DE102009003439A1 - New permanent human cell line - Google Patents

Abstract

The present invention relates to a permanent human cell line comprising nucleic acid sequences for the adenoviral gene functions E1A and E1B and the nucleic acid sequence for the SV40 large T antigen or the Epstein-Barr virus (EBV) nuclear antigen-1 (EBNA-1). The present invention further relates to a method for the transient expression of recombinant polypeptides and proteins in one of the permanent human cell lines.

Description

The The present invention relates to a permanent human cell line, comprising the nucleic acid sequences for the adenoviral Gene functions E1A and E1B and the nucleic acid sequence for the large T-antigen of SV40 or the Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1). The present invention relates a method for the transient expression of recombinant polypeptides and proteins in one of the permanent human cell line.

In addition to bacteria, yeasts and plant cells, in particular animal cells are used for the production of recombinant polypeptides or proteins. About 60-70% of all therapeutic proteins are now produced in mammalian cells ( Worm, Nat. Biotechnology 22, 1393-1398, 2004 ). The production of recombinant polypeptides or proteins for therapeutic, diagnostic or technical purposes in cell culture, ie in vitro, can in principle be done in two different ways. In stable, permanently or permanently established cell lines, the nucleic acid encoding the desired polypeptide or protein is integrated in at least one copy into the chromosomal DNA of the cell and is passed on to the daughter cells during cell division with the cellular chromosome set (so-called stable expression in production cell lines). For the production of these stable production cell lines it is necessary that at least one of the nucleic acids introduced into the cell by transfection carries a gene function which gives the cell a selection advantage in growth in cell culture. The nucleic acid containing such a gene function does not necessarily have to be present on the same molecule as the expression cassette for the desired polypeptide or protein. Gene function is either a resistance gene to antibiotics or chemotherapeutic agents in the medium (e.g., commonly used in mammalian cells; Worm, Nat. Biotechnology 22, 1393-1398, 2004 ), a gene whose gene product complements a deficient metabolic pathway (eg, used in yeast cells), or a transforming gene function (shown for human amniotic fluid cells; Schiedner et al., BMC Biotechnology 8, 13, 2008 ). In this way, it is ensured that those cells in which a stable integration of the transfected nucleic acid into the chromosomal DNA of the cell has taken place and the gene product is produced, the other cells can be overgrown and selected without such integration. In the production of the production cells by transfection into the so-called host cell line on the one hand, the nucleic acid encoding the recombinant polypeptide (the so-called transgene), with the necessary transcriptional regulatory elements transferred, on the other hand, a second expression cassette with a gene containing a Selected selection marker and its gene product of the cell provides a specific selection advantage. A few days after the gene transfer, during which the cells z. B. be cultured in a culture medium without selection reagent, the medium is added to a suitable selection reagent. In the presence of the selection reagent, only the cells which have taken up the nucleic acids used for transfection and express the selection marker survive and grow. Frequently used selection markers are the neomycin resistance gene, the hygromycin resistance gene and the dihydrofolate reductase (DHFR) ( Worm, Nat. Biotechnology 22, 1393-1398, 2004 ; Wurm and Jordan, 309-333 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 ). The selection is carried out accordingly in culture medium with the selection reagents such as the antibiotics neomycin or hygromycin or the synthetic glucocorticoid methotrexate. Cells with the selection marker and the transgene that survive and proliferate the selection process (so-called transformants) are usually subsequently isolated (cloned) to ensure that all cells in the culture are genetically identical and have the desired production cell lines with the best Production rate of less well producing cell lines to separate.

In the so-called transient expression, on the other hand, the nucleic acid introduced into the cell by transfection, which encodes the desired polypeptide or protein, is not integrated into the chromosomal DNA of the cell or is not selected for this event, and thus the introduced nucleic acid generally becomes in the course of cell division during the growth of the culture thinned out and lost, which causes the transient nature of this transient process. The selection of stable production cell lines with good expression efficiency takes several months and causes considerable costs. By transient expression, however, milligram quantities of the desired polypeptide or protein can be produced within a few days. Speed and cost are key factors in the industrial development of biopharmaceutical and diagnostic products. The transient expression of proteins in smaller amounts or of different variants of a protein is therefore carried out except in basic research for early exploratory and preclinical development, e.g. For example, in target identification, assay development, biochemical characterization of gene products, toxicology and pharmacokinetic and pharmacodynamic studies ( Baldi et al., Biotechnol. Lett. 29, 677-684, 2007 ; Pham et al., Molecular Biotechnology 34, 225-237, 2006 ). In contrast, the industrial production of proteins on a gram to kilogram scale for carrying out major clinical studies and market supply is carried out with the aid of stable production cell lines.

Secreted, membrane-bound and intracellular proteins have been produced by transient gene expression. Mammalian cells are currently the most common expression systems for many complex proteins, especially when the proteins are to be used for therapeutic purposes, since prokaryotic and low eukaryotic cell systems (eg yeasts) are clearly disadvantaged in terms of post-translational modifications. For transient protein expression, essentially four mammalian cell lines have been used: COS-1 and COS-7 cells, respectively, derived from the African Green Monkey CV-1 monkey kidney cell line; BHK cells derived from neonatal hamster kidney cells; CHO cells derived from Chinese hamster ovary cells; and HEK293 cells, a human embryonic kidney cell line with neuronal characteristics ( Pham et al., Molecular Biotechnology 34, 225-237, 2006 ; Wurm et Bernard, Current Opinion in Biotechnology 10, 156-159, 1999 ). In addition to the use of viral expression vectors such as Semliki Forest virus or adenovirus, which are efficient but complex and associated with high safety requirements and therefore less common, transient expression in these mammalian cell lines is usually based on the transfection of a plasmid vector containing the expression cassette the coding sequence for the desired gene product. A variety of physical and chemical methods have been developed for DNA transfer into cultured mammalian cells. Physical gene transfer methods include electroporation, nucleofection, and microinjection. The chemical transfection methods use inorganic substances (eg calcium phosphate / DNA coprecipitation), cationic polymers (eg polyethyleneimine, DEAE / dextran method) or cationic lipids (so-called lipofection). Calcium phosphate and polyethyleneimine are the most commonly used transfection reagents (up to a few liters) for nucleic acid transfer ( Baldi et al., Biotechnol. Lett. 29, 677-684, 2007 ).

