DE102007031137A1 - Real-time detection of nucleic acid targets, comprises providing a primer containing a sequence-target binding sequence to amplify nucleic acid, introducing a fluorophore and providing a probe for detection, which carries a fluorophore - Google Patents

Real-time detection of nucleic acid targets, comprises providing a primer containing a sequence-target binding sequence to amplify nucleic acid, introducing a fluorophore and providing a probe for detection, which carries a fluorophore

Info

Publication number
DE102007031137A1
DE102007031137A1 DE200710031137 DE102007031137A DE102007031137A1 DE 102007031137 A1 DE102007031137 A1 DE 102007031137A1 DE 200710031137 DE200710031137 DE 200710031137 DE 102007031137 A DE102007031137 A DE 102007031137A DE 102007031137 A1 DE102007031137 A1 DE 102007031137A1
Authority
DE
Grant status
Application
Patent type
Prior art keywords
nucleic
primer
fluorophore
probe
reaction
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
DE200710031137
Other languages
German (de)
Inventor
Werner Dr. Lehmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Attomol Molekulare Diagno GmbH
Attomol Molekulare Diagnostika GmbH
Original Assignee
ATTOMOL GMBH MOLEKULARE DIAGNO
Attomol Molekulare Diagnostika GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]

Abstract

Real-time detection of nucleic acid targets as products of a nucleic acid-amplification reaction by a primer/probe system, comprises providing at least a primer, which contains at least one sequence-target binding sequence (TBS) to specifically amplify nucleic acid and carries modification at the 3'-end, which allows an enzymatic extension complementary to the target; introducing a fluorophore 1; and providing at least a probe for the detection, which carries a fluorophore 2 at least at the 3'-end, where one of both fluorophores is stimulated by light of suitable wavelength. Real-time detection of nucleic acid targets as products of a nucleic acid-amplification reaction by a primer/probe system, comprises providing at least a primer, which contains at least one sequence-target binding sequence (TBS) specifically to amplify nucleic acid and carries modification at the 3'-end, which allows an enzymatic extension complementary to the target; introducing a fluorophore 1; and providing at least a probe for detection, which carries a fluorophore 2 at least at the 3'-end, where at least one probe with the complementary strand is extended to the target sequence at the 3'-end primer or use of more primers hybridized with the target strand, and one of both fluorophores is stimulated by light of suitable wavelength in such a way a fluorescence resonance energy transfer takes place between fluorophore 1 and 2, which are detected by optical fluorescence method. Independent claims are included for: (1) the primer/probe system for the detection of nucleic acids, comprising: (a) at least a primer containing at least one sequence specific for the assigned nucleic acid target and exhibiting modification at the 3'-end, which allows an enzymatic extension, where optionally one of the primer is marked with a fluorophore 1; and (b) at least a probe, which at least carries a fluorophore 2 and optionally exhibits a further fluorophore 1; (2) a reagent kit for the detection of nucleic acids, comprising at least a primer/probe system and a suitable buffer and optionally further auxiliary materials; (3) a device system for the performance of real-time polymerase chain reaction (PCR) reactions, which is fully automated computer-assisted technique, comprising: thermo-cycler, which exhibits a reaction range with several temperaturable recordings for the reaction containers; optionally an immobilization system for micro-particles; a reaction range assigned lighting mechanisms (light emitting diode and/or laser) with which the stimulated light is radiationable; detector installation, which produces measured values as a function of a measured light intensity with optical installation; optionally a reference arrangement, which produces a reference value; and an evaluator, where the reaction containers contain optically transparent container bottom and/or container cap with low characteristic fluorescence, in which the fluorescence optical analysis facilitates during the thermocyclic or isothermic performance of the detection reaction; (4) a reaction container for PCR with transparent container bottom; and (5) an immuno-PCR, which conducts multiplex-immune reactions under the use of non-fluorescent beads, porous or non-porous two-dimensional or small rod-shaped carrier materials and the analyte specific amplification product of fluorescence coded microparticle.

