DE202008012716U1 - Peptides that bind to human collagen IV modified by matrix metalloprotease 2 - Google Patents

Peptides that bind to human collagen IV modified by matrix metalloprotease 2 Download PDF

Info

Publication number
DE202008012716U1
DE202008012716U1 DE202008012716U DE202008012716U DE202008012716U1 DE 202008012716 U1 DE202008012716 U1 DE 202008012716U1 DE 202008012716 U DE202008012716 U DE 202008012716U DE 202008012716 U DE202008012716 U DE 202008012716U DE 202008012716 U1 DE202008012716 U1 DE 202008012716U1
Authority
DE
Germany
Prior art keywords
peptide
protection
phage
amino acid
oligopeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
DE202008012716U
Other languages
German (de)
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Essler Markus Dr
Mueller Jan Dipl-Biol
Original Assignee
Essler Markus Dr
Mueller Jan Dipl-Biol
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Essler Markus Dr, Mueller Jan Dipl-Biol filed Critical Essler Markus Dr
Priority to DE202008012716U priority Critical patent/DE202008012716U1/en
Priority claimed from DE102008047781A external-priority patent/DE102008047781B4/en
Publication of DE202008012716U1 publication Critical patent/DE202008012716U1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/10—Peptides having 12 to 20 amino acids

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Verwendung eines Oligopeptids gekennzeichnet durch die Aminosäure-Sequenz Thr Leu Thr Tyr Thr Trp Ser.use an oligopeptide characterized by the amino acid sequence Thr Leu Thr Tyr Thr Trp Ser.

Figure 00000001
Figure 00000001

Description

Technisches Gebiet der ErfindungTechnical field of the invention

Die Erfindung liegt auf dem Gebiet der Medizin. Dort speziell in der Bereitstellung von Material zur Detektion und Inhibition von Angiogenese durch Verwendung von selektiven Agenzien, welche an proteolytisch modifiziertem Kollagen IV binden.The Invention is in the field of medicine. There especially in the Provision of material for the detection and inhibition of angiogenesis by the use of selective agents which are proteolytically modified Bind collagen IV.

Stand der TechnikState of the art

Die Angiogenese, die Neubildung von Blutgefäßen, ist ein natürlicher Prozess, welcher bei der Wundheilung, der Reproduktion und der Entwicklung vorkommt. Die physiologische Angiogenese, ist ein hochregulierter Prozess. Sie besteht aus mehreren Phasen, der Permeabilität des Endotheles, der Proliferation von Endothelzellen, der Proteolyse der Basalmembran, der Migration von Zellen und der Entstehung von Lumen und dessen Stabilisierung. Dabei findet eine Interaktion unterschiedlicher Zellmembranrezeptoren, wie den Integrinen, und von Wachstumsfaktoren statt. Zusammenfassend kommt es durch Verlust der Zell-Zell Adhäsion zu einer Permeabilität des Endothels. Es handelt sich um den Verlust von VE-Katherinen der Endothelzellen, welche das Endothel von Blutgefäßen bilden. Durch Ausschüttung von Wachstumsfaktoren kommt es zu einer Proliferation der Endothelzellen. Es folgt die Proteolyse der Basalmembran, die Voraussetzung zur Bildung eines neuen Blutgefäßes. Die aus Kollagen IV, Laminin und Entaktin bestehende Basalmembran, welche das Endothel von den darunterliegenden Muskelzellen und Bindegewebe separiert, wird durch Matrix-Metalloproteinasen (MMPs) 2 und 9 gespalten. Durch die Spaltung des Kollagens IV werden bisher verborgene Bereiche freigelegt, die den Endothelzellen als Migrationssignale dienen. Durch die Migration der Endothelzellen kommt es zur Bildung des neuen Gefäßlumens. Einwandernde Muskelzellen umgeben das neu entstandene Gefäß und stabilisieren es ( Hangai, M., et al. (2002) Am J Pathol 161(4): 1429–1437 ), ( Xu et al. (2001). J Cell Biol 154(5): 1069–1079 ), ( Milkiewicz et al. (2006) Int J Biochem Cell Biol 38(3): 333–357 ).Angiogenesis, the new formation of blood vessels, is a natural process that occurs in wound healing, reproduction and development. Physiological angiogenesis is a highly regulated process. It consists of several phases, the permeability of the endothelium, the proliferation of endothelial cells, the proteolysis of the basement membrane, the migration of cells and the formation of lumens and their stabilization. An interaction of different cell membrane receptors, such as integrins, and growth factors takes place. In summary, loss of cell-cell adhesion leads to endothelial permeability. It is the loss of VE-catherins of the endothelial cells, which form the endothelium of blood vessels. Through the release of growth factors there is a proliferation of endothelial cells. This is followed by proteolysis of the basement membrane, the prerequisite for the formation of a new blood vessel. The collagen IV, laminin and entactin basement membrane, which separates the endothelium from the underlying muscle cells and connective tissue, is cleaved by matrix metalloproteinases (MMPs) 2 and 9. By cleavage of the collagen IV previously hidden areas are exposed, which serve the endothelial cells as migration signals. Migration of the endothelial cells leads to the formation of the new vessel lumen. Immigrating muscle cells surround the newly formed vessel and stabilize it ( Hangai, M., et al. (2002) Am J Pathol 161 (4): 1429-1437 ) Xu et al. (2001). J Cell Biol 154 (5): 1069-1079 ) Milkiewicz et al. (2006) Int J Biochem Cell Biol 38 (3): 333-357 ).

Obwohl die Angiogenese ein hochregulierter Prozess ist, findet bei einer Vielzahl von Krankheiten eine nicht regulierte Angiogenese statt, welche zu einem Vorschreiten der Erkrankung führt. Beispiele für solche Erkrankungen sind unter anderen pathologischen Wundheilungsstörungen, wie die diabetische Fußulzeration, die Dekubitus-Ulzerationen und den durch Venenstauungen verursachten Ulzerationen. Weiterhin ist die Matrix-Metalloprotease 2 auch bei entzündlichen Prozessen beteiligt ( Xue et al. (2006), Expert Opin Ther Targets 10(1): 143–155 ), ( Toy et al. (2005). J Wound Care 14(1): 202 ).Although angiogenesis is a highly regulated process, unregulated angiogenesis takes place in a variety of diseases, leading to disease progression. Examples of such diseases include pathological wound healing disorders such as diabetic foot ulceration, decubitus ulceration and ulceration caused by venous stasis. Furthermore, the matrix metalloprotease 2 is also involved in inflammatory processes ( Xue et al. (2006), Expert Opin Ther Targets 10 (1): 143-155 ) Toy et al. (2005). J Wound Care 14 (1): 202 ).

Weiterhin wurden angiogene Vorgänge auch bei Erkrankungen des Gehirns durch Schädigung der Blut-Hirn-Schranke, wie die bakterielle Meningitis, multiple Sklerose, der Alzheimer Erkrankung und bei entzündlichen Myopathien und Tumoren des zentralen Nervensystems, wie den Gliomen. ( Yong et al. (2001). Nat Rev Neurosci 2(7): 502–511 ), ( Leppert et al. (2000). Clin Infect Dis 31(1): 80–84 ), ( Ozenci et al. (2000) J Neuroimmunol 108(1–2): 236–243 ), ( Yong et al. (1998). Trends Neurosci 21(2): 75–80 ), ( Nakada et al. (2003). Front Biosci 8: e261–269 ).Furthermore, angiogenic processes have also been observed in diseases of the brain by damage to the blood-brain barrier, such as bacterial meningitis, multiple sclerosis, Alzheimer's disease and in inflammatory myopathies and tumors of the central nervous system, such as gliomas. ( Yong et al. (2001). Nat Rev Neurosci 2 (7): 502-511 ) Leppert et al. (2000). Clin Infect Dis 31 (1): 80-84 ) Ozenci et al. (2000) J Neuroimmunol 108 (1-2): 236-243 ) Yong et al. (1998). Trends Neurosci 21 (2): 75-80 ) Nakada et al. (2003). Front Biosci 8: e261-269 ).

Ein weiteres Beispiel für die Aktivität der MMP2 sind Erkrankungen des Herzens und der Gefäße. So konnte eine Assoziation mit der Bildung und Instabilität von atherosklerotischen Plaques, der Migration von Gefäßmuskelzellen, der Restenose von Gefäßen, der Entwicklung Aortenaneurysmen und dem Herzversagen belegt werden ( Galis et al. (1994). J Clin Invest 94(6): 2493–2503 ), ( Lovdahl et al. (1999). Histol Histopathol 14(4): 1101–1112 ), ( Longo et al. (2002). J Clin Invest 110(5): 625–632 ), ( Danielsen et al. (1998). J Mol Cell Cardiol 30(7): 1431–42 ), ( Yamazaki et al. (2004). Eur J Heart Fail 6(1): 41–45 ).Another example of the activity of MMP2 is diseases of the heart and vessels. Thus, an association with the formation and instability of atherosclerotic plaques, the migration of vascular muscle cells, the restenosis of vessels, the development of aortic aneurysms and heart failure could be demonstrated ( Galis et al. (1994). J Clin Invest 94 (6): 2493-2503 ) Lovdahl et al. (1999). Histol Histopathol 14 (4): 1101-1112 ) Longo et al. (2002). J Clin Invest 110 (5): 625-632 ) Danielsen et al. (1998). J Mol Cell Cardiol 30 (7): 1431-42 ) Yamazaki et al. (2004). Eur J Heart Fail 6 (1): 41-45 ).

Daneben werden aber auch bei anderen Erkrankungen, wie der diabetischen Retinopathie, angiogenetische Vorgänge beobachtet ( Carmeliet et al (2000). Nature 407(6801): 249–257 ).In addition, however, angiogenic processes are also observed in other diseases, such as diabetic retinopathy ( Carmeliet et al (2000). Nature 407 (6801): 249-257 ).

Bei Tumorerkrankungen sind die MMPs 2 und 9 essenziell. Sie ermöglichen unter anderem durch Spaltung der Basalmembran die Gefäßneubildung und somit die Versorgung des Tumorgewebes mit Nährstoffen ( Malemud (2006). Front Biosci 11: 1696–1701 ).For tumors, MMPs 2 and 9 are essential. They allow, among other things by cleavage of the basement membrane, the neovascularization and thus the supply of the tumor tissue with nutrients ( Malemud (2006). Front Biosci 11: 1696-1701 ).

Durch die unkontrollierte Teilung von Tumorzellen, haben sie einen erhöhten Sauerstoff- und Nährstoffbedarf. Das Tumorgewebe kann sich jedoch nur bis zu einer Größe von etwas 0,125 mm2 durch Diffusion mit den notwendigen Nährstoffen versorgen. Weitere Zellteilungen führen zur Nährstoff und Sauerstoffunterversorgung und so zur Hypoxie mit anschließender Nekrose. Eine weitere Zunahme des Tumorgewebes und die Metastasierung erfordern daher den Zugang zum Blutgefäßsystem. Dieser Zugang zum Gefäßsystem wird durch eine Neubildung von Blutgefäßen ermöglicht, der Tumor-Angiogenese. Im Rahmen der Angiogenese ist die Proteolyse der Basalmembran ein wichtiger Bestandteil. Sie erfolgt insbesondere durch die MMPs 2 und 9. Durch die Proteolyse werden bisher verborgene Bereiche des Kollagens IV freigelegt. Diese Bereiche enthalten Migrationssignale für Endothelzellen ( Hangai (2002) , wie oben genannt), ( Xu (2001) , wie oben genannt), ( Davis et al. (2000). Am J Pathol 156(5): 1489–1498 ), ( Roth et al. (2006). Am J Pathol 168(5): 1576–1586 ).Due to the uncontrolled division of tumor cells, they have an increased oxygen and nutrient requirement. The tumor tissue, however, can only supply up to a size of about 0.125 mm 2 by diffusion with the necessary nutrients. Further cell divisions lead to nutrient and oxygen deficiency and thus to hypoxia with subsequent necrosis. Further increase in tumor tissue and metastasis therefore require access to the blood vessel system. This access to the vascular system will Through a neoplasm of blood vessels allows tumor angiogenesis. In the context of angiogenesis, proteolysis of the basement membrane is an important component. It is carried out in particular by the MMPs 2 and 9. By means of proteolysis previously hidden areas of the collagen IV are exposed. These areas contain migration signals for endothelial cells ( Hangai (2002) , as mentioned above), ( Xu (2001) , as mentioned above), ( Davis et al. (2000). At J Pathol 156 (5): 1489-1498 ) Roth et al. (2006). At J Pathol 168 (5): 1576-1586 ).

Die Angiogenese trägt jedoch nicht nur zur Versorgung des Tumors bei, sondern ist auch der Ausgangspunkt zur hämatogenen Metastasierung eines Primärtumors.The However, angiogenesis not only helps to supply the tumor at, but is also the starting point for hematogenous Metastasis of a primary tumor.

