DE19725014A1 - Aprotinin variants with improved properties and bikunins of aprotinin variants - Google Patents

Abstract

The invention relates to aprotinin variants with a net charge of +3 to -3 at pH 7. In the binding site, the amino acid radical 10 is Ser, the amino acid radical 13 is Ile, Phe or Leu, the amino acid radical 15 is Arg, the amino acid radical 17 is Tyr, Leu or Arg, and the amino acid radical 19 is Thr or Lys. The invention also relates to bikunins, comprising two aprotinin variants linked by a spacer with several amino acid radicals. One of said aprotinin variants is a) an aprotinin variant wherein the amino acid radical 13 is Ile, Phe or Leu, the amino acid radical 15 is Arg, Val or Leu, the amino acid radical 17 is Tyr, Leu or Ala, the amino acid radical 19 is Thr or Lys, the amino acid radical 39 is Arg or Leu, and the amino acid radical 46 is Leu or Lys; or b) an inventive aprotinin variant as defined above. The invention also relates to medicaments containing one or several of said aprotinin variants or bikunins, DNA sequences which give the coding for one of said aprotinin variants or bikunins, micro-organisms containing a DNA sequence of this type, and a method for producing said aprotinin variants and bikunins using micro-organisms.

Description

The present invention relates to aprotinin variants and bikunins of Aprotininvarianten with improved enzyme-inhibiting, immunological and pharmacokinetic properties and their production.

Aprotinin, also referred to as bovine pancreator trypsin inhibitor (BPTI) belongs to the family of Kunitz-type serine protease inhibitors. The spectrum The inhibitable serine proteases include, for. Trypsin, chymotrypsin, plasmin, and Plasma kallikrein (W. Gebhard, H. Tschesche and H. Fritz, Proteinase Inhibitors, Barrett and Salvesen (eds.), Elsevier Science Publ. BV 375-387, 1986).

Aprotinin is a 58-chain single-chain polypeptide having the following sequence:

The three-dimensional structure of the protein was determined with the help of X-ray structure analysis and NMR spectroscopy have been elucidated (Wlodawer et al., J. Mol. Biol. 198 (3), 469-480, 1987; Wagner et al., J. Mol. Biol. 196 (1), 227-231, 1987; Berndt et al., Biochemistry 32 (17), 4564-4570, 1993).

Under the trade name Trasylol®, natural aprotinin is originally used for the Treatment of pancreatitis used. Trasylol is being used today in cardiac surgery  used after clinical studies have shown that treatment with Aprotinin significantly reduces the need for transfusion in such operations and to reduce rebleeding (D. Royston, J. Cardiothorac, Vasc.Anesth., 6; 76-100, 1992).

It could be shown that the exchange of the inhibitory specificity Amino acid in position 15 to valuable aprotinin variants with improved Inhibitory properties leads (DE-PS 33 39 693). Depending on the imported amino acid can be produced in this way potent inhibitors z. B. the elastase Pancreas or from leukocytes.

Furthermore, it could be shown that the inhibitory properties of aprotinin and by Exchange in position 15 generated variants also by more Amino acid residues in the contact region between the target protease to be inhibited and the inhibitor molecule is determined. These include especially the additional ones Amino acid residues in positions 14, 16, 17, 18, 19, 34, 38 and 39. Aprotininvarianten with improved properties by replacing one or Several of these amino acid residues in the region of the contact region were u. a. in following patent applications: WO 89/01968, WO 89/10374, EP 307 592, EP 683 229, DE 19 62 998.2, WO 94/01461.

Interestingly, the pharmacokinetic properties of aprotinin and its variants are enhanced by amino acid substitutions that the determine the physicochemical properties of the substance. So succeeded, through Lowering the net positive charge of the molecule significantly increases kidney retention reduce. Such variants have been described in the patent application WO 92/06111.

For reasons of better technical manufacturability, it is beneficial in certain Make a modification at the N-terminal end of the inhibitor molecule. Such modifications may include N-terminal truncations or extensions or  Deletions of one or more amino acids. N-terminally modified Aprotininvarianten were described in the patent application EP 419 878.

Bikunins are protease inhibitors, e.g. B. the inter-alpha trypsin inhibitor, the two Kunitz domains contain a spacer of several amino acids separated (J.-P. Salier, TIBS 15, 435-439, 1990). In general, but it is only one of the two Kunitzdomänen inhibitory active.

Aprotinin variants according to the invention and bikunins of aprotinin variants

The aprotinin variants and bikunins claimed in the present patent application are characterized by the following features:

• 1. Exchange of one or more amino acids in the active site of the Molecule for improving the activity properties EP 307 592.
• 2. Exchange of amino acids to reduce the net positive charge with the aim of to improve the immunological and pharmacokinetic properties (WO 92/06111).
• 3. Modification of the N-terminal amino acid sequence for technical reasons Manufacturability EP 419 878.
• 4. Exchange of one or more amino acids in the active site of the Molecule to change the specificity.
• 5. Linkage of aprotinin variants with different specificities and Activity properties using a spacer of amino acids to the To extend inhibitory spectrum, through the associated Kunitz domains.
• 6. Use of the bikunins as pro-drugs, because after the cleavage in the spacer region a protease that releases single domains as active Kunitzinhibitoren.
• 7. Aprotinin variants and bikunins, their in vivo half-life after conjugation is extended with activated polyethylene glycol.

Aprotininvarianten, each containing only one of the above features have been described in the above-cited patent applications. The aprotinin variants according to the invention now combine in their molecular structure two or three of the abovementioned features or represent protease inhibitors from a plurality of Kunitz domains. The amino acid sequences are shown by way of example for some variants or bikunins in FIGS . 1 and 2.

However, the aprotinin variants according to the invention are not limited to the examples mentioned in FIGS. 1 and 2. The aprotinin variants according to the invention also include variants having the N-terminal extension Ala (-2) -Gln (-1), with the natural amino acid residue proline in position 2, with the replacement of other amino acids carrying a positive charge with neutral or negatively charged ones Amino acid residues, or with the replacement of other neutral amino acids against negatively charged amino acid residues and with amino acid substitutions in the spacer, which ensure an individual activity of the individual Kunitzdomänen and compounds resulting from cleavage of the Kex protease in the leader.

The selection of the exchanges of amino acid residues in the aprotinin variant follows the principle to produce a substance that at physiological pH a has reduced net positive charge, preferably in the range of +2 to -2. The mentioned changes in the amino acid sequence including the N-terminal Extensions or shortenings or deletions can be done in any combination be used together. The aprotinin variants of the invention include Thus, all compounds that have a combination of the above features and a net positive charge reduced at physiological pH have.

The amino acids in the spacer can be combinations of natural amino acids which ensure the alignment of the individual domains so that they are individual are active. The aprotinin variants for linking are described, inter alia in EP 307 592, WO 92/06111, EP 419 878, WO 89/01968, WO 89/10374, EP 0307592, EP 683 229, DE 196 29 982.  

Surprisingly, it was found that the combination of two or three of mentioned features not only to preserve, but sometimes even to reinforce or change in the severity of the individual features compared to previously described Variants leads. In addition, significant new substance properties could be obtained are generated, z. B. on the immunological, the pharmacokinetic and relate the surface bonding properties. The new individual variants show a significantly reduced response with polyclonal human and rabbit Antisera generated using aprotinin. Next was found that the new variants reduced immunogenic behavior in the Compared to aprotinin own. The enzyme kinetic inhibition constants (Ki values) are surprisingly despite the large number of changes in the molecular body improved over previous variants of the molecule or changed the specificity Service.

Surprisingly, the individual activity of the bikunins was Single domains are observed, the inhibitory constants compared to the investigated enzymes were slightly attenuated compared to the single domains were. After enzymatic cleavage in the spacer unfold the generated Kunitzinhibitoren regain their full activity or become unexpected in their activity increased.

The present invention relates to aprotinin variants with a net charge of +3 to -3 at pH 7, wherein in the binding region the amino acid residue is 10 Ser, the Amino acid residue 13 is Ile, Phe or Leu, the amino acid residue is 15 Arg, the Amino acid residue 17 is Tyr, Leu or Arg and the amino acid residue 19 is Thr or Lys. Preferred are those aprotinin variants with a net charge of +2 to -2, particularly preferably those with +1 to -1.

Aprotinin variants may have an altered N-terminal and / or C-terminal sequence have. These are aprotinin variants with an N-terminal extension or Shortening or with deleted amino acids in the N-terminus.  

Aprotinin variants with the formula are preferred

Arg X ² Asp Phe Cys Leu Glu Pro Pro Ser Thr Gly X ¹³ Cys Arg Ala X ¹⁷ Ile Thr Arg Tyr Phe Tyr X ²⁴ Ala Thr Ala Gly Leu Cys X ³¹ Thr Phe Val Tyr Gly Gly Cys X ³⁹ Ala Asn Arg Asn Asn Phe X ⁴⁶ Ser Ala Glu Asp Cys Met Glu Thr Cys Gly Gly Ala

wherein X ^{2 is} Pro or a bond, X ^{13 is} Ile, Phe or Leu, X ^{17 is} Tyr Leu or Arg, X ^{24 is} Asp or Asn, X ^{31 is} Glu or Gln is X ³⁹ Arg or Leu, X ⁴⁶ Lys or Leu is or polyethylene glycol derivatives thereof.

