DE19840897A1

DE19840897A1 - Assay for detecting the factor V disease mutation comprises a polymerase chain reaction using a reporter/quencher-labeled probe having a defined nucleotide sequence

Info

Publication number: DE19840897A1
Application number: DE19840897A
Authority: DE
Inventors: Dirk Happich; Dirk Hoernschemeyer
Original assignee: Individual
Current assignee: Individual
Priority date: 1998-09-08
Filing date: 1998-09-08
Publication date: 2000-03-09

Abstract

Assay for detecting the factor V disease mutation comprises a polymerase chain reaction (PCR) in which a DNA sample is denatured by heat treatment, the DNA strands are hybridized with a reporter/quencher-labeled probe and the probe is cut by a polymerase. Assay for detecting the factor V disease mutation comprises a polymerase chain reaction (PCR) in which a DNA sample is denatured by heat treatment, the DNA strands are hybridized with a reporter/quencher-labeled probe having a sequence comprising or complementary to the sequence: (I) CCTGTATTCCTCGCCTGTCCAGG; or (II) CCTGTATTCCTTGCCTGTCCAGG, and the probe is cut by a polymerase. An Independent claim is also included for a test kit comprising reporter/quencher-labeled probes having a sequence comprising or complementary to sequences (I) and (II).

Description

Die Erfindung betrifft ein Verfahren zum Nachweis des Faktors V-Leiden und einen Test-Kit, der die zur Durchführung des Nachweises erforderlichen Reagenzien enthält.The invention relates to a method for the detection of Factor V-Leiden and a test kit that is used for Carrying out the necessary reagents contains.

Ein Großteil der vererbten Thromboseerkrankungen ist mit einer Unempfindlichkeit gegenüber dem aktivierten Protein C verknüpft. In der Mehrzahl der Fälle ist der für diese Unempfindlichkeit verantwortliche genetische Defekt eine Punktmutation des Faktor V-Gens, wobei Cytosin durch Thymidin ersetzt ist. Das mutierte Faktor V-Molekül, bekannt als Faktor V-Leiden, ist in der Gerinnungskaskade wirksam, wird durch das aktivierte Protein C aber nicht proteolytisch abgebaut.Much of the inherited thrombosis is with an insensitivity to the activated protein C linked. In the majority of cases this is for them Insensitivity responsible genetic defect one Point mutation of the factor V gene, whereby cytosine by Thymidine is replaced. The mutant factor V molecule, known as factor V suffering, is in the coagulation cascade effective, but is not activated by activated protein C. degraded proteolytically.

Die Diagnose einer homozygoten oder heterozygoten Manifestierung des mutierten Faktor V-Leiden Gens wird immer wichtiger. Verschiedene Nachweisverfahren auf der Basis einer PCR(Polymerase Chain Reaction)-Reaktion sind bekannt, um diese Punktmutation im Codon 506 von Exon 10 des Faktor V-Gens nachzuweisen. Mit Ausnahme derjenigen Tests, in denen eine Sequenzierung erfolgt, beruhen die Verfahren zum Nachweis des mutierten Faktor V-Leiden-Gens auf Hybridisierungstechniken mit spezifischen Oligonukleotiden, der Amplifizierung mit sequenzspezifischen Primern oder mutagenen Primern und einer Amplifizierung der Zielregion, gefolgt von einer Verdauung mit der Restriktionsendonuklease Mnl I. Beschrieben sind diese Verfahren beispielsweise in Nature 1994, 369: 64-7, in Thromb Haemost 1996: 75(5) 757-9 und in Thromb Haemost 1995: 74 1379-80. Ferner wird zur allelen Diskriminierung eine sogenannte Heteroduplextechnologie vorgeschlagen, die in Thromb. Haemost. 1997, 77(1) 119-22 beschrieben ist.The diagnosis of a homozygous or heterozygous Manifestation of the mutated factor V-Leiden gene increasingly important. Different detection methods on the The basis of a PCR (Polymerase Chain Reaction) reaction known to have this point mutation in codon 506 of exon 10 of the factor V gene. Except for those Tests in which sequencing takes place are based on the Procedure for the detection of the mutant factor V Leiden gene on hybridization techniques with specific Oligonucleotides, amplification with sequence specific primers or mutagenic primers and an amplification of the target region followed by one Digestion with the restriction endonuclease Mnl I. These processes are described, for example, in Nature 1994, 369: 64-7, in Thromb Haemost 1996: 75 (5) 757-9 and in Thromb Haemost 1995: 74 1379-80. It also becomes an allele Discrimination is a so-called heteroduplex technology suggested that in Thromb. Haemost. 1997, 77 (1) 119-22 is described.

