DE102012216381A1 - Use of 4- (4-hydroxyphenyl) -2-butanone as demethylating agent - Google Patents

Use of 4- (4-hydroxyphenyl) -2-butanone as demethylating agent Download PDF

Info

Publication number
DE102012216381A1
DE102012216381A1 DE201210216381 DE102012216381A DE102012216381A1 DE 102012216381 A1 DE102012216381 A1 DE 102012216381A1 DE 201210216381 DE201210216381 DE 201210216381 DE 102012216381 A DE102012216381 A DE 102012216381A DE 102012216381 A1 DE102012216381 A1 DE 102012216381A1
Authority
DE
Germany
Prior art keywords
dna
skin
oder
cells
genes
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
DE201210216381
Other languages
German (de)
Inventor
Marc Winnefeld
Elke Grönniger
Sabine Hagemann
Torsten Schläger
Ursula Holtzmann
Jörn Söhle
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beiersdorf AG
Original Assignee
Beiersdorf AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beiersdorf AG filed Critical Beiersdorf AG
Priority to DE201210216381 priority Critical patent/DE102012216381A1/en
Priority to PCT/EP2013/067275 priority patent/WO2014040826A2/en
Publication of DE102012216381A1 publication Critical patent/DE102012216381A1/en
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/33Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
    • A61K8/35Ketones, e.g. benzophenone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Emergency Medicine (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Dermatology (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Verwendung von Himbeerketon als demethylierendes Agens.Use of raspberry ketone as a demethylating agent.

Description

Die vorliegende Erfindung betrifft kosmetische bzw. dermatologische Zubereitungen, enthaltend Wirkstoffe zur Pflege und zum Schutze der Haut, insbesondere der empfindlichen Haut wie auch ganz besonders im Vordergrunde stehend der durch intrinsische und/oder extrinsische Faktoren gealterten oder alternden Haut sowie die Verwendung solcher Wirkstoffe und Kombinationen solcher Wirkstoffe auf dem Gebiete der kosmetischen und dermatologischen Hautpflege. The present invention relates to cosmetic or dermatological preparations containing active ingredients for the care and protection of the skin, in particular the sensitive skin as well as especially in the foreground standing of intrinsic and / or extrinsic factors aged or aging skin and the use of such agents and combinations such active ingredients in the field of cosmetic and dermatological skin care.

Unter kosmetischer Hautpflege ist in erster Linie zu verstehen, daß die natürliche Funktion der Haut als Barriere gegen Umwelteinflüsse (z.B. Schmutz, Chemikalien, Mikroorganismen) und gegen den Verlust von körpereigenen Stoffen (z.B. Wasser, natürliche Fette, Elektrolyte) gestärkt oder wiederhergestellt wird. Cosmetic skin care is understood primarily to strengthen or restore the skin's natural function as a barrier against environmental influences (e.g., dirt, chemicals, microorganisms) and against the loss of endogenous substances (e.g., water, natural fats, electrolytes).

Wird diese Funktion gestört, kann es zu verstärkter Resorption toxischer oder allergener Stoffe oder zum Befall von Mikroorganismen und als Folge zu toxischen oder allergischen Hautreaktionen kommen. If this function is disturbed, it may lead to increased absorption of toxic or allergenic substances or the infestation of microorganisms and as a result to toxic or allergic skin reactions.

Ziel der Hautpflege ist es ferner, den durch tägliches Waschen verursachten Fett- und Wasserverlust der Haut auszugleichen. Dies ist gerade dann wichtig, wenn das natürliche Regenerationsvermögen nicht ausreicht. Außerdem sollen Hautpflegeprodukte vor Umwelteinflüssen, insbesondere vor Sonne und Wind, schützen und die Hautalterung verzögern. The aim of skin care is also to compensate for the daily loss of fat and water loss of the skin. This is especially important when the natural regeneration capacity is insufficient. In addition, skin care products to protect against environmental influences, especially from the sun and wind, and delay the aging of the skin.

Die chronologische Hautalterung wird z.B. durch endogene, genetisch determinierte Faktoren verursacht. In Epidermis und Dermis kommt es alterungsbedingt z.B. zu folgenden Strukturschäden und Funktionsstörungen, die auch unter den Begriff „Senile Xerosis“ fallen können:

  • a) Trockenheit, Rauhigkeit und Ausbildung von Trockenheitsfältchen,
  • b) Juckreiz und
  • c) verminderte Rückfettung durch Talgdrüsen (z.B. nach Waschen).
The chronological skin aging is caused eg by endogenous, genetically determined factors. In the epidermis and dermis, aging causes, for example, the following structural damage and dysfunctions, which may also fall under the term "senile xerosis":
  • a) dryness, roughness and formation of dryness wrinkles,
  • b) itching and
  • c) diminished fatty tissue suppression through sebaceous glands (eg after washing).

Exogene Faktoren, wie UV-Licht und chemische Noxen, können kumulativ wirksam sein und z.B. die endogenen Alterungsprozesse beschleunigen bzw. sie ergänzen. In Epidermis und Dermis kommt es insbesondere durch exogene Faktoren z.B. zu folgenden Strukturschäden- und Funktionsstörungen in der Haut, die über Maß und Qualität der Schäden bei chronologischer Alterung hinausgehen:

  • d) Sichtbare Gefäßerweiterungen (Teleangiektasien, Cuperosis);
  • e) Schlaffheit und Ausbildung von Falten;
  • f) lokale Hyper-, Hypo- und Fehlpigmentierungen (z.B. Altersflecken) und
  • g) vergrößerte Anfälligkeit gegenüber mechanischem Stress (z.B. Rissigkeit).
Exogenous factors, such as UV light and chemical noxae, can be cumulatively effective and, for example, accelerate or supplement endogenous aging processes. In the epidermis and dermis, the following structural and functional disorders in the skin occur, in particular due to exogenous factors, which go beyond the extent and quality of the damage in the case of chronological aging:
  • d) Visible vascular dilations (telangiectasias, cuperosis);
  • e) slackness and formation of wrinkles;
  • f) local hyper-, hypo- and false pigmentation (eg age spots) and
  • g) increased susceptibility to mechanical stress (eg cracking).

Die vorliegende Erfindung betrifft insbesondere Produkte zur Pflege der auf natürliche Weise gealterten Haut, sowie zur Behandlung der Folgeschäden der Lichtalterung, insbesondere der unter a) bis g) aufgeführten Phänomene. The present invention relates in particular to products for the care of naturally aged skin, as well as for the treatment of the consequential damages of photoageing, in particular of the phenomena listed under a) to g).

Produkte zur Pflege gealterter Haut sind an sich bekannt. Sie enthalten z.B. Retinoide (Vitamin A-Säure und/oder deren Derivate) bzw. Vitamin A und/oder dessen Derivate. Ihre Wirkung auf die Strukturschäden ist allerdings umfangsmäßig begrenzt. Darüber hinaus gibt es bei der Produktentwicklung erhebliche Schwierigkeiten, die Wirkstoffe in ausreichendem Maße gegen oxidativen Zerfall zu stabilisieren. Die Verwendung Vitamin A-Säure-haltiger Produkte bedingt darüber hinaus oft starke erythematöse Hautreizungen. Retinoide sind daher nur in geringen Konzentrationen einsetzbar. Products for the care of aged skin are known per se. They contain e.g. Retinoids (vitamin A acid and / or derivatives thereof) or vitamin A and / or its derivatives. Their effect on the structural damage, however, is limited in scope. In addition, there are significant difficulties in product development in stabilizing the active ingredients sufficiently against oxidative degradation. In addition, the use of vitamin A acid-containing products often causes severe erythematous skin irritation. Retinoids can therefore only be used in low concentrations.