Description

  • [0001]
    Die Erfindung betrifft allgemein das Gebiet der Nukleinsäureamplifikation. The invention relates generally to the field of nucleic acid amplification. Insbesondere betrifft sie ein Verfahren zum „real time" Nachweis eines Nukleinsäuretargets. Gegenstand der Erfindung sind auch ein Primer/Sondensystem und ein Kit zum Nachweis eines Nukleinsäuretargets und seine Verwendung in einer Lösung oder im Array, vorzugsweise zur Flüssigphasen-PCR und zur Multiplex-PCR. More particularly, it relates to a method for "real time" detection of a nucleic acid target. The invention provides a primer / probe system and a kit for detecting a nucleic acid target and its use in a solution or in the array, preferably for liquid phase PCR and multiplex PCR ,
  • [0002]
    Verfahren zur Erkennung und Mengenbestimmung von Nukleinsäuren sind bekannt. Methods for detection and quantification of nucleic acids are known. Ausgehend von einer zu analysierenden mRNA wird zunächst eine einzelsträngige cDNA mit Hilfe einer Reversen Transkriptase hergestellt, mit Hilfe von PCR wird dann ein doppelsträngiges DNA-Amplifikationsprodukt erzeugt. Starting from an analyte mRNA, a single-stranded cDNA is prepared using a reverse transcriptase, first, a double stranded DNA amplification product is generated with the aid of PCR. Die PCR ist sowohl für qualitative als auch für quantitative Aussagen einsetzbar. The PCR can be used for both qualitative and quantitative statements. Eine Mengenbestimmung von PCR-Produkten kann auf unterschiedlichen Arten erfolgen. A quantification of PCR products can be done in different ways. Neuere Detektionsmethoden erlauben es, die in vitro Synthese von PCR-Produkten „real time", dh homogen direkt im jeweils verwendeten PCR-Reaktionsgefäß zu messen. Diese so genannte „real time" PCR (RT-PCR) stellt eine besonders sensitive Methode dar. Hierbei wird in jedem Zyklus der PCR die Entstehung von PCR-Produkten verfolgt. Newer detection methods allow the in vitro synthesis of PCR products "real time", homogeneous measure that is directly in each case used PCR reaction tube. This so-called "real time" PCR (RT-PCR) is a particularly sensitive method. Here, in each cycle of PCR, the formation of PCR products is pursued. Die Messung der Amplifikation erfolgt dabei in der Regel in Thermozyklen, welche zusätzliche Mittel zur Messung von Fluoreszenzsignalen während der Amplifikationreaktion aufweisen. The measurement of the amplification is carried out usually in the thermal cycles which have additional means for measuring fluorescence signals during the amplification reaction. Die Amplifikationsprodukte werden beispielsweise durch Fluoreszenz-markierte Hybridisationsproben, die lediglich bei Bindung an die Targetnukleinsäure Fluoreszenzsignale emittieren oder in bestimmten Fällen auch durch Doppelstrang-DNA bindende Fluoreszenzfarbstoffe detektiert. The amplification products are detected, for example by fluorescence-labeled Hybridisationsproben that emit fluorescent signals only when bound to the target nucleic acid or in certain cases also by double-strand DNA binding fluorescent dyes. Ein definierter Signalschwellenwert wird für alle analysierten Reaktionen festgelegt und die zur Erreichung des Schwellenwerts notwendige Zykluszahl Cp sowohl für die Targetnukleinsäure als auch für die Referenznukleinsäuren bestimmt. A defined signal threshold is determined for all analyzed reactions and is necessary to achieve the threshold cycle number Cp determined for both the target nucleic acid as well as for reference nucleic acids. Auf der Grundlage der für die Targetnukleinsäure sowie die Referenznukleinsäure erhaltenen Cp-Werte können so entweder absolute oder relative Kopienzahlen des Targetmoleküls bestimmt werden. Based on the obtained for the target nucleic acid and the reference nucleic acid Cp values ​​as either absolute or relative copy numbers of the target molecule can be determined.
  • [0003]
    Ein neueres Verfahren zum Nachweis eines spezifischen Nukleinsäuremoleküls verwendet so genannte „Molecular Beacons" (Tyagi et al. A more recent method for the detection of a specific nucleic acid molecule used so-called "Molecular Beacons" (Tyagi et al. US 6,150,097A US 6,150,097A ) Molecular Beacons sind farbstoffmarkierte Oligonukleotide, die eine Stamm-Schleifen-Struktur haben. ) Molecular beacons are dye-labeled oligonucleotides that have a stem-loop structure. An den beiden freien Enden der Stamm-Abschnitte (dem 3'- und dem 5'-Ende) ist jeweils ein Fluorophor gekoppelt, wobei der eine als Reporter-Farbstoff und der andere als Quencher-Farbstoff, der die Fluoreszenz des Reporter-Farbstoffs bei hinreichender räumlicher Nähe durch Foerster-Energietransfer löscht. At the two free ends of the stem portions (the 3 'and the 5' end) a fluorophore is coupled respectively, one acting as a reporter dye and the other as a quencher dye at the fluorescence of the reporter dye sufficient spatial proximity by Foerster energy transfer clears. Die Sequenzen der Stammabschnitte an beiden Enden der Molecular Beacons sind so gewählt, dass dann, wenn sich der Molecular Beacon faltet, die Stammabschnitte ausschließlich aneinander, nicht aber mit anderen Abschnitten des Oligonukleotids hybridisieren. The sequences of the stem portions at both ends of the molecular beacons are chosen so that when the molecular beacon folds, the stem portions to each other only, but do not hybridize with other portions of the oligonucleotide. Der Abstand zwischen Reporter- und Quencher-Farbstoff ist im Zustand der hybridisierten Stammabschnitte hinreichend klein, so dass der Fluoreszenz-Farbstoff auch bei geeigneter Anregung mit Licht nicht fluoresziert. The distance between the reporter and quencher dye is sufficiently small in the state of the hybridized stem portions so that the fluorescent dye does not fluoresce with light even when suitably excited. Der Schleifen-Abschnitt weist eine Sequenz auf, die zur Sequenz einer Targetsequenz komplementär ist. The loop portion has a sequence that is complementary to the sequence of a target sequence. Befinden sich die Molecular Beacons und die Targetsequenz aufweisenden Nukleinsäure-Moleküle in einer Lösung, können die Schleifenabschnitte und die Targetsequenz-Abschnitte hybridisieren, wodurch sich der Molecular Beacon unter Lösung der Hybridisierung der beiden Stammabschnitte entfaltet. Are the molecular beacons and the target sequence comprising nucleic acid molecules in a solution, the loop portions and the target sequence sections can hybridize, whereby the molecular beacon deployed under solution hybridization of two parent segments. Diese Entfaltung führt zur Vergrößerung des räumlichen Abstands zwischen dem Reporter-Farbstoff und dem Quencher-Farbstoff und der Reporter-Farbstoff wird zur Fluoreszenz angeregt. This development leads to increasing the spatial distance between the reporter dye and the quencher dye and reporter dye is excited to fluorescence. Bei kontinuierlicher Beobachtung der Fluoreszenz-Intensität kann ein Anstieg der Intensität festgestellt werden, wenn die Molecular Beacons die Targetsequenzen aufspüren und an diesen hybridisieren. With continuous monitoring of the fluorescence intensity, an increase in intensity can be detected when the Molecular Beacons track the target sequences and hybridize to these. So können die Nukleinsäuremoleküle quantitativ nachgewiesen werden. Thus, the nucleic acid molecules can be detected quantitatively. Diese Molecular Beacons haben den großen Nachteil einer aufwändigen und teuren Synthese, da diese Sonden sowohl mit dem Fluoroeszenz- als auch mit dem Quencher-Farbstoff markiert werden müssen. These molecular beacons have the great disadvantage of a complex and expensive synthesis, as these probes must be labeled with both the Fluoroeszenz- and with the quencher dye. Quencher-Fluoreszenzfarbstoff-Systeme werden in vergleichbaren Sondensystemen wie Amplifluor-Primer, Scorpions und TaqMan-Sonden genutzt. Quencher fluorescent dye systems are used in comparable probe systems such Amplifluor primer, Scorpions and TaqMan probes.
  • [0004]
    Ein weiteres bekanntes System ist das Light-Cycler-System. Another known system is the Light Cycler system. Hier werden die Fluoreszenzfarbstoffe auf zwei verschiedene Oligonukleotide verteilt. Here, the fluorescent dyes in two different oligonucleotides are distributed. Am 3'-Ende des ersten Oligonukleotides befindet sich der eine Fluoreszenzfarbstoff, z. At the 3 'end of the first oligonucleotide is a fluorescent dye, eg. B. Fluorescein, und das sich stromabwärts anlagernde Oligonukleotid hat am 5'-Ende einen weiteren Fluoreszenzfarbstoff, z. B. Fluorescein, and the downstream anlagernde oligonucleotide has a further fluorescent dye at the 5 'end, z. B. IC Red 640. Fluorescein wird von einer LED als Lichtquelle angeregt und emittiert Licht, das über Fluoreszenzresonanzenergietransfer (FRET) das zweite Fluoreszenzmolekül anregt. B. IC 640. Red Fluorescein is excited by an LED as a light source and emits light by fluorescence resonance energy transfer (FRET) excites the second fluorescent molecule. Das von dem zweiten Farbstoff emittierte Licht wird über einen entsprechenden Filter detektiert. The light emitted from the second dye light is detected over an appropriate filter. Eine Anregung des zweiten Farbstoffs kann nur dann erfolgen, wenn sich durch die Anlagerung der beiden Oligonukleotide an ihren Komplementärstrang die beiden Farbstoffmoleküle in räumlicher Nähe (Distanz 1 bis 5 Nukleotiden) befinden. An excitation of the second dye can only take place if the two dye molecules by the addition of the two oligonucleotides to their complementary strand in close proximity (distance 1 to 5 nucleotides) are located. Das Prinzip dieses Systems beruht auf der sekundären Anregung eines zweiten Fluoreszenzfarbstoffs, die erst durch die Generation des PCR-Produktes ermöglicht wird. The principle of this system is based on the secondary exciting a second fluorescent dye, which is made possible by the generation of the PCR product.
  • [0005]
    Die genannten Systeme sind grundsätzlich für Multiplexanwendungen einsetzbar, haben jedoch den Nachteil, dass – sollen verschiedene Zielsequenzen nebeneinander nachgewiesen werden – der Reaktionsansatz wegen der steigenden Zahl der verschiedenen Detektionssonden relativ teuer wird und die zunehmende Zahl der Sonden die Amplifikationsreaktion beeinträchtigen kann. Said systems are basically used for multiplexing applications, but have the disadvantage that - are different target sequences are next to each other proven - the reaction is relatively expensive because of the rising number of different detection probes and the increasing number of probes can affect the amplification reaction. Außerdem sind nicht genügend FRET-Paare bekannt, um einen hohen Multiplex-Grad zu erzielen. In addition, plenty of FRET pairs are not known to achieve a high degree of multiplexing.
  • [0006]
    Der Erfindung lag deshalb die Aufgabe zugrunde, Verfahren und Primer/Sonden-Systeme bereitzustellen, die kostengünstiger und einfach synthetisiert werden können und die gleiche oder verbesserte Sensivität aufweisen. The invention therefore had the object to provide methods and primer / probe systems that can be synthesized easily and cost-effectively and have the same or improved sensitivity. Durch geeignete Veränderung der Primerstrukturen soll eine Möglichkeit gefunden werden, den teuren Einsatz jeweils spezifischer Sondenoligonukleotide zu umgehen, wobei die Multiplex-Anwendung, die für die heutige Diagnostik immer wichtiger wird, nicht beeinträchtigt werden soll. By appropriately changing the primer structures a way should be found to bypass the expensive use each specific probe oligonucleotides, the multiplexing application, which is becoming increasingly important for today's diagnostics, should not be affected.
  • [0007]
    Erfindungsgemäß wird die Aufgabe gelöst durch ein Verfahren zum „real-time" Nachweis von Nukleinsäuretargets als Produkte einer Nukleinsäure-Amplifikationsreaktion mittels eines neuen Primer/Sondensystems. Dieses Verfahren umfasst die folgenden Schritte: According to the invention the object is achieved by a method of "real-time" detection of nucleic acid targets as products of a nucleic acid amplification reaction using a new primer / probe system This method comprises the following steps.:
    • a) Verwendung von mindestens einem Primer, der mindestens eine für die zu amplifizierende Nukleinsäure spezifische Sequenz – im folgenden auch Targetbindungssequenz(en) (TBS) genannt – umfasst und der am 3'-Ende Modifikationen trägt, die eine enzymatische Verlängerung komplementär zum Target gestatten. a) using at least one primer, the at least one specific for the product to be amplified nucleic acid sequence - in the following also target binding sequence (s) (TBS) called - includes and contributes modifications at the 3'-end, which allow an enzymatic extension complementary to the target ,
    • b) Einführung eines Fluophors 1. Dabei kann dieses Fluorophor 1 in einer Ausführungsvariante direkt an einem ersten oder weiteren Primer vorliegen oder in einer Markierungsreaktion in einen Primer eingeführt werden. b) introduction of a fluor 1. It can be directly to a first or further primer or be introduced in a labeling reaction in a primer of this fluorophore 1 in a variant embodiment. Alternativ kann es auch an einer Sonde vorliegen. Alternatively, it can also be present on a probe.
    • c) Nach enzymatischer Verlängerung erfolgt der Einsatz von mindestens einer Sonde zum Nachweis des Targets, die mindestens am 3'-Ende ein Fluorophor 2 trägt. c) After enzymatic extension of the use of at least one probe for the detection of the target, which carries at least at the 3 'end of a fluorophore 2 takes place. Dabei kann die mindestens eine Sonde mit dem Komplementärstrang des zur Targetsequenz am 3'-Ende verlängerten Primers hybridisieren oder bei Verwendung mehrerer Primer an die Targetsequenz. Here, the at least one probe to hybridize with the complementary strand of the extended to the target sequence at the 3 'end of the primer or when using multiple primers to the target sequence.
  • [0008]
    Die zwei verschiedenen, jeweils mit einem FREI-Donor bzw. FREI-Akzeptor markierten Primer/Sonden-Nukleotide sind so konstruiert, dass sich nach erfolgter Hybridisierung die Fluorophore 1 und 2 in einer für den FREI ausreichenden Nähe befinden, so dass sie während eines PCR-Zyklus eine Fluoreszenz des Akzeptors ermöglichen. The two different, each labeled with a FRET donor and FRET acceptor primer / probe nucleotides are constructed so that the fluorophores are in an amount sufficient to FREE close after hybridisation 1 and 2, so that during a PCR enable cycle fluorescence of the acceptor. Das heißt einer der beiden Fluorophore wird durch Licht geeigneter Wellenlänge angeregt, so dass zwischen Fluorophor 1 und 2 ein FREI stattfindet, der fluoreszenzoptisch detektiert wird. That is one of the two fluorophores is excited by light of a suitable wavelength, so that between fluorophore 1 and 2 there will be a free, the fluorescence is detected optically.
  • [0009]
    In einer Ausführungsvariante der Erfindung weist der mindestens eine Primer am 5'-Ende zusätzlich einen zum Target unspezifischen Schwanz auf. In one embodiment of the invention, the at least one primer at the 5 'end, in addition to a non-specific to the target tail. Fluorophor 1 kann zum Beispiel am spezifischen oder unspezifischen Teil eines ersten Primers oder an einem weiteren Primer vorliegen. 1 fluorophore may be present for example at the specific or unspecific part of a first primer, or on another primer. Die Anordnung der Fluorophore ist dabei austauschbar, so dass Fluophor 1 an einem Primer und Fluophor 2 an der Sonde vorliegen kann bzw. umgekehrt. The arrangement of the fluorophores is thereby exchangeable, so that fluor 1 may be present on the probe to a primer and fluophor 2 or vice versa. Alternativ können Fluorophor 1 und 2 in Sonden eingebracht werden. Alternatively, the fluorophore can be 1 and 2 incorporated into probes. In welcher Richtung FREI erfolgt ist letztlich egal. In which direction is carried FREE ultimately does not matter. Vorzugsweise liegen die Fluorophore 1 und 2 kovalent gebunden an Primern und Sonden vor. Preferably, the fluorophores 1 and 2 are of primers and probes covalently bound.
  • [0010]
    Die Erfindung basiert auf einem neuartigen Primer/Sonden-Design, wobei in einer ganz besonders bevorzugten Variante mindestens ein Primer eine Teilsequenz aufweist, die im 5'-Bereich teilweise komplementär zum 3'-Bereich ist, so dass sie eine Haarnadel bildet. The invention is based on a novel primer / probe design, wherein at least one primer having a partial sequence in a very particularly preferred variant, which is partially complementary to the 3 'region of the 5' region, so that it forms a hairpin.
  • [0011]
    Vorzugsweise kann der mindestens eine Primer das Fluorophor 1 am 5'-Ende aufweisen, wobei der Primer entweder nur aus einer Target-spezifischen Sequenz besteht oder zusätzlich einen unspezifischen Schwanz besitzt. Preferably, the at least one primer, the fluorophore 1 at the 5 'end, said primer consists either of only one target-specific sequence or in addition, has a non-specific tail. Nach enzymatischer Verlängerung und erfolgter Sondenhybridisierung bildet zum Nachweis des Targets der Primer am 5'-Ende keine Haarnadel oder partiell bzw. vollständig eine Haarnadel mit sich selbst oder zu der komplementär zum Target verlängerten Primersequenz, so dass ein FREI-Signal entsteht. After enzymatic extension and completion of probe hybridization to detect the target of the primer at the 5'-end does not form hairpin or partially or completely a hairpin with itself or to the complementary extended primers to the target sequence such that a FRET signal is generated.
  • [0012]
    In einer ganz bevorzugten erfindungsgemäßen Ausgestaltung ist das Verfahren dadurch gekennzeichnet, dass es mindestens drei Primer verwendet. In a very preferred embodiment of the invention the method is characterized in that it uses at least three primers. Dabei umfasst es die folgenden Schritte: It comprises the following steps:
    In einer ersten Reaktion erfolgt der Einsatz eines Primerpaares 1 und 2. Der gewählte Vorwärtsprimer 1 umfasst mindestens eine Targetbindungssequenz 1 (TBS 1) und mindestens eine Targetbindungssequenz 2 (TBS 2) und ist so konstruiert, dass TBS 1 an das zu amplifizierende Target binden kann. In a first reaction, the use of a primer pair 1 and 2. The selected forward primer 1 is performed comprises at least one target binding sequence 1 (TBS 1) and at least one target binding sequence 2 (TBS 2) and is constructed so that TBS 1 at capable of binding to amplified target , Anschließend wird dieser Primer 1 komplementär zum Target verlängert, Rückwärtsprimer 2 bindet an das komplementäre Target und wird ebenfalls verlängert. Then, this primer 1 is complementary to the target extended, reverse primer 2 binds to the complementary target and is also extended. Primer 1 enthält vorzugsweise eine TBS 1 und eine TBS 2. In einer Variante enthält er mehrere TBS 2, die sich geringfügig bis vollständig unterscheiden. Primer 1 preferably contains a TBS 1 TBS and 2. In a variant, it includes a plurality of TBS 2, which differ slightly until complete. So können in einer Reaktion mehrere Targetsequenzen in Summe erfasst werden (z. B. Erfassung humaner Papillomaviren der Gruppen „hohes Risiko" und „geringes Risiko"). Thus, several target sequences can be detected in total (z. B. detection of human papilloma viruses of the groups "high risk" and "low risk") in a reaction.
  • [0013]
    In einer weiteren Reaktion wird ein Primer 3 eingesetzt, welcher mit dem 5'-Bereich von Primer 1 identisch oder teilweise identisch ist, jedoch keine TBS aufweist. In another reaction, however, a primer 3 is used, which is identical to the 5 'region of primer 1 or partially identical, having no TBS. Primer 3 trägt gegebenenfalls das Fluorophor 1 am 5'-Ende. Primer 3 optionally bears 1, the fluorophore on the 5 'end. Er ist so konstruiert, dass er eine Haarnadel 1 vollständig oder teilweise mit sich selbst oder mit komplementären Abschnitten der Primer 1-Sequenz bilden kann. It is designed so that it may form a hairpin sequence 1 1 completely or partially with itself or with complementary portions of the primers. Die Bedingungen werden so eingestellt, dass mit Primer 2 und 3 die Amplifikation stattfindet. The conditions are adjusted so that with primers 2 and 3 takes place amplification. Dabei bindet die mindestens eine TBS 2 von Primer 1 an einen oder mehrere weitere(n) Targetbindungsabschnitt(e), welche(r) nun zwischen verlängertem Primer 1 und der komplementären Sequenz von Primer 2 liegt, wodurch eine Haarnadel 2 entsteht. The at least one TBS 2 of Primer 1 binds to one or more further (n) Target binding portion (s) which is (r) now lies between the extended primer 1 and the complementary sequence of primer 2, whereby a hairpin 2 is formed. Wird das Amplifikat dann mit der mit Fluorophor 2 markierten Sonde in Kontakt gebracht kann das mit dem Fluorophor 1 gebildete FREI-Signal detektiert werden. If the amplicon then brought into contact with the fluorophore labeled probe 2 can be detected formed with the fluorophore 1-FREE signal. In einer bevorzugten Ausgestaltung trägt der Primer 3 Fluorophor 1 und die Sonde mit Fluorophor 2 am 3'-Ende hybrisidisiert vollständig an der Targetsubstanz. In a preferred embodiment of the primers carries fluorophore 3 1 and the probe 2 with fluorophore at the 3 'end hybrisidisiert entirely at the target substance. Alternativ kann die Sonde mit Fluorophor 2 am 3'-Ende über Haarnadel 2 und Primer 1 an der Targetsbstanz hybridisieren. Alternatively, the probe with the fluorophore 2 at the 3'-end via hairpin primer 1 and 2 capable of hybridizing to the Targetsbstanz.
  • [0014]
    In einer weiteren Ausgestaltung der Erfindung können die drei Primer und zwei Sonden verwendet werden, die jeweils FREI-Donor und -Akzeptor (Fluorophor 1 und 2) tragen, wobei die eingesetzte Sonde 1 Primer 1-spezifisch ist und die verwendete Sonde 2 Target-spezifisch. In a further embodiment of the invention, the three primers and two probes may be used, each carrying FREE donor and acceptor (fluorophore 1 and 2), wherein the probe used is 1 Primer 1-specific, and the probe used 2 target specific ,
  • [0015]
    Die erfindungsgemäß eingesetzten Fluophore 1 und 2 sind ausgewählt aus Fluoreszenzfarbstoffmolekülen, wobei das Licht, das vom ersten Fluorophor absorbiert und remittiert wird, vom zweiten, nach Bindung der Sonde(n) dem ersten Fluorophor räumlich nahen zweiten Fluorophor erneut absorbiert und remittiert wird. The fluors 1 and 2 employed in this invention are selected from fluorescent dye molecules, the light that is absorbed by the first fluorophore and an equal mixture, is re-absorbed by the second, after binding of the probe (s) to the first fluorophore geographically proximate the second fluorophore and remission. Vorzugsweise dienen verschiedene Fluorophore als Donor und Akzeptor, so dass ein FREI-Signal als Auftreten Donor-stimulierter Fluoreszenz des Akzeptors aufgezeichnet werden kann. Preferably, different fluorophores are used as donor and acceptor so that a FRET signal can be recorded as the appearance of donor-stimulated fluorescence of the acceptor. Alternativ kann auch derselbe Farbstoff als Donor und Akzeptor eingesetzt werden und die resultierende Depolarisation der Fluoreszenz detektiert werden. Alternatively, the same dye can be used as donor and acceptor, and the resulting depolarization of the fluorescence to be detected. Bevorzugt ist Fluorophor 1 Fluorescein und Fluorophor 2 LC Red 640 oder LC Red 705 Beispiele für weitere bevorzugte FREI-Paare sind: Preferably, fluorophore and fluorophore fluorescein is 1 2 LC Red 640 or LC Red 705 Examples of further preferred FRET pairs:
    Fluophor 1 fluor 1 Fluophor 2 fluor 2
    Aminocumarin amino coumarin Fluorescein fluorescein
    Fluorescein fluorescein Rhodamin oder Tetramethylrhodamin Rhodamine or tetramethylrhodamine
    Fluorescein fluorescein Cy3 Cy3
    Cy3 Cy3 Cy5 Cy5
    Cy3 Cy3 Tetramethylrhodamin tetramethylrhodamine
    Europium europium Cy5 Cy5
    Terbium terbium Rhodamin rhodamine
    Bodipy Bodipy Bodipy Bodipy
    Dansyl dansyl Fluorescein fluorescein
    Naphtalen naphthalene Dansyl dansyl
    Ruthenium ruthenium Cy5. Cy5.
  • [0016]
    Wie bereits ausgeführt, kann erfindungsgemäß Fluophor 1 an einem Primer und Fluophor 2 an der Sonde vorliegen bzw. umgekehrt. As already stated, according to the invention may be fluor 1 or on a primer and 2 at the probe fluor vice versa. Das FREI-Paar kann auch an Sonden gebunden vorliegen. The FRET pair may be bound to probes. Die erfindungsgemäß eingesetzen FREI-Paare erzielen einen hohen Multiplex-Grad. The invention is set FREE pairs achieve a high degree of multiplexing. Es sind für das erfindungsgemäße Verfahren zahlreiche Fluorophore für den Spektralbereich von 350 bis 750 nm, das heißt von Ultraviolett bis Infrarot, verfügbar. Numerous fluorophores for the spectral range 350-750 nm for the inventive method, i.e., from ultraviolet to infrared, available.
  • [0017]
    Die Amplifikationsreaktion ist vorzugsweise eine homogene Flüssigphasen-PCR, eine Multiplex-PCR, eine asymmetrische PCR, eine Festphasen-PCR, eine RT-PCR, eine in situ-PCR, eine immuno-PCR oder eine nested PCR. The amplification reaction is preferably a homogeneous liquid-phase PCR, multiplex PCR, asymmetric PCR, a solid phase PCR, RT-PCR, in situ PCR, an immuno-PCR or nested PCR.
  • [0018]
    Das neuartige Primer/Sondensystem zum Nachweis von Nukleinsäuren umfasst: The novel primer / probe system for the detection of nucleic acids comprising:
    • a) mindestens einen Primer, der mindestens eine für das nachzuweisende Nukleinsäuretarget spezifische Sequenz umfasst und am 3'-Ende Modifikationen aufweist, die eine enzymatische Verlängerung gestatten, wobei gegebenenfalls einer der Primer mit einem Fluorophor 1 markiert ist, a) at least one primer comprising at least one specific for the nucleic acid to the target sequence and having modifications at the 3'-end, which allow an enzymatic extension, where appropriate, one of the primers is labeled with a fluorophore 1,
    • b) mindestens eine Sonde, die ein Fluorophor 2 trägt oder mehrere Sonden die jeweils Fluorophor 1 und 2 tragen. b) at least one probe which carries a fluorophore 2 carry one or more probes each fluorophore. 1 and 2
  • [0019]
    Vorzugsweise kommen für die verschiedenen Amplikons oder Polymorphismen unterschiedliche FREI-Paare zum Einsatz. Preferably, different FRET pairs come for the various amplicons or polymorphisms used.
  • [0020]
    Ein bevorzugtes Primer/Sondensystem umfasst: A preferred primer / probe system includes:
    • a) einen Primer, der mindestens eine für das nachzuweisende Nukleinsäuretarget spezifische Sequenz umfasst und am 3'-Ende Modifikationen aufweist, die eine enzymatische Verlängerung gestatten, wobei dieser Primer mit dem Fluorophor 1 markiert ist, a) a primer comprising at least one specific for the nucleic acid to the target sequence and having modifications at the 3'-end, which allow an enzymatic extension, said primer is labeled with the fluorophore 1,
    • b) eine Sonde, die am 3'-Ende das Fluorophor 2 trägt und die für den 3'-verlängerten Komplentärstrang von a) spezifisch ist. b) a probe which carries the fluorophore 2 at the 3 'end and is specific for the 3'-extended Komplentärstrang of a).
  • [0021]
    Ein weiteres bevorzugtes Primer/Sondensystem umfasst: Another preferred primer / probe system comprising:
    • a) drei Primer, wobei – ein Primerpaar 1 und 2 als Vorwärts- und Rückwärtsprimer fungieren und Primer 1 mindestens zwei für das nachzuweisende Nukleinsäuretarget spezifische Sequenzen (TBS 1 und 2) umfasst und beide Modifikationen aufweisen, die eine enzymatische Verlängerung gestatten, und – einen Primer 3, der mit dem 5'-Bereich von Primer 1 teilweise oder vollständig identisch ist, ebenfalls enzymatisch verlängerbar ist und Fluorophor 1 trägt, wobei er so konstruiert ist, dass er eine Haarnadel 1 vollständig oder partiell mit sich selbst oder mit komplementären Abschnitten der Primer 1-Sequenz bilden kann, a) three primers, wherein - 1 and 2 function as a pair of primers as forward and reverse primers and primer 1 at least two (for the nucleic acid to target specific sequences TBS 1 and 2), and both have modifications which allow for enzymatic extension, and - a primer 3, which is connected to the 5 'region of primer 1 is partially or completely identical, is also enzymatically extendable and fluorophore 1', wherein it is constructed so that it has a hairpin 1 completely or partially with itself or with complementary portions of the primer may form 1 sequence,
    • b) eine Sonde, die am 3'-Ende Fluorophor 2 trägt und die vollständig für die Targetsequenz spezifisch ist, oder die für die Targetsequenz und Primer 1 spezifisch ist. b) a probe which carries the 3'-end and the fluorophore 2 is completely specific for the target sequence, or which is specific for the target sequence and primer. 1
  • [0022]
    Gegenstand der Erfindung kann auch ein Primer/Sondensystem sein, das umfasst: The invention may be / probe system, a primer, comprising:
    • a) drei Primer, wobei – ein Primerpaar 1 und 2 als Vorwärts- und Rückwärtsprimer fungieren und wobei Primer 1 mindestens zwei für das nachzuweisende Nukleinsäuretarget spezifische Sequenzen (TBS) umfasst und beide Modifikationen aufweisen, die eine enzymatische Verlängerung gestatten, und – Primer 3, der mit dem 5'-Bereich von Primer 1 teilweise oder vollständig identisch ist und ebenfalls enzymatisch verlängerbar ist, 1 and 2 function as a pair of primers as forward and reverse primers and wherein comprises Primer 1 at least two specific for the nucleic acid to target sequences (TBS) and having both modifications which allow for enzymatic extension, and - - a) three primers, said primers 3, which is partially or completely identical to the 5 'region of primer 1 and also is enzymatically extendable,
    • b) zwei Sonden, die jeweils Fluorophor 1 und 2 tragen und die vollständig für die Targetsequenz spezifisch sind, oder die für die Targetsequenz und Primer 1 spezifisch sind. b) two probes, each carrying fluorophore 1 and 2 and which are completely specific for the target sequence, or that are specific to the target sequence and primer. 1
  • [0023]
    Gegenstand der Erfindung ist auch ein Reagenzienkit zum Nachweis von Nukleinsäuren umfassend The invention is also a reagent kit for the detection of nucleic acids comprising
    • – mindestens ein neuartiges Primer/Sondensystem, - at least a novel primer / probe system
    • – geeignete Puffer und ggf. weitere Hilfsstoffe. - appropriate buffer and optionally further auxiliaries.
  • [0024]
    Puffer und Hilfsstoffe sind dem Fachmann bekannt. Buffer and excipients are known in the art. Sie umfassen vorzugsweise thermostabile Polymerase, dNTP-Mix, PCR-Puffer und ggf. MgCl 2 . They preferably comprise thermostable polymerase, dNTP mix, PCR buffer and optionally MgCl 2.
  • [0025]
    Bei der technischen Realisierung von Nukleinsäureassays für Routine-Untersuchungen sind insbesondere von Bedeutung, das homogene Assay, das Multiplex-Verfahren und die so genannten Mikroarrays (auch Gen- oder Biochips genannt). In the technical realization of nucleic acid assays for routine examinations, the homogeneous assay, the multiplex method and the microarrays are known as particularly important (also called gene or biochips). In einer erfindungsgemäßen Multiplex-PCR mit dem Primer/Sondensystem bzw. dem Kit lassen sich mit dem oben beschriebenen Verfahren mehrere Primersätze kombinieren, die aufgrund unterschiedlicher Targetbindungssequenzen (TBS) die Detektion mehrerer Zielsequenzen in einem Reaktionsansatz erlauben. In an inventive multiplex PCR with the primer / probe system or the kit can be combined in several sets of primers with the above-described methods which allow due to different target binding sequences (TBS), the detection of multiple target sequences in one reaction mixture. Qualitative Messungen erfolgen, indem nach einer vorher definierten Anzahl von Amplifikationszyklen geprüft wird, ob die Konzentration der aufgekoppelten Nukleinsäuremoleküle einen bestimmten Schwellwert übersteigt. Qualitative measurements are carried out by checking after a pre-defined number of cycles of amplification, if the concentration of the nucleic acid molecules be coupled exceeds a certain threshold value. Für eine Quantifizierung wird diese Konzentration nach jedem Zyklus erfasst und die Anzahl der Zyklen bis zum Erreichen eines bestimmten Schwellwertes bestimmt. For quantification, this concentration is detected after each cycle and determines the number of cycles to reach a certain threshold value. Diese Anzahl ist ein Maß für die Konzentration der gesuchten Nukleinsäure in einer Probe. This number is a measure of the concentration of the desired nucleic acid in a sample.
  • [0026]
    Das Prinzip eines Array-Experiments besteht darin, alle auf dem Array befindlichen Genproben simultan mit einer Nukleinsäureprobe zu hybridisieren. The principle of an array experiment is to hybridize all gene probes present on the array simultaneously with a nucleic acid sample. Entscheidend ist hierbei, dass die durch reverse Transkription von RNA aus Zellen oder Gewebe gewonnene cDNA im Idealfall alle dort spezifisch exprimierten Gene umfasst. It is decisive here that the cDNA obtained by reverse transcription of RNA from cells or tissue specific expressed genes includes all there in the ideal case. Das parallele Hybridisieren einer Nukleinsäureprobe mit einer Vielzahl von komplementären Genproben auf einem DNA-Array führt zu einem charakteristischen Hybridisierungsmuster mit entsprechender Hybridisierungsintensität. The parallel hybridizing a nucleic acid sample with a plurality of complementary gene probes on a DNA array results in a characteristic pattern of hybridization with appropriate hybridization intensity. Hier zeigt sich der entscheidende Vorteil dieser Technologie gegenüber anderen Methoden zur Untersuchung von Genexpresssion. Here, the key advantage of this technology over other methods is to investigate GenExpress Sion. Während sich herkömmliche Methoden auf die Untersuchung einzelner Gene beschränken, liefert ein DNA-Array ein komplettes Genexpressionsprofil der untersuchten Zelle bzw. des untersuchten Gewebes. While conventional methods are limited to the analysis of individual genes, a DNA array provides a complete gene expression profile of the investigated cell or tissue under examination. Besonders interessant ist die hierdurch gegebene Möglichkeit, die Interaktion verschiedener Gene zu untersuchen. Particularly interesting is the hereby given way to investigate the interaction of several genes. Das Erfassen von Unterschieden in der Genexpression ist durch das gleichzeitige Hybridisieren von normalen/immortalisierten oder foetalen/adulten Zellen möglich. The detection of differences in gene expression is possible by simultaneously hybridizing normal / immortalized or fetal / adult cells.
