WO2019030313A2 - Oligonucleotides for modulating ube3c expression - Google Patents

Oligonucleotides for modulating ube3c expression Download PDF

Info

Publication number
WO2019030313A2
WO2019030313A2 PCT/EP2018/071597 EP2018071597W WO2019030313A2 WO 2019030313 A2 WO2019030313 A2 WO 2019030313A2 EP 2018071597 W EP2018071597 W EP 2018071597W WO 2019030313 A2 WO2019030313 A2 WO 2019030313A2
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
nucleosides
embodiments
nucleic acid
region
Prior art date
Application number
PCT/EP2018/071597
Other languages
French (fr)
Other versions
WO2019030313A3 (en
Inventor
Peter Hagedorn
Lykke PEDERSEN
Original Assignee
Roche Innovation Center Copenhagen A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP17185951.5 priority Critical
Priority to EP17185951 priority
Application filed by Roche Innovation Center Copenhagen A/S filed Critical Roche Innovation Center Copenhagen A/S
Publication of WO2019030313A2 publication Critical patent/WO2019030313A2/en
Publication of WO2019030313A3 publication Critical patent/WO2019030313A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===

Abstract

The present invention relates to antisense oligonucleotides that are capable of modulating expression of UBE3C in a target cell. The oligonucleotides hybridize to UBE3C pre-m RNA, preferably at repeated target sites. The present invention further relates to conjugates of the oligonucleotide and pharmaceutical compositions and methods for treatment of proliferatory or inflammatory disorders using the oligonucleotides.

Description

OLIGONUCLEOTIDES FOR MODULATING UBE3C EXPRESSION

FIELD OF INVENTION

The present invention relates to oligonucleotides (oligomers) that are complementary to ubiquitin-protein ligase 3C (UBE3C) transcript. Such oligonucleotides may be used for reducing UBE3C transcript in a cell, leading to modulation of the expression of UBE3C. Modulation of UBE3C expression is beneficial for a range of medical disorders, such as proliferatory or inflammatory disorders.

BACKGROUND

Ubiquitin-protein ligase E3C (UBE3C) is a member of the E3 ligase enzymes which are part of the ubiquitin protease system. UBE3C accepts ubiquitin from the E2 ubiquitin-conjugating enzyme UBE2D1 in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. The ubiquitin protease system contributes to the progression of human

malignancies including melanoma, renal cell carcinoma and hepatocellular carcinoma. UBE3C has been shown to be an important tumor-related regulatory molecule involved in the promotion of both tumor growth and metastasis. In particular, Wen JL et al 2015 Feb 6;10(2) showed that UBE3C promotes growth and metastasis of renal cell carcinoma via activation of the wnt/β- catenin pathway.

UBE3C promotes glioma progression by mediating the ubiquitination and degrading of Annexin A7 and it has been shown that inhibition of UBE3C expression in glioma cells significantly decrease cell migration and invasion in vitro (Pan SJ et all, June 1 1 ;5:1 1066).

Jiang JH et al, showed a clinical significance of UBE3C in hepatocellular carcinoma revealed by exome sequencing published in Hepatology, 2014, Jun 59 (6): 2216-27 discloses that mutations in the UBE3C gene were observed in tumor tissues. UBE3C involvement in melanoma progression was shown by Tang L et al, Oncotarget, 2016 Mar 29;7(13):15738-46). Tang et al showed that UBE3C promotes melanoma progression by increasing epithelial-mesenchymal transition in melanoma cells, and that aberrant expression of UBE3C plays a key role in tumor development and progression.

Xiong J et al. 2016 discloses that_MiR-30a-5p/UBE3C axis regulates breast cancer cell proliferation and migration (Biochem Biophys Res Commun.2016 Mar 18. pii: S0006- 291 X(16)30381 -3).

The occurrence of aspirin intolerance in asthmatic patients has in some studies been linked to the occurrence of polymorphisms in the UBE3C gene (Lee et al. 2010, Ann Allergy Asthma Immunol. 105(4): 307-312). Antisense oligonucleotides targeting repeated sites in the same RNA have been shown to have enhanced potency for reducing expression of the target mRNA in some cases in in vitro transfection experiments. This has been the case for GCGR, STST3, MAPT, OGFR, and BOK RNA (T. Vickers at al. (PLOS one, October 2014, Volume 9, Issue 10). Similar data are shown in WO 2013/120003.

Cancer treatment in most cases will include combination treatments using different compounds that will work together. The present invention provides compounds that may function as a further layer i.e. on top of existing treatments.

OBJECTIVE OF THE INVENTION UBE3C is involved in the progression of a number of solid tumors. The present invention provides antisense oligonucleotides capable of modulating UBE3C mRNA and protein expression both in vivo and in vitro. Accordingly, the present invention can be used alone or potentially in combination therapy together with the known cancer care therapies, in particular in treatment of solid cancers such as carcinomas and melanomas. SUMMARY OF INVENTION

The present invention relates to oligonucleotides targeting a nucleic acid capable of modulating the expression of UBE3C and to treat or prevent diseases related to the functioning of UBE3C .

Accordingly, in a first aspect the invention provides oligonucleotides which comprise a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90%

complementarity to UBE3C pre-mRNA of SEQ ID NO: 1 and/or mRNA of SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. The oligonucleotide can be an antisense oligonucleotide, preferably with a gapmer design. Preferably, the oligonucleotide is capable of inhibiting the expression of UBE3C by cleavage of a target nucleic acid. The cleavage is preferably achieved via nuclease recruitment.

In a further aspect the invention provides the antisense oligonucleotide, wherein the

independent region on a target nucleic acid is in intron 22 defined by position 1 18133 to 128672 of SEQ ID NO: 1 .

In a further aspect the invention provides the antisense oligonucleotide, wherein the

independent region is within a SEQ ID NO: 6.

In a further aspect the invention provides the antisense oligonucleotide, wherein the

independent region is a sequence selected from the group 125153-125170, 125317-125334, 125435-125452, 125485-125502, 125541 -125558, 125595-125612, 125153-125168, 125317- 125332, 125435-125450, 125485-125500, 125541 -125556, 125595-125610; 125153-125166, 125317-125330, 125435-125448, 125485-125498, 125541 -125554, 125595-128608; 125151 - 125170, 125315-125334, 125433-125452, 125483-125502, 125539-125558, 125593-125612; 125151 -125166, 125315-125330, 125433-125448, 125483-125498, 125539-125554, 125593- 125608; 125152-125169, 125316-125333, 125434-125451 , 125484-125501 , 125540-125557, 125594-12561 1 ; 125152-125171 , 125316-125335, 125434-125453, 125484-125503, 125540- 125559, 125594-125613 of SEQ ID NO: 1 .

In a further aspect an antisense oligonucleotide according to the invention, comprises or consists a sequence selected from the group consisting of SEQ ID NO: 7 to 21 .

In a further aspect, the invention provides pharmaceutical compositions comprising the oligonucleotides of the invention and pharmaceutically acceptable diluents, carriers, salts and/or adjuvants.

In a further aspect, the invention provides methods for in vivo or in vitro method for modulation of UBE3C expression in a target cell which is expressing UBE3C, by administering an oligonucleotide or composition of the invention in an effective amount to said cell.

In a further aspect the invention provides methods for treating or preventing a disease, disorder or dysfunction associated with in vivo activity of UBE3C comprising administering a

therapeutically or prophylactically effective amount of the oligonucleotide of the invention to a subject suffering from or susceptible to the disease, disorder or dysfunction.

In a further aspect the oligonucleotide or the conjugate or the pharmaceutical composition of the invention is used for the treatment or prevention of proliferatory diseases, preferably cancer, or inflammatory diseases such as asthma. DEFINITIONS Oligonucleotide

The term "oligonucleotide" as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.

Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.

Antisense oligonucleotides

The term "Antisense oligonucleotide" as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded.

Contiguous Nucleotide Sequence

The term "contiguous nucleotide sequence" refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term "contiguous nucleobase sequence" and the term "oligonucleotide motif sequence". In some embodiments all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

Nucleotides

Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in

nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as "units" or "monomers".

Modified nucleoside

The term "modified nucleoside" or "nucleoside modification" as used herein refers to

nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. In a preferred embodiment the modified nucleoside comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term "nucleoside analogue" or modified "units" or modified "monomers". Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.

Modified internucleoside linkage

The term "modified internucleoside linkage" is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed "modified nucleotides". In some embodiments, the modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides.

In an embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from the natural phosphodiester to a linkage that is for example more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art. Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages. In some embodiments at least 50% of the internucleoside linkages in the

oligonucleotide, or contiguous nucleotide sequence thereof, are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. It will be recognized that, in some embodiments the nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate, may be phosphodiester. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages.

In some embodiments the modified internucleoside linkages may be selected from the group comprising phosphorothioate, diphosphorothioate and boranophosphate. In some

embodiments, the modified internucleoside linkages are compatible with the RNaseH recruitment of the oligonucleotide of the invention, for example phosphorothioate,

diphosphorothioate or boranophosphate.

In some embodiments the internucleoside linkage comprises sulphur (S), such as a

phosphorothioate internucleoside linkage, which is currently the preferred internucleoside linkage.

A phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmakokinetics and ease of manufacture. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are

phosphorothioate.

In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkage, particularly a internucleoside linkage selected from phosphotriester,

methylphosphonate, MMI, amide-3, formacetal or thioformacetal.

Further internucleoside linkages are disclosed in WO2009/124238 (incorporated herein by reference). In an embodiment the internucleoside linkage is selected from linkers disclosed in WO2007/031091 (incorporated herein by reference). Particularly, the internucleoside linkage may be selected from -0-P(0)2-0-, -0-P(0,S)-0-, -0-P(S)2-0-, -S-P(0)2-0-, -S-P(0,S)-0-, -S- P(S)2-0-, -0-P(0)2-S-, -0-P(0,S)-S-, -S-P(0)2-S-, -0-PO(RH)-0-, 0-PO(OCH3)-0-, -0-PO(NRH)- 0-, -0-PO(OCH2CH2S-R)-0-, -0-PO(BH3)-0-, -0-PO(NHRH)-0-, -0-P(0)2-NRH-, -NRH-P(0)2-0- , -NRH-CO-0-, -NRH-CO-NRH-, and/or the internucleoside linker may be selected form the group consisting of: -0-CO-0-, -0-CO-NRH-, -NRH-CO-CH2-, -0-CH2-CO-NRH-, -0-CH2-CH2-NRH-, - CO-NRH-CH2-, -CH2-NRHCO-, -0-CH2-CH2-S-, -S-CH2-CH2-0-, -S-CH2-CH2-S-, -CH2-S02-CH2-, -CH2-CO-NRH-, -0-CH2-CH2-NRH-CO -, -CH2-NCH3-0-CH2-, where RH is selected from hydrogen and C1 -4-alkyl.

Nuclease resistant linkages, such as phosphothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers, or the non-modified nucleoside region of headmers and tailmers. Phosphorothioate linkages may, however, also be useful in non-nuclease recruiting regions and/or affinity enhancing regions such as regions F and F' for gapmers, or the modified nucleoside region of headmers and tailmers.

Each of the design regions may however comprise internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, in particularly in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation. Inclusion of phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and/or bio-distribution of an oligonucleotide - see WO2008/1 13832, incorporated herein by reference.

In an embodiment all the internucleoside linkages in the oligonucleotide are phosphorothioate and/or boranophosphate linkages. Preferably, all the internucleoside linkages in the

oligonucleotide are phosphorothioate linkages.

Nucleobase

The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring

nucleobases, but are functional during nucleic acid hybridization. In this context "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1 .4.1 .

In a some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo- cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2- chloro-6-aminopurine.

The nucleobase moieties may be indicated by the letter code for each corresponding

nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified

nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.

Modified oligonucleotide

The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar- modified nucleosides and/or modified internucleoside linkages. The term chimeric"

oligonucleotide is a term that has been used in the literature to describe oligonucleotides with modified nucleosides.

Complementarity

The term "complementarity" describes the capacity for Watson-Crick base-pairing of

nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non- modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1 .4.1 ).

The term "% complementary" as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to (i.e. form Watson Crick base pairs with) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences, dividing by the total number of nucleotides in the

oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch.

The term "fully complementary", refers to 100% complementarity.

The following is an example of an oligonucleotide (SEQ ID NO: 15) that is fully complementary to the target nucleic acid (SEQ ID NO: 6).

5' CAACATGCTCGGCCTGTTACACACACACACACACAC 3' (SEQ ID NO: 6) 3' CGAGCCGGACAATGTGTGTG 5' (SEQ ID NO: 15) Identity

The term "Identity" as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are identical to (i.e. in their ability to form Watson Crick base pairs with the complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, including gaps, but excluding insertions and deletions, and dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. Percent Identity = (Matches x 100)/Length of aligned region (with gaps). Hybridization

The term "hybridizing" or "hybridizes" as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions Tm is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy AG0 is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by AG°=-RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG0 of the reaction between an

oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG0 is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG0 is less than zero. AG0 can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG0 measurements. AG0 can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:1 121 1-1 1216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated AG0 values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG0. The oligonucleotides may hybridize to a target nucleic acid with estimated AG0 values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated AG0 value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or -16 to -27 kcal such as -18 to -25 kcal.

