DE19851413A1 - Selecting mutants of a transactivator, useful for regulating gene expression in eukaryotes, by expressing a reporter gene under the control of a mutant transactivator - Google Patents

Selecting mutants of a transactivator, useful for regulating gene expression in eukaryotes, by expressing a reporter gene under the control of a mutant transactivator

Info

Publication number
DE19851413A1
DE19851413A1 DE1998151413 DE19851413A DE19851413A1 DE 19851413 A1 DE19851413 A1 DE 19851413A1 DE 1998151413 DE1998151413 DE 1998151413 DE 19851413 A DE19851413 A DE 19851413A DE 19851413 A1 DE19851413 A1 DE 19851413A1
Authority
DE
Germany
Prior art keywords
nucleic acid
acid molecule
gene
tta
rtta
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
DE1998151413
Other languages
German (de)
Other versions
DE19851413C2 (en
Inventor
Wolfgang Hillen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
TET SYSTEMS GMBH & CO. KG, DE
Original Assignee
Wolfgang Hillen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wolfgang Hillen filed Critical Wolfgang Hillen
Priority to DE1998151413 priority Critical patent/DE19851413C2/en
Publication of DE19851413A1 publication Critical patent/DE19851413A1/en
Priority to US10/108,524 priority patent/US20050037335A1/en
Application granted granted Critical
Publication of DE19851413C2 publication Critical patent/DE19851413C2/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1086—Preparation or screening of expression libraries, e.g. reporter assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline

Abstract

Selecting mutant forms (A) of a transactivator comprises; (i) producing a nucleic acid molecule (I) comprising a mutant transactivator gene (II) and a reporter gene (III) which, depending on the concentration of a low molecular weight effector, can be expressed in a eukaryote; and (ii) transforming (I) into eukaryotes. An Independent claim is also included for (I).

Description

Die Erfindung betrifft ein Verfahren zur Auswahl von Mutanten von Transaktivatoren. Sie betrifft ferner ein Nukleinsäuremo­ lekül und dessen Verwendung.The invention relates to a method for selecting mutants of transactivators. It also relates to a nucleic acid mo lekül and its use.

Es ist allgemein bekannt, dass der TN10-codierte Tet- Repressor TetR die Expression von Tetrazyklin-Resistenzgenen in Bakterien, wie E.coli, in Abhängigkeit der Tetrazyklinkon­ zentration reguliert: In Abwesenheit von Tetrazyklin Tc bin­ det TetR an zwei Operatorsequenzen tetO. TetR reprimiert im gebundenen Zustand die Expression des Tetrazyklin- Resistenzgens. Bei Anwesenheit von Tc wird dieses an TetR ge­ bunden, wodurch die Bindung von TetR an tetO gelöst wird. Es kommt dann zur Expression des Tetrazyklin-Resistenzgens.It is well known that the TN10 encoded Tet- Repressor TetR the expression of tetracycline resistance genes in bacteria, such as E.coli, depending on the tetracycline cone concentration regulated: In the absence of tetracycline Tc bin det TetR on two operator sequences tetO. TetR repressed in bound state the expression of the tetracycline Resistance gene. If Tc is present, it is sent to TetR bound, whereby the binding of TetR to tetO is released. It the tetracycline resistance gene is then expressed.

Zum Einsatz von TetR zum Regulieren der Expression von Ziel­ genen in Säugerzellen hat sich ein Konstrukt aus TetR und der viralen Transkriptionsaktivatordomäne des Virusproteins 16 VP16 aus Herpes simplex bewährt. Dieses Konstrukt wird als hybrider Transaktivator tTA bezeichnet. tTA hat die Eigen­ schaft bei Abwesenheit von Tc die Expression von Genen zu stimulieren, die stromabwärts eines die tetO enthaltenden Mi­ nimalpromotors sich befinden. Bei Anwesenheit von Tc wird da­ gegen die Expression blockiert (Gossen, M. & Bujard, H. 1992: Tight control of gene expression in mammalian cells by tetracycline responsive promotors, Proc. Natl. Acad. Sci. USA 89, 5547-5551).Use TetR to regulate target expression genes in mammalian cells a construct from TetR and the viral transcription activator domain of virus protein 16 VP16 from herpes simplex proven. This construct is called hybrid transactivator called tTA. tTA has its own expression of genes in the absence of Tc stimulate the downstream of a Mi containing the tetO nimalpromotors. In the presence of Tc there will be blocked against expression (Gossen, M. & Bujard, H. 1992: Tight control of gene expression in mammalian cells by tetracycline responsive promotors, Proc. Natl. Acad. Sci. United States 89, 5547-5551).

Ein weiteres solches Konstrukt ist der reverse tTA ( = rtTk). Er hat die umgekehrte Eigenschaft: Bei Abwesenheit von Tc wird die Expression blockiert, während bei Anwesenheit von Tc die Expression stimuliert wird (Gossen, M., Freudenlieb, S., Bender, G., Müller, G., Hillen, W. & Bujard, H., 1995: Transcriptional activation by tetracyclines in mammalian cells; Science 268, 1766-1769.Another such construct is the reverse tTA (= rtTk). It has the opposite property: in the absence of Tc expression is blocked while in the presence of Tc  expression is stimulated (Gossen, M., Freudenlieb, S., Bender, G., Müller, G., Hillen, W. & Bujard, H., 1995: Transcriptional activation by tetracyclines in mammalian cells; Science 268, 1766-1769.

Zum Auffinden von für eine vorgegebene Anwendung geeigneten neuen Mutanten von tTA oder rtTA werden in E.coli TetR- Varianten erzeugt. Aus den TetR-Varianten werden anschließend die korrespondierenden tTA bzw. rtTA hergestellt. Die Eigen­ schaften der so hergestellten tTA bzw. rtTA werden dann in Eukaryoten geprüft.To find suitable ones for a given application new mutants of tTA or rtTA are identified in E.coli TetR- Variants created. The TetR variants then become the corresponding tTA and rtTA are produced. The own The tTA or rtTA produced in this way are then in Eukaryotes tested.

