) N (H) R ₅ is; R _{5 is} H or C ₁ -C ₈ alkyl; Z ₁ , Z ₂ and Z ₃ comprises a ring system of from about 4 to about 7 carbon atoms or from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein the heteroatoms are selected from oxygen, nitrogen and sulfur and wherein the ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic; Z _{5 is} alkyl or haloalkyl of 1 to about 10 carbon atoms, alkenyl of 2 to about 10 carbon atoms, alkynyl of 2 to about 10 carbon atoms, aryl of 6 to about 14 carbon atoms, N (R ₁ ) (R ₂ ) OR ₁ , halogen; SR is ₁ or CN; each q ₁ , independently, is an integer from 1 to 10; each q is ₂ , independent, 0 or 1; q ₃ is 0 or an integer from 1 to 10; q _{4 is} an integer from 1 to 10; and q is 0 _5, 1 or 2; provided that q _{3 is} 0, q _{4 is} greater than 1. An oligonucleotide according to claim 1, wherein each of the nucleotides of the further part is independently a 2'-F ribonucleotide, a 2'-O- (C ₁ -C ₆ alkyl) ribonucleotide or a 2'-O- (substituted C ₁ - C ₆ alkyl) ribonucleotide, wherein the substitution is C ₁ -C ₆ ether, C ₁ -C ₆ thioether, amino, amino (C ₁ -C ₆ alkyl) or amino (C ₁ -C ₆ Alkyl) ₂ . An oligonucleotide according to claim 1, wherein the nucleotides the other part together in a continuous sequence are by 3'-5'-phosphodiester, 2'-5'-phosphodiester, Sp phosphorothioate, Rp phosphorothioate, Phosphorodithioate, 3'-deoxy-3'-amino phosphoramidate, 3'-methylene phosphonate, Methylene (methylimino), dimethylhydrazino, amide 3-, amide 4- or Bora phosphate bonds. An oligonucleotide according to claim 1, wherein at least two of the nucleotides of the other part are taken together in a continuous sequence that is 3'-positioned to the first part. An oligonucleotide according to claim 1, wherein at least two of the nucleotides of the other part together in a continuous Sequence are united, which is 5'-positioned for the first part. An oligonucleotide according to claim 1, wherein at least two of the nucleotides of the other part together in a continuous Sequence, which is 3'-positioned to the first part, and at least two the nucleotides of the further part together in a continuous Sequence are united, which is 5'-positioned for the first part. An oligonucleotide according to claim 1, wherein at least four of the nucleotides of the other part together in a continuous Sequence are united, the first part is 3'-positioned. An oligonucleotide according to claim 1, wherein at least four of the nucleotides of the other part together in a continuous Sequence are united, which is 5'-positioned for the first part. An oligonucleotide according to claim 1, wherein at least four of the nucleotides of the other part together in a continuous Sequence, which is 3'-positioned to the first part, and at least four the nucleotides of the further part together in a continuous Sequence are united, which is 5'-positioned for the first part. The oligonucleotide of claim 1, wherein the oligonucleotide a chimera Is a mixed sequence oligonucleotide. An oligonucleotide according to claim 1 or 20, wherein the Oligonucleotide comprises 8 to 25 nucleotides. A method comprising contacting an oligonucleotide according to claim 1 with RNA or DNA in vitro. A method comprising contacting an oligonucleotide according to claim 4 with RNA or DNA in vitro. A method comprising contacting an oligonucleotide according to claim 5 with RNA or DNA in vitro. A method comprising contacting an oligonucleotide according to claim 7 with RNA or DNA in vitro. A method comprising contacting an oligonucleotide according to claim 20 with RNA or DNA in vitro. A method comprising contacting an oligonucleotide according to claim 21 with RNA or DNA in vitro. A method comprising contacting an oligonucleotide according to claim 1 with RNA or DNA in a cell analysis. A method comprising contacting an oligonucleotide according to claim 4 with RNA or DNA in a cell analysis. A method comprising contacting an oligonucleotide according to claim 5 with RNA or DNA in a cell analysis. A method comprising contacting an oligonucleotide according to claim 7 with RNA or DNA in a cell analysis. A method comprising contacting an oligonucleotide according to claim 20 with RNA or DNA in a cell analysis. A method comprising contacting an oligonucleotide of claim 21 with RNA or DNA in a cell analysis.