DE102005036341A1 - Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses - Google Patents
Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses Download PDFInfo
- Publication number
- DE102005036341A1 DE102005036341A1 DE200510036341 DE102005036341A DE102005036341A1 DE 102005036341 A1 DE102005036341 A1 DE 102005036341A1 DE 200510036341 DE200510036341 DE 200510036341 DE 102005036341 A DE102005036341 A DE 102005036341A DE 102005036341 A1 DE102005036341 A1 DE 102005036341A1
- Authority
- DE
- Germany
- Prior art keywords
- hydrophobin
- hydrophobins
- repellent
- furniture
- dirt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C11—ANIMAL OR VEGETABLE OILS, FATS, FATTY SUBSTANCES OR WAXES; FATTY ACIDS THEREFROM; DETERGENTS; CANDLES
- C11D—DETERGENT COMPOSITIONS; USE OF SINGLE SUBSTANCES AS DETERGENTS; SOAP OR SOAP-MAKING; RESIN SOAPS; RECOVERY OF GLYCEROL
- C11D3/00—Other compounding ingredients of detergent compositions covered in group C11D1/00
- C11D3/16—Organic compounds
- C11D3/38—Products with no well-defined composition, e.g. natural products
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Detergent Compositions (AREA)
Abstract
Description
Die vorliegende Erfindung betrifft die Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen, insbesondere in Kombination mit einer Reinigung der Oberfläche, ein Verfahren zur schmutzabweisenden Behandlung harter Oberflächen, Reinigungsmittel für harte Oberflächen sowie harte Oberflächen mit einer schmutzabweisenden, Hydrophobine umfassenden Beschichtung.The The present invention relates to the use of hydrophobins for dirt-repellent treatment of hard surfaces, in particular in combination with a surface cleaning, a procedure for dirt repellent Treatment of hard surfaces, Cleaning agent for hard surfaces as well as hard surfaces with a dirt-repellent, Hydrophobine coating.
Es ist bekannt, harte Oberflächen, wie beispielsweise Glas, Keramik oder Fußböden mit schmutzabweisenden Beschichtungen zu versehen. Diese Ausrüstungen sollen die Schmutzhaftung vermindern, die Verschmutzung von Oberflächen zumindest erschweren und nachfolgende Reinigungen erleichtern. So sollen beispielsweise Fette, Öle oder Kalkrückstände leichter ablösbar sein, oder es soll das Auftreten eingetrockneter Wasserspuren beim Ablaufen von Wasser vermieden werden.It is known, hard surfaces, such as glass, ceramics or floors with dirt-repellent Coatings to provide. These equipments are said to have the dirt adhesion at least complicate the pollution of surfaces and facilitate subsequent cleanings. For example, fats, oils or lime residues should be lighter removable be, or it should be the appearance of dried traces of water during drainage be avoided by water.
Hierbei kann es sich um permanente, schmutzabweisende Beschichtungen, beispielsweise um dem Lotuseffekt nachempfundene Beschichtungen handeln.in this connection it can be permanent, dirt-repellent coatings, for example to act on the lotus effect imitated coatings.
Es kann sich aber auch um einen temporären Schutz handeln. Ein derartiger, temporärer schmutzabweisender Effekt kann beispielsweise durch Substanzen in einer Reinigerformulierung erreicht werden, welche beim Reinigen der Oberfläche aufgetragen werden. Wesentliche Anwendungsgebiete derartiger Reiniger sind Haushaltsanwendungen, wie Reiniger für den Küchen- oder Sanitärbereich, aber auch industrielle Anwendungen, wie beispielsweise Reiniger für die Autowäsche.It but can also be a temporary protection. Such a, temporary dirt repellent Effect, for example, by substances in a cleaner formulation can be achieved, which are applied when cleaning the surface. basics Areas of application of such cleaners are household applications, like cleaner for the kitchen or sanitary area, but also industrial applications, such as cleaners for the Car wash.
EP-A 467 472 offenbart eine Zusammensetzung zur Erhöhung der Hydrophilie von harten Oberflächen, beispielsweise Oberflächen im Haushalt, um ein erleichtertes Reinigen in nachfolgenden Reinigungsschritten zu erreichen. Die Formulierung enthält ein wasserlösliches, ionisches oder nichtionisches Polymer, beispielsweise ein kationisches Polymer mit quaternisierten Ammoniumalkylmethacrylat-Einheiten. Die offenbarten Reinigerformulierungen enthalten 0,02 bis 5 Gew. % des Polymeren.EP-A 467,472 discloses a composition for increasing the hydrophilicity of hard Surfaces, for example, surfaces in the household, to facilitate cleaning in subsequent cleaning steps to reach. The formulation contains a water-soluble, ionic or nonionic polymer, for example a cationic one Polymer with quaternized ammonium alkyl methacrylate units. The disclosed detergent formulations contain 0.02 to 5 wt. % of the polymer.
WO 03/002620 offenbart die Verwendung von (Meth)acrylsäuredialkylaminoalkylestern als Soil-Release-Polymere für harte Oberflächen, beispielsweise Feinsteinböden oder Edelstahloberflächen. Die offenbarten Reinigerformulierungen enthalten 0,1 bis 5 Gew. % des Polymeren.WHERE 03/002620 discloses the use of (meth) acrylic acid dialkylaminoalkyl esters as soil-release polymers for hard surfaces, For example, fine stone floors or stainless steel surfaces. The disclosed detergent formulations contain from 0.1 to 5 wt. % of the polymer.
DE-A 100 61 897 offenbart Reinigungsmittel, die hydrophile, silikathaltige Partikel enthalten, die zu einer verbesserten Schmutzablösung bei gleichzeitiger Verringerung der Wiederanschmutzung führen. Die Partikel lagern sich auf der Oberfläche der zu reinigenden Substanzen an und verändern so die Oberflächeneigenschaften.DE-A 100 61 897 discloses detergents containing hydrophilic, silicate-containing Particles that contribute to improved soil release Simultaneous reduction of re-soiling. The Particles are deposited on the surface of the substances to be cleaned and change so the surface properties.
Hydrophobine sind kleine Proteine von etwa 100 bis 150 Aminosäuren, die charakteristisch für filamentöse Pilze, beispielsweise Schizophyllum commune, sind. Sie weisen in aller Regel 8 Cystein-Einheiten auf.hydrophobins are small proteins of about 100 to 150 amino acids that are characteristic for filamentous mushrooms, for example, Schizophyllum commune. They point in all Rule 8 cysteine units on.
Hydrophobine weisen eine ausgeprägte Affinität zu Grenzflächen auf und eignen sich daher zur Beschichtung von Oberflächen. So lässt sich beispielsweise Teflon mittels Hydrophobinen unter Erhalt einer hydrophilen Oberfläche beschichten.hydrophobins have a pronounced affinity to interfaces and are therefore suitable for coating surfaces. So let yourself For example, Teflon using hydrophobins to obtain a hydrophilic surface coat.
Hydrophobine können aus natürlichen Quellen isoliert werden. Es können aber auch natürlich nicht vorkommende Hydrophobine mittels chemischer und/oder biotechnologischer Herstellverfahren synthetisiert werden. Unsere ältere Anmeldung DE 102005007480.4 offenbart ein Herstellverfahren für Hydrophobine, die nicht in der Natur vorkommen.hydrophobins can from natural Sources are isolated. It can but of course not occurring hydrophobins by means of chemical and / or biotechnological Manufacturing process can be synthesized. Our older application DE 102005007480.4 discloses a preparation process for hydrophobins that are not in of nature.
Im Stand der Technik ist die Verwendung von Hydrophobinen für verschiedene Anwendungen vorgeschlagen worden.in the The state of the art is the use of hydrophobins for various purposes Applications have been proposed.
WO 96/41882 schlägt die Verwendung von Hydrophobinen als Emulgatoren, Verdicker, oberflächenaktive Substanzen, zum Hydrophilieren hydrophober Oberflächen, zur Verbesserung der Wasserbeständigkeit hydrophiler Substrate, zur Herstellung von Öl-in-Wasser-Emulsionen oder von Wasser-in-Öl-Emulsionen vor. Weiterhin werden pharmazeutische Anwendungen wie die Herstellung von Salben oder Cremes sowie kosmetische Anwendungen wie Hautschutz oder die Herstellung von Haarshampoos oder Haarspülungen vorgeschlagen.WHERE 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active Substances for Hydrophilizing Hydrophobic Surfaces Improvement of water resistance hydrophilic substrates, for the preparation of oil-in-water emulsions or water-in-oil emulsions in front. Furthermore, pharmaceutical applications such as the production of ointments or creams, as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses.
EP-A 1 252 516 offenbart die Beschichtung von Fenstern, Kontaktlinsen, Biosensoren, medizinischen Vorrichtungen, Behältern zur Durchführung von Versuchen oder zur Lagerung, Schiffrümpfen, festen Teilchen oder Rahmen oder Karosserie von Personenkraftwagen mit einer Hydrophobine enthaltenden Lösung bei einer Temperatur von 30 bis 80°C.EP-A 1 252 516 discloses the coating of windows, contact lenses, Biosensors, medical devices, containers for carrying out Try or for storage, ship hulls, solid particles or Frame or body of passenger car with a hydrophobin containing solution at a temperature of 30 to 80 ° C.