Das bekannte Verfahren ist nachteilig, weil die unter Verwen­ dung von Prokaryoten hergestellten tTA bzw. rtTA nicht ohne weiteres zum Einsatz in Eukaryoten geeignet sind: z. B. wirkt Tc schon in geringen Konzentrationen toxisch auf Prokaryoten, nicht jedoch Eukaryoten.The known method is disadvantageous because the use tTA or rtTA produced by prokaryotes not without other suitable for use in eukaryotes: z. B. acts Tc toxic to prokaryotes even in low concentrations, but not eukaryotes.

Aufgabe der Erfindung ist es, die Nachteile nach dem Stand der Technik zu beseitigen. Es soll insbesondere ein möglichst einfaches und effizientes Verfahren zur Auswahl von Mutanten von Transaktivatoren angegeben werden. Weiteres Ziel der Er­ findung ist es, ein dafür geeignetes Nukleinsäuremolekül und eine Verwendung desselben anzugeben.The object of the invention is to overcome the disadvantages of the prior art of technology to eliminate. In particular, it should be as possible simple and efficient process for selecting mutants be specified by transactivators. Another goal of the Er is to find a suitable nucleic acid molecule and to indicate use of the same.

Diese Aufgabe wird durch die Merkmale der Ansprüche 1, 17 und 30 gelöst. Zweckmäßige Ausgestaltungen ergeben sich aus den Merkmalen der Ansprüche 2-16, 18-29 und 31-36.This object is achieved by the features of claims 1, 17 and 30 solved. Appropriate configurations result from the Features of claims 2-16, 18-29 and 31-36.

Nach Maßgabe der Erfindung ist ein Verfahren zur Auswahl von Mutanten von Transaktivatoren mit folgenden Schritten vorge­ sehen:
According to the invention, a method for selecting mutants of transactivators is provided with the following steps:

  • a) Herstellung eines Nukleinsäuremoleküls, das
    • 1. ein mutiertes Transaktivator-Gen sowie
    • 2. ein Indikator-Gen aufweist, das in Abhängigkeit der Konzentration eines niedermolekularen Effektors in einem Eukaryoten exprimierbar ist
    a) Preparation of a nucleic acid molecule, the
    • 1. a mutated transactivator gene as well
    • 2. has an indicator gene which can be expressed in a eukaryote depending on the concentration of a low molecular weight effector
  • b) undFederation
  • c) Transformation des Nukleinsäuremoleküls in einen Eur­ karyoten.c) transforming the nucleic acid molecule into a Eur caryotes.

Das ermöglicht auf einfache und effiziente Weise die eigen­ schaftsspezifische Auswahl von Mutanten von Transaktivatoren.This enables the own in a simple and efficient way Company-specific selection of mutants of transactivators.

Das Transaktivator-Gen kann ein tTA- oder rtTA-Gen sein. Das Nukleinsäuremolekül ist vorteilhafterweise ein Plasmid, das vom Plasmid pCM190 abgeleitet sein kann. Das Indikator-Gen kann mehrere tet-Operatoren aufweisen. Als besonders vorteil­ haft es sich erwiesen, dass das Indikator-Gen das grün fluo­ reszierende Protein GFP aus Aequorea victoria codiert. Das GFP-Gen wird zweckmäßigerweise in die singuläre BamHI- Schnittstelle von pCM190 ligiert. Ein solches Plasmid erlaubt eine besonders einfache und effiziente Verfahrensführung.The transactivator gene can be a tTA or rtTA gene. The The nucleic acid molecule is advantageously a plasmid which may be derived from plasmid pCM190. The indicator gene can have multiple tet operators. As a special advantage It has been shown that the indicator gene is the green fluo Resected protein GFP encoded from Aequorea victoria. The The GFP gene is conveniently inserted into the singular BamHI Interface of pCM190 ligated. Such a plasmid allows a particularly simple and efficient procedure.

Das Nukleinsäuremolekül kann außerdem einen Selektionsmarker aufweisen, wobei als Selektionsmarker das URA3-Gen verwendet werden kann. Das erleichtert die Selektion der entsprechend beladenen eukaryotischen Zellen.The nucleic acid molecule can also be a selection marker have, the URA3 gene being used as the selection marker can be. This facilitates the selection of the corresponding loaded eukaryotic cells.

Nach einem weiteren Ausgestaltungsmerkmal kann das Nuklein­ säuremolekül eine 2µ-Sequenz aufweisen. Das gewährleistet ei­ ne hohe Anzahl von Kopien des Nukleinsäuremoleküls im Eu­ karyoten. Ferner kann eine multiple Klonungsstelle vorgesehen sein.According to another design feature, the nucleus acid molecule have a 2µ sequence. This ensures  ne high number of copies of the nucleic acid molecule in the Eu caryotes. A multiple cloning site can also be provided his.

Die Verwendung von GFP ermöglicht eine qualitative und quan­ titative Auswertung auf optischem Weg durch Analyse der Fluo­ reszenz. Eine solche Auswertung ist besonders schnell und einfach durchführbar.The use of GFP enables a qualitative and quan titative evaluation by optical means by analysis of the fluo resence. Such an evaluation is particularly quick and easy to do.

Zur Vereinfachung der Herstellung des Nukleinsäuremoleküls hat es sich als zweckmäßig erwiesen, beim Schritt lit. a den tetR oder rtetR-Anteil eines konstitutiv exprimierten tTA oder rtTA gegen mutierte tetR bzw. rtetR zu ersetzen.To simplify the production of the nucleic acid molecule it has proven to be useful to use step lit. a den tetR or rtetR portion of a constitutively expressed tTA or to replace rtTA with mutated tetR or rtetR.

Der mutierte tTA oder rtTA kann durch Amplifizierung des tetR-Gens, eines davon abgeleiteten Fusions-Gens oder einer Mutanten von TetR mittels Polymerase-Kettenreaktion (PCR) un­ ter Zugabe von Manganchlorid hergestellt werden. Dadurch kann schnell und einfach eine große Anzahl an Mutanten bereitge­ stellt werden.The mutated tTA or rtTA can be amplified by tetR gene, a fusion gene derived therefrom or one Mutants of TetR using polymerase chain reaction (PCR) and ter addition of manganese chloride. This can ready a large number of mutants quickly and easily be put.