  • [0027]
    Mit Hilfe des erfindungsgemäßen Systems und Verfahrens können zur gleichzeitigen Unterscheidung von mehreren Targetsequenzen die Targetsequenzen im Sondenbindungsbereich, im Primerbindungsbereich oder im Stamm der Haarnadel(n) vorzugsweise durch Schmelzkurvenanalyse unterschieden werden. Using the system and method of the invention, the target sequences in the probe binding region may be used to simultaneously distinguish between several target sequences in the primer binding region or in the stem of the hairpin (s) are preferably differentiated by melting curve analysis.
  • [0028]
    Darüber hinaus können zur gleichzeitigen Unterscheidung von mehreren Targetsequenzen mehrere Primer-/Sondensysteme eingesetzt werden, die sich mindestens teilweise oder vollständig in den targetsequenzspezifischen Abschnitten und den Emissionswellenlängen der emittierenden Fluophore unterscheiden, so dass diese durch Mehrfarbenfluoreszenzdetektion differentiell erfasst werden können. In addition, several primer / probe systems may be used for the simultaneous discrimination of a plurality of target sequences which differ at least partially or completely in the target sequence-specific portions and the emission wavelengths of the emitting fluors, so that they can be differentially detected by multi-color fluorescence detection.
  • [0029]
    Weiterhin können zum Nachweis von mehreren Targetsequenzen die targetspezifischen Primer sich im 3'-Bereich unterscheiden und dadurch vollständig oder unvollständig komplementär mit der Targetsequenz in der jeweiligen Probe sind, wodurch sie detektiert oder nicht detektiert werden. Furthermore, for the detection of multiple target sequences, the target-specific primer may be different in the 3 'region and thereby are completely or incompletely complementary to the target sequence in the respective sample, thereby detected or not detected.
  • [0030]
    Weiterhin können zum gleichzeitigen Nachweis von mehreren Targetsequenzen unterschiedliche Detektionssysteme eingesetzt werden, wobei die einzusetzenden targetspezifischen Primer Längenpolymorphismen und Fluorszenzmarkierungen enthalten können. Furthermore, for the simultaneous detection of multiple target sequences different detection systems can be used, wherein the amounts to be target-specific primers may contain length polymorphisms and Fluorszenzmarkierungen.
  • [0031]
    Darüber hinaus können die Targetsequenzen durch Echtzeitfluoreszenzanalyse, durch Elektrophorese oder durch Hybridisierung ohne Amplifikation der Targetsequenz, durch Hybridisierung nach der Amplifikation der Targetsequenz oder durch Hybridisierung während der Amplifikation der Targetsequenz erfasst werden. In addition, the target sequences can be detected by real-time fluorescence analysis by electrophoresis or by hybridization without amplification of the target sequence by hybridization following amplification of the target sequence or by hybridization during amplification of the target sequence.
  • [0032]
    Ihre weite Verbreitung verdankt die Real-Time-PCR zwei Eigenschaften, die im Laboralltag nur selten gut zusammenpassen: sie ist schnell und gleichzeitig präzise. Their widespread owes the real-time PCR, two characteristics that rarely work well together in the laboratory everyday life: it is fast and precise at the same time. Länger als zwei Stunden benötigt kaum ein Real-Time-Cycler, um winzigste DNA-Mengen zu vervielfältigen und zu quantifizieren. More than two hours hardly needs a real-time cycler to amplify tiny amounts of DNA and quantified. Das Ganze funktioniert auch im Hochdurchsatz. This works well in a high throughput. Bis zu 384 PCR-Reaktionen gleichzeitig können Geräte durchführen, deren Cyclerblöcke sich mit entsprechenden Mikrotiterplatten bestücken lassen. Up to 384 PCR reactions can simultaneously perform devices let their Cyclerblöcke be equipped with appropriate microtiter plates.
  • [0033]
    Real-Time-Cycler sind zahlreich bekannt. Real-time cycler are numerous known. Sie ermöglichen eine Detektion von bis vorzugsweise zu fünf Fluoreszenzfarbstoffen gleichzeitig für Multiplex Anwendungen, besitzen Heizblöcke vorzugsweise im Viererpack für 96er oder 384er-Well Mikrotiterplatten, zeigen schnelle Heiz-/Kühlraten die z. They enable detection of up to five preferably fluorescent dyes simultaneously for multiplex applications have in packs of four for 96 or 384-well microtiter plates heating blocks preferably exhibit rapid heating / cooling rates, eg. B. 30 PCR-Zyklen in 30 Minuten möglich machen, Quantifizierungssoftware, Schmelzpunktanalyse und vieles mehr. As do 30 PCR cycles in 30 minutes possible quantification software, melting point analysis and much more. Das erfindungsgemäße System und Verfahren ist auch für Hochdurchsatzlabore geeignet, die ganze Berge von Proben abarbeiten müssen, wodurch bis zu 5000 Analysen pro Tag mit entsprechenden automatisierten Real-Time-PCR-Robotern der neuesten Generation möglich sind. The system and method according to the invention is also suitable for high-throughput laboratories, need to process the mountains of samples, allowing for up to 5000 analyzes per day with appropriate automated real-time PCR latest generation robots. Falls kein Wert auf Real-Time-Quantifizierung gelegt wird und nur Interesse an der Endpunkt-PCR besteht, kann bis zu 30.000 Proben in knapp 3 Stunden durch entsprechende PCR-Roboter ermöglicht werden. If no emphasis is placed on real-time quantification and is only interested in the end-point PCR, up to 30,000 samples may be allowed in less than 3 hours through corresponding PCR robot.
  • [0034]
    Mit dem erfindungsgemäßen System kann ein vorgefertigter Real-Time-PCR-Kit bereitgestellt werden, der alle nötigen Ingredenzien enthält. With the inventive system, a prefabricated Real-Time PCR kit can be provided which contains all the necessary ingredience. Damit ist das einzelne Pipettieren von Puffer, Nuleotidmix, Reportermoleküle, Polymerasen und Primer nicht notwendig. In order for the individual pipetting buffer Nuleotidmix, reporter molecules, polymerases and primer is not necessary. Für die Quantifizierung nutzt man bei diesem (klassischen) Verfahren der Real-Time-PCR die Schmelzpunktbestimmung der amplifizierten DNA und die Analyse des Schwellenwertes der Fluoreszenzintensität (CT). For the quantification in this (conventional) method of the Real-Time PCR making use of the melting point of the amplified DNA and the analysis of the threshold value of the fluorescence intensity (CT).
  • [0035]
    Die Bestimmung eines genauen Hybridisierungsereignisses von Sonden an die immobilisierten Nukleotid-Sequenzen ist ein entscheidender Schritt für ein Erhalten von optimalen Ergebnissen bei einer Durchführung eines Mikroarrays. The determination of specific hybridization event of probes to the immobilized nucleotide sequences is a crucial step for obtaining optimum results in performing a microarray.
  • [0036]
    Erfindungsgemäß kann die Verwendung eines erfindungsgemäßen Primer/Sondenystems in einer Vorrichtung erfolgen, welche die Sonden als Fangsonden immobilisiert umfasst, zur simultanen Detektion von Targetsequenzen während der Amplifikation der Targetsequenzen, wobei die zufällig oder systematisch in der Reaktionsumgebung verteilten Messpunkte, an die die Targetsequenzen über die immobilisierte Fangsonden hybridisieren, bildgebend fluoreszenzoptisch erfasst, dekodiert und vermessen werden und die Reaktionsumgebung thermozyklisch steuerbar ist, ggf. mittels Peltierelementen, Luftstrom, Wasserbad, Wärmestrahlung, Induktion oder Mikrowellen. According to the invention the use of an inventive primer / Sondenystems can be carried out in an apparatus which comprises immobilized probes as capture probes for the simultaneous detection of target sequences during amplification of the target sequences, the randomly or systematically distributed in the reaction environment measurement points at which the target sequences on the immobilized capture probes hybridize, recorded as an image fluorescence-optically decoded and measured and the reaction environment is thermodynamically cyclically controllable, possibly by means of Peltier elements, air flow, water, radiant heat, induction or microwaves.
  • [0037]
    Bevorzugt werden Vorrichtungen zur simultanen Detektion von Targetsequenzen während der Amplifikation der Targetsequenzen verwendet, die einen optisch transparenten Gefäßboden und/oder Gefäßdeckel mit geringer Eigenfluoreszenz umfassen, welche die fluoreszenzoptische Auswertung während der thermozyklischen oder isothermischen Durchführung der Nachweisreaktion ermöglichen. Devices for the simultaneous detection of target sequences during amplification of the target sequences are preferably used which comprise an optically transparent base of the vessel and / or vessel cover with low intrinsic fluorescence, which allow the fluorescence-optical evaluation during thermal cycling or isothermal carrying out the detection reaction.
  • [0038]
    Der feste Träger kann in irgendeiner Form vorliegen, und kann aus verschiedenen Materialien bzw. Werkstoffen bestehen, die insbesondere verschiedene Metalle, Glas und Kunststoffe umfassen. The solid support may be in any form, and may consist of different materials or materials which comprise, in particular, various metals, glass and plastics. Bevorzugte feste Träger sind Nylonmembranen, Epoxidglas und Borfluoratglas. Preferred solid supports are nylon membranes, epoxy and Borfluoratglas. Der Vorteil der Verwendung von Glas und Kunststoffen kann in der Durchsichtigkeit der Materialien liegen, die die Herstellung von Trägern in der Art von Objektträgern oder Mikroplatten für den parallelen Hochdurchsatz von Proben und einer daraus herrührenden Kostenverringerung ermöglicht. The advantage of the use of glass and plastics can be in the transparency of the materials allows the production of carriers in the form of slides or microplates for parallel high throughput of samples and deriving therefrom cost reduction. Die Mikroarrays können in Form eines Objektträgers oder einer Mikroplatte (ebenfalls als Mikrotiterplatte bezeichnet) vorliegen. The microarrays can be in the form of a slide or a microplate (also referred to as a microtiter plate) are present. Bei der Mikroplatte handelt es sich um einen geschusselten (dished) Behälter mit mehreren (mindestens zwei) Vertiefungen. When the microplate is a geschusselten (dished) container having a plurality (at least two) recesses. Bei auf Mikroplatten basierenden Mikroarrays handelt es sich um eine Mikroplatte mit mehreren Vertiefungen, in deren Böden in den Mikroarray-Biochip platziert ist. When based on microplates microarray is a microplate with multiple wells is placed in the bottoms in the microarray biochip. Ein Beispiel der Mikroplatte ist eine gut bekannte ELISA Mikrotiterplatte mit 96 Vertiefungen. An example of the micro plate is a well-known ELISA 96 well microtiter plate.
  • [0039]
    Weiterhin sind auf selbst-anordnenden Schichtsystemen basierende feste Träger ebenso für die Implementierung der vorliegenden Erfindung geeignet. Furthermore, based on self-arranging layer systems solid supports are also suitable for implementing the present invention. Die Anwendung kann unter Verwendung automatischer Verfahren erfolgen. The application can be done using automated methods.
  • [0040]
    Um die Zuordnung jeder Nukleinsäure an eine bestimmte Stelle auf dem festen Träger zu ermöglichen, ist der weiterhin in verschiedene symmetrische, beispielsweise rechteckige, Bereich der gleichen Größe unterteilt, um das Muster zu erhalten, in dem die Sonden auf dem festen Träger immobilisiert sind. In order to enable the assignment of each nucleic acid to a specific location on the solid support, further symmetrical in different, for example rectangular area of ​​the same size is divided in order to obtain the pattern in which the probes are immobilized on the solid support. Das Muster ermöglicht die Analyse der Ergebnisse auf eine vereinfachte Art, da eine einfache und spezifische Zuordnung der jeweiligen Hybridisierungsereignisse möglich ist. The pattern enables the analysis of the results in a simplified manner, as an easy and specific assignment of the respective hybridization events is possible.
  • [0041]
    Bevorzugt wird eine Vorrichtung verwendet, die in einer Ausführung der Erfindung als Messpunkte fluoreszenzkodierte Mikropartikel beinhaltet, die die Fangsonden tragen und durch Schwerkraft, magnetische Kräfte oder durch chemische oder physikalische Bindung am Gefäßboden permanent oder während der Dauer des Meßvorganges immobilisiert sind. Preferably is used a device which includes, in one embodiment of the invention as measuring points fluorescence-encoded microparticles carrying the capture probes and permanently by gravity, magnetic forces or by chemical or physical bond at the bottom of the vessel, or the duration of the measurement process are immobilized. Die Erfassung erfolgt invers durch den optisch transparenten Gefäßboden oder im Auflicht durch Öl und einen optisch transparenten Deckel und durch die Ölbeschichtung. The detection is carried out inversely through the optically transparent bottom of the vessel or in incident light by oil and an optically transparent cover and through the oil coating. Alternativ zur Ölüberschichtung kann ein perforierter Heizdeckel im Thermocycler eingesetzt werden, der die Bildaufnahme im Auflicht nicht behindert. Alternatively, the oil overlay in a perforated heated lid thermocycler can be employed that does not hinder the image pickup in the incident light.
  • [0042]
    Die Verfügbarkeit von reaktiven oder nichtreaktiven Additiven flüssiger Kunststoffe, z. The availability of reactive or non-reactive additives liquid plastics such. B. Thermoplaste, Elastomere, Duromere, lässt sich effizient durch Umhüllung oder Einbettung in linearkettige oder netzwerkbildende Polymere steuern. As thermoplastics, elastomers, thermosets, can efficiently by coating or embedding in straight or network-forming polymers to control. Derartige polymerbasierte Mikrokomposite sind in Form von Mikrokapseln mit Kern-Schale-Struktur bzw. von mikroskaligen Matrixpartikeln mit weitgehend homogener Verteilung der Komponenten über den Partikelquerschnitt bekannt. Such polymer-based microcomposites are known in the form of microcapsules having a core-shell structure or matrix of micro-scale particles with a largely homogeneous distribution of the components on the particle cross section. Der Kern von Mikrokapseln kann in fester, flüssiger oder gasförmiger Form (Hohlkugeln) vorliegen. The core of the microcapsules may be in solid, liquid or gaseous form (hollow spheres) available. Bei Matrixpartikeln sind homogen- und heterogenphasige Systeme bekannt. In matrix particles systems are known Homogeneous, and heterogeneous-. Erfindungsgemäß kommen alle Mikropartikel in Frage, die eine Immobilisierung ermöglichen. According to the invention, all microparticles in question, which allow immobilization. Die Trägerteilchen bestehen vorzugsweise aus einem Polymermaterial. The carrier particles are preferably made of a polymeric material. Bevorzugt sind folgende Polymermaterialien, welche umfassen, jedoch nicht hierauf beschränkt sind: Polystyrol, Polyacrylsäure, Polyacrylnitril, Polyamid, Polyacrylamid, Polyacrolein, Polybutadien, Polycaprolacton, Polycarbonat, Polyester, Polyethylen, Polyethylenterephthalat, Polydimethylsiloxan, Polyisopren, Polyurethan, Polyvinylacetat, Polyvinylchlorid, Palyvinylpyridin, Polyvinylbenzylchlorid, Polyvinyltoluol, Polyvinylidenchlorid, Polydivinylbenzol, Polymethylmethacrylat, Polylactid, Polyglycolid, Poly(lactid-co-glycolid], Polyanhydrid, Polyorthoester, Polysulfon oder Kombinationen derselben. Andere Polymermaterialien, wie zum Beispiel Kohlehydrate, wie Carboxymethylcellulose, Hydroxyethylcellulose, Agar, Gel, ein eiweißartiges Polymer, Polypeptide, eukaryotische und prokaryotische Zellen, Lipide, Metall, Harze, Latex, Kautschuk, Silikon, wie zum Beispiel Polydimethyldiphenylsiloxan, Glas, Melamin, Keramik, Holzkohle, Kaolinit, Bentonit und dergl. können in gleicher Weise verw The following polymeric materials which include, but are not limited to, preferred are polystyrene, polyacrylic acid, polyacrylonitrile, polyamide, polyacrylamide, polyacrolein, polybutadiene, polycaprolactone, polycarbonate, polyester, polyethylene, polyethylene terephthalate, polydimethylsiloxane, polyisoprene, polyurethane, polyvinylacetate, polyvinylchloride, Palyvinylpyridin, polyvinylbenzylchloride, polyvinyltoluene, polyvinylidene chloride, polydivinylbenzene, polymethylmethacrylate, polylactide, polyglycolide, poly (lactide-co-glycolide], polyanhydrides, polyorthoesters, polysulfone, or combinations thereof. Other polymeric materials such as, for example, carbohydrates, such as carboxymethyl cellulose, hydroxyethyl cellulose, agar, gel, proteinaceous polymer, polypeptide, eukaryotic and prokaryotic cells, lipids metal, resin, latex, rubber, silicone, such as polydimethyldiphenyl siloxane, glass, melamine, ceramic, charcoal, kaolinite, bentonite and the like. can in the same way verw endet werden. be completed. In diese Polymeren können auch ein Magnet oder ein aus der Gruppe ausgewähltes magnetisch ansprechbares Metalloxid eingearbeitet werden, das aus superparamagnetischem, paramagnetischem oder ferromagnetischem Metalloxid besteht. In these polymers, a magnet or a member selected from the group magnetically addressable metal oxide may be incorporated, consisting of superparamagnetic, paramagnetic, or ferromagnetic metal oxide. Die Partikel können zusätzliche funktionelle Gruppen an der Oberfläche enthalten, wie zum Beispiel Carboxylate, Ester, Alkohole, Carbamide, Aldehyde, Amine, Schwefeloxide, Stickoxide oder Halogenide, die eine Bindung analytischer Reaktanden und/oder ein Binden von Teilchen an Teilchen erleichtern können. The particles may contain additional functional groups on the surface, such as carboxylates, esters, alcohols, carbamides, aldehydes, amines, sulfur oxides, nitrogen oxides, or halides, which may facilitate bonding of analytical reactants and / or a binding particles to particles.
  • [0043]
    Verfahren zur Herstellung von Mikropartikeln mittels reaktiver und nichtreaktiver Partikelbildungsprozesse sind vielfach beschrieben. A process for the preparation of microparticles by means of reactive and non-reactive particle formation processes have been widely described. Bei der reaktiven Partikelbildung erfolgt die Bildung der Wand oder der Matrix parallel zu einem Polymerisations-, Polykondensations- oder Polyadditionsprozess. In the reactive particle formation, the formation of the wall or of the matrix is ​​carried out in parallel with a polymerisation, polycondensation or polyaddition. Bei den nichtreaktiven Verfahren werden filmbildende Polymere direkt eingesetzt, die auf thermodynamische Weise zur Phasenseparation und zur Partikelbildung gebracht werden. In the non-reactive process film-forming polymers are used directly, which are brought by a thermodynamic phase separation and particle formation. In Verfahren zur Verkapselung fester oder flüssiger Kernmaterialien werden z. In process for encapsulating solid or liquid core materials z. B. Melamin-Formaldehyd-Harze eingesetzt. For example, melamine-formaldehyde resins used. Insbesondere Melamin-Formaldehyd-Harze sind vielfältig und problemlos einsetzbar, und sie können zur Partikelbildung aus wässriger Phase appliziert werden. In particular melamine-formaldehyde resins are varied and easily used, and they can be applied for particle formation from the aqueous phase. Die Mikrokapselgröße kann in Abhängigkeit von den Reaktionsbedingungen, z. The microcapsule size can vary depending on the reaction conditions, eg. B. Emulgatorzusatz oder Dispergiermethode eingestellt werden. B. emulsifier or dispersing method can be set. Eine weitere Möglichkeit ist die hydrothermale Vernetzung von Hydroxymethyl-Melamin. Another option is the hydrothermal networking hydroxymethyl-melamine.
  • [0044]
    Fluoreszenzkodierte Mikropartikel sind dem Fachmann bekannt und z. Fluorescently encoded microparticles are known in the art and such. B. in B. DE 699 07 630 T2 DE 699 07 630 T2 beschrieben. described. Die Farbstoffe, wenn mehr als ein Farbstoff zum Färben von mehr als einer Population von Partikeln verwendet wird, sind derart ausgewählt, dass sie wesentlich verschiedene Emissionsspektren besitzen, vorzugsweise mit Emissionsmaxima, welche um mehr als 10 nm, bevorzugter mit Emissionsmaxima, die um mehr als 25 nm, getrennt sind, noch bevorzugter um mehr als 50 nm getrennt sind. The dyes, when more than one dye for dyeing of more than one population of particles is used are selected such that they possess substantially different emission spectra, preferably having emission maxima, which is more than 10 nm, more preferably having emission maxima, as more 25 nm, are separated, are more preferably separated by more than 50 nm. Die Farbstoffe können ausgewählt werden, um Emissionsbanden aufzuweisen, welche zu im Handel erhältlichen Filtern passen, oder zum Nachweis von Mehrfachfluorophoren mit verschiedenen Erregungs- und Emissionsbanden. The dyes can be selected to have emission bands that match commercially available filters or detecting multiple fluorophores with several excitation and emission bands.
  • [0045]
    Gemäß der Erfindung werden bevorzugt Mikropartikel aus Melamin, Silika, Polysulfon und Polyether, ganz bevorzugt aus Melamin eingesetzt. In accordance with the invention are preferably microparticles from melamine, silica, polysulfone and polyether, most preferably of melamine employed. Sie haben id R. einen Durchmesser von 0,5–20 μm. You have usually a diameter of 0.5 to 20 microns. Die bevorzugte Partikelgröße beträgt 5–10 μm. The preferred particle size is 5-10 microns.
  • [0046]
    Die vorzugsweise verwendeten Mikropartikel zeichnen sich dadurch aus, dass sie bevorzugt aus 2 Schichten und einem Kern bestehen, die sich fluoreszenzoptisch unterscheiden und wobei wenigstens die äußere Schichttemperaturbeständig ist und z. The microparticles preferably used are characterized in that they preferably consist of 2 layers and a core, which differ optically fluorescence and wherein at least the outer layer of temperature resistant and z. B. aus Melamin besteht. B. consists of melamine. Die mittlere und äußere Schicht bestehen bevorzugt ebenfalls aus Melamin. The middle and outer layer are preferably also made of melamine. Die mittlere Schicht enthält Partikel wie z. The middle layer contains particles such. B. Magnetpartikel, mit deren Hilfe eine sichere Immobilisierung der Partikel während der Messung gewährleistet ist. As magnetic particles, by means of which a secure immobilization of the particles is ensured during measurement.
  • [0047]
    Das Grundelement eines bevorzugt verwendeten Chips besteht vorzugsweise aus einem Glas- oder Kunststoffträger, wie sie in der Mikroskopie verwendet werden. The basic element of a chip preferably used is preferably made of a glass or plastic substrate, such as those used in microscopy. Auf einen solchen Träger werden die Sonden (bevorzugt an Mikropartikeln) z. the probes are (preferably of microparticles) Z on such a support. B. von einem Roboter aufgebracht. As applied by a robot. Dieser muss hoch präzise und sauber arbeiten. This has to work in a highly precise and clean. Für jeden Spot werden Milliardstel Liter (normalerweise 0,6 nl) der Oligonukleotid-Lösung verwendet. For each spot billionth liter (typically 0.6 nl) used the oligonucleotide solution. Nach jedem Durchgang findet eine gründliche Selbstreinigung der Nadeln (Spülung, Ultraschall) statt, um keine Verunreinigungen zu verschleppen. After each pass a thorough self-cleaning of the needles (flush, ultrasound) will be held to procrastinate no impurities. An einem Ende der Oligonukleotide befindet sich eine Aminogruppe (NH 2 ). At one end of the oligonucleotides is an amino group (NH 2). Diese verbindet sich mit einer chemischen Reaktion dauerhaft auf dem Träger bzw. an dem Mikropartikel. This is combined with a chemical reaction permanently on the carrier or on the microparticles. Diese so genannten Spots haben einen Durchmesser von bevorzugt 100 μm (0,1 mm). These so-called spots have a diameter of preferably 100 microns (0.1 mm). Aufgrund dieser geringen Menge und des kleinen Abstandes zwischen den einzelnen Punkten (vzw. 0,3 mm) haben auf einem Glasträger bis zu 30.000 Spots Platz. Because of this low amount and the small distance between the individual points (vzw. 0.3 mm) on a glass substrate up to 30,000 Spots place. Diese dienen als spätere Andockstellen für die Proben-DNA. These serve as docking sites for later the sample DNA. Die unbenützte Fläche des Trägers muss abschließend „gesperrt" werden. Das geschieht durch eine Behandlung mit einer speziellen Blocking-Solution, die bereits im fertigen Kit enthalten sein kann. Mit Hilfe von PCR werden die spezifischen Targetgene vermehrt, mit einer Fluoreszenz gekoppelt, auf die Träger aufgetragen und zur Hybridisierung inkubiert. Gegebenefalls entfernt man durch mehrere Waschungen ungebundene DNA. Ein spezieller Scanner bestrahlt die Chips mit Licht einer passenden Wellenlänge, das die Fluoreszenz zum Leuchten bringt. Das daraus resultierende Ergebnis wird anschließend ausgewertet: Leuchten die entsprechenden Spots ist das Ergebnis positiv. The unused area of ​​the carrier must be "locked" in conclusion. This is done by a treatment with a special blocking solution, which may already be present in the finished kit. Using PCR, the specific target genes are increased, coupled with a fluorescent, to the carrier and incubated for hybridization Shared If you remove unbound by several washings DNA a special scanner irradiates the chip with light of an appropriate wavelength, which brings the fluorescent glow the resulting value will then be evaluated... lights the corresponding spots is the result positive.
  • [0048]
    Die Auswertung erfolgt fachgemäß, normalerweise unter Einbeziehung von Referenzwerten. The evaluation is performed expertly, usually involving reference values.
  • [0049]
    Geräte zur erfindungsgemäßen Durchführung von Real-Time PCR-Reaktionen an einem Array, die vollautomatisch computermäßig steuerbar sind, umfassen: Device for the inventive implementation of real-time PCR reactions on an array, which are fully automatic computer moderately controlled, include:
    • – Thermocycler, der einen Reaktionsbereich mit mehreren temperierbaren Aufnahmen für Reaktionsgefäße aufweist, - thermal cycler which has a reaction zone having a plurality of heatable seats for reaction vessels,
    • – Positioniereinrichtung für den Thermocycler, - positioning of the thermal cycler,
    • – dem Reaktionsbereich zugeordnete Beleuchtungseinrichtungen (LED und/oder Laser) mit denen Anregungslicht strahlbar ist, - associated with the reaction area illumination devices (LED and / or laser) to which excitation light is strahlbar,
    • – Detektoreinrichtung, die in Abhängigkeit von einer gemessenen Lichtintensität Messwerte erzeugt, mit Optikeinrichtungen vorzugsweise für Durchlicht und Auflicht, - detector means which generates in response to a measured light intensity values, with optical devices, preferably for transmitted and reflected light,
    • – ggf. eine Referenzeinrichtung, die einen Referenzwert erzeugt, - if necessary, a reference means for generating a reference value,
    • – Auswerteeinrichtungen. - evaluating devices.
  • [0050]
    Für den Einsatz von Mikropartikeln können die Geräte zusätzlich Immobilisierungseinrichtungen für z. For the use of microparticles, the devices can also Immobilisierungseinrichtungen for z. B. magnetische oder paramagnetische Partikel umfassen. As magnetic or paramagnetic particles comprise.
  • [0051]
    Durch die Verwendung optisch transparenter Gefäßboden und/oder Gefäßdeckel mit geringer Eigenfluoreszenz, welche die fluoreszenzoptische Auswertung während der thermozyklischen oder isothermischen Durchführung der Nachweisreaktion ermöglichen, sind Messungen mit Auflicht und Durchlichtfluoreszenz möglich. Through the use of optically transparent bottom of the vessel and / or vessel cover with low intrinsic fluorescence, which allow the fluorescence-optical evaluation during thermal cycling or isothermal carrying out the detection reaction, measurements with reflected light and transmitted light fluorescence are possible. Bei Auflichtfluoreszenz können handelsübliche Mikrotiterplatten eingesetzt werden wie z. In reflected light fluorescence standard microtiter plates can be used such. B. Nucleolink oder Nukleosorb. B. Nucleolink or Nukleosorb. Die verwendeten handelsüblichen Reaktionsgefäße können zur Verringerung der Eigenfluoreszenz beschichtet werden. The commercial reaction vessels used can be coated to reduce the self-fluorescence.
  • [0052]
    Die Durchführung von Real-time-Nachweisen am Array kann unter Verwendung der erfindungsgemäßen Sondensysteme aber auch unter Verwendung von anderen Sondensystemen wie z. The implementation of real-time evidence on the array can using the probe systems of the invention but also using other probe systems such. B. Molecular Beacon, FREI-Sonden, TaqMan, Scorpions, GenePins oder Amplifluor-Primern vorgenommen werden. B. Molecular Beacon, FRET probes, TaqMan, Scorpions, GenePins or Amplifluor primers are made.
  • Vorteile: Advantages:
    • – Kombination von Real-time Amplifikation und Chip-Detektion im PCR-Array als ein geschlossenes System ermöglicht eine genaue Bestimmung von Targetsequenzen, wobei der Multiplex-Grad nur durch den Miniaturisierungsgrad verwendeteter Array-Systeme begrenzt wird. - combination of real-time amplification and detection in PCR chip array as a closed system allows an accurate determination of target sequences, wherein the multiplexing degree is limited only by the degree of miniaturization used Teter array systems.
    • – Ein Primer, der universell für verschieden Amplifikate eingesetzt werden kann trägt bereits ein Fluophor. - A primer which can be used universally for different amplicons already carries a fluorophore. Dadurch können kostengünstig die Fluophore der Sonden verschiedener Amplikons detektiert werden (Beispiel 3). Thereby, the fluors of the probes of different amplicons can be detected (Example 3) cost-effective.
    • – Die farbstoffmarkierten Sonden und Primer müssen nicht polymorph sein, da die Polymorphismen über variierende Targetbindungssequenzen von unmarkierten Primer 1 erfaßt werden können. - The dye-labeled probes and primers need not be polymorphic since the polymorphisms can be detected by varying target binding sequences of unlabeled primer first Dadurch ist es möglich, die farbstoffmarkierten Sonden und Primer auf maximale Detektionssensitivität zu optimieren und die Spezifitätsbestimmung für die Identifizierung von Sequenzunterschieden auf die Optimierung nicht markierter Primer zu begrenzen (z. B. Primer 1, Beispiel 3), was den Kostenaufwand bei der Optimierung der PCR-Systeme reduziert. This makes it possible to optimize the dye-labeled probes and primers for maximum detection sensitivity and to limit the specificity determination for the identification of sequence differences in the optimization of non-labeled primer (z. B. Primer 1, Example 3), the cost required for the optimization of the PCR systems reduced.
    • – Da ein Fluoreszenzfarbstoff über einen Primer kovalent an das Amplifikat gebunden wird und somit nur eine Sonde eingesetzt werden muß, können höhere Empfindlichkeiten erzielt werden, können über einen höheren Temperaturbereich stabiliere Meßwerte erzielt werden, was das System robuster als das klassische Zwei-Sonden-System macht. - Since a fluorescent dye through a primer is covalently bound to the amplicon and thus only a probe must be used, higher speeds can be achieved, can be achieved over a higher temperature range stabiliere measurements, making the system more robust than the classic two-probe system makes.
    • – Da weitere Targetbindungssequenzen in Primer 1 eingeführt werden können, Polymorphismen über die Primerspezifität zu detektieren, ohne, anders als bei der klassischen allelspezifischen PCR, die Sequenz in das Priming-Ereignis mit einzubeziehen und damit zu gegebenenfalls zu verfälschen. - Since more target binding sequences can be introduced into primer 1 to detect polymorphisms through the primer specificity without, unlike the conventional allele-specific PCR, the sequence in the priming event and thus involve distort to optionally. Damit ist eine nachfolgende Sequenzierung oder Klonierung der detektierten Ursprungssequenz problemlos möglich. Thus subsequent sequencing or cloning of the detected original sequence is possible.
    • – Die eingesetzten Partikel lassen eine hohe Zahl an Kodierungen zu, da Schicht 1 (außen), der Kern und gegebenenfalls die mittlere Schicht unterschiedlich kodiert werden können. - The particles used can be a high number of codes to as Layer 1 (the outside), the core and optionally the middle layer may be coded differently. Die Einbeziehung unterschiedlicher Schichtdicken bzw. Kerndurchmesser als Kodierungsparameter bei dem Vorteil insgesamt etwa gleichgroße Partikel einsetzen zu können, erhöht weiterhin die Anzahl unterschiedlicher Kodierungsmöglichkeiten bei hoher Testgenauigkeit. The inclusion of different layer thicknesses or core diameter being able to use a total of approximately equal-sized particles as the coding parameters for the advantage of further increasing the number of different coding options at high test accuracy. Die äußere Schicht ist als Ringfluoreszenz zu erkennen, die sich gegen den Kern scharf durch die Einpolymerisation von Magnetpartikeln oder anderer Fluorochrome abgrenzen läßt. The outer layer can be seen as a ring fluorescence which can delimit sharply by the copolymerization of magnetic particles or other fluorochromes against the core. Dadurch ist es möglich äußere Schicht und Kern unter Verwendung identischer Fluorochrome oder aber auch unter Verwendung des Ligandenfarbstoffs zu kodieren. Thereby, it is possible to encode outer layer and the core using identical fluorochromes or also using the ligand dye. Damit erhöhen sich die Kodierungsmöglichkeiten für Mikropartikelpopulationen beträchtlich, so daß komplexe Detektionsansätze wie die Komplettgenotypisierung von Amplikons, Exons oder Genen im Real-time-Format möglich wird. Thus, the coding possibilities for microparticle populations considerably, so that complex detection approaches such as Komplettgenotypisierung of amplicons, exons or genes in the real-time format is possible increase.