WO 03/53383 offenbart die Verwendung von Hydrophobin zum Behandeln von Keratin-Materialien in kosmetischen Anwendungen.WHERE 03/53383 discloses the use of hydrophobin for treating of keratin materials in cosmetic applications.
WO 03/10331 offenbart einen mit Hydrophobin beschichteten Sensor, beispielsweise eine Messelektrode, an den nicht kovalent weitere Substanzen, z.B. elektroaktive Substanzen, Antikörper oder Enzyme gebunden sind.WO 03/10331 discloses a sensor coated with hydrophobin, for example a measuring electrode, to which non-covalently further substances, eg electroactive substances, antibodies or enzymes, are disclosed me are bound.
Keine der zitierten Schriften offenbart die Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung harter Oberflächen.None The cited documents disclose the use of hydrophobins for dirt-repellent treatment of hard surfaces.
Aufgabe der Erfindung war es, neuartige Techniken zur Schmutzabweisung bereit zu stellen.task It was the object of the invention to provide novel techniques for soil release to deliver.
Dementsprechend wurde die Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung harter Oberflächen gefunden. In einer bevorzugten Ausführungsform der Erfindung wird die schmutzabweisende Behandlung in Kombination mit einer Reinigung der Oberfläche vorgenommen.Accordingly was the use of hydrophobins for stain-resistant treatment hard surfaces found. In a preferred embodiment of the invention the dirt-repellent treatment in combination with a cleaning the surface performed.
In einem zweiten Aspekt betrifft die Erfindung ein Verfahren zur schmutzabweisenden Behandlung harter Oberflächen, bei dem man die Oberfläche mit einer Zusammensetzung umfassend mindestens ein Hydrophobin sowie mindestens ein Lösemittel in Kontakt bringt.In In a second aspect, the invention relates to a method for stain-resistant Treatment of hard surfaces, where you have the surface with a composition comprising at least one hydrophobin as well at least one solvent brings in contact.
In einem dritten Aspekt betrifft die Erfindung ein Reinigungsmittel für harte Oberflächen, welches mindestens ein Hydrophobin, mindestens ein Tensid sowie mindestens ein Lösemittel umfasst.In In a third aspect, the invention relates to a cleaning agent for hard Surfaces, which at least one hydrophobin, at least one surfactant and at least one solvent includes.
In einem vierten Aspekt betrifft die Erfindung harte Oberflächen, welche eine Hydrophobine umfassende, schmutzabweisende Beschichtung aufweisen.In In a fourth aspect, the invention relates to hard surfaces which have a hydrophobin comprehensive, dirt-repellent coating.
Überraschenderweise wurde gefunden, dass schon äußerst geringe Mengen von Hydrophobinen zu einer wirksamen, schmutzabweisenden Behandlung von harten Oberflächen ausreichend sind.Surprisingly was found to be extremely low Quantities of hydrophobins to an effective, stain-resistant Treatment of hard surfaces are sufficient.
Zu
der Erfindung ist im Einzelnen das Folgende auszuführen:
Der
Begriff „harte
Oberflächen" ist dem Fachmann bekannt.
Es handelt sich um nicht oder nur in geringem Maße kompressible Oberflächen, insbesondere um
glatte Oberflächen,
zum Beispiel Oberflächen aus
Glas, Keramik, Metallen, wie beispielsweise Edelstahl oder Messing,
Emaille, Kunststoff und/oder um lackierte Oberflächen. Beispiele lackierter
Oberflächen
umfassen die Oberfläche
von lackierten Automobilkarosserien oder die Oberfläche von
Haushaltsgeräten.
Bei den harten Oberflächen
kann es sich insbesondere um typische, im Haushalt vorkommende Oberflächen handeln,
wie beispielsweise die Oberfläche
von Fliesen, Fußböden, Armaturen, Waschbecken,
Duschwannen, Badwannen, Toiletten, Duschkabinen, Badezimmermöbeln, Küchenmöbeln wie
Tischen, Stühlen,
Schränken,
Arbeitsflächen oder
sonstigen Möbeln,
Spiegeln, Fenstern, Geschirr, Besteck, Gläsern, Porzellangegenständen oder
die Oberflächen
von Haushaltsgeräten
wie Waschmaschinen, Geschirrspülmaschinen,
Herde oder Dunstabzugshauben.More specifically, the following is to be accomplished for the invention:
The term "hard surfaces" is known to those skilled in the art and is not or only slightly compressible surfaces, in particular smooth surfaces, for example surfaces of glass, ceramics, metals, such as stainless steel or brass, enamel, plastic and / or. Examples of painted surfaces include the surface of painted automotive bodies or the surface of household appliances, and the hard surfaces may be, in particular, typical household surfaces such as the surface of tiles, floors, fixtures, sinks, etc. Shower trays, bathtubs, toilets, shower cubicles, bathroom furniture, kitchen furniture such as tables, chairs, cupboards, work surfaces or other furniture, mirrors, windows, crockery, cutlery, glasses, porcelain items or the surfaces of household appliances such as washing machines, dishwashers, cookers or dunes tabzugshauben.
Der Begriff „schmutzabweisend" ist dem Fachmann bekannt. Mittels einer schmutzabweisenden Behandlung einer Oberfläche wird deren Verschmutzung verhindert oder zumindest erschwert und/oder die Ablösung von Schmutz von der Oberfläche erleichtert. Bei Schmutz handelt es sich in bekannter Art und Weise um alle Arten unerwünschter Kontamination von harten Oberflächen mit festen und/oder flüssigen Stoffen. Beispiele von Schmutz umfassen Fette, Öle, Eiweiße, Speisereste, Staub oder Erde. Bei Verschmutzungen kann es sich auch um Kalkablagerungen wie beispielsweise eingetrocknete Wasserspuren handeln, die sich aufgrund der Wasserhärte bilden. Weitere Beispiele umfassen Reste von Reinigungs- und Pflegemitteln zur Körperpflege oder auch unlösliche Kalkseifen, die sich aus derartigen Reinigungs- und Pflegemitteln in Verbindung mit Wasserhärte bilden können, und die sich auf harten Oberflächen wie beispielsweise Waschbecken, Duschverkleidungen oder Badewannen niederschlagen können.Of the Term "dirt repellent" is the expert known. By means of a dirt-repellent treatment of a surface becomes their pollution prevents or at least impedes and / or the replacement of dirt from the surface facilitated. Dirt is in a known manner around all types of unwanted contamination from hard surfaces with solid and / or liquid Substances. Examples of dirt include fats, oils, egg whites, leftovers, dust or Earth. Contamination can also be limescale deposits such as dried-up traces of water that are due to the water hardness form. Further examples include residues of cleaning and care products for body care or insoluble Lime soaps resulting from such cleaning and care products in conjunction with water hardness can form and that are on hard surfaces such as sinks, shower panels or bathtubs can knock down.
Erfindungsgemäß wird zur schmutzabweisenden Behandlung der harten Oberflächen mindestens ein Hydrophobin verwendet. Es kann nur ein Hydrophobin oder ein Gemisch mehrerer, verschiedener Hydrophobine eingesetzt werden.According to the invention is for Dirt-repellent treatment of hard surfaces at least one hydrophobin used. It can only be one hydrophobin or a mixture of several, various hydrophobins are used.
Unter
dem Begriff „Hydrophobine" im Sinne dieser
Erfindung sollen im Folgenden Polypeptide der allgemeinen Strukturformel
(I)
Die Polypetide gemäß Formel (I) sind weiterhin durch die Eigenschaft charakterisiert, dass sie bei Raumtemperatur nach Beschichten einer Glasoberfläche eine Vergrößerung des Kontaktwinkels eines Wassertropfens von mindestens 20°, bevorzugt mindestens 25°, besonders bevorzugt mindestens 30°, und ganz besonders bevorzugt mindestens 35° bewirken, jeweils verglichen mit dem Kontaktwinkel eines gleich großen Wassertropfens mit der unbeschichteten Glasoberfläche.The polypetides according to formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 °, more preferably at least 30 °, and most preferably at least 35 °, in each case compared with the contact angle ei an equal drop of water with the uncoated glass surface.
Die mit C1 bis C8 benannten Aminosäuren sind bevorzugt Cysteine; sie können aber auch durch andere Aminosäuren ähnlicher Raumerfüllung, bevorzugt durch Alanin, Serin, Threonin, Methionin oder Glycin ersetzt werden. Allerdings sollen mindestens vier, bevorzugt mindestens 5, besonders bevorzugt mindestens 6 und insbesondere mindestens 7 der Positionen C1 bis C8 aus Cysteinen bestehen. Cysteine können in den erfindungsgemäßen Proteinen entweder reduziert vorliegen oder miteinander Di sulfidbrücken ausbilden. Besonders bevorzugt ist die intramolekulare Ausbildung von C-C Brücken, insbesondere die mit mindestens einer, bevorzugt 2, besonders bevorzugt 3 und ganz besonders bevorzugt 4 intramolekularen Disulfidbrücken. Bei dem oben beschriebenen Austausch von Cysteinen durch Aminosäuren ähnlicher Raumerfüllung werden vorteilhaft solche C-Positionen paarweise ausgetauscht, die intramolekulare Disulfidbrücken untereinander ausbilden können.The amino acids designated C 1 to C 8 are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C 1 to C 8 should consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or form di-sulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.