Die konstitutiv exprimierte tTA oder rtTA kann ein VP16 auf­ weisendes Konstrukt sein. Der Effektor ist zweckmäßigerweise Tetrazyklin oder ein Derivat davon.The constitutively expressed tTA or rtTA can have a VP16 be a pointing construct. The effector is convenient Tetracycline or a derivative thereof.

Als besonders vorteilhaft hat es sich erwiesen, dass der Eu­ karyot Hefe, vorzugsweise Saccaromyces cerevisiae, ist. Ein solcher Eukaryot ist unproblematisch zu handhaben und billig verfügbar.It has proven to be particularly advantageous that the Eu karyot yeast, preferably Saccaromyces cerevisiae. On such eukaryote is easy to handle and inexpensive available.

Nach weiterer Maßgabe der Erfindung ist ein Nukleinsäuremole­ kül zur Durchführung des erfindungsgemäßen Verfahrens vorge­ sehen, das ein mutiertes Transaktivator-Gen sowie ein Indika­ tor-Gen aufweist, das in Abhängigkeit der Konzentration eines Effektors in einem Eukaryoten exprimierbar ist. - Ein solches Nukleinsäuremolekül ermöglicht eine einfache und effiziente Auswahl von in Eukaryoten benutzbaren Mutanten von tTA bzw. rtTA.Another requirement of the invention is a nucleic acid mole cool for performing the method according to the invention see that a mutated transactivator gene as well as an indica  Tor gene which, depending on the concentration of a Effector is expressible in a eukaryote. - Such one Nucleic acid molecule enables simple and efficient Selection of mutants of tTA or usable in eukaryotes rtTA.

Das Transaktivator-Gen kann ein tTA- oder rtTA-Gen sein. Das Nukleinsäuremolekül ist zweckmäßigerweise ein Plasmid, wobei das Plasmid von pCM190 abgeleitet sein kann.The transactivator gene can be a tTA or rtTA gene. The The nucleic acid molecule is expediently a plasmid, where the plasmid can be derived from pCM190.

Das Indikator-Gen weist mehrere tet-Operatoren auf und/oder enthält das GFP-Gen aus Aeuqorea victoria. GFP ermöglicht ei­ ne optische Auswahl der geeigneten Mutanten. Eine solche Aus­ wahl ist einfach und schnell durchzuführen.The indicator gene has several tet operators and / or contains the GFP gene from Aeuqorea victoria. GFP enables egg ne optical selection of the suitable mutants. Such an out choice is quick and easy.

Das GFP-Gen kann in die singuläre BamHI-Schnittstelle von pCM190 ligiert sein. Nach einem weiteren Ausgestaltungsmerk­ mal ist ein Selektionsmarker vorgesehen, wobei der Selekti­ onsmarker das URA3-Gen sein kann. Eine zweckmäßigerweise vor­ gesehene 2µ-Sequenz gewährleistet eine hohe Kopienzahl des Plasmids in einem geeigneten Eukaryoten. Bei dem Eukaryoten handelt es sich vorteilhafterweise um Hefe, vorzugsweise um Saccaromyces cerevisiae.The GFP gene can be inserted into the unique BamHI site of pCM190 ligated. After another design feature sometimes a selection marker is provided, the Selekti onsmarker the URA3 gene can be. An expediently before seen 2µ sequence ensures a high number of copies of the Plasmids in a suitable eukaryote. With the eukaryote it is advantageously yeast, preferably Saccaromyces cerevisiae.

Nach weiterer Maßgabe der Erfindung ist die Verwendung eines Nukleinsäuremoleküls mit einem Indikator-Gen, das für ein Protein mit fluoreszenten Eigenschaften kodiert, in Hefe zum Prüfen der Eigenschaften mutierter Transaktivatoren vorgese­ hen. - Das ermöglicht eine besonders effiziente und kosten­ günstige Auswahl mutierter Transaktivatoren.According to another aspect of the invention, the use of a Nucleic acid molecule with an indicator gene that is responsible for a Protein encoded with fluorescent properties, in yeast for Checking the properties of mutated transactivators hen. - This enables a particularly efficient and cost inexpensive selection of mutated transactivators.

Das Indikator-Gen ist zweckmäßigerweise das GFP-Gen aus Aequ­ orea victoria. Bei den Nukleinsäuremolekül handelt es sich geeigneterweise um ein Plasmid, das von pCM190 abgeleitet sein kann.The indicator gene is expediently the GFP gene from Aequ orea victoria. The nucleic acid molecule is  suitably a plasmid derived from pCM190 can be.

Das Plasmid kann ein mutiertes tTA- oder rtTA-Gen aufweisen. Als Hefe wird zweckmäßigerweise Saccaromyces cerevisiae ver­ wendet.The plasmid can have a mutated tTA or rtTA gene. Saccaromyces cerevisiae is advantageously used as yeast turns.

Nachfolgend wird die Erfindung anhand mehrerer Ausführungs­ beispiele erläutert. Dabei zeigen:The invention is based on several embodiments examples explained. Show:

Fig. 1 eine Karte des Plasmids pCM190-GFP+, Fig. 1 is a map of the plasmid pCM190-GFP +,

Fig. 2 die Fluoreszenzintensität verschiedener Transakti­ vatoren in Saccaromyces cerevisiae und Fig. 2 shows the fluorescence intensity of various Transakti vatoren in Saccaromyces cerevisiae and

Fig. 3 die Luciferaseaktivität verschiedener Transaktiva­ toren in HeLa-Zellen. Fig. 3 shows the luciferase activity of various Transaktiva gates in HeLa cells.

Fig. 1 zeigt beispielhaft ein erfindungsgemäßes Nukleinsäure­ molekül, nämlich den Vektor pCM190-GFP+. Der Vektor enthält eine konstitutiv exprimierte TetR-VP16-Fusion als Transakti­ vator tTA. Stromabwärts schliesst sich daran ein durch Tc re­ gulierbarer Promotor, z. B. ein CMV Promotor an. Der hier ge­ wählte Promotor umfasst 7 tet-Operatoren tetO7, die stromauf­ wärts der CYC TATA-Region der Bäckerhefe angeordnet sind. In der Nähe der CYC TATA-Region ist das grün fluoreszierende Protein GFP aus Aequorea victoria über glatte Enden in die singuläre BamHI-Schnittstelle von pCM190 ligiert. Der Vektor enthält ferner ein URA3-Gen sowie eine 2µ-Sequenz. Fig. 1 shows an example of an inventive nucleic acid molecule, namely the vector pCM190-GFP +. The vector contains a constitutively expressed TetR-VP16 fusion as a transaction tTA. This is followed downstream by a promoter which can be regulated by Tc, e.g. B. a CMV promoter. The promoter chosen here comprises 7 tet operators tetO7, which are arranged upstream of the CYC TATA region of the baker's yeast. In the vicinity of the CYC TATA region, the green fluorescent protein GFP from Aequorea victoria is ligated into the unique BamHI site of pCM190 via blunt ends. The vector also contains a URA3 gene and a 2µ sequence.