Das Kollagen IV, welches Bestandteil der Basalmembran ist, gehört zu der Familie der Kollagene. Generell bestehen Kollagene aus 3 Polypeptid-Ketten, den α-Strängen. Sie enthalten sich wiederholende Aminosäuremotive der Form Gly-Xaa-Yaa, wobei Xaa und Yaa jede beliebige Aminosäure außer Glycin sein kann. Diese Stränge bilden eine Tripelhelix. An der Xaa-Position ist häufig Prolin anzutreffen. An der Yaa-Position hingegen findet sich häufig 4-Hydroxyprolin. Das Kollagen IV ist im Gegensatz zu Kollagen I nicht fibrillär, sondern wabenförmig angeordnet. Es bildet sich aus 2 α1(IV) Ketten und einer α2(IV) Kette ( Olsen et al. (1999). Collagens. Guidebook to the extracellular matrix, anchor, and adhesion Proteins (2nd edition). T. Kreis and R. Vale. New York, USA, Oxford University Press Inc.: 380–408 ).Collagen IV, which is part of the basement membrane, belongs to the family of collagens. In general, collagens consist of 3 polypeptide chains, the α-strands. They contain repeating amino acid motifs of the form Gly-Xaa-Yaa, where Xaa and Yaa can be any amino acid except glycine. These strands form a triple helix. At the Xaa position proline is common. In contrast, 4-hydroxyproline is frequently found at the Yaa position. The collagen IV is not fibrillar in contrast to collagen I, but arranged honeycomb. It is formed by 2 α1 (IV) chains and an α2 (IV) chain ( Olsen et al. (1999). Collagen. Guidebook to the extracellular matrix, anchor, and adhesion protein (2nd edition). T. Kreis and R. Vale. New York, USA, Oxford University Press Inc .: 380-408 ).

Die Matrix-Metalloproteinasen (MMP) stellen eine seit längerem bekannte Familie Zinkabhängiger Kollagen spaltender Endopeptidasen dar, welche sowohl als lösliche als auch als membrangebundene Proteine vorliegen können.The Matrix metalloproteinases (MMPs) have been around for a long time known family of zinc-dependent collagen-cleaving endopeptidases which are soluble as well as membrane bound Proteins may be present.

Die MMPs 2 und 9 sind diejenigen Proteasen, welche am häufigsten Kollagen IV spalten ( Somerville et al. (2003). Genome Biol 4(6): 216 ).MMPs 2 and 9 are those proteases which most frequently cleave collagen IV ( Somerville et al. (2003). Genomes Biol 4 (6): 216 ).

Auf Grund der Beteiligung von Matrix-Metalloproteasen an einer Vielzahl von Experimenten wurden MMP-Inhibitoren entwickelt. Allerdings zeigten die klinischen Studien dieser Stoffe ein eher nachteiligen Effekt für die Patienten, so dass sie abgebrochen werden mussten ( Coussens, et al. (2002) Science 295(5564): 2387–92 ).Due to the involvement of matrix metalloproteases in a variety of experiments, MMP inhibitors have been developed. However, the clinical studies of these substances showed a rather adverse effect on the patients, so they had to be discontinued ( Coussens, et al. (2002) Science 295 (5564): 2387-92 ).

Es besteht daher das Bedürfnis nach Verbindungen, die in der Behandlung von Krankheiten, bei denen angiogene Prozesse involviert sind, nützlich sind. So sind Stoffe, welche zur Detektion von proteolytisch verändertem Kollagen IV verwendet werden, hilfreich bei dem Auffinden von Entzündungen, Tumoren, Metastasen und anderen angiogenen Prozessen. Da die Angiogenese ein essenzieller Bestandteil des Tumorwachstums ist, können Stoffe, welche sich dort einfinden gezielt therapeutische Agenzien transportieren.It There is therefore a need for compounds that exist in the Treatment of diseases involving angiogenic processes are, are useful. So are substances which are for detection used by proteolytically altered collagen IV, helpful in finding inflammation, tumors, Metastases and other angiogenic processes. Because angiogenesis is an essential component of tumor growth Substances which find themselves there specifically therapeutic agents transport.

Beschreibung der ErfindungDescription of the invention

Wie hierin verwendet, bedeutet „Peptid" eine polymere Form von Aminosäuren jeder Länge, welche chemisch synthetisiert werden kann durch Verfahren, die einem Fachmann mit durchschnittlichem Können bekannt sind. Beispielsweise sei hier die Festphasensynthese genannt.As As used herein, "peptide" means a polymeric form of amino acids of any length which are chemically synthesized can be achieved by methods that a person skilled in the average Can be known. For example, here is the solid phase synthesis called.

Wie hierin verwendet, folgen die Namen von natürlich vorkommenden Aminosäuren größten Teils den Benennungskonventionen, die von der IUPAC Kommission über die Nomenklatur der organischen Chemie vorgeschlagen wurden und der IUPAC-IUB Kommission der biochemischen Nomenklatur, wie dargelegt in Nomenclature of α-Amin Acids ( Recommendations, 1974 ), Biochemistry, 14(2), (1975) . Dementsprechend beziehen sich die Ausdrücke „Ala", „Arg", „Asn", „Asp", „Cys", „Gln", „Glu", „Gly", „His", „Ile", „Leu", „Lys", „Met", „Phe", „Pro", „Ser", „Thr", „Trp", „Tyr" und „Val" auf die Aminosäuren Alanin, Arginin, Asparagin, Asparaginsäure, Cystein, Glutamin, Glutaminsäure, Glycin, Histidin, Isoleucin, Leucin, Lysin, Methionin, Phenylalanin, Prolin, Serin, Threonin, Tryptophan, Tyrosin und Valin, und auf ihre entsprechenden Aminoacylreste in Peptiden in ihren L-, D- oder D,L-Formen. Wo keine spezifische Konfiguration angegeben ist, würde jemand, der im Fachgebiet bewandert ist, verstehen, dass die Stereochemie des α-Kohlenstoffs der Aminosäuren und Aminoacrylresten in Peptiden, welche in dieser Beschreibung beschrieben sind, die natürlich vorkommende oder „L" Konfiguration, mit der Ausnahme des achiralen Moleküls Glycin und mit der weiteren Ausnahme von irgendwelchen Aminosäuren, welche achiral sind oder anderweitig als „D"- bezeichnet sind.As used herein, the names of naturally occurring amino acids most closely follow the naming conventions proposed by the IUPAC Commission on the nomenclature of organic chemistry and the IUPAC-IUB Commission of Biochemical Nomenclature, as set forth in Nomenclature of α-Amin Acids ( Recommendations, 1974 ) Biochemistry, 14 (2), (1975) , Accordingly, the terms "Ala", "Arg", "Asn", "Asp", "Cys", "Gln", "Glu", "Gly", "His", "Ile", "Leu", " Lys "," Met "," Phe "," Pro "," Ser "," Thr "," Trp "," Tyr "and" Val "to the amino acids alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid , Glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine and valine, and their corresponding aminoacyl residues in peptides in their L, D or D, L forms. Where no specific configuration is given, one skilled in the art would understand that the stereochemistry of the α-carbon of the amino acids and aminoacrylic residues in peptides described in this specification, the naturally occurring or "L" configuration, with the Except for the achiral molecule glycine and with the exception of any amino acids which are achiral or otherwise designated "D".

Wie hierin verwendet, bedeutet „Peptid gekoppelte Verbindung", die chemische Kopplung von anderen Stoffen, wie beispielsweise Paramagnetische Nanopartikel, an ein Peptid. Die Methodik der Kopplungschemie ist dem Fachmann bekannt und die benötigten chemischen Verbindungen, wie beispielsweise N-[A-Maleimidoacetoxy] Succimidester sind kommerziell erhältlich. Welche Kopplungschemie benutzt wird bleibt dem Fachmann in Bezug auf die zu koppelnden Stoffe überlassen.As used herein, "peptide-coupled compound" means the chemical coupling of other substances, such as paramagnetic nanoparticles, to a peptide The methodology of coupling chemistry is known to those skilled in the art and the chemical compounds required, such as N- [A-maleimidoacetoxy] succinimide esters are commercially available. Which coupling chemistry is used is left to the skilled person with regard to the substances to be coupled.

Wie hierin verwendet, bedeutet „Escherichia coli ER2738", ein Bakterium der Spezies Escherichia coli K 12 mit dem Gentyp F'proA+B+ lacIq Δ(lacZ)M15 zzf::Tn10(TetR)/fhuA2 glnV Δ(lac-proAB) thi-1 Δ(hsdS-mcrB)5, welches kommerziell von der Firma New England Biolabs, Deutschland bezogen wurde und in LB-Medium (10 g/l Trypton, 5 g/l Hefe-Extrakt, 10 g/l NaCl) kultiviert wurde.As used herein, "Escherichia coli ER2738" means a bacterium of the species Escherichia coli K 12 with the genotype F'proA + B + lacI q Δ (lacZ) M15 ZZF :: Tn 10 (Tet R) / fhuA2 glnV Δ (lac proAB) thi-1 Δ (hsdS-mcrB) 5 which was obtained commercially from New England Biolabs, Germany and in LB medium (10 g / l tryptone, 5 g / l yeast extract, 10 g / l NaCl ) was cultivated.

Wie hierin verwendet, bedeutet „TLTYTWS-Phage", ein M13-Bakteriophage, welcher rekombinant die Peptidsequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser am aminoterminalen Ende der 5 Kopien des Hüllproteins 3 präsentiert. Die Herstellung von rekombinanten Phagen ist einem Fachmann auf dem Gebiet der Molekularbiologie bekannt. Dieser Phage wurde bei einem Phage-Display mit einer M13 Phagenbibliothek, welche dem Fachmann bekannt ist und kommerziell bei New England Biolabs, Deutschland erworben wurde, gefunden ( Noren et al. (2001), Methods, 23, 169–178 ). Die Methodik des Phage Display ist dem Fachmann bekannt ( Szardenings (2003) J Recept Signal Transduct Res. 2003; 23(4): 307–49 ), ( Ruoslahti, E. (2002). Nat Rev Cancer 2(2): 83–90 ).As used herein, "TLTYTWS phage", an M13 bacteriophage, which recombinantly presents the peptide sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser at the amino-terminal end of the 5 copies of coat protein 3. The production of recombinant phage is This phage was found in a phage display with an M13 phage library known to those skilled in the art and commercially available from New England Biolabs, Germany ( Noren et al. (2001), Methods, 23, 169-178 ). The methodology of the phage display is known to the person skilled in the art ( Szardenings (2003) J Recept Signal Transduct Res. 2003; 23 (4): 307-49 ) Ruoslahti, E. (2002). Nat Rev Cancer 2 (2): 83-90 ).

Wie hierin verwendet, bedeutet „SRPQITN-Phage", ein M13-Bakteriophage, welcher rekombinant die Peptidsequenz Ser-Arg-Pro-Gln-Ile-Thr-Asn am aminoterminalen Ende der 5 Kopien des Hüllproteins 3 präsentiert. Die Herstellung von rekombinanten Phagen ist einem Fachmann auf dem Gebiet der Molekularbiologie bekannt. Dieser Phage wurde bei einem Phage-Display mit einer M13 Phagenbibliothek, welche dem Fachmann bekannt ist und kommerziell bei New England Biolabs, Deutschland erworben wurde, gefunden ( Noren et al. (2001) , wie oben angegeben). Die Methodik des Phage Display ist dem Fachmann bekannt ( Szardenings (2003) wie oben angegeben), ( Ruoslahti, E. (2002) wie oben angegeben).As used herein, "SRPQITN phage" means an M13 bacteriophage which recombinantly presents the peptide sequence Ser-Arg-Pro-Gln-Ile-Thr-Asn at the amino-terminal end of the 5 copies of coat protein 3. The production of recombinant phage is This phage was found in a phage display with an M13 phage library known to those skilled in the art and commercially available from New England Biolabs, Germany ( Noren et al. (2001) , as you can read above). The methodology of the phage display is known to the person skilled in the art ( Szardenings (2003) as you can read above), ( Ruoslahti, E. (2002) as you can read above).

Wie hierin verwendet, bedeutet „GLGYGWS-Phage", ein M13-Phage, bei dem rekombinant die DNA-Sequenz 5'-GTACCTTTCTATTCTCACTCTGGTCTTGGTTATGGGTGGTCTGGTGGAGGTTC zwischen die Schnittstellen KpnI und EagI des für das Hüllprotein 3 kodieren den Gens mittels Ligation eingefügt worden ist. Die M13-DNA ist kommerziell bei New England Biolabs, Deutschland erhältlich.As used herein means "GLGYGWS phage", an M13 phage, in which the recombinant DNA sequence 5'-GTACCTTTCTATTCTCACTCTGGTCTTGGTTATGGGTGGTCTGGTGGAGGTTC between the KpnI and EagI's for the envelope protein 3 encode the gene has been inserted by ligation. The M13 DNA is commercially available from New England Biolabs, Germany available.

Die so erhaltene rekombinant veränderte Bakteriophagen-DNA wurde in Escherichia coli ER2738 Bakterien, welche kommerziell bei New England Biolabs, Deutschland erhältlich sind, transformiert.The thus obtained recombinantly modified bacteriophage DNA was in Escherichia coli ER2738 bacteria, which are commercially New England Biolabs, Germany are available.

Die Vorgänge und die Durchführung einer Ligation und einer Transformation sind dem Fachmann auf dem Gebiet der Molekularbiologie bekannt. Dieser Phage präsentiert statt der Peptid-Seqenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser die Sequenz Gly-Leu-Gly-Tyr-Gly-Trp-Ser.The Operations and the implementation of a ligation and a transformation are those skilled in the field of molecular biology known. This phage presents Thr-Leu-Thr-Tyr-Thr-Trp-Ser instead of the peptide sequence the sequence Gly-Leu-Gly-Tyr-Gly-Trp-Ser.