    • – Bei Verwendung fluoreszenzmarkierter Fangprimer oder Fangsonden zur Immobilisierung an der Partikeloberfläche und nicht markierter Oligos in der Flüssigphase können FREI-Signale nur an immobilisiertem Amplifikat und nicht an Amplifikat in der Lösung entstehen, so daß störende Hintergrundfluoreszenz zugunsten der Testsensitivität minimiert wird. - When using fluorescently labeled capture primers or capture probes for immobilization on the particle surface and unlabelled oligos in the liquid phase FREE signals can only arise on immobilized amplicon and not to amplified product in the solution, so that interfering background fluorescence is minimized in favor of the test sensitivity.
    • – Die Nutzung von aktiven, auf Elektromagenten basierenden Systemen zur Immobilisierung von Mikropartikeln hat den Vorteil, daß die Mikropartikel während des Meßvorganges immobilisiert werden können und ansonsten während der PCR-Reaktion auf Grund thermischer Turbulenzen frei beweglich sind. - The use of active-based Elektromagenten systems for the immobilization of microparticles has the advantage that the microparticles can be immobilized during the measurement, and otherwise are free to move during the PCR reaction due to thermal turbulence. Dadurch wird der üblicherweise bei Biochips auftretende und die Sensitivität limittierende Massentransport der Analyten zur Fangsonde/Fangprimer überwunden. Thus, the usually occurring in biochips and the sensitivity limit animal mass transport of the analyte to the capture probe / capture primer is overcome. Intensives Schütteln, was im Thermocycler schwer technisch zu realisieren ist, kann entfallen. Intensive shaking thing to realize technically difficult in the thermocycler can be dispensed with. Strömungsabhängige Unterschiede im Gefäßlumen, wie sie sich bei ortskodierten Biochips nachteilig bemerkbar machen, verlieren an Bedeutung. Flow-dependent differences in the vascular lumen as they become disadvantageous in spatially encoded biochips become less important.
  • [0053]
    Die Erfindung ist schematisch in den The invention is schematically illustrated in 1 1 bis to 3 3 dargestellt. shown. Gegenstand der Erfindung ist auch ein Gerätesystem zur kombinierten Amplifikation von Targetsequenzen und Detektion der Amplifikate an einem Array insbesondere an einem Mikropartikelarray und in den The invention is also an instrument system for the combined amplification of target sequences and detection of the amplicons on an array on a particular microparticle array and in the 4 4 und and 5 5 näher erläutert. explained. Das vollautomatisch computergesteuerte Gerät stellt von seinen Leistungsparametern her eine Kombination aus Fluoreszenzmikroskop und Thermocycler dar, kann jedoch auch als vollintegrierte Lösung konstruiert sein. The fully automatic computer-controlled device provides from its performance parameters here is a combination of fluorescence microscope and thermal cycler, but can also be designed as a fully integrated solution. Die verschiedenen Nachweis und Gerätesysteme entsprechend The various detection devices and systems according to 1 1 bis to 5 5 funktionieren immer für alle möglichen Anwendungen, so z. always work for all sorts of applications, such. B. zum Nachweis von verschiedenen Krankheitserregern, wie z. As for the detection of different pathogens such. B. Viren, von Polymorphismen, zu simultanen Nachweisen, insbesondere zur Multiplex-Anwendung und/oder im Mikroorray. As viruses, polymorphisms to simultaneously detect, especially for multiplex application and / or in Mikroorray.
  • [0054]
    Nachfolgend wird die Erfindung anhand von Zeichnungen und Ausführungsbeispielen näher erläutert, wobei sie nicht darauf beschränkt werden soll. The invention will be explained in more detail with reference to drawings and exemplary embodiments, wherein it should not be limited thereto.
  • 1 1 – schematische Darstellung des Einsatzes eines Primer/Sondensystems unter Verwendung eines Primers und einer Sonde - schematic representation of the use of a primer / probe system using a primer and a probe
  • [0055]
    Ein Primer 1 trägt ein kovalent gebundenes Fluorophor 1, bindet mit seiner Targetbindungssequenz 1 am 3'-Ende an die Targetsequenz und wird durch eine DNS-Polymerase unter geeigneten Bedingungen komplementär zum Target verlängert. A primer 1 carries a covalently bound fluorophore 1, binds to its target binding sequence 1 at the 3'-end of the target sequence and is extended by a DNA polymerase under suitable conditions complementary to target. Nach Denaturierung des Doppelstranges kann die Sonde, die Fluorophor 2 am 3'-Ende trägt an den komplementär zum Target verlängerten Primer 1 hybridisieren. After denaturation of the double strand, the probe bearing fluorophore 2 at the 3'end capable of hybridizing to the complementary extended primers to the target. 1 Durch Bestrahlung des Reaktionsgemisches mit Licht einer definierten Wellenlänge wird ein über Fluorophor 1 vermittelter FREI ausgelöst und die Emission bei ebenfalls definierter Wellenlänge korreliert mit der im Reaktionsgemisch befindlichen Menge an Template. By irradiating the reaction mixture with light of a defined wavelength, a fluorophore about 1 mediated FREE is triggered and the emission at a defined wavelength also correlates with the amount of mixture present in the reaction template.
  • 2 2 – schematische Darstellung des Einsatzes des Primer/Sondensystems unter Verwendung eines Primers und einer Sonde zur Detektion eines Target-Polymorphismus - schematic representation of the use of the primer / probe system using a primer and a probe for detecting a target polymorphism
  • [0056]
    Primer 1 trägt ein kovalent am 5'-Ende gebundenes Fluorophor 1 sowie eine Targetbindungssequenz 1 und 2, wobei die Targetbindungssequenz 2 zur Polymorphismuserfassung dient. Primer 1 carries a covalently bound at the 5 'end and a fluorophore 1 target binding sequence 1 and 2, wherein the target binding sequence 2 is used for Polymorphismuserfassung. Primer 1 bindet mit der Targetbindungssequenz 1 seines 3'-Endes an die Targetsequenz in einer 1. Position und wird durch eine DNS-Polymerase unter geeigneten Bedingungen komplementär verlängert. Primer 1 binds to the target binding sequence 1 of its 3 'end to the target sequence in a first position and is extended by a complementary DNA polymerase under appropriate conditions. Nach Denaturierung des Doppelstranges bildet das 5'-Ende von Primer 1 über Targetbindungssequenz 2 eine Haarnadel mit der Targetsequenz 2 des Gens, die den Polymorphismus umfasst. After denaturation of the double strand, the 5 'end of primer 1 on the target binding sequence 2 forms a hairpin with the target sequence 2 of the gene which contains the polymorphism. Außerdem bindet die Sonde, die Fluorophor 2 am 3'-Ende trägt an den komplementär zum Target verlängerten Primer unmittelbar anschließend an die gebildete Haarnadel. In addition, the probe binds, the fluorophore 2 carries directly adjacent to the extended complementary to the target primer at the 3 'end of the hairpin formed. Durch Bestrahlung des Reaktionsgemisches wird mit Licht definierter Wellenlänge von Fluorophor 1 vermittelter FREI ausgelöst und eine Emission von Fluorophor 2 gemessen. defined with light of wavelength fluorophore 1 mediated FREE is triggered by irradiation of the reaction mixture and an emission of the fluorophore 2 measured. Diese Emission korreliert mit der im Reaktionsgemisch befindlichen Menge an Template, die den Polymorphismus umfasst. This emission correlates with the amount of mixture present in the reaction template, which includes the polymorphism. Zur besseren Unterscheidung von Targetsequenzen mit Polymorphismus und von Targetsequenzen ohne, die sich nur geringfügig in ihrer Targetsequenz 2 unterscheiden wird eine Schmelzkurve erstellt. For better distinction of target sequences with polymorphism and target sequences will differ only slightly in their target sequence 2 creates a melting curve without. Sind beide Targetsequenzen im Reaktionsgemisch enthalten, resultieren zwei Peaks in der Darstellung der 1. Ableitung der Schmelzkurve. If both target sequences in the reaction mixture contained two peaks resulting in the presentation of the 1st derivative of the melting curve.
  • 3 3 – schematische Darstellung des Einsatzes des Primer/Sondensystems unter Verwendung dreier Primer und einer Sonde zum Real-time-Nachweis und zum elektrophoretischen Nachweis von Polymorphismen - schematic representation of the use of the primer / probe system using three primers and a probe for real-time detection and for the electrophoretic detection of polymorphisms
    • (A) Primer 1 umfasst zwei Targetbindungssequenzen 1 und 2 sowie ein 5'-Ende, welches der Sequenz von Primer 3 entspricht. (A) Primer 1 has two target binding sequences 1 and 2 and a 5 'end which corresponds to the sequence of primer. 3 Primer 1 bindet mit der Targetbindungssequenz 1 seines 3'-Endes an die Targetsequenz des zu detektierenden Gens und wird durch eine DNS-Polymerase unter geeigneten Bedingungen komplementär zum Target verlängert. Primer 1 binds to the target binding sequence 1 of its 3 'end to the target sequence of the gene to be detected and is extended by a DNA polymerase under suitable conditions complementary to target. Nach Denaturierung des Doppelstranges bindet Primer 2 an den verlängerten Primer 1 und wird komplementär dazu verlängert. After denaturation of the double strand Primer 2 binds to the extended primer 1 is extended and complementary thereto.
    • (B) Der resultierende Doppelstrang wird denaturiert, so dass (C) Primer 3 mit Fluorophor 1 am 5'-Ende an das komplementäre Ende von Primer 1 bindet und verlängert wird. (B) The resulting double strand is denatured, so that (C) Primer 3 fluorophore-1 binds to the complementary end of primers 1 at the 5 'end, and is extended.
    • (D) Der resultierende Doppelstrang wird denaturiert, so dass bei der Rehybridisierung sich eine Haarnadel 1 zwischen Targetbindungssequenz 2 und Targetsequenz 2 ausbildet. (D) The resulting double strand is denatured, so that a hairpin 1 between target binding sequence 2 and target sequence 2 forms in the rehybridization. Außerdem bildet sich zwischen dem 5'-Ende der Primer 3-Sequenz und Primer 1 eine Haarnadel 2 aus. Further, a hairpin 2 is formed between the 5 'end of the primer 3 and primer sequence. 1 Die Sonde, die eine Markierung mit Fluorophor 2 am 3'-Ende trägt, bindet an den komplementär zum Target verlängerten Primer 3 unmittelbar anschließend an die Haarnadel 1. (D1) Zur selektiven Amplifikation unterschiedlicher Targetsequenzen unterscheidet sich Primer 1 in der Targetbindungssequenz 1 und durch einen Längenmarker zwischen Primerbindungssequenz 1 am 3'-Ende sowie Primersequenz 3 an seinem 5'-Ende von anderen Primern 1 für andere Targetsequenzen im Multiplex-Ansatz. The probe, which carries a labeling fluorophore-2 at the 3 'end, immediately thereafter binds to the complementary extended to the target primer 3 to the hairpin 1 (D1) for selective amplification of different target sequences to primer 1 is different in the target binding sequence of 1, and by a marker length between the primer-binding sequence 1 at the 3 'end, and primer sequence 3 at its 5'-end of the other primers 1 for other target sequences in a multiplex approach.
  • [0057]
    Durch Bestrahlung des Reaktionsgemisches mit Licht definierter Wellenlänge wird ein über Fluorophor 1 vermittelter FREI ausgelöst und eine Emission von Fluorophor 2 bei definierter Wellenlänge gemessen. By irradiation of the reaction mixture with light of a defined wavelength, a fluorophore about 1 mediated FREE is triggered and an emission of the fluorophore 2 measured at a defined wavelength. Diese Emission korreliert mit der im Reaktionsgemisch befindlichen Menge an Template, die den Polymorphismus umfasst. This emission correlates with the amount of mixture present in the reaction template, which includes the polymorphism. Zur besseren Unterscheidung von Targetsequenzen mit Polymorphismus und von Targetsequenzen ohne, die sich nur geringfügig in ihrer Targetsequenz 2 unterscheiden wird eine Schmelzkurve erstellt. For better distinction of target sequences with polymorphism and target sequences will differ only slightly in their target sequence 2 creates a melting curve without. Sind beide Targetsequenzen im Reaktionsgemisch enthalten, resultieren zwei Peaks in der Darstellung der 1. Ableitung der Schmelzkurve. If both target sequences in the reaction mixture contained two peaks resulting in the presentation of the 1st derivative of the melting curve. Auf Grund unterschiedlicher Längenmarker in unterschiedlichen Primern 1 (siehe D1?) können die Amplifikate zusätzlich auch durch Gelelktrophorese oder Massenspektroskopie detektiert bzw. unterschieden werden. Due to different length marker in different primers 1 (see D1?) May be the amplified additionally also detected by gel electrophoresis or mass spectroscopy or distinguished.
  • 4a 4a : schematische Darstellung des Nachweises mehrerer Targetsequenzen mit einer Kombination aus Real-time-PCR und Mikropartikelarray : Schematic representation of the detection of multiple target sequences using a combination of real-time PCR and microparticles array
  • [0058]
    Als feste Phase für die Hybridisierung von Amplifikat unterschiedlicher oder ein und der selben Nukleotidsequenz an in ihrer Sequenz verschiedener, mit Fluophor 2 am 3'-Ende markierter und über ihr 5'-Ende kovalent immobilisierter Fangsonden (bestehend aus DNA, PTO-DNA oder LNA) dienen fluoreszenzkodierte Mikropartikel. As the solid phase for the hybridization of amplicon different or one and the same nucleotide sequence in their sequence of different, with fluophor 2 (at the 3 'end labeled and covalently immobilized via its 5'-end of capture probes consisting of DNA, PTO DNA or LNA ) are fluorescently encoded microparticles.
  • [0059]
    Die verwendeten Mikropartikel sind an sich dem Fachmann bekannt und zeichnen sich dadurch aus, dass sie bevorzugt aus 2 Schichten und einem Kern bestehen, die sich fluoreszenzoptisch unterscheiden und wobei wenigstens die äußere Schicht temperaturbeständig ist und z. The microparticles used are known per se in the art and are characterized in that they preferably consist of 2 layers and a core, which differ optically fluorescence and wherein at least the outer layer is temperature resistant and z. B. aus Melamin besteht. B. consists of melamine. Die mittlere und äußere Schicht bestehen bevorzugt ebenfalls aus Melamin. The middle and outer layer are preferably also made of melamine. Die mittlere Schicht enthält Partikel wie z. The middle layer contains particles such. B. Magnetpartikel, mit deren Hilfe eine sichere Immobilisierung der Partikel während der Messung gewährleistet ist. As magnetic particles, by means of which a secure immobilization of the particles is ensured during measurement.
  • [0060]
    Die Erfindung kommt beispielsweise in einem Array wie folgt zur Anwendung: Partikel aus Partikelpopulation 1 (linke Abbildungshälfte): The invention is for example in an array as follows are used: particles of particle population 1 (left panel half):
    Der Kern enthält z. The core contains z. B. 100 Teile Aminocumarin und z. B. 100 parts aminocoumarin and z. B. 20 Teile Nilblau (100/20). B. 20 parts of Nile blue (100/20). Die mittlere Schicht enthält z. The middle layer contains z. B. 100 Teile Fluorescein und die äußere Schicht enthält z. B. 100 parts of fluorescein and the outer layer contains z. B. 50 Teile Aminocumarin und z. B. 50 parts aminocoumarin and z. B. 100 Teile Nilblau. B. 100 parts Nile.
  • [0061]
    Farbstoff 1 im hybridisierten Amplifikat ist z. 1 dye in the hybridized amplicon is z. B. Fluorescein als Fluorophor 1 und Farbstoff 2 am 3'-Ende der Fangsonde ist z. Fluorescein as the fluorophore dye 1 and 2 at the 3 'end of the capture probe is z. B. Rhodamin als Fluorophor 2, so dass ein FREI-Paar entsteht. B. Rhodamine as a fluorophore 2, so that a FRET pair is created.
  • Partikel aus Partikelpopulation 2 (rechte Abbildungshälfte): Particles of particle population 2 (right half of figure):
  • [0062]
    Der Kern enthält z. The core contains z. B. 100 Teile Aminocumarin und z. B. 100 parts aminocoumarin and z. B. 20 Teile Nilblau (100/20). B. 20 parts of Nile blue (100/20). Die mittlere Schicht enthält z. The middle layer contains z. B. 20 Teile Fluorescein und die äußere Schicht enthält z. B. 20 parts of fluorescein and the outer layer contains z. B. 100 Teile Aminocumarin und z. B. 100 parts aminocoumarin and z. B. 100 Teile Nilblau. B. 100 parts Nile.
  • [0063]
    Wenn kein Amplifikat hybridisiert, kann kein FREI-Paar zwischen Farbstoff 1 (z. B. Fluorescein) und Farbstoff 2 am 3'-Ende der Fangsonde (z. B. Rhodamin) entstehen. If no amplified product hybridized, no FRET pair between Dye 1 (eg., Fluorescein) and dye 2 may occur at the 3 'end of the capture probe (z. B. rhodamine). Nachdem die amplifikathaltige Probe mit den Mikropartikeln in Kontakt gebracht wurde oder zyklisch während der Amplifikation im selben Reaktionsgefäß das Amplifikat entsteht, werden vor dem Messvorgang mittels mikroskopischer Optik, um die Hybridisierung des Amplifkates an unterschiedliche Mikropartikelpopulationen zu messen, alle Mikropartikel im Ansatz sedimentiert oder durch einen permanenten oder elektrischen Magenten am Gefäßboden fixiert. After the amplifikathaltige sample was brought into contact with the microparticles or cyclically, the amplificate is produced during amplification in the same reaction vessel, be before the measuring operation by means of microscopic optics to measure the hybridization of the Amplifkates to different microparticle populations, sedimented all microparticles in the mixture or by a permanent or electric Magenten fixed to the bottom of the vessel.
  • [0064]
    Durch Fluoreszenzspektroskopie werden die Mikropartikelpopulationen identifiziert und damit festgestellt, welche Fangsonde sich an welchem Mikropartikel befinden und ob fluoreszierendes Amplifikat hybridisierte. By fluorescence spectroscopy, the microparticle populations are identified and determined with what capture probe are located on which microparticles and whether fluorescent amplicon hybridized. Dazu erfolgt die Anregung des beispielhaft genannten Aminocumarins bei einer Wellenlänge von 350 nm, um die erste Kodierungsfluoreszenz der Partikel in der äußeren und in der inneren Schicht zu erfassen. For this purpose, the excitation of the exemplified aminocoumarin carried out at a wavelength of 350 nm, to detect the first coding fluorescence of the particles in the outer and in the inner layer. Anschließend wird z. Then z. B. Fluorescein bei einer Wellenlänge von 480 nm angeregt und bei 520 nm gemessen, um die zweite Kodierungs/Referenzfluoreszenz der Partikel zu bestimmen und simultan bei Verwendung eines Strahlteilerprismas (bei 560 nm) um das FREI-Signal (hier z. B. die Rhodaminfluoreszenz) des hybridisierten Amplifikates zu erfassen. Fluorescein excited at a wavelength of 480 nm and measured at 520 nm to determine the second encoding / reference fluorescence of the particles, and simultaneously using a beam splitter prism (at 560 nm) to the FRET signal (here z. B. The rhodamine ) of the hybridized amplicon to be detected. Durch nachfolgende Anregung bei 680 nm und Detektion bei 720 nm wird das beispielhaft genannte Nilblau angeregt und detektiert, um die zweite Kodierungsfluoreszenz des Kerns bzw. der äußeren Schicht zu bestimmen. exemplarily called Nile blue is excited and detected to determine the second coding fluorescence of the core or the outer layer by subsequent excitation at 680 nm and detection at 720 nm.
  • [0065]
    Die Verrechnung der ortsaufgelöst detektierten Fluoreszenzsiganle erfolgt nach folgenden Regeln: The offsetting of spatially resolved detected Fluoreszenzsiganle according to the following rules:
  • Kern: Core:
    • – Ermittlung des Quotienten 1 aus Aminocumarin- und Nilblau-Fluoreszenz - determination of the quotient from 1 and Aminocumarin- Nile blue fluorescence
    • – Ermittlung des Kerndurchmessers - Identification of the core diameter
  • Mittlere Schicht: Middle layer:
    • – Ermittlung des Quotienten 2 aus Fluoresceinfluoreszenz und Quotienten 1 - determination of the ratio 2 of fluorescein fluorescence quotient and 1
    • – Ermittlung der Dicke von Schicht 2 - determining the thickness of layer 2
  • Äußere Schicht: Outer layer:
    • – Ermittlung des Quotienten 3 aus Aminocumarin- und Nilblau-Fluoreszenz - determination of the ratio of 3 Aminocumarin- and Nile Blue fluorescence
    • – Ermittlung der Dicke von Schicht 3 - determining the thickness of layer 3
  • [0066]
    Nach diesen Regeln können die Mikropartikel des vorliegenden Beispiels dadurch unterschieden werden, daß Quotient 3 beider Partikel sich messbar unterscheidet. According to these rules, the microparticles of the present example can be distinguished in that the quotient of both particles 3 differs measurably.
  • Quotient 3 quotient 3
    • Partikelpopulation 1: 0,5 Particle population 1: 0.5
    • Partikelpopulation 2: 1 Particle population 2: 1
  • [0067]
    Alle übrigen Quotienten und alle anderen Durchmesser und Schichtdicken der Partikel unterscheiden sich nicht. All remaining quotients and all other diameters and thicknesses of the particles do not differ.
  • [0068]
    Die Amplifikat-Fluoreszenz, z. The amplicon fluorescence z. B. die der Emission des Rhodamin-FREI-Signals entspricht, kann als Intensität ausgegeben werden oder gegen einen konstant gehaltenen Parameter wie den Partikelgesamtdurchmesser der z. B. corresponding to the emission of the rhodamine-FRET signal can be output as intensity or against a held constant parameters such as the total particle diameter of z. B. über das Fluorescein- oder Rhodaminsignal erfasst werden kann, referenziert werden. B. can be detected using the fluorescein or Rhodaminsignal be referenced.
  • [0069]
    Wird die (z. B. Rhodamin)-Fluoreszenz während jedes PCR-Zyklus' gemessen, wenn PCR und Detektion simultan ablaufen, ist die Probe als positiv bewertet, wenn das FRET-Signal die Hintergrundsintensität durchbricht (Threshold-Cycle). If the (z. B. rhodamine) fluorescence measured 'during each PCR cycle as PCR and detection occur simultaneously, the sample is considered positive if the FRET signal breaks the background intensity (Threshold Cycle). Je mehr amplifizierte Targetsequenz in der Probe ist, um so höher ist die Signalintensität oder um so früher wird der Threshold-Cycle erreicht. The more amplified target sequence in the sample, the higher is the signal intensity or the earlier the threshold cycle is achieved. Insbesondere die Bestimmung des Threshold-Cycle lässt eine genaue Multiplex-Quantifizierung von Targetsequenzen zu. In particular, the determination of the threshold cycle allows an accurate multiplex quantification of target sequences. Alternativ kann für alle Mikropartikel am Ende der PCR eine Schmelzkurve aufgezeichnet werden (siehe auch Beispiel 2). Alternatively, a melting curve can be recorded (see also Example 2) for all microparticles at the end of PCR.
  • 4b 4b : schematische Darstellung des Nachweises eines Polymorphismus' an Amplifikat, welches durch Festphasen-PCR auf der Oberfläche von Mikropartikeln immobilisiert wird (am Bespile eines Polymorphismus im Faktor 2-Gen) : Schematic representation of the detection which is immobilized by solid phase-PCR on the surface of microparticles of a polymorphism of amplificate (the Bespile a polymorphism in the factor 2 gene)
  • [0070]
    Als feste Phase für die Immobilisierung von Amplifikat unterschiedlicher oder ein und der selben Nukleotidsequenz an in ihrer Sequenz verschiedener, mit über ihr 5'-Ende kovalent immobilisierter Fangprimer dienen fluoreszenzkodierte Mikropartikel. As the solid phase for immobilization of different amplicon or one and the same nucleotide sequence in their sequence of different, with about their 5 'end covalently immobilized capture primers fluorescently encoded microparticles are used. Die verwendeten Mikropartikel zeichnen sich dadurch aus, daß sie bevorzugt aus 2 Schichten und einem Kern bestehen, die sich fluoreszenzoptisch unterscheiden und wobei wenigstens die äußere Schicht temperaturbeständig ist und z. The microparticles used are characterized in that they preferably consist of 2 layers and a core, which differ optically fluorescence and wherein at least the outer layer is temperature resistant and z. B. aus Melamin besteht. B. consists of melamine. Die mittlere und äußere Schicht bestehen hier ebenfalls aus Melamin. The middle and outer layer also made here of melamine. Die mittlere Schicht enthält Partikel wie z. The middle layer contains particles such. B. Magnetpartikel, mit deren Hilfe eine sichere Immobilisierung der Partikel während der Messung gewährleistet ist. As magnetic particles, by means of which a secure immobilization of the particles is ensured during measurement. Der Einfachheit halber wurde hier nur ein Partikel aus Partikelpopulation 1 dargestellt, wobei für die Detektion mehrerer Polymorphismen auch mehrere Partikelpopulationen mit jeweils targetspezifischen Fangsonden eingesetzt werden können. For simplicity, only one particle has been presented for particle population 1 here, whereby a plurality of particle populations can be used with each target-specific capture probes for the detection of multiple polymorphisms.
  • Partikel aus Partikelpopulation 1, Particles of particle population 1,
  • [0071]
    Der Kern enthält 100 Teile Aminocumarin und 20 Teile Nilblau (100/20). The core contains 100 parts aminocoumarin and 20 parts of Nile blue (100/20). Die mittlere Schicht enthält 100 Teile Fluorescein und die äußere Schicht enthält 50 Teile Aminocumarin und 100 Teile Nilblau. The middle layer contains 100 parts of fluorescein and the outer layer contains 50 parts aminocoumarin and 100 parts of Nile Blue.
  • [0072]
    Farbstoff 1 im immobilisierten Amplifikat ist Fluorescein und Farbstoff 2 am 3'-Ende der Fangsonde ist Rhodamin, so daß ein FREI-Paar entsteht. Dye 1 in the immobilized amplicon is fluorescein and Dye 2 at the 3 'end of the capture probe is rhodamine, so that a FRET pair is created.
  • [0073]
    Nachdem die Probe mit den Mikropartikeln in Kontakt gebracht und thermozyklisch amplifiziert wurde, werden vor dem Meßvorgang mittels mikroskopischer Optik, um die Hybridisierung des Amplifkates an unterschiedliche Mikropartieklpopulationen zu messen, alle Mikropartikel im Ansatz sedimentiert oder wie hier im Beispiel durch einen permanenten oder elektrischen Magneten am Gefäßboden fixiert. was after the sample with the microparticles placed in contact and heat cyclically amplified are in front of the measuring means of microscopic optics to measure the hybridization of the Amplifkates to different Mikropartieklpopulationen sedimented all microparticles in the mixture or, as in this example by a permanent or electric magnet to the vessel bottom fixed.
  • [0074]
    Durch Fluoreszenzspektroskopie werden die Mikropartikelpopulationen ortsaufgelöst identifiziert und damit festgestellt, welcher Fangprimer sich an welchem Mikropartikel befindet und ob fluoreszierendes Amplifikat immobilisiert wurde. By fluorescence spectroscopy, the microparticle populations are spatially resolved identified and determined so that fishing primer at which microparticles and whether fluorescent amplicon was immobilized. Dazu erfolgt die Anregung des Aminocumarin bei einer Wellenlänge von 350 nm, um die erste Kodierungsfluoreszenz der Partikel in der äußeren und in der inneren Schicht zu erfassen. For this purpose, the excitation of the aminocoumarin carried out at a wavelength of 350 nm, to detect the first coding fluorescence of the particles in the outer and in the inner layer. Anschließend wird Fluorescein bei einer Wellenlänge von 480 nm angeregt und bei 520 nm gemessen, um die zweite Kodierungs/Referenzfluoreszenz der Partikel zu bestimmen und simultan, bei dehybridisierter Sonde, um immobilisiertes Amplifikat zu detektieren. Subsequently, fluorescein is excited at a wavelength of 480 nm and measured at 520 nm to determine the second encoding / reference fluorescence of the particles, and simultaneously, at dehybridisierter probe to detect immobilized amplicon. Für die Analyse etwaiger Polymorphismen wird anschließend bei 480 nm Anregungswellenlänge und bei 560 nm Emissionswellenlänge ortsaufgelöst detektiert um das FREI-Signal (Rhodaminfluoreszenz) der an das Amplifikat hybridisierten Sonde über einen Temperaturstufengradienten zu erfassen. For the analysis of any polymorphisms is subsequently at 480 nm excitation wavelength and detected by the FRET signal (rhodamine) hybridized to the amplified product over a probe Temperaturstufengradienten spatially resolved to detect at 560 nm emission wavelength. Durch nachfolgende Anregung bei 680 nm und Detektion bei 720 nm wird Nilblau angeregt und detektiert, um die zweite Kodierungsfluoreszenz des Kerns bzw. der äußeren Schicht zu bestimmen. Nile blue is excited and detected to determine the second coding fluorescence of the core or the outer layer by subsequent excitation at 680 nm and detection at 720 nm. Die Verrechnung der ortsaufgelöst detektierten Fluoreszenzsiganle erfolgt nach folgenden Regeln: The offsetting of spatially resolved detected Fluoreszenzsiganle according to the following rules:
  • Kern: Core:
    • – Ermittlung des Quotienten 1 aus Aminocumarin- und Nilblau-Fluoreszenz - determination of the quotient from 1 and Aminocumarin- Nile blue fluorescence
    • – Ermittlung des Kerndurchmessers - Identification of the core diameter
  • Mittlere Schicht: Middle layer:
    • – Ermittlung des Quotienten 2 aus Fluoresceinfluoreszenz und Quotienten 1 - determination of the ratio 2 of fluorescein fluorescence quotient and 1
    • – Ermittlung der Dicke von Schicht 2 - determining the thickness of layer 2
  • Äußere Schicht: Outer layer:
    • – Ermittlung des Quotienten 3 aus Aminocumarin- und Nilblau-Fluoreszenz - determination of the ratio of 3 Aminocumarin- and Nile Blue fluorescence
    • – Ermittlung der Dicke von Schicht 3 - determining the thickness of layer 3
  • [0075]
    Nachdiesen Regeln können die Mikropartikel des vorliegenden Beispiels dadurch unterschieden werden, daß Quotient 3 beider Partikel sich meßbar unterscheidet. Nachdiesen rules, the microparticles of the present example can be distinguished in that the quotient of both particles 3 differs measurably.
  • Quotient 3 quotient 3
    • Partikelpopulation 1: 0,5 Particle population 1: 0.5
    • Partikelpopulation 2: 1 Particle population 2: 1
  • [0076]
    Alle übrigen Quotienten und alle anderen Durchmesser und Schichtdicken der Partikel unterscheiden sich nicht. All remaining quotients and all other diameters and thicknesses of the particles do not differ.
  • [0077]
    Die Amplifikat-Fluoreszenz, die der Emission des Rhodamin-FREI-Signals entspricht kann als Intensität ausgegeben werden oder gegen einen konstant gehaltenen Parameter wie den Partikelgesamtdurchmesser der über das Fluorescein- oder Rhodaminsignal erfaßt werden kann, referenziert werden. The amplicon fluorescence corresponding to the emission of the rhodamine-FRET signal can be outputted as intensity or against a held constant parameters such as the total particle diameter which can be detected using the fluorescein or Rhodaminsignal be referenced.
  • [0078]
    Obwohl der Nachweis von Nukleisäurepolymorphismen auch entsprechend Although the detection of Nukleisäurepolymorphismen correspondingly 4a 4a durchgeführt werden kann, wird man bevorzugt folgendermaßen vorgehen. can be performed, the procedure will preferably as follows. Nachdem durch die PCR ausreichend Amplifikat auf den Mikropartikeln immobilisiert wurde, wird eine Schmelzkurve gefahren, dh, im kritischen Temperaturbereich zwischen 50°C und 70°C werden Messungen im Stufengradienten mit einem Abstand zwischen Stufen den von 2°C durchgeführt. After amplicon was immobilized on the microparticles sufficiently by the PCR, a melting curve is being driven, that is, in the critical temperature range between 50 ° C and 70 ° C measurements in the step gradient are carried out with a spacing between levels of the 2 ° C. Alternativ genügt es, eine Zweipunktmessung im Bereich des Schmelzkurvenpeaks jedes Amplikons (Sondenbereich oder Stambereich der Haarnadel) durchzuführen oder aber die Signale über den Stufengradienten in kleineren Schritten oder kontinuierlich zu detektieren. Alternatively, it is sufficient to carry out or to detect the signals over the step gradient in smaller steps or continuously, a two-point measurement in the range of the melting curve peaks each amplicon (probe section or Stambereich of the hairpin). Die Signale, die für einen Mikropartikelpopulation erfaßt werden, können gemittelt oder einzeln analysiert und dargestellt werden. The signals that are detected for a microparticle population can be averaged or individually analyzed and displayed.
  • [0079]
    Erfolgt die Schmelzpunktpunktbestimmung für einen Polymorphismus an einem Partikel an zwei Punkten, dann können die Absolutwerte der Signale miteinander verglichen werden oder ein Quotient aus beiden Signalen gebildet werden. If the melting point point determination for a polymorphism at a particle at two points, then the absolute values ​​of the signals can be compared with each other or a quotient is formed from two signals. Wird ein Signal detektiert, bedeutet dies die Anwesenheit des entsprechenden Polymorphismus in der Probe. If a signal is detected, it means the presence of the corresponding polymorphism in the sample.
  • [0080]