Die Funktion der vorgenannten Bestandteile des Vektors ist folgende:
Aus dem tTA bzw. rtTA kann über geeignete Restriktions­ schnittstellen der tet-Anteil entfernt und durch eine korre­ spondierende mutagenisierte tetR-Sequenz ersetzt werden.The function of the aforementioned components of the vector is as follows:
The tet portion can be removed from the tTA or rtTA via suitable restriction interfaces and replaced by a corresponding mutagenized tetR sequence.

Die Herstellung mutagenisierter TetR kann vorteilhafterweise mittels PCR erfolgen. Dazu wird TetR mittels der Taq-DNA- Polymerase amplifiziert. Ein Zusatz von z. B. Manganchlorid sowie die Einstellung eines Ungleichgewichts der Nukleotide bewirkt eine hohe Fehlerrate dieser Polymerase: Etwa 90% der gebildeten PCR-Produkte weisen einzelne oder mehrere Punktmu­ tationen auf.The production of mutagenized TetR can advantageously by means of PCR. For this, TetR is using the Taq DNA Polymerase amplified. An addition of e.g. B. Manganese Chloride and the establishment of an imbalance in the nucleotides causes a high error rate of this polymerase: about 90% of the formed PCR products have single or multiple Punktmu tations.

Das GFP-Gen dient als Indikator- bzw. Reportergen. Es eignet sich insbesondere als Reporter in der Bäckerhefe. Das URA3- Gen dient als Selektionsmarker in der Bäckerhefe. Die 2µ- Sequenz gewährleistet eine besonders hohe Kopienzahl des Vek­ tors in den Bäckerhefe-Zellen.The GFP gene serves as an indicator or reporter gene. It is suitable particularly as a reporter in the baker's yeast. The URA3 Gen serves as a selection marker in baker's yeast. The 2µ Sequence ensures a particularly high number of copies of the Vek tors in the baker's yeast cells.

Zur Durchführung des erfindungsgemäßen Auswahl- bzw. Scree­ ningverfahrens wird ein zufällig generiertes tetR-Mutanten enthaltendes pCM190-GFP+ Gemisch mittels Transformation in Saccaromyces cerevisiae eingebracht. Anschließend wird mit­ tels Uracil-Prototropie der Transformanden auf die Anwesen­ heit des Vektors selektioniert.To carry out the selection or scree according to the invention ning process is a randomly generated tetR mutant containing pCM190-GFP + mixture by transformation in Saccaromyces cerevisiae introduced. Then with Uracil prototropy of the transformants on the property selected of the vector.

Auf geeigneten Agarplatten kann nun die Induktion von TetR- Mutanten unter verschiedenen Bedingungen geprüft werden. Es kann z. B. der die Induktion von TetR-Mutanten bewirkende Ef­ fektor variiert werden. Als Effektoren kommen z. B. Tc- Derivate oder andere chemische Verbindungen in Frage. Es ist gleichfalls möglich, die Konstruktion neuer rtTAs zu prüfen. Selbstverständlich ist es auch möglich, neue effiziente TetR/Aktivator- bzw. TetR/Repressor-Funktionen zu identifi­ zieren. Ferner ist es möglich, Konstrukte zu testen, bei de­ nen ganze Genbanken anstelle von VP16 kloniert sind.The induction of TetR- Mutants are tested under different conditions. It can e.g. B. the Ef inducing TetR mutants can be varied. As effectors come e.g. B. Tc- Derivatives or other chemical compounds in question. It is it is also possible to check the construction of new rtTAs. Of course, it is also possible to find new efficient ones Identify TetR / activator or TetR / repressor functions  adorn. It is also possible to test constructs where de whole gene banks are cloned instead of VP16.

Die Fig. 2 und Fig. 3 zeigen die Eigenschaften von unter Ver­ wendung des erfindungsgemäßen Verfahrens aufgefundenen Mutan­ ten. Dabei wurde wie folgt vorgegangen:
Der TetR-Anteil von tTA wurde mit dem Vektor pCM190 als Ma­ trize und zwei entsprechenden Oligonukleotiden (5'- GACCGATCCAGCCTCCGCGG und 5'-CGTGTGTCCCGCGGGGAGAA) nach der Methode von Leung et al. (Leung, D. W., Chen, E. & Goeddel, D. V. 1989: A method for randon mutagenesis of a defined DNA segment using a modified polymerase chain reaction, Technique 1, 11-15) amplifiziert. Die enthaltenen, mutagenisierten PCR-Fragmente (= mutagenisierte TetR-Gene) und PCM190-GFP+ wurden mit Xbal und BsiWI verdaut und aufgereinigt. Anschlie­ ßend wurden die PCR-Fragmente in den geschnittenen Vektor li­ giert und in E.coli DH5α transformiert. Jeweils mehrere 1000 E.coli-Klone wurde zusammen kultiviert und deren Plasmid-DNA präpariert. Diese Plasmidpools wurden sodann mittels der LiAc-Methode in Saccaromyces cerevisiae transformiert (Ito et al., H., Fukada, Y., Murata, K. & Kimura 1983: Transformation of intact yeast cells treated with alkali cations, J. Bact. 153, 163-168). . Figs. 2 and 3 show by Ver application of the method, discovered the properties of Mutan th This procedure was as follows.:
The TetR portion of tTA was with the vector pCM190 as template and two corresponding oligonucleotides (5'-GACCGATCCAGCCTCCGCGG and 5'-CGTGTGTCCCGCGGGGAGAA) according to the method of Leung et al. (Leung, DW, Chen, E. & Goeddel, DV 1989: A method for randon mutagenesis of a defined DNA segment using a modified polymerase chain reaction, Technique 1, 11-15). The contained mutagenized PCR fragments (= mutagenized TetR genes) and PCM190-GFP + were digested and purified with Xbal and BsiWI. The PCR fragments were then ligated into the cut vector and transformed into E.coli DH5α. Several 1000 E. coli clones were cultivated together and their plasmid DNA was prepared. These plasmid pools were then transformed into Saccaromyces cerevisiae using the LiAc method (Ito et al., H., Fukada, Y., Murata, K. & Kimura 1983: Transformation of intact yeast cells treated with alkali cations, J. Bact. 153 , 163-168).