Falls in den mit X bezeichneten Positionen auch Cysteine, Serine, Alanine, Glycine, Methionine oder Threonine verwendet werden, kann sich die Nummerierung der einzelnen C-Positionen in den allgemeinen Formeln entsprechend verändern.If in the positions indicated by X, also cysteines, serines, alanines, Glycine, methionine or threonine can be used for numbering corresponding to the individual C positions in the general formulas change.
Bevorzugt
werden Hydrophobine der allgemeinen Formel (II)
Besonders
bevorzugt werden Hydrophobine der allgemeinen Formel (III)
Bei den Resten Xn und Xm kann es sich um Peptidsequenzen handeln, die natürlicherweise auch mit einem Hydrophobin verknüpft sind. Es kann sich aber auch bei einem oder beiden Resten um Peptidsequenzen handeln, die natürlicherweise nicht mit einem Hydrophobin verknüpft sind. darunter sind auch solche Reste Xn und/oder Xm zu verstehen, bei denen eine natürlicherweise in einem Hydrophobin vorkommende Peptidsequenz durch eine nicht natürlicherweise in einem Hydrophobin vorkommende Peptidsequenz verlängert ist.The radicals X n and X m may be peptide sequences that are naturally also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. including such radicals X N and / or X m are to be understood, in which a naturally occurring in a hydrophobin peptide sequence is extended by a non-naturally occurring in a hydrophobin peptide sequence.
Falls es sich bei Xn und/oder Xm um natürlicherweise nicht in Hydrophobinen vorkommende Peptidsequenzen handelt, sind derartige Sequenzen in der Regel mindestens 20, bevorzugt mindestens 35, besonders bevorzugt mindestens 50 und ganz besonders bevorzugt mindestens 100 Aminosäuren lang. Ein derartiger, natürlicherweise nicht mit einem Hydrophobin verknüpfter Rest soll im Folgenden auch als Fusionspartner bezeichnet werden. Damit soll ausgedrückt werden, dass die Proteine aus einem Hydrophobinteil und einem Fusionspartnerteil bestehen, die in der Natur nicht zusammen in dieser Form vorkommen.If X n and / or X m are naturally non-hydrophobic peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length. Such a residue, which is not naturally linked to a hydrophobin, will also be referred to below as a fusion partner. This is to say that the proteins consist of a hydrophobin part and a fusion partner part, which in nature do not coexist in this form.
Der Fusionspartnerteil kann aus einer Vielzahl von Proteinen ausgewählt werden. Es können auch mehrere Fusionspartner mit einem Hydrophobinteil verknüpft werden, beispielsweise am Aminoterminus (Xn) und am Carboxyterminus (Xm) des Hydrophobinteils. Es können aber auch beispielsweise zwei Fusionspartner mit einer Position (Xn oder Xm) des erfindungsgemäßen Proteins verknüpft werden.The fusion partner portion can be selected from a variety of proteins. Several fusion partners can also be linked to a hydrophobin part, for example at the amino terminus (X n ) and at the carboxy terminus (X m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X n or X m ) of the protein according to the invention.
Besonders geeignete Fusionspartner sind Polypeptide, die natürlicherweise in Mikroorganismen, insbesondere in E. coli oder Bacillus subtilis vorkommen. Beispiele für solche Fusionspartner sind die Sequenzen yaad (SEQ ID NO:15 und 16), yaae (SEQ ID NO:17 und 18), und Thioredoxin. Gut geeignet sind auch Fragmente oder Derivate dieser genannten Sequenzen, die nur einen Teil, bevorzugt 70-99%, besonders bevorzugt 80-98% der genannten Sequenzen umfassen, oder bei denen einzelne Aminosäuren, bzw. Nukleotide gegenüber der genannten Sequenz verändert sind.Especially suitable fusion partners are polypeptides that are naturally occur in microorganisms, in particular in E. coli or Bacillus subtilis. examples for Such fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NOs: 17 and 18), and thioredoxin. Well suited also fragments or derivatives of these named sequences that only a part, preferably 70-99%, more preferably 80-98% of said Include sequences, or in which individual amino acids, or Nucleotides opposite changed the said sequence are.
Die erfindungsgemäß verwendeten Proteine können auch noch in ihrer Polypeptidsequenz modifiziert sein, beispielsweise durch Glycosilierung, Acetylierung oder auch durch chemische Quervernetzung beispielsweise mit Glutardialdehyd.The used according to the invention Proteins can also be modified in their polypeptide sequence, for example by glycosylation, acetylation or by chemical cross-linking for example with glutaric dialdehyde.
Eine Eigenschaft der erfindungsgemäß verwendeten Proteine ist die Änderung von Oberflächeneigenschaften, wenn die Oberflächen mit den Proteinen beschichtet werden. Die Änderung der Oberflächeneigenschaften lässt sich experimentell dadurch bestimmen, dass der Kontaktwinkel eines Wassertropfens vor und nach der Beschichtung einer Oberfläche mit dem Protein gemessen wird und die Differenz der beiden Messungen ermittelt wird.One property of the proteins used in the invention is the change in surface properties when the surfaces are coated with the proteins. The change in surface properties can be experimentally determined by measuring the contact angle of a water drop before and after coating a surface with the protein, and the differences of the two measurements is determined.
Die Durchführung von Kontaktwinkelmessungen ist dem Fachmann prinzipiell bekannt. Die genauen experimentellen Bedingungen zur Messung des Kontaktwinkels sind im experimentellen Teil dargestellt. Unter den dort genannten Bedingungen besitzen die erfindungsgemäß verwendeten Proteine die Eigenschaft, den Kontaktwinkel eines Wassertropfens auf einer Glasoberfläche um mindestens 20°, bevorzugt mindestens 25°, besonders bevorzugt mindestens 30° zu vergrößern.The execution Contact angle measurements are known in principle to the person skilled in the art. The exact experimental conditions for measuring the contact angle are shown in the experimental part. Among the mentioned there Conditions have the proteins used in the invention Property, the contact angle of a water droplet on a glass surface by at least 20 °, preferably at least 25 °, more preferably at least 30 ° to enlarge.
Im Hydrophobinteil der bisher bekannten Hydrophobine sind die Positionen der polaren und unpolaren Aminosäuren konserviert, was sich in einem charakteristischen Hydrophobizitätsplot äußert. Unterschiede in den biophysikalischen Eigenschaften und in der Hydrophobizität führten zur Einteilung der bisher bekannten Hydrophobine in zwei Klassen, I und II (Wessels et al. 1994, Ann. Rev. Phytopathol., 32, 413-437).in the Hydrophobin part of the previously known hydrophobins are the positions of polar and nonpolar amino acids conserved, which manifests itself in a characteristic hydrophobicity plot. differences in biophysical properties and hydrophobicity led to Classification of previously known hydrophobins in two classes, I and II (Wessels et al., 1994, Ann. Rev. Phytopathol., 32, 413-437).
Die assemblierten Membranen aus Klasse I Hydrophobinen sind hochgradig unlöslich (selbst gegenüber 1 % SDS bei erhöhter Temperatur) und können nur durch konzentrierte Trifluoressigsäure (TFA), bzw. Ameisensäure wieder dissoziiert werden. Im Gegensatz dazu sind die assemblierten Formen von Klasse II Hydrophobinen weniger stabil. Sie können bereits durch 60%iges Ethanol, bzw. 1% SDS (bei Raumtemperatur) wieder aufgelöst werden.The Assembled membranes from Class I hydrophobins are high grade insoluble (even opposite 1% SDS at elevated Temperature) and can only by concentrated trifluoroacetic acid (TFA), or formic acid again be dissociated. In contrast, the assembled forms of class II hydrophobins less stable. You already can by 60% ethanol, or 1% SDS (at room temperature) are redissolved.
Ein Vergleich der Aminosäuresequenzen zeigt, dass die Länge des Bereichs zwischen Cystein C3 und C4 bei Klasse II Hydrophobinen deutlich kürzer ist, als bei Hydrophobinen der Klasse I. Klasse II Hydrophobine weisen weiterhin mehr geladene Aminosäuren als Klasse I auf.A comparison of the amino acid sequences shows that the length of the region between cysteine C 3 and C 4 is significantly shorter in class II hydrophobins than in class I hydrophobins. Class II Hydrophobins furthermore have more charged amino acids than class I.
Besonders bevorzugte Hydrophobine zur Ausführung der vorliegenden Erfindung sind die Hydrophobine des Typs dewA, rodA, hypA, hypB, sc3, basf1, basf2, die im nachfolgenden Sequenzprotokoll strukturell charakterisiert sind. Es kann sich auch nur um Teile oder Derivate davon handeln. Es können auch mehrere Hydrophobine, bevorzugt 2 oder 3, gleicher oder unterschiedlicher Struktur miteinander verknüpft und mit einer entsprechenden geeigneten Polypeptidsequenz, die natürlicherweise nicht mit einem Hydrophobin verbunden ist, verknüpft werden.Especially preferred hydrophobins for execution of the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basf1, basf2, which are structurally described in the Sequence Listing below are characterized. It may also be just parts or derivatives act on it. It can too several hydrophobins, preferably 2 or 3, the same or different Structure linked together and with a corresponding suitable polypeptide sequence naturally not associated with a hydrophobin.