Particularly preferred are the aprotinin variants DesPro2-Ser10-Ile13-Arg15-Tyr17- Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin, DesPro2-Ser10-Ile13-Arg15-Thr19- Asp24-Thr26 Glu31 Asn41 Glu53 Aprotinin DesPro2 Ser10 Ile13 Arg15 Tyr17 Thr19 Asp24-Thr26-Glu31-Leu39-Asn41-Glu53-aprotinin, DesPro2-Ser10-Ile13-Arg15- Thr19 Asp24-Thr26 Glu31 Leu39 Asn41 Glu53 Aprotinin, DesPro2 Ser10 Phe13 Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin, DesPro2-Ser10- Leu13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin, DesPro2- Ser10 Ile13 Arg15 Tyr17 Thr19 Asp24 Thr26 Asn41 Glu53 Aprotinin, PEG DesPro2 Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Asn41-Glu53-aprotinin, DesPro2-Ser10- Ile13-Arg15-Tyr17-Thr19-Thr26-Glu53 Asn41-aprotinin. These most preferred Aprotinin variants can also carry the amino acid proline in position 2.

The abovementioned aprotinin variants are suitable for the inhibition of Plasma kallikrein, plasmin and factor Xa.

The invention further relates to bikunins comprising two aprotinin variants linked by a spacer having a plurality of amino acid residues, one of the aprotinin variants

• a) is an aprotinin variant in which the amino acid residue is 13, Ile, Phe or Leu, which Amino acid residue 15 Arg, Val or Leu, amino acid residue 17 is Tyr, Leu or Ala the amino acid residue is 19 Thr or Lys, the amino acid residue is 39 Arg or Leu, and the amino acid residue 46 is Leu or Lys, or
• b) is an aprotinin variant according to the invention as defined above.

The spacer preferably has 10 to 40, in particular 10 to 20 amino acid residues. Particularly preferred as spacers are sequences with 13 amino acid residues, in particular the following sequences:
Asn-Ala-Asn-Arg-Ile-Ile-Lys-Thr-Thr-Leu-Gln-Gln-Glu, Asn-Ala-Asn-Arg-Leu-Leu-Lys-Thr-Thr-Leu-Gln-Gln- Glu and Gln-Ala-Gln-Arg-Ile-Ile-Lys-Thr-Thr-Leu-Gln-Gln-Glu.

In addition, these bikunins may have an altered N-terminal sequence. This is Bikunine with an N-terminal extension or shortening or with meant deleted amino acids in the N-terminus. Next, these bikunins can Replacements and extensions or shortenings of the preferred ones Spacer sequences included.

Bikunins from the group with the formula are preferred

Arg X ² Asp Phe Cys Leu Glu Pro Pro X ¹⁰ Thr Gly X ¹³ Cys X ¹⁵ Ala X ¹⁷ Ile X ¹⁹ Arg Tyr Phe Tyr X ²⁴ Ala X ²⁶ Ala Gly Leu Cys X ³¹ Thr Phe Val Tyr Gly Gly Cys X ³⁹ Ala X ⁴¹ Arg Asn Asn Phe X ⁴⁶ Ser Ala Glu Asp Cys Met X ⁵³ Thr Cys Gly Gly Ala Asn Ala Asn Arg X ⁶³ X ⁶⁴ Lys Thr Thr Leu Gln Gln Glu X ⁷² Pro Asp Phe Cys Leu Glu Pro Pro X ⁸¹ Thr Gly X ⁸⁴ Cys Arg Ala X ⁸⁸ Ile X ⁹⁰ Arg Tyr Phe Tyr X ⁹⁵ Ala X ⁹⁷ Ala Gly Leu Cys X ¹⁰² Thr Phe Val Tyr Gly Gly Cys X ¹¹⁰ Ala X ¹¹² Arg Asn Asn Phe Lys Ser Ala Glu Asp Cys Met X ¹²⁴ Thr Cys Gly GlyAla,

wherein X ^{2 is} Pro or a bond, X ^{10 is} Ser or Tyr, X ^{13 is} Ile or Pro, X ^{15 is} Arg, Val or Lys, X ^{17 is} Tyr, Arg or Ala, X ^{19 is} Thr or Ile, X ²⁴ Asp or Asn, X ^{26 is} Thr or Lys, X ^{31 is} Glu or Gln, X ^{39 is} Arg or Leu, X ^{41 is} Asn or Lys, X ^{46 is} Lys or Leu, X ^{53 is} Glu or Arg, X ⁶³ and X ^{64 is} each Ile or Leu, X ^{72 is} Arg or Lys, X ^{81 is} Tyr or Ser, X ^{84 is} Pro or Ile, X ^{88 is} Ala or Tyr, X is ⁹⁰ Ile or Thr, X ^{95 is} Asn or Asp, X ^{97 is} Lys or Thr, X ^{102 is} Gln or Glu, X ^{110 is} Arg or Leu, X ^{112 is} Lys or Asn and X ^{124 is} Arg or Glu.

Particularly preferred are the bikunins DesPro2-Ser10-Ile13-Arg15-Tyr17-Thr19- Asp24-Thr26 Glu31 Asn41 Glu53 Arg86 Ala88 Bikunin DesPro2 Ser10 Ile13 Arg15 Thr19 Asp24-Thr26 Glu31 Asn41 Glu53 Arg86 Ala88 Bikunin DesPro2 Arg15 Ala17  Ser81-Ile84-Arg86-Tyr88-Thr90-Asp95-Thr97-Glu102-Asn112-Glu124-bikunin DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-Arg86-Ala88-Bikunin, DesPro2- Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-Ser81-Arg86- Ala88-Asp95-Thr97-Glu102-Asn112-Glu124-Bikunin, DesPro2-Ser10-Val15-Asp24- Thr26-Glu31-Asn41-Glu53-Ser81-Arg86-Ala88-Asp95-Thr97-Glu102-Asn112-Glu124- Bikunin. These particularly preferred bikunins may also contain the amino acid proline wearing position 2.

The bikunins are useful in the inhibition of plasma kallikrein, factor Xa, plasmin and Elastase.

This invention also relates to pharmaceutical compositions containing one or more of these Aprotinin variants or bikunins.

The described novel protease inhibitors are suitable for the treatment of Disease states in which it - also as a result of complex surgical procedures such as B. in cardiac surgery or joint replacement or in the Transplantation medicine, in artificial organs - to activate the plasmatic enzyme systems by prolonged or intense Foreign surface contact and / or by cellular components of the blood comes.

The inhibitors reduce blood loss during surgeries that are associated with increased Bleeding risk (eg heart surgery, bone and joint surgery) are connected. Next, they are for the treatment of thromboembolic disease states as z. B. after operations, in hypercoagulable conditions of the blood, after accidents or can occur after the thrombolytic treatment can be used. They are suitable for Therapy for shock, polytrauma, sepsis, disseminated intravascular coagulation (DIC), Multi-organ failure (MOF), unstable angina, heart attack, stroke, embolism and deep venous thrombosis, reocclusions, perfusion damage, thrombosis and prevent bleeding after thrombolysis. They can be inflammatory Diseases involving the kallikrein system such as rheumatic  Joint disorders and asthma are used. They prevent the invasive Tumor growth and metastasis by inhibiting fibrinolysis. They are suitable also for pain and edema therapy, z. B. in traumatic brain trauma, by the Inhibition of tissue and plasmatic kallikrein. By inhibiting the intrinsic and extrinsic coagulation pathways can lead to Preventing the activation of hemostasis used in dialysis treatment become.

The invention further relates to DNA sequences which are suitable for one of the inventive Aprotinin variants or bikunins encode microorganisms carrying such a DNA Sequence included, and a method for producing the inventive Aprotinin variants and bikunins using microorganisms.

figure description

Figures 1 and 2 show the preferred aprotinin variants and bikunins of aprotinin variants of the present invention. The bold amino acid residues represent mutations of the natural aprotinin. Represents a deleted amino acid residue. The spacers of bikunins are amino acid residues 59 to 71.

Preparation of the Aprotininvarianten invention

It is for the preparation of the aprotinin variants and bikunins according to the invention favorable to use genetic engineering methods. This is done with common Molecular biological methods into a suitable microbial Expression organism the genetic information, d. H. a corresponding DNA Sequence encoding the aprotinin variants and bikunins according to the invention, for the Synthesis of the respective considered aprotinin variant introduced. The recombinant Microorganism is fermented; by choosing appropriate conditions, the heterologous genetic information for expression. The expressed aprotinin variant or the bikunin is subsequently obtained from the culture broth.  

Suitable host organisms for the production of the invention Aprotinin variants and bikunins can be bacteria, yeasts or fungi. The Expression may be intracellular or using appropriate secretion systems done extracellularly. The Aprotinvariante or the Bikunin can be processed correctly or fused to peptides or proteins.

Suitable systems for the expression of aprotinin variants have been described in the Patent applications EP 683 229, WO 89/02463, WO 90/10075 and in various further of the patent applications already mentioned above.