Die erhaltenen Uracil-prototrophen Hefeklone wurden auf Mini­ malmedium-Platten ohne Uracil, aber mit jeweils 10 µg/ml Tetrazyklin bzw. Doxyzyklin oder ohne Tc-Derivat replikaplat­ tiert und nach zwei bis drei Tagen Wachstum bei 30°C unter langweiligem UV-Licht kontrolliert. Dabei konnten Mutanten identifiziert werden, die einen reversen Phänotyp aufweisen, d. h. sie induzieren im Gegensatz zu tTA in Anwesenheit von Tetrazyklin-Derivaten. The uracil-prototrophic yeast clones obtained were mini malmedium plates without uracil, but each with 10 µg / ml Tetracycline or doxycycline or replicaplat without Tc derivative animals and after two to three days of growth at 30 ° C below controlled boring UV light. Mutants could identified that have a reverse phenotype, d. H. in contrast to tTA, they induce in the presence of Tetracycline derivatives.  

Die Mutanten rtTA-34R und -44R wurden zusammen mit einem GFP­ freien Kontrollstamm, dem tTA- und dem rtTA-enthaltenden Stamm über Nacht in Minimalmedium kultiviert. Die Zellen wur­ den geerntet und je eine OD600 wurde mit PBS gewaschen und in 2 ml PBS resuspendiert. Die Lichtemission der Zellen bei 512 mm wurde im Fluorimeter bei einer Anregungswellenlänge von 490 nm vermessen. Dabei erwies sich die Basalaktivität der Mutante rtTA-34R in Hefe als deutlich erniedrigt im Vergleich zu dem bisher bekannten rtTA (Belli et al. 1998: An activa­ tor/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast, Nucleic Acids Res. 26, 942-947). Wie aus Fig. 1 ersichtlich ist, liegt die Aktivierung etwa im Bereich des rtTA bzw. des rTA. Es werden hierbei In­ duktionsfaktoren von 100-300 gemessen. Also ist rtTA-34R für den Einsatz zur regulierbaren Genexpression in Hefe wesent­ lich besser geeignet als rtTA, dessen Induktionsraten maximal 40-fach sind.The mutants rtTA-34R and -44R were cultured overnight in minimal medium together with a GFP-free control strain, the tTA- and the rtTA-containing strain. The cells were harvested and one OD600 each was washed with PBS and resuspended in 2 ml PBS. The light emission of the cells at 512 mm was measured in the fluorimeter at an excitation wavelength of 490 nm. The basal activity of the mutant rtTA-34R in yeast was found to be significantly reduced in comparison with the previously known rtTA (Belli et al. 1998: An activator / repressor dual system allows tight tetracycline-regulated gene expression in budding yeast, Nucleic Acids Res 26, 942-947). As can be seen from FIG. 1, the activation lies approximately in the region of the rtTA or the rTA. Induction factors of 100-300 are measured here. RtTA-34R is therefore much more suitable for use in regulating gene expression in yeast than rtTA, whose induction rates are a maximum of 40 times.

Nach Isolation der entsprechenden Vektoren aus der Bäckerhefe wurden die mutagenisierten tTA-Bereiche sequenziert, um die für den reversen Phänotyp verantwortlichen Aminosäureaus­ tausch zu bestimmen. Anschließend wurden sowohl rtTA-34R als auch -44R in den Vektor pUHD15-1 (Gossen & Bujard, 1992: Tight control of gene expression in mammalian cells by tetracycline-responsive promoters, Proc., Natl., Acad. Sci. USA 89, 5547-5551) umkloniert, wobei die mutagenisierten Transaktivatoren tTA ersetzten. Durch transiente Transfektio­ nen zusammen mit dem Luciferase-kodierenden Vektor pUHC13-3 wurden die Aktivitäten der Konstrukte in HeLa-Zellen über­ prüft. After isolation of the corresponding vectors from the baker's yeast the mutagenized tTA regions were sequenced to obtain the amino acid responsible for the reverse phenotype to determine exchange. Then both rtTA-34R and also -44R in the vector pUHD15-1 (Gossen & Bujard, 1992: Tight control of gene expression in mammalian cells by tetracycline-responsive promoters, Proc., Natl., Acad. Sci. USA 89, 5547-5551), the mutagenized Replace transactivators tTA. Through transient transfection together with the vector pUHC13-3 encoding luciferase were the activities of the constructs in HeLa cells checks.  

Aus Fig. 3 ist ersichtlich, dass rtTA-34R auch in Humanzellen eine mehrfach höhere Induktion des Reportergens bewirkt als bisher verwendete rtTA. Dieser Effekt kommt zum einen wie in Saccaromyces cerevisiae durch erniedrigtes Basalniveau zu­ stande. Zum anderen dadurch, dass die Aktivierung der Expres­ sion deutlich erhöht ist.From Fig. 3 it can be seen that rtTA-34R also induces a higher induction of the reporter gene in human cells than previously used rtTA. On the one hand, this effect comes about, as in Saccaromyces cerevisiae, through a lower basal level. On the other hand, because the activation of the expression is significantly increased.