    Das Signal entsteht dann, wenn ausreichend Amplifikat über die Fangprimer an der Partikeloberfläche immobilisiert wird, die Sonde an das Amplifikat hybridisiert und das 5'-Ende des targetspezifischen Abschnittes des Fangprimers unter Ausbildung einer Haarnadel mit der/den Nukleotidposition(en) des Polymorphismus hybridisiert. The signal when amplicon is immobilized on the capture primer on the particle surface sufficiently, the probe hybridizes to the amplified and hybridized to the 5 'end of the target-specific portion of the capture primer to form a hairpin with the / the nucleotide position (s) of the polymorphism created. Fehlpaarungen im Stamm der Haarnadel können über die Schmelzpunktanalyse erfaßt werden. Mismatches in the stem of the hairpin can be detected above the melting point analysis. Während das im Schema dargestellte Amplikon ohne Fehlpaarung eine Haarnadel bildet, tritt mit Variation der Stammsequenz der Haarnadel im polymorphen Nukleotid an dieser Stelle eine Fehlpaarung auf, so daß bei der gleichen Temperatur sich die Haarnadel nicht ausbildet. While the amplicon shown in Scheme forms a hairpin without mismatch of the hairpin in the polymorphic nucleotide at this point occurs with variation of the master sequence in a mismatch, so that the hairpin is not formed at the same temperature.
  • [0081]
    Durch Kombination mehrerer Partikelpopulationen in einer Nachweisreaktion, können mehrere Amplifikate unterschiedlicher oder gleicher Genfragmente gleichzeitig auf Polymorphismen untersucht werden. By combining several particle populations in a detection reaction, several amplicons different or the same gene fragments can be assayed simultaneously for polymorphisms.
  • 5 5 : Schematische Darstellung eines Gerätesystems (A) und einer Reaktionsumgebung (B) zur kombinierten Amplifikation von Targetsequenzen und Detektion der Amplifikate am Mikropartikelarray : Schematic representation of a device system (A) and a reaction area (B) for the combined amplification of target sequences and detection of the amplified products on microparticle array
    • (A) Das vollautomatisch computergesteuerte Gerät stellt von seinen Leistungsparametern her eine Kombination aus Fluoreszenzmikroskop und Thermocycler dar. An einem Stativ (A) The fully automatic computerized device provides from its performance parameters produces a combination of fluorescence microscopy and thermal cycler is. On a tripod 6 6 mit motorisiertem (z-Trieb) befinden sich die optischen Komponenten mindestens bestehend aus einer Long-Distanz-Optik are motorized (z-drive) the optical components at least consisting of a long-distance optical 5 5 für die Fluoreszenzdetektion mit einem 20er-Objektiv und Elementen zur Strahlführung und zum Bildaufbau ausgestattet. equipped for fluorescence detection with a 20 objective and elements for beam guidance and for image construction. Die Anregung erfolgt über mindestens drei verschiedene LED Excitation takes place over at least three different LED 3 3 oder LASER or LASER 4 4 in den Spektralbereichen 350–400 nm; in the spectral ranges 350-400 nm; 450–500 nm; 450-500 nm; 550–600 nm. Die konkrete Wellenlängen des Anregungslichtes richten sich nach den verwendeten Fluoreszenzfarbstoffen und werden bei Bedarf durch passende Filter 550-600 nm. The specific wavelengths of the excitation light are determined by the used fluorescent dyes and, if required by appropriate filter 2 2 feinjustiert. fine-tuned. Das von den Fluoreszenzfarbstoffen emittierte Licht wird durch entsprechende Emissionsfilter The light emitted from the fluorescent dyes light through corresponding emission filter 1 1 vom Anregungslicht getrennt und durch eine sensitivierte CCD-Kamera aufgezeichnet separated from the excitation light and monitored by a CCD camera sensitized 3 3 . , Der Objekttisch besitzt einen x/y-Antrieb der eine Genauigkeit von unter 0,1 mm aufweist und den Thermocycler mit Probenhalterung (hier für 96 Reaktionsgefäße mit 0,2 ml Fassungsvermögen) aufnimmt. The stage has an x ​​/ y-drive having an accuracy of less than 0.1 mm and the thermal cycler with sample holder (here for 96 reaction vessels with 0.2 ml capacity) receives. Unter den Reaktionsgefäßen, die einen planaren Boden aufweisen, ist ein Magnet Under the reaction vessels, which have a planar bottom, is a magnet 11 11 (Dauermagent oder ein Elektromagnet) positioniert, so dass paramagnetische Mikropartikel während des Messvorganges gut immobilisiert werden. (Dauermagent or an electromagnet) positioned so that paramagnetic microparticles are well immobilized during the measuring process. Eine automatische Computersteuerung umfasst das PCR-Programm und damit das Temperaturprofil der PCR-Reaktion, die Filterwechsler, die CCD-Kamera, die Bildakquise und Bildverarbeitung, denx/y/z-Antrieb und die Steuerung des Anregungslichtes, so dass während der PCR-Reaktion sowie die Ausgabe der Amplifikat-Fluoreszenzen für die verschiedenen Partikelpopulationen gewährleistet werden kann. An automatic computer control comprising the PCR program, and thus the temperature profile of the PCR reaction, the filter changer, the CCD camera, the image acquisition and image processing, Denx / y / z-drive and the control of the excitation light, so that during the PCR reaction and the issue of amplicon-fluorescence can be ensured for the different particle populations.
    • (B) Als Reaktionsgefäße werden z. (B) As reaction vessels z. B. Nukleosorb 8er-Riegel B. Nukleosorb 8-bolt 12 12 verwendet, die mit einem Glasdeckglas verschlossen werden. used, which are sealed with a glass coverslip.
    • (C) Der PCR-Mastermix wird zusammen mit der Proben-DNS (C) The PCR master mix, together with the sample DNA 16 16 in das Reaktionsgefäß pipiettiert und mit Öl überschichtet. pipiettiert into the reaction vessel and covered with oil. Danach wird das Reaktionsgefäß mit einem Deckglas verschlossen und der PCR-/Messvorgang gestartet. Thereafter, the reaction vessel is sealed with a cover glass and start the PCR / metering process. Während die PCR-Zyklen ablaufen erfolgt die Messung der Fluoreszenzen bevorzugt in der Phase des Annealings bei isothermen Bedingungen. While the PCR cycles proceed, the measurement of fluorescence is preferably carried out in the phase of the annealing under isothermal conditions. Alternativ erfolgt das Aufzeichnen einer Schmelzkurve am Ende der PCR. Alternatively, the recording of a melting curve at the end of PCR. Die Mikropartikel sind während der PCR bevorzugt ständig immobilisiert durch kovalente Kopplung, Sedimentation oder magnetische Anziehung. The microparticles are preferably continuously during the PCR immobilized by covalent coupling, sedimentation, or magnetic attraction. Bei Verwendung von Elektromagneten können die Partikel während der PCR immobilisiert oder frei flottierend vorliegen und werden für jede Messung neu immobilisiert. When using electromagnets, the particles can be immobilized or be free-floating and re-immobilized for each measurement during the PCR.
  • 1 1
    Emissionsfilter emission filter
    2 2
    Filter für Anregungslicht Filter for excitation light
    3 3
    CCD-Kamera CCD camera
    4 4
    LED oder Laser zur Anregung LED or laser for excitation
    5 5
    Long-Distanz-Optik Long-distance optics
    6 6
    Stativ tripod
    7 7
    z-Antrieb z drive
    8 8th
    Thermocycler thermocycler
    9 9
    x/y-Antrieb x / y-drive
    10 10
    Ausschnittsmarkierung crop mark
    11 11
    Magnet magnet
    12 12
    Nukleosorb 8er Riegel Nukleosorb 8-bolt
    13 13
    Reaktionsgefäßaufnahme im Thermoblock Reaction vessel receiving in the heating block
    14 14
    Deckel cover
    15 15
    Ölüberschichtung Oil overlay
    16 16
    Master-Mix + Proben-DNS Master Mix + sample DNA
  • Beispiel 1 example 1
  • [0082]
    Nachweis des Erregers Herpes simplex Virus in einer Probe Ein Volumen von 5 μl aus Abstrichen von Lippenbläschen gereinigter Proben-DNS wird zu 15 μl Master-Mix folgender Zusammensetzung gegeben: Detection of the pathogen herpes simplex virus in a sample A volume of 5 ul from swabs of cold sores purified sample DNA is added to 15 ul master mix of the following composition:
    Primer 1 primer 1 400 nM 400 nM
    Primer 2 primer 2 300 nM 300 nM
    Sonde probe 100 nM 100 nM
    in Taq-DNS-Polymerase, Nukleotide, Magnesiumchlorid, Tris/HCl-Puffer und Tween 20 gelöst. dissolved in Taq DNA polymerase, nucleotides, magnesium chloride, Tris / HCl buffer and Tween 20th
  • [0083]
    Der Reaktionsansatz wird in eine LightCycler-Kapillare pipettiert und anschließend in den LightCycler überführt und thermocyclisch amplifiziert. The reaction mixture is pipetted into a LightCycler capillary and then transferred into the LightCycler and thermocyclisch amplified. Das Verfahren ist schematisch in The process is schematically illustrated in 1 1 dargestellt. shown. Primer 1 trägt ein kovalent gebundenes Fluorescein am 4. Nukleotid vom 3'-Ende aus gezählt, bindet mit seiner Targetbindungssequenz 1 am 3'-Ende an die Targetsequenz des Herpes simplex-Virus-Genoms und wird durch eine DNS-Polymerase unter geeigneten Bedingungen komplementär zum Target verlängert. Primer 1 carries a covalently bound fluorescein on the 4th nucleotide counted from the 3 'end, bind with its target binding sequence 1 at the 3'-end of the target sequence of the herpes simplex virus genome and is complementary with a DNA polymerase under appropriate conditions extended to the target. Nach Denaturierung des Doppelstranges kann die Sonde, die eine Rhodamin-Markierung am 3'-Ende trägt an den komplementär zum Target verlängerten Primer hybridisieren. After denaturation of the double strand, the probe carrying a rhodamine label at the 3'-end is capable of hybridizing to the complementary extended to the target primer. Durch Bestrahlung des Reaktionsgemisches mit Licht einer Wellenlänge von 480 nm wird ein über Fluorescein vermittelter FREI ausgelöst und die Emission bei 560 nm korreliert mit der im Reaktionsgemisch befindlichen Menge an Template. By irradiation of the reaction mixture with light having a wavelength of 480 nm a fluorescein mediated FREE is triggered and the emission at 560 nm correlated with the amount of mixture present in the reaction template.
  • [0084]
    Nach Abschluß der Amplifikation wird für alle Proben, die ein ausreichend hohes Meßsignal aufweisen, eine Schmelzkurve aufgezeichnet. After completion of the amplification, a melting curve is recorded for all samples having a sufficiently high measurement signal.
  • Sequenzen sequences
    • Primer 1: 5'-CAT CAC CGA CCC GGA GAG GGA C-3' Primer 1: 5'-CAT CAC CGA CCC GGA GAG GGA C-3 '
    • G an Position 20 (grau hinterlegt) trägt kovalent ein FITC-Molekül. G at position 20 (gray) carries a covalently FITC molecule.
    • Primer 2: 5'-GGG CCA GGC GCT TGT TGG TGT A-3' Primer 2: 5'-GGG CCA GGC TGT GCT TGG TGT A-3 '
    • Sonde: 5'-GGTGAGGACAAAGTCCTGGAT-3'-Rhodamin Probe: 5'-GGTGAGGACAAAGTCCTGGAT-3'-rhodamine
  • Beispiel 2: Example 2:
  • Nachweis eines Faktor 2-Polymorphismus Detection of a factor of 2 polymorphism
  • [0085]
    Ein Volumen von 5 μl aus Patientenblut gereinigter Proben-DNS wird zu 15 μl Master-Mix folgender Zusammensetzung gegeben: A volume of 5 ul of patient's blood purified sample DNA is added to 15 ul master mix of the following composition:
    Primer 1 (FITC-modifiziert) Primer 1 (FITC-modified) 300 nM 300 nM
    Primer 2 primer 2 300 nM 300 nM
    Sonde probe 100 nM 100 nM
    in Taq-DNS-Polymerase, Nukleotide, Magnesiumchlorid, Tris/HCl-Puffer und Tween 20 gelöst. dissolved in Taq DNA polymerase, nucleotides, magnesium chloride, Tris / HCl buffer and Tween 20th
  • [0086]
    Der Reaktionsansatz wird in eine LightCycler-Kapillare pipettiert und anschließend in den LightCycler überführt und thermocyclisch amplifiziert. The reaction mixture is pipetted into a LightCycler capillary and then transferred into the LightCycler and thermocyclisch amplified. Das Verfahren ist schematisch in The process is schematically illustrated in 2 2 dargestellt. shown. Primer 1 trägt ein kovalent am 5'-Ende gebundenes Fluorescein sowie eine Targetbindungssequenz 2, bindet mit der Targetbindungssequenz 1 seines 3'-Endes an die Targetsequenz des humanen Faktor 2-Gens und wird durch eine DNS-Polymerase unter geeigneten Bedingungen komplementär zum Target verlängert. Primer 1 carries a covalently bound at the 5'-end of fluorescein and a target binding sequence 2, binds to the target binding sequence 1 of its 3 'end to the target sequence of the human factor 2 gene and is extended by a DNA polymerase under suitable conditions complementary to the target , Nach Denaturierung des Doppelstranges bildet das 5'-Ende von Primer 1 eine Haarnadel mit der Targetsequenz zwei die den Polymorphismus umfaßt. After denaturation of the double strand, the 5 'end of primer 1 forms a hairpin with two of the target sequence comprising the polymorphism. Außerdem bindet die Sonde, die eine Rhodamin-Markierung am 3'-Ende trägt an den komplementär zum Target verlängerten Primer unmittelbar anschließend an die Haarnadel. In addition, the probe bearing a rhodamine label at the 3'-end complementary to the extended primer to the target immediately adjacent to the hairpin binds. Durch Bestrahlung des Reaktionsgemisches mit Licht einer Wellenlänge von 480 nm wird ein über Fluorescein vermittelter FREI ausgelöst und eine Emission von Rhodamin bei 560 nm gemessen. By irradiation of the reaction mixture with light having a wavelength of 480 nm a fluorescein mediated FREE is triggered and an emission of rhodamine at 560 nm measured. Diese Emission korreliert mit der im Reaktionsgemisch befindlichen Menge an Template, die den Polymorphismus umfaßt. This emission correlates with the amount of mixture present in the reaction template comprising the polymorphism. Zur besseren Unterscheidung von Targetsequenzen mit Polymorphismus und von Targetsequenzen ohne, die sich nur geringfügig in ihrer Targetsequenz 2 unterscheiden wird eine Schmelzkurve erstellt. For better distinction of target sequences with polymorphism and target sequences will differ only slightly in their target sequence 2 creates a melting curve without. Sind beide Targetsequenzen im Reaktionsgemisch enthalten, resultieren zwei Peaks in der Darstellung der 1. Ableitung der Schmelzkurve. If both target sequences in the reaction mixture contained two peaks resulting in the presentation of the 1st derivative of the melting curve.
  • [0087]
    Nach Abschluß der Amplifikation wird für alle Proben, die ein ausreichend hohes Meßsignal aufweisen, eine Schmelzkurve aufgezeichnet. After completion of the amplification, a melting curve is recorded for all samples having a sufficiently high measurement signal.
  • [0088]
    Alternativ ist die Unterscheidung der gebildeten Amplifikate auf Grund des Längenmarkers in Primer 1b elektrophoretisch möglich. Alternatively, the discrimination of the amplificates formed on the basis of the length marker into primer 1b is electrophoretically possible.
  • Sequenzen sequences
    • Primer 1 (FITC-modifiziert): FITC-5'-ggctcgctccaataaa agtgactctc a-3' Primer 1 (FITC-modified): FITC-5'-ggctcgctccaataaa agtgactctc a-3 '
    • Primer 2: 5'-ccaggtggtggattcttaagtc-3' Primer 2: 5'-ccaggtggtggattcttaagtc-3 '
    • Sonde: 5'-gctgcccatgaatagcactgggagcatt-3'-Rhodamin Probe: 5'-gctgcccatgaatagcactgggagcatt-3'-rhodamine
  • Beispiel 3: Example 3:
  • Simultaner Nachweis von Herpes simplex DNS und interner Standard in einer Probe Simultaneous detection of herpes simplex DNA and internal standard in a sample
  • [0089]
    Ein Volumen von 5 μl aus Patientenblut gereinigter Proben-DNS wird zu 15 μl Master-Mix folgender Zusammensetzung gegeben: A volume of 5 ul of patient's blood purified sample DNA is added to 15 ul master mix of the following composition:
    Primer 1a primer 1a 10 nM 10 nM
    Primer 1b primer 1b 10 nM 10 nM
    Primer 2 primer 2 300 nM 300 nM
    Primer 3 (FITC-modifiziert) Primer 3 (FITC-modified) 300 nM 300 nM
    Sonde 1 probe 1 100 nM 100 nM
    Sonde 2 probe 2 100 nM 100 nM
    Interner Stan internal Stan dard 100 fM dard 100 sc
    in Taq-DNS-Polymerase, Nukleotide, Magnesiumchlorid, Tris/HCl-Puffer und Tween 20 gelöst. dissolved in Taq DNA polymerase, nucleotides, magnesium chloride, Tris / HCl buffer and Tween 20th
  • [0090]
    Der Reaktionsansatz wird in eine LightCycler-Kapillare pipettiert und anschließend in den LightCycler überführt und thermocyclisch amplifiziert. The reaction mixture is pipetted into a LightCycler capillary and then transferred into the LightCycler and thermocyclisch amplified. Das Verfahren ist schematisch in The process is schematically illustrated in 3 3 dargestellt. shown. Nach Abschluß der Amplifikation wird für alle Proben, die ein ausreichend hohes Meßsignal aufweisen, eine Schmelzkurve aufgezeichnet, um Amplifikat des internen Standards und, bei HSV-positiven Proben, HSV-Amplifikat zu detektieren. After completion of the amplification, a melting curve is used for all samples having a sufficiently high measurement signal recorded to amplicon of the internal standard and to detect HSV in positive samples, HSV amplicon.
  • Sequenzen sequences
    • Primer 1a: 5'-actgcacgctcacacggacg gtgcagtaagtcctgg CAT CAC CGA CCC GGA GAG GGA C-3' Primer 1a: 5'-CAT CAC CGA actgcacgctcacacggacg gtgcagtaagtcctgg CCC GGA GAG GGA C-3 '
    • Primer 1b: 5'-actgcacgctcacacggacgttgttgttgt tgttgttgtt gttgttgttg ttgttgttgt gcgtgcagt gcggtccac Primer 1b: 5'-actgcacgctcacacggacgttgttgttgt tgttgttgtt gttgttgttg ttgttgttgt gcgtgcagt gcggtccac
    • CATCACCGAC CCGGACAGCC CA-3' CATCACCGAC CCGGACAGCC CA-3 '
    • Primer 2: 5'-GGG CCA GGC GCT TGT TGG TGT A-3' Primer 2: 5'-GGG CCA GGC TGT GCT TGG TGT A-3 '
    • Primer 3: FITC-5'-actgcacgctcacacggacg-3' Primer 3: 5'-FITC-actgcacgctcacacggacg-3 '
    • Sonde 1: 5'-tcagttcggcggtgaggaca-3'-Rhodamin Probe 1: 5'-tcagttcggcggtgaggaca-3'-rhodamine
    • Interner Standard: 5'-CATCACCGAC CCGGACAGCC CACCAGCGTG GACCGCTGT CCT CAC CGC CGA ACT GA GGCCAG GCGGTGAAGG GCAATCAGCT GTTGCCCGTC TCGCTGGTGA AAAGAAAAAC CACCCTGGCG CCCAATACGC AAACCGCCTA CACCAACAAG CGCCTGGCCC-3' Internal standard: 5'-CCT CAC CATCACCGAC CCGGACAGCC CACCAGCGTG GACCGCTGT CGC CGA ACT GA GGCCAG GCGGTGAAGG GCAATCAGCT GTTGCCCGTC TCGCTGGTGA AAAGAAAAAC CACCCTGGCG CCCAATACGC AAACCGCCTA CACCAACAAG CGCCTGGCCC-3 '
  • Beispiel 4: Example 4:
  • Kombination aus Sondensystem für die Real-time-PCR mit einem Mikropartikelarray zum simultanen Nachweis verschiedener Targetsequenzen eines Faktor 2- und eines Faktor 5-Polymorphismus'. Combination of probe system for the real-time PCR with a microparticle array for the simultaneous detection of different target sequences of a factor 2 and a factor of 5-polymorphism. Das Verfahren ist schematisch in The process is schematically illustrated in 4 4 dargestellt. shown.
  • [0091]
    Ein Volumen von 5 μl aus Patientenblut gereinigter Proben-DNS wird zu 15 μl Master-Mix folgender Zusammensetzung gegeben (Oligonukleotidsequenzen für Faktor 5 und Faktor 2 siehe unten): A volume of 5 ul of patient's blood purified sample DNA is 15 ul master mix of the following composition, where (oligonucleotide for factor 5 and a factor of 2, see below):
    Primer 1 (Flüssigphase) Primer 1 (liquid phase) 300 nM 300 nM
    Primer 1 (FITC-markierter Fangprimer zur Beschichtung der Mikorpartikel mittels EDC-Kopplung: Primer 1 (FITC-labeled capture primers for coating the Mikorpartikel by EDC coupling: 100 nM 100 nM
    Primer 2 (Flüssigphase) Primer 2 (liquid phase) 300 nM 300 nM
    Sonde (Rhodamin-markiert) Probe (rhodamine-labeled) 100 nM 100 nM
    in Taq-DNS-Polymerase, Nukleotide, Magnesiumchlorid, Tris/HCl-Puffer und Tween 20 gelöst. dissolved in Taq DNA polymerase, nucleotides, magnesium chloride, Tris / HCl buffer and Tween 20th
  • [0092]
    Der Reaktionsansatz wird in einem Nukleosorb (schwarz)-8er-Riegel pipettiert und anschließend in den Thermocycler der Meßstation ( The reaction mixture is pipetted (black) bars in a -8er Nukleosorb and then (in the thermocycler of the measuring station 5 5 ) überführt, mit Öl überschichtet, mit einem Glasdeckglas verschlossen, thermocyclisch amplifiziert und nach der Amplifikation mittels Schmelzkurvenanalyse detektiert (siehe ) Converted, overlaid with oil, sealed with a glass coverslip, and thermocyclisch amplified after amplification by melting curve analysis detected (see 4 4 und and 5 5 ). ).
  • Mirkopartikel: Microparticles:
  • [0093]
    Es werden die Partikel mit den Eigenschaften aus There are the particles with the properties of 4a 4a entsprechend mit Fangprimer für spezifisch für die Amplifikat-Sequenzen von Faktor 5 und Faktor 2-Gen mittels EDC-Kopplung beschichtet. appropriately coated with capture primers specific for the amplified sequences by a factor of 5 and factor 2 gene using EDC coupling.
  • Sequenzen sequences
  • Faktor 2: Factor 2:
    • Primer 1 (FITC-modifiziert, zur Festphasenimmobilisierung): Aminohexyl-5'-ttgttgttgttgttgggctcgctccaataaa agtgactctc a-3' Primer 1 (FITC-modified to Festphasenimmobilisierung): 5'-aminohexyl-ttgttgttgttgttgggctcgctccaataaa agtgactctc a-3 '
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Fett-kursiv: FITC-Markierung In bold italics: FITC labeling
    • Primer 1 (Flüssigphase): ggctcgctccaataaaagtgactctca-3' Primer 1 (liquid phase): ggctcgctccaataaaagtgactctca-3 '
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Primer 2 (Flüssigphase): 5'-ccaggtggtggattcttaagtc-3' Primer 2 (liquid phase): 5'-ccaggtggtggattcttaagtc-3 '
    • Sonde: 5'-gctgcccatgaatagcactgggagcatt-3'-Rhodamin Probe: 5'-gctgcccatgaatagcactgggagcatt-3'-rhodamine
  • Faktor 5: Factor 5:
    • Primer 1 (FITC-modifiziert, zur Festphasenimmobilisierung): Aminohexyl-5'-ttgttgttgttgaggaccggagatccctggacaggc-3' Primer 1 (FITC-modified to Festphasenimmobilisierung): 5'-aminohexyl-ttgttgttgttgaggaccggagatccctggacaggc-3 '
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Fett-kursiv: FITC-Markierung In bold italics: FITC labeling
    • Primer 1 (Flüssigphase): 5'-aggaccggagatccctggacaggc-3' Primer 1 (liquid phase): 5'-aggaccggagatccctggacaggc-3 '
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Primer 2 (Flüssigphase): 5'-cttgaaggaaa tgccccatta tttag-3' Primer 2 (liquid phase): 5'-cttgaaggaaa tgccccatta tttag-3 '
    • Sonde: 5'-ctgaaaggtt acttcaagga caaaatacct gtat-3'-Rhodamin Probe: 5'-ctgaaaggtt acttcaagga caaaatacct Gtat-3'-rhodamine
  • Legende zu den Abbildungen Key to figures
    Figure 00290001
  • Sequenzen sequences
    • Primer 1: 5'-CAT CAC CGA CCC GGA GAG GGA C-3' Primer 1: 5'-CAT CAC CGA CCC GGA GAG GGA C-3 '
    • G an Position 20 (grau hinterlegt) trägt kovalent ein FITC-Molekül. G at position 20 (gray) carries a covalently FITC molecule.
    • Primer 2: 5'-GGG CCA GGC GCT TGT TGG TGT A-3' Primer 2: 5'-GGG CCA GGC TGT GCT TGG TGT A-3 '
    • Sonde: 5'-GGTGAGGACAAAGTCCTGGAT-3'-Rhodamin Probe: 5'-GGTGAGGACAAAGTCCTGGAT-3'-rhodamine
  • Beispiel 2: Example 2:
  • Nachweis eines Faktor 2-Polymorphismus Detection of a factor of 2 polymorphism
  • [0094]
    Ein Volumen von 5 μl aus Patientenblut gereinigter Proben-DNS wird zu 15 μl Master-Mix folgender Zusammensetzung gegeben: A volume of 5 ul of patient's blood purified sample DNA is added to 15 ul master mix of the following composition:
    Primer 1 (FITC-modifiziert) Primer 1 (FITC-modified) 300 nM 300 nM
    Primer 2 primer 2 300 nM 300 nM
    Sonde probe 100 nM 100 nM
    in Taq-DNS-Polymerase, Nukleotide, Magnesiumchlorid, Tris/HCl-Puffer und Tween 20 gelöst. dissolved in Taq DNA polymerase, nucleotides, magnesium chloride, Tris / HCl buffer and Tween 20th
  • [0095]
    Der Reaktionsansatz wird in eine LightCycler-Kapillare pipettiert und anschließend in den LightCycler überführt und thermocyclisch amplifiziert. The reaction mixture is pipetted into a LightCycler capillary and then transferred into the LightCycler and thermocyclisch amplified. Das Verfahren ist schematisch in The process is schematically illustrated in 2 2 dargestellt. shown. Primer 1 trägt ein kovalent am 5'-Ende gebundenes Fluorescein sowie eine Targetbindungssequenz 2, bindet mit der Targetbindungssequenz 1 seines 3'-Endes an die Targetsequenz des humanen Faktor 2-Gens und wird durch eine DNS-Polymerase unter geeigneten Bedingungen komplementär zum Target verlängert. Primer 1 carries a covalently bound at the 5'-end of fluorescein and a target binding sequence 2, binds to the target binding sequence 1 of its 3 'end to the target sequence of the human factor 2 gene and is extended by a DNA polymerase under suitable conditions complementary to the target , Nach Denaturierung des Doppelstranges bildet das 5'-Ende von Primer 1 eine Haarnadel mit der Targetsequenz zwei die den Polymorphismus umfaßt. After denaturation of the double strand, the 5 'end of primer 1 forms a hairpin with two of the target sequence comprising the polymorphism. Außerdem bindet die Sonde, die eine Rhodamin-Markierung am 3'-Ende trägt an den komplementär zum Target verlängerten Primer unmittelbar anschließend an die Haarnadel. In addition, the probe bearing a rhodamine label at the 3'-end complementary to the extended primer to the target immediately adjacent to the hairpin binds. Durch Bestrahlung des Reaktionsgemisches mit Licht einer Wellenlänge von 480 nm wird ein über Fluorescein vermittelter FREI ausgelöst und eine Emission von Rhodamin bei 560 nm gemessen. By irradiation of the reaction mixture with light having a wavelength of 480 nm a fluorescein mediated FREE is triggered and an emission of rhodamine at 560 nm measured. Diese Emission korreliert mit der im Reaktionsgemisch befindlichen Menge an Template, die den Polymorphismus umfaßt. This emission correlates with the amount of mixture present in the reaction template comprising the polymorphism. Zur besseren Unterscheidung von Targetsequenzen mit Polymorphismus und von Targetsequenzen ohne, die sich nur geringfügig in ihrer Targetsequenz 2 unterscheiden wird eine Schmelzkurve erstellt. For better distinction of target sequences with polymorphism and target sequences will differ only slightly in their target sequence 2 creates a melting curve without. Sind beide Targetsequenzen im Reaktionsgemisch enthalten, resultieren zwei Peaks in der Darstellung der 1. Ableitung der Schmelzkurve. If both target sequences in the reaction mixture contained two peaks resulting in the presentation of the 1st derivative of the melting curve.
  • [0096]
    Nach Abschluß der Amplifikation wird für alle Proben, die ein ausreichend hohes Meßsignal aufweisen, eine Schmelzkurve aufgezeichnet. After completion of the amplification, a melting curve is recorded for all samples having a sufficiently high measurement signal.
  • [0097]
    Alternativ ist die Unterscheidung der gebildeten Amplifikate auf Grund des Längenmarkers in Primer 1b elektrophoretisch möglich. Alternatively, the discrimination of the amplificates formed on the basis of the length marker into primer 1b is electrophoretically possible.
  • Sequenzen sequences
    • Primer 1 (FITC-modifiziert): FITC-5'-ggctcgctccaataaa agtgactctc a-3' Primer 1 (FITC-modified): FITC-5'-ggctcgctccaataaa agtgactctc a-3 '
    • Primer 2: 5'-ccaggtggtggattcttaagtc-3' Primer 2: 5'-ccaggtggtggattcttaagtc-3 '
    • Sonde: 5'-gctgcccatgaatagcactgggagcatt-3'-Rhodamin Probe: 5'-gctgcccatgaatagcactgggagcatt-3'-rhodamine
  • Beispiel 3: Example 3:
  • Simultaner Nachweis von Herpes simplex DNS und interner Standard in einer Probe Simultaneous detection of herpes simplex DNA and internal standard in a sample
  • [0098]
    Ein Volumen von 5 μl aus Patientenblut gereinigter Proben-DNS wird zu 15 μl Master-Mix folgender Zusammensetzung gegeben: A volume of 5 ul of patient's blood purified sample DNA is added to 15 ul master mix of the following composition:
    Primer 1a primer 1a 10 nM 10 nM
    Primer 1b primer 1b 10 nM 10 nM
    Primer 2 primer 2 300 nM 300 nM
    Primer 3 (FITC-modifiziert) Primer 3 (FITC-modified) 300 nM 300 nM
    Sonde 1 probe 1 100 nM 100 nM
    Sonde 2 probe 2 100 nM 100 nM
    Interner Stan internal Stan dard 100 fM dard 100 sc
    in Taq-DNS-Polymerase, Nukleotide, Magnesiumchlorid, Tris/HCl-Puffer und Tween 20 gelöst. dissolved in Taq DNA polymerase, nucleotides, magnesium chloride, Tris / HCl buffer and Tween 20th
  • [0099]
    Der Reaktionsansatz wird in eine LightCycler-Kapillare pipettiert und anschließend in den LightCycler überführt und thermocyclisch amplifiziert. The reaction mixture is pipetted into a LightCycler capillary and then transferred into the LightCycler and thermocyclisch amplified. Das Verfahren ist schematisch in The process is schematically illustrated in 3 3 dargestellt. shown. Nach Abschluß der Amplifikation wird für alle Proben, die ein ausreichend hohes Meßsignal aufweisen, eine Schmelzkurve aufgezeichnet, um Amplifikat des internen Standards und, bei HSV-positiven Proben, HSV-Amplifikat zu detektieren. After completion of the amplification, a melting curve is used for all samples having a sufficiently high measurement signal recorded to amplicon of the internal standard and to detect HSV in positive samples, HSV amplicon.
  • Sequenzen sequences
    • Primer 1a: 5'-actgcacgctcacacggacg gtgcagtaagtcctgg CAT CAC CGA CCC GGA GAG GGA C-3' Primer 1a: 5'-CAT CAC CGA actgcacgctcacacggacg gtgcagtaagtcctgg CCC GGA GAG GGA C-3 '
    • Primer 1b: 5'-actgcacgctcacacggacgttgttgttgt tgttgttgtt gttgttgttg ttgttgttgt gcgtgcagt gcggtccac CATCACCGAC CCGGACAGCC CA-3' Primer 1b: 5'-actgcacgctcacacggacgttgttgttgt tgttgttgtt gttgttgttg ttgttgttgt gcgtgcagt gcggtccac CATCACCGAC CCGGACAGCC CA-3 '
    • Primer 2: 5'-GGG CCA GGC GCT TGT TGG TGT A-3' Primer 2: 5'-GGG CCA GGC TGT GCT TGG TGT A-3 '
    • Primer 3: FITC-5'-actgcacgctcacacggacg-3' Primer 3: 5'-FITC-actgcacgctcacacggacg-3 '
    • Sonde 1: 5'-tcagttcggcggtgaggaca-3'-Rhodamin Probe 1: 5'-tcagttcggcggtgaggaca-3'-rhodamine
    • Interner Standard: 5'-CATCACCGAC CCGGACAGCC CACCAGCGTG GACCGCTGT CCT CAC CGC CGA ACT GA GGCCAG GCGGTGAAGG GCAATCAGCT GTTGCCCGTC TCGCTGGTGA AAAGAAAAAC CACCCTGGCG CCCAATACGC AAACCGCCTA CACCAACAAG CGCCTGGCCC-3' Internal standard: 5'-CCT CAC CATCACCGAC CCGGACAGCC CACCAGCGTG GACCGCTGT CGC CGA ACT GA GGCCAG GCGGTGAAGG GCAATCAGCT GTTGCCCGTC TCGCTGGTGA AAAGAAAAAC CACCCTGGCG CCCAATACGC AAACCGCCTA CACCAACAAG CGCCTGGCCC-3 '
  • Beispiel 4: Example 4:
  • [0100]
    Kombination aus Sondensystem für die Real-time-PCR mit einem Mikropartikelarray zum simultanen Nachweis verschiedener Targetsequenzen eines Faktor 2- und eines Faktor 5-Polymorphismus'. Combination of probe system for the real-time PCR with a microparticle array for the simultaneous detection of different target sequences of a factor 2 and a factor of 5-polymorphism. Das Verfahren ist schematisch in The process is schematically illustrated in 4 4 dargestellt. shown.
  • [0101]
    Ein Volumen von 5 μl aus Patientenblut gereinigter Proben-DNS wird zu 15 μl Master-Mix folgender Zusammensetzung gegeben (Oligonukleotidsequenzen für Faktor 5 und Faktor 2 siehe unten): A volume of 5 ul of patient's blood purified sample DNA is 15 ul master mix of the following composition, where (oligonucleotide for factor 5 and a factor of 2, see below):
    Primer 1 (Flüssigphase) Primer 1 (liquid phase) 300 nM 300 nM
    Primer 1 (FITC-markierter Fangprimer zur Beschichtung der Mikorpartikel mittels EDC-Kopplung: Primer 1 (FITC-labeled capture primers for coating the Mikorpartikel by EDC coupling: 100 nM 100 nM
    Primer 2 (Flüssigphase) Primer 2 (liquid phase) 300 nM 300 nM
    Sonde (Rhodamin-markiert) Probe (rhodamine-labeled) 100 nM 100 nM
    in Taq-DNS-Polymerase, Nukleotide, Magnesiumchlorid, Tris/HCl-Puffer und Tween 20 gelöst. dissolved in Taq DNA polymerase, nucleotides, magnesium chloride, Tris / HCl buffer and Tween 20th
  • [0102]
    Der Reaktionsansatz wird in einem Nukleosorb (schwarz)-8er-Riegel pipettiert und anschließend in den Thermocycler der Meßstation ( The reaction mixture is pipetted (black) bars in a -8er Nukleosorb and then (in the thermocycler of the measuring station 5 5 ) überführt, mit Öl überschichtet, mit einem Glasdeckglas verschlossen, thermocyclisch amplifiziert und nach der Amplifikation mittels Schmelzkurvenanalyse detektiert (siehe ) Converted, overlaid with oil, sealed with a glass coverslip, and thermocyclisch amplified after amplification by melting curve analysis detected (see 4 4 und and 5 5 ). ).
  • Mirkopartikel: Microparticles:
  • [0103]
    Es werden die Partikel mit den Eigenschaften aus There are the particles with the properties of 4a 4a entsprechend mit Fangprimer für spezifisch für die Amplifikat-Sequenzen von Faktor 5 und Faktor 2-Gen mittels EDC-Kopplung beschichtet. appropriately coated with capture primers specific for the amplified sequences by a factor of 5 and factor 2 gene using EDC coupling.
  • Sequenzen sequences
  • Faktor 2: Factor 2:
    • Primer 1 (FITC-modifiziert, zur Festphasenimmobilisierung): Aminohexyl-5'-ttgttgttgttgttgggctcgctccaataaa agtgactctc a-3' Primer 1 (FITC-modified to Festphasenimmobilisierung): 5'-aminohexyl-ttgttgttgttgttgggctcgctccaataaa agtgactctc a-3 '
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Fett-kursiv: FITC-Markierung In bold italics: FITC labeling
    • Primer 1 (Flüssigphase): ggctcgctccaataaaagtgactctca-3' Primer 1 (liquid phase): ggctcgctccaataaaagtgactctca-3 '
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Primer 2 (Flüssigphase): 5'-ccaggtggtggattcttaagtc-3' Primer 2 (liquid phase): 5'-ccaggtggtggattcttaagtc-3 '
    • Sonde: 5'-gctgcccatgaatagcactgggagcatt-3'-Rhodamin Probe: 5'-gctgcccatgaatagcactgggagcatt-3'-rhodamine
  • Faktor 5: Factor 5:
    • Primer 1 (FITC-modifiziert, zur Festphasenimmobilisierung): Aminohexyl-5'-ttgttgttgttgaggaccggagatccctggacaggc-3' Primer 1 (FITC-modified to Festphasenimmobilisierung): 5'-aminohexyl-ttgttgttgttgaggaccggagatccctggacaggc-3 '
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Fett-kursiv: FITC-Markierung In bold italics: FITC labeling
    • Primer 1 (Flüssigphase): 5'-aggaccggagatccctggacaggc-3'' Primer 1 (liquid phase): 5'-aggaccggagatccctggacaggc-3 ''
    • Grau unterlegt: Polymorphismus Grayed out: Polymorphism
    • Primer 2 (Flüssigphase): 5'-cttgaaggaaa tgccccatta tttag-3' Primer 2 (liquid phase): 5'-cttgaaggaaa tgccccatta tttag-3 '
    • Sonde: 5'-ctgaaaggtt acttcaagga caaaatacct gtat-3'-Rhodamin Probe: 5'-ctgaaaggtt acttcaagga caaaatacct Gtat-3'-rhodamine
  • SEQUENZPROTOKOLL SEQUENCE LISTING
    Figure 00340001
  • Figure 00350001
  • Figure 00360001
  • Figure 00370001
  • Figure 00380001
  • Figure 00390001
  • ZITATE ENTHALTEN IN DER BESCHREIBUNG QUOTES INCLUDED IN THE DESCRIPTION
  • [0104]
    Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. This list of references cited by the applicant is generated automatically and is included solely to inform the reader. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. The list is not part of the German patent or utility model application. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen. The DPMA is not liable for any errors or omissions.
  • Zitierte Patentliteratur Cited patent literature
  • [0105]
    • - US 6150097 A [0003] - US 6150097 A [0003]
    • - DE 69907630 T2 [0044] - DE 69907630 T2 [0044]