Wie hierin verwendet, bedeutet „TGTYTWS-Phage", ein M13-Phage, bei dem rekombinant die DNA-Sequenz 5'-GTACCTTTCTATTCTCACTCTACGGGTACGTATACGTGGTCTGGTGGAGGTTC zwischen die Schnittstellen KpnI und EagI das für das Hüllprotein 3 kodierende Gen mittels Ligation eingefügt worden ist. Die M13-DNA ist kommerziell bei New England Biolabs, Deutschland erhältlich. Die so erhaltene rekombinant veränderte Bakteriophagen-DNA wurde in Escherichia coli ER2738 Bakterien, welche kommerziell bei New England Biolabs, Deutschland erhältlich sind, transformiert. Die Vorgänge und die Durchführung einer Ligation und einer Transformation sind dem Fachmann auf dem Gebiet der Molekularbiologie bekannt. Dieser Phage präsentiert statt der Peptid-Seqenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser die Sequenz Thr-Gly-Thr-Tyr-Thr-Trp-Ser.As used herein means "TGTYTWS phage", an M13 phage, in the recombinant DNA sequence 5'-GTACCTTTCTATTCTCACTCTACGGGTACGTATACGTGGTCTGGTGGAGGTTC between the KpnI and EagI interfaces for the envelope protein 3 coding gene has been inserted by means of ligation. The M13 DNA is commercially available from New England Biolabs, Germany available. The resulting recombinantly altered Bacteriophage DNA was transformed into Escherichia coli ER2738 bacteria, which commercially available from New England Biolabs, Germany are, transformed. The operations and the execution Ligation and transformation will be apparent to those skilled in the art Area of molecular biology known. This phage presents instead of the peptide sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser, the sequence Thr-Gly-Thr-Tyr-Thr-Trp-Ser.

Wie hierin verwendet, bedeutet „TLTYTGS-Phage", ein M13-Phage, bei dem rekombinant die DNA-Sequenz 5'-GTACCTTTCTATTCTCACTCTACGCTTACGTATACGGGTTCTGGTGGAGGTTC zwischen die Schnittstellen KpnI und EagI das für das Hüllprotein 3 kodierende Gen mittels Ligation eingefügt worden ist. Die M13-DNA ist kommerziell bei New England Biolabs, Deutschland erhältlich. Die so erhaltene rekombinant veränderte Bakteriophagen-DNA wurde in Escherichia coli ER2738 Bakterien, welche kommerziell bei New England Biolabs, Deutschland erhältlich sind, transformiert. Die Vorgänge und die Durchführung einer Ligation und einer Transformation sind dem Fachmann auf dem Gebiet der Molekularbiologie bekannt. Dieser Phage präsentiert statt der Peptid-Seqenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser die Sequenz Thr-Leu-Thr-Tyr-Thr-Gly-Ser.As used herein means "TLTYTGS phage", an M13 phage, in the recombinant DNA sequence 5'-GTACCTTTCTATTCTCACTCTACGCTTACGTATACGGGTTCTGGTGGAGGTTC between the KpnI and EagI interfaces for the envelope protein 3 coding gene has been inserted by means of ligation. The M13 DNA is commercially available from New England Biolabs, Germany available. The resulting recombinantly altered Bacteriophage DNA was transformed into Escherichia coli ER2738 bacteria, which commercially available from New England Biolabs, Germany are, transformed. The operations and the execution Ligation and transformation will be apparent to those skilled in the art Area of molecular biology known. This phage presents instead of the peptide sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser, the sequence Thr-Leu-Thr-Tyr-Thr-Gly-Ser.

Wie hierin verwendet, bedeutet „LKQNGGNFSL-Phage", ein M13-Phage, bei dem rekombinant die DNA-Sequenz 5'-GTACCTTTCTATTCTCACTCTCTGAAGCAGAATGGGGGTAATTTTTCGCTGGGTGGAGGTTC zwischen die Schnittstellen KpnI und EagI das für das Hüllprotein 3 kodierende Gen mittels Ligation eingefügt worden ist. Die M13-DNA ist kommerziell bei New England Biolabs, Deutschland erhältlich.As used herein, "LKQNGGNFSL phage", an M13 phage, is recombinantly ligated to the DNA sequence 5'-GTACCTTTCTATTCTCACTCTCTGAAGCAGAATGGGGGTAATTTTTCGCTGGGTGGAGGTTC between the KpnI and EagI cleavage sites of the gene encoding coat protein 3 has been inserted. The M13 DNA is commercially available from New England Biolabs, Germany.

Die so erhaltene rekombinant veränderte Bakteriophagen-DNA wurde in Escherichia coli ER2738 Bakterien, welche kommerziell bei New England Biolabs, Deutschland erhältlich sind, transformiert. Die Vorgänge und die Durchführung einer Ligation und einer Transformation sind dem Fachmann auf dem Gebiet der Molekularbiologie bekannt. Dieser Phage präsentiert statt der Peptid-Seqenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser die Sequenz Leu-Lys-Gln-Asn-Gly-Gly-Asn-Phe-Ser-Leu, welche bereits bekannt ist (Brooks, PCT, WO 2004/073649A2 ).The resulting recombinant bacteriophage DNA was transformed into Escherichia coli ER2738 bacteria commercially available from New England Biolabs, Germany. The processes and the performance of a ligation and a transformation are known to those skilled in the field of molecular biology. Instead of the peptide sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser, this phage presents the sequence Leu-Lys-Gln-Asn-Gly-Gly-Asn-Phe-Ser-Leu, which is already known (Brooks, et al. PCT, WO 2004 / 073649A2 ).

Wie hierin verwendet, bedeutet „Sequenz 1" ein Oligopeptid mit der Sequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser.As As used herein, "Sequence 1" means an oligopeptide with the sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser.

Wie hierin verwendet, bedeutet „Sequenz 2" ein Oligopeptid mit der Sequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser-Gly-Gly-Gly-Ser.As As used herein, "Sequence 2" means an oligopeptide with the sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser-Gly-Gly-Gly-Ser.

Wie hierin verwendet, bedeutet „Sequenz 3" ein Oligopeptid mit der Sequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser-Gly-Gly-Gly-Lys-Lys-CysAs As used herein, "Sequence 3" means an oligopeptide with the sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser-Gly-Gly-Gly-Lys-Lys-Cys

Wie hierin verwendet, bedeutet „Sequenz 4" ein Oligopeptid mit der Sequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser-Gly-Gly-Gly-Lys-Lys und eines Fluorochroms, wie beispielsweise Fluorescein, welches an die carboxyterminale Aminosäure gekoppelt ist.As As used herein, "Sequence 4" means an oligopeptide with the sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser-Gly-Gly-Gly-Lys-Lys and a fluorochrome, such as fluorescein, which is coupled to the carboxy-terminal amino acid.

Die Erfindung stellt Stoffe in Form von Peptiden bereit, welche an durch Matrix-Metalloprotease 2 gespaltenes Kollagen IV bindet.The Invention provides substances in the form of peptides, which by Matrix metalloprotease 2 cleaved collagen IV binds.

Die in dieser Erfindung beschriebenen selektiv Matrix-Metalloprotease 2 gespaltenes Kollagen IV bindenden Peptide oder Peptid gekoppelte Substanzen enthalten die Sequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser (Sequenz 1).The in this invention selectively matrix metalloprotease 2 cleaved collagen IV binding peptides or peptide-coupled Substances contain the sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser (Sequence 1).

In einer Ausführungsform stellt diese Erfindung ein Peptid bereit, welches die Peptidsequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser aminoterminal enthält und durch anfügen der Peptide Gly-Gly-Gly-Ser gekennzeichnet sind (Seqenz 2). Diese Ausführungsform kommt in dem oben beschriebenen TLTYTWS-Phagen vor.In In one embodiment, this invention provides a peptide which contains the peptide sequence Thr-Leu-Thr-Tyr-Thr-Trp-Ser amino terminal contains and by adding the peptides Gly-Gly-Gly-Ser are marked (Seqenz 2). This embodiment comes in the TLTYTWS phage described above.

In einer weiteren Ausführungsform stellt diese Erfindung ein chemisch synthetisiertes Peptid bereit, welches die Peptidsequenz Thr-Leu-Thr-Tyr-Thr-Trp-Ser aminoterminal enthält und durch anfügen der Peptide Gly-Gly-Gly-Lys-Lys-Cys gekennzeichnet sind (Sequenz 3).In Another embodiment provides this invention chemically synthesized peptide ready containing the peptide sequence Contains Thr-Leu-Thr-Tyr-Thr-Trp-Ser aminoterminal and by Attach the peptides Gly-Gly-Gly-Lys-Lys-Cys labeled are (sequence 3).

Das chemisch synthetisierte Peptid, welches die in der „Sequenz 3" genannte Sequenz enthält, ist in der Lage Angiogenese zu inhibieren.The chemically synthesized peptide, which contains the in the "Sequence Containing 3 "sequence is capable of angiogenesis to inhibit.

In einer weiteren Ausführungsform stellt diese Erfindung eine Peptid gekoppelte Verbindung bereit, welche durch Kopplung des in der Sequenz 3 dargestellten Peptids an paramagnetische Partikel gekennzeichnet ist. Die Herstellung dieser Kopplung selbst kann durch beliebige Verfahren, welche dem Fachmann bekannt sind, erfolgen.In In another embodiment, this invention provides a Peptide-coupled compound prepared by coupling the in the sequence 3 shown peptide to paramagnetic particles is marked. The preparation of this coupling itself can by any method known to those skilled in the art.

Beispielhaft kann die Kopplung mit Hilfe von N-[α-Maleimidoacetoxy] Succimidester an eine mit NH2-Gruppen beschichtete Oberfläche erfolgen ( Chen et al. (2003) J Biol Chem, 278(48): 48348–48356 ). Obige paramagnetische Partikel können beispielsweise aus einem paramagnetischen Isotop, wie 157Gd, 55Mn oder 56Fe bestehen. Diese Peptid gekoppelte Verbindungen finden insbesondere bei der Magnetresonanz Bildgebung (MRI) Verwendung.By way of example, the coupling with the aid of N- [α-maleimidoacetoxy] succinimide ester to a surface coated with NH 2 groups can take place ( Chen et al. (2003) J Biol Chem, 278 (48): 48348-48356 ). The paramagnetic particles mentioned above may consist, for example, of a paramagnetic isotope such as 157 Gd, 55 Mn or 56 Fe. These peptide-coupled compounds are used in particular in magnetic resonance imaging (MRI).

In einer weiteren Ausführungsform stellt diese Erfindung ein Peptid bereit, welches die Peptidsequenz „Sequenz 1" aminoterminal enthält und durch anfügen der Peptide Gly-Gly- Gly-Lys-Lys und eines Fluorochroms, wie beispielsweise Fluorescein, an die carboxyterminale Aminosäure gekennzeichnet ist (Sequenz 4).In Another embodiment provides this invention Peptide ready containing the peptide sequence "Sequence 1" amino terminal contains and by adding the peptides Gly-Gly-Gly-Lys-Lys and a fluorochrome, such as fluorescein, to the carboxyterminals Amino acid is characterized (Sequence 4).

Weitere Ausführungsformen dieser Erfindung sind Peptide beliebiger Länge, welche die in der „Sequenz 1" bezeichnete Peptidsequenz aminoterminal enthalten.Further Embodiments of this invention are peptides of any type Length, which is the one designated in "Sequence 1" Peptide sequence aminoterminal included.

Weitere Ausführungsformen dieser Erfindung sind Peptide beliebiger Länge, welche die in der „Sequenz 2" bezeichnete Peptidsequenz aminoterminal enthalten.Further Embodiments of this invention are peptides of any type Length, which is the one designated in "Sequence 2" Peptide sequence aminoterminal included.

Weitere Ausführungsformen zur in-vivo Detektion beinhalten die chemische Kopplung von Metallchelatoren, wie beispielsweise Diethylentriaminpentaessigsäure, Ethylendiamintetraessigsäure oder Tetraazacyclododecantetraessigsäure, an den Carboxyterminus von Peptide beliebiger Länge, welches die in der „Sequenz 1" bezeichnete Peptidsequenz aminoterminal enthalten.Further Embodiments for in vivo detection include the chemical coupling of metal chelators, such as diethylenetriaminepentaacetic acid, Ethylenediaminetetraacetic acid or tetraazacyclododecanetetraacetic acid, to the carboxy terminus of peptides of any length, which the peptide sequence designated in "Sequence 1" amino terminal contain.

Diese Ausführungsformen sind beispielsweise durch Bindung von radioaktiven Isotopen von Metallionen zur diagnostischen Bildgebung geeignet. Die Auswahl des geeigneten radioaktiven Isotops ist abhängig von dem Detektionsgerät und erfolgt durch den Fachmann. Beispiele für diese radioaktiven Isotope sind 99mTC, 123I, 131I, 131In, 97Ru, 67Ga, 68Ga.These embodiments are useful, for example, by binding radioactive isotopes of metal ions to diagnostic imaging. The selection of the appropriate radioactive isotope depends on the detection device and is carried out by a person skilled in the art. Examples of these radioactive isotopes are 99m TC, 123 I, 131 I, 131 In, 97 Ru, 67 Ga, 68 Ga.

Weitere Ausführungsformen der Erfindung enthalten Peptid gekoppelte Verbindungen, welche die in der „Sequenz 1" bezeichneten Peptidsequenz aminoterminal enthalten und carboxyterminal ein radioaktives Isotop tragen, welches diagnostisch und/oder therapeutisch genutzt werden kann. Ein Beispiel ist 18F, welches zur Positronen-Emission-Tomographie (PET) genutzt werden kann. Methoden zur Bindung von radioaktiven Isotopen an Peptide sind dem Fachmann bekannt.Further embodiments of the invention comprise peptide-coupled compounds which contain the amino acid terminal sequence indicated in "Sequence 1" and carry a radioactive isotope carboxy-terminally, which can be used diagnostically and / or therapeutically.An example is 18 F, which is used for positron emission. Tomography (PET) Methods for binding radioactive isotopes to peptides are known to those skilled in the art.