Besonders geeignet zur Durchführung der vorliegenden Erfindung sind weiterhin die Fusionsproteine mit den in SEQ ID NO: 20, 22, 24 dargestellten Polypeptidsequenzen sowie den dafür codierenden Nukleinsäuresequenzen, insbesondere den Sequenzen gemäss SEQ ID NO: 19, 21, 23. Auch Proteine, die sich ausgehend von den in SEQ ID NO. 20, 22 oder 24 dargestellten Polypeptidsequenzen durch Austausch, Insertion oder Deletion von mindestens einer, bis hin zu 10. bevorzugt 5, besonders bevorzugt 5% aller Aminosäuren ergeben, und die die biologische Eigenschaft der Ausgangsproteine noch zu mindestens 50% besitzen, sind besonders bevorzugte Ausführungsformen. Unter biologischer Eigenschaft der Proteine wird hierbei die bereits beschriebene Änderung des Kontaktwinkels um mindestens 20° verstanden.Especially suitable for implementation The present invention further provides the fusion proteins with the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the one for it coding nucleic acid sequences, in particular the sequences according to SEQ ID NO: 19, 21, 23. Also, proteins derived from the in SEQ ID NO. 20, 22 or 24 polypeptide sequences represented by exchange, Insertion or deletion of at least one, up to 10 preferred 5, more preferably 5% of all amino acids, and the biological Possess at least 50% property of the source proteins, are particularly preferred embodiments. The biological property of the proteins is already here described change the contact angle by at least 20 ° understood.
Die erfindungsgemäß verwendeten Polypeptide lassen sich chemisch durch bekannte Verfahren der Peptidsynthese, beispielsweise durch Festphasensynthese nach Merrifield herstellen.The used according to the invention Polypeptides can be prepared chemically by known methods of peptide synthesis, for example, by Merrifield solid phase synthesis.
Natürlich vorkommende Hydrophobine lassen sich aus natürlichen Quellen mittels geeigneter Methoden isolieren. Beispielhaft sei auf Wösten et. al., Eur. J Cell Bio. 63, 122-129 (1994) oder WO 96/41882 verwiesen.Naturally occurring Hydrophobins can be made from natural Isolate sources using appropriate methods. Exemplary on the way et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.
Die
Herstellung von Fusionsproteinen kann bevorzugt durch gentechnische
Verfahren erfolgen, bei denen eine für den Fusionspartner und eine
für den
Hydrophobinteil codierende Nukleinsäuresequenz, insbesondere DNA-Sequenz,
so kombiniert werden, dass in einem Wirtsorganismus durch Genexpression
der kombinierten Nukleinsäuresequenz das
gewünschte
Protein erzeugt wird. Ein derartiges Herstellverfahren ist in unserer älteren Anmeldung
Geeignete Wirtsorganismen (Produktionsorganismen) für das genannte Herstellverfahren können dabei Prokaryonten (einschließlich der Archaea) oder Eukaryonten sein, besonders Bakterien einschließlich Halobacterien und Methanococcen, Pilze, Insektenzellen, Pflanzenzellen und Säugerzellen, besonders bevorzugt Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec., Lactobacillen, Hansenula polymorpha, Trichoderma reesei, SF9 (bzw. verwandte Zellen) u.a.suitable Host organisms (production organisms) for said production process can while prokaryotes (including the archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, particularly preferred Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec., Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and the like.
Im Rahmen der vorliegenden Erfindungen können Expressionskonstrukte, erhalten unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen, eine für ein erfindungsgemäß verwendetes Polypeptid kodierende Nukleinsäuresequenz, sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte zur Herstellung von Hydrophobinen eingesetzt werden.in the Within the scope of the present invention, expression constructs, obtained under the genetic control of regulatory nucleic acid sequences, one for a polypeptide used according to the invention coding nucleic acid sequence, and vectors comprising at least one of these expression constructs be used for the production of hydrophobins.
Vorzugsweise umfassen eingesetzte Konstrukte 5'-stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'-stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz.Preferably, constructs used include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally also far the usual regulatory elements, each operatively linked to the coding sequence.
Unter einer "operativen Verknüpfung" versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz bestimmungsgemäß erfüllen kann.Under an "operational Linking "one understands the Sequential arrangement of promoter, coding sequence, terminator and optionally other regulatory elements such that each of the regulative elements have their function in the expression of the coding Sequence can meet as intended.
Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie Enhancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen. Geeignete regulatorische Sequenzen sind z. B. beschrieben in Goeddel, Gene Expression Techno- logy : Methods in Enzymology 185, Academic Press, San Diego, CA (1990).Examples for operational linkable Sequences are targeting sequences as well as enhancers, polyadenylation signals and the same. Other regulative elements include selectable ones Markers, amplification signals, origins of replication, and the like. suitable regulatory sequences are e.g. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Zusätzlich zu diesen Regulationssequenzen kann die natürliche Regulation dieser Sequenzen vor den eigentlichen Strukturgenen noch vorhanden sein und gegebenenfalls genetisch verändert worden sein, so dass die natürliche Regulation ausgeschaltet und die Expression der Gene erhöht wurde.In addition to These regulatory sequences may be the natural regulation of these sequences be present before the actual structural genes and optionally genetically modified have been so natural Regulation switched off and the expression of genes was increased.
Ein bevorzugtes Nukleinsäurekonstrukt enthält vorteilhaft auch eine oder mehrere der schon erwähnten "Enhancer"-Sequenzen, funktionell verknüpft mit dem Promotor, die eine erhöhte Expression der Nukleinsäuresequenz ermöglichen. Auch am 3'-Ende der DNA-Sequenzen können zusätzliche vorteilhafte Sequenzen inseriert werden, wie weitere regulatorische Elemente oder Terminatoren.One preferred nucleic acid construct contains advantageously also one or more of the already mentioned "enhancer" sequences, functionally linked to the promoter, which increased one Expression of the nucleic acid sequence enable. Also at the 3'-end the DNA sequences can additional advantageous Sequences are inserted, as are other regulatory elements or terminators.
Die Nukleinsäuren können in einer oder mehreren Kopien im Konstrukt enthalten sein. Im Konstrukt können noch weitere Marker, wie Antibiotikaresistenzen oder Auxotrophien komplementierende Gene, gegebenenfalls zur Selektion auf das Konstrukt enthalten sein.The nucleic acids can be contained in one or more copies in the construct. In the construct can even more markers, such as antibiotic resistance or auxotrophs complementing genes, optionally for selection on the construct be included.
Vorteilhafte Regulationssequenzen für das Verfahren sind beispielsweise in Promotoren wie cos-, tac-, trp-, tet-, trp-tet-, lpp-, lac-, lpp-lac-, laclq-T7-, T5-, T3-, gal-, trc-, ara-, rhaP(rhaPBAD) SP6-, lambda-PR-oder imlambda-P-Promotor enthalten, die vorteilhaft in gram-negativen Bakterien Anwendung finden. Weitere vorteilhafte Regulationssequenzen sind beispielsweise in den gram-positiven Promotoren amy und SP02, in den Hefe-oder Pilzpromotoren ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH enthalten.advantageous Regulatory sequences for the method are for example in promoters such as cos-, tac-, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq-T7, T5, T3, gal, trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter that are beneficial in gram-negative bacteria application Find. Further advantageous regulatory sequences are, for example in the gram-positive promoters amy and SP02, in the yeast or Fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH included.
Es können auch künstliche Promotoren für die Regulation verwendet werden.It can also artificial Promoters for the Regulation be used.
Das Nukleinsäurekonstrukt wird zur Expression in einem Wirtsorganismus vorteilhafterweise in einen Vektor, wie beispielsweise einem Plasmid oder einem Phagen inseriert, der eine optimale Expression der Gene im Wirt ermöglicht. Unter Vektoren sind außer Plasmiden und Phagen auch alle anderen dem Fachmann bekannten Vektoren, also z. B. Viren, wie SV40, CMV, Baculovirus und Adenovirus, Transposons, IS- Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA, sowie das Agrobacterium-System zu verstehen.The nucleic acid construct is advantageously for expression in a host organism into a vector, such as a plasmid or a phage inserted, which allows optimal expression of genes in the host. Among vectors are out of the box Plasmids and phages also all other vectors known in the art, So z. Viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA, and the Agrobacterium system to understand.
Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden. Diese Vektoren stellen eine weitere Ausgestaltung der Erfindung dar. Geeignete Plasmide sind beispielsweise in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III''3-B1, tgt11 oder pBdCl, in StreptomycesplJ101, pIJ364, pIJ702 oder pIJ361, in Bacillus pUB110, pC194 oder pBD214, in Corynebacterium pSA77 oder pAJ667, in Pilzen pALS1, pIL2 oder pBB116, in Hefen 2alpha, pAG-1, YEp6, YEp13 oder pEMBLYe23 oder in Pflanzen pLGV23, pGHlac+, pBIN19, pAK2004 oder pDH51. Die genannten Plasmide stellen eine kleine Auswahl der möglichen Plasmide dar. Weitere Plasmide sind dem Fachmann bekannt und können beispielsweise aus dem Buch Cloning Vectors (Eds. Pouwels P. H. et at. Elsevier, Ams- terdam- New York-Oxford, 1985, ISBN 0 444 904018) entnommen werden.These Vectors can autonomously replicated in the host organism or replicated chromosomally become. These vectors represent a further embodiment of the invention Suitable plasmids are, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III''3-B1, tgt11 or pBdCl, in Streptomycespl J101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL2 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHlac +, pBIN19, pAK2004 or pDH51. The said plasmids provide a small selection of possible Plasmids. Other plasmids are known in the art and may, for example from the book Cloning Vectors (Eds. Pouwels P.H. et at. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).
Vorteilhaft enthält das Nukleinsäurekonstrukt zur Expression der weiteren enthaltenen Gene zusätzlich noch 3'-und/oder 5'-terminale regulatorische Sequenzen zur Steige rung der Expression, die je nach ausgewähltem Wirtorganismus und Gen oder Gene für eine optimale Expression ausgewählt werden.Advantageous contains the nucleic acid construct for Expression of the other genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase expression, depending on the host organism selected and gene or genes for optimal expression selected become.
Diese regulatorischen Sequenzen sollen die gezielte Expression der Gene und der Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.These Regulatory sequences are designed to target the expression of genes and enable protein expression. For example, depending on the host organism, this may mean that the gene is expressed or overexpressed after induction, or that it is immediately expressed and / or overexpressed.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Genexpression der eingeführten Gene positiv beeinflussen und dadurch erhöhen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird.The Regulatory sequences or factors can preferably the Gene expression of the introduced Positively influence genes and thereby increase them. So can a reinforcement of the regulatory elements advantageously at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. But there is also a reinforcement Translation possible, for example, by improving the stability of the mRNA.
In einer weiteren Ausgestaltungsform des Vektors kann der das Nukleinsäurekonstrukt oder die Nukleinsäure enthaltende Vektor auch vorteilhaft in Form einer linearen DNA in die Mikroorganismen eingeführt werden und über heterologe oder homologe Rekombination in das Genom des Wirtsorganismus integriert werden. Diese lineare DNA kann aus einem linearisierten Vektor wie einem Plasmid oder nur aus dem Nukleinsäurekonstrukt oder der Nukleinsäure bestehen.In a further embodiment of the Vector, the vector containing the nucleic acid construct or the nucleic acid can also be advantageously introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.
Für eine optimale Expression heterologer Gene in Organismen ist es vorteilhaft die Nukleinsäuresequenzen entsprechend des im Organismus verwendeten spezifischen "codon usage" zu verändern. Der "codon usage" lässt sich anhand von Computerauswertungen anderer, bekannter Gene des betreffenden Organismus leicht ermitteln.For an optimal Expression of heterologous genes in organisms, it is advantageous the nucleic acid sequences according to the specific "codon usage" used in the organism. The "codon usage" can be on the basis of computer evaluations of other, known genes of the concerned Easily detect organism.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit einer geeigneten kodierenden Nukleotidsequenz sowie einem Terminator- oder Polyadenylierungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstechniken, wie sie beispielsweise in T. Maniatis, E. F.Fritsch und J. Sambrook, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T. J. Silhavy, M. L. Berman und L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F. M. etal., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind.The Production of an expression cassette takes place by fusion of a suitable promoter with a suitable coding nucleotide sequence as well as a terminator or Polyadenylation signal. For this purpose, conventional recombination and cloning techniques are used, as described, for example, in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusion, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus, vorteilhaft in einen wirtsspezifischen Vektor insertiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen wer- den.The recombinant nucleic acid construct or Gene construct is expressed for expression in a suitable host organism, advantageously inserted into a host-specific vector which has a optimal expression of the genes in the host allows. Vectors are the specialist well known and can for example, from "Cloning Vectors "(Pouwels P.H. et al., Eds., Elsevier, Amsterdam-New York-Oxford, 1985) become.
Mit Hilfe der Vektoren sind rekombinante Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem Vektor transformiert sind und zur Produktion der erfindungsgemäß verwendeten Polypeptide eingesetzt werden können. Vorteilhafterweise werden die oben beschriebenen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektionsmethoden, wie beispielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Transfektion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielsweise in Current Protocols in Molecular Biology, F.Ausubel etal., Hrsg., Wiley Interscience, New York 1997, oder Sambrook et al. Molecular Cloning : A Laboratory Manual. 2. Aufl., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 beschrieben.With The vectors can be used to produce recombinant microorganisms. which transforms, for example, with at least one vector are used and for the production of the polypeptides used in the invention can be. Advantageously, the above-described recombinant constructs introduced and expressed in a suitable host system. there are preferably known in the art known cloning and transfection methods, such as co-precipitation, Protoplast fusion, electroporation, retroviral transfection and the like, used to bind said nucleic acids in respective expression system for expression. Suitable systems For example, in Current Protocols in Molecular Biology, F. Anubel et al., Ed., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
Es sind auch homolog rekombinierte Mikroorganismen herstellbar. Dazu wird ein Vektor hergestellt, der zumindest einen Abschnitt eines erfindungsgemäß zu verwendenden Gens oder einer kodierenden Sequenz enthält, worin gegebenenfalls wenigstens eine Aminosäure-Deletion, -Addition oder -Substitution eingebracht worden ist, um die Sequenz zu verändern, z. B. funktionell zu disruptieren ("Knockout"- Vektor). Die eingebrachte Sequenz kann z. B. auch ein Homologes aus einem verwandten Mikroorganismus sein oder aus einer Säugetier-, Hefe- oder Insektenquelle abgeleitet sein. Der zur homologen Rekombination verwendete Vektor kann alternativ derart ausgestaltet sein, dass das endogene Gen bei homologer Rekombination mutiert oder anderweitig verändert ist, jedoch noch das funktionelle Protein kodiert (z. B. kann der stromaufwärts gelegene regulatorische Bereich derart verändert sein, dass dadurch die Expression des endogenen Proteins verändert wird). Der veränderte Abschnitt des erfindungsgemäß verwendeten Gens ist im homologen Rekombinationsvektor. Die Konstruktion geeigneter Vektoren zur homologen Rekombination ist z. B. beschrieben in Thomas, K. R. und Capecchi, M. R. (1987) Cell 51 : 503.It Homologously recombined microorganisms can be produced. To For example, a vector is made that contains at least a portion of a to be used according to the invention Contains gene or a coding sequence, wherein optionally at least an amino acid deletion, Addition or substitution has been introduced to the sequence to change, z. B. functionally disrupted ("knockout" - vector). The introduced sequence can z. B. also be a homologue of a related microorganism or from a mammalian, yeast or insect source. The homologous recombination Alternatively, the vector used may be configured such that mutated or otherwise the endogenous gene upon homologous recombination changed but the functional protein is still encoded (eg upstream regulatory area so changed that the Expression of the endogenous protein is changed). The modified section of the invention used Gene is in the homologous recombination vector. The construction of suitable vectors for homologous recombination is z. As described in Thomas, K. R. and Capecchi, M.R. (1987) Cell 51: 503.
Als rekombinante Wirtsorganismen für die erfindungsgemäß verwendete Nukleinsäure oder dem Nukleinsäurekonstrukt kommen prinzipiell alle prokaryontischen oder eukaryontischen Organismen in Frage. Vorteilhafterweise werden als Wirtsorganismen Mikroorganismen wie Bakterien, Pilze oder Hefen verwendet. Vorteilhaft werden grampositive oder gram-negative Bakterien, bevorzugt Bakterien der Familien Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae oder Nocardiaceae, besonders bevorzugt Bakterien der Gattungen Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium oder Rhodococcus verwendet.When recombinant host organisms for the invention used nucleic acid or the nucleic acid construct come in principle all prokaryotic or eukaryotic organisms in Question. Advantageously, microorganisms are used as host organisms like bacteria, fungi or yeasts used. Advantageous are gram-positive or gram-negative bacteria, preferably bacteria of the family Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferred bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus used.