Claims (32)

  1. Verfahren zum „real-time" Nachweis von Nukleinsäuretargets als Produkte einer Nukleinsäure-Amplifikationsreaktion mittels einem Primer/Sondensystem umfassend die Schritte: a) Einsatz von mindestens einem Primer, der mindestens eine für die zu amplifizierende Nukleinsäure spezifische Sequenz – Targetbindungssequenz(en) (TBS) – umfasst und der am 3'-Ende Modifikationen trägt, die eine enzymatische Verlängerung komplementär zum Target gestatten, b) Einführung eines Fluophors 1, c) zum Nachweis Einsatz von mindestens einer Sonde, die mindestens am 3'-Ende ein Fluorophor 2 trägt, wobei die mindestens eine Sonde mit dem Komplementärstrang des zur Targetsequenz am 3'-Ende verlängerten Primers oder bei Verwendung mehrerer Primer mit dem Targetstrang hybridisieren kann, wobei einer der beiden Fluorophore durch Licht geeigneter Wellenlänge angeregt wird, so dass zwischen Fluorophor 1 und 2 ein FREI stattfindet, der fluoreszenzoptisch detektiert wird. A method of "real-time" detection of nucleic acid targets as products of a nucleic acid amplification reaction comprising the steps of using a primer / probe system: a) using at least one primer, the at least one specific for the product to be amplified nucleic acid sequence - target binding sequence (s) (TBS ) - includes and contributes modifications at the 3'-end, which allow an enzymatic extension complementary to the target, b) introduction of a fluor 1, c) contributes to the detection of use of at least one probe, at least at the 3 'end of a fluorophore 2 wherein the can hybridize at least one probe with the complementary strand of the extended to the target sequence at the 3 'end of the primer, or when using more primers with the target strand, wherein one of the two fluorophores is excited by light of a suitable wavelength, so that between fluorophore 1 and 2 FREE takes place, the fluorescence is detected optically.
  2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass der mindestens eine Primer am 5'-Ende zusätzlich einen zum Target unspezifischen Schwanz aufweist. A method according to claim 1, characterized in that the at least one primer at the 5'-end additionally has a non-specific to the target tail.
  3. Verfahren nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass das Fluorophor 1 sich an einem Primer oder an einer weiteren Sonde befindet oder eingebracht wird. The method of claim 1 or 2, characterized in that the fluorophore 1 is located on a primer or probe or at another is introduced.
  4. Verfahren nach einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass die Fluorophore 1 und 2 kovalent gebunden an Primern und Sonden vorliegen. A method according to any one of claims 1 to 3, characterized in that the fluorophores 1 and 2 covalently attached to primers and probes are available.
  5. Verfahren nach einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass der mindestens eine Primer eine für die zu amplifizierende Targetsequenz spezifische Sequenz (TBS), im 5'-Bereich teilweise komplementär zum 3'-Bereich umfasst, so dass sie eine Haarnadel bildet. A method according to any one of claims 1 to 4, characterized in that the at least one primer specific for the product to be amplified target sequence sequence (TBS), comprises the 5 'region partially complementary to the 3'-region, so that it forms a hairpin.
  6. Verfahren nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass das Fluorophor 1 an den spezifischen oder unspezifischen Teil eines ersten Primers oder an einem weiteren Primer vorliegt. A method according to any one of claims 1 to 5, characterized in that the fluorophore is present at the 1 specific or unspecific part of a first primer, or on another primer.
  7. Verfahren nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass der mindestens eine Primer das Fluorophor am 5'-Ende aufweist, wobei zum Nachweis des Targets der Primer am 5'-Ende partiell oder vollständig eine Haarnadel mit sich selbst oder der komplementär zum Target verlängerten Primersequenz bildet. A method according to any one of claims 1 to 6, characterized in that the at least one primer has the fluorophore at the 5 'end, said partially or fully for the detection of the target of the primer at the 5'-end of a hairpin with itself or complementary to the target forms extended primer sequence.
  8. Verfahren nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass mindestens drei Primer verwendet werden, und das die folgenden Schritte umfasst: – in einer ersten Reaktion Einsatz eines Primerpaares 1 und 2, wobei der Vorwärtsprimer 1 mindestens eine Targetbindungssequenz 1 (TBS 1) und und mindestens eine Targetbindungssequenz 2 (TBS 2) umfasst, so dass TBS 1 an das zu amplifizierende Target bindet, anschließend Primer 1 komplementär zum Target verlängert wird, Rückwärtsprimer 2 an das komplementäre Target bindet und ebenfalls verlängert wird, – in einer weiteren Reaktion zwischen Primer 3, welcher mit dem 5'-Bereich von Primer 1 identisch oder teilweise identisch ist und der gegebenenfalls das Fluorophor 1 am 5'-Ende trägt, und Primer 2 die Amplifikation stattfindet, wobei Primer 3 so konstruiert ist, dass er eine Haarnadel 1 vollständig oder teilweise mit sich selbst oder mit komplementären Abschnitten der Primer 1-Sequenz bildet, und wobei die mindestens ein Method according to one of claims 1 to 7, characterized in that at least three primers are used, and which comprises the following steps: - in a first reaction using a primer pair 1 and 2, wherein the forward primer 1 at least one target binding sequence 1 (TBS 1) and and at least one target binding sequence 2 (TBS 2), so that TBS 1 binds to be amplified target on, then primer 1 is complementary extended to the target, reverse primer 2 binds to the complementary target and is also extended, - in a further reaction between primer 3, which is identical to the 5 'region of primer 1 or partially identical and optionally carrying the fluorophore 1 at the 5'-end, and primer 2 takes place amplification using primers 3 is constructed so that it has a hairpin 1 is completely or partially with itself or with complementary portions of the primer 1 sequence, and wherein the at least one e TBS 2 an mindestens einen weiteren Targetbindungsabschnitt bindet(en), welche(r) zwischen verlängertem Primer 1 und der komplementären Sequenz von Primer 2 liegt(en), wodurch eine Haarnadel 2 entsteht, – dann eine mit dem Fluorophor 2 markierte Sonde mit dem Amplifikat in Kontakt gebracht wird und dass das mit dem Fluorophor 1 gebildete FREI-Signal detektiert wird. e TBS 2 in at least one other target binding portion binds (s) which is (r) between extended primer 1 and the complementary sequence of Primer 2 is located (s), whereby a hairpin 2 is formed, - then a labeled with the fluorophore 2 probe with the amplificate is brought into contact, and that the formed with the fluorophore 1-FREE signal is detected.
  9. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass Primer 3 Fluorophor 1 trägt und die Sonde mit Fluorophor 2 am 3'-Ende vollständig an der Targetsbstanz hybridisiert. A method according to claim 8, characterized in that the primers carries fluorophore 3 1 and the probe hybridizes completely with 2 fluorophore at the 3 'end to the Targetsbstanz.
  10. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass Primer 3 Fluorophor 1 trägt und die Sonde mit Fluorophor 2 am 3'-Ende über Haarnadel 2 und Primer 1 an der Targetsubstanz hybridisiert. A method according to claim 8, characterized in that the primers carries fluorophore 3 1 and the probe 2 with fluorophore at the 3 'end hairpin about 2 and Primer 1 hybridizes to the target substance.
  11. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass zwei Sonden verwendet werden, die jeweils Fluorophor 1 und 2 tragen, wobei Sonde 1 Primer 1-spezifisch ist und Sonde 2 Target-spezifisch ist. A method according to claim 8, characterized in that two probes are used, each carrying fluorophore 1 and 2, wherein the probe 1 Primer 1-specific and probe 2 is target specific.
  12. Verfahren nach einem der Ansprüche 1 bis 11, dadurch gekennzeichnet, dass die Fluophore 1 und 2 ausgewählt sind aus Fluoreszenzfarbstoffmolekülen, wobei das Licht, das vom ersten Fluorophor absorbiert und remittiert wird, vom zweiten, nach Bindung der Sonde(n) dem ersten Fluorophor räumlich nahen zweiten Fluorophor erneut absorbiert und remittiert wird. Method according to one of claims 1 to 11, characterized in that the fluorophores are selected 1 and 2 from fluorescent dye molecules, wherein the light absorbed by the first fluorophore and is remitted from the second, after binding of the probe (s) to the first fluorophore spatially close second fluorophore is re-absorbed and re-emitted.
  13. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass folgende Fluorophore verwendet werden: A method according to claim 12, characterized in that the following fluorophores may be used: Fluorophor 1 fluorophore 1 Fluorophor 2 fluorophore 2 Fluorescein fluorescein LC Red 640 oder LC Red 705 LC Red 640 or LC Red 705 Aminocumarin amino coumarin Fluorescein fluorescein Fluorescein fluorescein Rhodamin oder Tetramethylrhodamin Rhodamine or tetramethylrhodamine Fluorescein fluorescein Cy3 Cy3 Cy3 Cy3 Cy5 Cy5 Cy3 Cy3 Tetramethylrhodamin tetramethylrhodamine Europium europium Cy5 Cy5 Terbium terbium Rhodamin rhodamine Bodipy Bodipy Bodipy Bodipy Dansyl dansyl Fluorescein fluorescein Naphtalen naphthalene Dansyl dansyl Ruthenium ruthenium Cy5. Cy5.
  14. Verfahren nach einem der Ansprüche 1 bis 13, dadurch gekennzeichnet, dass die Amplifikationsreaktion eine homogene Flüssigphasen-PCR, eine Multiplex-PCR, eine assymmetrische PCR, eine Festphasen-PCR, eine RT-PCR, eine in situ-PCR, eine immuno-PCR oder eine nested PCR ist. A method according to any one of claims 1 to 13, characterized in that the amplification reaction a homogeneous liquid-phase PCR, multiplex PCR, a assymmetrische PCR, a solid phase PCR, RT-PCR, in situ PCR, an immuno-PCR or a nested PCR.
  15. Verfahren nach einem der Ansprüche 1 bis 14, dadurch gekennzeichnet, dass zur gleichzeitigen Unterscheidung von mehreren Targetsequenzen, die Targetsequenzen im Sondenbindungsbereich, im Primerbindungsbereich, im Stamm der Haarnadel(n) durch Schmelzkurvenanalyse oder durch den Einsatz mehrerer Fluorophore oder Längenmarker unterschieden werden. A method according to any one of claims 1 to 14, characterized in that for the simultaneous differentiation of multiple target sequences, the target sequences in the probe binding region in the primer binding region in the stem of the hairpin (n) are discriminated by melting curve analysis or by the use of multiple fluorophores or length markers.
  16. Primer/Sondensystem zum Nachweis von Nukleinsäuren umfassend: a) mindestens einen Primer, der mindestens eine für das nachzuweisende Nukleinsäuretarget spezifische Sequenz umfasst und am 3'-Ende Modifikationen aufweist, die eine enzymatische Verlängerung gestatten, wobei gegebenenfalls einer der Primer mit einem Fluorophor 1 markiert ist, b) mindestens eine Sonde, wobei mindestens eine ein Fluorophor 2 trägt und ggf. eine weitere, die Fluorophor 1 aufweist. Primer / probe system for the detection of nucleic acids comprising: a) at least one primer comprising at least one specific for the nucleic acid to the target sequence and having modifications at the 3'-end, which allow an enzymatic extension, where appropriate, one of the primers labeled with a fluorophore 1 , b) at least one probe, at least one of a fluorophore 2 carries and optionally further comprising fluorophore. 1
  17. Primer/Sondensystem nach Anspruch 16 umfassend: a) einen Primer, der mindestens eine für das nachzuweisende Nukleinsäuretarget spezifische Sequenz umfasst und am 3'-Ende Modifikationen aufweist, die eine enzymatische Verlängerung gestatten, wobei dieser Primer mit dem Fluorophor 1 markiert ist, b) eine Sonde, die am 3'-Ende das Fluorophor 2 trägt und die für den 3'-verlängerten Komplentärstrang von a) spezifisch ist. Primer / probe system of claim 16 comprising: a) a primer comprising at least one specific for the nucleic acid to the target sequence and having modifications at the 3'-end, which allow an enzymatic extension, said primer is labeled with the fluorophore 1, b) a probe which carries the fluorophore 2 at the 3 'end and is specific for the 3'-extended Komplentärstrang of a).
  18. Primer/Sondensystem nach Anspruch 16 umfassend: a) drei Primer, wobei – ein Primerpaar 1 und 2 als Vorwärts- und Rückwärtsprimer fungieren und wobei Primer 1 mindestens zwei für das nachzuweisende Nukleinsäuretarget spezifische Sequenzen umfasst und beide Modifikationen aufweisen, die eine enzymatische Verlängerung gestatten, und – Primer 3, der mit dem 5'-Bereich von Primer 1 teilweise oder vollständig identisch ist, ebenfalls enzymatisch verlängerbar ist und Fluorophor 1 trägt, wobei er so konstruiert ist, dass er eine Haarnadel 1 vollständig oder partiell mit sich selbst, mit komplementären Abschnitten der Primer 1-Sequenz oder komplementären Abschnitten des Targets bilden kann, b) eine Sonde, die am 3'-Ende Fluorophor 2 trägt und die vollständig für die Targetsequenz spezifisch ist, oder die für die Targetsequenz und Primer 1 spezifisch ist. act a pair of primers 1 and 2 as forward and reverse primers and using primers 1 at least two of the nucleic acid to target includes specific sequences, and both have modifications which allow for enzymatic extension, - a) three primers, wherein: Primer / probe system of claim 16 comprising and - primer 3, which is connected to the 5 'region of primer 1 is partially or completely identical, is also enzymatically extendable and fluorophore 1', wherein it is constructed so that it has a hairpin 1 completely or partially with itself, with complementary portions of the primer may form 1 sequence or complementary portions of the target, b) a probe which carries 2 fluorophore at the 3 'end and which is completely specific for the target sequence, or which is specific for the target sequence and primer. 1
  19. Primer/Sondensystem nach Anspruch 16 umfassend: a) drei Primer, wobei – ein Primerpaar 1 und 2 als Vorwärts- und Rückwärtsprimer fungieren und wobei Primer 1 mindestens zwei für das nachzuweisende Nukleinsäuretarget spezifische Sequenzen umfasst und beide Modifikationen aufweisen, die eine enzymatische Verlängerung gestatten, und – Primer 3, der mit dem 5'-Bereich von Primer 1 teilweise oder vollständig identisch ist, ebenfalls enzymatisch verlängerbar ist, b) zwei Sonden, die jeweils Fluorophor 1 und 2 tragen und die vollständig für die Targetsequenz spezifisch sind, oder die für die Targetsequenz und Primer 1 spezifisch sind. act a pair of primers 1 and 2 as forward and reverse primers and using primers 1 at least two of the nucleic acid to target includes specific sequences, and both have modifications which allow for enzymatic extension, - a) three primers, wherein: Primer / probe system of claim 16 comprising and - primer 3, which is connected to the 5 'region of primer 1 is partially or completely identical, is enzymatically extendable also, b) the two probes each carrying fluorophore 1 and 2 and which are completely specific for the target sequence, or for the target sequence and primer 1 are specific.
  20. Reagenzienkit zum Nachweis von Nukleinsäuren umfassend a) mindestens ein Primer/Sondensystem gemäß einem der Ansprüche 16 bis 19, b) geeignete Puffer und gegebenenfalls weitere Hilfsstoffe. Reagent kit for the detection of nucleic acids comprising a) at least one primer / probe system according to any one of claims 16 to 19, b) suitable buffer, and optionally further auxiliaries.
  21. Verwendung eines Primer/Sondenystems nach einem der Ansprüche 16 bis 19 oder eines Reagenzienkits gemäß Anspruch 20 zur gleichzeitigen Unterscheidung von mehreren Targetsequenzen, wobei mehrere Primer-/Sondensysteme eingesetzt werden, die sich mindestens teilweise oder vollständig in den targetsequenzspezifischen Abschnitten und den Emissionswellenlängen der emittierenden Fluophore unterscheiden, so dass diese durch Mehrfarbenfluoreszenzdetektion differentiell erfasst werden können. Use of a primer / Sondenystems according to any one of claims 16 to 19 or of a reagent kit according to claim 20 for the simultaneous differentiation of multiple target sequences, with several primer / probe systems are used that are at least partially or completely in the target sequence-specific portions and the emission wavelengths of the emitting fluors differ, so that they can be differentially detected by multi-color fluorescence detection.
  22. Verwendung eines Primer/Sondenystems nach einem der Ansprüche 16 bis 19 oder eines Reagenzienkits gemäß Anspruch 20 zum Nachweis von mehreren Targetsequenzen, wobei die targetspezifischen Primer sich im 3'-Bereich unterscheiden und dadurch vollständig oder unvollständig komplementär mit der Targetsequenz in der jeweiligen Probe sind und dadurch detektiert oder nicht detektiert werden. Use of a primer / Sondenystems according to any one of claims 16 to 19 or of a reagent kit according to claim 20 for the detection of multiple target sequences, wherein the target-specific primers differs in the 3 'region and thus are completely or incompletely complementary to the target sequence in the respective sample and be detected by or not detected.
  23. Verwendung eines Primer/Sondenystems nach einem der Ansprüche 16 bis 19 oder eines Reagenzienkits gemäß Anspruch 20 zum gleichzeitigen Nachweis von mehreren Targetsequenzen unter Verwendung unterschiedlicher Detektionssysteme, wobei die einzusetzenden targetspezifischen Primer Längenpolymorphismen enthalten und Fluorszenzmarkierungen enthalten können. Use of a primer / Sondenystems according to any one of claims 16 to 19 or of a reagent kit according to claim 20 for the simultaneous detection of multiple target sequences using different detection systems, the target specific primers employed, and containing length polymorphisms can Fluorszenzmarkierungen.
  24. Verwendung eines Primer/Sondenystems nach einem der Ansprüche 16 bis 19 oder eines Reagenzienkits gemäß Anspruch 20, wobei die Targetsequenzen durch Echtzeitfluoreszenzanalyse, durch Elektrophorese oder durch Hybridisierung ohne Amplifikation der Targetsequenz, durch Hybridisierung nach der Amplifikation der Targetsequenz oder durch Hybridisierung während der Amplifikation der Targetsequenz erfasst werden. Use of a primer / Sondenystems according to any one of claims 16 to 19 or of a reagent kit according to claim 20, wherein the target sequences by real-time fluorescence analysis by electrophoresis or hybridization without amplification of the target sequence by hybridization following amplification of the target sequence or by hybridization during amplification of the target sequence are detected.
  25. Verwendung eines Primer/Sondenystems nach einem der Ansprüche 16 bis 19 oder eines Reagenzienkits gemäß Anspruch 20, in einem Mikroarray, welches die Sonden als Fangsonden oder eine Teilmenge eines Primers als Fangprimer immobilisiert umfasst. Use of a primer / Sondenystems according to any one of claims 16 to 19 or of a reagent kit according to claim 20, in a microarray comprising immobilized as capture probes, or a subset of a primer as the capture primer probes.
  26. Gerätesystem zur Durchführung von Real-Time PCR-Reaktionen, das vollautomatisch computermäßig steuerbar ist, umfassend: – Thermocycler, der einen Reaktionsbereich mit mehreren temperierbaren Aufnahmen für Reaktionsgefäße aufweist, – gegebenenfalls ein Immobilisierungsystem für Mikropartikel, – dem Reaktionsbereich zugeordnete Beleuchtungseinrichtungen (LED und/oder Laser) mit denen Anregungslicht strahlbar ist, – Detektoreinrichtung, die in Abhängigkeit von einer gemessenen Lichtintensität Messwerte erzeugt, mit Optikeinrichtungen, – ggf. eine Referenzeinrichtung, die einen Referenzwert erzeugt, – Auswerteeinrichtungen, wobei Reaktionsgefäße verwendet werden, die einen optisch transparenten Gefäßboden und/oder Gefäßdeckel mit geringer Eigenfluoreszenz umfassen, welche die fluoreszenzoptische Auswertung während der thermozyklischen oder isothermischen Durchführung der Nachweisreaktion ermöglichen. System for the implementation of real-time PCR reactions, which is fully automatic computer moderately controlled, comprising: - thermal cycler which has a reaction zone having a plurality of heatable seats for reaction vessels, - optionally a Immobilisierungsystem for microparticles, - associated with the reaction area illumination devices (LED, and / or laser) with which excitation light is strahlbar, - detector means which generates in response to a measured light intensity values, with optical devices, - if necessary, a reference means for generating a reference value, - evaluation means, said reaction vessels are used, an optically transparent vessel bottom and / comprise or vessel lid with low intrinsic fluorescence, which allow the fluorescence-optical evaluation during thermal cycling or isothermal carrying out the detection reaction.
  27. Gerätesystem zur simultanen Detektion von Targetsequenzen während der Amplifikation der Targetsequenzen nach Anspruch 26, dadurch gekennzeichnet, dass die Reaktionsgefäße einen Mikroarray darstellen, welches die Sonden als Fangsonden immobilisiert über zufällig oder systematisch in der Reaktionsumgebung verteilte Messpunkte umfasst, an die die Targetsequenzen über die immobilisierten Fangsonden hybridisieren, bildgebend fluoreszenzoptisch erfasst, dekodiert und vermessen werden und wobei die Reaktionsumgebung thermozyklisch steuerbar ist, vorzugsweise mittels Peltierelementen, Luftstrom, Wasserbad, Wärmestrahlung oder Mikrowellen. System for the simultaneous detection of target sequences during amplification of the target sequences according to claim 26, characterized in that the reaction vessels be a microarray, which immobilized probes as capture probes comprises more than randomly or systematically distributed in the reaction environment measurement points at which the target sequences on the immobilized capture probes hybridize are detected, decoded and measured optically by imaging fluorescence and the reaction environment is thermodynamically cyclically controllable, preferably by means of Peltier elements, air flow, water bath, heat radiation or microwaves.
  28. Gerätesystem nach Anspruch 26 oder 27, dadurch gekennzeichnet, dass die Reaktionsgefäße Messpunkte umfassen, wobei als Messpunkte Mikropartikel, vorzugsweise fluoreszenzkodierte, eingesetzt werden, die Fangsonden tragen und durch Schwerkraft, magnetische Kräfte oder durch chemische oder physikalische Bindung am Gefäßboden permanent oder während der Dauer des Messvorganges immobilisiert sind. Device system are used according to claim 26 or 27, characterized in that the reaction vessels measuring points include wherein as measuring points microparticles, preferably fluorescently coded carrying capture probes and by gravity, magnetic forces or by chemical or physical bond at the bottom of the vessel permanently or for the duration of measuring process are immobilized.
  29. Gerätesystem nach einem der Ansprüche 26 bis 28, dadurch gekennzeichnet, dass der Gefäßboden transparent oder nichttransparent ist und der Gefäßdeckel transparent, wobei die Messung durch den transparenten Gefäßboden von unten oder von oben und durch den nichttransparenten Gefäßboden von oben durchgeführt wird. Appliance system according to one of claims 26 to 28, characterized in that the vessel bottom is transparent or non-transparent and transparent to the vessel lid, with the measurement through the transparent bottom of the vessel from the bottom or from above and through the non-transparent bottom of the vessel is carried out from above.
  30. Reaktionsgefäß zur PCR mit transparentem Gefäßboden. Reaction vessel for PCR with a transparent bottom of the vessel.
  31. Verwendung eines Gerätesystems gemäß einem der Ansprüche 26 bis 30 zur fluoreszenzoptischen Auswertung während der thermozyklischen oder isothermischen Durchführung der Nachweisreaktion mittels Auflicht und Durchlichtfluoreszenz. Use of a device system according to one of claims 26 to 30 for fluorescence analysis optical during thermal cycling or isothermal performing the detection reaction by means of reflected and transmitted light fluorescence.
  32. Immuno-PCR bei der die Multiplex-Immunreaktion unter Verwendung nicht fluoreszierenden Beads, porösen oder nichtporösen flächigen oder stäbchenförmigen Trägermaterialien erfolgt und in einem zweiten Reaktionsschritt die Analytspezifischen Amplifikationsprodukte an fluoreszenzkodierten Mikropartikeln entsprechend Anspruch 1–27 nachgewiesen werden. Immuno-PCR in which the multiplex immune response using non-fluorescent beads, porous or nonporous flat or rod-shaped support materials is carried out and the analyte to be detected amplification fluorescence coded microparticles according to claim 1-27 in a second reaction step.
DE200710031137 2007-06-13 2007-06-29 Real-time detection of nucleic acid targets, comprises providing a primer containing a sequence-target binding sequence to amplify nucleic acid, introducing a fluorophore and providing a probe for detection, which carries a fluorophore Withdrawn DE102007031137A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
DE102007027779 2007-06-13
DE102007027779.4 2007-06-13
DE200710031137 DE102007031137A1 (en) 2007-06-13 2007-06-29 Real-time detection of nucleic acid targets, comprises providing a primer containing a sequence-target binding sequence to amplify nucleic acid, introducing a fluorophore and providing a probe for detection, which carries a fluorophore