Weitere Ausführungsformen der Erfindung enthalten Peptid gekoppelte Verbindungen, welche die in der „Sequenz 1" bezeichnete Peptidsequenz aminoterminal enthalten und carboxyterminal ein therapeutisches Agens tragen. Beispiele für ein solches Agens sind Chemotherapeutika, welche in der Tumortherapie Verwendung finden. Methoden zur Kopplung von therapeutischen Agenzien an Peptide sind dem Fachmann bekannt.Further Embodiments of the invention include peptide-coupled Compounds which are those designated in "Sequence 1" Contain peptide sequence aminoterminal and carboxyterminal a therapeutic Wear agent. Examples of such an agent are chemotherapeutic agents, which are used in tumor therapy. Methods for coupling of therapeutic agents to peptides are known in the art.

Die folgenden Beispiele sind dazu gedacht, die vorliegende Erfindung zu veranschaulichen, nicht aber zu begrenzen. Die Erfindung findet ihre Begrenzung ausschließlich in den Ansprüchen.The The following examples are intended to illustrate the present invention to illustrate, not to limit. The invention finds their limitation exclusively in the claims.

Die in dieser Beschreibung genannten Publikationen werden durch Bezugnahme eingefügt.The in this specification publications are by reference inserted.

Ausführungsbeispieleembodiments

Beispiel 1example 1

Untersuchung der Bindungsspezifität in Bezug auf unterschiedlich behandeltes humanes Kolagen IVInvestigation of binding specificity with respect to differently treated human collagen IV

Eine Mikrotiterplatte (Greiner BioOne GmbH, Deutschland) wurde zunächst mit 10 μg humanem Kollagen IV (Sigma, Deutschland), welches in 100 μl Dulbeccos Phosphat gepufferter Salzlösung (2,7 mM KCl, 1,5 mM KH2PO4, 136,9 mM NaCl, 8,1 mM Na2HPO4) (DPBS, Invitrogen, Deutschland) pro Vertiefung für eine Stunde bei Raumtemperatur beschichtet. Alternativ wurden die Vertiefungen mit 10 μg humanem Kollagen IV (Sigma, Deutschland), welches zuvor bei 99°C für 6 Minuten erhitzt wurde, in einem Volumen von 100 μl DPBS, wie oben beschrieben, pro Vertiefung für eine Stunde bei Raumtemperatur beschichtet. Alternativ wurden Vertiefungen mit 10 μg bovinem Serumalbumin (Reinheitsgrad 96%) (BSA, Sigma, Deutschland), welches in 100 μl Wasser, welches durch eine Millipore-Filteranlage gereinigt wurde (Leitfähigkeit 18,2 MΩcm), pro Vertiefung für eine Stunde bei Raumtemperatur beschichtet. Nicht gebundenes Kollagen beziehungsweise BSA wurde durch dreimaliges Waschen mit je 200 μl einer DPBS Lösung, welche 0,05% Tween20 (Sigma, Deutschland) enthielt, pro Vertiefung entfernt. Anschließend wurden je Vertiefung 200 μl einer 1%igen BSA (wie oben beschrieben)/DPBS-Lösung (wie oben beschrieben), welche 0,05% Tween20 (Sigma, Deutschland) enthielt, zugegeben und für eine Stunde bei Raumtemperatur inkubiert. Es folgte dreimaliges Waschen mit je 200 μl einer DPBS Lösung, welche 0,05% Tween20 (Sigma, Deutschland) enthielt, pro Vertiefung. In Vertiefungen, welchen keine Matrix-Metalloprotease zugegeben werden sollte, wurden jeweils 200 μl Wasser (wie oben beschrieben) eingefüllt. In weitere mit humanem Kollagen IV beschichtete Vertiefungen wurden unterschiedliche Matrix-Metalloproteasen, wie im Folgenden beschrieben, zugesetzt. Es wurden jeweils 260 ng der rekombinant hergestellten aktiven humanen Matrix-Metalloproteasen 2 und 9 (Calbiochem, Deutschland) verwendet. Sie wurden in einem Volumen von 100 μl in MMP2 und 9-Puffer (25 mM HEPES, 5 mM CaCl2, 20% Glycerol, 0,005 Brij-35, pH 7,5) verwendet. Es wurden jeweils 260 ng der humanen Matrix-Metalloproteasen 1 und 8 (Calbiochem, Deutschland) verwendet.A microtiter plate (Greiner BioOne GmbH, Germany) was initially incubated with 10 μg of human collagen IV (Sigma, Germany), which was dissolved in 100 μl of Dulbecco's phosphate buffered saline (2.7 mM KCl, 1.5 mM KH 2 PO 4 , 136.9%) mM NaCl, 8.1 mM Na 2 HPO 4 ) (DPBS, Invitrogen, Germany) per well for one hour at room temperature. Alternatively, the wells were coated with 10 μg of human collagen IV (Sigma, Germany) previously heated at 99 ° C for 6 minutes in a volume of 100 μl DPBS as described above per well for one hour at room temperature. Alternatively, 10 .mu.g of bovine serum albumin (purity 96%) (BSA, Sigma, Germany) were immersed in 100 .mu.l of water, which was purified by a Millipore filter system (conductivity 18.2 MΩcm), per well for one hour at room temperature coated. Unbound collagen or BSA was removed by washing three times with 200 μl each of a DPBS solution containing 0.05% Tween20 (Sigma, Germany) per well. 200 μl of a 1% BSA (as described above) / DPBS solution (as described above) containing 0.05% Tween20 (Sigma, Germany) were then added to each well and incubated for one hour at room temperature. This was followed by washing three times with 200 μl each of a DPBS solution containing 0.05% Tween20 (Sigma, Germany) per well. In wells to which no matrix metalloprotease was to be added, each 200 μl of water (as described above) was added. In further human collagen IV coated wells, different matrix metalloproteases were added as described below. In each case 260 ng of the recombinantly produced active human matrix metalloproteases 2 and 9 (Calbiochem, Germany) were used. They were used in a volume of 100 μl in MMP2 and 9 buffer (25 mM HEPES, 5 mM CaCl 2 , 20% glycerol, 0.005 Brij-35, pH 7.5). In each case, 260 ng of the human matrix metalloproteases 1 and 8 (Calbiochem, Germany) were used.

Die humanen Matrix-Metalloproteasen 1 und 8 wurden mit 1 mM 4-Aminophenylquecksilberacetat aktiviert ( Grant et al. (1987) J Biol Chem, 262, 5886 ), ( Mallya et al. (1990) Biochemistry, 29, 10628 ). Diese Proteasen wurden in einem Volumen von 100 μl MMP1 und 8 Puffer (50 mM Tris, 150 mM NaCl, 5 mM CaCl2, 1 μM ZnCl2, 0,05% Brij-35, pH 7,0) verwendet. Die Mikrotiterplatte wurde mit Parafilm (Sigma, Deutschland) abgedeckt und für mindestens 20 Stunden bei 37°C inkubiert. Verbliebende Matrix-Metalloprotease wurde durch 30maliges Waschen mit jeweils 200 μl einer DPBS-Lösung, welche 0,2% Tween20 (Sigma, Deutschland) enthielt, pro Vertiefung entfernt. Den gewaschenen Vertiefungen wurden 200 μl Wasser, wie oben beschrieben, zugesetzt und mit Parafilm abgedeckt in einem Kühlschrank bei 8°C aufbewahrt. Die so beschichtete Mikrotiterplatte wurde jedoch innerhalb von 7 Tagen verwendet.The human matrix metalloproteases 1 and 8 were activated with 1 mM 4-aminophenyl mercuric acetate ( Grant et al. (1987) J Biol Chem, 262, 5886 ) Mallya et al. (1990) Biochemistry, 29, 10628 ). These proteases were used in a volume of 100 μl of MMP1 and 8 buffer (50 mM Tris, 150 mM NaCl, 5 mM CaCl 2 , 1 μM ZnCl 2 , 0.05% Brij-35, pH 7.0). The microtiter plate was covered with Parafilm (Sigma, Germany) and incubated for at least 20 hours at 37 ° C. Remaining matrix metalloprotease was characterized by Wash 30 times with 200 μl each of a DPBS solution containing 0.2% Tween20 (Sigma, Germany) per well. The washed wells were added with 200 μl of water as described above and covered with parafilm stored in a refrigerator at 8 ° C. However, the microtiter plate thus coated was used within 7 days.

Die Vertiefungen wurden mit jeweils 1 × 1011 plaque forming units der zu untersuchenden Phagen, dem TLTYWS-Phagen und dem SRPQITN-Phagen, in einem Volumen von jeweils 100 μl in einer DPBS-Lösung, welche 0,2% Tween20 (Sigma, Deutschland) enthielt, in die wie oben beschrieben beschichteten Vertiefungen gegeben. Sie wurden unter Schütteln für eine Stunde bei Raumtemperatur inkubiert. Nicht gebundene Phagen wurden durch 10maliges Waschen mit jeweils 200 μl einer DPBS-Lösung, welche 0,2% Tween20 (Sigma, Deutschland) enthielt, pro Vertiefung entfernt. Durch Zugabe von 100 μl einer Escherichia coli ER2738-Suspension mit einer optischen Dichte, gemessen bei 600 nm (OD600nm), von 0,45 bis 0,5 und folgender Inkubation bei 37°C wurden die gebundenen Phagen von den Vertiefungen eluiert. Die Menge der eluierten Phagen wird durch Austitern mit einem Plaque-Assay bestimmt. Dazu wurden von der Bakterien-/Phagen-Suspension Verdünnungen in einer geometrischen Reihe in LB-Medium (10 g/l Trypton, 5 g/l Hefe-Extrakt, 10 g/l NaCl) erstellt. 10 μl jeder Verdünnung wurden zu 200 μl einer Escherichia coli ER2738 Bakterien-Suspension mit einer OD600nm von 0,48 bis 0,5 gegeben und 5 Minuten bei Raumtemperatur inkubiert. Der so hergestellten Phagen/Bakterien-Mischung wurden 3 ml Top-Agarose (10 g/l Trypton, 5 g/l Hefe-Extrakt, 5 g/l NaCl, 6 g/l Agarose) mit einer Temperatur zwischen 45°C und 50°C zugegeben und in einer Petrischale, welche LB-Medium unter Zusatz von 10 g/l Agar, 300 mg/l 3,4-Cyclohexeneoesculetin-β-D-galactopyranosid Natriumsalz (S-Gal®, Sigma, Deutschland) und 1 mM Isopropyl β-D-thiogalactosid (IPTG, Sigma, Deutschland) enthielt, ausplattiert.The wells were incubated with 1 × 10 11 plaque forming units each of the phages to be examined, the TLTYWS phage and the SRPQITN phage, in a volume of 100 μl each in a DPBS solution containing 0.2% Tween20 (Sigma, Germany ) was added to the wells coated as described above. They were incubated with shaking for one hour at room temperature. Unbound phage were removed by washing 10 times each with 200 μl of a DPBS solution containing 0.2% Tween20 (Sigma, Germany) per well. By addition of 100 .mu.l of a Escherichia coli ER2738 suspension with an optical density measured at 600 nm (OD 600 nm), from 0.45 to 0.5, and following incubation at 37 ° C, the bound phages were eluted from the wells. The amount of phage eluted is determined by grafting with a plaque assay. Dilutions in a geometric series in LB medium (10 g / l tryptone, 5 g / l yeast extract, 10 g / l NaCl) were prepared from the bacterial / phage suspension. 10 μl of each dilution was added to 200 μl of an Escherichia coli ER2738 bacterial suspension with an OD 600 nm of 0.48 to 0.5 and incubated for 5 minutes at room temperature. To the thus prepared phage / bacteria mixture was added 3 ml top agarose (10 g / l tryptone, 5 g / l yeast extract, 5 g / l NaCl, 6 g / l agarose) with a temperature between 45 ° C and 50 C. and added in a petri dish containing LB medium with the addition of 10 g / l agar, 300 mg / l 3,4-cyclohexene-eneceletin-.beta.-D-galactopyranoside sodium salt (S- Gal.RTM. , Sigma, Germany) and 1 mM Isopropyl β-D-thiogalactoside (IPTG, Sigma, Germany) contained, plated.