Target nucleic acid

According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian UBE3C and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as an UBE3C target nucleic acid.

The oligonucleotide of the invention may for example target exon regions of a mammalian UBE3C, or may for example target intron region in the UBE3C pre-mRNA as predicted below in Table 1 .

Table 1 . Exonic and intronic regions in the human UBE3C pre-mRNA

Figure imgf000010_0001
Exonic regions in the human UBE3C premRNA Intronic regions in the human UBE3C

(SEQ ID NO 1) premRNA (SEQ ID NO 1)

E12 68486 68643 112 68644 68790

E13 68791 69023 113 69024 77954

E14 77955 78059 114 78060 81776

E15 81777 81864 115 81865 84341

E16 84342 84439 116 84440 86494

E17 86495 86627 117 86628 92167

E18 92168 92415 118 92416 109455

E19 109456 109668 119 109669 115041

E20 115042 115230 120 115231 115331

E21 115332 115398 121 115399 118001

E22 118002 118132 122 118133 128672

E23 128673 130460

Suitably, the target nucleic acid encodes an UBE3C protein, in particular mammalian UBE3C , such as human UBE3C (See for example Tables 3; which provides the genomic sequence, the mature mRNA and pre-mRNA sequences for human, and pre-mRNA monkey, UBE3C).

In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1 , 2, 3, 4, or 5 or naturally occurring variants thereof (e.g. sequences encoding a mammalian UBE3C protein).

The target nucleic acid may, in some embodiments, be a RNA or DNA, such as a messenger RNA, such as a mature mRNA or a pre-mRNA which encodes mammalian UBE3C protein, such as human UBE3C, e.g. the human pre-mRNA sequence, such as that disclosed as SEQ ID NO: 1 or human mature mRNA as disclosed in SEQ ID NO: 2 (UBE3C mRNA isoform 1 ), SEQ ID NO: 3 (UBE3C mRNA isoform 2) and SEQ ID NO: 4 (UBE3C mRNA isoform 3). In some embodiments the target nucleic acid is a nucleic acid sequence which is conserved between human and monkey, in particular a sequence that is present in both SEQ ID NO: 1 and 5. In one preferred embodiment, such a target nucleic acid sequence is present in SEQ ID NO 6, and in another preferred embodiment, the target nucleic acid sequence is present in SEQ ID NO: 22.

If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

For in vivo or in vitro application, the oligonucleotide of the invention is typically capable of inhibiting the expression of the UBE3C target nucleic acid in a cell which is expressing the UBE3C target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the UBE3C target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g. region D' or D").

Further information on genome and assembly of UBE3C across species is provided in Table 2, and sequence details for pre-mRNA and mRNA in Table 3.

Table 2. Genome and assembly information for UBE3C ubiquitin ligase across species.

Figure imgf000012_0001

Fwd = forward strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence).

The NCBI reference provides the mRNA sequence (cDNA sequence).

Table 3. Sequence details for pre-mRNA and mRNA UBE3C.

Figure imgf000012_0002

Target Sequence

The term "target sequence" as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention (i.e. a sub-sequence).

The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to the target nucleic acid, such as a target sequence described herein.

The target nucleic acid sequence to which the oligonucleotide is complementary to or hybridizes to generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides. The contiguous target nucleotide sequence is between 10 to 50 nucleotides, such as 12 to 30, such as 13 to 25, such as 14 to 20, such as 15 to 18 contiguous nucleotides. In one embodiment of the invention the target sequence is SEQ ID NO: 6.

In one embodiment of the invention the target sequence is SEQ ID NO: 22.

Target Cell

The term a "target cell" as used herein refers to a cell which is expressing the target nucleic acid. In some embodiments the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell.

In preferred embodiments the target cell expresses UBE3C mRNA, such as the UBE3C pre- mRNA or UBE3C mature mRNA. The poly A tail of UBE3C mRNA is typically disregarded for antisense oligonucleotide targeting.

Naturally occurring variant

The term "naturally occurring variant" refers to variants of UBE3C gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.

In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian UBE3C target nucleic acid, such as a target nucleic acid of SEQ ID NO 1 (or any other pre-mRNAs or mRNAs disclosed in Table 3). Table 4 lists specific natural occurring variants of UBE3C.

Table 4. Numerous single nucleotide polymorphisms are known in the UBE3C gene, for example those disclosed in the following table (human pre-mRNA start/reference sequence is SEQ ID NO: 1 )

Figure imgf000013_0001
Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs6972035 A/G G 0,0800719 3234 rs71723392 ACG/- - 0,0778754 3454 rs6459734 A/G A 0,490815 3848 rs6459735 C/G G 0,26258 3875 rsl0714296 T/- - 0,211462 3943 rs7790880 C/T C 0,394768 3985 rs3802133 C/T T 0,207069 5025 rs28510264 G/A A 0,379792 5290 rsl50924111 -/T/TT T 0,180511 5772 rs79516096 -/A A 0,287013 5779 rs6967012 G/T T 0,0800719 5886 rs57309314 G/- G 0,490415 7499 rs6977324 G/C C 0,386182 7578 rs6977680 G/A A 0,470248 7812 rs7801905 T/C T 0,490615 8505 rs7798816 A/G A 0,490615 8968 rs547235032 -/T/TT T 0,0760783 9196 rs528127730 T/- - 0,304912 9820 rs74920287 T/C c 0,0800719 10148 rs7784779 T/C c 0,0810703 10324 rs6965963 C/T T 0,0808706 10479 rs7804018 C/T T 0,26258 11670 rs4716458 G/A A 0,207668 12195 rs3808317 A/G A 0,491014 12854 rs3808316 C/G G 0,492812 13181 rs35137829 T/A A 0,26238 14790 rs548970904 -/AAAC AAAC 0,476114 14916 rs74958275 G/A A 0,0778754 15010 rs59577520 -/G G 0,210064 15084 rsl39552195 GGGA/- GGGA 0,490615 15166 rs7784158 C/T T 0,258387 15207 rs75088001 A/C c 0,224042 15255 rs7806314 A/T A 0,490615 15297 rs7806775 A/G A 0,490415 15593 rs28520529 T/C C 0,0776757 16512 rs3824062 G/A A 0,207668 16932 rs6946660 T/C T 0,490815 17042 rs6946947 T/C T 0,490815 17181 rs35216117 C/G G 0,182308 17364 rs6951298 T/C T 0,490815 17543 rs555689452 A/- - 0,30651 17802 rs62491940 G/A A 0,0802716 18836 rs67483339 AT/- - 0,454273 19062 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs201879222 T/G G 0,0617013 19073 rsl0264936 T/G G 0,454273 19075 rs564046382 T/- - 0,459864 19139 rs73174376 G/A A 0,207668 19192 rs733483 A/G G 0,182508 20527 rs62491942 T/C C 0,0772764 21390 rs62491943 T/C C 0,0800719 21405 rs35129430 C/T T 0,182508 21438 rsl0256197 A/G G 0,223842 22882 rs57487459 C/A A 0,127796 23436 rs58983636 T/A A 0,210064 23499 rs62491945 G/A G 0,490815 23974 rs79062849 G/A A 0,223842 24258 rs75478275 C/T T 0,245607 24399 rsll2643901 C/T T 0,076278 26588 rsl0227115 G/A A 0,208466 26641 rs57603221 A/G G 0,0806709 27005 rs59115545 T/C C 0,0804712 27235 rs73492566 G/A A 0,0804712 27555 rsll2593328 G/A A 0,0850639 27605 rs28842518 T/C T 0,478634 27618 rsll5943567 C/T T 0,0766773 27815 rsl0231434 G/A A 0,0800719 27816 rs59014357 -/GTGGTT/GTT GTT 0,467452 28030 rs73492569 C/G G 0,0804712 28371 rs77455419 A/G G 0,207867 28677 rs4716690 G/A A 0,208267 28689 rs62491946 G/T T 0,0800719 28703 rs4716691 A/G A 0,367612 28815 rs4716692 T/A T 0,367612 28816 rs62491947 G/A G 0,491014 29207 rsll278310 GGCATGAG/- GGCATGAG 0,491414 31185 rs531550448 C/T T 0,413538 31223 rs6956046 G/A G 0,490815 31268 rsl0251112 A/G A 0,490415 31918 rs2107863 T/C T 0,491014 32125 rs5888710 -/T - 0,490815 32210 rs62491950 A/G G 0,077476 32318 rsl0268650 G/A A 0,0940495 32888 rsl0240226 C/T T 0,0938498 33014 rs34998574 -/T T 0,460863 33116 rs3802130 A/G A 0,490615 33631 rs3802129 G/A G 0,485823 33691 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rsl002389 C/G C 0,485823 36717 rs35241754 G/A A 0,0770767 36998 rsl0479650 A/G G 0,210264 37212 rs34923888 C/G G 0,0720847 37778 rs4716459 A/G G 0,208267 38378 rs4716460 T/C T 0,490216 38448 rsl0224221 T/C c 0,0802716 38600 rs3802126 G/A G 0,490216 38675 rs6977213 A/G G 0,0567093 38873 rs3802125 A/C C 0,470647 38957 rs3802124 G/A G 0,490415 39003 rs3802123 G/A A 0,429912 39035 rs869300 G/A A 0,207867 39246 rs73492583 G/A A 0,0692891 39947 rs870745 T/C T 0,372804 39975 rs3802122 T/A A 0,390375 40692 rs3802121 G/A A 0,360224 40925 rs565236708 -/ATT AAA ATT AAA 0,221446 41669