Die Epigenetik ist ein noch relativ junges Forschungsfeld im Life Science Bereich, das in den letzten Jahren eine große Aufmerksamkeit auf sich gezogen hat. Dies ist nicht weiter verwunderlich, denn die Epigenetik untersucht, wie sich Umweltfaktoren auf unseren Körper auswirken. Dabei geht es weniger darum, die oben beschriebenen morphologischen Veränderungen weiter deskriptiv zu analysieren, sondern vielmehr darum, die zugrundeliegenden molekularbiologischen Regulationsmechanismen zu verstehen. Im Gegensatz zur klassischen Genetik beschäftigt sich die Epigenetik nicht mit Veränderungen der Primärsequenz der DNA, sondern mit den Mechanismen der Genregulation. Dabei fungiert die Epigenetik als Bindeglied zwischen Umwelt und Genom. Eine der am besten beschriebenen Komponenten der Epigenetik ist die sogenannte DNA-Methylierung. Bei der DNA-Methylierung handelt es sich um eine Modifizierung der DNA, welche in Säugetieren in der Regel symmetrisch auf beiden DNA-Strängen an der C5 Position von Cytosinnukleotiden stattfindet, wenn sich diese in 5´-Richtung neben Guanosinnukleotiden befinden (CpG) [ Bird, 202 ]. Das hohe Mutationspotenzial der methylierten Cytosinnukleotide führt dazu, dass der Anteil der CpG-Dinukleotide bezogen auf das gesamte Genom sehr gering ist. Die hydrolytische Deaminierung des methylierten Cytosins führt spontan zu der Entstehung von Thymin, wobei es zu einer TG-Fehlbasenpaarung kommt. Im Vergleich dazu findet die Deaminierung eines unmethylierten Cytosins zu Uracil wesentlich langsamer statt und die Reparatur der entstehenden UG-Fehlbasenpaarung ist wesentlich effizienter, da es sich bei Uracil nicht um eine natürlich vorkommende Base der DNA handelt [ Coulondre et a., 1978 ; Jurkowska et al., 2010 ]. Trotz der hohen Mutationsrate gibt es einige CG-reiche DNA Abschnitte im Genom, die als CpG-Inseln bezeichnet werden. Diese kurzen DNA-Abschnitte werden definiert als 0,5–4 kb lange Regionen, deren Verhältnis von tatsächlichem zu erwartetem CG-Gehalt größer als 0,65 ist [ Takai and Jones, 2002 ]. Ca. 70% aller Promotoren des humanen Genoms werden mit solchen CpG-Inseln in Verbindung gebracht [ Saxonov et al., 2006 ]. Dort liegen sie in der Regel unmethyliert vor, was mit der transkriptionellen Expression des korrespondierenden Gens korreliert. Es sind jedoch auch einige biologische Prozesse bekannt, bei denen die Methylierung einer CpG-Insel zu der Stilllegung spezifischer Gene führt. Beispiele hierfür sind die Inaktivierung des X-Chromosoms sowie Keimbahn- und gewebespezifischer Gene [ Bird, 2002 , Avner and Heard, 2001 , Bird, 1986 ]. Dies verdeutlicht die fundamentale Rolle der DNA-Methylierung für die Regulation der Genexpression. Weitaus häufiger lässt sich jedoch die Methylierung in promotorfernen Bereichen, wie z.B. in repetitiven Sequenzen oder in parasitären Sequenzen, finden, wo die Methylierung die Transkription dieser Sequenzen verhindert und somit zur Integrität des Genoms beiträgt [ Yoder et al., 1997 , Walsh et al., 1998 ]. Insgesamt weisen ca. 3–5% der Cytosine in der genomischen DNA eine Methylierung auf, was letztlich bedeutet, dass ca. 80% der gesamten CpG-Loci des Genoms methyliert sind [ Ehrlich et al., 1982 , Gama-Sosa et al., 1983 ]. Epigenetics is still a relatively young field of research in the field of life sciences, which has attracted a great deal of attention in recent years. This is not surprising, because epigenetics examines how environmental factors affect our bodies. It is not so much a matter of further descriptive analysis of the morphological changes described above, but rather of understanding the underlying molecular-biological regulatory mechanisms. In contrast to classical genetics, epigenetics is not concerned with changes in the primary sequence of DNA but with the mechanisms of gene regulation. Epigenetics acts as a link between the environment and the genome. One of the best described components of epigenetics is DNA methylation. DNA methylation is a modification of DNA, which in mammals usually takes place symmetrically on both DNA strands at the C5 position of cytosine nucleotides when they are in the 5 'direction next to guanosine nucleotides (CpG) [ Bird, 202 ]. The high mutation potential of the methylated cytosine nucleotides means that the proportion of CpG dinucleotides relative to the entire genome is very low. The hydrolytic deamination of the methylated cytosine leads spontaneously to the formation of thymine, which leads to a TG base-pairing. In comparison, deamination of an unmethylated cytosine to uracil occurs much more slowly, and the repair of the resulting UG mispair pairing is much more efficient, since uracil is not a naturally occurring base of the DNA [ Coulondre et al., 1978 ; Jurkowska et al., 2010 ]. Despite the high mutation rate, there are some CG-rich DNA segments in the genome called CpG islands. These short DNA segments are defined as 0.5-4 kb regions whose ratio of actual to expected CG content is greater than 0.65 [ Takai and Jones, 2002 ]. Approximately 70% of all promoters of the human genome are associated with such CpG islands [ Saxonov et al., 2006 ]. There they are usually unmethylated, which correlates with the transcriptional expression of the corresponding gene. However, some biological processes are known in which the methylation of a CpG island leads to the decommissioning of specific genes. Examples include the inactivation of the X chromosome as well as germ line and tissue-specific genes [ Bird, 2002 . Avner and Heard, 2001 . Bird, 1986 ]. This illustrates the fundamental role of DNA methylation in the regulation of gene expression. However, methylation can be found far more frequently in promotor-distant areas, such as in repetitive sequences or in parasitic sequences, where methylation prevents the transcription of these sequences and thus contributes to the integrity of the genome [ Yoder et al., 1997 . Walsh et al., 1998 ]. Overall, about 3-5% of the cytosines in the genomic DNA methylate, which ultimately means that about 80% of the total CpG loci of the genome are methylated [ Ehrlich et al., 1982 . Gama-Sosa et al., 1983 ].

Im Vergleich zu der DNA-Methylierung in gesunden Zellen konnte eine Vielzahl von Studienergebnissen belegen, dass das DNA-Methylierungsmuster in entarteten Krebszellen häufig verändert vorliegt. So wurde im Krebsgewebe vermehrt eine globale Methylierungsabnahme des Genoms festgestellt (Hypomethylierung), die vor allem durch eine Verminderung des Methylierungslevels in repetitiven Elementen entsteht [ Ehrlich, 2002 ]. Diese Hypomethylierung kann die Reaktivierung dieser transponierenden Elemente verursachen [ Yoder et al., 1997 , Wash et al., 1998 ] und wirkt sich somit negativ auf die genomische Integrität aus [ Gaudet, 2003 ]. Parallel zu der globalen Hypomethylierung konnte ebenso eine Hypermethylierung von CpG-Inseln beobachtet werden, die mit dem Promotorbereich von Genen assoziiert sind [ Herman and Baylin, 2000 , Jones and Baylin, 2007 ]. Diese Hypermethylierung geht häufig mit der transkriptionellen Inaktivierung des Gens einher. Da unter anderem Tumorsuppressorgene von dieser Hypermethylierung betroffen sind, kommt es zu einer Fehlregulation wichtiger zellulärer Mechanismen. Um solche epigenetischen Veränderungen von klassischen genetischen Mutationen zu unterschieden, werden sie als „Epimutationen“ bezeichnet [ Jeggo and Holliday, 1986 ]. Compared to DNA methylation in healthy cells, a variety of study results have shown that the pattern of DNA methylation in degenerated cancer cells is often altered. For example, in the cancerous tissue an increase in global methylation of the genome (hypomethylation) was observed, which is mainly due to a reduction of the methylation level in repetitive elements [ Honest, 2002 ]. This hypomethylation can cause the reactivation of these transposing elements [ Yoder et al., 1997 . Wash et al., 1998 ] and thus has a negative effect on genomic integrity [ Gaudet, 2003 ]. In parallel with global hypomethylation, hypermethylation of CpG islands associated with the promoter region of genes has also been observed [ Herman and Baylin, 2000 . Jones and Baylin, 2007 ]. This hypermethylation is often associated with the transcriptional inactivation of the gene. Since tumor suppressor genes are affected by this hypermethylation, there is a dysregulation of important cellular mechanisms. To distinguish such epigenetic changes from classical genetic mutations, they are referred to as "epimutations" [ Jeggo and Holliday, 1986 ].