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
DE200710031137 DE102007031137A1 (en) 2007-06-13 2007-06-29 Real-time detection of nucleic acid targets, comprises providing a primer containing a sequence-target binding sequence to amplify nucleic acid, introducing a fluorophore and providing a probe for detection, which carries a fluorophore
ES08761034T ES2538100T3 (en) 2007-06-13 2008-06-13 Procedure for conducting tests and evaluation of mixing and metering to measure reaction kinetics and affinities and concentrations of analytes in multiplex format
PCT/EP2008/057515 WO2008152145A1 (en) 2007-06-13 2008-06-13 Method for carrying out and evaluating mix & measure assays for the measurement of reaction kinetics, concentrations and affinities of analytes in multiplex format
EP20080761034 EP2167964B1 (en) 2007-06-13 2008-06-13 Method for carrying out and evaluating mix&measure assays for the measurement of reaction kinetics, concentrations and affinities of analytes in multiplex format
EP20080761031 EP2167685B1 (en) 2007-06-13 2008-06-13 Method and probe/primer system for the "real time" detection of a nucleic acid target
PCT/EP2008/057512 WO2008152144A1 (en) 2007-06-13 2008-06-13 Method and probe/primer system for the 'real time' detection of a nucleic acid target
US12664246 US20100203572A1 (en) 2007-06-13 2008-06-13 Method for carrying out and evaluating mix & measure assays for the measurement of reaction kinetics, concentrations and affinities of analytes in multiplex format