The described methods for the transient expression of polypeptides and proteins based on long-known cell lines have disadvantages in various respects. A problem associated with transient methods is the low expression performance. To improve cellular expression yields, various genetic systems have been used to increase the number of gene copies per cell using episomal replication of the introduced nucleic acid. COS cells express the large T antigen of Simian Virus 40 (SV40), a replication factor that causes high copy number episomal replication of plasmids carrying an SV40 origin of replication (SV40 ori). The initial event of this replication is the binding of the T-antigen to the SV40 origin of replication (SV40 ori), which recruits cellular replication factors to the DNA / T-antigen complex and initiates replication by cellular DNA polymerase. From the HEK293 cell line, which was generated about 30 years ago by transformation of human embryonic kidney cells with sheared adenovirus type 5 DNA and which is well transfectable, two genetic variants were described which also contain the SV40 large T antigen (HEK293T). or the Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1) express (HEK293E or 293EBNA-1). These cell lines are intended to ensure episomal replication or amplification of plasmids containing an SV40 ori or an EBV oriP. The replication factor EBNA-1 interacts with the EBV origin of replication oriP in the latter case. At least for HEK293E cells, an increase in expression yields using oriP-containing expression plasmids is detected. In contrast to the use of EBNA-1 in combination with the replication origin oriP, some studies indicate that there is no strong replication of SV40-ori-containing plasmids in HEK293T cells ( Durocher et al., Nucleic Acid Research 30, e9, 2002 ). CHO cells generated a stable variant that expresses the large T-antigen (LT) of polyomavirus (Epi-CHO) and can be used in combination with a plasmid carrying the polyomavirus origin of replication (PyOri) ( Kunaparaju et al., Biotechnology and Bioengineering 91, 670-677, 2005 ). With such mammalian cell systems yields of about 10-20 mg / liter are achieved on average in the transient expression of recombinant proteins ( Baldi et al., Biotechnol. Lett. 29, 677-684, 2007 ). With stable, permanent production cell lines, however, yields in the range of several grams per liter are quite common, but as described with a considerably higher expenditure of time and money.

A further disadvantage of the cell systems used hitherto for recombinant protein expression is that some cell lines are suitable for transient expression (eg HEK293T or HEK293E cells) because of good transfectability and the capability for episomal plasmid amplification, but others Cell lines are preferably used for the production of stable cell lines (eg CHO cells) because of their culturing properties and yields. Since cell systems differ significantly in different aspects of the posttranslational modification, however, after transient expression (usually in the early development phase of protease therapeutic products) in a best. Cell system data on the structure and function of the gene products only very limited to the structure and function of these gene products after expression in stable cell lines of another cell system (usually in the later development phase, for clinical studies and market supply). In many therapeutic product candidates are post-translational modifications, such as. As glycosylation, phosphorylation, carboxylation, palmitylation or specific cleavage, for different properties of the expression products of great importance. They can have a significant influence on the activity, solubility, half-life, stability or immunogenicity. Therefore, human cell systems play an increasing role in the production of therapeutic proteins; Only human cells as production sites guarantee an authentic, human modification of the expression products and thus reduce the risk of impaired product qualities or unwanted side effects. For example, for recombinant erythropoietin used for human therapy, it is known that protein produced in CHO cells (epoetin alpha) has N-glycolyl neuraminic acid residues in its carbohydrate side chains while the protein produced in human cells (epoetin delta) - as well as the natural human erythropoietin - does not contain such sugar residues. In view of the fact that the human demonstrably forms circulating antibodies against these "foreign" sugar structures, the use of a human expression system appears advantageous ( Varki, Am. J. Phys. Anthropol. 33, 54-69, 2001 ). At present, no human cell system is available that is equally well suited for transient expression and production of stable production cell lines, thus ensuring a reproducible product profile throughout the development of a protein-based therapeutic.

humane Cells are for the production of human biotherapeutics Particularly suitable because they are complex polypeptides - im Unlike other mammalian or animal cells Cells - with an authentic post-translational modification pattern express. The Glycosylation Pattern of Complex Recombinant Proteins, that is, the structure and arrangement of the sugar residues in the molecule, becomes much better when produced in human cells Patterns of authentic human polypeptide reproduce as a production in non-human production systems. This glycosylation pattern is often for important properties of the polypeptide such as biological activity, stability, solubility and immunogenicity of vital importance.

Therefore the invention is based on the object, a human cell system to provide for transient expression of polypeptides and the production of stable production cell lines alike good.

The Task is defined by the in the claims Object solved.

The The following figures explain the invention.

1 shows schematically the structure of the plasmids for the permanent expression of T-antigen. In pGS158 ( 1a ) T-antigen is expressed under the control of the human CAG promoter, in pGS159 ( 1b ) under the control of the RSV promoter and in pGS161 ( 1c ) under the control of the human CMV promoter.

2 shows schematically the structure of the plasmids for transient expression of human alpha1-antitrypsin (hAAT) or human erythropoietin (Epo), each under the control of the human CMV promoter. Plasmid pGS116 ( 2a ) and pGS151 ( 2 B ) have identical expression cassettes for hAAT, pGS151 additionally contains the starting point of DNA replication of Simian Virus 40 (SV40 ori). pGS177 also contains the SV40 ori in addition to the Epo-expression cassette.

3 Figure 3 shows schematically the amount of hAAT transiently expressed in culture supernatant in various T antigen-expressing amniocytic cell lines (CAP-T Z582, Z583 and Z597) compared to the parental amniocytic cell line (CAP) without T antigen expression. In Z582, the T-antigen is expressed under control of the CAG promoter, in Z583 under control of the RSV promoter and in Z597 under control of the CMV promoter.

4 schematically shows the amount of hAAT (bar) transiently expressed in the culture supernatant and the viable cell count (lines) at different time points after transfection of a plasmid without SV40 ori (hAAT / cell number -ori, plasmid pGS116) or with SV40 (hAAT / cell number + ori , pGS 151).

5 Figure 3 shows schematically the amount of hAAT (bar) transiently expressed in the culture supernatant and the viable cell count (lines) at various time points after transfection of pGS151 (with SV40 ori) into CAP-T and HEK293T cells.

6 schematically shows the intracellular copy number of plasmids pGS116 (without SV40 ori) and pGS151 (with SV40 ori) at different time points after transfection into CAP-T and 293-T cells.

7 Figure 3 shows schematically the amount of hAAT (bar) transiently expressed in the culture supernatant and the viable cell count (lines) at various time points after transfection of pGS151 (with SV40 ori) into CAP-T with polyethyleneimine (PEI) as transfection reagent.

The term "amniocytes" as used herein means in a broader sense all cells that are present in the amniotic fluid and can be obtained by amniotic fluid puncture. The cells are either from the amnion or fetal tissue in contact with the amniotic fluid. Three main classes of amniocytes have been described, which are distinguished on the basis of morphological criteria: fibroblast-like cells (F cells), epitheloid cells (E cells) and amniotic fluid cells (AF cells) ( Hohn et al., Pediat. Res. 8: 746-754, 1974 ). AF cells are the predominant cell type.