Auch über die Krebsforschung hinaus wurde In den vergangenen Jahren immer klarer, dass die Epigenetik für die Entwicklung eines gesunden Organismus ebenso wichtig ist, wie die DNA selbst. Deutlich wurde bei den wissenschaftlichen Untersuchungen auch, dass das Epigenom – die Gesamtheit aller epigenetischen Modifikationen – durch äußere Einflüsse viel leichter verändert werden kann als die Gene selbst. Epigenetisch wirksame Moleküle treten dabei als die Mittler zwischen Umwelt und Erbgut in Aktion. Es konnte eindeutig nachgewiesen werden, dass äußere Faktoren Gene an- oder abschalten können und so phänotypische Veränderungen und/oder Krankheiten auslösen ( Jaenisch & Bird, 2003 , Bird et al. 2007 ; Reik, 2007 ; Feinberg, 2008 ). Neue Studien konnten außerdem zeigen, dass epigenetische Veränderungen – insbesondere des DNA-Methylierungsmusters – auch während der Alterung auftreten ( Fraga et al. 2005 ; Esteller et al. 2012 ; Winnefeld & Lyko 2012 ). Beyond cancer research, it has become increasingly clear in recent years that epigenetics is just as important for the development of a healthy organism as the DNA itself. It has also become clear in the scientific investigations that the epigenome - the totality of all epigenetic modifications - has become external influences are much easier to change than the genes themselves. Epigenetically effective molecules act as the mediators between environment and genome in action. It has been clearly demonstrated that external factors can turn genes on or off, triggering phenotypic changes and / or diseases ( Jaenisch & Bird, 2003 . Bird et al. 2007 ; Reik, 2007 ; Feinberg, 2008 ). New studies have also shown that epigenetic changes - especially of the DNA methylation pattern - also occur during aging ( Fraga et al. 2005 ; Esteller et al. 2012 ; Winnefeld & Lyko 2012 ).

Kürzlich konnte zudem gezeigt werden, dass epigenetische Veränderungen (Hypermethylierungen) auch während der Hautalterung zu beobachten sind ( Grönniger et al., 2010 ), was zu einer "Stilllegung" von hautrelevanten Genen führt. Um eine Verbesserung des Hautzustandes zu erreichen, ist es daher wünschenswert epigenetische Veränderungen – die entweder im Alter oder bei bestimmten Hautzuständen auftreten – rückgängig zu machen, um so die hautrelevanten Gene zu reaktivieren. Bis dato ist allerdings nur eine begrenzte Anzahl an Substanzen bekannt, die eine DNA-demethylierende Aktivität besitzen. In addition, it has recently been shown that epigenetic changes (hypermethylation) can also be observed during skin aging ( Grönniger et al., 2010 ), which leads to a "decommissioning" of skin-relevant genes. In order to achieve an improvement of the skin condition, it is therefore desirable to reverse epigenetic changes - which occur either in old age or in certain skin conditions - in order to reactivate the skin-relevant genes. To date, however, only a limited number of substances are known that have a DNA-demethylating activity.

In diesem Zusammenhang zeigte überraschenderweise die Substanz "Himbeerketon"(4-(4-Hydroxyphenyl)-2-Butanon) eine demethylierende Wirkung wodurch CpG-Dinukleotide in der DNA von Sec31B hypomethyliert wurden (gezeigt im COBRA Assay). Darüber hinaus konnte durch den Einsatz von Himbeerketon eine Expressionssteigerung von altersabhängig hypermethylierten Genen erreicht werden (gezeigt für die Gene Tet2, DDAH2, Sec31B). In this connection, surprisingly, the substance "raspberry ketone" (4- (4-hydroxyphenyl) -2-butanone) showed a demethylating effect whereby CpG dinucleotides were hypomethylated in Sec31B DNA (shown in the COBRA assay). In addition, the use of raspberry ketone increased the expression of age-dependent hypermethylated genes (shown for the genes Tet2, DDAH2, Sec31B).

Himbeerketon (auch Rheosmin, Oxyphenylon oder Frambinon genannt, nach IUPAC 4-(4-Hydroxyphenyl)-butan-2-on) ist ein natürlich in der Himbeere vorkommendes Phenol, das den wesentlichen Geruchseindruck der Beere ausmacht (eine sogenannte „characterimpact-Verbindung“). Raspberry ketone (also called rheosmin, oxyphenylon or frambinone, after IUPAC 4- (4-hydroxyphenyl) -butan-2-one) is a naturally occurring in the raspberry phenol, which makes up the essential odor impression of the berry (a so-called "characterimpact connection"). ).

Seine chemische Struktur ist wie folgt gekennzeichnet:

Figure DE102012216381A1_0002
Its chemical structure is characterized as follows:
Figure DE102012216381A1_0002

Die Verwendung von Himbeerketon zur Aromatisierung von Lebensmitteln und vereinzelt auch Kosmetika ist an sich bekannt. Auch wurde seine Verwendung als Hautaufheller („whitening agent“) beschrieben. The use of raspberry ketone for the flavoring of foods and occasionally cosmetics is known per se. Also, its use as a skin whitening agent has been described.

Dennoch konnte dies nicht den Weg zur vorliegenden Erfindung weisen. Nevertheless, this could not point the way to the present invention.

Die Lösung der Aufgaben, die der Erfindung zugrunde lagen, besteht folglich in der Verwendung von Himbeerketon als demethylierendes Agens. The solution of the objects on which the invention is based is therefore the use of raspberry ketone as a demethylating agent.

Vorteilhaft wird diese Verwendung in topischen Zubereitungen, insbesondere kosmetischen oder dermatologischen Zubereitungen verwirklicht. Advantageously, this use is realized in topical preparations, in particular cosmetic or dermatological preparations.

Bevorzugt enthalten kosmetische oder dermatologische Zubereitungen gemäß der Erfindung 0,001–10 Gew.-%, besonders bevorzugt 0,01–1 Gew -% Himbeerketon, bezogen auf die Gesamtzusammensetzung der Zubereitungen. Cosmetic or dermatological preparations according to the invention preferably contain 0.001-10% by weight, particularly preferably 0.01-1% by weight of raspberry ketone, based on the total composition of the preparations.

Emulsionen sind vorteilhafte Darreichungsformen im Sinne der vorliegenden Erfindung, z.B. in Form einer Crème, einer Lotion, einer kosmetischen Milch sind vorteilhaft und enthalten z.B. Fette, Öle, Wachse und/oder andere Fettkörper, sowie Wasser und einen oder mehrere Emulgatoren, wie sie üblicherweise für einen solchen Typ der Formulierung verwendet werden. Emulsions are advantageous dosage forms in the sense of the present invention, e.g. in the form of a cream, a lotion, a cosmetic milk are advantageous and contain e.g. Fats, oils, waxes and / or other fatty substances, as well as water and one or more emulsifiers, as they are commonly used for such a type of formulation.