Mit dem erfindungsgemäßen Verfahren konnte u. a. die TetR- Mutante rtTA-34R identifiziert werden, welche die Transkrip­ tion von Reportergenen nach Gabe von Doxyzyklin aktiviert und die Anwendungsmöglichkeiten durch erhöhte Induktionsraten in Hefen und Säugerzellen verbessert. Die in Hefe mittels GFP bestimmten Aktivitäten von tTA bzw. rtTA und den jeweiligen Mutanten können auf Humanzellen übertragen werden.With the method according to the invention u. a. the TetR Mutant rtTA-34R can be identified which is the transcript activation of reporter genes after administration of doxycycline and the application possibilities through increased induction rates in Yeast and mammalian cells improved. The in yeast using GFP certain activities of tTA or rtTA and the respective Mutants can be transferred to human cells.

Das erfindungsgemäße Screening-Verfahren ist besonders geeig­ net zum Auffinden von tTA-Mutanten, die unterschiedlich sen­ sitiv auf die verschiedenen Induktoren reagieren: Es wurden elf Mutanten des gewünschten Phänotyps identifiziert. Durch die Sequenzierung dieser tTA-Varianten konnte festgestellt werden, dass alle durch Aminosäureaustausche betroffenen Po­ sitionen entweder in der Tetrazyklin-Bindetasche oder in In­ duktionsbereichen lagen. Nach der Klonierung der tTA-Mutanten in den Vektor pUHD15-1 wurden fünf der Klone, die in Hefe ei­ nen sehr ausgeprägten Phänotyp zeigten, mittels transienter Transfektionen in humanen Epithelzellen getestet. Diese Mes­ sungen bestätigten die in Hefe beobachteten Induktionsunter­ schiede.The screening method according to the invention is particularly suitable net to find mutants of tTA that differ reacting sitiv to the different inductors: There were eleven mutants of the desired phenotype were identified. By the sequencing of these tTA variants could be determined that all Po affected by amino acid exchanges sitions either in the tetracycline binding pocket or in production areas. After cloning the tTA mutants In the vector pUHD15-1, five of the clones that were found in yeast showed a very pronounced phenotype by means of transient Transfections tested in human epithelial cells. This Mes solutions confirmed the induction effects observed in yeast different.

Als Beispiel sei die Mutante 45 näher ausgeführt, die einen Aminosäureaustausch an Position 170 von TetR trägt (L170 V): Durch Transfektion der entsprechenden Plasmide in HeLa-Zellen und Verabreichung steigender Mengen an Tetrazyklin bzw. Doxy­ zyklin wurde die jeweilige Induktorenkonzentration bestimmt, die zu 50% Repression der Luciferaseaktivität führt (IC50). Die nachfolgende Tabelle zeigt einen Vergleich der Induktion von tTA und tTA-45 mittels Tetrazyklin und Doxyzyklin:
As an example, the mutant 45, which carries an amino acid exchange at position 170 of TetR (L170 V), is described in more detail: by transfection of the corresponding plasmids in HeLa cells and administration of increasing amounts of tetracycline or doxycycline, the respective inductor concentration was determined, the 50% repression of luciferase activity leads (IC 50 ). The following table shows a comparison of the induction of tTA and tTA-45 using tetracycline and doxycycline:

Es zeigt sich, dass tTA-45 durch den Austausch an Position 170 im Vergleich mit tTA etwa 100-fach unempfindlicher auf Tetraxzyklin, aber nur etwa 10-fach unempfindlicher auf Doxy­ zyklin reagiert. Das beschriebene System ist also nicht nur zur Selektion reversen tTA-Phänotypen geeignet, sondern kann auch zur Auswahl von tTAs mit anderen Eigenschaften genutzt werden. It turns out that tTA-45 by exchanging in position 170 compared to tTA about 100 times less sensitive Tetraxcycline, but only about 10 times less sensitive to doxy cyclin responds. So the system described is not only suitable for selection of reverse tTA phenotypes, but can also used to select tTAs with other properties become.  

SEQUENCE LISTING SEQUENCE LISTING

Claims (36)