Under The term "expression cassette" is used in particular a nucleic acid molecule or a region of a Nucleic acid molecule understood that a before the coding region lying regulatory element or promoter, a coding region or an open reading frame, as well as a behind the coding region transcriptional termination element contains. The regulatory upstream of the coding region Element or the promoter can be constitutive, d. H. permanently the Transcription activating promoter (eg CMV promoter) or a adjustable, d. H. activatable and / or deactivatable promoter (eg Tetracycline-regulatable promoter). The coding region The expression cassette can be a continuous open reading frame as in a cDNA with a start codon at the 5 'end and a stop codon at the 3'-end be. The coding region may be from a genomic or a newly combined array of coding exons and intervening, consist of non-coding introns. The coding region of the expression cassette but can also consist of several open reading frames, by so-called IRES (Internal Ribosome Entry Sites) are separated.

Under the term "permanent cell lines" as used herein one understands cells that are so genetically modified, that they are permanently in cell culture under suitable culture conditions can continue to grow. Such cells are also immortalized Called cells.

Under the term "polypeptide" or "recombinant Polypeptide "as used herein peptides from at least 2 amino acids understood. The polypeptide may be co- and / or post-translationally modified, eg. B. by attaching of sugar residues or by modification of amino acid residues. The polypeptide may be linear, circular or branched. Furthermore, the polypeptide may consist of more than one amino acid chain exist, whereby the chains by intra- and / or intermoleculare Bindings can take more or less complex spatial structures (eg secondary, tertiary, quaternary structure). If the polypeptide consists of an amino acid chain, can these are also more or less complex due to intramolecular bonds Occupy spatial structures. The polypeptides may be pharmacologically or immunologically active polypeptides or for diagnostic Purpose used polypeptides.

Under the term "primary cells" as used herein One understands cells by direct removal from an organism or a tissue and taken into culture. Primary cells have only a very limited lifespan.

Under the term "production cell lines" as used herein one understands permanent cell lines which, by introducing a transgene, which encodes the desired polypeptide to be produced, stable were genetically modified.

Under understands the term "CAP" as used herein one permanent human amniocytic cell lines by immortalization of primary human amniocytes with adenoviral gene functions E1A and E1B have been generated.

Under the term "CAP-T" as used herein one CAP cells, in addition to a nucleic acid molecule contain the sequence of SV40 large T antigen stable were transfected.

Under the term "transfection" as used herein is understood to be any process which is suitable for the introduction of said Nucleic acid (s) in the cells is suitable. As examples are the classic calcium phosphate method, electroporation, liposomal To name systems of any kind and combinations of these methods.

Under the term "transient expression" as used herein is any method of transfecting nucleic acid (s) be introduced into the cell without a suitable selection method stable cell lines are selected that persist in cell culture can be cultivated further.

Under the term "stable expression" as used herein One understands the expression of a transgene in production cell lines.

Under understands the term "transgene" as used herein the nucleic acid sequence encoding a recombinant polypeptide.

An object of the present invention relates to a permanent human cell line comprising the nucleic acid sequences for the adenoviral gene functions E1A and E1B and the nucleic acid sequence for the SV40 large T-antigen or the Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1).

The permanent human cell line is characterized by immortalization of primary human cells with the adenoviral gene functions E1A and E1B generated; so-called 1st transfection. Subsequently, the permanent human cell line stable in one embodiment with a Nucleic acid molecule transfected containing an expression cassette encoding the SV40 large T antigen, one Replication factor, contains, so-called 2. Transfection. Preferably the expression cassette contains a non-secreted Shape of SV40 large T antigen.

In another embodiment of the present invention The permanent human cell line becomes stable with a nucleic acid molecule which transfected an expression cassette for the Contains Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1), so-called 2nd transfection. Preferably, the expression cassette contains a non-secreted form of the Epstein-Harr virus (EBV) Nuclear Antigen-1 (EBNA-1).

The used for immortalization of primary human cells Nucleic acid molecules include E1A and E1B nucleic acid sequences, preferably derived from human adenoviruses, in particular from human adenovirus serotype 5. An exemplary sequence finds join Genbank Acc. No. X02996. In particular, the nucleic acid molecules include nucleotides 1 to 4344 (SEQ ID NO: 1), 505 to 3522 (SEQ ID NO: 1) 2) or nucleotides 505 to 4079 (SEQ ID NO: 3) of the human adenovirus Serotype 5.

The expression cassette contains in one embodiment in particular the sequence for the SV40 large T antigen (SEQ ID NO: 4), the sequence for a promoter selected from the group CMV promoter (SEQ ID NO: 5), CAG promoter ( Niwa et al., Gene 108: 193-199, 1991 and RSV promoter (Genbank Acc No. DQ075935), the sequence for SV40 SD / SA (intron) (SEQ ID NO: 6), and the sequence for SV40 polyA (SEQ ID NO: 7).

In a further embodiment, the expression cassette contains in particular the sequence for the Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1) (SEQ ID NO: 8), the sequence for a promoter selected from the group CMV promoter ( SEQ ID NO: 5), CAG promoter ( Niwa et al., Gene 108: 193-199, 1991 and RSV promoter (Genbank Acc No. DQ075935), the sequence for SV40 SD / SA (intron) (SEQ ID NO: 6), and the sequence for SV40 polyA (SEQ ID NO: 7).

The primary human cells are characterized by direct withdrawal the organism or a tissue taken from the organism and taken in culture. Preferred are such primary human Cells produced by expression of adenoviral E1A and E1B well in permanent human cell lines can be converted in particular amniocytic cells, embryonic retinal cells and embryonic Cells of neuronal origin.

The Cell lines according to the invention can also made from existing permanent human cell lines be in their genome, the nucleic acid sequences for have the adenoviral gene functions E1A and E1B. To do this the existing permanent human cell lines when needed with the containing nucleic acid molecules described above an expression cassette coding for the large SV40 T-antigen or Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1) transfected. The skilled artisan recognizes that the 2nd transfection time only dependent on the 1st transfection of the primary human cell, than that after the 1. Transfection must be done. It is not necessary that the 2. Transfection must take place immediately after the 1st transfection. So can already been established for several years permanent human cell lines immortalized with E1A and / or E1B if necessary with the above nucleic acid molecules be transfected in a 2nd transfection. Preferably in addition immortalized human amniocytes, immortalized human embryonic Retinal cells, in particular PER.C6 cells, or immortalized human embryonic cells of neuronal origin, in particular HEK293 cells, be used.