Nach Erhärten der Top-Agarose wurden die Platten umgedreht bei 37°C für mindestens 18 Stunden inkubiert. Bei jeder Platte wurden anschließend die schwarz gefärbten Löcher im Bakterienrasen gezählt. Die Anzahl der Löcher im Bakterienrasen (Plaques) wurden mit der verwendeten Verdünnung multipliziert und gaben so die Anzahl der eluierten Phagen in einem Volumen von 10 μl ausgedrückt in der Einheit „plaque forming unit" (pfu) an. Die Ergebnisse sind in den Tabellen 1 und 3 dargestellt. In der 1 sind jeweils die ermittelten arithmetischen Mittelwerte dargestellt. Weiterhin wurde die Signifikanz der Ergebnisse mit dem t-Test für kleine Probenumfänge ( Moore (1957) , Biometrika 44 (3–4), 482–489 ) ermittelt. Die Ergebnisse des Signifikanz-Tests sind als Fehler 1. Ordnung (p-Werte) bezogen auf die Bindung des TLTYTWS-Phagen an MMP2 modifiziertes humane Kollagen IV in den Tabellen 2 und 4 dargestellt. Tabelle 1 TLTYTWS-Phage arithmetischer Mittelwert (pfu/μl) hKollagen IV 3,48E+04 hKollagen IV + rhMMP2 8,52E+05 hKollagen IV + rhMMP9 8,18E+04 hKollagen IV + hMMP1 1,30E+05 hKollagen IV + hMMP8 3,66E+04 hitze denaturiertes hKollagen IV 2,15E+03 BSA 2,17E+04 Tabelle 2 TLTYTWS-Phage p-Wert hKollagen IV < 0,01 hKollagen IV + rhMMP9 < 0,01 hKollagen IV + hMMP1 < 0,01 hKollagen IV + hMMP8 < 0,01 hitze denaturiertes hKollagen IV < 0,01 BSA < 0,02 Tabelle 3 SRPQITN-Phage arithmetischer Mittelwert (pfu/μl) hKollagen IV 4,21E+04 hKolllagen IV + rhMMP2 4,86E+04 hKollagen IV + rhMMP9 3,32E+04 hKollagen IV + hMMP1 4,58E+04 hKollagen IV + hMMP8 8,00E+04 hitze denaturiertes hKollagen IV 1,97E+04 BSA 3,36E+04 Tabelle 4 SRPQITN-Phage p-Wert hKollagen IV < 0,05 hKollagen IV + rhMMP2 < 0,01 hKollagen IV + rhMMP9 < 0,01 hKollagen IV + hMMP1 < 0,01 hKollagen IV + hMMP8 < 0,01 hitze denaturiertes hKollagen IV < 0,01 BSA < 0,05 After hardening the top agarose, the plates were inverted at 37 ° C for at least 18 hours. Each plate was then counted the black colored holes in the bacterial lawn. The number of holes in the bacterial lawn (plaques) was multiplied by the dilution used, indicating the number of phages eluted in a volume of 10 μl expressed in the unit of "plaque forming unit" (pfu) The results are shown in Tables 1 and 3. In the 1 the calculated arithmetic mean values are shown in each case. Furthermore, the significance of the results with the t-test for small sample volumes ( Moore (1957) . Biometrics 44 (3-4), 482-489 ). The results of the significance test are shown as 1st order errors (p-values) related to the binding of TLTYTWS phage to MMP2 modified human collagen IV in Tables 2 and 4. Table 1 TLTYTWS phage arithmetic mean (pfu / μl) Collagen IV 3,48E + 04 h collagen IV + rhMMP2 8,52E + 05 h collagen IV + rhMMP9 8,18E + 04 h collagen IV + hMMP1 1,30E + 05 h collagen IV + hMMP8 3,66E + 04 heat denatured h collagen IV 2,15E + 03 BSA 2,17E + 04 Table 2 TLTYTWS phage p-value Collagen IV <0.01 h collagen IV + rhMMP9 <0.01 h collagen IV + hMMP1 <0.01 h collagen IV + hMMP8 <0.01 heat denatured h collagen IV <0.01 BSA <0.02 Table 3 SRPQITN phage arithmetic mean (pfu / μl) Collagen IV 4,21E + 04 hKolllagen IV + rhMMP2 4,86E + 04 h collagen IV + rhMMP9 3,32E + 04 h collagen IV + hMMP1 4,58E + 04 h collagen IV + hMMP8 8,00E + 04 heat denatured h collagen IV 1,97E + 04 BSA 3,36E + 04 Table 4 SRPQITN phage p-value Collagen IV <0.05 h collagen IV + rhMMP2 <0.01 h collagen IV + rhMMP9 <0.01 h collagen IV + hMMP1 <0.01 h collagen IV + hMMP8 <0.01 heat denatured h collagen IV <0.01 BSA <0.05

Beispiel 2Example 2

Auswirkung von Veränderungen der Peptidsequenz des Phagen auf die Bindung an durch Matrix-Metalloprotease 2 modifiziertem humanem Kollagen IVImpact of changes the peptide sequence of the phage on binding by matrix metalloprotease 2 modified human collagen IV

Wie im Beispiel 1 beschrieben wurden Vertiefungen einer Mikrotiterplatte, welche mit 10 μg humanem Kollagen IV beschichtet waren und anschließend mit jeweils 260 ng rekombinanter aktiver humaner Matrix-Metalloprotease 2 inkubiert wurden, verwendet. Je Vertiefung wurden jeweils 1 × 1011 plaque forming units den zu untersuchenden Phagen, dem GLGYGWS-Phagen, dem TGTYTWS-Phagen, dem TLTYTGS-Phagen und dem LKQNGGNFSL-Phagen in einem Volumen von jeweils 100 μl in einer DPBS-Lösung, welche 0,2% Tween20 (Sigma, Deutschland) enthielt, in die wie oben beschrieben beschichteten Vertiefungen gegeben. Sie wurden unter Schütteln für eine Stunde bei Raumtemperatur inkubiert. Nicht gebundene Phagen wurden durch 10maliges Waschen mit jeweils 200 μl einer DPBS-Lösung, welche 0,2% Tween20 (Sigma, Deutschland) enthielt, pro Vertiefung entfernt. Durch Zugabe von 100 μl einer Escherichia coli ER2738-Suspension mit einer optischen Dichte, gemessen bei 600 nm (OD600nm), von 0,45 bis 0,5 und folgender Inkubation bei 37°C wurden die gebundenen Phagen von den Vertiefungen eluiert. Die Menge der eluierten Phagen wird durch Austitern mit einem Plaque-Assay bestimmt. Dazu wurden von der Bakterien-/Phagen-Suspension Verdünnungen in einer geometrischen Reihe in LB-Medium erstellt. 10 μl jeder Verdünnung wurden zu 200 μl einer Escherichia coli ER2738 Bakterien-Suspension mit einer OD600nm von 0,48 bis 0,5 gegeben und 5 Minuten bei Raumtemperatur inkubiert. Der so hergestellten Phagen/Bakterien-Mischung wurden 3 ml Top-Agarose (10 g/l Trypton, 5 g/l Hefe-Extrakt, 5 g/l NaCl, 6 g/l Agarose) mit einer Temperatur zwischen 45°C und 50°C zugegeben und in einer Petrischale, welche LB-Medium unter Zusatz von 10 g/l Agar, 300 mg/l S-Gal® (Sigma, Deutschland) und 1 mM IPTG (Sigma, Deutschland) enthielt, ausplattiert. Nach Erhärten der Top-Agarose wurden die Platten umgedreht bei 37°C für mindestens 18 Stunden inkubiert. Bei jeder Platte wurden anschließend die schwarz gefärbten Löcher im Bakterienrasen gezählt. Die Anzahl der Löcher im Bakterienrasen (Plaques) wurden mit der verwendeten Verdünnung multipliziert und gaben so die Anzahl der eluierten Phagen in einem Volumen von 10 μl ausgedrückt in der Einheit „plaque forming unit" (pfu) an. Die Ergebnisse sind in der Tabelle 5 dargestellt. In der 2 sind jeweils die ermittelten arithmetischen Mittelwerte dargestellt.As described in Example 1, wells of a microtiter plate which had been coated with 10 μg of human collagen IV and subsequently incubated with in each case 260 ng of recombinant active human matrix metalloprotease 2 were used. In each case, 1 × 10 11 plaque-forming units each were administered to the phages to be examined, the GLGYGWS phage, the TGTYTWS phage, the TLTYTGS phage and the LKQNGGNFSL phage in a volume of 100 μl each in a DPBS solution which was 0 , 2% Tween20 (Sigma, Germany) was added to the wells coated as described above. They were incubated with shaking for one hour at room temperature. Unbound phage were removed by washing 10 times each with 200 μl of a DPBS solution containing 0.2% Tween20 (Sigma, Germany) per well. By addition of 100 .mu.l of a Escherichia coli ER2738 suspension with an optical density measured at 600 nm (OD 600 nm), from 0.45 to 0.5, and following incubation at 37 ° C, the bound phages were eluted from the wells. The amount of phage eluted is determined by grafting with a plaque assay. For this purpose dilutions in a geometric series in LB medium were created by the bacterial / phage suspension. 10 μl of each dilution was added to 200 μl of an Escherichia coli ER2738 bacterial suspension with an OD 600 nm of 0.48 to 0.5 and incubated for 5 minutes at room temperature. To the thus prepared phage / bacteria mixture was added 3 ml top agarose (10 g / l tryptone, 5 g / l yeast extract, 5 g / l NaCl, 6 g / l agarose) with a temperature between 45 ° C and 50 ° C and in a Petri dish containing LB medium with the addition of 10 g / l agar, 300 mg / l S-Gal ® (Sigma, Germany) and 1 mM IPTG (Sigma, Germany), plated out. After hardening the top agarose, the plates were inverted at 37 ° C for at least 18 hours. Each plate was then counted the black colored holes in the bacterial lawn. The number of holes in the bacterial lawn (plaques) was multiplied by the dilution used to indicate the number of phages eluted in a volume of 10 μl expressed in the unit of "plaque forming unit" (pfu) The results are shown in Table 5 shown in the 2 the calculated arithmetic mean values are shown in each case.

Weiterhin wurde die Signifikanz der Ergebnisse mit dem t-Test für kleine Probenumfänge (Moore (1957), wie oben genannt) ermittelt. Die Ergebnisse des Signifikanz-Tests sind als Fehler 1. Ordnung (p-Werte) bezogen auf die Bindung des TLTYTWS-Phagen an MMP2 modifiziertes humane Kollagen IV in der Tabelle 6 dargestellt. Tabelle 5 Phage arithmetischer Mittelwert (pfu/μl) LKQNGGNFSL-Phage 2,02E+03 GLGYGWS-Phage 8,59E+03 TGTYTWS-Phage 1,67E+04 TLTYTGS-Phage 3,81E+04 TLTYTWS-Phage 8,52E+05 Tabelle 6 Phage p-Wert LKQNGGNFSL-Phage < 0,01 GLGYGWS-Phage < 0,01 TGTYTWS-Phage < 0,01 TLTYTGS-Phage < 0,01 Furthermore, the significance of the results was determined with the t-test for small sample volumes (Moore (1957), as mentioned above). The results of the significance test are as 1st order errors (p-values) related to the binding of TLTYTWS phage to MMP2-modified human collagen IV in Table 6 shown. Table 5 phage arithmetic mean (pfu / μl) LKQNGGNFSL phage 2,02E + 03 GLGYGWS phage 8,59E + 03 TGTYTWS phage 1,67E + 04 TLTYTGS phage 3,81E + 04 TLTYTWS phage 8,52E + 05 Table 6 phage p-value LKQNGGNFSL phage <0.01 GLGYGWS phage <0.01 TGTYTWS phage <0.01 TLTYTGS phage <0.01

Beispiel 3Example 3

Inhibition der Bindung des TLTYTWS-Phagen an durch MMP2 modifiziertem humanem Kollagen IV durch Inkubation mit dem chemisch synthetisierten Peptid, welches als Sequenzidentifikation-Nr 3 offenbart wurde.Inhibition of TLTYTWS phage binding on MMP2-modified human collagen IV by incubation with the chemically synthesized peptide used as SEQ ID NO 3 was disclosed.

Wie im Beispiel 1 beschrieben wurden Vertiefungen einer Mikrotiterplatte, welche mit 10 μg humanem Kollagen IV beschichtet waren und anschließend mit jeweils 260 ng rekombinanter aktiver humaner Matrix-Metalloprotease 2 inkubiert wurden, verwendet. Zunächst erfolgte die Zugabe unterschiedlicher Mengen des in der „Sequenz 3" bezeichnete Peptids in die einzelnen Vertiefungen in einem Volumen von 100 μl DPBS-Lösung. Es folgte eine einstündigen Inkubation bei Raumtemperatur auf einem Schüttler. Anschließend wurde die überstehende Lösung entfernt. In jeder der so behandelten Vertiefungen wurden 1 × 1011 plaque forming units der TLTYTWS-Phagen in einem Volumen von 100 μl in einer DPBS-Lösung, welche 0,2% Tween20 (Sigma, Deutschland) enthielt, in die wie oben beschrieben vorbehandelten Vertiefungen gegeben. Sie wurden unter Schütteln für eine Stunde bei Raumtemperatur inkubiert. Nicht gebundene Phagen wurden durch 10maliges Waschen mit jeweils 200 μl einer DPBS-Lösung, welche 0,2% Tween20 (Sigma, Deutschland) enthielt, pro Vertiefung entfernt. Durch Zugabe von 100 μl einer Escherichia coli ER2738-Suspension mit einer optischen Dichte, gemessen bei 600 nm (OD600nm), von 0,45 bis 0,5 und folgender Inkubation bei 37°C wurden die gebundenen Phagen von den Vertiefungen eluiert. Die Menge der eluierten Phagen wird durch Austitern mit einem Plaque-Assay bestimmt. Dazu wurden von der Bakterien-/Phagen-Suspension Verdünnungen in einer geometrischen Reihe in LB-Medium erstellt. 10 μl jeder Verdünnung wurden zu 200 μl einer Escherichia coli ER2738 Bakterien-Suspension mit einer OD600nm von 0,48 bis 0,5 gegeben und 5 Minuten bei Raumtemperatur inkubiert. Der so hergestellten Phagen/Bakterien-Mischung wurden 3 ml Top-Agarose (10 g/l Trypton, 5 g/l Hefe-Extrakt, 5 g/l NaCl, 6 g/l Agarose) mit einer Temperatur zwischen 45°C und 50°C zugegeben und in einer Petrischale, welche LB-Medium unter Zusatz von 10 g/l Agar, 300 mg/l S-Gal® (Sigma, Deutschland) und 1 mM IPTG (Sigma, Deutschland) enthielt, ausplattiert. Nach Erhärten der Top-Agarose wurden die Platten umgedreht bei 37°C für mindestens 18 Stunden inkubiert. Bei jeder Platte wurden anschließend die schwarz gefärbten Löcher im Bakterienrasen gezählt.As described in Example 1, wells of a microtiter plate which had been coated with 10 μg of human collagen IV and subsequently incubated with in each case 260 ng of recombinant active human matrix metalloprotease 2 were used. First, different amounts of the peptide designated in "Sequence 3" were added to the individual wells in a volume of 100 μl of DPBS solution, followed by incubation at room temperature on a shaker for one hour, after which the supernatant was removed Wells treated in this manner were added to the 1 × 10 11 plaque forming units of the TLTYTWS phages in a volume of 100 μl in a DPBS solution containing 0.2% Tween20 (Sigma, Germany) in the wells pretreated as described above Unbound phage were removed by washing 10 times with 200 μl each of a DPBS solution containing 0.2% Tween20 (Sigma, Germany) per well by adding 100 μl of an Escherichia coli ER2738 suspension with an optical density measured at 600 nm (OD 600nm ), from 0.45 to 0.5 and subsequent incubation at 37 ° C the bound phages were eluted from the wells. The amount of phage eluted is determined by grafting with a plaque assay. For this purpose dilutions in a geometric series in LB medium were created by the bacterial / phage suspension. 10 μl of each dilution was added to 200 μl of an Escherichia coli ER2738 bacterial suspension with an OD 600 nm of 0.48 to 0.5 and incubated for 5 minutes at room temperature. To the thus prepared phage / bacteria mixture was added 3 ml top agarose (10 g / l tryptone, 5 g / l yeast extract, 5 g / l NaCl, 6 g / l agarose) with a temperature between 45 ° C and 50 ° C and in a Petri dish containing LB medium with the addition of 10 g / l agar, 300 mg / l S-Gal ® (Sigma, Germany) and 1 mM IPTG (Sigma, Germany), plated out. After hardening the top agarose, the plates were inverted at 37 ° C for at least 18 hours. Each plate was then counted the black colored holes in the bacterial lawn.