/AAAACCAT/CCAT/

rs370244354 TAAAAACCAT CCAT 0,221446 41671 rsl2672740 A/G G 0,334065 41770 rs2301916 G/T G 0,477236 42521 rs6459737 G/A G 0,490216 43530 rsl2671829 C/A A 0,20627 44081 rsl0237192 G/T T 0,210264 44460 rs59247346 C/T T 0,210264 44471 rsl0267463 C/T T 0,210463 44516 rs7794035 C/T T 0,276358 44615 rs3815217 A/G A 0,386581 45375 rsl0228143 A/G G 0,208267 45643 rs3802120 C/T C 0,490615 46188 rs58409418 T/A A 0,0940495 46603 rs6971896 C/T C 0,490415 46806 rs6957939 T/C T 0,490415 46879 rs6954050 A/G A 0,491014 46948 rsll390914 -/A/AA A 0,257588 47504 rs58522767 C/G/T T 0,0802716 48056 rs7778193 C/T c 0,492212 48481 rs577610774 -/T T 0,106629 48673 rs7778050 G/A A 0,0844649 49091 rs3839848 CTAA/- - 0,208067 49858 rs3839847 -/T T 0,151957 49894 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs7802642 A/G G 0,259185 50066 rsll404789 -/c C 0,205471 50843 rs6950739 T/C T 0,488219 50844 rsl0534786 TC/- - 0,438898 50914 rs7798305 C/T T 0,0760783 51049 rs6951930 A/G G 0,21226 51725 rs7785599 A/G G 0,0802716 51902 rs7786095 A/G G 0,0802716 52241 rs4716461 T/C C 0,210663 52675 rsll973570 A/G G 0,125998 52866 rs3824060 C/T T 0,25 53446 rsl41627680 -/TGAATGTGG TGAATGTGG 0,15595 53822 rsl3221911 C/T T 0,0511182 54149 rs3839845 -/CAG - 0,473642 54376 rs59176594 G/T T 0,0802716 54505 rs3802118 T/C T 0,491014 55208 rs3802117 C/T c 0,490815 55394 rs28435188 A/G G 0,0549121 56663 rs28459514 G/A A 0,0942492 57107 rsll980541 G/C G 0,490016 57170 rs62493391 A/T T 0,0942492 57272 rs62493392 G/T T 0,0804712 57537 rs3837148 -/G G 0,441893 57843 rs71303922 -/A/G A 0,067492 57844 rs6955184 T/G G 0,15595 58433 rs2286132 A/G G 0,210863 58556 rs74600078 T/- T 0,476637 58598 rs2286130 C/T T 0,259385 58948 rsl7837723 C/A A 0,141973 59547 rs73505598 A/G G 0,0694888 60066 rs2366214 A/G A 0,490615 60855 rs2366215 T/G G 0,210463 61084 rs60687230 T/A A 0,15595 61318 rs59869013 T/- - 0,151957 61399 rsl0085650 T/C T 0,489816 61807 rsl0239165 C/T T 0,0806709 62280 rs2301915 C/T T 0,210463 62705 rs531565551 T/- - 0,321086 62726 rsl7837725 T/C c 0,210264 63263 rs6967764 C/T c 0,491014 63358 rsl0259021 A/C c 0,208267 63673 rs2023977 C/G c 0,490415 64416 rs3802115 T/C T 0,366813 64622 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs28714421 G/A A 0,250399 65135 rs28446734 T/C T 0,477037 65169 rsl014248 C/G G 0,151957 65454 rs546994636 A/- - 0,202476 65487 rs6459738 T/G T 0,490415 66926 rsl0271970 A/C c 0,210264 66994 rs6459739 A/T A 0,490415 67257 rs7784795 C/T T 0,207867 67436 rs7785227 C/T c 0,490216 67691 rsl0678811 -/AG - 0,490615 67882 rs2301914 T/C T 0,490415 68570 rsl41339604 AAGAA/- - 0,0804712 69481 rs6943921 A/G G 0,210663 69555 rs3802113 A/G G 0,210463 70031 rsl034785 T/C C 0,5 70777 rsl0488093 A/G G 0,0509185 70801 rsl808217 T/C T 0,490415 71135 rs2006844 G/A G 0,490415 71245 rs35887132 -/T T 0,0521166 71374 rsl7719499 A/G G 0,0804712 71560 rs886677 T/A T 0,490415 72176 rs6969244 A/G G 0,499201 72406 rsl0229630 G/A A 0,499401 73184 rs3802111 A/G/T T 0,210264 73277 rs6955056 G/T T 0,207468 73976 rs6979947 A/G G 0,457867 74257 rsl2531196 T/G G 0,127796 75051 rsl0224496 A/G G 0,221246 75056 rsl0230895 T/C T 0,490815 75432 rsl0228145 A/G A 0,491613 75731 rsl7646960 A/G G 0,0646965 75950 rsl7837729 G/A A 0,2502 76059 rs62493426 G/A A 0,0802716 76410 rs60283573 T/C C 0,250399 76543 rs73507518 A/G G 0,0808706 76600 rs62493428 G/A A 0,0808706 76736 rs2051877 A/T A 0,490815 77207 rs2051876 G/A G 0,490815 77431 rs527482172 -/T T 0,176917 77441 rs6947927 G/A A 0,358826 79262 rs28588639 C/T T 0,0846645 79333 rs933344 A/T A 0,490415 79659 rs2023976 G/A A 0,0802716 80336 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs2023975 G/A A 0,499201 80490 rs2023974 A/G G 0,0802716 80589 rs555295585 A/- - 0,224042 80990 rs543916388 -/A A 0,0872604 82529 rsl2533082 T/A T 0,482029 82566 rs6459741 G/T G 0,482827 82947 rs73176416 A/G G 0,210264 83298 rs73507531 T/G G 0,0676917 85108 rsll82365 A/T T 0,482228 85649 rs28523534 T/C c 0,0804712 85816 rs28654361 C/G G 0,081869 85834 rsl0261642 G/A A 0,327276 86209 rsll82364 T/C C 0,492812 86306 rs62491931 G/A A 0,0804712 87370 rsll82363 A/G G 0,482228 87545 rsl42300323 -/T T 0,336462 87808 rsll82362 A/G G 0,492412 87929 rs3824058 A/G G 0,223043 87937 rs28505161 G/A A 0,0804712 88026 rs28463479 G/A A 0,0992412 88525 rsl0259984 A/G G 0,225639 88623 rsl99763738 -/A A 0,139177 88631 rsl45609937 T/C C 0,0844649 88640 rsll82360 G/C C 0,482428 88944 rsl636608 C/A C 0,257588 89034 rs3802108 T/G G 0,225639 89460 rs 1182448 G/A A 0,482228 89809 rs 1182447 A/G A 0,106629 90399 rs56097864 -/A/AC/AT - 0,107628 91016 rsl0250039 T/A A 0,378195 91016 rs56180280 -/A - 0,107628 91019 rsll976909 T/A A 0,14996 91020 rs373436674 -/A A 0,238419 91484 rs34173241 -/G G 0,460863 91800 rsl0264206 G/A A 0,0780751 91940 rs2301947 T/C C 0,231629 92115 rsl7837732 A/G G 0,0846645 92432 rs 1182445 C/G G 0,482228 92822 rs 1182444 A/G G 0,482827 92904 rs73507540 G/A A 0,138578 93465 rs73176423 T/C C 0,231829 94044 rs 1182443 A/G A 0,285942 94446 rs28761283 G/A A 0,0806709 94549 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs55683148 A/G G 0,138379 94607 rsll82442 G/A A 0,482029 95027 rsll82441 A/G G 0,481829 95044 rs6459742 G/A A 0,38778 95378 rs6459743 G/A A 0,411542 95502 rs28667423 G/A A 0,224241 95564 rs6459744 G/A A 0,160144 95695 rsll82439 G/A A 0,481829 95761 rs58300955 C/G G 0,411542 95769 rs6977962 G/A A 0,411542 95821 rsll82438 G/A A 0,481829 95832 rsll82437 C/T T 0,481829 96062 rs59571492 G/A A 0,409944 96078 rsll82436 T/C T 0,267372 96147 rsll82435 G/C c 0,482029 96193 rs28367460 T/C c 0,234824 96203 rs73176427 T/C c 0,250599 96272 rs6965998 A/T T 0,0806709 96809 rs55904424 C/A A 0,0842652 96914 rs6946713 C/G G 0,0804712 96974 rs6949802 G/A A 0,411142 97274 rs551260543 -/ I 1 1 1 I I 1 I A 1 1 1 1 1 1 1 I A 0,23123 97329 rs3802106 A/G G 0,23143 97510 rsll82432 C/T T 0,482428 97570 rs60648842 A/G G 0,180511 97920 rsll83107 G/A A 0,482228 98089 rsll2612291 G/A A 0,0780751 98125 rs6975954 A/G G 0,411142 98305 rs6956786 C/T T 0,159545 98453 rs6955670 G/A A 0,411142 98486 rs6955689 G/A A 0,411342 98524 rs73507561 T/C C 0,411342 98610 rs201457851 -/AG/G/GA AG 0,414337 98984 rs3779599 A/C C 0,410144 99088 rs3779598 A/G G 0,411342 99252 rs6960676 G/A A 0,411142 99311 rs6961953 C/T T 0,160144 99362 rs6962133 C/T T 0,0802716 99480 rs6459745 T/C c 0,411342 99582 rs6459746 A/G G 0,411342 99622 rs73743311 G/T T 0,0844649 99667 rsll82397 T/G T 0,10643 99801 rs73176433 A/G G 0,23143 99886 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs58313408 C/A A 0,0802716 99934 rs6459747 G/A A 0,411342 99959 rsll82396 A/C C 0,482628 100225 rs59580574 G/A A 0,0844649 100391 rsl003373 C/G C 0,123602 100640 rsl0266129 A/G G 0,415935 100781 rsl0266281 A/G G 0,225439 100936 rsl0266518 A/G G 0,411142 101084 rsl0280094 G/T T 0,211062 101182 rsl0254551 C/T T 0,231829 101283 rsll82395 T/G G 0,482628 101318 rs56009768 T/C C 0,159944 101489 rs62493373 C/T T 0,0806709 101734 rs55961058 G/A A 0,0840655 101784 rs58654062 G/A A 0,0834665 102689 rsl833098 G/A A 0,0503195 103859 rsl0233206 G/A A 0,0750799 103862 rsl833097 G/A/C C 0,104633 103916 rsll82394 G/A G 0,493211 104068 rs3779596 G/A A 0,223442 104221 rs7811779 A/G G 0,0882588 104371 rs73509649 C/T T 0,0632987 104549 rsll82392 C/T c 0,426717 104594 rsl0271990 C/T T 0,230032 105915 rsl0228373 A/C c 0,225639 105986 rsll82391 T/C/G T 0,385583 106762 rsll82390 G/A G 0,3752 106952 rsll82389 A/G G 0,467652 107197 rs3837146 -/T T 0,261382 107319 rsll82388 C/T c 0,150559 107876 rsll2340031 G/C c 0,0856629 108666 rsl2535762 G/A A 0,232029 108710 rs62493375 C/T T 0,110623 108736 rsll82386 G/A A 0,467252 108737 rsll82385 C/T T 0,467053 108977 rsl2530850 C/T T 0,230431 109000 rsll82384 A/G G 0,467851 109036 rs60535165 A/G G 0,0650958 109068 rsl3226247 C/T T 0,0656949 109919 rs62493376 A/G G 0,0858626 110060 rsll82381 G/A A 0,467252 111867 rs73509658 C/T T 0,115216 111952 rsl7837739 T/C c 0,295128 112722 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rs7794202 T/C C 0,0858626 112818 rsll297417 Gi- - 0,0860623 112945 rs78979825 cn T 0,261981 113058 rs79477401 G/A A 0,229633 113153 rs929354 C/T T 0,466853 113951 rs6966805 T/C c 0,0638978 114044 rsl38233488 -/ATTA - 0,0802716 115486 rs75371354 A/G G 0,181909 116005 rs7384424 G/A A 0,138778 116043 rsl39867841 -/A A 0,0652955 116247 rsll82378 T/C C 0,467851 116716 rsll82377 T/C T 0,416933 116797 rsll82375 C/G G 0,466254 117312 rsl0240474 C/T T 0,100439 117497 rs2301946 G/A A 0,229633 118203 rsll82371 T/C T 0,283746 119794 rsll82370 C/A c 0,283746 119806 rs7806672 G/A A 0,262181 120111 rs73509667 A/G G 0,116014 120769 rsl0259783 G/A A 0,229233 120788 rs6971669 A/T T 0,100439 120932 rs3757828 C/T T 0,0654952 121645 rsll82452 G/A G 0,418131 122012 rs3779593 C/T T 0,192093 122161 rsll82450 G/A G 0,316893 122473 rsll2819804 T/- T 0,314896 122536 rs74472351 AT/- - 0,100639 122564 rs71538011 A/G G 0,0652955 123146 rslll900340 A/T T 0,0634984 123558 rs1182449 G/A G 0,417931 123723 rs28405316 A/G G 0,0896565 124313 rs28645654 A/G G 0,0882588 124329 rs527503427 A/G G 0,0816693 124352 rs62493378 G/C C 0,0902556 124363 rs6459749 C/T T 0,102636 124479 rs36004823 G/A/C A 0,0650958 124573 rsll84670 G/A G 0,317292 125180 rs537068805 -/AC AC 0,108069 125331 rslll613223 AC/- AC 0,278371 125385 rsl40579430 ACACAC/- - 0,413738 125495 rs563319111 -/AC AC 0,0642971 125551 rsl39639074 AC/- - 0,243074 125605 rs3757827 C/T T 0,192292 126610 Variant name Variant alleles minor allele Minor allele Position on SEQ frequency ID NO: 1 rsll82414 G/A G 0,418131 126757 rs3802103 G/A A 0,0756789 126861 rsll82413 G/A G 0,417732 126951 rs62493379 G/A A 0,082468 127334 rs4262225 C/A A 0,0634984 128222 rs34722975 -/A A 0,0750799 128294 rsll82412 A/G A 0,188099 128371 rs8101 T/C C 0,46885 129868 rs7807 C/A C 0,284744 130036

Modulation of expression

The term "modulation of expression" as used herein is to be understood as an overall term for an oligonucleotide's ability to alter the amount of UBE3C when compared to the amount of UBE3C before administration of the oligonucleotide. Alternatively modulation of expression may be determined by reference to a control experiment. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock). It may however also be an individual treated with the standard of care.

One type of modulation is an oligonucleotide's ability to inhibit, down-regulate, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of UBE3C, e.g. by degradation of mRNA or blockage of transcription. Another type of modulation is an oligonucleotide's ability to restore, increase or enhance expression of UBE3C, e.g. by repair of splice sites or prevention of splicing or removal or blockage of inhibitory mechanisms such as microRNA repression. High affinity modified nucleosides

A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1 .5 to +10°C and most preferably between+3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2' substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213). Sugar modifications

The oligomer of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.

Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.

Such modifications include those where the ribose ring structure is modified, e.g. by

replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO201 1/017521 ) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.

Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2', 3', 4' or 5' positions.

Nucleosides with modified sugar moieties also include 2' modified nucleosides, such as 2' substituted nucleosides. Indeed, much focus has been spent on developing 2' substituted nucleosides, and numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.

2' modified nucleosides.

A 2' sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or comprises a 2' linked biradicle, and includes 2' substituted nucleosides and LNA (2' - 4' biradicle bridged) nucleosides. For example, the 2' modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2' substituted modified nucleosides are 2'-0-alkyl-RNA, 2'-0- methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, and 2'-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293- 213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2' substituted modified nucleosides.