One Another object of the present invention relates to a method for the transient expression of recombinant polypeptides or proteins, using the permanent invention human cell line.

contains the permanent human cell line according to the invention the nucleic acid sequence for the big one SV40 T antigen, the cell line is linked to an expression plasmid transfected, which is an expression cassette for the to be expressed Transgene and the SV40 origin of replication (SV40 ori). The stably expressed intracellularly in the cell line SV40 T-antigen binds to the SV40 origin of replication Transfection into the cell line introduced expression plasmids and causes episomal replication of the expression plasmid and thereby an amplification of the copy number of the transgene to be expressed. The transgene-encoded desired gene product can be after Cultivating the cells for a few days from the cells or recovered from the culture supernatant. The transgene is thus transiently expressed.

contains the permanent human cell line according to the invention the nucleic acid sequence for Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1), the cell line is linked to an expression plasmid transfected, which is an expression cassette for the to be expressed Transgene and the EBV origin of replication (EBV oriP). Stably intracellularly expressed EBNA-1 in the cell line EBV binds to the oriP origin of replication by transfection introduced into the cell line expression plasmids and causes a episomal replication of the expression plasmid and thereby amplification the copy number of the transgene to be expressed. That from the transgene encoded desired gene product can after cultivating the Cells for a few days from the cells or from the culture supernatant be won. The transgene is thus transiently expressed.

The Cells according to the invention can be used in serum-containing or serum-free medium, in adherent culture or in suspension culture be cultivated. The cultivation in suspension can be carried out in various ways Fermentation vessels take place, for. In stirred tank reactors, "Wave" reactors, in shaker or spinner vessels or in so-called "scooters Bottles ". The cells are thus for process expansion in the suitable for industrial scale. Transfection of the cells For transient expression can be with various transfection methods done as described above. Transfection and transient Expression can also be in "high-throughput" format or screening, z. B. in the 96 or 384-well format.

T-antigen Simian Virus 40 (SV40) is a multifunctional phosphoprotein, this is both viral replication and cellular Functions after infection controlled. T-antigen is a transforming one Agent and accesses interaction with the tumor suppressor protein p53 into the cell cycle. During the replication of the viral genome, T antigen is needed as a DNA helicase, to get rid of the double-stranded genome. T antigen is the only viral protein needed for replication; The other functions are of cellular proteins Fulfills. In the first step of DNA replication bind 12 T-antigen molecules as double hexamers at the starting point DNA replication (ori) in the SV40 genome. At this helicase complex then bind the necessary cellular proteins like DNA polymerase and unwind and replicate the DNA. The so-called "minimal ori "consists of a 63-bp" core "sequence. In transient transfection of circular plasmids into the target cell there is no integration into the host genome, which This causes the plasmid concentration after cell division steadily decreasing and the expression of one lying on the plasmid coding gene is only temporary. The introduction of the SV40 ori fragment into the expression plasmid and expression of the SV40 T antigen in the production cell lead to a increased copy number of the plasmid and thus to an increased Expression performance.

The inventive method for transient expression Of polypeptides and proteins has the advantage that it is in terms of the quantity and quality of the recombinant gene product more efficient and thus in the overall process of industrial Development of protein-based therapeutics also cheaper is as previously used method. In particular, it is advantageous that a highly efficient transient expression system based on a human cell line is provided, the first, in contrast to non-human mammalian cells or non-mammalian cells human proteins are authentically post-translationally modified, and secondly equally stable for the establishment Production cell lines suitable in the industrial production process is. In this way it can be ensured that in the course of the Development of diagnostic or therapeutic products qualitative Characteristics of the gene product after transient expression in the early Development phase and stable expression in permanent production cell lines in the late phase and industrial production as possible Identity especially with regard to differences in These features are based on the nature of the cell system may be.

One Another advantage of the present invention is that the permanent human cell lines of the invention have high expression yields with transient expression. Thus, in transient expression in SV40-T antigen-producing Amniocyte cell lines after transfection with a plasmid vector, the other than the coding sequence for the desired Gene product carries an SV40 origin of replication (SV40 ori), unexpectedly very high product yields in the culture supernatant found up to 60 mg / liter. The product yields were more than 70-fold higher than transient expression in one Amniocytic cell line expressing no T antigen.

A further advantage of the permanent human cell line according to the present invention is that it provides a human cell system, preferably based on immortalized human amniocytes, which is suitable both for the transient expression of proteins and for the stable expression of proteins in permanent production cell lines ( Schiedner et al., BMC Biotechnology 8, 13, 2008 ) is suitable. Compared to the use of different cell systems for transient expression (eg HEK293 or HEK293 variants) and stable expression (eg CHO), the risk is minimized that structural or funktio nal properties of the expression products from transient and stable production, which are due to the nature of the expression system, differ. This makes the development process easier to plan, less time-consuming and less expensive.

The nucleic acid sequences for the expression of the at least one recombinant polypeptide are present in at least one expression cassette. The expression cassettes contain promoters and transcriptional termination sequences. As promoters z. B. CMV (cytomegalovirus) promoter ( Makrides, 9-26 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 ), EF-1α promoter ( Kim et al., Gene 91: 217-223, 1990 ), CAG promoter (a hybrid promoter from the human cytomegalovirus immediate early enhancer and a modified chicken β-actin first intron promoter) ( Niwa et al., Gene 108: 193-199, 1991 ), human or murine pgk (phosphoglycerate kinase) promoter ( Adra et al., Gene 60: 65-74, 1987 ), RSV (Rous sarcoma virus) promoter ( Makrides, 9-26 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 ) or SV40 (Simian Virus 40) promoter ( Makrides, 9-26 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 ) serve. As polyadenylation z. The polyadenylation sequences of the SV40 Large T antigen (Genbank Acc No. J02400) or the human G-CSF (granulocyte colony stimulating factor) gene ( Mizushima and Nagata, Nucl. Acids Res. 18: 5322, 1990 ) serve.

The recombinant polypetides can be therapeutic proteins such as For example, human alpha 1-antitrypsin or growth factors such as Erythropoietin or interleukin-2. Human alpha 1-antitrypsin (hAAT) is a proteinase inhibitor, elastase and other proteinases hereditary hAAT deficiency leading to severe lung and liver damage, therapeutically effective is. Erythropoietin is an important growth factor for erythrocytes (red blood cells), at Anemia as well as blood-forming in transplant patients Has effect. Interleukin-2 (Il-2) is one of the cellular Messengers of the immune system and is of great importance the activation of the cellular immune response, for example in tumor diseases. To the therapeutically effective polypeptides also include blood coagulation factors such. B. Factor VIII and factor IX, which in hemophilia patients with coagulation disorders be used. The recombinant polypeptide of the invention Procedure can be a hormone. Biotechnologically produced hormones be in the substitution therapy in patients with hormonal Interference used. Examples are the blood sugar lowering Hormone insulin, which many diabetes mellitus patients rely on are, somatotropin (growth hormone) for the treatment of dwarfism, and gonadotropic factors such as follicle stimulating Hormone (FSH) or luteinizing hormone (LH) for the Treatment of fertility disorders. The rekom binanten Polypeptides may also be enzymes that are intracellular or simultaneously expressed in the culture supernatant modify recombinant polypeptides post-translationally, e.g. B. on enzymes involved in glycosylation.