Die Anzahl der Löcher im Bakterienrasen (Plaques) wurden mit der verwendeten Verdünnung multipliziert und gaben so die Anzahl der eluierten Phagen in einem Volumen von 10 μl ausgedrückt in der Einheit „plaque forming unit" (pfu) an. Die Ergebnisse sind in der Tabelle 7 dargestellt. In der 3 sind jeweils die ermittelten arithmetischen Mittelwerte dargestellt. Zusätzlich wurde eine Trendlinie eingefügt, welche die Dosisabhängigkeit der Inhibition zeigt. Weiterhin wurde die Signifikanz der Ergebnisse mit dem t-Test für kleine Probenumfänge ( Moore (1957) , wie oben genannt) ermittelt. Die Ergebnisse des Signifikanz-Tests sind als Fehler 1. Ordnung (p-Werte) bezogen auf die Bindung des TLTYTWS-Phagen an MMP2 modifiziertes humane Kollagen IV in der Tabelle 8 dargestellt. Tabelle 6 Peptid (μg × 10–6) arithmetischer Mittelwert pfu/μl) 0 3,20E+04 1 1,61E+04 10 2,57E+03 100 5,55E+03 1000 4,22E+03 10000 3,55E+03 100000 4,29E+03 Tabelle 7 Peptid (μg × 10–6) p-Wert 1 < 0,1 10 < 0,02 100 < 0,05 1000 < 0,02 10000 < 0,05 100000 < 0,01 The number of holes in the bacterial lawn (plaques) was multiplied by the dilution used to indicate the number of phages eluted in a volume of 10 μl expressed in the unit of "plaque forming unit" (pfu) The results are shown in Table 7 shown in the 3 the calculated arithmetic mean values are shown in each case. In addition, a trend line was inserted showing the dose-dependency of the inhibition. Furthermore, the significance of the results with the t-test for small sample volumes ( Moore (1957) as mentioned above). The results of the significance test are shown as 1st order errors (p-values) related to the binding of TLTYTWS phage to MMP2-modified human collagen IV in Table 8. Table 6 Peptide (μg × 10 -6 ) arithmetic mean pfu / μl) 0 3,20E + 04 1 1,61E + 04 10 2,57E + 03 100 5,55E + 03 1000 4,22E + 03 10000 3,55E + 03 100000 4,29E + 03 Table 7 Peptide (μg × 10 -6 ) p-value 1 <0.1 10 <0.02 100 <0.05 1000 <0.02 10000 <0.05 100000 <0.01

Beispiel 4Example 4

Untersuchung der Eigenschaft des TLTYTWS-Phagen sich in einem Tumor einzufindenInvestigation of the property of TLTYTWS phage to find yourself in a tumor

Diese Untersuchung wurde an einem Tumor-Maus Modell als drei unabhängige Versuche durchgeführt.These Examination was performed on a tumor-mouse model as three independent Experiments performed.

Einer weiblichen 8 Wochen alten NMRI nu/nu Nacktmaus (Charles River Laboratories, Deutschland) wurden an beiden Oberschenkeln 1 × 107 Lewis-Lung-Carcinoma Zellen (LLC (Cell-Line-Services, Deutschland) unter die Haut mittels einer Insulinspritze (BD Bioscience, Deutschland) injiziert. Innerhalb der folgenden 2 Wochen entwickelten sich an den Oberschenkeln Tumore. Die Haltung der Maus erfolgte entsprechend der tierschutzrechtlichen Bestimmungen bei ad libitum Fütterung. Nach 2 Wochen wurde die Maus mittels Gabe von 250 μl einer Ketamin/Xylazin-Mischung (8% Rompun®, 10% Ketamin in einer 0,9%igen NaCl-Lösung) in das Peritoneum anästhesiert. Es folgte die Injektion von 1 × 1011 plaque-forming units des zu untersuchenden Phagen, dem TLTYTWS-Phagen oder dem SRPQITN-Phagen (Kontrollphage), in die Schwanzvene mittels Insulinspritze. Nach einer Zirkulationszeit von 10 Minuten wurde der Brustkorb der anästhesierten Maus eröffnet. In die linke Herzkammer des schlagenden Herzens wurden, nach Durchtrennen der Aorta, mindestens 10 ml einer sterilen DPBS-Lösung, wie oben beschrieben, infundiert. Dabei wurden das Blut und darin enthaltene nicht gebundene Phagen aus dem Organismus entfernt. Dem nun toten Tier wurden beide Tumore und folgende Organe entnommen. Bei den zu untersuchenden Organen handelte es sich um das Gehirn, das Herz, die Lunge, die Leber, beide Nieren, die Milz und den Magen. Die entnommenen Organe und die Tumore wurden gewogen und mittels eines Homogenisators in LB-Medium, wie oben beschrieben, zerkleinert. Die so gewonnen Homogenate wurden bei 2700 × g für 5 Minuten zentrifugiert. Der unlösliche Homogenatanteil wurde anschließend 4 mal mit jeweils 1 ml einer DPBS-Lösung gewaschen. Zur Eluation der Phagen wurden 900 μl einer Escherichia coli ER 2738 Bakteriensuspension mit einer OD600nm von 0,45 dem gewaschenen Homogenat zugegeben. Es schloss sich eine 30minütige Inkubation bei 37°C an. Nach dieser Inkubation wurden 10 μl der Suspension zur Bestimmung des Phagentiters mittels des oben beschriebenen Plaque-Assays verwendet. Die Werte wurden unter Berücksichtigung der eingesetzten Phagenmenge als „output/input-Verhältnis pro g Gewebe" ausgedrückt (Tabelle 8).A female 8-week-old NMRI nu / nu nude mouse (Charles River Laboratories, Germany) was injected on both thighs with 1x10 7 Lewis lung carcinoma cells (LLC (Cell-Line-Services, Germany) under the skin using an insulin syringe (BD Within two weeks, tumors developed on the thighs and the mice were kept in ad libitum feeding according to the animal welfare regulations.After 2 weeks, the mice were treated by administering 250 μl of a ketamine / xylazine mixture (see Bioscience, Germany). 8% Rompun ®, ketamine 10% in a 0.9% NaCl solution) anesthetized in the peritoneum. this was followed by injection of 1 x 10 11 plaque-forming units of the phage to be tested, the TLTYTWS phage or SRPQITN- Phage (control phage) into the tail vein using insulin syringe After a circulating time of 10 minutes, the thorax of the anesthetized mouse was opened, into the left ventricle of the beating heart after cutting the aorta, infuse at least 10 ml of a sterile DPBS solution as described above. The blood and unbound phage contained therein were removed from the organism. The now dead animal, both tumors and the following organs were removed. The organs to be examined were the brain, the heart, the lung, the liver, both kidneys, the spleen, and the stomach. The removed organs and tumors were weighed and minced by a homogenizer in LB medium as described above. The homogenates thus obtained were centrifuged at 2700 × g for 5 minutes. The insoluble homogenate was then washed 4 times with 1 ml each of a DPBS solution. For elution of the phages, 900 μl of an Escherichia coli ER 2738 bacterial suspension with an OD 600 nm of 0.45 were added to the washed homogenate. This was followed by a 30 minute incubation at 37 ° C. After this incubation, 10 μl of the suspension was used to determine the phagitis using the plaque assay described above. The values were expressed as the "output / input ratio per g tissue", taking into account the amount of phage used (Table 8).

Zur besseren Darstellung des Versuchsergebnisses wurden die Werte als „fache der Kontrolle" bezogen auf die einzelnen Organe in der 4 dargestellt. Die für die Abbildung verwendeten Werte sind in Tabelle 8a dargestellt. Weiterhin wurde die Signifikanz der Ergebnisse für die Tumorgewebe des TLTYTWS-Phagen und des SRPQITN-Phagen mit dem t-Test für kleine Probenumfänge ( Moore (1957) , wie oben genannt) ermittelt. Es ergab sich als Fehler 1. Ordnung (p-Werte) für den Unterschied der Phagenmenge im Tumorgewebe von p < 0,5. Tabelle 8 TLTYTWS-Phage Gewebe Einzelwerte (output/input/g Gewebe) Hirn 7,37E–05 6,78E–06 7,09E–06 Muskel 2,49E–05 6,06E–05 3,17E–05 Tumor 1,41E–03 2,35E–03 Magen 1,98E–04 5,07E–05 1,47E–04 Niere 3,87E–04 7,41E–04 1,03E–03 Herz 1,39E–04 3,28E–04 8,61E–04 Lunge 1,66E–02 1,43E–02 8,73E–03 Milz 9,33E–03 2,39E–02 5,85E–02 Leber 1,08E–03 1,45E–03 3,51E–03 SRPQITN-Phage Gewebe Mittelwert (output/input/g Gewebe) Hirn 1,72E–04 Muskel 6,17E–04 Tumor 5,06E–04 Magen 1,11E–03 Niere 3,32E–03 Herz 8,88E–03 Lunge 2,39E–02 Milz 2,44E–02 Leber 1,41E–02 Tabelle 8a Gewebe fache des Kontrollphagen Hirn 0,17 Muskel 0,06 Tumor 3,71 Magen 0,12 Niere 0,22 Herz 0,05 Lunge 0,55 Milz 1,25 Leber 0,14 For a better presentation of the test results, the values were used as "times of control" in relation to the individual organs in the 4 shown. The values used for the mapping are shown in Table 8a. Furthermore, the significance of the results for the tumor tissue of TLTYTWS-Pha gene and the SRPQITN phage with the t-test for small sample volumes ( Moore (1957) as mentioned above). The 1st order error (p-values) resulted for the difference in the amount of phage in the tumor tissue of p <0.5. Table 8 TLTYTWS phage tissue Individual values (output / input / g tissue) brain 7,37E-05 6,78E-06 7,09E-06 muscle 2,49E-05 6,06E-05 3,17E-05 tumor 1,41E-03 2,35E-03 stomach 1,98E-04 5,07E-05 1,47E-04 kidney 3,87E-04 7,41E-04 1,03E-03 heart 1,39E-04 3,28E-04 8,61E-04 lung 1,66E-02 1,43E-02 8,73E-03 spleen 9,33E-03 2,39E-02 5,85E-02 liver 1.08E-03 1,45E-03 3,51E-03 SRPQITN phage tissue Mean value (output / input / g tissue) brain 1,72E-04 muscle 6,17E-04 tumor 5,06E-04 stomach 1,11E-03 kidney 3,32E-03 heart 8,88E-03 lung 2,39E-02 spleen 2,44E-02 liver 1,41E-02 Table 8a tissue fold of the control phage brain 0.17 muscle 0.06 tumor 3.71 stomach 0.12 kidney 0.22 heart 0.05 lung 0.55 spleen 1.25 liver 0.14