Nachteilig an den meisten dieser Verfahren sind die aufwendigen Arbeitsschritte nach Durchführung der PCR- Reaktion wegen des erforderlichen Zeitaufwands. Ein anderer Nachteil ist die Kontamination durch Verschleppung von erzeugten Amplifikaten.Most of these processes are disadvantageous complex work steps after performing the PCR Reaction due to the time required. On another disadvantage is contamination by Carryover of generated amplificates.

Der Erfindung liegt somit die Aufgabe zugrunde, ein Nachweisverfahren bereitzustellen, welches einen hohen Probendurchsatz bei höchster Genauigkeit und möglichst einfacher Bearbeitung erlaubt.The invention is therefore based on the object Provide detection methods that have a high Sample throughput with maximum accuracy and if possible easy editing allowed.

Gelöst wird diese Aufgabe durch ein molekularbiologisches Verfahren zum Nachweis der Faktor V-Leiden-Mutation auf der Basis einer PCR-Reaktion, in welchem man durch thermische Behandlung bei einer DNA enthaltenden Probe die Trennung der einzelnen Stränge bewirkt, bei einer Temperatur von 61 bis 66°C die Hybridisierung der Einzelstränge mit nach dem Reporter/Quencher-Prinzip markierten Sonden herbeiführt, wobei die Sonden eine der folgenden DNA-Sequenzen oder deren homologe Sequenzen enthalten:
This problem is solved by a molecular biological method for the detection of the factor V-Leiden mutation based on a PCR reaction, in which the individual strands are separated by thermal treatment of a sample containing DNA, at a temperature of 61 to 66 ° C brings about the hybridization of the single strands with probes labeled according to the reporter / quencher principle, the probes containing one of the following DNA sequences or their homologous sequences:

CCTGTATTCCTCGCCTGTCCAGG
CCTGTATTCCTTGCCTGTCCAGG,
anschließend die Sonde(n) durch eine Polymerase zerschneidet und die Probe auswertet.CCTGTATTCCTCGCCTGTCCAGG
CCTGTATTCCTTGCCTGTCCAGG,
then the probe (s) are cut by a polymerase and the sample is evaluated.

Das erfindungsgemäße Verfahren erlaubt den einfachen, schnellen und zuverlässigen Nachweis des Faktor V-Leiden. Im Gegensatz zu anderen auf einer PCR-Reaktion basierenden Verfahren wird das erfindungsgemäße Verfahren in einem geschlossenen Teströhrchen durchgeführt und die bei den bekannten Verfahren erforderlichen Schritte nach Durchführung der PCR-Reaktion vermieden. Eine mögliche Kontaminierung mit PCR-Produkten wird verringert, da die amplifizierten Produkte ohne Öffnung der Reaktionsgefäße analysiert werden können.The method according to the invention allows simple quick and reliable detection of the factor V-suffering. Unlike others on a PCR reaction based method is the inventive method performed in a closed test tube and the steps required in the known methods Avoid carrying out the PCR reaction. A possible Contamination with PCR products is reduced because of the amplified products without opening the reaction vessels can be analyzed.

Gemäß einer bevorzugten Ausführungsform der Erfindung wird dem Reaktionsgemisch dUTP zugesetzt, so daß bei einer gegebenenfalls dennoch eintretenden Amplifikatverschleppung diese vor der Reaktion durch den Einsatz des Enzyms Uracil-N-Glykosylase zerstört werden kann.According to a preferred embodiment of the invention is added to the reaction mixture dUTP, so that at a possibly occurring nevertheless Amplificate carryover before the reaction by the Use of the enzyme uracil-N-glycosylase can be destroyed can.