Methods for carrying out the invention enzymes

The enzymes used (restriction endonucleases, alkaline Calf intestine phosphatase, T4 polynucleotide kinase and T4 DNA ligase) obtained from Boehringer Mannheim and GIBCO / BRL and after Used by manufacturers.

Molecular biological techniques

Routine cloning work such. B. the Isolation of plasmid DNA from E. coli (so-called miniprep) and the transformation of E. coli with plasmid DNA were prepared according to Sambrook et al. (Molecular Cloning, Cold Spring Harbor, 1989). As a host organism for transformations, the E. coli strain DH5α₋ (GIBCO / BRL). For isolation of larger amounts of plasmid DNA was used Qiagen-tips (Qiagen). The extraction of DNA fragments from agarose gels was made using Jetsorb according to the manufacturer (Genomed).

Oligonucleotides for site-directed mutagenesis experiments and primers for PCR and PCR Sequencing reactions were performed with the company's "380A DNA synthesizer" Applied Biosystems. The mutagenesis experiments were after a Deng and Nickoloff (Deng et al., Anal. Biochem. 200, 81-88, 1992) using a kit from Pharmacia Biotech ("Unique Site Elimination mutagenesis "). All vector constructions and mutagenesis experiments  were generated by Taq cycle DNA sequencing with fluorescently labeled terminators on an "ABI 373 A Sequencer" (Applied Biosystems).

Transformation of Saccharomyces cerevisiae

Yeast cells, e.g. For example, strain JC34.4D (MATα, ura3-52, suc2) was grown in 10 ml of YEPD (2% glucose, 2% peptone, 1% Difco yeast extract) and harvested at an OD _600nm of 0.6 to 0.8 , The cells were washed with 5 ml of solution A (1 M sorbitol, 10 mM bicin pH 8.35, 3% ethylene glycol), resuspended in 0.2 ml of solution A and stored at -70 ° C.

Plasmid DNA (5 μg) and carrier DNA (50 μg of herring sperm DNA) were added to the given to frozen cells. The cells were then shaken for 5 min thawed at 37 ° C. After addition of 1.5 ml of solution B (40% PEG 1000, 200 mM Bicin pH 8.35), the cells were incubated for 60 min at 30 ° C, with 1.5 ml of solution C. (0.15 M NaCl, 10 mM Bicin pH 8.35) and washed in 100 μl of solution C resuspended. Plating took place on a selective medium with 2% agar. Transformants were obtained after incubation for 3 days at 30 ° C.

Nutrient media for fermentation 1. SD2 medium

Bacto Yeast Nitrogen Base 6.7 g / l glucose * 20 g / l KH ₂ PO ₄ 6.7 g / l pH 6.0

2. SC5 medium

glucose * 20 g / l Difco yeast extract 20 g / l KH ₂ PO ₄ 6.7 g / l (NH ₄ ) ₂ SO ₄ 2.0 g / l MgSO ₄ .7H ₂ O 1.0 g / l Trace element solution SL4 1.0 ml / l pH 6.0

Trace element solution SL4

Titriplex III 5 g / l FeSO ₄ × 7 H ₂ O 2 g / l ZnSO ₄ × 7 H ₂ O 0.1 g / l MnCl ₂ × 4 H ₂ O 0.03 g / l H ₃ BO ₃ 0.3 g / l CoCl ₂ × 6 H ₂ O 0.2 g / l CuCl ₂ × 2 H ₂ O 0.01 g / l NiCl ₂ × 6 H ₂ O 0.02 g / l Na ₂ MoO ₄ × 2 H ₂ O 0.03 g / l Autoclave AL = L <* = separately

3. Fermenter medium

glucose * 2.0 g / l Soy peptone 25.0 g / l KH ₂ PO ₄ 1.4 g / l MgSO ₄ × 7H ₂ O 1.0 g / l thiamine 5.1 mg / l inositol 20 mg / l Trace element solution 3 ml / l vitamin solution 3 ml / l (NH ₄ ) ₂ SO ₄ 3.8 g / l pH 5.5

feed solution

glucose * 530 g / l (NH ₄ ) ₂ SO ₄ 5.0 g / l KH ₂ PO ₄ 2.9 g / l MgSO ₄ .7H ₂ O 3.8 g / l thiamine 13 mg / l inositol 70 mg / l Trace element solution 6.8 ml / l vitamin solution 6.8 ml / l

Trace element solution

FeCl ₃ × 6 H ₂ O 13.5 g / l ZnCl ₂ × 4 H ₂ O 2.0 g / l H ₃ BO ₃ 0.5 g / l CoCl ₂ × 6 H ₂ O 2.0 g / l CuSO ₄ × 5 H ₂ O 1.9 g / l Na ₂ MoO ₄ × 2 H ₂ O 2.0 g / l CaCl ₂ × 2 H ₂ O 1.0 g / l HCl conc. 100 ml / l Autoclave AL = L <* = separately

vitamin solution

riboflavin 0.42 g / l Ca pantothenate 5.9 g / l nicotinic acid 6.1 g / l pyridoxine hydrochloride 1.7 g / l biotin 0.06 g / l folic acid 0.04 g / l

Production of canned goods

200 ml of SD2 medium in a 1 l Erlenmeyer flask were used with a stock preserve 1% inoculated. The culture was 72 hours at 28 ° C on the shaker (260 rpm) incubated. After that, 2 ml were each filled into canned containers and in liquid nitrogen frozen.

Fermentation in shake flask

As a preculture, 200 ml of SD2 medium in a 1 L flask 1% with a working inoculated and fermented for 72 hours at 28 ° C on a shaker (260 rpm). With the preculture, main cultures (200 ml SC medium in 1 liter flask) became 1% inoculated and incubated on the shaker at 28 ° C for 72-96 hours.

Fermentation in 10 l bioreactors

As a preculture, 200 ml of SD2 medium in a 1 L flask 1% with a working inoculated and fermented for 72 hours at 28 ° C on a shaker (260 rpm). The main culture in the 10 L fermenter was as fed-batch fermentation over 96 hours carried out. As a nutrient medium fermenter medium was used, the starting volume was 7 l. The fermenter was inoculated with 200 ml of preculture.

fermentation conditions

Temperature: 28 ° C
Stirrer speed: 500 rpm
Ventilation: 10 l / min
pH: 5.5
Headspace pressure: 200 mbar.

After 7 hours of fermentation, the feeding was started. The feeding rate was controlled by the respiratory quotient (RQ) (RQ = CO _{2 formed} / consumed oxygen). If the RQ increased to values <1.15, the feed rate was reduced, it dropped to values <1.05, the feeding rate was increased.

At regular intervals samples were taken from the fermenter and the Cell growth determined by measuring the optical density at 700 nm. also the concentration of protease inhibitors in the supernatant was tested Activity measurement determined.

At fermentation end, the pH was increased by adding 50% (w / v) Lowered citric acid to 3.0 and heated the fermenter to 70 ° C for 10 min. The Cells were then separated by centrifugation at 7500xg and the Supernatant released for protein purification.

Materials for protein analysis

The sequence analyzes were performed with a protein sequencer Model 473A from the company Applied Biosystems (Forster City, U.S.A.). The Standard sequencing program was used. The sequencer, the various sequencing programs as well as the PTH detection system are in Detail in the operating manual (User's manual protein sequencing system model 473A (1989) Applied Biosystems Forster City, CA 94404, U.S.A.).

The reagents for the operation of the sequencer and the HPLC column for the PTH Detection was purchased from Applied Biosystems.

The HPLC analyzes were carried out on a HP1090 HPLC system from Hewlett Packard (D - Waldbronn). An RP-18 HPLC column (250 mm x 4.6 mm, 5 μ  Material, 30 nm (300 angstroms) pore diameter) from Backerbond (D-Groß Gerau) was used for the separation.

Capillary electrophoresis Model 270A-HT was manufactured by Applied Biosystems (Forster City, CA 94404, U.S.A.). The samples were usually hydrodynamically over injected different time intervals. The capillary column used (50 μm × 72 cm) was from Applied Biosystems.

The amino acid analyzes were performed with an LC3000 amino acid analyzer Eppendorf Biotronik (D-Maintal). A slightly modified one Biotronik standard separation program was used. The separation programs and the Function of the analyzer are described in detail in the manual of the device.

The molecular weights were measured with a MALDI I system from Kratos / Shimadzu (D Duisburg) determined. The SDS electrophoreses were performed with a Electrophoresis system from Pharmacia (D-Freiburg).

The determination of the kinetic data was carried out with the microtiter plate reader of SLT (D-Crailsheim) carried out. The washing of the microtiter plates was performed with a Washer made by Dynatec (D-Denkendorf).

Enzymes and substrates were from Calbiochem (D-Bad Soden). All other Chemicals and reagents were manufactured by Merck (D-Darmstadt) or Sigma (D Deisenhofen). 96 well plates were purchased from Greiner.

The polyclonal rabbit anti-aprotinin antibodies were administered in rabbit Immunization with aprotinin produced. The human polyclonal antibodies Aprotinin antibodies are from patients treated with aprotinin.  