Die im Herstellverfahren für Fusionsproteine verwendeten Organismen werden je nach Wirtsorganismus in dem Fachmann bekannter Weise angezogen bzw. gezüchtet. Mikroorganismen werden in der Regel in einem flüssigen Medium, das eine Kohlenstoff quelle meist in Form von Zuckern, eine Stickstoffquelle meist in Form von organischen Stickstoffquellen wie Hefeextrakt oder Salzen wie Ammoniumsulfat, Spurenelemente wie Eisen-, Mangan- und Magnesiumsalze sowie gegebenenfalls Vitamine enthält, bei Temperaturen zwischen 0 und 100°C, bevorzugt zwischen 10 bis 60°C unter Sauerstoffbegasung angezogen. Dabei kann der pH-Wert der Nährflüssigkeit auf einem festen Wert gehalten werden, das heißt während der Anzucht reguliert werden oder nicht. Die Anzucht kann "batch"-weise, "semi-batch"-weise oder kontinuierlich erfolgen. Nährstoffe können zu Beginn der Fermentation vorgelegt oder semikontinuierlich oder kontinuierlich nachgefüttert werden. Die Enzyme können nach dem in den Beispielen beschriebenen Verfahren aus den Organismen isoliert werden oder als Rohextrakt für die Reaktion verwendet werden.The organisms used in the production process for fusion proteins are grown or bred, depending on the host organism, in a manner known to those skilled in the art. Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins Temperatures between 0 and 100 ° C, preferably between 10 to 60 ° C attracted under oxygen fumigation. In this case, the pH of the nutrient be kept at a fixed value, that is regulated during the breeding or not. The cultivation can be done batchwise, semi-batchwise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously. The enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.
Die erfindungsgemäß verwendeten Polypeptide oder funktionelle, biologisch aktive Fragmente davon können mittels eines rekombinanten Verfahrens hergestellt werden, bei dem man einen Polypeptide-produzierenden Mikroorganismus kultiviert, gegebenenfalls die Expression der Polypeptide induziert und diese aus der Kultur isoliert. Die Polypeptide können so auch in großtechnischem Maßstab produziert werden, falls dies erwünscht ist. Der rekombinante Mikroorganismus kann nach bekannten Verfahren kultiviert und fermentiert werden. Bakterien können beispielsweise in TB-oder LB-Medium und bei einer Temperatur von 20 bis 40°C und einem pH-Wert von 6 bis 9 vermehrt werden. Im Einzelnen werden geeignete Kultivierungsbedingungen beispielsweise in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) beschrieben.The used according to the invention Polypeptides or functional, biologically active fragments thereof can be prepared by a recombinant process in which to cultivate a polypeptide-producing microorganism, optionally induces the expression of the polypeptides and these isolated from the culture. The polypeptides can thus also in large-scale scale produced if desired. The recombinant Microorganism can be cultured and fermented by known methods become. Bacteria can for example in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9 be increased. Specifically, suitable cultivation conditions for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).
Die Zellen werden dann, falls die Polypeptide nicht in das Kulturmedium sezerniert werden, aufgeschlossen und das Produkt nach bekannten Proteinisolierungsverfahren aus dem Lysat gewonnen. Die Zellen können wahlweise durch hochfrequenten Ultraschall, durch hohen Druck, wie z. B. in einer French-Druckzelle, durch Osmolyse, durch Einwirkung von Detergenzien, lytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren aufgeschlossen werden.The Cells then become, if the polypeptides are not in the culture medium be secreted, open-minded and the product according to known Protein isolation method recovered from the lysate. The cells can optionally by high-frequency ultrasound, by high pressure, such. In a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or digested by combining several of the listed methods become.
Eine Aufreinigung der Polypeptide kann mit bekannten, chromatographischen Verfahren erzielt werden, wie Molekularsieb-Chromatographie (Gelfiltration), wie Q-Sepharose-Chromatographie, Ionenaustausch-Chromatographie und hydrophobe Chromatographie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristallisation, Aussalzen, Dialyse und nativer Gelelektrophorese. Geeignete Verfahren werden beispielsweise in Cooper, F. G., Biochemische Arbeitsmethoden, Verlag Water de Gruyter, Berlin, New York oder in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin beschrieben.A Purification of the polypeptides can be carried out by known, chromatographic Be achieved, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as other common ones Methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are, for example in Cooper, F.G., Biochemical Working Methods, Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Publisher, New York, Heidelberg, Berlin.
Vorteilhaft kann es sein, zur Isolierung des rekombinanten Proteins Vektorsysteme oder Oligonukleotide zu verwenden, die die cDNA um bestimmte Nukleotidsequenzen verlängern und damit für veränderte Polypeptide oder Fusionsproteine kodieren, die beispielsweise einer einfacheren Reinigung dienen. Derartige geeignete Modifikationen umfassen als Anker fungierende sogenannte "Tags", wie beispielsweise die als Hexa-Histidin-Anker bekannte Modifikation oder Epitope, die als Antigene von Antikörpern erkannt werden können (beschrieben zum Beispiel in Harlow, E. and Lane, D., 1988, Antibodies : A Laboratory Manual. Cold Spring Harbor (N. Y.) Press). Weitere geeignete Tags sind z.B. HA, Calmodulin-BD, GST, MBD; Chitin-BD, Steptavidin-BD-Avi-Tag, Flag-Tag, T7 etc. Diese Anker können zur Anheftung der Proteine an einen festen Träger, wie z. B. einer Polymermatrix, dienen, die beispielsweise in einer Chromatographiesäule eingefüllt sein kann, oder an einer Mikrotiterplatte oder an einem sonstigen Träger verwendet werden kann. Die entsprechenden Reinigungsprotokolle sind von den kommerziellen Affinitäts-Tag-Anbietern erhältlich.Advantageous it may be to isolate the recombinant protein vector systems or oligonucleotides that encode the cDNA for particular nucleotide sequences extend and for that changed Polypeptides or fusion proteins encode, for example, a serve easier cleaning. Such suitable modifications include anchors that act as anchors, such as the hexa-histidine anchor known modification or epitopes recognized as antigens of antibodies can be (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (N.Y.) Press). Further suitable tags are e.g. HA, calmodulin BD, GST, MBD; Chitin-BD, Streptavidin-BD-Avi-tag, Flag tag, T7 etc. These anchors can for attaching the proteins to a solid support, such as. B. a polymer matrix, serve, for example, be filled in a chromatography column can be used, or on a microtiter plate or on another carrier can be. The corresponding purification protocols are from the commercial Affinity tag suppliers available.
Die wie beschrieben hergestellten Proteine können sowohl direkt als Fusionsproteine als auch nach Abspaltung und Abtrennung des Fusionspartners als „reine" Hydrophobine verwendet werden.The Proteins produced as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner used as "pure" hydrophobins become.
Wenn eine Abtrennung des Fusionspartners vorgesehen ist, empfiehlt es sich eine potentielle Spaltstelle (spezifische Erkennungsstelle für Proteasen) in das Fusionsprotein zwischen Hydrophobinteil und Fusionspartnerteil einzubauen. Als Spaltstelle geeignet sind insbesondere solche Peptidsequenzen geeignet, die ansonsten weder im Hydrophobinteil noch im Fusionspartnerteil vorkommen, was sich mit bioinformatischen Tools leicht ermitteln lässt. Besonders geeignet sind beispielsweise BrCN-Spaltung an Methionin, oder durch Protease vermittelte Spaltlung mit Faktor Xa-, Enterokinase-, Thrombin, TEV-Spaltung (Tobacca etch virus Protease).If a separation of the fusion partner is provided, it recommends a potential cleavage site (specific recognition site for proteases) into the fusion protein between hydrophobin part and fusion partner part install. Particularly suitable cleavage sites are those peptide sequences which are suitable, otherwise neither in the hydrophobin part nor in the fusion partner part what can easily be determined with bioinformatic tools leaves. Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, Thrombin, TEV cleavage (Tobacca etch virus protease).
Zur erfindungsgemäßen Verwendung von Hydrophobinen zur schmutzabweisenden Behandlung von harten Oberflächen können die Hydrophobine auch in Substanz verwendet werden. Bevorzugt werden die Hydrophobine aber als Formulierungen bzw. Zusammensetzungen in mindestens einem geeigneten Lösemittel eingesetzt.to use according to the invention of hydrophobins for stain-resistant treatment of hard surfaces, the Hydrophobins can also be used in bulk. To be favoured but the hydrophobins as formulations or compositions in at least one suitable solvent used.
Die Auswahl der Hydrophobine zur Ausführung der Erfindung ist nicht beschränkt. Es können ein Hydrophobin oder auch mehrere verschiedene eingesetzt werden. Der Fachmann trifft eine geeignete Auswahl. Beispielsweise können Fusionsproteine, wie beispielsweise yaad-Xa-dewA-his (SEQ ID NO: 19) oder yaad-Xa-rodA-his (SEQ ID NO: 21) eingesetzt werden.The Selection of hydrophobins for carrying out the invention is not limited. It can be Hydrophobin or several different can be used. Of the Professional makes a suitable choice. For example, fusion proteins, such as for example, yaad-Xa-dewA-his (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21) are used.
Bei den Lösemitteln für Formulierungen kann es sich um Wasser und/oder organische Lösemittel handeln. Selbstverständlich können auch Lösemittelgemische eingesetzt werden. Die Art des Lösemittels richtet sich nach dem Hydrophobin, der Art der zu be handelnden Oberfläche sowie der Anwendung und wird vom Fachmann entsprechend gewählt. Für Haushaltsanwendungen werden im Allgemeinen Wasser oder wässrige Formulierungen bevorzugt. Bei Industrieanwendungen kommen sowohl wässrige wie auch nichtwässrige Formulierungen in Frage.The solvents for formulations may be water and / or organic solvents. Of course, solvents can also be used mixtures are used. The type of solvent depends on the hydrophobin, the type of surface to be treated and the application and is selected accordingly by the expert. For household applications, water or aqueous formulations are generally preferred. In industrial applications, both aqueous and non-aqueous formulations come into question.