Figure imgf000025_0001

2'-0- β 2'F-HNA 2'F-ANA

Figure imgf000025_0002

2'-0-MOE 2'nD-Allyl 2'-0-Eth¾ tamine

Locked Nucleic Acid Nucleosides (LNA).

LNA nucleosides are modified nucleosides which comprise a linker group (referred to as a biradicle or a bridge) between C2' and C4' of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.

In some embodiments, the modified nucleoside or the LNA nucleosides of the oligomer of the invention has a general structure of the formula I or II:

Figure imgf000025_0003

or

Formula I Formula II

wherein W is selected from -0-, -S-, -N(Ra)-, -C(RaRb)-, such as, in some embodiments -0-; B designates a nucleobase or modified nucleobase moiety;

Z designates an internucleoside linkage to an adjacent nucleoside, or a 5'-terminal group; Z* designates an internucleoside linkage to an adjacent nucleoside, or a 3'-terminal group; X designates a group selected from the list consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, - C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z

In some embodiments, X is selected from the group consisting of: -0-, -S-, NH-, NRaRb, -CH2-, CRaRb, -C(=CH2)-, and -C(=CRaRb)-

In some embodiments, X is -O- Y designates a group selected from the group consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, - C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z

In some embodiments, Y is selected from the group consisting of: -CH2-, -C(RaRb)-, - CH2CH2-, -C(RaRb)-C(RaRb)-, -CH2CH2CH2-, -C(RaRb)C(RaRb)C(RaRb)-, -C(Ra)=C(Rb)-, and -C(Ra)=N-

In some embodiments, Y is selected from the group consisting of: -CH2-, -CHRa-, - CHCH3-, CRaRb- or -X-Y- together designate a bivalent linker group (also referred to as a radicle) together designate a bivalent linker group consisting of 1 , 2, 3 or 4 groups/atoms selected from the group consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -0-, -Si(Ra)2-, -S-, -S02-, -N(Ra)-, and >C=Z,

In some embodiments, -X-Y- designates a biradicle selected from the groups consisting of: -X-CH2-, -X-CRaRb-, -X-CHRa-, -X-C(HCH3)~, -0-Y-, -0-CH2-, -S-CH2-, -NH-CH2-, -O- CHCH3-, -CH2-0-CH2, -0-CH(CH3CH3)-, -0-CH2-CH2-, OCH2-CH2-CH2-,-0-CH2OCH2-, - 0-NCH2-, -C(=CH2)-CH2-, -NRa-CH2-, N-0-CH2, -S-CRaRb- and -S-CHRa-.

In some embodiments -X-Y- designates -0-CH2- or -0-CH(CH3)-.

wherein Z is selected from -0-, -S-, and -N(Ra)-,

and Ra and, when present Rb, each is independently selected from hydrogen, optionally substituted C^e-alkyl, optionally substituted C2.6-alkenyl, optionally substituted C2.6-alkynyl, hydroxy, optionally substituted Ci-e-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6- alkoxycarbonyl, Ci-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(Ci_6- alkyl)amino, carbamoyl, mono- and di(Ci-6-alkyl)-amino-carbonyl, amino-Ci-6-alkyl- aminocarbonyl, mono- and di(Ci-6-alkyl)amino-Ci-6-alkyl-aminocarbonyl, Ci_6-alkyl- carbonylamino, carbamido, Ci-6-alkanoyloxy, sulphono, Ci-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C _6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents Ra and Rb together may designate optionally substituted methylene (=CH2), wherein for all chiral centers, asymmetric groups may be found in either R or S orientation.

wherein R1 , R2, R3, R5 and R5* are independently selected from the group consisting of:

hydrogen, optionally substituted C^e-alkyl, optionally substituted C2.6-alkenyl, optionally substituted C2.6-alkynyl, hydroxy,

Figure imgf000026_0001
C2.6-alkoxyalkyl, C2.6-alkenyloxy, carboxy, C1-6- alkoxycarbonyl, d-e-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1.6- alkyl)amino, carbamoyl, mono- and di(C1.6-alkyl)-amino-carbonyl, amino-d-e-alkyl- aminocarbonyl, mono- and di(C1.6-alkyl)amino-C1.6-alkyl-aminocarbonyl, d-e-alkyl- carbonylamino, carbamido, Ci-e-alkanoyloxy, sulphono, Ci-e-alkylsulphonyloxy, nitro, azido, sulphanyl, C _6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene.

In some embodiments R1 , R2, R3, R5 and R5* are independently selected from Ci_6 alkyl, such as methyl, and hydrogen.

In some embodiments R1 , R2, R3, R5 and R5* are all hydrogen.

In some embodiments R1 , R2, R3, are all hydrogen, and either R5 and R5* is also hydrogen and the other of R5 and R5*is other than hydrogen, such as Ci_6 alkyl such as methyl. In some embodiments, Ra is either hydrogen or methyl. In some embodiments, when present, Rb is either hydrogen or methyl.

In some embodiments, one or both of Ra and Rb is hydrogen

In some embodiments, one of Ra and Rb is hydrogen and the other is other than hydrogen

In some embodiments, one of Ra and Rb is methyl and the other is hydrogen

In some embodiments, both of Ra and Rb are methyl.

In some embodiments, the biradicle -X-Y- is -0-CH2-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO99/014226, WO00/66604, WO98/039352 and WO2004/046160 which are all hereby incorporated by reference, and include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides. In some embodiments, the biradicle -X-Y- is -S-CH2-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such thio LNA nucleosides are disclosed in WO99/014226 and

WO2004/046160 which are hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -NH-CH2-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such amino LNA nucleosides are disclosed in WO99/014226 and

WO2004/046160 which are hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -0-CH2-CH2- or -0-CH2-CH2- CH2-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in

WOOO/047599 and Morita et al, Bioorganic & Med.Chem. Lett. 12 73-76, which are hereby incorporated by reference, and include what are commonly known as 2'-0-4'C-ethylene bridged nucleic acids (ENA).

In some embodiments, the biradicle -X-Y- is -0-CH2-, W is O, and all of R1 , R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such 5' substituted LNA nucleosides are disclosed in WO2007/1 34181 which is hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -0-CRaRb-, wherein one or both of Ra and Rb are other than hydrogen, such as methyl, W is O, and all of R1 , R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as Ci-6 alkyl, such as methyl. Such bis modified LNA nucleosides are disclosed in WO2010/077578 which is hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O- CH(CH2OCH3)- (2' O-methoxyethyl bicyclic nucleic acid - Seth at al., 201 0, J. Org. Chem. Vol 75(5) pp. 1569-81 ). In some embodiments, the biradicle -X-Y- designate the bivalent linker group -0-CH(CH2CH3)- (2'O-ethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81 ). In some embodiments, the biradicle -X-Y- is -0-CHR% W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such 6' substituted LNA nucleosides are disclosed in W010036698 and WO07090071 which are both hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -0-CH(CH2OCH3)-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are also known as cyclic MOEs in the art (cMOE) and are disclosed in WO07090071 .

In some embodiments, the biradicle -X-Y- designate the bivalent linker group -0-CH(CH3)-. - in either the R- or S- configuration. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -0-CH2-0-CH2- (Seth at al., 2010, J. Org. Chem). In some

embodiments, the biradicle -X-Y- is -0-CH(CH3)-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such 6' methyl LNA nucleosides are also known as cET nucleosides in the art, and may be either (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010/036698 (alpha-L) which are both hereby incorporated by reference).

In some embodiments, the biradicle -X-Y- is -0-CRaRb-, wherein in neither Ra or Rb is hydrogen, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. In some embodiments, Ra and Rb are both methyl. Such 6' di-substituted LNA nucleosides are disclosed in WO

2009006478 which is hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -S-CHR% W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such 6' substituted thio LNA nucleosides are disclosed in W01 1 1 56202 which is hereby incorporated by reference. In some 6' substituted thio LNA embodiments Ra is methyl.

In some embodiments, the biradicle -X-Y- is -C(=CH2)-C(RaRb)-, such as -C(=CH2)-CH2- , or - C(=CH2)-CH(CH3)-W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. Such vinyl carbo LNA nucleosides are disclosed in WO08154401 and WO09067647 which are both hereby incorporated by reference.

In some embodiments the biradicle -X-Y- is -N(-ORa)-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C -6 alkyl such as methyl. Such LNA nucleosides are also known as N substituted LNAs and are disclosed in WO2008/150729 which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -0-NRa-CH3- (Seth at al., 2010, J. Org. Chem). In some embodiments the biradicle -X-Y- is -N(Ra)-, W is O, and all of R1 , R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is Ci_6 alkyl such as methyl.

In some embodiments, one or both of R5 and R5* is hydrogen and, when substituted the other of R5 and R5* is C1-6 alkyl such as methyl. In such an embodiment, R1 , R2, R3, may all be hydrogen, and the biradicle -X-Y- may be selected from -0-CH2- or -0-C(HCRa)-, such as -0-C(HCH3)-.

In some embodiments, the biradicle is -CRaRb-0-CRaRb-, such as CH2-0-CH2-, W is O and all of R1 , R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is 0 -6 alkyl such as methyl. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868 which is hereby incorporated by reference.

In some embodiments, the biradicle is -0-CRaRb-0-CRaRb-, such as 0-CH2-0-CH2-, W is O and all of R1 , R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is 01-6 alkyl such as methyl. Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238, which is hereby incorporated by reference.

It will be recognized than, unless specified, the LNA nucleosides may be in the beta-D or alpha- L stereoisoform.

Certain examples of LNA nucleosides are presented in Scheme 1 .

Scheme 1

Figure imgf000030_0001

As illustrated in the examples, in some embodiments of the invention the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides. Nuclease mediated degradation

Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence.

In some embodiments, the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H. Examples of oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one side or both sides by affinity enhancing nucleosides, for example gapmers, headmers and tailmers.

RNase H Activity and Recruitment

The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613 (hereby incorporated by reference).

Gapmer

The term gapmer as used herein refers to an antisense oligonucleotide which comprises a region of RNase H recruiting oligonucleotides (gap) which is flanked 5' and 3' by regions which comprise one or more affinity enhancing modified nucleosides (flanks or wings). Various gapmer designs are described herein. Headmers and tailmers are oligonucleotides capable of recruiting RNase H where one of the flanks is missing, i.e. only one of the ends of the oligonucleotide comprises affinity enhancing modified nucleosides. For headmers the 3' flank is missing (i.e. the 5' flank comprises affinity enhancing modified nucleosides) and for tailmers the 5' flank is missing (i.e. the 3' flank comprises affinity enhancing modified nucleosides).

LNA Gapmer

The term LNA gapmer is a gapmer oligonucleotide wherein at least one of the affinity enhancing modified nucleosides is an LNA nucleoside.

Mixed Wing Gapmer

The term mixed wing gapmer or mixed flank gapmer refers to a LNA gapmer wherein at least one of the flank regions comprise at least one LNA nucleoside and at least one non-LNA modified nucleoside, such as at least one 2' substituted modified nucleoside, such as, for example, 2'-0-alkyl-RNA, 2'-0-methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA (MOE), 2'- amino-DNA, 2'-Fluoro-RNA and 2'-F-ANA nucleoside(s). In some embodiments the mixed wing gapmer has one flank which comprises only LNA nucleosides (e.g. 5' or 3') and the other flank (3' or 5' respectfully) comprises 2' substituted modified nucleoside(s) and optionally LNA nucleosides. Conjugate

The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region).

In some embodiments, the non-nucleotide moiety selected from the group consisting of a protein, such as an enzyme, an antibody or an antibody fragment or a peptide; a lipophilic moiety such as a lipid, a phospholipid, a sterol; a polymer, such as polyethyleneglycol or polypropylene glycol; a receptor ligand; a small molecule; a reporter molecule; and a non- nucleosidic carbohydrate.

WO 93/07883 and WO2013/033230 provides suitable conjugate moieties, which are hereby incorporated by reference. Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr). In particular tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the the ASGPr, see for example WO 2014/076196, WO 2014/207232 and WO 2014/179620 (hereby incorporated by reference, in particular figure 13 of WO 2014/076196 or claimsl 58-164 of WO 2014/179620).

Oligonucleotide conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S . Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety. Linkers

A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region (region C), e.g. a conjugate moiety to an oligonucleotide (region A) (e.g. connecting one of the termini of region A to C).

In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B) which is positioned between the oligonucleotide or the contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).

Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 10 nucleosides, such as 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA.

Phosphodiester containing biocleavable linkers are described in more detail in WO

2014/076195 (hereby incorporated by reference).

Conjugates may also be linked to the oligonucleotide via non-biocleavable linkers, or in some embodiments the conjugate may comprise a non-cleavable linker which is covalently attached to the biocleavable linker (region Y). Linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide (region A or first region), may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments the non-cleavable linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group. Conjugate linker groups may be routinely attached to an oligonucleotide via use of an amino modified oligonucleotide, and an activated ester group on the conjugate group.

Treatment

The term 'treatment' as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.