Medizinische topische Zusammensetzungen im Sinne der vorliegenden Erfindung enthalten in der Regel ein oder mehrere Medikamente in wirksamer Konzentration. Der Einfachheit halber wird zur sauberen Unterscheidung zwischen kosmetischer und medizinischer Anwendung und entsprechenden Produkten auf die gesetzlichen Bestimmungen der Bundesrepublik Deutschland verwiesen (z.B. Kosmetikverordnung, Lebensmittel- und Arzneimittelgesetz). Medicinal topical compositions according to the present invention usually contain one or more drugs in effective concentration. For the sake of simplicity, reference is made to the clear distinction between cosmetic and medical use and corresponding products to the statutory provisions of the Federal Republic of Germany (for example, Cosmetics Regulation, Food and Medicines Act).

Es ist dabei ebenfalls von Vorteil, den erfindungsgemäß verwendeten Wirkstoff als Zusatzstoff zu Zubereitungen zu geben, die bereits andere Wirkstoffe für andere Zwecke enthalten. It is also advantageous to add the active ingredient used according to the invention as an additive to preparations which already contain other active ingredients for other purposes.

Sofern die kosmetische oder dermatologische Zubereitung im Sinne der vorliegenden Erfindung eine Lösung oder Emulsion oder Dispersion darstellt, können als Lösungsmittel verwendet werden:

  • – Wasser oder wäßrige Lösungen
  • – Öle, wie Triglyceride der Caprin- oder der Caprylsäure, vorzugsweise aber Rizinusöl;
  • – Fette, Wachse und andere natürliche und synthetische Fettkörper, vorzugsweise Ester von Fettsäuren mit Alkoholen niedriger C-Zahl, z.B. mit Isopropanol, Propylenglykol oder Glycerin, oder Ester von Fettalkoholen mit Alkansäuren niedriger C-Zahl oder mit Fettsäuren;
  • – Alkohole, Diole oder Polyole niedriger C-Zahl, sowie deren Ether, vorzugsweise Ethanol, Isopropanol, Propylenglykol, Glycerin, Ethylenglykol, Ethylenglykolmonoethyl- oder -monobutylether, Propylenglykolmonomethyl, -monoethyl- oder -monobutylether, Diethylenglykolmonomethyl- oder -monoethylether und analoge Produkte.
If the cosmetic or dermatological preparation in the sense of the present invention is a solution or emulsion or dispersion, it is possible to use as solvent:
  • - water or aqueous solutions
  • - Oils, such as triglycerides of capric or caprylic, but preferably castor oil;
  • Fats, waxes and other natural and synthetic fatty substances, preferably esters of fatty acids with lower C-number alcohols, for example with isopropanol, propylene glycol or glycerol, or esters of fatty alcohols with lower C-number alkanoic acids or with fatty acids;
  • Alcohols, diols or polyols of low C number, and their ethers, preferably ethanol, isopropanol, propylene glycol, glycerol, ethylene glycol, ethylene glycol monoethyl or monobutyl ether, propylene glycol monomethyl, monoethyl or monobutyl ether, diethylene glycol monomethyl or monoethyl ether and analogous products.

Insbesondere werden Gemische der vorstehend genannten Lösungsmittel verwendet. Bei alkoholischen Lösungsmitteln kann Wasser ein weiterer Bestandteil sein. In particular, mixtures of the abovementioned solvents are used. For alcoholic solvents, water can be another ingredient.

Die Ölphase der Emulsionen, Oleogele bzw. Hydrodispersionen oder Lipodispersionen im Sinne der vorliegenden Erfindung wird vorteilhaft gewählt aus der Gruppe der Ester aus gesättigten und/oder ungesättigten, verzweigten und/oder unverzweigten Alkancarbonsäuren einer Kettenlänge von 3 bis 30 C-Atomen und gesättigten und/oder ungesättigten, verzweigten und/oder unverzweigten Alkoholen einer Kettenlänge von 3 bis 30 C-Atomen, aus der Gruppe der Ester aus aromatischen Carbonsäuren und gesättigten und/oder ungesättigten, verzweigten und/oder unverzweigten Alkoholen einer Kettenlänge von 3 bis 30 C-Atomen. Solche Esteröle können dann vorteilhaft gewählt werden aus der Gruppe Isopropylmyristat, Isopropylpalmitat, Isopropylstearat, Isopropyloleat, n-Butylstearat, n-Hexyllaurat, n-Decyloleat, Isooctylstearat, Isononylstearat, Isononylisononanoat, 2-Ethylhexylpalmitat, 2-Ethylhexyllaurat, 2-Hexyldecylstearat, 2-Octyldodecylpalmitat, Oleyloleat, Oleylerucat, Erucyloleat, Erucylerucat sowie synthetische, halbsynthetische und natürliche Gemische solcher Ester, z.B. Jojobaöl. The oil phase of the emulsions, oleogels or hydrodispersions or lipodispersions in the context of the present invention is advantageously selected from the group of esters of saturated and / or unsaturated, branched and / or unbranched alkanecarboxylic acids having a chain length of 3 to 30 carbon atoms and saturated and / or or unsaturated, branched and / or unbranched alcohols having a chain length of 3 to 30 carbon atoms, from the group of esters of aromatic carboxylic acids and saturated and / or unsaturated, branched and / or unbranched alcohols having a chain length of 3 to 30 carbon atoms. Such Ester oils can then advantageously be chosen from the group isopropyl myristate, isopropyl palmitate, isopropyl stearate, isopropyl oleate, n-butyl stearate, n-hexyl laurate, n-decyl oleate, isooctyl stearate, isononyl stearate, isononyl isononanoate, 2-ethylhexyl palmitate, 2-ethylhexyl laurate, 2-hexyldecyl stearate, 2-octyldodecyl palmitate , Oleyl oleate, oleyl erucate, erucyl oleate, erucyl erucate and synthetic, semi-synthetic and natural mixtures of such esters, eg jojoba oil.

Ferner kann die Ölphase vorteilhaft gewählt werden aus der Gruppe der verzweigten und unverzweigten Kohlenwasserstoffe und -wachse, der Silkonöle, der Dialkylether, der Gruppe der gesättigten oder ungesättigten, verzweigten oder unverzweigten Alkohole, sowie der Fettsäuretriglyceride, namentlich der Triglycerinester gesättigter und/oder ungesättigter, verzweigter und/oder unverzweigter Alkancarbonsäuren einer Kettenlänge von 8 bis 24, insbesondere 12–18 C-Atomen. Die Fettsäuretriglyceride können beispielsweise vorteilhaft gewählt werden aus der Gruppe der synthetischen, halbsynthetischen und natürlichen Öle, z.B. Olivenöl, Sonnenblumenöl, Sojaöl, Erdnußöl, Rapsöl, Mandelöl, Palmöl, Kokosöl, Palmkernöl und dergleichen mehr. Furthermore, the oil phase can be advantageously selected from the group of branched and unbranched hydrocarbons and waxes, the silicone oils, the dialkyl ethers, the group of saturated or unsaturated, branched or unbranched alcohols, and the fatty acid triglycerides, in particular the triglycerol esters of saturated and / or unsaturated, branched and / or unbranched alkanecarboxylic acids of a chain length of 8 to 24, in particular 12-18 C-atoms. For example, the fatty acid triglycerides can be advantageously selected from the group of synthetic, semi-synthetic and natural oils, e.g. Olive oil, sunflower oil, soybean oil, peanut oil, rapeseed oil, almond oil, palm oil, coconut oil, palm kernel oil, and the like.