Das Prinzip des erfindungsgemäßen Nachweisverfahren liegt darin, daß DNA enthaltende Proben und eine der beiden Sonden gemeinsam einer PCR-Reaktion unterzogen werden, wobei zunächst eine Hybridisierung der jeweils komplementären Basen der Sonde und der DNA-Probe erfolgt. Die zur PCR-Reaktion eingesetzte Polymerase schneidet die an die DNA angelagerte Sonde weg, so daß Reporter- Farbstoff und Quencher-Farbstoff nicht mehr an dasselbe Molekül gebunden sind. Folglich wird die Fluoreszenz des Reporter-Farbstoffs durch den Quencher nicht mehr unterdrückt, was eine fluoreszierende Analysenprobe zur Folge hat. The principle of the detection method according to the invention lies in that DNA containing samples and one of the two Probes are subjected to a PCR reaction together, initially hybridizing each complementary bases of the probe and the DNA sample. The polymerase used for the PCR reaction cuts the probe attached to the DNA away so that reporter The dye and quencher dye are no longer the same Molecule are bound. Consequently, the fluorescence of the Reporter dye no longer through the quencher suppresses what a fluorescent analytical sample is for Consequence.

Zur Durchführung des erfindungsgemäßen Nachweisverfahrens werden Sonden eingesetzt, die die oben angegebene Nukleotidsequenz aufweisen. Sehr gute Ergebnisse sind noch mit Sonden zu erzielen, die sowohl am 5'- und/oder 3'-Ende der zuvor angegebenen Sequenz bis zu 5 weitere Nukleotidreste aufweisen. Damit eine einwandfreie Hybridisierung mit dem Faktor V-Leiden-Gen oder dem Wildtypallel errreicht wird, sollte das zur Faktor V- Leidenmuation komplementäre Nukleotid im Bereich der Mitte der Sondensequenz angeordnet sein. Die Markierung der Sonden erfolgt nach der Reporter/Quencher-Methode. Gemäß einer bevorzugten Ausführungsform sind die Fluoreszenz-Reporterfarbstoffe FAM (6-Carboxyfluorescein) und TET (Tetrachlor-6- carboxyfluorescein) und der Quencher-Farbstoff TAMRA (6- Carboxytetramethylrhodamin). FAM kann beispielsweise am 5'-Ende und TAMRA am 3'-Ende der Sonde angekoppelt sein;
in diesem Fall zeigt die Sonde keine Fluoreszenz.To carry out the detection method according to the invention, probes are used which have the nucleotide sequence given above. Very good results can still be achieved with probes which have up to 5 further nucleotide residues at both the 5 'and / or 3' end of the sequence given above. In order to achieve perfect hybridization with the factor V-Leiden gene or the wild type allele, the nucleotide complementary to the factor V-Leiden muation should be arranged in the region of the center of the probe sequence. The probes are labeled using the reporter / quencher method. In a preferred embodiment, the fluorescent reporter dyes are FAM (6-carboxyfluorescein) and TET (tetrachloro-6-carboxyfluorescein) and the quencher dye is TAMRA (6-carboxytetramethylrhodamine). For example, FAM can be coupled at the 5 'end and TAMRA at the 3' end of the probe;
in this case the probe shows no fluorescence.

Wesentliche Voraussetzung zur erfolgreichen Durchführung des erfindungsgemäßen Verfahrens ist eine Temperatur für die Hybridisierung der Sonde mit der DNA enthaltenden Probe ist eine Temperatur des Reaktionsgemischs von 60 bis 66°C.Essential prerequisite for successful implementation of the method according to the invention is a temperature for hybridization of the probe with the DNA-containing Sample is a temperature of the reaction mixture of 60 up to 66 ° C.

Die Signifikanz des erfindungsgemäßen Nachweisverfahren läßt sich weit über 95% hinaus steigern, wenn das Reaktionsgemisch 0,5 bis 4 Gew.-% Glycerol, bezogen auf das Gewicht des Reaktionsgemischs, enthält.The significance of the detection method according to the invention can be increased well over 95% if that Reaction mixture 0.5 to 4 wt .-% glycerol, based on the weight of the reaction mixture.

Als vorteilhaft hat es sich erwiesen, die Konzentration an Magnesium im Reaktionsgemisch auf vorzugsweise 4 bis 6 mM, insbesondere etwa 5 einzustellen. It has proven advantageous to concentrate of magnesium in the reaction mixture to preferably 4 to 6 mM, in particular about 5.