DETAILED DESCRIPTION OF THE INVENTION The Oligonucleotides of the Invention

The invention relates to oligonucleotides capable of inhibiting expression of UBE3C. The modulation is achieved by hybridizing an oligonucleotide (antisense) to a target nucleic acid encoding UBE3C. The target nucleic acid may be a mammalian UBE3C sequence, such as a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 3, 4 or 5, or naturally occurring variants thereof. The oligonucleotide of the invention is an antisense oligonucleotide which targets UBE3C pre- mRNA of SEQ ID NO: 1 . Alternatively, the antisense oligonucleotide target a UBE3C mature mRNA of SEQ ID NO: 2, 3 or 4. In some preferred embodiments the antisense oligonucleotide is complementary to or hybridizes to both SEQ ID NO: 1 and SEQ ID NO: 5. In some preferred embodiments, the antisense oligonucleotide is complementary to or hybridizes to SEQ ID NO: 6. In some preferred embodiments, the antisense oligonucleotide is complementary to or hybridizes to SEQ ID NO: 22.

In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of the target by inhibiting or reducing target transcript in the cell. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the normal expression level of the target. In some embodiments oligonucleotides of the invention may be capable of inhibiting expression levels of UBE3C mRNA by at least 60% or 70% in vitro using HeLa cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of UBE3C protein by at least 50% in vitro using HeLa cells. Suitably, the examples provide assays which may be used to measure UBE3C RNA or protein inhibition (e.g. example 1 ). The target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of UBE3C

expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2' modified nucleosides, including LNA, present within the oligonucleotide sequence.

The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to the target nucleic acid, such as a target sequence (subsequence) as described herein.

An aspect of the present invention relates to an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90%

complementarity to an UBE3C target nucleic acid.

In some embodiments, the oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid or a target sequence. In a preferred embodiment the oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target nucleic acid or target sequence), or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.

In some embodiments the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as fully (or 100%)

complementary, to a target nucleic acid region (target sequence) present in SEQ ID NO: 1 , 2, 3 and/or 4. In some embodiments the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present in SEQ ID NO: 1 and 5. In some embodiments the contiguous nucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO 5.

In some embodiments, the target sequence is repeated within the target nucleic acid. A repeat (or repeated) target sequence in the context of the present application means that there is a number of independent regions located within the target nucleic acid which have at least 90% identity, preferably 95% identity more preferably at least 100% identity. The repeat target sequences can be distributed independently from each other across the target nucleic acid (i.e. they are not necessarily adjacent to each other). The length of the repeated independent regions are generally between 8 and 50 nucleotides, such as between 10 and 30 nucleotides, such as between 12 and 25 nucleotides such as between 13 and 22 nucleotides, such as between 14 and 20 nucleotides, such as between 15 and 19 nucleotides, such as between 16 and 18 nucleotides. In a preferred embodiment the independent region that is repeated is between 14 and 20 nucleotides.

In one aspect the invention provides oligonucleotides that can hybridize to multiple repeated target sequences located at different positions in the target nucleic acid and exert its effect, such as cleavage or blockage, at several independent regions on the target nucleic acid, which potentially leads to an oligonucleotide that is more effective in modulating the target, than an oligonucleotide that only hybridizes at one place on the target nucleic acid. In some

embodiments the oligonucleotide hybridizes to more than one independent region over the length of SEQ ID NO: 1 , 2, 3 and/or 4, such that the oligonucleotide is complementary to at least 3 independent regions (target sequences), such as at least 4, 5, 6, 7, 8, 9 or 10 independent regions, such as more than 10 independent regions of SEQ ID NO: 1 , 2, 3 and/or 4.

In some embodiments the invention provides an oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to at least three independent regions within a target nucleic acid selected from the group consisting of SEQ ID NO: 1 , 2, 3, and/or 4. In a preferred embodiment the oligonucleotide is fully complementary to at least two of the independent regions.

In some embodiments the invention provides an oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to at least three repeat target sequences within a target nucleic acid selected from the group consisting of SEQ ID NO: 1 , 2, 3, and/or 4. In a preferred embodiment the oligonucleotide is fully complementary to at least two of the repeat target sequences.

In the present application independent regions, repeat target sequences and repeated target sequences can be used interchangeably.

In a further embodiment, the invention provides the antisense oligonucleotide of the previous embodiment, wherein at least one of the at least three independent regions or repeat target sequences of the target nucleic acid is located in an intron. In a preferred embodiment all the independent regions or repeat target sequences to which the oligonucleotide is complementary are located in intron sequences.

In a further embodiment, the invention provides the antisense oligonucleotide of the previous embodiments, wherein all the independent regions are located in an intron as indicated in Table 1 . In a preferred embodiment the all the independent regions are in intron 22, which is defined as a nucleic acid region consisting of the positions between 1 18133-128672 of SEQ ID NO 1 . Targeting intron sequences with antisense oligonucleotides, allows modulation of pre-mRNA's which may in some instances be very effective.

In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 20 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region present in SEQ ID NO: 6.

In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence of 10 - 20 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region present in SEQ ID NO: 22.

In some embodiments, the oligonucleotide or contiguous nucleotide sequence is

complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of position 125153-125170, 125317-125334, 125435- 125452, 125485-125502, 125541 -125558, 125595-125612, 125153-125168, 125317-125332, 125435-125450, 125485-125500, 125541 -125556, 125595-125610; 125153-125166, 125317- 125330, 125435-125448, 125485-125498, 125541 -125554, 125595-128608; 125151 -125170, 125315-125334, 125433-125452, 125483-125502, 125539-125558, 125593-125612; 125151 - 125166, 125315-125330, 125433-125448, 125483-125498, 125539-125554, 125593-125608; 125152-125169, 125316-125333, 125434-125451 , 125484-125501 , 125540-125557, 125594- 12561 1 ; 125152-125171 , 125316-125335, 125434-125453, 125484-125503, 125540-125559, 125594-125613 of SEQ ID NO: 1 .

In some embodiments, the oligonucleotide of the invention comprises or consists of 10 to 35 nucleotides in length, such as from 10 to 30, such as 1 1 to 22, such as from 12 to 20, such as from such as from 14 to 20, such as from 14 to 18 such as from 14 to 16, such as from 16 to 20 contiguous nucleotides in length.

In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 22 or less nucleotides, such as 20 or less nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if an oligonucleotide is said to include from 10 to 30 nucleotides, both 10 and 30 nucleotides are included.

In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of sequences listed in Table 5.

In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 22 nucleotides in length with at least 90% identity, preferably

100% identity, to a sequence selected from the group consisting of SEQ ID NO: 7- 14 (see motif sequences listed in Table 5).

In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 22 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 15- 21 (see motif sequences listed in Table 5).

Oligonucleotide design

Oligonucleotide design refers to the pattern of nucleoside sugar modifications in the

oligonucleotide sequence. The oligonucleotides of the invention comprise sugar-modified nucleosides and may also comprise DNA or RNA nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and DNA nucleosides. Incorporation of modified nucleosides into the oligonucleotide of the invention may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the modified nucleosides can be referred to as affinity enhancing modified nucleotides, the modified nucleosides may also be termed units.

In an embodiment, the oligonucleotide comprises at least 1 modified nucleoside, such as from 1 to 8 modified nucleosides, such as from 2 to 8 modified nucleosides, such as from 3 to 7 modified nucleosides, such as from 4 to 6 modified nucleosides. In a preferred embodiment the oligonucleotide comprises 3 to 6 modified nucleosides. In an embodiment, the oligonucleotide comprises one or more sugar modified nucleosides, such as 2' sugar modified nucleosides. Preferably the oligonucleotide of the invention comprise the one or more 2' sugar modified nucleoside independently selected from the group consisting of 2'-0-alkyl-RNA, 2'-0-methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA, 2'-amino-DNA, 2'- fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. Even more preferably the one or more modified nucleoside is a locked nucleic acid (LNA).

In a further embodiment the oligonucleotide comprises at least one modified internucleoside linkage. In a preferred embodiment all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages.

In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside, such as from 1 to 8 LNA nucleosides, such as from 2 to 8 LNA nucleosides, such as from 3 to 7 LNA nucleosides, such as from 4 to 6 LNA nucleosides.

In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside and at least one 2' substituted modified nucleoside.

In an embodiment of the invention the oligonucleotide of the invention is capable of recruiting RNase H.

Gapmer design

In a preferred embodiment the oligonucleotide of the invention has a gapmer design or structure also referred herein merely as "Gapmer". In a gapmer structure the oligonucleotide comprises at least three distinct structural regions a 5'-flank, a gap and a 3'-flank, F-G-F' in '5 -> 3' orientation. In this design, flanking regions F and F' (also termed wing regions) comprise a contiguous stretch of modified nucleosides, which are complementary to the UBE3C target nucleic acid, while the gap region, G, comprises a contiguous stretch of nucleotides which are capable of recruiting a nuclease, preferably an endonuclease such as RNase, for example RNase H, when the oligonucleotide is in duplex with the target nucleic acid. Nucleosides which are capable of recruiting a nuclease, in particular RNase H. In preferred embodiments the gap region consists of DNA nucleosides. Regions F and F', flanking the 5' and 3' ends of region G, preferably comprise non-nuclease recruiting nucleosides (nucleosides with a 3' endo structure), more preferably one or more affinity enhancing modified nucleosides. In some embodiments, the 3' flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. In some embodiments, the 5' flank comprises at least one LNA nucleoside. In some embodiments both the 5' and 3' flanking regions comprise a LNA nucleoside. In some embodiments all the nucleosides in the flanking regions are LNA nucleosides. In other embodiments, the flanking regions may comprise both LNA nucleosides and other nucleosides (mixed flanks), such as DNA nucleosides and/or non-LNA modified nucleosides, such as 2' substituted nucleosides. In this case the gap is defined as a contiguous sequence of at least 5 RNase H recruiting nucleosides (nucleosides with a 2' endo structure, preferably DNA) flanked at the 5' and 3' end by an affinity enhancing modified nucleoside, preferably LNA, such as beta-D-oxy-LNA.

Consequently, the nucleosides of the 5' flanking region and the 3' flanking region which are adjacent to the gap region are modified nucleosides, preferably non-nuclease recruiting nucleosides or high affinity nucleosides.

Region F

Region F (5' flank or 5' wing) attached to the 5' end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, or at least 4 modified nucleosides. In an embodiment region F comprises or consists of from 1 to 4 modified nucleosides, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified

nucleosides, such as 1 , 2, 3 or 4 modified nucleosides. The F region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.

In some embodiments, the modified nucleosides in region F have a 3' endo structure.

In an embodiment, one or more of the modified nucleosides in region F are 2' modified nucleosides. In one embodiment all the nucleosides in Region F are 2' modified nucleosides.

In another embodiment region F comprises DNA and/or RNA nucleosides in addition to the 2' modified nucleosides. Flanks comprising DNA and/or RNA are characterized by having a 2' modified nucleoside in the 5' end and the 3'end (adjacent to the G region) of the F region. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. The length of the 5' flank (region F) in oligonucleotides with DNA and/or RNA nucleotides in the flanks may be longer, maintaining the number of 2' modified nucleotides at 1 to 4 as described above. In a further embodiment one or more of the 2' modified nucleosides in region F are selected from 2'- O-alkyl-RNA units, 2'-0-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units.

In some embodiments the F region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.

In one embodiment of the invention all the modified nucleosides in region F are LNA

nucleosides. In a further embodiment all the nucleosides in region F are LNA nucleosides. In a further embodiment the LNA nucleosides in region F are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof. In a preferred embodiment region F comprises at least 1 beta-D-oxy LNA unit, at the 5' end of the contiguous sequence. In a further preferred embodiment region F consists of beta-D-oxy LNA nucleosides. Region G

Region G (gap region) preferably comprise, contain or consist of from 6 to 17, or from 7 to 16 or from 8 to 12 consecutive nucleotide units capable of recruiting RNase H nuclease.

The nucleoside units in region G, which are capable of recruiting nuclease are in an

embodiment selected from the group consisting of DNA, alpha-L-LNA, C4' alkylated DNA (as described in PCT/EP2009/050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296 - 2300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F- ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661 ), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039 incorporated herein by reference). UNA is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked "sugar" residue.

In some embodiments, region G consists of 100% DNA units.

In further embodiments the region G may consist of a mixture of DNA and other nucleosides capable of mediating RNase H cleavage.

In some embodiments, nucleosides in region G have a 2' endo structure. Region F

Region F' (3' flank or 3' wing) attached to the 3' end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, or at least 4 modified nucleosides. In an embodiment region F' comprises or consists of from 1 to 4 modified nucleosides, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified

nucleosides, such as 1 , 2, 3 or 4 modified nucleosides. The F' region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.

In some embodiments, the modified nucleosides in region F' have a 3' endo structure.