Bevorzugt handelt es sich bei dem Lösemittel um Wasser oder Gemische aus Wasser und mit Wasser mischbaren, organischen Lösemitteln. Beispiele derartiger organischer Lösemittel umfassen mit Wasser mischbare einwertige oder mehrwertige Alkohole, wie beispielsweise Methanol, Ethanol, n-Propanol, i-Propanol, Ethylenglykol, Propylenglykol oder Glycerin. Weiterhin kann es sich auch um Etheralkohole handeln. Beispiele umfassen Monoalkylether von (Poly)ethylen- oder (Poly)propylenglykolen wie Ethylenglykolmonobutylether. Art und Menge der wasserlöslichen, organischen Lösemittel werden vom Fachmann gewählt.Prefers it is the solvent to water or mixtures of water and water-miscible, organic Solvents. Examples of such organic solvents include with water miscible monohydric or polyhydric alcohols, such as Methanol, ethanol, n-propanol, i-propanol, ethylene glycol, propylene glycol or glycerin. Furthermore, it may also be ether alcohols. Examples include monoalkyl ethers of (poly) ethylene or (poly) propylene glycols such as ethylene glycol monobutyl ether. Type and amount of water-soluble, organic solvents are chosen by the expert.
Zur Herstellung der erfindungsgemäß verwendeten Zusammensetzung können bevorzugt die bei der Synthese, Isolierung und/oder Reinigung der Hydrophobine erhaltenen wässrigen Lösungen der Hydrophobine eingesetzt werden. Diese können je nach Reinheit noch Reste von Hilfsstoffen aus der Synthese enthalten. Selbstverständlich können die Hydrophobine aber auch zunächst als Substanz isoliert werden, beispielsweise durch Gefriertrocknen, und erst in einem zweiten Schritt formuliert werden.to Preparation of the invention used Composition can preferred in the synthesis, isolation and / or purification of the hydrophobins obtained aqueous solutions the hydrophobins are used. These may still depending on the purity Contain residues of excipients from the synthesis. Of course, the hydrophobins can but also first be isolated as a substance, for example by freeze-drying, and be formulated in a second step.
Die Menge der Hydrophobine in der Formulierung kann vom Fachmann je nach der Art der Oberfläche und/oder der Anwendung bestimmt werden. Es sind aber schon relativ kleine Mengen ausreichend, um eine schmutzabweisende Wirkung zu erzielen. Bewährt hat sich eine Menge von 0,0001 bis 1 Gew. % bezüglich der Summe aller Bestandteile der Formulierung, ohne dass die Erfindung damit auf diesen Bereich beschränkt sein soll. Bevorzugt beträgt die Menge von 0,0005 bis 0,5 Gew. % und besonders bevorzugt 0,001 bis 0,1 Gew. %.The The amount of hydrophobins in the formulation can be determined by those skilled in the art according to the type of surface and / or the application. But they are already relative small quantities sufficient to have a dirt repellent effect achieve. proven has a quantity of 0.0001 to 1 wt.% with respect to the sum of all components of the Formulation, without the invention being limited to this area should. Preferred is the amount of 0.0005 to 0.5% by weight, and more preferably 0.001 to 0.1% by weight.
Bevorzugt handelt es sich bei der verwendeten Zusammensetzung um ein Reinigungsmittel, wie beispielsweise Glasreiniger, Fußbodenreiniger, Allzweckreiniger, Badreiniger, Klarspüler, Geschirrspülmittel zur Hand- oder Maschinenreinigung von Geschirr, Maschinenreiniger, Metallentfetter, Hochdruckreiniger, alkalische Reiniger, saure Reiniger, Spitzenentfetter oder Molkereireiniger. Das erfindungsgemäße Reinigungsmittel umfasst neben einem Lösemittel und mindestens einem Hydrophobin in prinzipiell bekannter Art und Weise eines oder mehrere Tenside in wirksamen Mengen.Prefers if the composition used is a cleaning agent, such as glass cleaner, floor cleaner, all-purpose cleaner, Bathroom cleaner, rinse aid, Dishwashing liquid for manual or machine cleaning of dishes, machine cleaners, Metal degreaser, high pressure cleaner, alkaline cleaner, acid cleaner, top degreaser or dairy cleaner. The cleaning agent according to the invention comprises next to a solvent and at least one hydrophobin in a basically known manner and One or more surfactants in effective amounts.
Bei den Zusammensetzungen kann es sich auch um Vor- oder Nachbehandlungsmittel für harte Oberflächen, insbesondere für Glas, Keramik oder Fußböden handeln.at the compositions may also be pre- or post-treatment agents for hard surfaces, in particular for glass, Ceramics or floors act.
Bei den Tensiden kann es sich um anionische, nichtionische, amphotere und/oder kationische Tenside handeln. Derartige Tenside sowie deren jeweils bevorzugter Einsatzweck sind dem Fachmann prinzipiell bekannt.at The surfactants may be anionic, nonionic, amphoteric and / or cationic surfactants. Such surfactants and their each preferred use purpose are known in principle to those skilled in the art.
Beispiele anionischer Tenside umfassen Fettalkoholsulfate, Alkylethersulfate, Alkansulfonate, Alkylbenzolsulfonate oder Alkylphosphate. Es können die freien Säuren oder Salze davon eingesetzt werden.Examples anionic surfactants include fatty alcohol sulfates, alkyl ether sulfates, Alkanesulfonates, alkylbenzenesulfonates or alkyl phosphates. It can be the free acids or salts thereof.
Beispiele nichtionischer Tenside umfassen alkoxylierte C8-C22-Alkohole wie Fettalkoholalkoxylate oder Oxoalkoholalkoxylate, Alkylphenolethoxylate mit C6-C14-Alkylketten und 5 bis 30 Mol Ethylenoxideinheiten, Alkylpolyglucoside mit 8 bis 22 in der Alkylkette, Alkylaminalkoxylate oder Alkylamidethoxylate.Examples of nonionic surfactants include alkoxylated C 8 -C 22 alcohols, such as fatty alcohol alkoxylates or oxo alcohol alkoxylates, alkylphenol ethoxylates having C 6 -C 14 alkyl chains and from 5 to 30 moles of ethylene oxide units, alkyl polyglucosides having from 8 to 22 in the alkyl chain, alkylamine alkoxylates or alkylamide ethoxylates.
Beispiele amphoterer Tenside umfassen Alkylbetaine, Alkylamidbetaine, Aminopropionate, Aminoglycinate oder amphotere Imidazoliumverbindungen.Examples amphoteric surfactants include alkyl betaines, alkyl amide betaines, aminopropionates, Aminoglycinates or amphoteric imidazolium compounds.
Beispiele kationischer Tenside umfassen substituierte oder unsubstituierte, geradkettige oder verzweigte quartäre Ammoniumsalze, z.B. C8-5-Dialkyldimethylammoniumhalogenide, Dialkoxydimethylammoniumhalogenide oder Imidazoliumsalze mit langkettigem Alkylrest.Examples of cationic surfactants include substituted or unsubstituted, straight-chain or branched quaternary ammonium salts, for example C 8-5 dialkyldimethylammonium halides, dialkoxydimethylammonium halides or long-chain alkyl imidazolium salts.
Weitere Beispiele von Tensiden sind in DE-A 101 60 993, Abschnitten [0056] bis [0073] aufgeführt.Further Examples of surfactants are described in DE-A 101 60 993, Sections [0056] to [0073] listed.
Der Fachmann trifft hinsichtlich von Art und Menge der Tensiden eine geeignete Auswahl. Bewährt hat sich eine Menge von 0,01 bis 30 Gew. % Tenside bezüglich der Summe aller Komponenten der Formulierung.Of the The expert meets with regard to type and amount of surfactants one suitable selection. proven has an amount of 0.01 to 30 wt.% Surfactants with respect to Sum of all components of the formulation.
Die Formulierung kann optional darüber hinaus noch weitere Komponenten, beispielsweise Zusatzstoffe und/oder Hilfsmittel umfassen. Beispiele derartiger Komponenten umfassen Säuren oder Basen, beispielsweise Carbonäuren oder Ammoniak, Puffersysteme, Polymere, anorganische Partikel wie SiO2 oder Silikate, Farbstoffe, Duftstoffe oder Biozide. Weitere Beispiele von Zusatzstoffen sind in DE-A 101 60 993, insbesondere Abschnitte [0074] bis [0131] aufgeführt. Der Fachmann trifft hinsichtlich der Art und Menge zusätzlicher Komponenten je nach der Anwendung eine geeignete Auswahl.The formulation may optionally further comprise further components, for example additives and / or adjuvants. Examples of such components include acids or bases, for example, carboxylic acids or ammonia, buffer systems, polymers, inorganic particles such as SiO 2 or silicates, dyes, fragrances or biocides. Further examples of additives are listed in DE-A 101 60 993, in particular Sections [0074] to [0131]. The person skilled in the art makes a suitable choice with regard to the type and amount of additional components, depending on the application.