The recombinant polypetide can be a recombinant antibody be used for therapeutic or diagnostic purposes can be. Antibody to tumor necrosis factor alpha (TNF-α) is used in patients with rheumatoid arthritis, Antibody to the cellular receptor of the epidermal Growth factor (EGFR) used in cancer patients. For can be used for diagnostic purposes for example, components of commercial diagnostic kits, which are based on methods such as enzyme-linked immune adsorption tests (enzyme-linked Immuno sorbent assay, ELISA) or radioactive immunoadsorption tests (Radio Immuno sorbent assay, RIA). The antibodies are used in these test methods for detecting the antigens of infectious agents, such as the human hepatitis B virus.

antibody or immunoglobulins (Ig) are composed of a heavy and a light chain together, each consisting of variable and constant regions or domains exist. The nucleic acid sequences the transfected nucleic acid molecules for expression One antibody can be two separate expression cassettes one of which is the light chain, the other the encoded heavy chain of the immunoglobulin molecule. After expression store both chains in the cell of the invention These together to the active antibody molecule. The expression cassettes of the two chains can thereby on separate or on the same nucleic acid molecule lie. The coding sequences for the light and the but heavy chain can also be within the same expression cassette and by an IRES sequence (internal ribosome entry site, internal ribosome binding site) which express both heavy and light chain. The coding sequences for the light and heavy chain can in principle also within the same expression cassette and separated by a sequence containing an enzymatic cleavage site for a proteinase (eg thrombin), which then is expressed simultaneously in the cell and the precursor polypeptide from light and heavy chain sequence in active light and heavy chain splits.

recombinant Antibodies derived from the nucleic acid sequence in the cell of the invention can be coded also consist of fragments of an antibody instead the complete light and heavy chain. So-called single-chain antibodies (scFv, single chain variable fragments) consist of the variable Domains of a heavy and a light chain passing through an amino acid sequence (a so-called linker) are connected, which ensures free mobility of both domains. By intramolecular assembly of both domains ensteht an antigen-binding structure corresponding to the variable region of an immunoglobulin molecule equivalent. Bispecific single-chain antibodies (bis-scFv) consist of two such single-chain arrangements of the variable Domains of a heavy and a light chain, in turn again linked by a connecting sequence and are movable against each other; such molecules can simultaneously bind to two antigenic binding sites (epitopes) and thereby non-covalently bonding two molecular structures. Bispecific Diabodies consist of two separately expressed single chains, each variable domains of a light and a heavy Chain, separated only by a very short or no linker, contain. The short or missing linker prevents the intramolecular Agglomeration, by intermolecular assembly of a variable heavy and light domain, in turn, creates an active Molecule with two binding valences.

The of the nucleic acid molecules transfected in the present method coded recombinant polypetides can be viral, bacterial or be parasitic proteins for use as a prophylactic or therapeutic vaccine (vaccine) produced should be. These may be both structural polypeptides as well as regulatory or enzymatically active polypeptides of Viruses, bacteria or parasites. Viral protein can z. B. the hepatitis B virus surface antigen (HBV Surface Antigen) or the structural protein L1 of human papillomaviruses. Bacterial proteins after expression in production cell lines for vaccine production in question, z. B. Enterotoxin subunits of enterotoxinogenic Escherichia coli (ETEC) or transferrin-binding proteins (transferrin binding protein, Tbp A and B) of Neisseria gonorrhoeae. Polypeptides of parasites, that of the nucleic acid molecules transfected in the present method could be coded, z. B. the merozoite surface protein (Merozoite Surface Protein, MSP) of the malaria pathogen Plasmodium falciparum or glutathione S-transferase (GST) from Schistosoma japonicum.

The of the nucleic acid molecules transfected in the present method Coded recombinant polypeptides may also be used be viral proteins that produce a recombinant cell line allow viral gene transfer vectors. These viral also complementation factors mentioned proteins are expressed in the cell line and are the necessary for the production of gene transfer vectors enzymatic or structural components that are not on the Nucleic acid molecule of the gene transfer vector encoded become. In such gene transfer vectors are usually for safety reasons deletes certain viral gene functions. To the gene transfer vectors, their complementation factors by using the described method introduced transgenes may be encoded for example, vectors associated to adenovirus, adenovirus-associated Virus (AAV), retro or lentivirus, or herpes virus based. The In the cell line expressed complementation factors can also complement deleted or recombinant viruses in their production, which contain no gene to be transferred and thus not as gene transfer vectors act, but z. B. be used as a vaccine.

The polypeptide transiently expressed by the present method may further be a receptor polypeptide that is specifically located on the surface of the cell and is responsible for the infection of the cell by a virus or the transduction of the cell by a viral gene transfer vector. As a viral receptor for the initial step of infection of cells with adenovirus serotype 2 or 5, most of which are conventional adenoviral vectors, the so-called coxsackie and adenovirus receptor, CAR, has been identified ( Bergelson et al., Science 275: 1320-1323, 1997 ). Sufficient expression of CAR on the surface is a prerequisite for a cell to be suitable as a production cell for adenoviral gene transfer vectors. In a preferred embodiment, the recombinant polypeptide is the coxsackie and adenovirus receptor (CAR). The overexpression of the receptor polypeptide can significantly improve the infectivity and thus the production efficiency of these cells with respect to adenoviral vectors. Further, the nucleic acid molecule other than CAR can encode secondary receptors or internalization receptors, such as e.g. B. certain integrins that mediate the uptake of the virus or gene transfer vector into the cell and their additional expression in the production of production cells for adenoviral vectors are useful.

The described method can be used, inter alia, for the production of therapeutic polypeptides, blood coagulation and growth factors, hormones and antibodies as well as viral, bacterial or parasitic polypeptides for use as a vaccine. Furthermore, the cells of the invention are for the production of diagnostically relevant Proteins usable, such. As viral, bacterial or parasitic antigens or corresponding specific antibodies. Furthermore, the cells according to the invention are suitable for the production of technically or industrially relevant proteins, for. As enzymes for catalysis technical synthesis process or the degradation of pollutants. The cells of the invention may express one or more different recombinant polypeptides. The number of expressible polypeptides depends on how many different nucleic acid sequences coding for the recombinant polypeptides are transiently transfected into the cells by the method according to the invention.

The following examples illustrate the invention and are not to be construed as limiting. Unless otherwise stated, standard molecular biological methods were used, such. B. from Sambrook et al., 1989, Molecular cloning: A Laboratory Manual 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York , described.