Protein chemical analysis N-terminal sequence analysis

1-3 nmol protease inhibitor dissolved in water on a sequencer sheet pre-incubated with Polybren®. The protein was sequenced with the almost normal sequencer cycle. The PTH amino acids were identified by online HPLC using a 50 pmol PTH standard.

amino acid analysis

200 μg protein was dissolved in 200 μl 6 N HCl and added for 1 h Hydrolyzed 166 ° C. About 1 nmol of the sample was placed on the amino acid analyzer given. The amount of amino acid was determined via a 5 nmol standard. Cysteine, after the performic acid oxidation of the protein (C.H.W. Hirs, Methods Enzymol. 11, 59-62) as described above.

SDS gel electrophoresis

SDS gel electrophoresis was performed according to the conditions performed by Laemmli. 10 μg of the protease inhibitor were mixed with a 10-20% SDS gel analyzed and visualized by silver staining (Merril et.al.). (U.K. Laemmli, Nature 227, 680-685 (1970) and C.R.Merril, M.L.Dunau, D.Goldman, Anal. 110: 201-207 (1981)).

capillary

8 ng of the protease inhibitor were by capillary electrophoresis on a glass column (length 72 cm, inner diameter 50 μm) examined. Conditions: current 65 μA, column temperature 30 ° C, 100 mM Phosphate buffer pH 3.0, detection 210 nm, task under pressure 1 s.

Reverse phase chromatography

5 nmol of the protease inhibitor were on a Bakerbond RP-18 HPLC column (5μ material, 4.6mm x 250mm, 30nm (300 Angstrom) pore size). The eluent was an acetonitrile / TFA Gradient used. Conditions: flow 0.7 ml / min, column temperature 40 ° C, Detection 210 nm, solvent A: 0.1% TFA, solvent B: 0.1% TFA / 60% acetonitrile; Gradient: 0 min. 0% B, 10 min. 0% B, 70 min. 100% B, 80 min. 0% B.  

Molecular Weight Determination

1 μg of the protease inhibitor was mixed with the MALDI Technology analyzed. The matrix used was sinapinic acid. The standard proteins for mass calibrations were melittin (2847 Da), bovine insulin (5734 Da), cytochrome C (12327 Da) and myoglobin (16951 Da).

protein content

The protein content of the samples was determined by amino acid analysis or determined by measuring the OD280 nm.

Trypsin inhibition test (titrimetric)

The trypsin inhibitory activity of the protease Inhibitors in the fermentation broths were via the trypsin-catalyzed hydrolysis of Nα-benzoyl-L-arginine ethyl ester (BAEE). The number involved in the reaction liberated carboxyl groups, which are determined by an alkali titration provides a measure of the tryptic inhibitory activity of the inhibitors.

Determination of cross-reaction of the protease inhibitors with polyclonal rabbits or human anti-aprotinin antibodies

0.5-10 ng protease inhibitor or aprotinin dissolved in the coupling buffer were added overnight at 4 ° C to a microtiter plate bound. The wells were washed 4 times with 300 μl wash buffer each and then Added 100 μl of the blocking solution. The plate was covered and one hour incubated at 37 ° C. After washing as described above, the polyclonal Rabbit anti-aprotinin antibody (0.2 μg / ml in 1% BSA in PBS buffer) or the polyclonal human antibodies (20 μg / ml in 1% HSA in PBS buffer). The plate was covered, incubated for one hour at 37 ° C and then washed as described above. Now, 100 μl of biotinylated anti-rabbit or anti-human Antibody (25 μl + 10 ml 1% BSA or 1% HSA in PBS buffer) was added and incubated for one hour at 37 ° C. The plate was washed as described above and then 100 μl streptavidin-peroxidase complex (50 μl + 10 ml 1% BSA or 1% HSA in PBS buffer) to each well. The plate was covered and one Incubated at 37 ° C and then washed as described above.  

Substrate reaction was performed with TMB substrate + peroxidase solution (1 + 1; 100 μl per well Well). The reaction was after 10 min with 100 ul / well 2 M Phosphoric acid stopped and the absorbance at 450 nm measured (reference 570 nm).

solutions

• 1. Coupling buffer: 15 mM Na ₂ CO ₃ , 35 mM NaHCO ₃ , pH 9.6.
• 2. Sample Buffer: The samples were in a suitable concentration in 1% BSA or HSA dissolved in PBS buffer pH 7.
• 3. Wash Solution: 0.1% (v / v) Tween®-20 in PBS.
• 4. Blocking buffer: 3% (w / v) BSA or HSA in PBS.

Determination of inhibitory constants

Determination of inhibitory Constants with different enzymes were carried out according to Bieth (J.G.Bieth Methods in Enzymology 248: 59-84 (1995)).

The substrates were Chromozym PL for plasmin, HD-Pro-Phe-Arg-pNA for factor XI, S-2444 for trypsin, Suc-Phe-Leu-Phe-pNA for chymotrypsin, Bz-Ile-Glu-Gly-Arg-pNA for FXa, HD-Val-Leu-Arg-pNA for urokallikrein and HD-Pro-Phe-Arg-pNA.

Examples example 1 Preparation of a yeast expression vector for the secretion of recombinant Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53- aprotinin

The starting material for the preparation of the Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin gene was a Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin gene in one modified pYES2 vector (plU28.11.L). The GAL1 promoter present on the vector pYES2 (Invitrogen) and the f1 ori are replaced in this vector by the MFα1 promoter. To remove the Xhol cleavage site in the "multiple cloning site" at the 3 'end of the aprotinin variant, the vector plU28.11.L was digested with EcoRI and partially with XbaI and subsequently filled in with Klenow polymerase and dNTPs. The vector resulting from this cloning (plU17.4.M) was subjected to the mutagenesis primer A of a double-stranded mutagenesis reaction according to the USE method (Pharmacia Biotech), wherein the restriction could be carried out with Xhol, as by the mutagenesis singular Xhol site in the aprotinin gene is removed. The mutagenesis primer A had the following sequence:

This primer generates the mutations Ile13, Tyr17 and Thr19 in the Ser10-Arg15-Ala17- Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin gene. The analysis of the clones was carried out by a restriction digest with the enzymes Xbal and Xhol. The desired sequence was also confirmed by DNA sequencing of the clone plU2.7.M. yeast cells (JC34.4D) were transformed with the vector plU2.7.M. The expression vector plU2.7.M no longer contains an α-factor pro sequence, so that the processing of the Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin finally done by the signal peptidase and becomes independent of the cleavage by the KexII protease.

Example 2 Preparation of a yeast expression vector for the secretion of recombinant Ser10-Ile13 Arg15 Tyr17 Thr19 Asp24 Thr26 Glu31 Leu39 Asn41 Glu53-aprotinin

The starting material for the preparation of the Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Leu39-Asn41-Glu53-aprotinin gene was a Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin gene in the vector plU17.4.M (see Example 1). The vector plU17.4.M was subjected to the mutagenesis primers A (see Example 1) and B of a double-stranded mutagenesis reaction according to the USE method (Pharmacia Biotech), wherein the restriction could be carried out with Xhol, since by the Mutagenesis with the primer A the unique Xhol interface in the aprotinin gene is removed. The mutagenesis primer B had the following sequence:

5 'TACGGCGGCTGCTTGGCTAACCGTAAC 3'.

The primer A generates the mutations Ile13, Tyr17 and Thr19 of the primer B the Mutation Leu39 in Ser10-Arg15-Ala17-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin Gene. The clones were analyzed by restriction digestion with the enzymes Xbal and Xhol. The desired sequence was also confirmed by DNA sequencing of the clone pES8.4.O confirmed. Yeast cells (JC34.4D) were mixed with the vector pES8.4.O transformed.

Example 3 Production of a yeast expression vector for the secretion of recombinant Nantem Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-aprotinin with the natural N-ter min sequence "Arg-Pro-Asp"

For the production of a yeast expression vector which allows the secretion of Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-aprotinin with the natural N-terminal sequence "Arg-Pro-Asp", first the MFα1 promoter with the α-factor Pre-sequence and the 5 'end of the aprotinin gene (up to the recognition sequence of the restriction enzyme Xhol) amplified by PCR and cloned. The primers used had the following sequences:
Primer C (the EcoRV recognition sequence is underlined):

Primer D (the Xhol recognition sequence is underlined):

The PCR batch contained 200 ng pA202 plasmid DNA, 0.2 pM primer C, 0.2 μM primer D, 200 pM dNTPs, 1 × PCR reaction buffer 11 (Stratagene, Opti-Prime®) and 2.5 U Taq DNA polymerase (Perkin Elmer) in a total volume of 50 μl. The "Cycle" Conditions were: 1 min at 94 ° C, 30 cycles of 1 min each at 94 ° C, 1 min 50 ° C and 2 min at 72 ° C and a subsequent 5 min incubation at 72 ° C. The PCR mixture was diluted 1: 5 and ligated with the vector pCRII (Invitrogen). With the Ligation batch were transformed into E. coli DH5α cells. Positive clones were after a restriction digest with the enzyme EcoRI identified and several clones sequenced. The clone plU20.11.L was used for further work.