Die erfindungsgemäße Testzusammenstellung enthält mindestens die zwei Sonden, welche jeweils eine der Nukleotidsequenzen CCTGTATTCCTCGCCTGTCCAGG und CCTGTATTCCTTGCCTGTCCAGG enthalten oder aus diesen bestehen sowie die dazu komplementären Sequenzen, wobei diese Sonden eine Reporter/Quencher-Markierung aufweisen.The test compilation according to the invention contains at least the two probes, each one of the Nucleotide sequences CCTGTATTCCTCGCCTGTCCAGG and CCTGTATTCCTTGCCTGTCCAGG included or from these exist as well as the complementary sequences, whereby these probes have a reporter / quencher label.

Gemäß einer besonders bevorzugten Ausführungsform werden die erforderlichen Enzyme und/oder Primer oder der gesamte Reaktionsansatz im Gemisch mit Trehalose zur Erhöhung Lagerstabilität gelagert. Eine Kühlung ist dann nicht erforderlich. Der Reaktionsansatz umfaßt Enzyme, Sonden, Primer und dNTP.According to a particularly preferred embodiment the required enzymes and / or primers or the entire reaction mixture in a mixture with trehalose Increased storage stability. Cooling is then not mandatory. The reaction approach includes enzymes Probes, primers and dNTP.

Beispielhaft wird das erfindungsgemäße Verfahren nachfolgend erläutert.The method according to the invention becomes an example explained below.

Nucleic acid extraction

Zur Vorbereitung der zu prüfenden DNA werden diese über QIAMP Spin-Säulen nach den Anweisungen des Herstellers (Qiagen GmbH, Hilden, Deutschland) gegeben. 200 µl einer mit EDTA versehenen Blutprobe wurden mit 200 µl einer Guanidiniumsalzlösung und 25 µl Proteinase K Stock-Lösung vermischt und 10 Minuten lang bei 70°C vermischt. Es werden 210 µl Ethanol (96%) hinzugefügt, auf einem Vortex-Mischer gemischt, über die Säule gegeben und 1 Minute lang bei 6000 G zentrifugiert. Das Säulenmaterial wurde zweimal mit 500 µl Waschpuffer AW gewaschen und ein weiteres Mal bei 6000 G 1 Minute lang zentrifugiert. Die Nukleinsäuren wurden mit 200 µl auf 70°C erwärmten Wasser durch einminütiges Zentrifugieren bei 6000 G eluiert. 5 µl dieses DNA-Extrakts wurden als Substrat in der PCR eingesetzt. In order to prepare the DNA to be checked, these are over QIAMP spin columns according to the manufacturer's instructions (Qiagen GmbH, Hilden, Germany). 200 µl one blood sample provided with EDTA was mixed with 200 µl of a Guanidinium salt solution and 25 µl proteinase K stick solution mixed and mixed at 70 ° C for 10 minutes. It 210 ul ethanol (96%) are added, on a Vortex mixer mixed, placed over the column and 1 Centrifuged at 6000 G for one minute. The pillar material was washed twice with 500 ul washing buffer AW and a centrifuged again at 6000 G for 1 minute. The Nucleic acids were heated with 200 µl water heated to 70 ° C eluted by centrifugation at 6000 G for one minute. 5 ul of this DNA extract were used as a substrate in the PCR used.

PCR primers and probes

Die Reaktionsbedingungen und Primer zur Amplizifierung der Zielregion (Exon 10 des Faktors V-Gens) und die anschließende Mnl I-Restriktionsendonuklease-Verdauung (die Mutation verhindert eine Mnl I-Schnittstelle) wurden verwendet wie zuvor in N. Engl J. Med. 1994; 330: 517-22 beschrieben. Die beispielhaft eingesetzten Primer und Sonden zur allelen Diskriminierung der Faktor V-Leiden- Mutation sind in der folgenden Tabelle 1 dargestellt.The reaction conditions and primers for amplification the target region (exon 10 of the factor V gene) and the subsequent MnI I restriction endonuclease digestion (the mutation prevented a Mnl I interface) used as before in N. Engl J. Med. 1994; 330: 517-22 described. The primers and Allelic Discrimination Probes Mutations are shown in Table 1 below.