Publications (1)

Publication Number Publication Date
DE102007031137A1 true true DE102007031137A1 (en) 2008-12-18

Family

ID=39986258

Family Applications (1)

Application Number Title Priority Date Filing Date
DE200710031137 Withdrawn DE102007031137A1 (en) 2007-06-13 2007-06-29 Real-time detection of nucleic acid targets, comprises providing a primer containing a sequence-target binding sequence to amplify nucleic acid, introducing a fluorophore and providing a probe for detection, which carries a fluorophore

Country Status (1)

Country Link
DE (1) DE102007031137A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102269759A (en) * 2010-06-07 2011-12-07 常州楚天生物科技有限公司 Detecting a multi-immune pcr and melting curve analysis Based on dna
EP3130679A1 (en) 2015-08-13 2017-02-15 Cladiac GmbH Method and test system for the detection and/or quantification of a target nucleic acid in a sample

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6150097A (en) 1996-04-12 2000-11-21 The Public Health Research Institute Of The City Of New York, Inc. Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes
US6174670B1 (en) * 1996-06-04 2001-01-16 University Of Utah Research Foundation Monitoring amplification of DNA during PCR
WO2001048237A2 (en) * 1999-12-23 2001-07-05 Andreas Hoeft Method for quickly detecting microbial dna/rna, kit therefor and the use of said method
US6514750B2 (en) * 2001-07-03 2003-02-04 Pe Corporation (Ny) PCR sample handling device
DE69907630T2 (en) 1998-01-22 2004-02-26 Luminex Corp., Austin Microparticles with multiple fluorescence signals
DE10320519A1 (en) * 2003-04-30 2004-11-25 4Base Lab Gmbh Advanced Molecular Analysis A method for detecting infectious (+) - strand RNA viruses, in particular infectious enterovirus

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6150097A (en) 1996-04-12 2000-11-21 The Public Health Research Institute Of The City Of New York, Inc. Nucleic acid detection probes having non-FRET fluorescence quenching and kits and assays including such probes
US6174670B1 (en) * 1996-06-04 2001-01-16 University Of Utah Research Foundation Monitoring amplification of DNA during PCR
DE69907630T2 (en) 1998-01-22 2004-02-26 Luminex Corp., Austin Microparticles with multiple fluorescence signals
WO2001048237A2 (en) * 1999-12-23 2001-07-05 Andreas Hoeft Method for quickly detecting microbial dna/rna, kit therefor and the use of said method
US6514750B2 (en) * 2001-07-03 2003-02-04 Pe Corporation (Ny) PCR sample handling device
DE10320519A1 (en) * 2003-04-30 2004-11-25 4Base Lab Gmbh Advanced Molecular Analysis A method for detecting infectious (+) - strand RNA viruses, in particular infectious enterovirus

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102269759A (en) * 2010-06-07 2011-12-07 常州楚天生物科技有限公司 Detecting a multi-immune pcr and melting curve analysis Based on dna
EP3130679A1 (en) 2015-08-13 2017-02-15 Cladiac GmbH Method and test system for the detection and/or quantification of a target nucleic acid in a sample

Similar Documents

Publication Publication Date Title
Epstein et al. Fluorescence-based nucleic acid detection and microarrays
US6287766B1 (en) DNA polymorphism identity determination using flow cytometry
Knemeyer et al. Probes for detection of specific DNA sequences at the single-molecule level
US5641658A (en) Method for performing amplification of nucleic acid with two primers bound to a single solid support
US20020146688A1 (en) Method of analyzing a target nucleic acid
US5545528A (en) Rapid screening method of gene amplification products in polypropylene plates
US6579680B2 (en) Method for label-free detection of hybridized DNA targets
US20110267457A1 (en) Systems and methods for nucleic acid sequencing
US20030186310A1 (en) Apparatus and methods of detecting features on a microarray
US20090047673A1 (en) Miniaturized lateral flow device for rapid and sensitive detection of proteins or nucleic acids
US20030013091A1 (en) Methods for detection and quantification of analytes in complex mixtures
US20080176242A1 (en) Two stage nucleic acid amplification using an amplification oligomer
US20070105100A1 (en) Process for assay of nucleic acids by competitive hybridization using a dna microarray
DE19940810A1 (en) Biochemical analysis instrument uses mixture of sample and smart reagent beads viewed by color CCD camera to perform chemical analysis of medical samples.
US20100330574A1 (en) Chimeric primers with hairpin conformations and methods of using same
US20130157899A1 (en) Reagents and methods relating to dna assays using amplicon probes on encoded particles
Chen et al. DNA hybridization detection in a microfluidic channel using two fluorescently labelled nucleic acid probes
US20050064452A1 (en) System and method for the detection of analytes
US20040009514A1 (en) Assembly for label-free detection of hybridized nucleic targets
US20060166249A1 (en) Methods for separating short single-stranded nucleic acid from long single-and double-stranded nucleic acid, and associated biomolecular assays
US20120088691A1 (en) Highly multiplexed real-time pcr using encoded microbeads
WO2007075894A2 (en) Comparative genomic hybridization on encoded multiplex particles
DE10201463A1 (en) Reaction vessel, useful for detecting a specific interaction between a target and probe, e.g. in medical tests, comprises at its base a carrier for immobilized probes
US20090004666A1 (en) Method of detecting nucleotide sequence with an intramolecular probe
WO2004111602A2 (en) Colorimetric and fluorescent methods for sensing of oligonucleotides

Legal Events

Date Code Title Description
ON Later submitted papers
OP8 Request for examination as to paragraph 44 patent law
8139 Disposal/non-payment of the annual fee