Beispiel 5Example 5

Inhibition der Angiogenese durch das TLTYTWS-Peptid („Sequenz 3") in-vitro (Teil a) und in-vivo (Teil b)Inhibition of angiogenesis by the TLTYTWS peptide ("Sequence 3") in vitro (part a) and in vivo (part b)

a) Untersuchung in-vitroa) In vitro study

In die Vertiefungen einer „24-well"-Platte (Greiner, Frickenhausen, Deutschland) wurden 100 μl Wachstumsfaktor reduzierte Matrigel (BD, Heidelberg, Deutschland) je Vertiefung gegeben und eine Stunde bei 37°C inkubiert. Je Vertiefung wurden nun 5 × 104 humane Endothelzellen der Nabelschnurvene (HUVEC; PromoCell, Heidelberg, Deutschland) in je 1 ml HUVEC-Wachstumsmedium (PromoCell; enthielt 1 ng/ml basic Fibroblasten-Wachstumsfaktor (bFGF)) gegeben. Weiterhin wurden bei je drei Vertiefungen 0,1; 1 oder 10 μg des Peptides („Sequenz 3") zugegeben. Es wurden jeweils Triplikate durchgeführt. Die Platte wurde für 16 Stunden bei 37°C und 5% CO2 inkubiert. Bei dem sich bildenden tubulären Netzwerk wurden jeweils die Verknüpfungspunkte je Gesichtsfeld gezählt. Je Vertiefung wurden 6 Gesichtsfelder ausgezählt. Die Ergebnisse sind in der Tabelle 9 und in der 5 dargestellt. In der 6 ist die Reduktion der Verzweigungspunkte in % gegenüber der Peptidmenge dargestellt. Zusätzlich wurde eine Trendlinie eingefügt, welche eine lineare Korrelation zwischen der Reduktion der Verzweigungspunkte und der zugegeben Peptid-Menge zeigt. Weiterhin wurde die Signifikanz der Ergebnisse mit dem t-Test für kleine Probenumfänge ( Moore (1957) , am angegebenem Ort) ermittelt. Die Ergebnisse des Signifikanz-Tests sind als Fehler 1. Ordnung (p-Werte) bezogen auf das Experiment ohne Zugabe des Peptides sind in der Tabelle 10 dargestellt. Tabelle 9 Probe arithmetrischer Mittelwert % Reduktion der Verzweigungspunkte ohne Peptid 35,3888889 0 0.1 μg Peptid 27,0555556 23,5478807 1 μg Peptid 21,6111111 38,9324961 10 μg Peptid 13,8650794 60,8208118 Tabelle 10 Peptid (in μg) P-Wert 0,1 < 0,05 1 < 0,05 10 < 0,01 In the wells of a "24-well" plate (Greiner, Frickenhausen, Germany), 100 μl of growth factor-reduced Matrigel (BD, Heidelberg, Germany) were added per well and incubated for one hour at 37 ° C. Each well was now 5 × 10 4 human umbilical vein endothelial cells (HUVEC, PromoCell, Heidelberg, Germany), each in 1 ml of HUVEC growth medium (PromoCell, containing 1 ng / ml basic fibroblast growth factor (bFGF)) and 0.1, 1 or 10 μg of the peptide ("Sequence 3"). In each case triplicates were carried out. The plate was incubated for 16 hours at 37 ° C and 5% CO 2 . In the case of the forming tubular network, the linking points per visual field were counted in each case. For each well, 6 visual fields were counted. The results are shown in Table 9 and in 5 shown. In the 6 the reduction of the branch points in% compared to the amount of peptide is shown. In addition, a trend line was inserted showing a linear correlation between the branch point reduction and the added amount of peptide. Furthermore, the significance of the results with the t-test for small sample volumes ( Moore (1957) , at the specified place). The results of the significance test are shown as errors of the first order (p-values) relative to the experiment without addition of the peptide are shown in Table 10. Table 9 sample arithmetic mean % Reduction of branch points without peptide 35.3888889 0 0.1 μg peptide 27.0555556 23.5478807 1 μg peptide 21.6111111 38.9324961 10 μg peptide 13.8650794 60.8208118 Table 10 Peptide (in μg) P value 0.1 <0.05 1 <0.05 10 <0.01

b) Untersuchung in-vivob) In vivo study

Zur Untersuchung der Angiogenese in-vivo wurde der Matrigel-Plug-Versuch verwendet. Dazu wurden jeweils 500 μl wachstumsfaktor reduziertes Matrigel (BD) mit 200 ng bFGF gemischt. Dieser Mischung wurden 1; 5 oder 10 μg Peptid („Sequenz 3") zugegeben. Diese Mischung wurde einer weiblichen CD1-Maus subkutan in die Flanke injiziert. Nach 14 Tagen wurde die Maus getötet, der aus der Injektion entstandene Plug entnommen, durch Ultraschall homogenisiert, und der Hämoglobin-Gehalt nach der Drabkin-Methode ( Drabkin (1935) J Biol Chem. 112: 51 ) bestimmt. Der Hämoglobin-Gehalt des Matrigel-Plugs ist ein Maß für die stattgefundene Angiogenese. Die Ergebnisse sind in der Tabelle 11 und in der 7 dargestellt. In der 8 ist die Reduktion der Verzweigungspunkte in % gegenüber der Peptidmenge dargestellt. Zusätzlich wurde eine Trendlinie eingefügt, welche einen logarithmischen Zusammenhang in Form einer Sättigungskurve zwischen der Reduktion der Angiogenese und der zugegeben Peptid-Menge zeigt. Weiterhin wurde die Signifikanz der Ergebnisse mit dem t-Test für kleine Probenumfänge ( Moore (1957) , am angegebenem Ort) ermittelt. Die Ergebnisse des Signifikanz-Tests sind als Fehler 1. Ordnung (p-Werte) bezogen auf das Experiment ohne Zugabe des Peptides sind in der Tabelle 12 dargestellt. Tabelle 11 Probe arithmetrischer Mittelwert % Reduktion des Hämoglobingehalts 200 ng bFGF 69,1982627 0 200 ng bFGF + 1 μg Peptid 23,8113356 76,1886644 200 ng bFGF + 5 μg Peptid 20,5571811 79,4428189 200 ng bFGF + 10 μg Peptid 9,76024798 90,239752 Tabelle 12 Peptid (in μg) P-Wert 1 > 0,1 5 > 0,1 10 < 0,05 To study angiogenesis in vivo, the Matrigel plug experiment was used. In each case, 500 μl growth factor-reduced Matrigel (BD) were mixed with 200 ng bFGF. This mixture was 1; 5 or 10 μg of peptide ("Sequence 3") was injected into the flank of a female CD1 mouse, and after 14 days the mouse was sacrificed, the plug from the injection was homogenized, and the hemoglobin was homogenized Content according to the Drabkin method ( Drabkin (1935) J Biol Chem. 112: 51 ) certainly. The hemoglobin content of the Matrigel plug is a measure of the angiogenesis that has taken place. The results are shown in Table 11 and in 7 shown. In the 8th the reduction of the branch points in% compared to the amount of peptide is shown. In addition, a trend line was inserted which shows a logarithmic relationship in the form of a saturation curve between the reduction of angiogenesis and the added amount of peptide. Furthermore, the significance of the results with the t-test for small sample volumes ( Moore (1957) , at the specified place). The results of the significance test are shown as errors of the first order (p-values) relative to the experiment without addition of the peptide are shown in Table 12. Table 11 sample arithmetic mean % Reduction in hemoglobin content 200 ng bFGF 69.1982627 0 200 ng bFGF + 1 μg peptide 23.8113356 76.1886644 200 ng bFGF + 5 μg peptide 20.5571811 79.4428189 200 ng bFGF + 10 μg peptide 9.76024798 90.239752 Table 12 Peptide (in μg) P value 1 > 0.1 5 > 0.1 10 <0.05

ZITATE ENTHALTEN IN DER BESCHREIBUNGQUOTES INCLUDE IN THE DESCRIPTION

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list The documents listed by the applicant have been automated generated and is solely for better information recorded by the reader. The list is not part of the German Patent or utility model application. The DPMA takes over no liability for any errors or omissions.

Zitierte PatentliteraturCited patent literature

  • - WO 2004/073649 A2 [0027] WO 2004/073649 A2 [0027]

Zitierte Nicht-PatentliteraturCited non-patent literature

  • - Hangai, M., et al. (2002) Am J Pathol 161(4): 1429–1437 [0002] Hangai, M., et al. (2002) Am J Pathol 161 (4): 1429-1437 [0002]
  • - Xu et al. (2001). J Cell Biol 154(5): 1069–1079 [0002] Xu et al. (2001). J Cell Biol 154 (5): 1069-1079 [0002]
  • - Milkiewicz et al. (2006) Int J Biochem Cell Biol 38(3): 333–357 [0002] Milkiewicz et al. (2006) Int J Biochem Cell Biol 38 (3): 333-357 [0002]
  • - Xue et al. (2006), Expert Opin Ther Targets 10(1): 143–155 [0003] Xue et al. (2006), Expert Opin Ther Targets 10 (1): 143-155 [0003]
  • - Toy et al. (2005). J Wound Care 14(1): 202 [0003] - Toy et al. (2005). J Wound Care 14 (1): 202 [0003]
  • - Yong et al. (2001). Nat Rev Neurosci 2(7): 502–511 [0004] - Yong et al. (2001). Nat Rev Neurosci 2 (7): 502-511 [0004]
  • - Leppert et al. (2000). Clin Infect Dis 31(1): 80–84 [0004] - Leppert et al. (2000). Clin Infect Dis 31 (1): 80-84 [0004]
  • - Ozenci et al. (2000) J Neuroimmunol 108(1–2): 236–243 [0004] - Ozenci et al. (2000) J Neuroimmunol 108 (1-2): 236-243 [0004]
  • - Yong et al. (1998). Trends Neurosci 21(2): 75–80 [0004] - Yong et al. (1998). Trends Neurosci 21 (2): 75-80 [0004]
  • - Nakada et al. (2003). Front Biosci 8: e261–269 [0004] - Nakada et al. (2003). Front Biosci 8: e261-269 [0004]
  • - Galis et al. (1994). J Clin Invest 94(6): 2493–2503 [0005] - Galis et al. (1994). J Clin Invest 94 (6): 2493-2503 [0005]
  • - Lovdahl et al. (1999). Histol Histopathol 14(4): 1101–1112 [0005] - Lovdahl et al. (1999). Histol Histopathol 14 (4): 1101-1112 [0005]
  • - Longo et al. (2002). J Clin Invest 110(5): 625–632 [0005] - Longo et al. (2002). J Clin Invest 110 (5): 625-632 [0005]
  • - Danielsen et al. (1998). J Mol Cell Cardiol 30(7): 1431–42 [0005] Danielsen et al. (1998). J Mol Cell Cardiol 30 (7): 1431-42 [0005]
  • - Yamazaki et al. (2004). Eur J Heart Fail 6(1): 41–45 [0005] Yamazaki et al. (2004). Eur J Heart Fail 6 (1): 41-45 [0005]
  • - Carmeliet et al (2000). Nature 407(6801): 249–257 [0006] - Carmeliet et al (2000). Nature 407 (6801): 249-257 [0006]
  • - Malemud (2006). Front Biosci 11: 1696–1701 [0007] - Malemud (2006). Front Biosci 11: 1696-1701 [0007]
  • - Hangai (2002) [0008] - Hangai (2002) [0008]
  • - Xu (2001) [0008] - Xu (2001) [0008]
  • - Davis et al. (2000). Am J Pathol 156(5): 1489–1498 [0008] Davis et al. (2000). At J Pathol 156 (5): 1489-1498 [0008]
  • - Roth et al. (2006). Am J Pathol 168(5): 1576–1586 [0008] Roth et al. (2006). At J Pathol 168 (5): 1576-1586 [0008]
  • - Olsen et al. (1999). Collagens. Guidebook to the extracellular matrix, anchor, and adhesion Proteins (2nd edition). T. Kreis and R. Vale. New York, USA, Oxford University Press Inc.: 380–408 [0010] Olsen et al. (1999). Collagen. Guidebook to the extracellular matrix, anchor, and adhesion protein (2nd edition). T. Kreis and R. Vale. New York, U.S.A., Oxford University Press Inc .: 380-408 [0010]
  • - Somerville et al. (2003). Genome Biol 4(6): 216 [0012] - Somerville et al. (2003). Genomes Biol 4 (6): 216 [0012]
  • - Coussens, et al. (2002) Science 295(5564): 2387–92 [0013] - Coussens, et al. (2002) Science 295 (5564): 2387-92 [0013]
  • - Recommendations, 1974 [0016] - Recommendations, 1974 [0016]
  • - Biochemistry, 14(2), (1975) [0016] - Biochemistry, 14 (2), (1975) [0016]
  • - Noren et al. (2001), Methods, 23, 169–178 [0019] - Noren et al. (2001), Methods, 23, 169-178 [0019]
  • - Szardenings (2003) J Recept Signal Transduct Res. 2003; 23(4): 307–49 [0019] - Szardenings (2003) J Recept Signal Transduct Res. 2003; 23 (4): 307-49 [0019]
  • - Ruoslahti, E. (2002). Nat Rev Cancer 2(2): 83–90 [0019] - Ruoslahti, E. (2002). Nat Rev Cancer 2 (2): 83-90 [0019]
  • - Noren et al. (2001) [0020] - Noren et al. (2001) [0020]
  • - Szardenings (2003) [0020] Szardenings (2003) [0020]
  • - Ruoslahti, E. (2002) [0020] Ruoslahti, E. (2002) [0020]
  • - Chen et al. (2003) J Biol Chem, 278(48): 48348–48356 [0038] - Chen et al. (2003) J Biol Chem, 278 (48): 48348-48356 [0038]
  • - Grant et al. (1987) J Biol Chem, 262, 5886 [0049] - Grant et al. (1987) J Biol Chem, 262, 5886 [0049]
  • - Mallya et al. (1990) Biochemistry, 29, 10628 [0049] - Mallya et al. (1990) Biochemistry, 29, 10628 [0049]
  • - Moore (1957) [0051] Moore (1957) [0051]
  • - Biometrika 44 (3–4), 482–489 [0051] Biometrics 44 (3-4), 482-489 [0051]
  • - Moore (1957) [0055] Moore (1957) [0055]
  • - Moore (1957) [0058] Moore (1957) [0058]
  • - Moore (1957) [0059] Moore (1957) [0059]
  • - Drabkin (1935) J Biol Chem. 112: 51 [0060] - Drabkin (1935) J Biol Chem. 112: 51 [0060]
  • - Moore (1957) [0060] Moore (1957) [0060]