The E. coli / yeast shuttle vector pYES2 (Invitrogen) was used for the construction of a Yeast secretion vector in which the Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46- Aprotinin sequence is linked directly to the yeast alpha-factor pre-sequence. First, the vector pYES2 with the restriction enzymes Sspl and BamHI cut, dephosphorylated and gel purified. The one on the vector pYES2 existing GAL1 promoter and the f1 ori are removed here. An approx. 1030 bp large DNA fragment was digested with EcoRV and Xhol from vector pIU20.11.L excised, purified by agarose gel electrophoresis and co-purged with an approximately 180 bp Xhol and BamHI fragment from the vector pEM24.3.L in cloned with the SspI and BamHI vector pYES2. With the Ligation batch were transformed into E. coli DH5α cells. Positive clones were after a restriction digest with the enzyme Xhol identified and sequenced. yeast cells (JC34.4D) were isolated with the vector pEM1.4.L resulting from this cloning transformed.

Example 4 Production of a yeast expression vector for the secretion of recombinant Nantem DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-Spacer-Arg15-Ala17-Bikunin

As starting material for the production of the recombinant DesPro2-Ile13-Arg15- Tyr17-Thr19-Leu39-Leu46-spacer-Arg15-Ala17-bikunin gene served a DesPro2- Ile13-Arg15-Tyr-17-Thr19-Leu-39-Leu46 gene, one Arg15-Ala17 gene and two  Oligonucleotides that generate the spacer. Each aprotinin variant gene was coupled by means of a PCR reaction to one of the Spaceroligonukleotide and in a PCR cloning vector ligated.

Spacer oligonucleotide 1

Spacer oligonucleotide 2

The PCR assay contained 570 ng of pEM30.3.L plasmid DNA (encoding DesPro (2) - Ile (13) Arg (15) -Tyr (17) -Thr (19) -Leu (39) -Leu (46 ) -Protinin), 20 pmol primer E (primer E binds in the α-factor leader and has the following sequence: 5 'AACGGGTTATTGTTTATA 3'), 60 pmol spacer oligonucleotide 1, 200 μM dNTP, 1x PCR reaction buffer II (Perkin Elmer), 2 mM MgCl ₂ and 2.5 U Taq DNA polymerase (Perkin Elmer) in a total volume of 100 μl. The "cycle" conditions were: 95 ° C for 3 minutes, 94 ° C for 25 minutes, 55 ° C for 1 minute and 72 ° C for 1 minute, followed by incubation at 72 ° C for 5 minutes. The PCR mixture was diluted 1: 5 and ligated with the vector pCRII (Invitrogen). The ligation mixture was used to transform E. coli DH5α cells. Positive clones were identified by blue-white screening (10 mM IPTG + 20 mg / ml X-gal) and after restriction digestion with the enzymes Xhol and BamHI. The clone pEM22.5.L contained the desired sequence (coding for Arg (15) -la (17) -protinin) and was used for further work.

The connection of the spacer oligonucleotide 2 with Arg15-Ala17-aprotinin was preceded by a primer extension reaction. It contained 60 pmol spacer oligonucleotide 2, 200 μM dNTP, 2 U Klenow fragment, 20 ng pEM6.6.L plasmid DNA and 2 mM MgCl ₂ in a total volume of 100 μl.

reaction conditions

Heat the test batch without Klenow fragment at 95 ° C. for 3 min. After addition of Klenow fragment was incubated for 30 min at room temperature. It was heated to 70 ° C and 2.5 U Taq DNA polymerase and 20 pmol reverse primer M13 added.

The "cycle" conditions would be: 3 min at 95 ° C, 30 cycles of 1 min each at 94 ° C, 1 min at 45 ° C and 1 min at 72 ° C and followed by a 5 min incubation 72 ° C. Approximately 150 ng of the PCR fragment were digested with the vector pCRII (Invitrogen) ligated. The ligation mixture was used to transform E. coli DH5α cells. positive Clones were identified after restriction digestion with the enzyme EcoRI and sequenced. The clone pEM12.6.L contained the desired sequence and was used for the used in further work.

A 182 bp DNA fragment was digested with Hind III and BspMI from the vector pEM22.5.L and a 240 bp DNA fragment with BamHI and BspMI from the Vector pEM 12.6.L excised, purified by agarose gel electrophoresis and ligated overnight with T4 DNA ligase. The ligation product was over the Restriction sites Hind III and BamHI cloned into the vector pUC 19. The resulting clone (pEM16.6.L) had the desired sequence.

The E. coli / yeast shuttle vector pA202 was used for the construction of a yeast Secretion vector, in which the DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39- Leu46-spacer-Arg15-Ala17-bikunin sequence with the yeast alpha-factor pre-prob Sequence is linked. The vector pA202 carries an ampicillin resistance gene (bla) and a URA3 gene as selectable marker genes for E. coli and yeast.

Other essential elements of the vector are the Col E1 and the 2 μ origin of replication (ori). The REP3 locus is also located in this region. On 1200 bp EcoRI-HindIII fragment carries the MFα1 promoter and the N-terminal ones pre-pro sequence of the yeast alpha-factor precursor protein (Kurjan and Herskowitz, Cell 30, 933-943, 1982).  

Hefevektorklonierung

From the clone pEM16.6.L is using the restriction enzymes HindIII and BamHI cut out a 422 bp fragment. This is about purified an agarose gel and also cut into HindIII and BamHI Vector pA202 cloned. The resulting clone pEM21.6.L is used for the Transformation of yeast cells (JC34.4D) used.

Other E. coli / yeast shuttle vectors with different promoters such. B. the Constitutive GAPDH or the inducible GAL10 promoter can work in a similar way also lead to the secretion of DesPro2-Ile13-Arg15-Tyr17- Thr19-Leu39-Leu46-spacer-Arg15-Ala17-bikunin.

In addition, it is of course also possible to use swing vectors with other yeasts. Replication origins such. B. the chromosomally autonomously replicating segment (ars) use.

Suitable selectable marker genes are, in addition to the URA3 gene, such genes help an aotrophic yeast mutant to prototrophy, such. B. the LEU2, HIS3 or TRP1 genes. In addition, of course, genes can be used, their products resistance to various antibiotics such. B. the Aminoglycoside G418 mediate.

Other yeasts such. As the methylotrophic yeasts Pichia pastoris or Hansenula polymorpha are also capable after transformation with suitable vectors DesPro2 Ile13 Arg15 Tyr17 Thr19 Leu39 Leu46 Spacer Arg15 Ala17 Bikunin to produce.

Example 5 Fermentation of Saccharomyces cerevisiae

A recombinant Saccharomyces cerevisae expression strain was used for the Fermentation used (see: Methods for carrying out the invention).  

Example 6 Purification of aprotinin variants without net charge at neutral pH and bikunins I. Overview of suitable purification processes

After fermentation, the cells are separated by centrifugation and the remaining supernatant is filtered to remove residual cells.

The cell-free supernatant is adjusted to pH 3 by addition of concentrated citric acid set. The solution must be suitably diluted with purified water in order to to set a conductivity of less than 8 mS / cm. Following is the solution applied to a cation exchange column, previously with an acidic buffer has been equilibrated. Unbound material is washed by extensive washing Start buffer removed. The product is eluted using a salt gradient. The fractions obtained are recovered by means of reverse phase High pressure liquid chromatography (RP-HPLC) and a biological Activity test, which determines the protease inhibition, on their product content examined. Fractions containing the product are pooled and placed directly on one preparative RP-HPLC column applied.

The column was previously equilibrated with an acidic buffer. Unbound protein is removed by washing the column with starting buffer. The product will help with eluted an organic solvent gradient. The fractions will, like already described above, re-examined for product content and those Fractions containing product are pooled. Depending on the achieved Purity of the product, it may be necessary to combine the fractions to clean over a second RP-HPLC column. The conditions are essentially the same as already described. The resulting product solution is washed with water for Injections diluted and filled in appropriate portions and freeze-dried.  

Other methods for the purification of aprotinin derivatives without net charge at neutral pH, which are combined with the processes described above are affinity chromatography on Sepharose®-immobilized trypsin and Gel permeation chromatography.

II. Purification of Ser10 Ile13 Arg15 Tyr17 Thr19 Asp24 Thr26 Glu31 Asn41 Glu53 aprotinin

Material from 10 L fermentations was purified by the following procedure. After the fermentation was completed, the fermenter content was with concentrated citric acid to pH 3 and heated to 70 ° C for 10 minutes. The cells were then centrifuged (15 minutes, 7500 x g, Heraeus Centrifuge) and the supernatant obtained is filtered (8 μm to 0.2 μm, Millipore, Germany). At this stage, the supernatant may freeze at -18 ° C until freezing be kept for further use. The solution was then passed through Addition of purified water to a conductivity of less than 8 mS / cm diluted and applied to an SP-Sepharose® FF column (Pharmacia, Sweden). The column had previously been equilibrated with 50 mM citrate-NaOH buffer, pH 3. Not bound protein was by intensive washing with the same buffer away. The product was then purified by means of a salt gradient (1 M NaCl). eluted. The resulting fractions were purified by reverse phase reaction. High pressure liquid chromatography (RP-HPLC, C4) and by testing the Protease inhibitory activity was assayed for product content.