1. Verfahren zur Auswahl von Mutanten von Transaktivatoren mit folgenden Schritten
  • a) Herstellung eines Nukleinsäuremoleküls, das
    • 1. ein mutiertes Transaktavator-Gen sowie
    • 2. ein Indikator-Gen aufweist, das in Abhängig­ keit der Konzentration eines niedermolekularen Ef­ fektors in einem Eukaryoten exprimierbar ist
  • b) und
  • c) Transformation des Nukleinsäuremoleküls in einen Eukaryoten.
1. Procedure for selecting mutants of transactivators with the following steps
  • a) Preparation of a nucleic acid molecule, the
    • 1. a mutated transaction gene as well
    • 2. has an indicator gene that can be expressed in a eukaryote as a function of the concentration of a low molecular weight efector
  • Federation
  • c) transforming the nucleic acid molecule into a eukaryote.
2. Verfahren nach Anspruch 1, wobei das Transaktivator-Gen ein tTA- oder rtTA-Gen ist.2. The method of claim 1, wherein the transactivator gene is a tTA or rtTA gene. 3. Verfahren nach Anspruch 1 oder 2, wobei das Nukleinsäu­ remolekül ein Plasmid ist.3. The method according to claim 1 or 2, wherein the nucleic acid remolecule is a plasmid. 4. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei das Nukleinsäuremolekül vom Plasmid pCM190 abgelei­ tet ist.4. The method according to any one of the preceding claims, where the nucleic acid molecule is derived from plasmid pCM190 is. 5. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei das Indikator-Gen mehrere tet-Operatoren aufweist.5. The method according to any one of the preceding claims, where in which the indicator gene has several tet operators. 6. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei das Indikator-Gen das GFP aus Aequorea victoria ko­ diert. 6. The method according to any one of the preceding claims, where in the indicator gene, the GFP from Aequorea victoria ko dated.   7. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei das GFP über glatte Enden in die singuläre BamHI- Schnittstelle von pCM190 ligiert wird.7. The method according to any one of the preceding claims, where with the GFP over smooth ends into the singular BamHI Interface of pCM190 is ligated. 8. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei das Nukleinsäuremolekül einen Selektionsmarker auf­ weist.8. The method according to any one of the preceding claims, where a selection marker on the nucleic acid molecule points. 9. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei als Selektionsmarker das URA3-Gen Gen verwendet wird.9. The method according to any one of the preceding claims, where used the URA3 gene as a selection marker becomes. 10. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei das Nukleinsäuremolekül eine 2µ-Sequenz aufweist.10. The method according to any one of the preceding claims, where the nucleic acid molecule has a 2µ sequence. 11. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei das Nukleinsäuremolekül eine multiple Klonungsstel­ le aufweist.11. The method according to any one of the preceding claims, where a multiple cloning point for the nucleic acid molecule le has. 12. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei beim Schritt lit. a der tetR oder rtetR-Anteil ei­ nes konstitutiv exprimierten tTA oder rtTA gegen mu­ tierte tetR bzw. tetR ersetzt wird.12. The method according to any one of the preceding claims, where at step lit. a the tetR or rtetR component nes constitutively expressed tTA or rtTA against mu tated tetR or tetR is replaced. 13. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei die konstitutiv exprimierte tTA oder rtTA ein VP16 aufweisendes Konstrukt ist.13. The method according to any one of the preceding claims, where a VP16 for the constitutively expressed tTA or rtTA is construct. 14. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei der mutierte tTA oder rtTA durch Amplifizierung ei­ nes tetR-Gens, eines davon abgeleiteten Fusions-Gens oder einer Mutanten von TetR mittels PCR und unter Zu­ gabe von Manganchlorid hergestellt wird. 14. The method according to any one of the preceding claims, where in the mutated tTA or rtTA by amplification ei nes tetR gene, a fusion gene derived from it or a mutant of TetR using PCR and Zu Manganese chloride is produced.   15. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei der Effektor Tetrazyklin oder ein Derivat davon ist.15. The method according to any one of the preceding claims, where at the effector tetracycline or a derivative thereof is. 16. Verfahren nach einem der vorhergehenden Ansprüche, wo­ bei der Eukaryot Hefe der Gattung Saccharomyces, vor­ zugsweise Saccharomyces cerevisiae, ist.16. The method according to any one of the preceding claims, where in the eukaryotic yeast of the genus Saccharomyces preferably Saccharomyces cerevisiae. 17. Nukleinsäuremolekül zur Durchführung des Verfahrens nach Anspruch 1, das ein mutiertes Transaktivator-Gen sowie ein Indikator-Gen aufweist, das in Abhängigkeit der Konzentration eines Effektors in einem Eukaryoten exprimirbar ist.17. Nucleic acid molecule for performing the method according to claim 1, which is a mutated transactivator gene and has an indicator gene that is dependent the concentration of an effector in a eukaryote is expressible. 18. Nukleinsäuremolekül nach Anspruch 17, wobei der Trans­ aktivator tTA- oder rtTA ist.18. The nucleic acid molecule according to claim 17, wherein the trans activator is tTA or rtTA. 19. Nukleinsäuremolekül nach Anspruch 17 oder 18, wobei das Nukleinsäuremolekül ein Plasmid ist.19. The nucleic acid molecule according to claim 17 or 18, wherein the Nucleic acid molecule is a plasmid. 20. Nukleinsäuremolekül nach einem der Ansprüche 17 bis 19, wobei das Plasmid von pCM190 abgeleitet ist.20. Nucleic acid molecule according to one of claims 17 to 19, the plasmid being derived from pCM190. 21. Nukleinsäuremolekül nach einem der Ansprüche 17 bis 20, wobei das Indikator-Gen mehrere tet-Operatoren auf­ weist.21. Nucleic acid molecule according to one of claims 17 to 20, where the indicator gene has multiple tet operators points. 22. Nukleinsäuremolekül nach einem der Ansprüche 17 bis 21, wobei das Indikator-Gen GFP aus Aequorea victoria ist.22. Nucleic acid molecule according to one of claims 17 to 21, the indicator gene being GFP from Aequorea victoria. 23. Nukleinsäuremolekül nach einem der Ansprüche 17 bis 22, wobei das GFP über glatte Enden in die singuläre BamHI- Schnittstelle von pCM190 ligiert ist. 23. Nucleic acid molecule according to one of claims 17 to 22, with the GFP blunt-ended into the unique BamHI Interface of pCM190 is ligated.   24. Nukleinsäuremolekül nach einem der Ansprüche 16 bis 23, wobei ein Selektionsmarker vorgesehen ist.24. Nucleic acid molecule according to one of claims 16 to 23, a selection marker is provided. 25. Nukleinsäuremolekül nach einem der Ansprüche 16 bis 24, wobei der Selektionsmarker das URAJ-Gen ist.25. Nucleic acid molecule according to one of claims 16 to 24, where the selection marker is the URAJ gene. 26. Nukleinsäuremolekül nach einem der Ansprüche 16 bis 25, wobei eine 2µ-Sequenz vorgesehen ist.26. Nucleic acid molecule according to one of claims 16 to 25, a 2µ sequence is provided. 27. Nukleinsäuremolekül nach einem der Ansprüche 16 bis 26, wobei eine multiple Klonungsstelle vorgesehen ist.27. Nucleic acid molecule according to one of claims 16 to 26, a multiple cloning site is provided. 28. Nukleinsäuremolekül nach einem der Ansprüche 16 bis 27, wobei der Effektor Tetrazyklin oder ein Derivat davon ist.28. Nucleic acid molecule according to one of claims 16 to 27, the effector being tetracycline or a derivative thereof is. 29. Nukleinsäuremolekül nach einem der Ansprüche 16 bis 28, wobei der Eukaryot Hefe, vorzugsweise Saccharomyces ce­ revisiae, ist.29. Nucleic acid molecule according to one of claims 16 to 28, the eukaryote yeast, preferably Saccharomyces ce revisiae, is. 30. Verwendung eines Nukleinsäuremoleküls mit einem Indika­ tor-Gen, das für ein Protein mit fluoreszenten Eigen­ schaften kodiert, in Hefe zum Prüfen der Eigenschaften mutierter Transaktivatoren.30. Use of a nucleic acid molecule with an indicator tor gene that is responsible for a protein with fluorescent eigen coded in yeast to test the properties mutated transactivators. 31. Verwendung nach Anspruch 30, wobei der Transaktivator tTA oder rtTA ist.31. Use according to claim 30, wherein the transactivator is tTA or rtTA. 32. Verwendung nach Anspruch 30 oder 31, wobei das Indika­ tor-Gen GFP aus Aequorea victoria ist.32. Use according to claim 30 or 31, wherein the indica tor gene GFP from Aequorea victoria. 33. Verwendung nach einem der Ansprüche 30 bis 32, wobei das Nukleinsäuremolekül ein Plasmid ist. 33. Use according to any one of claims 30 to 32, wherein the nucleic acid molecule is a plasmid.   34. Verwendung nach einem der Ansprüche 30 bis 33, wobei das Plasmid von pCM190 abgeleitet ist.34. Use according to any one of claims 30 to 33, wherein the plasmid is derived from pCM190. 35. Verwendung nach einem der Ansprüche 30 bis 34, wobei das Plasmid ein mutiertes tTA- oder rtTA-Gen aufweist.35. Use according to any one of claims 30 to 34, wherein the plasmid has a mutated tTA or rtTA gene. 36. Verwendung nach einem der Ansprüche 30 bis 35, wobei als Hefe Saccaromyces cerevisiae verwendet wird.36. Use according to any one of claims 30 to 35, wherein Saccaromyces cerevisiae is used as yeast.
DE1998151413 1998-11-07 1998-11-07 Procedure for selecting mutants of tTA or rtTA Expired - Lifetime DE19851413C2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DE1998151413 DE19851413C2 (en) 1998-11-07 1998-11-07 Procedure for selecting mutants of tTA or rtTA
US10/108,524 US20050037335A1 (en) 1998-11-07 2002-03-27 Method for identifying novel transcriptional regulatory proteins