Auch beliebige Abmischungen solcher Öl- und Wachskomponenten sind vorteilhaft im Any mixtures of such oil and wax components are advantageous in

Die wäßrige Phase der erfindungsgemäßen Zubereitungen enthält gegebenenfalls vorteilhaft

  • – Alkohole, Diole oder Polyole niedriger C-Zahl, sowie deren Ether, vorzugsweise Ethanol, Isopropanol, Propylenglykol, Glycerin, Ethylenglykol, Ethylenglykolmonoethyl- oder -monobutylether, Propylenglykolmonomethyl, -monoethyl- oder -monobutylether, Diethylenglykolmonomethyl- oder -monoethylether und analoge Produkte, ferner Alkohole niedriger C-Zahl, z.B. Ethanol, Isopropanol, 1,2-Propandiol, Glycerin sowie insbesondere ein oder mehrere Verdickungsmittel, welches oder welche vorteilhaft gewählt werden können aus der Gruppe Siliciumdioxid, Aluminiumsilikate, Polysaccharide bzw. deren Derivate, z.B. Hyaluronsäure, Xanthangummi, Hydroxypropylmethylcellulose, besonders vorteilhaft aus der Gruppe der Polyacrylate, bevorzugt ein Polyacrylat aus der Gruppe der sogenannten Carbopole, beispielsweise Carbopole der Typen 980, 981, 1382, 2984, 5984, jeweils einzeln oder in Kombination.
The aqueous phase of the preparations according to the invention optionally contains advantageous
  • Alcohols, diols or polyols of low C number, and also their ethers, preferably ethanol, isopropanol, propylene glycol, glycerol, ethylene glycol, ethylene glycol monoethyl or monobutyl ether, propylene glycol monomethyl, monoethyl or monobutyl ether, diethylene glycol monomethyl or monoethyl ether and analogous products, furthermore low C-number alcohols, for example ethanol, isopropanol, 1,2-propanediol, glycerol and in particular one or more thickening agents, which can be advantageously selected from the group of silicon dioxide, aluminum silicates, polysaccharides or their derivatives, for example hyaluronic acid, xanthan gum , Hydroxypropylmethylcellulose, particularly advantageous from the group of polyacrylates, preferably a polyacrylate from the group of so-called Carbopols, for example Carbopols types 980, 981, 1382, 2984, 5984, each individually or in combination.

Erfindungsgemäß verwendete Gele enthalten üblicherweise Alkohole niedriger C-Zahl, z.B. Ethanol, Isopropanol, 1,2-Propandiol, Glycerin und Wasser bzw. ein vorstehend genanntes Öl in Gegenwart eines Verdickungsmittels, das bei ölig-alkoholischen Gelen vorzugsweise Siliciumdioxid oder ein Aluminiumsilikat, bei wäßrig-alkoholischen oder alkoholischen Gelen vorzugweise ein Polyacrylat ist. Gels used in the present invention usually contain low C number alcohols, e.g. Ethanol, isopropanol, 1,2-propanediol, glycerol and water or an above-mentioned oil in the presence of a thickener which is preferably silica or an aluminosilicate in oily-alcoholic gels, in aqueous-alcoholic or alcoholic gels, preferably a polyacrylate.

Feste Stifte enthalten z.B. natürliche oder synthetische Wachse, Fettalkohole oder Fettsäureester. Fixed pins contain e.g. natural or synthetic waxes, fatty alcohols or fatty acid esters.

Übliche Grundstoffe, welche für die Verwendung als kosmetische Stifte im Sinne der vorliegenden Erfindung geeignet sind, sind flüssige Öle (z.B. Paraffinöle, Ricinusöl, Isopropylmyristat), halbfeste Bestandteile (z.B. Vaseline, Lanolin), feste Bestandteile (z.B. Bienenwachs, Ceresin und Mikrokristalline Wachse bzw. Ozokerit) sowie hochschmelzende Wachse (z.B. Carnaubawachs, Candelillawachs) Conventional base materials which are suitable for use as cosmetic sticks in the context of the present invention are liquid oils (for example paraffin oils, castor oil, isopropyl myristate), semi-solid constituents (eg petrolatum, lanolin), solid constituents (eg beeswax, ceresin and microcrystalline waxes or Ozokerite) and high-melting waxes (eg carnauba wax, candelilla wax)

Als Treibmittel für aus Aerosolbehältern versprühbare kosmetische und/oder dermatologische Zubereitungen im Sinne der vorliegenden Erfindung sind die üblichen bekannten leichtflüchtigen, verflüssigten Treibmittel, beispielsweise Kohlenwasserstoffe (Propan, Butan, Isobutan) geeignet, die allein oder in Mischung miteinander eingesetzt werden können. Auch Druckluft ist vorteilhaft zu verwenden. Suitable propellants for sprayable from aerosol containers cosmetic and / or dermatological preparations in the context of the present invention, the usual known volatile, liquefied propellants, such as hydrocarbons (propane, butane, isobutane) are suitable, which can be used alone or in mixture with each other. Also, compressed air is advantageous to use.

Die erfindungsgemäße Wirkung des Himbeerketons wird nachfolgende demonstriert: The effect of raspberry ketone according to the invention is demonstrated below:

1. Kultivierung und Wirkstoffbehandlungen der HaCaT Zellen 1. Cultivation and drug treatment of HaCaT cells

Um die Zellen einer demethylierenden Behandlung zu unterziehen, wurden 100.000 Zellen in eine 25T-Flasche ausgesät. Am Folgetag wurden sie mit dPBS gewaschen und Himbeerketon (Konz. 100 µM) dem Kultivierungsmedium (KGM-Gold) zugesetzt. Als Kontrollen wurden Decitabin-(Konz. 1 µM, 5 µM) bzw. DMSO-behandelte Zellen mitgeführt. 6 Tage nach der Aussaat der Zellen wurden sie passagiert und eine Auffrischung des Mediums inkl. des Himbeerketons bzw. des Decitabins vorgenommen. Nach einer 10-tägigen Behandlung wurden die DNA und die RNA isoliert. To demodulate the cells, 100,000 cells were seeded in a 25T bottle. The following day they were washed with dPBS and raspberry ketone (conc. 100 μM) was added to the culture medium (KGM-gold). As controls, decitabine (conc. 1 μM, 5 μM) or DMSO-treated cells were carried. 6 days after sowing the cells, they were passaged and a refresh of the medium including the raspberry ketone or decitabine made. After 10 days of treatment, DNA and RNA were isolated.

2. Isolierung der genomischen DNA aus HaCaT Zellen 2. Isolation of genomic DNA from HaCaT cells

Zur Isolierung der genomischen DNA aus kultivierten Zellen wurde das QIAamp® DNA Investigator Kit von Qiagen verwendet und nach dem Protokoll „Isolation of total DNA from Tissue“ vorgegangen. Nach Zentrifugation der Zellen wurde das Zellpellet in 180 µL ATL-Puffer und 20 µL Proteinase K aufgenommen und die Zellen bei 56°C für 10 min lysiert. Alle weiteren Schritte erfolgten gemäß dem Protokoll. Nach der Aufarbeitung über die QIAamp MiniElute-Säulen wurde die DNA in 25 µL Tris-EDTA-Buffer, pH 8,0 eluiert. Im Anschluss wurde die DNA-Konzentration bestimmt. To isolate the genomic DNA from cultured cells, the QIAamp ® DNA Investigator Kit from Qiagen was used and the protocol "Isolation of total DNA from Tissue" was used. After centrifugation of the cells, the cell pellet was taken up in 180 μL ATL buffer and 20 μL proteinase K. and lysing the cells at 56 ° C for 10 min. All further steps were taken according to the protocol. After working up on the QIAamp MiniElute columns, the DNA was eluted in 25 μL Tris-EDTA buffer, pH 8.0. Subsequently, the DNA concentration was determined.