Table 1

Principle of the TaqMan® reaction and provision of the fluorogenic probes

Die TaqMan-PCR nutzt die 5 → 3 exonuklease Wirkung von AmpliTaq-Gold® DNA-Polymerase zur Verdauung einer Sonde, die mit einem fluoreszierenden Reporter und einem Quencher-Farbstoff markiert ist. Die beiden Sonden werden direkt dem PCR-Reaktionsgemisch zugesetzt. Die erste Sonde hybrisiert mit der Region innerhalb der flankierenden PCR-Primer und repräsentiert die für den Wildtyp-spezifische Nukleotidsequenz des Faktors V-Gens. Der fluoreszierende Reporter-Farbstoff FAM ist kovalent an das 5'-Ende der Sonde gebunden. Der Quencher-Farbstoff TAMRA ist am 3'-Ende der Probe gebunden. Der Quencher reduziert die Emissionsintensität der Sonde solange sie intakt ist, und die Phosphorylierung am 3'-Ende verhindert die Verlängerung der Sequenz während der Amplifizierung. In ähnlicher Weise ist die zweite Sonde beschaffen, um spezifisch an die mutierte Nukleotidsequenz des Faktor V-Leiden zu binden; diese enthält den Reporterfarbstoff TET. Während des PCR-Zyklus hybridisieren die Sonden spezifisch an der komplementären Sequenz und werden verdaut, wenn sich die AmpliTaq-Gold von dem PCR-Primer erstreckt. Das Verdauen der Proben setzt den Reporter von der Aktivität des Quenchers frei und aufeinander folgende PCR-Zyklen führen zu einer exponentiellen Verstärkung des PCR-Produkts und der Fluoreszenzintensität. Die PCR-Produkte werden innerhalb von Minuten nach der Beendigung der PCR durch Messen der Fluoreszenz der markierten Sonde ermittelt.The TaqMan-PCR uses the 5 → 3 exonuclease effect of AmpliTaq-Gold® DNA polymerase for digestion of a probe, the one with a fluorescent reporter and one Quencher dye is marked. The two probes will added directly to the PCR reaction mixture. The first Probe hybridizes with the region within the flanking PCR primer and represents the for the Wild-type specific nucleotide sequence of factor V gene. The fluorescent reporter dye FAM is covalent bound to the 5 'end of the probe. The quencher dye TAMRA is bound at the 3 'end of the sample. The quencher reduces the emission intensity of the probe as long as it is intact, and the phosphorylation at the 3 'end prevents the sequence from being extended during the Amplification. The second probe is similar procure to specifically match the mutant Bind nucleotide sequence of factor V suffering; this contains the reporter dye TET. During the PCR cycle hybridize the probes specifically to the complementary one Sequence and are digested when the AmpliTaq gold extended from the PCR primer. Digesting the samples releases the reporter from the activity of the quencher and successive PCR cycles result in one exponential amplification of the PCR product and the Fluorescence intensity. The PCR products are inside minutes after the completion of the PCR by measuring the Fluorescence of the labeled probe was determined.

Zur PCR wurde der TaqMan-Core-Reagenz-Kit (Perkin Elmer, Weitestadt, Germany) verwendet. Das Reaktionsgemisch enthielt 10 × PCR-Puffer (100 mM Tris-HCl, 500 mM KCl, 0,1 M EDTA, 600 nm passive Referenz 5 mM MgCl₂, die Mononukleotide dATP, dGTP, dCTP, (jeweils 200 µM), dUTP (400 µM), AmpliTaq-Gold (0,025 U/µl), AmpErase (0,01 U/µl), Glycerol (2%), die Primer APCF, APCR (jeweils 300 µM) und TaqMan-Sonden APCMU und APCWT (jeweils 200 µM). Das System enthielt Uracil-N- glycosylase, um das Einschleppen einer Kontamination zu verhindern. Alle PCR-Produkte wurde mit dUTP synthetisiert, um diese gegenüber der Uracil-N- glycosylase von Dauer empfindlich zu machen. Die Uracil- N-glycosylase wird vor dem Thermozyklus zugesetzt. Die Amplifizierung wurde zweimal unterbrochen, einmal 2 Minuten lang bei 50°C und einmal 10 Minuten lang bei 95°C, worauf 35 Zyklen einer zweistufigen PCR (95°C 15 s, 63°C 80 s) und schließlich 5 Minuten lang bei 63°C.The TaqMan core reagent kit (Perkin Elmer, Weitestadt, Germany) was used for the PCR. The reaction mixture contained 10 × PCR buffer (100 mM Tris-HCl, 500 mM KCl, 0.1 M EDTA, 600 nm passive reference 5 mM MgCl ₂ , the mononucleotides dATP, dGTP, dCTP, (each 200 μM), dUTP ( 400 µM), AmpliTaq-Gold (0.025 U / µl), AmpErase (0.01 U / µl), Glycerol (2%), the primers APCF, APCR (300 µM each) and TaqMan probes APCMU and APCWT (200 The system contained uracil-N-glycosylase to prevent contamination from being carried in. All PCR products were synthesized with dUTP to make them susceptible to uracil-N-glycosylase in the long term, uracil-N-glycosylase The amplification was interrupted twice, once for 2 minutes at 50 ° C. and once for 10 minutes at 95 ° C., followed by 35 cycles of a two-stage PCR (95 ° C. 15 s, 63 ° C. 80 s) and finally at 63 ° C for 5 minutes.