In an embodiment, one or more of the modified nucleosides in region F' are 2' modified nucleosides. In one embodiment all the nucleosides in Region F' are 2' modified nucleosides.

In another embodiment region F' comprises DNA and/or RNA nucleosides in addition to the 2' modified nucleosides. Flanks comprising DNA and/or RNA are characterized by having a 2' modified nucleoside in the 5' end and the 3'end (adjacent to the G region) of the F' region. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. The length of the 3' flank (region F') in oligonucleotides with DNA and/or RNA nucleotides in the flanks may be longer, maintaining the number of 2' modified nucleotides at 1 to 4 as described above. In a further embodiment one or more of the 2' modified nucleosides in region F' are selected from 2'- O-alkyl-RNA units, 2'-0-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units. In some embodiments the F' region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.

In one embodiment of the invention all the modified nucleosides in region F' are LNA

nucleosides. In a further embodiment all the nucleosides in region F' are LNA nucleosides. In a further embodiment the LNA nucleosides in region F' are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof. In a preferred embodiment region F' comprises at least two beta-D-oxy LNA unit, at the 3' end of the contiguous sequence. In a further preferred embodiment region F' consists of beta-D-oxy LNA nucleosides. Region D' and D"

Region D' and D" can be attached to the 5' end of region F or the 3' end of region F', respectively.

Region D' or D" may independently comprise 1 , 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. In this respect the oligonucleotide of the invention, may in some embodiments comprise a contiguous nucleotide sequence capable of modulating the target which is flanked at the 5' and/or 3' end by additional nucleotides. Such additional nucleotides may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5' and/or 3' end

nucleotides are linked with phosphodiester linkages, and may be DNA or RNA. In another embodiment, the additional 5' and/or 3' end nucleotides are modified nucleotides which may for example be included to enhance nuclease stability or for ease of synthesis. In an embodiment the oligonucleotide of the invention, comprises a region D' and/or D" in addition to the contiguous nucleotide sequence.

The gapmer oligonucleotide of the present invention can be represented by the following formulae:

In some embodiments the oligonucleotide is a gapmer consisting of 14-20 nucleotides in length, wherein each of regions F and F' independently consists of 1 , 2, 3 or 4 modified nucleoside units complementary to the UBE3C target nucleic acid and region G consists of 6-17 nucleoside units, capable of recruiting nuclease when in duplex with the UBE3C target nucleic acid.

In some embodiments the F-G-F' design is selected from 1 -17-2, 3-13-2, 2-12-2, 3-9-2, 2-14-4, 2-10-4, 4-10-4, 4-10-2, 4-9-3, 2-8-4 and 4-6-4.

In preferred embodiments the F-G-F' design is selected from 1 -17-2, 2-10-4, 3-12-3, 2-14-2, 4- 10-2, 2-8-4 and 4-6-4. In all instances the F-G-F' design may further include region D' and/or D", which may have 1 , 2 or 3 nucleoside units, such as DNA units. Preferably, the nucleosides in region F and F' are modified nucleosides, while nucleotides in region G are unmodified nucleosides.

In each design, the preferred modified nucleoside is LNA.

In another embodiment all the internucleoside linkages in the gap in a gapmer are

phosphorothioate and/or boranophosphate linkages. In another embodiment all the

internucleoside linkages in the flanks (F and F' region) in a gapmer are phosphorothioate and/or boranophosphate linkages. In another embodiment all the internucleoside linkages in the oligonucleotide with the F-G-F' design are phosphorothioate linkages. In another preferred embodiment all the internucleoside linkages in the D' and D" region in a gapmer are

phosphodiester linkages.

For specific gapmers as disclosed herein, when the cytosine (C) residues are annotated as 5- methyl-cytosine, in various embodiments, one or more of the C's present in the oligonucleotide may be unmodified C residues.

For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 7_1 , 8_1 , 9_1 , 10_1 , 1 1_1 , 12_1 , 13_1 , 14_1 , 15_1 ; 16_1 ; 17_1 ; 18_1 ; 19_1 ; 20_1 ; 21_1 , and 21_2.

In a preferred embodiment of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 15_1 ; 16_1 ; 17_1 ; 18_1 ; 19_1 ; 20_1 ; 21_1 , and 21_2.

Method of manufacture

In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287- 313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand). In a further aspect a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.

Pharmaceutical Composition

In a further aspect, the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 - 300μΜ solution.

Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091 .

Oligonucleotides or oligonucleotide conjugates of the invention may be mixed with

pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 1 1 , more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.

In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. In particular with respect to oligonucleotide conjugates the conjugate moiety is cleaved of the oligonucleotide once the prodrug is delivered to the site of action, e.g. the target cell.

Applications

The oligonucleotides of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.

In research, such oligonucleotides may be used to specifically modulate the synthesis of UBE3C protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically the target modulation is achieved by degrading or inhibiting the pre- mRNA or mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.

If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

The present invention provides an in vivo or in vitro method for modulating UBE3C expression in a target cell which is expressing UBE3C, said method comprising administering an oligonucleotide of the invention in an effective amount to said cell.

In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In preferred embodiments the target cell is present in lymph nodes, heart, skeletal muscle, small intestine, colon, kidney, liver, lung, pancreatic, thyroid, salivary and adrenal gland, ovary, prostate tissues. In a preferred embodiment the target cell is a liver cell, such as a hepatocyte.

In diagnostics the oligonucleotides may be used to detect and quantitate UBE3C expression in cell and tissues by northern blotting, in-situ hybridization or similar techniques.

For therapeutics, an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of UBE3C.

The invention provides methods for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease.

The invention also relates to an oligonucleotide, a composition or a conjugate as defined herein for use as a medicament.

The oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount.

The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.

The disease or disorder, as referred to herein, is associated with expression of UBE3C. In some embodiments disease or disorder may be associated with a mutation in the UBE3C gene.

The methods of the invention are preferably employed for treatment or prophylaxis against diseases caused by abnormal levels and/or activity of UBE3C.

The invention further relates to use of an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of abnormal levels and/or activity of UBE3C. In one embodiment, the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of diseases or disorders selected from, proliferatory disorders, such as cancer. In some embodiments cancer is selected from selected from the group comprising melanoma, breast cancer, glioma and renal cell carcinoma. In another embodiment, the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of inflammatory disorders, such as asthma, in particular aspirin resistant asthma.

Administration

The oligonucleotides or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, by inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal).

In a preferred embodiment the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial,

subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g. intracerebral or intraventricular, intravitreal administration. In one embodiment the active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment the active oligonucleotide or oligonucleotide conjugate is administered

subcutaneously.

In some embodiments, the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1 - 15 mg/kg, such as from 0.2 - 10 mg/kg, such as from 0.25 - 5 mg/kg. The administration can be once a week, every 2nd week, every third week or even once a month.

The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for subcutaneous administration. The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for intravenous administration.

EMBODIMENTS

The following embodiments of the present invention may be used in combination with any other embodiments described herein.

1 . An antisense oligonucleotide which comprises or consists of a contiguous nucleotide sequence of 10 to 30 nucleotides in length capable of modulating expression of UBE3C in a cell. 2. The antisense oligonucleotide of embodiment 1 , wherein the contiguous nucleotide sequence is at least 80%, or at least 85%, or at least 90%, or at least 95% or fully

complementary to a UBE3C target nucleic acid.

3. The antisense oligonucleotide of embodiment 1 or 2, wherein the contiguous nucleotide sequence is 100% complementary to a UBE3C target nucleic acid

4. The antisense oligonucleotide of any one of embodiments 1 to 3, wherein the UBE3C target nucleic acid is selected from SEQ ID NO's: 1 , 2, 3 and/or 4 or natural variants thereof.

5. The antisense oligonucleotide of embodiment 1 to 4, wherein the contiguous nucleotide sequence is complementary to both SEQ ID NO: 1 and SEQ ID NO: 5.

6. The antisense oligonucleotide of embodiment 1 to 5, wherein the contiguous nucleotide sequence is complementary to at least one independent region of 10 to 50 nucleotides in length located within an intron of the target nucleic acid of SEQ ID NO: 1 .

7. The antisense oligonucleotide of any one of embodiments 1 to 6, wherein the contiguous nucleotide sequence has at least 90% complementarity to at least two repeat target sequences within the target nucleic acid.

8. The antisense oligonucleotide of any of the embodiments 1 to 7, wherein the contiguous nucleotide sequence is at least 90% complementarity to a target sequence of 12-30 nucleotides in length present in a target nucleic acid selected from SEQ ID NO's: 1 , 2, 3 and/or 4, wherein the target sequence is repeated anyone of 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more times across said target nucleic acid.

9. The antisense oligonucleotide of embodiment 8, wherein at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 of said repeat target sequences across the target nucleic acid has at least 95% or at least 100% identity with each other.

10. The antisense oligonucleotide of any one of embodiments 8 to 9, wherein the repeat target sequences is present 3 to 5 times.

1 1 . The antisense oligonucleotide of any of the embodiments 7 to 10, wherein all the repeat target sequences are located in one or more introns of the target nucleic acid.

12. The antisense oligonucleotide of embodiment 1 1 , wherein at least one of the repeat target sequences is positioned in intron 22 in SEQ ID NO: 1 .

13. The antisense oligonucleotide of embodiment 12, wherein at least three of the repeat target sequences are independently located within the region between position 1 18133-128672 of SEQ ID NO 1 .

14. The antisense oligonucleotide of any one of embodiments 1 -13, wherein the contiguous nucleotide sequence is complementary to at least 12 nucleotides of SEQ ID NO: 6. 15. The antisense oligonucleotide of any one of embodiments 1 -13, wherein the contiguous nucleotide sequence is complementary to at least 12 nucleotides of SEQ ID NO: 22.

16. The antisense oligonucleotide of any one of the embodiments 1 -14, wherein the contiguous nucleotide sequence is complementary to at least two of the target sequences, selected from the group consisting of position 125153-125170, 125317-125334, 125435-

125452, 125485-125502, 125541 -125558, 125595-125612, 125153-125168, 125317-125332, 125435-125450, 125485-125500, 125541 -125556, 125595-125610; 125153-125166, 125317- 125330, 125435-125448, 125485-125498, 125541 -125554, 125595-128608; 125151 -125170, 125315-125334, 125433-125452, 125483-125502, 125539-125558, 125593-125612; 125151 - 125166, 125315-125330, 125433-125448, 125483-125498, 125539-125554, 125593-125608; 125152-125169, 125316-125333, 125434-125451 , 125484-125501 , 125540-125557, 125594- 12561 1 ; 125152-125171 , 125316-125335, 125434-125453, 125484-125503, 125540-125559, 125594-125613 of SEQ ID NO: 1 .

17. The antisense oligonucleotide of embodiment 1 to 16, wherein the oligonucleotide is capable of hybridizing to a target nucleic acid selected from the group consisting of SEQ ID NO: 1 , 2, 3, 4, 5, 6 and/or 22 with a AG0 below -10 kcal.

18. The antisense oligonucleotide of any one of embodiments 1 or 17, wherein the target nucleic acid is RNA.

19. The antisense oligonucleotide of embodiment 18, wherein the RNA is mRNA.

20. The antisense oligonucleotide of embodiment 19, wherein the mRNA is pre-mRNA or mature mRNA.

21 . The antisense oligonucleotide of any one of embodiments 1 -20, wherein the contiguous nucleotide sequence comprises or consists of from 12 to 22 nucleotides.

22. The antisense oligonucleotide of embodiment 21 , wherein the contiguous nucleotide sequence comprises or consists of from 14-20 nucleotides.

23. The antisense oligonucleotide of anyone of embodiments 1 -22, wherein the

oligonucleotide comprises or consists of 12 to 25 nucleotides in length.

24. The antisense oligonucleotide of any one of embodiments 1 -23, wherein the

oligonucleotide or contiguous nucleotide sequence is single stranded.

25. The antisense oligonucleotide of any one of embodiments 1 -24 wherein the

oligonucleotide is neither siRNA nor self-complementary.

26. The antisense oligonucleotide of any one of embodiments 1 -6 or 17-25, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ's ID NO: 7, 8, 9, 10, 1 1 , 12, 13 and 14. 27. The antisense oligonucleotide of any one of embodiments 1 -25, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ's ID NO: 15, 16, 17, 18, 19, 20 and 21 .

28. The antisense oligonucleotide of any one of embodiments 1 -26, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the target nucleic acid it is complementary to.

29. The antisense oligonucleotide of embodiment 28, wherein the contiguous nucleotide sequence has one mismatch compared to the target nucleic acid.

30. The antisense oligonucleotide of embodiment 28, wherein the contiguous nucleotide sequence is fully complementary to the target nucleic acid sequence.

31 . The antisense oligonucleotide of any one of embodiments 1 -30, comprising one or more modified nucleosides.

32. The antisense oligonucleotide of embodiment 31 , wherein the one or more modified nucleoside is a high-affinity modified nucleosides.