Those fractions containing the desired product were pooled. Subsequently, the product solution was applied directly to the first RP-HPLC column (Source 15 RPC, Pharmacia, Sweden), previously 0.1% Trifluoroacetic acid / water had been equilibrated. Unbound protein became removed by intensive washing with the same buffer. The product was with Assistance of a linear acetonitrile gradient (0-70%) eluted. The fractions obtained were again based on the product content using the methods described above and those containing product were pooled and lyophilized.  

For final purification, the protein was dissolved in 150 mM NaCl / 50 mM Phosphate buffer pH 7.3 recorded and chromatographed on a Superdex 30. The fractions obtained were again based on the product content with the above investigated methods and those containing product have been united.

III. Purification of DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-Spacer-Arg15- Ala17-bikunin

Material from 10 L fermentations was purified by the following procedure. After the fermentation was completed, the fermenter content was with concentrated citric acid to pH 3 and heated to 70 ° C for 10 minutes. The cells were then centrifuged (15 minutes, 7500 x g, Heraeus Centrifuge) and the resulting supernatant filtered (8 microns to 0.2 microns, Millipore, Germany). At this stage, the supernatant may freeze at -18 ° C until freezing be kept for further use. The solution was then passed through Addition of purified water to a conductivity of less than 8 mS / cm diluted and applied to an SP-Sepharose® FF column (Pharmacia, Sweden). The column had previously been equilibrated with 50 mM citrate-NaOH buffer, pH 3. Not bound protein was by intensive washing with the same buffer away. The product was then purified by means of a salt gradient (1 M NaCl). eluted. The fractions obtained were after adjusting to less than 8 mS / cm with a Sepharose® HP chromatographed. The column was previously exposed to 20 mM Hepes NaOH buffer, pH 6 has been equilibrated. Unbound protein was through intensive washing with the same buffer removed. Subsequently, the Product eluted with the aid of a salt gradient (1 M NaCl).

The resulting fractions were purified by reverse phase reaction. High pressure liquid chromatography (RP-HPLC, C4) and by testing the Protease inhibitory activity was assayed for product content. Those Fractions containing the desired product were pooled.  

Subsequently, the product solution was applied directly to the first RP-HPLC column (Source 15 RPC, Pharmacia, Sweden), previously 0.1% Trifluoroacetic acid / water had been equilibrated. Unbound protein became removed by intensive washing with the same buffer. The product was with Assistance of a linear acetonitrile gradient (0-70%) eluted. The fractions obtained were again based on the product content using the methods described above and those containing product were pooled and lyophilized.

For final purification, the protein was ligated to a Source S30 with a Hepes / NaCl gradient pH 6 chromatographed. The resulting fractions were again examined for product content using the methods described above and those containing product were combined and lyophilized.

Example 7 Determination of the Ki value of human plasmin with Ser10-Ile13-Arg15- Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin

1 U human plasmin was diluted to 16 ml with buffer (0.2 M tris- (hydroxymethyl) -aminomethane, 0.01 M CaCl ₂ , 0.05% Tween®-20, pH 8, 1 ml benzyl alcohol / L). 200 μl of this enzyme solution was spiked with decreasing volumes of assay buffer (250, 240, 230, 220, 200, 180, 170, 150, 100, 50 μl) and then increasing amounts of inhibitor added in the assay buffer (10, 20, 30, 50, 70 , 80, 100, 150, 200 and 250 μl, concentration 0.6 μg / μl).

The enzyme / inhibitor solution was preincubated for 4 h at room temperature, then 180 μl of each solution was added to the well of a microtiter plate and treated with 20 μl substrate solution. The change in absorbance was measured at 405 nm for 10 min. The rate of enzyme reactions was determined and the Ki value calculated therefrom by the method of Bieth (Biochemical Medicine 32: 387-97 (1984) or Meth. In Enzyme 248: 59-84 (1995)).
Substrate Stock solution: 0.1 M in DMSO
Substrate solution: 1 × 10 ^-3 M chromozyme PL in assay buffer
Assay buffer: 0.2 M tris- (hydroxymethyl) -aminomethane,
0.01M CaCl ₂ , 0.05% Tween®-20; pH 8; 1 ml of benzyl alcohol / l.

The kinetic constants of the complexation with the enzymes kallikrein, factor Xa, Trypsin and chymotrypsin were determined by the same procedure. The Substrates were HD-Pro-Phe-Arg-pNA for plasma kallikrein, S-2444 for trypsin, sucrose. Phe-Leu-Phe-pNA for chymotrypsin and Bz-Ile-Glu-Gly-Arg-pNA for FXa.

Kinetic constants of bikunins, single domains of bikunins and PEG conjugates were determined by the same method.

Example 8 Results of the Proteinochemical Characterization of Ser10-Ile13 Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin

The protease inhibitor Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41- Glu53-aprotinin was produced by a genetically engineered yeast organism Secretion produced. From the yeast supernatant he was different purified chromatographic procedures to homogeneity. The identity of the Inhibitors with the cloned sequence show the following protein analysis Investigations.

N-terminal sequence analysis

The protease inhibitor was completely sequenced over 58 steps. The following list shows the particular protein sequence that is identical to the cloned sequence:

amino acid analysis

The amino acid analysis represents an important quantitative Parameter for the characterization of a protein. In addition to the protein content is with known primary structure determines the number of single amino acids. The Amino acid analysis of Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41- Glu53-aprotinin is in good agreement with the theoretical values from the Primary structure (Table 1).

Table 1

Amino acid analysis of Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin. The integers are based on Ala = 6.

Reverse phase chromatography

In the HPLC chromatography of proteins chemically bound reversed phases occur via a hydrophobic Interaction of the proteins to bind to the phase used. The proteins be according to the strength of their binding to the stationary phase of organic Solvents (mobile phase) displaced. Because of this, this method is one  good criterion for assessing the purity of a protein. The protease inhibitor Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin elutes as slender peak of an RP-18 phase.

CE chromatography

Capillary electrophoresis allows the separation of peptides and proteins due to their charge in the electric field. The goodness of the separation depends on the buffer, the pH, the temperature and the used Additives off. As capillaries so-called "fused silica" columns with a Internal diameter of 50 to 100 microns used. The protease inhibitor Ser10-Ile13- Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin was fused to a "fused silica "column in electric field isolated .The electropherogram shows a slim peak.

Molecular Weight Determination

The molecular weight of Ser10-Ile13-Arg15-Tyr17- Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin was added by the MALDI technique 6425 daltons. The determined molecular weight is good Consistent with the theoretical value of 6408 daltons in the context of Accuracy of the measuring method. Sinapinic acid was used as a matrix.

SDS gel electrophoresis

Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41- Glu53-aprotinin was under reducing and not by SDS electrophoresis analyzed reducing conditions. The gels show a band in the range of about 6.5 kD.

Example 9 Determination of Ki values for the complexation of enzymes with Ser10 Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin

The inhibitory constants of Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26- Glu31-Asn41-Glu53-aprotinin were determined for various enzymes. In the Table 2 shows the Ki values.  

Inhibitory constants of complexation of Ser10-Ile13-Arg15-Tyr17- Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin with the enzymes plasma kallikrein, Plasmin, factor Xa and chymotrypsin

Inhibitory constants of complexation of Ser10-Ile13-Arg15-Tyr17- Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin with the enzymes plasma kallikrein, Plasmin, factor Xa and chymotrypsin

Example 10 Interaction of the protease inhibitors with polyclonal rabbits or human anti-aprotinin antibodies

The recombinantly produced protease inhibitors were tested for their cross-reactivity examined with polyclonal rabbit or human anti-aprotinin antibodies. It was found that the different protease inhibitor variants only one very weak cross-reactivity to the polyclonal used Rabbit or human anti-aprotinin antisera show.

Example 11 Determination of the Ki value of human urinary kallikrein with DesPro2 Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-spacer-Arg15-Ala17-bikunin

The determination of the Ki value with human urokallikrein was carried out as described in Example 7. The inhibitor concentration used was 1.1 μg / μl.

Substrate Stock solution: 0.1 M in DMSO
Substrate Solution: 1 x 10 ^-3 M HD-Val-Leu-Arg-pNA in Assay Buffer
Assay Buffer: 0.05 M Tris- (hydroxymethyl) -aminomethane, 0.1 M NaCl, 0.05% Tween®-20; pH 7.5; 1 ml of benzyl alcohol / l.

The kinetic constants of complexation with the enzymes kallikrein, factor Xa, chymotrypsin and plasmin were used according to the same procedure certainly. The substrates were HD-Pro-Phe-Arg-pNA for plasma kallikrein, suc-phe- Leu-Phe-pNA for chymotrypsin, Bz-Ile-Glu-Gly-Arg-pNA for FXa and chromozyme PL for plasmin.

Example 12 Results of the Protein Chemical Characterization of DesPro2 Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-spacer-Arg15-Ala17-bikunin

The Protease Inhibitor DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46 Spacer Arg15-Ala17-bikunin was produced by a genetically engineered yeast organism produced by secretion. From the yeast supernatant he was different purified chromatographic procedures to homogeneity. The identity of the Inhibitors with the cloned sequence show the following protein analysis Investigations.

sequence analysis

The protease inhibitor was completely sequenced. The sequencing was performed N-terminally, via fragments of the bikunin isolated from the culture supernatant and via cyanogen bromide peptides. The following list shows the particular protein sequences of the fragments: N-terminal sequencing (underlined), fragment of bikunin from the culture supernatant of yeast fermentation (bold), cyanogen bromide fragment (in italics). The determined sequence is identical to the cloned sequence.

amino acid analysis

The amino acid analysis represents an important quantitative Parameter for the characterization of a protein. In addition to the protein content If the primary structure is known, the number of single amino acids is determined. The Amino acid analysis of DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-spacer Arg15-Ala17-bikunin is in good agreement with the theoretical values the primary structure (Table 3).