Die Ergebnisse einer Untersuchung von 56 Proben sind in der Fig. 1 dargestellt. 6 Kontrollreaktionsgemische enthielten keine Schablone (template); homozygote und negative Kontrollen für die Faktor V-Leiden-Mutation wurden ebenfalls zugesetzt. Die Fluoreszenz jeder Probe wurde gemessen und nach dem thermischen Zyklus in 30 Sekunden. Alle 4 Cluster können ohne Probleme spezifischen Gruppen zugeordnet werden. Cluster 1 mit Signalwerten von etwa 1 für Allel 2 derjenigen Proben, die keine Faktor V-Leiden-Mutation aufweisen. Die Proben in Cluster 2 mit Signalwerten von etwa 0,5 für Allel 1 und Allel 2 zeigen die heterozygote Mutation. Die homozygoten Proben mit Signalwerten von bis zu 1 für Allel 1 bildende Cluster 3. Cluster 4 mit den niedrigsten Signalen für Allel 1 (FAM, negativ für Faktor V-Leiden- Mutation) und Allel 2 (TET, homozygot für die Mutation steht für die Signale der Kontrollen ohne Schablone.The results of an examination of 56 samples are shown in FIG. 1. 6 control reaction mixtures contained no template; Homozygous and negative controls for the factor V Leiden mutation were also added. The fluorescence of each sample was measured and after the thermal cycle in 30 seconds. All 4 clusters can easily be assigned to specific groups. Cluster 1 with signal values of approximately 1 for allele 2 of those samples which do not have a factor V Leiden mutation. The samples in cluster 2 with signal values of approximately 0.5 for allele 1 and allele 2 show the heterozygous mutation. The homozygous samples with signal values of up to 1 for allele 1 forming clusters 3. Cluster 4 with the lowest signals for allele 1 (FAM, negative for factor V-Leiden mutation) and allele 2 (TET, homozygous for the mutation stands for Control signals without template.

Claims

1. Molecular biological method for the detection of the factor V-Leiden mutation based on a PCR reaction, characterized in that the DNA strands are separated by thermal treatment of a DNA-containing sample at a temperature of 60 to 66 ° C. Hybridization of the single strands with probes marked in the manner of a reporter / quencher marker brings about, the probes being one of the DNA sequences
CCTGTATTCCTCGCCTGTCCAGG
CCTGTATTCCTTGCCTGTCCAGG,
or contain or consist of their complementary sequences, then the probe (s) are cut by a polymerase and the sample is evaluated.

2. Molecular biological method according to claim 1, characterized in that the probes have the following base sequences
CCTGTATTCCTCGCCTGTCCAGG
CCTGTATTCCTTGCCTGTCCAGG
or have their complementary sequences.

3. Molecular biological method according to a of claims 1 to 3, characterized in that the Detection reaction carried out in a reaction mixture is the 0.5 to 4 wt .-% glycerol, based on the Weight of the reaction mixture contains.

4. Test kit, containing probes labeled in the manner of a reporter / quencher marker, which contain the following DNA sequences or their complementary sequences:
CCTGTATTCCTCGCCTGTCCAGG
CCTGTATTCCTTGCCTGTCCAGG.

5. Test kit according to claim 4, characterized characterized in that for the microbiological Detection methods required enzymes in trehalose are stored.