1. Cloning

a. T-antigen expression plasmids: pGS158, pGS159, pGS161 ( 1 )

Plasmids pGS158 ( 1a ), pGS159 ( 1b ) and pGS161 ( 1c ) all contain the SV40 T-antigen expression cassette (SEQ ID NO: 4) flanked by an SV40 intron (SEQ ID NO: 6) and a polyadenylation site (SEQ ID NO: 7). In addition, pGS158 contains the CAG promoter (hybrid promoter consisting of the CMV enhancer and the chicken β-actin promoter) ( Niwa et al., Gene 108: 193-199, 1991 ), pGS159 the RSV promoter (promoter from Rous sarcoma virus) (Genbank Acc No. DQ075935) and pGS161 the CMV promoter (early promoter of human cytomegalovirus) (SEQ ID NO: 5). To generate stable cell lines, plasmids pGS158, pGS159 and pGS161 contain a blasticidin expression cassette containing the ubiquitin promoter (pUB / Bsd, Invitrogen # V512-20). In a first step, a 2.6 kb fragment containing the T-antigen coding sequences was inserted into the plasmid pGS140. The plasmid pGS140 contains the human CMV promoter (SEQ ID NO: 5), an SV40 splice donor / splice acceptor site intron region (SEQ ID NO: 6), a unique NotI restriction site, and a polyA sequence of SV40 (SEQ. ID NO: 7). To insert the T-antigen fragment, pGS140 was linearized with NotI, the 5'-overhang filled in and ligated to the isolated fragment. The resulting plasmid was named pGS149.

For plasmid pGS158, pGS149 was digested with XbaI and an approximately 3 kb fragment containing the intron sequence, T antigen and polyA sequence isolated. This fragment was inserted into the NotI site (5'-overhang filled in) of pGS152. pGS152 was prepared by inserting a 1.1 kb CAG promoter fragment ( Niwa et al., Gene 108: 193-199, 1991 ) into the EcoRV interface of pUBBsd.

For Plasmid pGS159 became the 3-kb T antigen-containing XbaI fragment from pGS149 in the padded NotI interface inserted by pGS153. pGS153 contains about 0.6 kb large RSV promoter fragment inserted in the EcoRV interface of pUBBsd. For plasmid pGS161 pGS149 was digested with SphI, the 3 'overhangs filled in, the 3.6 kb fragment containing the CMV promoter, the SV40 intron, the T antigen sequence and the polyA, isolated and inserted into the EcoRV interface of pUBBsd.

b. hAAT expression plasmids: pGS116, pGS151 ( 2a , b)

Plasmid pGS116 was detailed in EP1948789 and contains the human CMV promoter followed by an SV40 splice donor / splice acceptor site, the hAAT cDNA (SEQ ID NO: 12) and the SV40 polyadenylation site ( 2a ).

The plasmid pGS151 ( 2 B ) contains this hAAT expression cassette and the starting point of DNA replication (origin of replication, ori) from SV40. Using SV40 DNA and the primers ori 1 (CCGGAATTCTTTGCAAAAGCCTAGGCCTC) (SEQ ID NO: 9) and ori 2 (CCGGAATTCTGAGGCGGAAAGAACCAGCT) (SEQ ID NO: 10), the SV40 sequences were amplified by polymerase chain reaction (PCR), digested with EcoRI ( one EcoRI site localized in the primers) and inserted into the EcoRI site of pGS116.

c. Epo-expression plasmids: pGS177 ( 2c )

Plasmid pGS 127 was described in detail in EP1948789 and contains the human CMV promoter followed by an SV40 splice donor / splice acceptor site, the human erythropoietin (Epo) cDNA and the SV40 polyadenylation site. For plasmid pGS177, the ori fragment from SV40 was amplified as described above with the primers ori 1 and ori 2 and inserted into pGS127 ( 2 B ).

2. Review of the constructs

a. sequence analysis

The completeness of all the above Plasmids were checked by restriction digestion. Furthermore, the correct sequence and orientation of the SV40 ori fragment in pGS151 and pGS177 was confirmed by sequence analysis.

b. expression

plasmids pGS158, pGS159, pGS161 were transfected into cells and expression of the T antigen by Western blots and a monoclonal antibody (Abcam, Cambridge, UK).

plasmids pGS116 and pGS151 were transfected into CAP cells and expression and secretion of human alpha1-antitrypsin (hAAT) in the culture supernatant detected by ELISA (see FIG. 5).

As well plasmids pGS127 and pGS177 were transfected into CAP cells and the expression of human Epo detected by ELISA (see 5).

3. Cultivation of cells

Amniocyte (CAP and CAP-T) cells were transfected into 293SFMII medium (Invitrogen # 11686-029), 0.5% antifungal / antibiotic (Invitrogen # 15240-062), 4 mM L-glutamine (Invitrogen # 25030-024 ) at 37 ° C, 95% humidity, 8% CO ₂ cultured. The culture medium of CAP-T cells additionally contained 5 μg / ml blasticidin (Invitrogen # R210-01). The cells were usually seeded at a starting density of 2-4 x 10 ⁵ cells / ml in a volume of 12 ml in a shake flask and cultured in the shaking incubator at 100 rpm for 3-4 days. At a density of 1-2 x 10 ⁶ cells / ml, the cells were harvested by centrifugation and further cultured with the above-described start density in fresh medium.

HEK293-T cells (ATCC # CRL-11268) were cultured in Dulbecco's Modified Eagles Medium (Advanced D-MEM, Invitrogen # 12491-015) with 10% fetal calf serum adherent in cell culture dishes. The cells were gradually adapted to serum-free suspension growth in 293-SFMII medium and cultured in shake flasks at 100 rpm, 37 ° C, 95% humidity and 8% CO ₂ .

4. Preparation of T-antigen expressing cell pool

1 × 10 ⁷ CAP cells each were transfected with 5 μg of linearized pGSl58, pGS150 and pGS161 plasmid DNA and cultured in the shaking flask under the conditions described above. For the selection of stably transfected cells, 5 μg / ml blasticidin were added 48 hours after transfection and the cells were further cultivated until after about 3-4 weeks stable growing cell pools were formed. The cell pools were designated Z582 (transfection with pGS158, T antigen expressed from the CAG promoter), Z583 (transfection with pGS159, T antigen expressed from the RSV promoter) and Z597 (transfection with pGS161, T antigen expressed from CMV). promoter).

There It is unknown if an increased T-antigen concentration possibly toxic to CAP cells, T antigen was attempted express with the help of different strong promoters. It could be shown to be the expression of a reference protein highest in CAP cells in use of the CMV promoter, slightly weaker with the CAG promoter and significantly weaker with the RSV promoter. With all three promoters were able to generate stably growing cell pools and all three cell pools express intracellular T antigen.