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE1998151413 DE19851413C2 (en) 1998-11-07 1998-11-07 Procedure for selecting mutants of tTA or rtTA

Publications (2)

Publication Number Publication Date
DE19851413A1 true DE19851413A1 (en) 2000-05-11
DE19851413C2 DE19851413C2 (en) 2003-05-22

Family

ID=7887042

Family Applications (1)

Application Number Title Priority Date Filing Date
DE1998151413 Expired - Lifetime DE19851413C2 (en) 1998-11-07 1998-11-07 Procedure for selecting mutants of tTA or rtTA

Country Status (1)

Country Link
DE (1) DE19851413C2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7541446B2 (en) 1999-06-07 2009-06-02 Tet Systems Holding Gmbh & Co. Kg Tet repressor-based transcriptional regulatory proteins
US8541002B2 (en) 2003-09-12 2013-09-24 Agenus Inc. Vaccine for treatment and prevention of herpes simplex virus infection

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040892A1 (en) * 1995-06-07 1996-12-19 Basf Ag Tetracycline regulated transcriptional modulators with altered dna binding specificities

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040892A1 (en) * 1995-06-07 1996-12-19 Basf Ag Tetracycline regulated transcriptional modulators with altered dna binding specificities

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7541446B2 (en) 1999-06-07 2009-06-02 Tet Systems Holding Gmbh & Co. Kg Tet repressor-based transcriptional regulatory proteins
US8541002B2 (en) 2003-09-12 2013-09-24 Agenus Inc. Vaccine for treatment and prevention of herpes simplex virus infection

Also Published As

Publication number Publication date
DE19851413C2 (en) 2003-05-22

Similar Documents

Publication Publication Date Title
DE69835085T2 (en) REGULATION OF TRANSCRIPTION IN MAMMALIAN CELLS AND VIRAL REPLICATION BY A TETRACYCLINREPRESSOR
DE69635992T2 (en) AN AUTOREGULATED TETRACYCLIN-REGULATED SYSTEM FOR INDUCED GENE EXPRESSION IN EUKARYOTES
DE69831083T2 (en) REPRIMATED TRANS-ACTIVATOR SYSTEM FOR CHARACTERIZING PROTEIN-PROTEIN INTERACTIONS
DE60221801T3 (en) CPG-FREE SYNTHETIC GENES AND BACTERIAL PLASMIDES
EP0942999A1 (en) Gene trap construct for identification and isolation of genes
WO1999020780A1 (en) Positive-negative selection for homologous recombination
DE19851413C2 (en) Procedure for selecting mutants of tTA or rtTA
DE19851415B4 (en) Mutant transactivator
EP0826775B1 (en) Vector for conditional gene expression
DE60104019T2 (en) Compositions, methods and reagent kits for detecting protein-protein interaction interfering substances
DE602004010112T2 (en) In cis regulated conditional gene vectors
AT500838B1 (en) MULTIPLE HSE
DE10130155B3 (en) Reporter gene construct for the detection of HIV-Rev and HIV-Tat
DE19808453C2 (en) Expression vector for the conditional regulation of the expression of the large subunit of RNA polymerase II
DE102020129009A1 (en) DETECTION OF ENVIRONMENTAL INFLUENCES USING BIOLUMINESCENCE
EP1298440B1 (en) Functional screening for transcription factors
DE102010036997A1 (en) LOV domains Protein for photosensitive defunctionalization
DE60125926T2 (en) Method for finding proteins with a signal sequence
EP1337651A2 (en) Promoter for the functional characterisation of g-protein coupled receptors in the yeast saccharomyces cerevisiae
DE10012861C2 (en) Recombinant HHV8 DNA
DE19845420C2 (en) Intercellular spread of recombinant DNA
DE60226056T2 (en) AEQUORIN AS REPORTERS IN YEAST
DE102021005748A1 (en) Replicase chain reaction (RCR) and its use in the diagnosis and treatment of viral diseases
DE60315179T2 (en) A method of inserting a nucleic acid into a prokaryotic or eukaryotic cell by homologous recombination
WO1998046789A1 (en) New reporter-vectors for one-hybrid and two-hybrids systems

Legal Events

Date Code Title Description
OP8 Request for examination as to paragraph 44 patent law
8304 Grant after examination procedure
8364 No opposition during term of opposition
8327 Change in the person/name/address of the patent owner

Owner name: TET SYSTEMS GMBH & CO. KG, 69120 HEIDELBERG, DE

8381 Inventor (new situation)

Inventor name: HILLEN, WOLFGANG, 91080 UTTENREUTH, DE

R081 Change of applicant/patentee

Owner name: TET SYSTEMS GMBH & CO. KG, DE

Free format text: FORMER OWNER: HILLEN, WOLFGANG, 91080 UTTENREUTH, DE

Effective date: 20110301

R082 Change of representative
R071 Expiry of right