3. Bisulfit-Konvertierung der DNA 3. Bisulfite conversion of the DNA

Für die Bisulfit-Behandlung wurden maximal 1000 ng DNA eingesetzt. Das Kit EpiTect® Bisulfite Kit von Qiagen wurde nach den Herstellerangaben verwendet. Je 500 ng der Bisulfit-konvertierten DNA wurden mit 2 × 10 µL Elutionspuffer von den Säulen eluiert. Folgende Cyclereinstellungen wurden gewählt: Denaturierung 99°C 5 min Inkubation 60°C 25 min Denaturierung 99°C 5 min Inkubation 60°C 1 h 25 min Denaturierung 99°C 5 min Inkubation 60°C 4 h 55 min For the bisulfite treatment a maximum of 1000 ng of DNA were used. The Kit EpiTect ® Bisulfite Kit from Qiagen was used according to the manufacturer's instructions. 500 ng each of the bisulfite-converted DNA was eluted from the columns with 2 x 10 μL of elution buffer. The following cyclist settings were selected: denaturation 99 ° C 5 min incubation 60 ° C 25 min denaturation 99 ° C 5 min incubation 60 ° C 1 h 25 min denaturation 99 ° C 5 min incubation 60 ° C 4 h 55 min

4. COBRA 4. COBRA

Bei der COBRA (Combined Bisulfite Restriction Analysis) handelt es sich um eine Methode, mit der der Methylierungszustand einzelner CpG-Dinukleotide eines Genabschnitts untersucht werden kann. Zunächst wird dabei auf Basis der Bisulfit-konvertierten DNA eine PCR zur Amplifikation der zu untersuchenden Gensequenz durchgeführt. Die Primer wurden mit Hilfe der im Internet verfügbaren Software MethPrimer ( http://www.urogene.org/methprimer/index1.html ) so gestaltet, dass die Primersequenzen in der Regel 4 Cytosinnukleotide der originalen DNA abdeckten, die nicht in einem CpG-Kontext standen (verwendete Primer:Sec31B_forward GTTTGGGGTTTTTGGTAGTAGAGA, Sec31B_revers CAACAATAAACAAAAAAACCCTCAT). Combined Bisulfite Restriction Analysis (COBRA) is a method that can be used to study the methylation state of individual CpG dinucleotides in a gene segment. First, a PCR for amplifying the gene sequence to be examined is carried out on the basis of the bisulfite-converted DNA. The primers were synthesized using the software MethPrimer (available on the internet). http://www.urogene.org/methprimer/index1.html ) such that the primer sequences generally covered 4 cytosine nucleotides of the original DNA that were not in a CpG context (primers used: Sec31B_forward GTTTGGGGTTTTGTAGTAGAGA, Sec31B_revers CAACAATAAACAAAAAACCCTCAT).

Das PCR-Produkt wurde mittels Agarosegelelektrophorese auf die erwartungsgemäße Bandenhöhe hin überprüft. Nach Aufreinigung des amplifizierten DNA-Fragmentes aus dem Gel wurde ein Restriktionsverdau mit einer Endonuklease (HpyCH4IV (R0619L)) durchgeführt, deren Schnittstelle mindestens ein CpG-Dinukleotid beinhaltete. Dieses blieb nach der Bisulfit-Behandlung der DNA nur erhalten, wenn es in der Originalsequenz methyliert vorlag. The PCR product was checked by agarose gel electrophoresis for the expected band height. After purification of the amplified DNA fragment from the gel, restriction digestion was carried out with an endonuclease (HpyCH4IV (R0619L)) whose site contained at least one CpG dinucleotide. This was retained after bisulfite treatment of the DNA only if it was methylated in the original sequence.

Eine Auftrennung der verdauten DNA im Agarosegel ermöglichte eine Visualisierung der jeweils entstandenen Fragmente. Ein Vergleich der Bandenintensitäten der verdauten (in der Originalsequenz methyliert vorliegendes CpG) und der unverdauten Fragmente (in der Originalsequenz unmethyliert vorliegendes CpG) gab Aufschluss über den Methylierungszustand der untersuchten Gensequenz. Separation of the digested DNA in the agarose gel allowed visualization of each resulting fragments. A comparison of the intensities of the digested (in the original sequence methylated CpG) and the undigested fragments (unmethylated in the original sequence CpG) gave information about the methylation state of the gene sequence under study.

5. Isolierung von RNA aus HaCaT Zellen 5. Isolation of RNA from HaCaT cells

Zur Isolierung der RNA aus kultivierten Zellen wurde das RNeasy® Mini Kit von Qiagen nach Herstellerangaben verwendet. Für den Homogenisierungsschritt wurden die QIAshredder Säulen verwendet. Das Eluierungsvolumen wurde je nach eingesetzter Zellzahl angepasst. Die Konzentration der RNA wurde mittels Nanodrop bestimmt. For the isolation of RNA from cultured cells, the RNeasy ® mini kit from Qiagen was used according to manufacturer's instructions. For the homogenization step, the QIAshredder columns were used. The elution volume was adjusted depending on the number of cells used. The concentration of RNA was determined by nanodrop.

6. Reverse Transkription 6. Reverse Transcription

Die isolierte RNA wurde mit Hilfe des High Capacity cDNA Reverse Transcription Kits von Applied Biosystems in cDNA umgeschrieben. Es wurden maximal 1000 ng RNA in die Reaktion eingesetzt. The isolated RNA was transcribed into cDNA using Applied Biosystems' High Capacity cDNA Reverse Transcription Kit. A maximum of 1000 ng RNA was used in the reaction.

7. Real-time PCR (qRT-PCR) 7. Real-time PCR (qRT-PCR)

Zur Quantifizierung der relativen Expressionslevel der Gene DDAH2, Sec31B und Tet2 wurden TaqMan Low Density Arrays von Applied Biosystems (Darmstadt) durchgeführt. Der PCR-Ansatz wurde nach folgendem Schema zusammen pipettiert: je Ansatz wurden 50 µL TaqMan Gene Expression Master Mix in ein 1,5 mL Eppendorfgefäß pipettiert. Anschließend wurden 500 ng cDNA je Ansatz und Wasser (ges. 50 µL) zugefügt – unter der Annahme, dass die Menge an RNA, die in die cDNA Synthese eingesetzt wurde, komplett umgeschrieben wurde. Die Lösungen (100 µl) wurden dann in die Reservoire der LDA-Platten überführt. Die anschließende Zentrifugation der LDA-Platten (1200 rpm für 2 × 1 min) mit der Multifuge 3 S-R von Heraeus (Düsseldorf) verteilte letztendlich die cDNA-Proben in die einzelnen Wells. Mit einem Versiegeler wurden die Wells voneinander isoliert. Die PCR wurde mit dem 7900 HT Fast Real-time PCR System von Applied Biosystems durchgeführt:
Als Ladekontrolle erfolgte zunächst eine Normierung der Ct-Werte der einzelnen Proben auf ein housekeeping Gen (GAPDH): ∆Ct = Ct(Zielsequenz) – Ct(housekeeping Gen) Formel 1
To quantify the relative expression levels of the genes DDAH2, Sec31B and Tet2, TaqMan Low Density Arrays were performed by Applied Biosystems (Darmstadt). The PCR mixture was pipetted together according to the following scheme: per batch, 50 μl of TaqMan Gene Expression Master Mix were pipetted into a 1.5 ml Eppendorf tube. Subsequently, 500 ng of cDNA per batch and water (total 50 μL) were added - assuming that the amount of RNA used in the cDNA synthesis was completely rewritten. The solutions (100 μl) were then transferred to the reservoirs of the LDA plates. The subsequent centrifugation of the LDA plates (1200 rpm for 2 × 1 min) with the Multifuge 3 SR from Heraeus (Dusseldorf) finally distributed the cDNA samples into the individual wells. With a sealer, the wells were isolated from each other. The PCR was performed with the Applied Biosystems 7900 HT Fast Real-time PCR System:
Charge control was initially performed by normalizing the Ct values of the individual samples for a housekeeping gene (GAPDH): ΔCt = Ct (target sequence) - Ct (housekeeping gene) Formula 1

Zur Berechnung der relativen Zykluszahl bezogen auf die Referenz (unbehandelte Probe) wurde folgende Gleichung herangezogen: ∆∆Ct = ∆Ct(Referenz) – ∆Ct(Probe) Formel 2 The following equation was used to calculate the relative cycle number based on the reference (untreated sample): ΔΔCt = ΔCt (reference) - ΔCt (sample) Formula 2