33. The antisense oligonucleotide of embodiments 31 or 32, wherein the modified nucleoside is a 2' sugar modified nucleosides.

34. The antisense oligonucleotide of embodiment 33, wherein the modified 2' sugar modified nucleoside is independently selected from the group consisting of 2'-0-alkyl-RNA, 2'-0-methyl- RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.

35. The antisense oligonucleotide of any one of embodiments 31 -34, wherein the antisense oligonucleotide comprise 3 to 6 2' sugar modified nucleosides.

36. The antisense oligonucleotide of any one of embodiments 1 -35, wherein the

oligonucleotide comprises at least one modified internucleoside linkage.

37. The antisense oligonucleotide of embodiment 36, wherein the modified internucleoside linkage is nuclease resistant.

38. The antisense oligonucleotide of embodiments 36 or 37, wherein at least 75% of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boranophosphate internucleoside linkages.

39. The antisense oligonucleotide of embodiments 36 or 37, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages. 40. The antisense oligonucleotide of any one of embodiments 1 -39, wherein the oligonucleotide is capable of recruiting RNase H.

41 . The antisense oligonucleotide of embodiment 40, wherein the oligonucleotide is a gapmer.

42. The antisense oligonucleotide of embodiment 40 or 41 , wherein the oligonucleotide is a gapmer of formula 5'-F-G-F'-3', where region F and F' independently comprise or consist of 1 - 4 2' sugar modified nucleosides according to embodiment 34 and G is a region between 6 and 17 nucleosides which are capable of recruiting RNaseH.

43. The antisense oligonucleotide of any one of embodiments 33-35 or 42, wherein one or more of the 2' sugar modified nucleosides is a LNA nucleoside.

44. The antisense oligonucleotide of embodiment 43, wherein all the 2' sugar modified nucleosides are LNA nucleosides.

45. The antisense oligonucleotide of embodiment 42, wherein region F and F' consist of LNA nucleosides.

46. The antisense oligonucleotide of any one of embodiments 43-45, wherein the LNA nucleoside is selected from beta- D-oxy- LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L- amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA.

47. The antisense oligonucleotide of any one of embodiments 43-46, wherein the LNA nucleoside is oxy-LNA.

48. The antisense oligonucleotide of any one of embodiments 43.47, wherein the LNA nucleoside is beta- D-oxy- LNA.

49. The antisense oligonucleotide of any one of embodiments 43-47, wherein the LNA nucleoside is thio-LNA.

50. The antisense oligonucleotide of any one of embodiments 43-47, wherein the LNA nucleoside is amino-LNA.

51 . The antisense oligonucleotide of any one of embodiments 43-47, wherein the LNA nucleoside is cET.

52. The antisense oligonucleotide of any one of embodiments 43-47, wherein the LNA nucleoside is ENA.

53. The antisense oligonucleotide of embodiment 43, wherein at least one of region F or F' further comprises at least one 2' substituted modified nucleoside independently selected from the group consisting of 2'-0-alkyl-RNA, 2'-0-methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl- RNA, 2'-amino-DNA and 2'-fluoro-DNA. 54. The antisense oligonucleotide of any one of embodiments 42-53, wherein the RNaseH recruiting nucleosides in region G are independently selected from DNA, alpha-L-LNA, C4' alkylated DNA, ANA and 2'F-ANA and UNA.

55. The antisense oligonucleotide of embodiment 54, wherein the nucleosides in region G is DNA nucleosides.

56. The antisense oligonucleotide of any one of embodiments 1 -6 or 17-55, wherein the oligonucleotide is selected from CMP ID NO: 7_1 , 8_1 , 9_1 , 10_1 , 1 1_1 , 12_1 , 13_1 , and 14_1 .

57. The antisense oligonucleotide of any one of embodiments 1 -55, wherein the

oligonucleotide is selected from CMP ID NO: 15_1 , 16_1 , 17_1 , 18_1 , 19_1 , 20_1 , 21_1 and 21_2.

58. A conjugate comprising the antisense oligonucleotide according to any one of embodiments 1 -57 and at least one conjugate moiety covalently attached to said

oligonucleotide.

59. The antisense oligonucleotide conjugate of embodiment 58, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations thereof.

60. The antisense oligonucleotide conjugate of any one of embodiments 58 or 59, wherein the conjugate moiety is capable of binding to the asialoglycoprotein receptor.

61 . The antisense oligonucleotide conjugate of any one of embodiments 58-60, comprising a linker which is positioned between the oligonucleotide and the conjugate moiety.

62. The antisense oligonucleotide conjugate of embodiment 61 , wherein the linker is a physiologically labile linker.

63. The antisense oligonucleotide conjugate of embodiment 62, wherein the physiologically labile linker is a nuclease susceptible linker.

64. The antisense oligonucleotide conjugate of any one of embodiments 62 to 63, wherein the oligonucleotide has the formula D'-F-G-F' or F-G-F'-D", wherein F, F' and G are as defined in embodiments 42-55 and D' or D" comprises 1 , 2 or 3 DNA nucleosides with phosphorothioate internucleoside linkages.

65. A pharmaceutical composition comprising the oligonucleotide of embodiment 1 -57 or a conjugate of embodiments 58-64 and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant.

66. An in vivo or in vitro method for modulating UBE3C expression in a target cell which is expressing UBE3C , said method comprising administering an oligonucleotide of embodiment 1 - 57 or a conjugate of embodiment 58-64 or the pharmaceutical composition of embodiment 65 in an effective amount to said cell.

67. A method for alleviation or prevention of a disease comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of embodiment 1 -57 or a conjugate of embodiment 58-64 or the pharmaceutical composition of embodiment 65 to a subject suffering from or susceptible to the disease.

68. The antisense oligonucleotide of embodiment 1 -57 or a conjugate of embodiment 58-64 or the pharmaceutical composition of embodiment 65, for use as a medicament for treatment or prevention of a disease in a subject.

69. Use of the oligonucleotide of embodiments 1 -57 or a conjugate of embodiments 58-64 for the preparation of a medicament for treatment or prevention of a disease in a subject.

70. The method, the oligonucleotide or the use of embodiments 66 - 69, wherein the disease is associated with in vivo activity of UBE3C.

71 . The method, the oligonucleotide or the use of embodiments 66 - 69, wherein the disease is associated with overexpression of UBE3C and/or abnormal levels of UBE3C.

72. The method, the oligonucleotide or the use of embodiment 70, wherein the UBE3C is reduced by at least 30%, or at least or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to the expression without the oligonucleotide of embodiment 1 -57 or a conjugate of embodiment 58-64 or the pharmaceutical composition of embodiment 65.

73. The method, the oligonucleotide or the use of embodiments 66 - 72, wherein the disease is selected from proliferatory disorders, such as cancer, or inflammatory disorders, such as asthma, in particular aspirin intolerance in asthma.

74. The method, the oligonucleotide or the use of embodiment 73, wherein the cancer is a solid cancer selected from the group comprising melanoma, breast cancer, glioma, carcinomas, renal cell carcinoma and hepatocellular carcinoma.

75. The method, the oligonucleotide, or use in treatment according to claim 73 or 74, wherein the treatment of cancer is in combination with one or more known cancer care therapies.

76. The method, the oligonucleotide or the use of embodiments 66 - 75, wherein the subject is a mammal.

77. The method, the oligonucleotide or the use of embodiment 76, wherein the mammal is human. EXAMPLES

Materials and methods

Table 5: list of oligonucleotide motif sequences (indicated by SEQ ID NO), designs of these, as well as specific oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence.

Figure imgf000052_0001

Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide.

Designs refer to the gapmer design, F-G-F', where each number represents the number of consecutive modified nucleosides, e.g. 2' modified nucleosides (first number=5' flank), followed by the number of DNA nucleosides (second number= gap region), followed by the number of modified nucleosides, e.g2' modified nucleosides (third number=3' flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is

complementary to the target nucleic acid.

Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl DNA cytosines are presented by "e", all internucleoside linkages are

phosphorothioate internucleoside linkages.

Oligonucleotide synthesis

Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.

Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 μηιοΙ scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16hours at 60°C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.

Elongation of the oligonucleotide:

The coupling of β-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA- C(Bz), DNA- T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5'-0-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired

modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1 ). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1 . The rest of the reagents are the ones typically used for oligonucleotide synthesis.

For post solid phase synthesis conjugation a commercially available C6 aminolinker

phorphoramidite can be used in the last cycle of the solid phase synthesis and after

deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.

Purification by RP-HPLC:

The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10μ 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid. Abbreviations:

DCI: 4,5-Dicyanoimidazole

DCM: Dichloromethane

DMF: Dimethylformamide

DMT: 4,4'-Dimethoxytrityl

THF: Tetrahydrofurane

Bz: Benzoyl

Ibu: Isobutyryl

RP-HPLC: Reverse phase high performance liquid chromatography Tm Assay:

Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x Tm-buffer (200mM NaCI, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 955C for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (Tm) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 205C to 955C and then down to 255C, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex Tm.

Example 1 - Testing in vitro efficacy and potency

Oligonucleotides targeting one region as well as oligonucleotides targeting at least three independent regions on UBE3C protein ligase pre-mRNA were tested in an in vitro experiment in HeLa cells. EC50 (potency) and max kd (efficacy) was assessed for the oligonucleotides.

Cell lines

The HeLa cell line was purchased from European Collection of Authenticated Cell Cultures (ECACC) and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% C02. For assays, 2,500 cells/well were seeded in a 96 multi well plate in Eagle's Minimum Essential Medium (Sigma, M4655) with 10% fetal bovine serum (FBS) as

recommended by the supplier.

Oligonucleotide potency and efficacy

Cells were incubated for 24 hours before addition of oligonucleotides. The oligonucleotides were dissolved in PBS and added to the cells at final concentrations of oligonucleotides was of 0.01 , 0.031 , 0.1 , 0.31 , 1 , 3.21 , 10, and 32.1 μΜ, the final culture volume was 100 μΙ/well. The cells were harvested 3 days after addition of oligonucleotide compounds and total RNA was extracted using the PureLink Pro 96 RNA Purification kit (Thermo Fisher Scientific), according to the manufacturer's instructions. Target transcript levels were quantified using FAM labeled TaqMan assays from Thermo Fisher Scientific in a multiplex reaction with a VIC labelled GAPDH control probe in a technical duplex and biological triplex set up. TaqMan primer assays for the target transcript of interest, UBE3C (Hs00904539_m1 )) and a house keeping gene GAPDH (4326317E VIC®/MGB probe).

EC50 calculations were performed in GraphPad Prism6. The maximum UBE3C knock down level is shown in table 6 as % of control.