5. Transient protein expression in CAP and CAP T cells ( 3 . 4 . 5 )

The 359 bp ori fragment used here also contains the 21 bp and 72 bp repeat sequences (SEQ ID NO: 11) in addition to the 63 bp minimal ori in addition to this "core" sequence. Although these two repeats are primarily important for the function of the ori overlapping promoter, there is evidence that they also enhance SV40 DNA replication ( Chandrasekharappa and Subramanian, J. Virol. 61, 2973-2980, 1987 ).

To test whether the concentration of T antigen in the cell has an influence on the expression of a reference protein, three cell pools Z582, Z583 and Z597 were tested which express T antigen under promoters of different strengths and with transient expression in CAP Cells that do not express T antigen. For this purpose, 1 × 10 ⁷ cells were transfected using the Nucleofector technology (Amaxa / Lonza, program X-001, buffer V) with the circular plasmid pGS151 and cultured in a starting volume of 12 ml. Three and six days after transfection, the medium was changed, with the volume also increased to 15 ml on day 6. Throughout the course, an aliquot was taken each day, the number of cells determined, and the expression of hAAT using the ELISA (Enzyme-linked Immunosorbent Assay) method using polyclonal anti-hAAT antibodies (uncoupled and HRP-coupled; ICN Biomedicals ) certainly. As a control hAAT purified from human plasma (ICN Biomedicals) was used.

In 3 was transient expression over a period of 9 days after transfection in the three T-antigen-expressing cell pools Z582, Z583 and Z597 compared with that in parental CAP cells. The transient expression in Z582 is 8-fold, in Z583 25-fold and in Z597 70-fold higher than that of CAP cells. Also, a second CAP-T cell pool with T-antigen expression from the CMV promoter resulted in a similar high expression as with Z597. These data show that both permanent T-antigen expression in CAP cells and the level of T-antigen expression has an impact on the level of transient expression. In 4 Comparative transient expression levels of hAAT in Z597 are shown by transient transfection of pGS116 and pGS151, respectively. These two plasmids differ only in the presence of the SV40 ori fragment in pGS151. Transfection and quantitative analysis of hAAT were performed as described above, showing both the level of expression of hAAT (bars) and the development of viable cell numbers (lines) over the experimental period of 9 days. The presence of the SV40 ori fragment in the expression plasmid leads to a 30-fold increased transient expression. A total of 2.5 mg of hAAT in 40 ml volume could be expressed by transfection of 1 × 10 ⁷ CAP-T cells within 9 days, which corresponds to an expression performance of about 60 mg / L and up to 40 pg / cell / day. The 4 further shows that about 3 days after transfection cell growth sets in, the cell's vitality remains over 80% throughout the experimental period (data not shown).

Around to show that this transient expression performance is not specific is for hAAT, was another highly-glycosylated protein Erythropoietin (Epo) transiently expressed in CAP-T cells. As for hAAT 1 × 10 CAP-T cells were extracted from the Z597 cell pool with the plasmids pGS177 (contains the Epo-expression cassette and the SV40 ori fragment) and Epo in cell culture supernatant by ELISA (R & D Systems, Quantikine IVD, Human Epo Immunoassay, DEP00). about a trial period of 7 days, 0.73 mg Epo could be expressed are at an expression performance of 32 mg / L (data not shown).

6. Comparison with Transient Expression in Other Cell Systems ( 5 )

A previously described human cell line, the so-called HEK293 T cell line, stably expresses the SV40 T antigen and is based on the human, adenovirus-transformed HEK293 cell line ( DuBridge et al., Mol. Cell. Biol. 7, 379-387, 1987 ). Similar to Z597, 1 x 10 ⁷ HEK293 T cells (serum-free medium, suspension culture) were transfected with 5 μg circular plasmid pGS151 using Amaxa Nucleofector technology according to the manufacturer's instructions (program X-001, buffer V) and cultivated. In 5 the transient expression in 293-T and Z597 after transfection with the plasmid pGS151 is shown.

Even though the 293 T cell count on day 9 is significantly higher than with CAP-T, is the transient expression in CAP-T 293-T increased about 40 times.

7. Replication Assay ( 6 )

In a Replikationsassy should be shown whether the expression of T-antigen in CAP-T cells leads to an increased copy number of the ori-containing expression plasmid, thus explaining the significantly increased transient protein expression. For this purpose, Z597 or HEK293 T cells were transfected with the plasmids pGS116 and pGS151 and cultured as described above. After 6, 12, 24, 48, 72 and 96 hours, 1 × 10 ⁵ cells were removed, centrifuged off, taken up in PBS and lysed by adding an equal volume of 0.8 N NaOH. The cell lysates were blotted on a positively charged nylon membrane (GE Healthcare, Hybond-N +) in a slot blot apparatus. As a control, increasing amounts of plasmid pGS116 and pGS151 were added to 1 x 10 ⁵ Z597 cells, lysed as described above, and blotted. This standard corresponded to 1000, 2500, 5000, 10000 and 15000 copies per cell. The DNA was fixed by incubating the membrane for 30 minutes at 120 ° C and using a non-radioactively labeled PCR probe from the hAAT cDNA according to the manufacturer (AlkPhos Direct Labeling and Detection System, GE Healthcare, RPN 3680 and 3682 ) made visible. The copy number in pGS116 and pGS151 transfected cells was quantified from the known concentration of the standard plasmid. In 6 the copy number of pGS116 and pGS151 is shown in CAP-T Z597 and HEK293-T. 6 clearly shows that, as expected, only pGS151 but not pGS116 replicates in CAP-T Z597. With a constant cell number, the copy number of pGS151 increases from about 1500 copies / cell 6 h after transfection to almost 7000 copies / cell 72 h after transfection. In contrast, the copy number of pGS151 in HEK293-T remains constant for 96 h. Since the 293 T cell count has doubled during this period, it can be assumed that pGS151 is weakly replicated in these cells, but it is well below the replication rate of Z597.

Detection of expression of T antigen in the amniocytic cell lines and HEK293 T cells was performed by Western blot analysis. Of the three CAP-T cell pools and HEK293-T cells, 1 × 10 ⁶ cells each were suspended in 50 μl 50 mM Tris / HCl pH8, 140 mM NaCl, 0.5% NP40, 4 mM EDTA, 2 mM EGTA, 0.5 mM PMSF, 5% glycerol and incubated for 30 min on ice. The protein mixture was centrifuged for 10 min at 13 000 rpm and the prote in the supernatant concentration using a protein determination kit (Coomassie, Bradford, Thermo Life Science # 23200). 10 μg protein were separated on a 12% SDS-polyacrylamide gel, transferred to a nitrocellulose membrane (Hybond ECL, Amersham Pharmacia Biotech) and visualized using a T antigen-specific antibody (Abcam, anti-SV40 T antigen ab16879). This experiment showed that more T antigen is expressed in Z597 than in the other two pools and in HEK 293 T cells (data not shown).