Unter der Annahme einer 100%igen Amplifikationseffizienz berechnet sich die relative Quantität folgendermaßen: relative Quantität = 2∆∆Ct Formel 3 Assuming a 100% amplification efficiency, the relative quantity is calculated as follows: relative quantity = 2ΔΔCt formula 3

log10(relative Quantität) wurde hier für die graphische Darstellung gewählt. verwendete Taqman-Assays: Name Assay ID Accession number GAPDH HS99999905_m1 NM_002046 Tet2 HS00289469_m1 NM_001127208 DDAH2 HS00203889_m1 NM_013974 Sec31B Hs00248868_m1 NM_015490 log10 (relative quantity) was chosen here for the graphical representation. used Taqman assays: Surname Assay ID Accession number GAPDH HS99999905_m1 NM_002046 Tet2 HS00289469_m1 NM_001127208 DDAH2 HS00203889_m1 NM_013974 Sec31B Hs00248868_m1 NM_015490

Ergebnisse: Results:

Um zu zeigen, dass eine DNA-Demethylierung in den verwendeten Zellen möglich ist, wurden sie mit dem DNMT-Inhibitor 5-Aza-2´-Deoxycytidin (Decitabin) behandelt. Für Decitabin ist in vielen Zellkultursystemen eine inhibitorische Wirkung der DNA-Methyltransferasen und eine damit einhergehende Demethylierung beschrieben, was u.a. zu einer Reaktivierung von hypermethylierten und somit stillgelegten Genen führt. [ Bachman et al., 1999 , Paz et al., 2003 ]. Aus diesem Grund wurde Decitabin in diesen Versuchen als Positivstandard für eine demethylierende Behandlung der Keratinozytenzelllinie verwendet. Im direkten Vergleich zu Decitabin ist auch bei Himbeerketon eine demethylierende Aktivität zu beobachten. Die COBRA-Ergebnisse zeigten eindeutig eine verminderte Bandenintensität der verdauten PCR-Fragmente (M = methyliert) des beispielhaft untersuchten Gens Sec31B, in den Himbeerketon-behandelten Zellen (100 µM Himbeerketon) im Vergleich zu den DMSO-Kontrollzellen (siehe ). To demonstrate that DNA demethylation is possible in the cells used, they were treated with the DNMT inhibitor 5-aza-2'-deoxycytidine (decitabine). For decitabine, an inhibitory effect of DNA methyltransferases and a concomitant demethylation is described in many cell culture systems, which among other things leads to a reactivation of hypermethylated and thus shut down genes. [ Bachman et al., 1999 . Paz et al., 2003 ]. For this reason, decitabine was used in these experiments as a positive standard for a demethylating treatment of the keratinocyte cell line. In direct comparison with decitabine, a demethylating activity is also observed in raspberry ketone. The COBRA results clearly showed a decreased band intensity of the digested PCR fragments (M = methylated) of the exemplified Sec31B gene in the raspberry ketone-treated cells (100 μM raspberry ketone) compared to the DMSO control cells (see ).

Darüber hinaus konnte eine „Reaktivierung“ von im alter hypermethylierten Genen ( Grönniger et al., 2010 ) sowohl in Gegenwart von Decitabin als auch in Gegenwart von Himbeerketon gemessen werden ( ). Die drei ausgewählten Gene (Sec31B, Tet2 und DDAH2) zeigten dabei eine Steigerung der transkriptionellen Genexpression. Bei Sec31B wurde sogar eine deutlichere „Reaktivierung“ in Gegenwart von Himbeerketon im Vergleich zum Positivstandard Decitabin beobachtet. In addition, a "reactivation" of old hypermethylated genes ( Grönniger et al., 2010 ) are measured both in the presence of decitabine and in the presence of raspberry ketone ( ). The three selected genes (Sec31B, Tet2 and DDAH2) showed an increase in transcriptional gene expression. In Sec31B even a more pronounced "reactivation" was observed in the presence of raspberry ketone compared to the positive standard decitabine.

Zusammenfassend zeigen die Ergebnisse, dass durch die demethylierende Wirkung von Himbeerketon eine Reaktivierung der transkriptionellen Genaktivität bei den exemplarisch ausgewählten Genen erreicht werden kann. In summary, the results show that by the demethylating effect of raspberry ketone, a reactivation of the transcriptional gene activity in the exemplarily selected genes can be achieved.

Das nachfolgenden Beispiel soll die vorliegende Erfindung verdeutlichen. O/W-Emulsion Anteil (%) Cetearylglucosid 1.5 Cetearylalkohol 5.0 Caprylic/Capric Triglycerid 3.0 Dicaprylylcarbonat 4.0 C12-15 Alkylbenzoat 3.0 Cyclomethicon 2.0 Propylenglycol 5.0 Panthenol 1.0 Natrium Hydroxid q.s. 4–(4–Hydroxyphenyl)–2–Butanon 0.1 Wasser Ad 100 The following example is intended to illustrate the present invention. O / W emulsion Proportion of (%) cetearylglucoside 1.5 cetearyl 5.0 Caprylic / Capric triglyceride 3.0 dicaprylyl 4.0 C12-15 alkyl benzoate 3.0 cyclomethicone 2.0 propylene glycol 5.0 panthenol 1.0 Sodium hydroxide qs 4- (4-hydroxyphenyl) -2-butanone 0.1 water Ad 100

ZITATE ENTHALTEN IN DER BESCHREIBUNG QUOTES INCLUDE IN THE DESCRIPTION

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Zitierte Nicht-PatentliteraturCited non-patent literature

  • Bird, 202 [0009] Bird, 202 [0009]
  • Coulondre et a., 1978 [0009] Coulondre et al., 1978 [0009]
  • Jurkowska et al., 2010 [0009] Jurkowska et al., 2010 [0009]
  • Takai and Jones, 2002 [0009] Takai and Jones, 2002 [0009]
  • Saxonov et al., 2006 [0009] Saxonov et al., 2006 [0009]
  • Bird, 2002 [0009] Bird, 2002 [0009]
  • Avner and Heard, 2001 [0009] Avner and Heard, 2001 [0009]
  • Bird, 1986 [0009] Bird, 1986 [0009]
  • Yoder et al., 1997 [0009] Yoder et al., 1997 [0009]
  • Walsh et al., 1998 [0009] Walsh et al., 1998 [0009]
  • Ehrlich et al., 1982 [0009] Ehrlich et al., 1982 [0009]
  • Gama-Sosa et al., 1983 [0009] Gama-Sosa et al., 1983 [0009]
  • Ehrlich, 2002 [0010] Honest, 2002 [0010]
  • Yoder et al., 1997 [0010] Yoder et al., 1997 [0010]
  • Wash et al., 1998 [0010] Wash et al., 1998 [0010]
  • Gaudet, 2003 [0010] Gaudet, 2003 [0010]
  • Herman and Baylin, 2000 [0010] Herman and Baylin, 2000 [0010]
  • Jones and Baylin, 2007 [0010] Jones and Baylin, 2007 [0010]
  • Jeggo and Holliday, 1986 [0010] Jeggo and Holliday, 1986 [0010]
  • Jaenisch & Bird, 2003 [0011] Jaenisch & Bird, 2003 [0011]
  • Bird et al. 2007 [0011] Bird et al. 2007 [0011]
  • Reik, 2007 [0011] Reik, 2007 [0011]
  • Feinberg, 2008 [0011] Feinberg, 2008 [0011]
  • Fraga et al. 2005 [0011] Fraga et al. 2005 [0011]
  • Esteller et al. 2012 [0011] Esteller et al. 2012 [0011]
  • Winnefeld & Lyko 2012 [0011] Winnefeld & Lyko 2012 [0011]
  • Grönniger et al., 2010 [0012] Grönniger et al., 2010 [0012]
  • http://www.urogene.org/methprimer/index1.html [0038] http://www.urogene.org/methprimer/index1.html [0038]
  • Bachman et al., 1999 [0047] Bachman et al., 1999 [0047]
  • Paz et al., 2003 [0047] Paz et al., 2003 [0047]
  • Grönniger et al., 2010 [0048] Grönniger et al., 2010 [0048]