Claims (17)

Verwendung eines Oligopeptids gekennzeichnet durch die Aminosäure-Sequenz Thr Leu Thr Tyr Thr Trp Ser.Use of an oligopeptide labeled by the amino acid sequence Thr Leu Thr Tyr Thr Trp Ser. Verwendung eines Oligopeptids gekennzeichnet durch die Aminosäure-Sequenz Thr Leu Thr Tyr Thr Trp Ser Gly Gly Ser.Use of an oligopeptide characterized by the amino acid sequence Thr Leu Thr Tyr Thr Trp Ser Gly Gly Ser. Verwendung eines Oligopeptids gekennzeichnet durch die Aminosäure-Sequenz Thr Leu Thr Tyr Thr Trp Ser Gly Gly Ser Gly Gly Gly Lys Lys Cys, wobei das carboxyterminale Ende amidiert istUse of an oligopeptide characterized by the amino acid sequence Thr Leu Thr Tyr Thr Trp Ser Gly Gly Ser Gly Gly Gly Lys Lys Cys, where the carboxy-terminal end is amidated Verwendung eines Oligopeptids gekennzeichnet durch die Aminosäure-Sequenz Thr Leu Thr Tyr Thr Trp Ser Gly Gly Ser Gly Gly Gly Lys Lys, wobei das carboxyterminale Ende amidiert ist und ein Fluorochrom an die Seitenkette des Lysins gebunden istUse of an oligopeptide characterized by the amino acid sequence Thr Leu Thr Tyr Thr Trp Ser Gly Gly Ser Gly Gly Gly Lys Lys, with the carboxy terminal end amidated and a fluorochrome is attached to the side chain of lysine Verbindung eines Oligpeptids nach den Schutzansprüchen 1, 2 und 3 mit paramagnetischen Partikeln, welche aus einem paramagnetischen Isotop, wie beispielsweise 157Gd, 55Mn oder 56Fe, oder einer Mischung verschiedener Stoffe, welche in ihrer Gesamtheit eine paramagnetische Eigenschaft haben, bestehen.Compound of an oligopeptide according to claims 1, 2 and 3 with paramagnetic particles consisting of a paramagnetic isotope such as 157 Gd, 55 Mn or 56 Fe, or a mixture of various substances which in their entirety have a paramagnetic property. Verwendung von Peptiden beliebiger Länge, welche die Peptidsequenz nach Schutzanspruch 1 aminoterminal enthalten.Use of peptides of any length, which contain the peptide sequence according to protection claim 1 amino terminal. Verwendung von Peptiden beliebiger Länge, welche die Peptidsequenz nach Schutzanspruch 2 aminoterminal enthalten.Use of peptides of any length, which contain the peptide sequence according to protection claim 2 amino terminal. Kopplung eines Oligopeptids nach den Schutzansprüchen 1, 2, 2 und 4 an ein Peptid beliebiger Länge, welches auch ein Protein sein kannCoupling of an oligopeptide according to the claims 1, 2, 2 and 4 to a peptide of any length, which also can be a protein Die carboxyterminale Kopplung von Metallchelatoren an Oligopeptide, welche aminoterminal eine Aminosäuresequenz nach den Schutzansprüchen 1, 2 und 3 enthalten.The carboxy-terminal coupling of metal chelators to oligopeptides which aminoterminal an amino acid sequence according to the protection claims 1, 2 and 3 included. Bindung von radioaktiven Isotopen von Metallionen an gekoppelte Metallchelatoren nach dem Schutzanspruch 9.Binding of radioactive isotopes of metal ions to coupled metal chelators according to the protection claim 9. Bindung von anderen radioaktiven Isotopen als in Schutzanspruch 10 an Oligopeptide, welche aminoterminal eine Aminosäuresequenz nach den Schutzansprüchen 1, 2 und 3 enthalten oder ein Peptid nach Schutzanspruch 8 darstellen.Binding of other radioactive isotopes than in Protection claim 10 to oligopeptides which aminoterminal an amino acid sequence according to claims 1, 2 and 3 contain or a Represent peptide for protection claim 8. Verwendung von Peptid gekoppelte Verbindungen, welche die in den Schutzansprüchen 1, 2 und 3 genannten Peptidsequenzen aminoterminal enthalten oder eine Kopplung nach Schutzanspruch 8 darstellen und ein therapeutisches Agens tragen.Use of peptide-coupled compounds which the peptide sequences mentioned in claims 1, 2 and 3 contain amino terminal or a coupling according to protection claim 8 represent and carry a therapeutic agent. Verwendung einer pharmazeutischen Zubereitung, welche Stoffe nach den Schutzansprüchen 4–12.Use of a pharmaceutical preparation which Substances according to the protection claims 4-12. Verwendung einer pharmazeutischen Zubereitung nach Schutzanspruch 13 zur Diagnostik eines pathologischen Zustandes, welcher durch angiogene Vorgänge gekennzeichnet ist.Use of a pharmaceutical preparation according to Protection claim 13 for the diagnosis of a pathological condition, which is characterized by angiogenic processes. Verwendung einer pharmazeutischen Zubereitung nach Schutzanspruch 13 zur Therapie eines pathologischen Zustandes, welcher durch angiogene Vorgänge gekennzeichnet ist.Use of a pharmaceutical preparation according to Protection claim 13 for the treatment of a pathological condition, which characterized by angiogenic processes. Verwendung einer Verbindung nach den Schutzansprüchen 13, 14 und 15, wenn der Patient ein Säugetier ist.Use of a compound according to the claims 13, 14 and 15 when the patient is a mammal. Verwendung einer Verbindung nach den Schutzansprüchen 13, 14 und 15, wenn der Patient ein Mensch ist.Use of a compound according to the claims 13, 14 and 15 if the patient is a human.
DE202008012716U 2007-09-18 2008-09-17 Peptides that bind to human collagen IV modified by matrix metalloprotease 2 Expired - Lifetime DE202008012716U1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
DE202008012716U DE202008012716U1 (en) 2007-09-18 2008-09-17 Peptides that bind to human collagen IV modified by matrix metalloprotease 2

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
DE102007044437.2 2007-09-18
DE102007044437 2007-09-18
DE102008047781A DE102008047781B4 (en) 2007-09-18 2008-09-17 Peptides that bind to matrix metalloprotease 2 modified human collagen IV, pharmaceutical preparation and their use
DE202008012716U DE202008012716U1 (en) 2007-09-18 2008-09-17 Peptides that bind to human collagen IV modified by matrix metalloprotease 2

Publications (1)

Publication Number Publication Date
DE202008012716U1 true DE202008012716U1 (en) 2009-02-12

Family

ID=40348996

Family Applications (1)

Application Number Title Priority Date Filing Date
DE202008012716U Expired - Lifetime DE202008012716U1 (en) 2007-09-18 2008-09-17 Peptides that bind to human collagen IV modified by matrix metalloprotease 2

Country Status (1)

Country Link
DE (1) DE202008012716U1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017214681A1 (en) * 2016-06-16 2017-12-21 Baker Idi Heart And Diabetes Institute Holdings Limited Agents and methods for the diagnosis and treatment of diseases associated with extracellular matrix turnover

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004073649A2 (en) 2003-02-20 2004-09-02 New York University Clk-peptide and slk-peptide

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004073649A2 (en) 2003-02-20 2004-09-02 New York University Clk-peptide and slk-peptide

Non-Patent Citations (33)

* Cited by examiner, † Cited by third party
Title
Biochemistry, 14(2), (1975)
Biometrika 44 (3-4), 482-489
Carmeliet et al (2000). Nature 407(6801): 249-257
Chen et al. (2003) J Biol Chem, 278(48): 48348-48356
Coussens, et al. (2002) Science 295(5564): 2387-92
Danielsen et al. (1998). J Mol Cell Cardiol 30(7): 1431-42
Davis et al. (2000). Am J Pathol 156(5): 1489-1498
Drabkin (1935) J Biol Chem. 112: 51
Galis et al. (1994). J Clin Invest 94(6): 2493-2503
Grant et al. (1987) J Biol Chem, 262, 5886
Hangai, M., et al. (2002) Am J Pathol 161(4): 1429-1437
Leppert et al. (2000). Clin Infect Dis 31(1): 80-84
Longo et al. (2002). J Clin Invest 110(5): 625-632
Lovdahl et al. (1999). Histol Histopathol 14(4): 1101-1112
Malemud (2006). Front Biosci 11: 1696-1701
Mallya et al. (1990) Biochemistry, 29, 10628
Milkiewicz et al. (2006) Int J Biochem Cell Biol 38(3): 333-357
Moore (1957)
Nakada et al. (2003). Front Biosci 8: e261-269
Noren et al. (2001), Methods, 23, 169-178
Olsen et al. (1999). Collagens. Guidebook to the extracellular matrix, anchor, and adhesion Proteins (2nd edition). T. Kreis and R. Vale. New York, USA, Oxford University Press Inc.: 380-408
Ozenci et al. (2000) J Neuroimmunol 108(1-2): 236-243
Recommendations, 1974
Roth et al. (2006). Am J Pathol 168(5): 1576-1586
Ruoslahti, E. (2002). Nat Rev Cancer 2(2): 83-90
Somerville et al. (2003). Genome Biol 4(6): 216
Szardenings (2003) J Recept Signal Transduct Res. 2003; 23(4): 307-49
Toy et al. (2005). J Wound Care 14(1): 202
Xu et al. (2001). J Cell Biol 154(5): 1069-1079
Xue et al. (2006), Expert Opin Ther Targets 10(1): 143-155
Yamazaki et al. (2004). Eur J Heart Fail 6(1): 41-45
Yong et al. (1998). Trends Neurosci 21(2): 75-80
Yong et al. (2001). Nat Rev Neurosci 2(7): 502-511

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017214681A1 (en) * 2016-06-16 2017-12-21 Baker Idi Heart And Diabetes Institute Holdings Limited Agents and methods for the diagnosis and treatment of diseases associated with extracellular matrix turnover
CN109922817A (en) * 2016-06-16 2019-06-21 贝克Idi心脏和糖尿病研究院控股有限公司 The agent and method of relevant disease are had enough to meet the need to extracellular matrix for diagnosing and treating

Similar Documents

Publication Publication Date Title
DE69518083T2 (en) COMPLEX IMAGERS FOR RADIONUCLIDES DERIVED FROM PEPTIDES
DE202014011593U1 (en) Labeled inhibitors of prostate-specific membrane antigen (PSMA), their use as imaging agents and active pharmaceutical ingredients for the treatment of prostate cancer
CN108473541A (en) Pass through the peptide compounds and peptide conjugate of receptor-mediated regimen chemotherapy cancer
EP2167139A2 (en) Activatable diagnostic and therapeutic compound
US20090226369A1 (en) STQ Peptides
CA2515033C (en) Clk-peptide and slk-peptide
Chen et al. Ultrasmall PtAu2 nanoclusters activate endogenous anti-inflammatory and anti-oxidative systems to prevent inflammatory osteolysis
DE102012108598A1 (en) New D3-D enantiomeric peptides derived from D3 and their use
DE102008047781B4 (en) Peptides that bind to matrix metalloprotease 2 modified human collagen IV, pharmaceutical preparation and their use
US9211349B2 (en) Molecular probes for multimodality imaging of anionic membrane surfaces
DE69230287T2 (en) COMPOUNDS AND PHARMACEUTICAL COMPOSITIONS FOR DETECTING AND LOCALIZING TISSUE WITH NEUROKININ-1 RECEPTORS
DE202008012716U1 (en) Peptides that bind to human collagen IV modified by matrix metalloprotease 2
KR20080000554A (en) Chemically modified peptide analogs
DE3851226T2 (en) GROWTH FACTOR RECEPTOR.
US10174097B2 (en) Specific A-beta species-binding peptides for the therapy and/or diagnosis of Alzheimer&#39;s dementia
DE60301891T2 (en) Peptide for the diagnosis and therapy of tumors
CN105111287B (en) A kind of polypeptide and application thereof for inside and outside apoptosis image probe
TWI246425B (en) Pharmaceutical compositions for imaging and treating thrombi
DE112011105133T5 (en) Octapeptide for the manufacture of radiopharmaceuticals, the drugs produced therefrom and diagnostic methods of somatostatin receptor-expressing tumors
WO2023161211A1 (en) Peptidic inhibitors of amyloid self- and cross-assembly
DE102012108599A1 (en) New peptide containing amino acid sequences and their homologues and polymers and their homologues, useful to inhibit fibril formation of amyloid-beta peptides and to bind aggregated amyloid beta peptides to treat Alzheimers disease
Beloborodov ЕА et al. Development and Synthesis of Bombesin-Based Radiopharmaceutical Precursors Modified with Knottin
DE102010026059A1 (en) 11C-labeled peptide for the detection of a diseased tissue that expresses a chemokine receptor
DE102010026065A1 (en) 11C-labeled peptide for detection of a tumor expressing a bombesin receptor

Legal Events

Date Code Title Description
R207 Utility model specification

Effective date: 20090319

R150 Utility model maintained after payment of first maintenance fee after three years
R150 Utility model maintained after payment of first maintenance fee after three years

Effective date: 20111130

R151 Utility model maintained after payment of second maintenance fee after six years
R151 Utility model maintained after payment of second maintenance fee after six years

Effective date: 20141007

R152 Utility model maintained after payment of third maintenance fee after eight years
R071 Expiry of right