8. Transfection with Polyethyleneimine ( 7 )

Since the transfection method described above has limited scalability, another transfection reagent, polyethyleneimine (PEI, Polysciences, # 23966), was tested, which has been described above all for large-scale transfections. Linear PEI (MW = 25,000) was dissolved according to the manufacturer's instructions at a concentration of 1 mg / ml and used in the ratio DNA: PEI = 1: 3. For transfection, 10 μg pGS151 was mixed with 30 μg PEI, incubated for 10 min at room temperature and added to 1 × 10 ⁷ CAP-T Z597 cells in 6 ml FreeStyle medium (Invitrogen # 12338-018). After 5 h, 6 ml of 293-SFMII medium were added and the cells were incubated for 7 days. Three days after transfection, the medium was exchanged with 293-SFMII, and due to the vigorous growth of the cells, the volume was increased to 30 ml. The 7 shows that high transient protein expression in CAP-T can also be achieved by transfection with PEI. However, the maximum protein yield was about 2-fold lower than that obtained with nucleofection. It is striking that the cells grow much faster and stronger after transfection with PEI and after 7 days, the approximately 10-fold cell count is achieved in comparison to nucleofection.

It follows Sequence listing according to WIPO St. 25. This can of the official publication platform of the DPMA.

QUOTES INCLUDE IN THE DESCRIPTION

This list The documents listed by the applicant have been automated generated and is solely for better information recorded by the reader. The list is not part of the German Patent or utility model application. The DPMA takes over no liability for any errors or omissions.

Cited patent literature

• EP 1948789 [0059, 0061]

Cited non-patent literature

• - worm, Nat. Biotechnology 22, 1393-1398, 2004 [0002]
• - worm, Nat. Biotechnology 22, 1393-1398, 2004 [0002]
• - Schiedner et al., BMC Biotechnology 8, 13, 2008 [0002]
• - worm, Nat. Biotechnology 22, 1393-1398, 2004 [0002]
• - Wurm and Jordan, 309-333 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 [0002]
• Baldi et al., Biotechnol. Lett. 29, 677-684, 2007 [0003]
• Pham et al., Molecular Biotechnology 34, 225-237, 2006 [0003]
• Pham et al., Molecular Biotechnology 34, 225-237, 2006 [0004]
• - Wurm et Bernard, Current Opinion in Biotechnology 10, 156-159, 1999 [0004]
• Baldi et al., Biotechnol. Lett. 29, 677-684, 2007 [0004]
• Durocher et al., Nucleic Acid Research 30, e9, 2002 [0005]
• Kunaparaju et al., Biotechnology and Bioengineering 91, 670-677, 2005 [0005]
• Baldi et al., Biotechnol. Lett. 29, 677-684, 2007 [0005]
• - Varki, Am. J. Phys. Anthropol. 33, 54-69, 2001 [0006]
• - Hohn et al., Pediat. Res. 8: 746-754, 1974 [0018]
• Niwa et al., Gene 108: 193-199, 1991 [0034]
• Niwa et al., Gene 108: 193-199, 1991 [0035]
• - Schiedner et al., BMC Biotechnology 8, 13, 2008 [0045]
• - Makrides, 9-26 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 [0046]
• Kim et al., Gene 91: 217-223, 1990 [0046]
• Niwa et al., Gene 108: 193-199, 1991 [0046]
• Adra et al., Gene 60: 65-74, 1987 [0046]
• - Makrides, 9-26 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 [0046]
• - Makrides, 9-26 in: Makrides (ed.), Gene Transfer and Expression in Mammalian Cells, Elsevier, Amsterdam, 2003 [0046]
• - Mizushima and Nagata, Nucl. Acids Res. 18: 5322, 1990 [0046]
• Bergelson et al., Science 275: 1320-1323, 1997 [0053]
• Sambrook et al., 1989, Molecular cloning: A Laboratory Manual 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York [0055]
• Niwa et al., Gene 108: 193-199, 1991 [0056]
• Niwa et al., Gene 108: 193-199, 1991 [0057]
• Chandrasekharappa and Subramanian, J. Virol. 61, 2973-2980, 1987 [0070]
• DuBridge et al., Mol. Cell. Biol. 7, 379-387, 1987 [0074]

Claims (8)

A permanent human amniocytic cell line, comprising the nucleic acid sequences for the adenoviral Gene functions E1A and E1B and the nucleic acid sequence for the large T-antigen of SV40 or the Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1). The permanent human amniocytic cell line according to claim 1, wherein the nucleic acid sequences for the adenoviral Gene functions E1A and E1B derived from a human adenovirus, in particular of the human adenovirus serotype 5. The permanent human amniocytic cell line according to claim 2, wherein the nucleic acid sequences are nucleotides 1 to 4344, 505 to 3522 or nucleotides 505 to 4079 of the human Adenovirus serotype 5. The permanent human amniocytic cell line according to claim 1, wherein the nucleic acid sequence for the large T-antigen of SV40 further the nucleic acid sequence for a promoter selected from the group CMV promoter, CAG promoter and RSV promoter, the nucleic acid sequence for SV40 SD / SA (intron) and the nucleic acid sequence for SV40 polyA, and the nucleic acid sequence for the Epstein-Barr virus (EBV) Nuclear Antigen-1 (EBNA-1) also the Nucleic acid sequence selected for a promoter from the group CMV promoter, CAG promoter and RSV promoter, the Nucleic acid sequence for SV40 SD / SA (intron) and the nucleic acid sequence for SV40 comprises polyA. Method for the transient expression of recombinant Polypeptides and proteins in a permanent human amniocytic cell line according to one of claims 1 to 4, comprising the following steps a) transfecting the cell line with a nucleic acid molecule comprising a nucleic acid sequence of a desired Polypeptide or protein and a recognition or binding site for SV40's large T-antigen or the Epstein beard virus (EBV) Nuclear Antigen-1 (EBNA-1), b) isolate the desired Polypeptide or protein from the cells or from the culture supernatant. Method according to one of the preceding claims, wherein the recombinant polypeptide or protein is a hormone, a plasma factor, a blood coagulation factor, a growth factor, a cellular Receptor, a fusion protein, the coxsackie and adenovirus receptor (CAR), an antibody, a viral, bacterial or parasitic Antigen, or complementation factors for the production of recombinant Is viruses. Use of the cells according to one of the claims 1 to 4 for the production of a polypeptide or protein. Polypeptide or protein, obtainable according to a method according to any one of the claims 5 or 6.