Table 3

Amino acid analysis of DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46- Spacer-Arg15-Ala17-bikunin. The integers are based on Arg = 10.

Reverse phase chromatography

In the HPLC chromatography of proteins chemically bound reversed phases occur via a hydrophobic Interaction of the proteins to bind to the phase used. The Proteins become dependent on the strength of their binding to the stationary phase of displaced organic solvents (mobile phase). That's why this one is Method a good criterion for assessing the purity of a protein. DesPro2- Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-spacer-Arg15-Ala17-bikunin elutes as clean peak from the RP-18 phase.

Molecular Weight Determination

The molecular weight of DesPro2-Ile13-Arg15- Tyr17-Thr19-Leu39-Leu46-spacer-Arg15-Ala17-bikunin was labeled with the MALDI Technique destined to 14314 daltons. The determined molecular weight is good Conformity with the theoretical value of 14313 daltons in the context of Accuracy of the measuring method. Sinapinic acid was used as a matrix.

SDS gel electrophoresis

DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-spacer Arg15-Ala17-bikunin was analyzed by non-reducing SDS electrophoresis Conditions analyzed. The gel shows a band in the range of about 14 kD.  

Example 13 Determination of Ki values for the complexation of enzymes with DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-spacer-Arg15-Ala17-bikunin

The inhibitory constants of DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46- Spacer Arg15-Ala17 bikunin were determined for various enzymes. In the Table 4 shows the Ki values.

Inhibitory constants of complexation of DesPro2-Ile13-Arg15- Tyr17-Thr19 Leu39 Leu46 Spacer Arg15 Ala17 Bikunin with the enzymes Urokallikrein, factor Xa, bovine chymotrypsin, plasma kallikrein and plasmin

Inhibitory constants of complexation of DesPro2-Ile13-Arg15- Tyr17-Thr19 Leu39 Leu46 Spacer Arg15 Ala17 Bikunin with the enzymes Urokallikrein, factor Xa, bovine chymotrypsin, plasma kallikrein and plasmin

Example 14 Results of the Protein Chemical Characterization of Thr-Thr-Leu Gln-Gln-Glu-Lys-DesArg1-Arg15-Ala17 aprotinin

The protease inhibitor Thr-Thr-Leu-Gln-Gln-Glu-Lys-DesArg1-Arg15-Ala17-aprotinin was made from the yeast supernatant, among other fission products of bikunin isolated various chromatographic methods. The protease inhibitor  corresponds to the back part of the bikunin. It contains the 2nd Kunitz domain. He was cleaned to homogeneity. Belonging to the Bikunin show the subsequent protein analysis.

sequence analysis

Sequencing was performed N-terminally over 60 steps. It shows the identity with the 2nd Bikunindomäne.

Reverse phase chromatography

In the HPLC chromatography of proteins chemically bound reversed phases occur via a hydrophobic Interaction of the proteins to bind to the phase used. The Proteins become dependent on the strength of their binding to the stationary phase of displaced organic solvents (mobile phase). That's why this one is Method a good criterion for assessing the purity of a protein. Thr-Thr Leu-Gln-Gln-Glu-Lys-DesArg1-Arg15-Ala17-aprotinin elutes as a clean peak of the RP-18 phase.

Molecular Weight Determination

The molecular weight of Thr-Thr-Leu-Gln-Gln-Glu Lys-DesArg1-Arg15-Ala17-aprotinin was added as a Na + ion using the MALDI technique 7154 daltons. The determined molecular weight is good Corresponds to the theoretical value of the Na⁺ ion of 7150 daltons in Frame of accuracy of the measuring method. Sinapinic acid was used as a matrix used.  

SDS gel electrophoresis

Thr-Thr-Leu-Gln-Gln-Glu-Lys-DesArg1-Arg15-Ala17- Aprotinin was under reducing and not by SDS electrophoresis analyzed reducing conditions. The gels show a band in the range of about 7kD.

Example 15 Determination of Ki values for the complexation of enzymes with Thr Thr-Leu-Gln-Gln-Glu-Lys-DesArg1-Arg15-Ala17 aprotinin

The inhibitory constants of Thr-Thr-Leu-Gln-Gln-Glu-Lys-DesArg1-Arg15- Ala17-aprotinin was determined for various enzymes. In Table 5 are the Ki values are reproduced.

Inhibitory constants of the complexation of Thr-Thr-Leu-Gln-Gln Glu-Lys-DesArg1-Arg15-Ala17-aprotinin with the enzymes urokallikrein, factor Xa, Chymotrypsin, plasma kallikrein and plasmin

Inhibitory constants of the complexation of Thr-Thr-Leu-Gln-Gln Glu-Lys-DesArg1-Arg15-Ala17-aprotinin with the enzymes urokallikrein, factor Xa, Chymotrypsin, plasma kallikrein and plasmin

Example 16 Results of the Protein Chemical Characterization of Asp (-3) Lys ( 2) -Arg (-1) -DesPro2-Ile13-Arg15-Thr19-Tyr17-Leu39-Leu46-Asn59-aprotinin Ala60- Asn61

The protease inhibitor Asp (-3) -Lys (-2) -Arg (-1) -DesPro2-Ile13-Arg15-Tyr17-Thr19- Leu39-Leu46-aprotinin-Asn59-Ala60-Asn61 was added from the yeast supernatant other fission products of bikunin by different chromatographic Procedure isolated. The protease inhibitor corresponds to the anterior part of the bikunin. It contains the 1st Kunitz domain. He was cleaned to homogeneity. The Belonging to Bikunin show the following protein analysis Investigations.

sequence analysis

The sequencing was performed N-terminal over 21 steps. It shows the identity with the 1st bikunin domain.

Reverse phase chromatography

In the HPLC chromatography of proteins chemically bound reversed phases occur via a hydrophobic Interaction of the proteins to bind to the phase used. The Proteins become dependent on the strength of their binding to the stationary phase of displaced organic solvents (mobile phase). That's why this one is Method a good criterion for assessing the purity of a protein. The Protease inhibitor Asp (-3) -Lys (-2) -Arg (-1) -DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39- Leu46-aprotinin-Asp59-Ala60-Asn61 elutes as a clean peak from the RP-18 Phase.  

Molecular Weight Determination

The molecular weight of Asp (-3) -Lys (-2) -Arg (-1) - DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46 aprotinin-Asn59-Ala60-Asn61 was determined to be 7118 daltons using the MALDI technique as the Na + ion. That determined Molecular weight is in good agreement with the theoretical value of NaOH of 7117 Daltons within the accuracy of the measurement method. Sinapinic acid was used as a matrix.

capillary

The protease inhibitor Asp (-3) -Lys (-2) -Arg (-1) -DesPro2-Ile13- Arg15-Tyr17-Thr19-Leu39-Leu46-aprotinin-Asn59-Ala60-Asn61 was used Capillary electrophoreses under analyzed. The inhibitor shows a slender peak at approx. 12 min.

Example 17 Determination of Ki values for the complexation of enzymes with Asp (- 3) -Lys (-2) -Arg 5 (-1) -DesPro2-Ile13-Arg15-Thr19-Tyr17-Leu39-Leu46-Asn59-Ala60 aprotinin-Asn61

The inhibitory constants of Asp (-3) -Lys (-2) -Arg (-1) -DesPro2-Ile13-Arg15- Tyr17-Thr19-Leu39-Leu46-aprotinin-Asn59-Ala60-Asn61 were used for various Enzymes determined. Table 6 shows the Ki values.

Inhibitory constants of complexation of Asp (-3) -Lys (-2) -Arg (-1) - DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-aprotinin-Asn59-Ala60-Asn61 with the enzymes Factor Xa, plasma kallikrein and plasmin

Inhibitory constants of complexation of Asp (-3) -Lys (-2) -Arg (-1) - DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-aprotinin-Asn59-Ala60-Asn61 with the enzymes Factor Xa, plasma kallikrein and plasmin

Example 18 Synthesis and Purification of Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24- Thr26-Glu31-Asn41-Glu53-aprotinin PEG-5000

Ser10-Ile13-Arg15-Asp24-Thr19-Tyr17-Thr26-Glu31-Asn41-Glu53-aprotinin was treated with SC-PEG-5000 which specifically reacts with the free NH ₂ groups in 0.2 M borate buffer pH 8.3 for 1 h reacted at 37 ° C with gentle shaking. Unreacted inhibitor or SC-PEG-5000 was removed by gel filtration on a Superdex 30 with 50 mM Na phosphate / 150 mM NaCl pH 7.2.

The SC-PEG-5000 (succinimidyl carbonate polyethylene glycol monomethyl ether-5000; average molecular weight 5 kD) was purchased from Calbiochem, D - Bad Soden.