Claims (3)

Verwendung von Himbeerketon als demethylierendes Agens.  Use of raspberry ketone as a demethylating agent. Verwendung nach Anspruch 1 in topischen Zubereitungen, insbesondere kosmetischen oder dermatologischen Zubereitungen.  Use according to claim 1 in topical preparations, in particular cosmetic or dermatological preparations. Verwendung nach Anspruch 1 oder 2 in kosmetischen oder dermatologischen Zubereitungen mit einem Gehalt von 0,001–10 Gew.-%, besonders bevorzugt 0,01–1 Gew -% Himbeerketon, bezogen auf die Gesamtzusammensetzung der Zubereitungen.  Use according to claim 1 or 2 in cosmetic or dermatological preparations with a content of 0.001-10 wt .-%, particularly preferably 0.01-1 wt .-% of raspberry ketone, based on the total composition of the preparations.
DE201210216381 2012-09-14 2012-09-14 Use of 4- (4-hydroxyphenyl) -2-butanone as demethylating agent Withdrawn DE102012216381A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DE201210216381 DE102012216381A1 (en) 2012-09-14 2012-09-14 Use of 4- (4-hydroxyphenyl) -2-butanone as demethylating agent
PCT/EP2013/067275 WO2014040826A2 (en) 2012-09-14 2013-08-20 Use of 4–(4–hydroxyphenyl)–2–butanone as a demethylating agent

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE201210216381 DE102012216381A1 (en) 2012-09-14 2012-09-14 Use of 4- (4-hydroxyphenyl) -2-butanone as demethylating agent

Publications (1)

Publication Number Publication Date
DE102012216381A1 true DE102012216381A1 (en) 2014-05-28

Family

ID=49029090

Family Applications (1)

Application Number Title Priority Date Filing Date
DE201210216381 Withdrawn DE102012216381A1 (en) 2012-09-14 2012-09-14 Use of 4- (4-hydroxyphenyl) -2-butanone as demethylating agent

Country Status (2)

Country Link
DE (1) DE102012216381A1 (en)
WO (1) WO2014040826A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR3088200B1 (en) * 2018-11-12 2021-02-26 Univ De Lorraine USE OF AN ORGANOMETAL COMPOUND AS A DNA DEMETHYLATION AGENT

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030017997A1 (en) * 2001-05-28 2003-01-23 Tomohiro Yokota Dihydroxyphenyl compounds and glucoside compounds thereof
US20080182894A1 (en) * 2005-07-28 2008-07-31 Ajinomoto Co., Inc. Method of providing preparation for topical application and supplement meeting client's needs
WO2008132950A1 (en) * 2007-04-13 2008-11-06 Maruishi Pharmaceutical Co., Ltd. External preparation for skin and external preparation for lips

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3340935B2 (en) * 1997-03-26 2002-11-05 カネボウ株式会社 Melanin production inhibitor and whitening cosmetic
JP2000290177A (en) * 1999-04-05 2000-10-17 Kanebo Ltd Nitrogen monoxide scavenger and aging-protecting cosmetic material
JP2008280325A (en) * 2007-04-13 2008-11-20 Okayama Taiho Pharmaceutical Co Ltd External preparation for skin, hair restoration or hair growth agent, and external preparation for lip

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030017997A1 (en) * 2001-05-28 2003-01-23 Tomohiro Yokota Dihydroxyphenyl compounds and glucoside compounds thereof
US20080182894A1 (en) * 2005-07-28 2008-07-31 Ajinomoto Co., Inc. Method of providing preparation for topical application and supplement meeting client's needs
WO2008132950A1 (en) * 2007-04-13 2008-11-06 Maruishi Pharmaceutical Co., Ltd. External preparation for skin and external preparation for lips

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
Avner and Heard, 2001
Bachman et al., 1999
Bird et al. 2007
Bird, 1986
Bird, 2002
Bird, 202
Coulondre et a., 1978
Ehrlich et al., 1982
Ehrlich, 2002
Esteller et al. 2012
Feinberg, 2008
Fraga et al. 2005
Gama-Sosa et al., 1983
Gaudet, 2003
Grönniger et al., 2010
Herman and Baylin, 2000
http://www.urogene.org/methprimer/index1.html
Jaenisch & Bird, 2003
Jeggo and Holliday, 1986
Jones and Baylin, 2007
Jurkowska et al., 2010
Paz et al., 2003
Reik, 2007
Saxonov et al., 2006
Takai and Jones, 2002
Walsh et al., 1998
Wash et al., 1998
Winnefeld & Lyko 2012
Yoder et al., 1997

Also Published As

Publication number Publication date
WO2014040826A3 (en) 2014-10-23
WO2014040826A2 (en) 2014-03-20

Similar Documents

Publication Publication Date Title
DE102008059523A1 (en) Cosmetic mixture containing ascorbic acid-2-glucoside and ergothioneine
WO2011117034A2 (en) Cosmetic or dermatological preparations with a content of one or more thiazole derivatives
WO2018004212A1 (en) Antioxidant composition for skin
DE10155200A1 (en) Use of cholesterol, substances containing cholesterol or substances that increase cholesterol in cosmetic and dermatological preparations for the purpose of UV protection
EP3062763B1 (en) Improved protection against extrinsic skin aging
DE102012216381A1 (en) Use of 4- (4-hydroxyphenyl) -2-butanone as demethylating agent
EP0968221B1 (en) Novel salicylic acid derivatives and their use in cosmetic or dermatological compositions
EP2462919B1 (en) Synergistic active agent combination for protecting the skin from IR radiation
CN110996897A (en) Skin external composition containing ceramide, its derivative and cortex Hibisci extract
WO2022096195A1 (en) Use of dihydromyricetin as epigenetic cosmetic or dermatological skin care agent
DE69824910T2 (en) Andiroba extract containing cosmetic or pharmaceutical composition
DE102011089582A1 (en) Use of a combination of 2-methyl-1,4,5,6-tetrahydro-4-pyrimidinecarboxylic acid or its derivative and a blue-green algae extract to increase the skin barrier function
DE3149528A1 (en) AGENT BASED ON A 10-POSITIONED 1,8-DIHYDRO-9 ANTHRON FOR TREATING PSORIASIS
DE102011089558A1 (en) Use of a cosmetic topical composition comprising trimethylglycine (betaine) and a urea derivative in a carrier for increasing mechanical stability of the epidermis and/or for improving the barrier properties of the epidermis
EP2046276B1 (en) Cosmetic or dermatological preparations containing folic acid and one or more polyols
KR102415530B1 (en) Composition for moisturizing skin
KR102084415B1 (en) Cosmetic Composition comprising epipinoresinol
WO2018099675A1 (en) Use of 2'-methoxyflavone in cosmetic or dermatological preparations for the prevention and treatment of sensitive skin
WO2002041916A2 (en) Use of 3-hydroxyl-3-methylglutaryl-coenzyme-a-reductase inhibitors
JP2019210246A (en) Nerve elongation inhibitor
WO2009103427A2 (en) Use of 3-(4-hydroxy-3-methoxyphenyl)-1(4-hydroxyphenyl)-propane-1-on against hyperpigmentation
DE102011089270A1 (en) Use of a combination of taurine and hydrolysed protein from yeast to increase epidermal lipid synthesis
DE102012222445A1 (en) Cosmetic or dermatological preparations containing combinations of 4-n-butylresorcinol and one or more non-terpenoid perfume raw materials
EP2046280A1 (en) Cosmetic or dermatological preparations containing folic acid, volatile and non-volatile silicones
DE10047204A1 (en) Topical skin treatment products with arginase

Legal Events

Date Code Title Description
R163 Identified publications notified
R119 Application deemed withdrawn, or ip right lapsed, due to non-payment of renewal fee