Table 6: EC50 and maximal knock down (Max Kd) % of control

Figure imgf000055_0001

Claims

1 . An antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a target nucleic acid selected from the group consisting of SEQ ID NO: 1 , 2, 3 and 4 or natural occurring variants thereof.
2. The antisense oligonucleotide of claim 1 , wherein the contiguous nucleotide sequence has at least 90% complementarity to at least three independent regions within the target nucleic acid.
3. The antisense oligonucleotide according to claim 1 or 2, wherein the contiguous nucleotide sequence is complementary to at least one independent region located within an intron of the target nucleic acid.
4. The antisense oligonucleotide of any one of claims 1 to 3, wherein the contiguous
nucleotide sequence is complementary to at least three independent regions located within position 1 18133 to 128672 of SEQ ID NO 1 .
5. The antisense oligonucleotide of any one of claims 2 to 4, wherein the independent regions are within SEQ ID NO: 6 or SEQ ID NO: 22.
6. The antisense oligonucleotide of any one of claims 2 to 5, wherein the independent regions are selected from the group consisting of position 125153-125170, 125317-125334, 125435-125452, 125485-125502, 125541 -125558, 125595-125612, 125153-125168, 125309-125344, 125317-125332, 125435-125450, 125485-125500, 125541 -125556, 125595-125610; 125153-125166, 125317-125330, 125435-125448, 125485-125498, 125541 -125554, 125595-128608; 125151 -125170, 125315-125334, 125433-125452, 125483-125502, 125539-125558, 125593-125612; 125151 -125166, 125315-125330, 125433-125448, 125483-125498, 125539-125554, 125593-125608; 125152-125169, 125316-125333, 125434-125451 , 125484-125501 , 125540-125557, 125594-12561 1 ;
125152-125171 , 125316-125335, 125434-125453, 125484-125503, 125540-125559,
125594-125613 of SEQ ID NO: 1 .
7. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises or consists of a
sequence selected from the group consisting of SEQ ID NO: 7 to 14.
8. The oligonucleotide of any one of claims 1 to 7, wherein the oligonucleotide comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 15 to 21 .
9. The oligonucleotide of any one of claim 1 to 8, comprising one or more 2' sugar modified nucleosides.
10. The oligonucleotide of claim 9, wherein the one or more 2' sugar modified nucleoside is independently selected from the group consisting of 2'-Q-alkyl-RNA, 2'-0-methyl-RNA, 2'- alkoxy-RNA, 2'-0-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.
1 1 . The oligonucleotide of claim 9 or 10, wherein the one or more modified nucleoside is a LNA nucleoside.
12. The oligonucleotide of any one of claims 1 to 1 1 , where the oligonucleotide comprises at least one modified internucleoside linkage.
13. The oligonucleotide of claim 12, wherein at least 90% of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.
14. The oligonucleotide of claim 1 to 13, wherein the oligonucleotide is capable of recruiting RNase H.
15. The oligonucleotide of claim 14, wherein the oligonucleotide is a gapmer.
16. The oligonucleotide of claim 14 or 15, wherein the oligonucleotide is a gapmer of formula 5'- F-G-F'-3', where region F and F' independently comprise 1 - 4 2' sugar modified
nucleosides and G is a region between 6 and 17 nucleosides which are capable of recruiting RNaseH.
17. A conjugate comprising the oligonucleotide according to any one of claims 1 to 16, and at least one conjugate moiety covalently attached to said oligonucleotide.
18. A pharmaceutical composition comprising the oligonucleotide of claim 1 to 16 or the
conjugate of claim 17 and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
19. An in vivo or in vitro method for modulating UBE3C expression in a target cell which is
expressing UBE3C said method comprising administering an oligonucleotide of any one of claims 1 to 16 or the conjugate of claim 17 or the pharmaceutical composition of claim 18 in an effective amount to said cell.
20. The oligonucleotide of any one of claims 1 to 16 or the conjugate according to claim 17 or the pharmaceutical composition of claim 18 for use in medicine.
21 . The oligonucleotide of any one of claims 1 to 16 or the conjugate according to claim 17 or the pharmaceutical composition of claim 18 for use in the treatment or prevention of proliferatory diseases, such as cancer, or inflammatory disorders such as asthma, or of aspirin intolerance in asthma .
22. The oligonucleotide, conjugate or pharmaceutical composition for use in treatment
according to claim 20 or 21 , wherein the treatment of proliferatory diseases and is in combination with one or more known cancer care therapies.
3. Use of the oligonucleotide of claim 1 to 16 or the conjugate according to claim 17 or the pharmaceutical composition of claim 18, for the preparation of a medicament for treatment or prevention of proliferatory disorders, such as cancer, selected from the group comprising proliferatory diseases, such as cancer, inflammatory disorders such as asthma, or of aspirin intolerance in asthma.
PCT/EP2018/071597 2017-08-11 2018-08-09 Oligonucleotides for modulating ube3c expression WO2019030313A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP17185951.5 2017-08-11
EP17185951 2017-08-11

Publications (2)

Publication Number Publication Date
WO2019030313A2 true WO2019030313A2 (en) 2019-02-14
WO2019030313A3 WO2019030313A3 (en) 2019-05-02

Family

ID=63168421

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/071597 WO2019030313A2 (en) 2017-08-11 2018-08-09 Oligonucleotides for modulating ube3c expression

Country Status (1)

Country Link
WO (1) WO2019030313A2 (en)

Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2000047599A1 (en) 1999-02-12 2000-08-17 Sankyo Company, Limited Novel nucleosides and oligonucleotide analogues
WO2000066604A2 (en) 1999-05-04 2000-11-09 Exiqon A/S L-ribo-lna analogues
WO2001023613A1 (en) 1999-09-30 2001-04-05 Isis Pharmaceuticals, Inc. Human rnase h and oligonucleotide compositions thereof
WO2004046160A2 (en) 2002-11-18 2004-06-03 Santaris Pharma A/S Amino-lna, thio-lna and alpha-l-oxy-ln
WO2007031091A2 (en) 2005-09-15 2007-03-22 Santaris Pharma A/S Rna antagonist compounds for the modulation of p21 ras expression
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
WO2008113832A2 (en) 2007-03-22 2008-09-25 Santaris Pharma A/S SHORT RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF TARGET mRNA
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2009124238A1 (en) 2008-04-04 2009-10-08 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising neutrally linked terminal bicyclic nucleosides
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
WO2010077578A1 (en) 2008-12-09 2010-07-08 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
WO2011017521A2 (en) 2009-08-06 2011-02-10 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
WO2011156202A1 (en) 2010-06-08 2011-12-15 Isis Pharmaceuticals, Inc. Substituted 2 '-amino and 2 '-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013036868A1 (en) 2011-09-07 2013-03-14 Marina Biotech Inc. Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
WO2013120003A1 (en) 2012-02-08 2013-08-15 Isis Pharmaceuticals, Inc. Modulation of rna by repeat targeting
WO2013154798A1 (en) 2012-04-09 2013-10-17 Isis Pharmaceuticals, Inc. Tricyclic nucleic acid analogs
WO2014076196A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Anti apob antisense conjugate compounds
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014207232A1 (en) 2013-06-27 2014-12-31 Santaris Pharma A/S Antisense oligomers and conjugates targeting pcsk9

Patent Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993007883A1 (en) 1991-10-24 1993-04-29 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
WO1998039352A1 (en) 1997-03-07 1998-09-11 Takeshi Imanishi Novel bicyclonucleoside and oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
WO2000047599A1 (en) 1999-02-12 2000-08-17 Sankyo Company, Limited Novel nucleosides and oligonucleotide analogues
WO2000066604A2 (en) 1999-05-04 2000-11-09 Exiqon A/S L-ribo-lna analogues
WO2001023613A1 (en) 1999-09-30 2001-04-05 Isis Pharmaceuticals, Inc. Human rnase h and oligonucleotide compositions thereof
WO2004046160A2 (en) 2002-11-18 2004-06-03 Santaris Pharma A/S Amino-lna, thio-lna and alpha-l-oxy-ln
WO2007031091A2 (en) 2005-09-15 2007-03-22 Santaris Pharma A/S Rna antagonist compounds for the modulation of p21 ras expression
WO2007090071A2 (en) 2006-01-27 2007-08-09 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007134181A2 (en) 2006-05-11 2007-11-22 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
WO2008113832A2 (en) 2007-03-22 2008-09-25 Santaris Pharma A/S SHORT RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF TARGET mRNA
WO2008150729A2 (en) 2007-05-30 2008-12-11 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
WO2009006478A2 (en) 2007-07-05 2009-01-08 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
WO2009067647A1 (en) 2007-11-21 2009-05-28 Isis Pharmaceuticals, Inc. Carbocyclic alpha-l-bicyclic nucleic acid analogs
WO2009124238A1 (en) 2008-04-04 2009-10-08 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising neutrally linked terminal bicyclic nucleosides
WO2010036698A1 (en) 2008-09-24 2010-04-01 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
WO2010077578A1 (en) 2008-12-09 2010-07-08 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
WO2011017521A2 (en) 2009-08-06 2011-02-10 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
WO2011156202A1 (en) 2010-06-08 2011-12-15 Isis Pharmaceuticals, Inc. Substituted 2 '-amino and 2 '-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
WO2013036868A1 (en) 2011-09-07 2013-03-14 Marina Biotech Inc. Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
WO2013120003A1 (en) 2012-02-08 2013-08-15 Isis Pharmaceuticals, Inc. Modulation of rna by repeat targeting
WO2013154798A1 (en) 2012-04-09 2013-10-17 Isis Pharmaceuticals, Inc. Tricyclic nucleic acid analogs
WO2014076196A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Anti apob antisense conjugate compounds
WO2014076195A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Oligonucleotide conjugates
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2014207232A1 (en) 2013-06-27 2014-12-31 Santaris Pharma A/S Antisense oligomers and conjugates targeting pcsk9

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences, 17th ed.", 1985, MACK PUBLISHING COMPANY
BERGSTROM, CURRENT PROTOCOLS IN NUCLEIC ACID CHEMISTRY, 2009
BIOCHEM BIOPHYS RES COMMUN, vol. S0006-29, no. 16, 18 March 2016 (2016-03-18), pages 30381 - 3
CARUTHERS ET AL., METHODS IN ENZYMOLOGY, vol. 154, 1987, pages 287 - 313
DELEAVEY; DAMHA, CHEMISTRY AND BIOLOGY, vol. 19, 2012, pages 937
FLUITER ET AL., MOL. BIOSYST., vol. 10, 2009, pages 1039
FREIER; ALTMANN, NUCL. ACID RES., vol. 25, 1997, pages 4429 - 4443
HANSEN ET AL., CHEM. COMM., 1965, pages 36 - 38
HIRAO ET AL., ACCOUNTS OF CHEMICAL RESEARCH, vol. 45, 2012, pages 2055
HOLDGATE ET AL., DRUG DISCOV TODAY, 2005
JIANG JH ET AL.: "showed a clinical significance of UBE3C in hepatocellular carcinoma revealed by exome sequencing", HEPATOLOGY, vol. 59, no. 6, June 2014 (2014-06-01), pages 2216 - 27
LANGER, SCIENCE, vol. 249, 1990, pages 1527 - 1533
LEE ET AL., ANN ALLERGY ASTHMA IMMUNOL., vol. 105, no. 4, 2010, pages 307 - 312
MANGOS ET AL., J. AM. CHEM. SOC., vol. 125, 2003, pages 654 - 661
MANOHARAN, ANTISENSE AND NUCLEIC ACID DRUG DEVELOPMENT, vol. 12, 2002, pages 103
MCTIGUE ET AL., BIOCHEMISTRY, vol. 43, 2004, pages 5388 - 5405
MERGNY; LACROIX, OLIGONUCLEOTIDES, vol. 13, 2003, pages 515 - 537
MITSUOKA ET AL., NUCLEIC ACIDS RESEARCH, vol. 37, no. 4, 2009, pages 1225 - 1238
MORITA ET AL., BIOORGANIC & MED.CHEM. LETT., vol. 12, pages 73 - 76
S.T. CROOKE: "Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications", 2001, MARCEL DEKKER, INC., article "Ch. 16"
SANTALUCIA, PROC NATL ACAD SCI USA., vol. 95, 1998, pages 1460 - 1465
SETH, J. ORG. CHEM, 2010
SETH, J. ORG. CHEM., vol. 75, no. 5, 2010, pages 1569 - 81
SUGIMOTO ET AL., BIOCHEMISTRY, vol. 34, 1995, pages 11211 - 11216
T. VICKERS, PLOS ONE, vol. 9, no. 10, October 2014 (2014-10-01)
TANG L ET AL., ONCOTARGET, vol. 7, no. 13, 29 March 2016 (2016-03-29), pages 15738 - 46
UHLMANN, CURR. OPINION IN DRUG DEVELOPMENT, vol. 3, no. 2, 2000, pages 293 - 213
VESTER ET AL., BIOORG. MED. CHEM. LETT., vol. 18, 2008, pages 2296 - 2300

Also Published As

Publication number Publication date
WO2019030313A3 (en) 2019-05-02

Similar Documents

Publication Publication Date Title
Gryaznov Oligonucleotide N3′→ P5′ phosphoramidates as potential therapeutic agents
AU2003281969B2 (en) Amino-LNA, thio-LNA and alpha-L-oxy-LN
EP1910395B1 (en) Compositions and methods for modulation of SMN2 splicing
ES2377327T3 (en) antisense compounds
JP5198430B2 (en) A pharmaceutical composition comprising a antimiRNA antisense oligonucleotides
US8404659B2 (en) Pharmaceutical compositions for treatment of MicroRNA related diseases
DK2002004T3 (en) Small internally segmented interfering RNA
US9157081B2 (en) Chimeric oligomeric compounds for modulation of splicing
CN1984921B (en) Modulation of survivin expression
AU742993B2 (en) Antisense modulation of human mdm2 expression
JP6336755B2 (en) Non-coding rna related to Polycomb
ES2635866T3 (en) Link modified oligomeric compounds and voids uses thereof
JP6452614B2 (en) Oligonucleotide conjugate
RU2649367C2 (en) Lna oligonucleotide carbohydrate conjugates
JP6382150B2 (en) ENA nucleic acid drug that modifies splicing of pre-mRNA
US7622453B2 (en) Oligomeric compounds for the modulation of Bcl-2
ES2569558T3 (en) A pharmaceutical composition comprising anti-miRNA antisense oligonucleotides
US7098192B2 (en) Antisense oligonucleotide modulation of STAT3 expression
US9879265B2 (en) Oligonucleotide conjugates
CA2666191C (en) Rna antagonist compounds for the modulation of pcsk9
AU2008329327B2 (en) LNA antagonists targeting the androgen receptor
JP5209204B2 (en) Polymer oligonucleotide prodrugs
AU2003202376B2 (en) Oligonucleotides comprising alternating segments and uses thereof
CN103154245B (en) Antisense nucleic acid
US8440637B2 (en) Combination treatment for the treatment of hepatitis C virus infection

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18753161

Country of ref document: EP

Kind code of ref document: A2