Example 19 Results of the Protein Chemical Characterization of PEG-Ser10 Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin

The Protease Inhibitor PEG-Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31- Asn41-Glu53-aprotinin was reported by the gel filtration after reaction Separated starting materials and used for characterization.

sequence analysis

The sequencing was performed N-terminal over 21 steps. It shows the identity of the inhibitor used.

SDS gel electrophoresis

PEG-Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31- Asn41-Glu53-aprotinin was reduced by SDS electrophoresis Conditions analyzed. The gel shows a band in the range of about 12 kD.  

Example 20 Determination of Ki values for the complexation of enzymes with PEG- Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin

The inhibitory constants of PEG-Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24- Thr26-Glu31-Asn41-Glu53-aprotinin were determined for various enzymes. In Table 7 shows the Ki values.

Inhibitory constants of complexation of PEG-Ser10-Ile13- Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin with the enzymes Factor Xa, plasma kallikrein and plasmin

Inhibitory constants of complexation of PEG-Ser10-Ile13- Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin with the enzymes Factor Xa, plasma kallikrein and plasmin

SEQUENCE LISTING

Claims (17)

1. Aprotininvarianten with a net charge of +3 to -3 at pH 7, wherein in the Binding region of amino acid residue 10 Ser, amino acid residue 13 Ile, Phe or Leu is, the amino acid residue is 15 Arg, the amino acid residue is 17 Tyr, Leu or Arg and the amino acid residue is 19 Thr or Lys. 2. Aprotininvarianten according to claim 1 with an altered N-terminal and / or C-terminal sequence, in particular with an N-terminal extension or Truncation or with a deleted amino acid in the N-terminus. 3. Aprotininvarianten according to claim 1 or 2 with the formula
Arg X ² Asp Phe Cys Leu Glu Pro Pro Ser Thr Gly X ¹³ Cys Arg Ala X ¹⁷ Ile Thr Arg Tyr Phe Tyr X ²⁴ Ala Thr Ala Gly Leu Cys X ³¹ Thr Phe Val Tyr Gly Gly Cys X ³⁹ Ala Asn Arg Asn Asn Phe X ⁴⁶ Ser Ala Glu Asp Cys Met Glu Thr Cys Gly Gly Ala
wherein X ^{2 is} Pro or a bond, X ^{13 is} Ile, Phe or Leu, X ^{17 is} Tyr Leu or Arg, X ^{24 is} Asp or Asn, X ^{31 is} Glu or Gln is X ³⁹ Arg or Leu, X ⁴⁶ Lys or Leu is or polyethylene glycol derivatives thereof. 4. Aprotininvarianten according to claim 3, selected from DesPro2-Ser10-Ile13-Arg15- Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin, DesPro2-Ser10-Ile13-Arg15- Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin, DesPro2-Ser10-Ile13-Arg15-Tyr17- Thr19 Asp24 Thr26 Glu31 Leu39 Asn41 Glu53 Aprotinin, DesPro2 Ser10 Ile13 Arg15-Thr19-Asp24-Thr26-Glu31-Leu39-Asn41-Glu53-aprotinin, DesPro2-Ser10- Phe13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin, DesPro2- Ser10-Leu13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-aprotinin, DesPro2 Ser10 Ile13 Arg15 Tyr17 Thr19 Asp24 Thr26 Asn41 Glu53 Aprotinin, PEG DesPro2-Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu53 Asn41-aprotinin, DesPro2 Ser10 Ile13 Arg 15 Tyr17 Thr29 Thr26 Asn41 Glu53 Aprotinin.   5. Aprotininvarianten according to claim 4, wherein the amino acid in position 2 is proline. 6. Bikunins comprising two aprotinin variants linked by a spacer having a plurality of amino acid residues, wherein at least one of the arpotinin variants

• a) is an aprotinin variant in which the amino acid residue is 13 Ile, Phe or Leu, the amino acid residue is 15 Arg Val or Leu, the amino acid residue is 17 Tyr, Leu or Ala, the amino acid residue is 19 Thr or Lys, the amino acid residue is 39 Arg or Leu is and the amino acid residue is 46 Leu or Lys, or
• b) is a Aprotininvariante according to claim 1 to 5.

7. bikunins according to claim 6, wherein the spacer 10 to 40, in particular 10 to 20 Contains amino acid residues. 8. Bikunins according to claim 7, wherein the spacer is selected from the sequences: Asn-Ala-Asn-Arg-Ile-Ile-Lys-Thr-Thr-Leu-Gln-Gln-Glu, Asn-Ala-Asn-Arg-Leu-Leu-Lys- Thr-Thr-Leu-Gln-Gln-Glu, Gln-Ala-Gln-Arg-Ile-Ile-Lys-Thr-Thr-Leu-Gln-Gln-Glu, and Fragments of the same. 9. bikunins according to one or more of claims 6 to 8 with an N-terminal Extension or truncation or with a deleted amino acid in the N- Terminus. 10. Bikunins according to one or more of claims 6 to 9 having the formula
Arg X ² Asp Phe Cys Leu Glu Pro Pro X ¹⁰ Thr Gly X ¹³ Cys X ¹⁵ Ala X ¹⁷ Ile X ¹⁹ Arg Tyr Phe Tyr X ²⁴ Ala X ²⁶ Ala Gly Leu Cys X ³¹ Thr Phe Val Tyr Gly Gly Cys X ³⁹ Ala X ⁴¹ Arg Asn Asn Phe X ⁴⁶ Ser Ala Glu Asp Cys Met X ⁵³ Thr Cys Gly Gly Ala Asn Ala Asn Arg X ⁶³ X ⁶⁴ Lys Thr Thr Leu Gln Gln Glu X ⁷² Pro Asp Phe Cys Leu Glu Pro Pro X ⁸¹ Thr Gly X ⁸⁴ Cys Arg Ala X ⁸⁸ Ile X ⁹⁰ Arg Tyr Phe Tyr X ⁹⁵ Ala X ⁹⁷ Ala Gly Leu Cys X ¹⁰² Thr Phe Val Tyr Gly Gly Cys X ¹¹⁰ Ala X ¹¹² Arg Asn Asn Phe Lys Ser Ala Glu Asp Cys Met X ¹²⁴ Thr Cys Gly Gly Ala,
wherein X ^{2 is} Pro or a bond, X ^{10 is} Ser or Tyr, X ^{13 is} Ile or Pro, X ^{15 is} Arg, Val or Lys, X ^{17 is} Tyr, Ng or Ala, X ^{19 is} Thr or Ile, X ²⁴ Asp or Asn, X ^{26 is} Thr or Lys, X ^{31 is} Glu or Gln, X ^{39 is} Arg or Leu, X ^{41 is} Asn or Lys, X ^{46 is} Lys or Leu, X ^{53 is} Glu or Arg, X ⁶³ and X ^{64 is} each Ile or Leu, X ^{72 is} Arg or Lys, X ^{81 is} Tyr or Ser, X ^{84 is} Pro or Ile, X ^{88 is} Ala or Tyr, X is ⁹⁰ Ile or Thr, X ^{95 is} Asn or Asp, X ^{97 is} Lys or Thr, X ^{102 is} Gln or Glu, X ^{110 is} Arg or Leu, X ^{112 is} Lys or Asn and X ^{124 is} Arg or Glu. 11. Bikunins according to claim 10 selected from DesPro2-Ser10-Ile13-Arg15-Tyr17- Thr19 Asp24-Thr26 Glu31 Asn41 Glu53 Arg86 Ala88 Bikunin DesPro2 Ser10 Ile13 Arg15-Thr19 Asp24-Thr26 Glu31 Asn41 Glu53 Arg86 Ala88 Bikunin DesPro2 Arg15 Ala17-Ser81-Ile84-Arg86-Tyr88-Thr90-Asp95-Thr97-Glu102-Asn112-Glu124-bikunin DesPro2-Ile13-Arg15-Tyr17-Thr19-Leu39-Leu46-Arg86-Ala88-Bikunin, DesPro2- Ser10-Ile13-Arg15-Tyr17-Thr19-Asp24-Thr26-Glu31-Asn41-Glu53-Ser81-Arg86- Ala88-Asp95-Thr97-Glu102-Asn112-Glu124-Bikunin, DesPro2-Ser10-Val15-Asp24- Thr26-Glu31-Asn41-Glu53-Ser81-Arg86-Ala88-Asp95-Thr97-Glu102-Asn112-Glu124- Bikunin. The bikunin of claim 11, wherein the amino acid in position 2 is proline. 13. A pharmaceutical composition containing one or more aprotinin variants according to claims 1 to 5 and / or one or more bikunins according to claims 6 to 12. 14. Use of aprotinin variants according to claims 1 to 5 and of bikunins according to claims 6 to 12 for the manufacture of a medicament for use in the Surgery and for the treatment of thromboembolic disease states. 15. A DNA sequence encoding an aprotinin variant according to one or more of claims 1 to 5 or for a bikunin according to one or more of Claims 6 to 12. 16. A microorganism containing a DNA sequence according to claim 15.   17. A process for the preparation of a Aprotininvariante according to one or more of Claims 1 to 5 or a bikunin according to one or more of claims 6 to 12, comprising cultivating a microorganism according to claim 16.