Erfindungsgemäß wird die schmutzabweisende Behandlung harter Oberflächen vorgenommen, indem man die harte Oberfläche mit einer Zusammensetzung umfassend mindestens ein Hydrophobin sowie mindestens ein Lösemittel in Kontakt bringt.According to the invention the dirt-repellent treatment of hard surfaces is vorgenom by bringing the hard surface into contact with a composition comprising at least one hydrophobin and at least one solvent.
Das „In-Kontakt-Bringen" richtet sich nach der Art des Gegenstandes. Es kann beispielsweise durch Besprühen, Spülen oder Wischen der Oberfläche mit der Zusammensetzung erfolgen oder auch durch Eintauchen des gesamten Gegenstandes in die Formulierung. Letzteres ist naturgemäß nur bei nicht eingebauten Gegenständen möglich. Die Behandlungsdauer wird vom Fachmann festgelegt. Sie kann wenige Sekunden bis zu mehreren Stunden dauern. Die Oberfläche kann nach der Behandlung zur Entfernung überschüssiger Behandlungslösung nachgespült werden, beispielsweise mit Wasser.The "bringing into contact" depends on the Type of object. It can, for example, by spraying, rinsing or Wipe the surface done with the composition or by dipping the entire article in the formulation. The latter is by nature only not built-in objects possible. The duration of treatment is determined by the person skilled in the art. She can do a few Seconds to several hours. The surface can rinsed after treatment to remove excess treatment solution, for example, with water.
Die schmutzabweisende Behandlung kann besonders vorteilhaft in Kombination mit einer Reinigung, d.h. im Zuge des eigentlichen Reinigungsvorganges selbst erfolgen. Hierzu wird ein Reinigungsmittel eingesetzt, welches wie oben beschrieben mindestens ein Hydrophobin, mindestens ein Tensid sowie mindestens ein Lösemittel umfasst.The Dirt-repellent treatment can be particularly beneficial in combination with a cleaning, i. in the course of the actual cleaning process yourself. For this purpose, a cleaning agent is used, which as described above, at least one hydrophobin, at least one Surfactant and at least one solvent includes.
Die Behandlung kann bei Temperaturen unterhalb von Raumtemperatur, bei Raumtemperatur oder bei erhöhten Temperaturen vorgenommen werden, beispielsweise bei 20 bis 100°C, bevorzugt 20 bis 60°C. Bevorzugt wird die Behandlung bei Temperaturen von nicht mehr als 30°C vorgenommen, insbesondere 20 bis 30°C.The Treatment may be at temperatures below room temperature, at Room temperature or at elevated Temperatures are made, for example at 20 to 100 ° C, preferably 20 to 60 ° C. Preferably, the treatment at temperatures of not more than 30 ° C, in particular 20 to 30 ° C.
Nach dem Behandeln mit der Zusammensetzung wird die behandelte Oberfläche getrocknet. Das Trocknen der behandelten Oberfläche kann, quasi von selbst, bei Raumtemperatur erfolgen, oder es kann auch bei erhöhten Temperaturen getrocknet werden.To When treated with the composition, the treated surface is dried. The drying of the treated surface can, as it were, at room temperature, or it can also be at elevated temperatures be dried.
An die Behandlung sowie ggf. das Trocknen der Oberfläche kann sich eine thermische Nachbehandlung der Oberfläche bei erhöhten Temperaturen, beispielsweise bei Temperaturen von bis zu 120°C anschließen. Die thermische Nachbehandlung kann natürlich auch kombiniert mit der Trocknung vorgenommen werden. Bevorzugt betragen die Temperaturen bei einer thermischen Nachbehandlung 30 bis 100°C, besonders bevorzugt 40 bis 80°C und beispielsweise 50 bis 70°C. Die Behandlungsdauer wird vom Fachmann festgelegt, sie kann beispielsweise von 1 min bis 10 h betragen.At the treatment and possibly the drying of the surface can a thermal treatment of the surface at elevated temperatures, for example at temperatures up to 120 ° C. The Of course, thermal aftertreatment can also be combined with the Drying be made. The temperatures are preferably at a thermal post-treatment 30 to 100 ° C, more preferably 40 to 80 ° C and for example 50 to 70 ° C. The duration of treatment is determined by the person skilled in the art; 1 min to 10 h.
Durch das erfindungsgemäße Verfahren ist eine harte Oberfläche erhältlich, die eine schmutzabweisende, mindestens ein Hydrophobin umfassende Beschichtung aufweist. Bei der Beschichtung handelt es sich in der Regel mindestens um eine monomolekulare Schicht des Hydrophobins auf der Oberfläche.By the inventive method is a hard surface available, the one dirt-repellent coating comprising at least one hydrophobin having. The coating is usually at least around a monomolecular layer of hydrophobin on the surface.
Die schmutzabweisende Wirkung kann mittels prinzipiell bekannter Methoden bestimmt werden, beispielsweise, indem man die Ablösbarkeit von Schmutz durch Abspülen mit Wasser von einer unbehandelten und einer mit Hydrophobinen behandelten Oberfläche vergleicht.The Dirt-repellent effect can be achieved by methods known in principle be determined, for example, by removing the detachability from dirt by rinsing off with water from an untreated and a hydrophobin treated surface.
Die Hydrophobine weisen bereits in geringen Mengen eine deutliche Wirkung auf. Bereits die Behandlung mit einer nur 0,01 Gew. % Hydrophobine enthaltenden Zusammensetzung führt zu einer deutlich verbesserten Schmutzablösung.The Hydrophobins have a clear effect even in small amounts on. Already the treatment with only 0.01 wt.% Hydrophobins containing Composition leads to a significantly improved soil removal.
Die erfindungsgemäße, schmutzabweisende Behandlung eignet sich besonders vorteilhaft für keramische Oberflächen, wie beispielsweise für Fliesen. Hier kann über die schmutzabweisende Wirkung hinaus durch die Behandlung auch noch eine deutliche Hydrophobierung der Oberfläche erreicht werden. Dies ist insbesondere in Feuchträumen, wie beispielsweise Badezimmern ein weiterer Vorteil.The inventive, dirt-repellent treatment is particularly advantageous for ceramic surfaces, such as for example Tiles. Here can over the dirt-repellent effect also through the treatment a significant hydrophobization of the surface can be achieved. This is especially in wet rooms, such as bathrooms another advantage.
Die folgenden Beispiele sollen die Erfindung näher erläutern:The The following examples are intended to explain the invention in more detail:
Teil A:Part A:
Herstellung und Test der erfindungsgemäß verwendeten Hydrophobinemanufacturing and test of the invention used hydrophobins
Beispiel 1example 1
Vorarbeiten für die Klonierung von yaad-His6/yaaE-His6 Preliminary work for the cloning of yaad-His 6 / yaaE-His 6
Mit
Hilfe der Oligonukleotide Hal570 und Hal571 (Hal 572/Hal 573) wurde
eine Polymerase Kettenreaktion durchgeführt. Als Template DNA wurde
genomische DNA des Bakteriums Bacillus subtilis verwendet. Das erhaltene
PCR Fragment enthielt die codierende Sequenz des Gens yaaD/yaaE
aus Bacillus subtilis, und an den Enden je eine NcoI bzw. BgIII Restriktionsschnittstelle.
Das PCR Fragment wurde gereinigt und mit den Restriktionsendonukleasen NcoI
und BgIII geschnitten. Dieses DNA Fragment wurde als Insert verwendet,
und in den zuvor mit den Restriktionsendonukleasen NcoI und BgIII
linearisierten Vektor pQE60 der Firma Qiagen kloniert. Die so enstandenen
Vektoren pQE60YAAD#2/pQE60YaaE#5 können zur Expression von Proteinen
bestehend aus, YAAD::HIS6 bzw. YAAE::HIS6 verwendet werden.
Hal570: gcgcgcccatggctcaaacaggtactga
Hal571:
gcagatctccagccgcgttcttgcatac
Hal572: ggccatgggattaacaataggtgtactagg
Hal573:
gcagatcttacaagtgccttttgcttatattccUsing the oligonucleotides Hal570 and Hal571 (Hal 572 / Hal 573), a polymerase chain reaction was carried out. As template DNA genomic DNA of the bacterium Bacillus subtilis was used. The PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site. The PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII. This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BgIII. The resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS 6 and YAAE :: HIS 6 , respectively.
Hal570: gcgcgcccatggctcaaacaggtactga
Hal571: gcagatctccagccgcgttcttgcatac
Hal572: ggccatgggattaacaataggtgtactagg
Hal573: gcagatcttacaagtgccttttgcttatattcc
Beispiel 2Example 2
Klonierung von yaad-Hydrophobin DewA-His6 Cloning of yaad hydrophobin DewA-His 6
Mit Hilfe der Oligonukleotide KaM 416 und KaM 417 wurde eine Polymerase Kettenreaktion durchgeführt. Als Template DNA wurde genomische DNA des Schimmelpilzes Aspergillus nidulans verwendet. Das erhaltene PCR Fragment enthielt die codierende Sequenz des Hydrophobin Gens dewA und einer N-Terminalen FaktorXa Proteinase Schnittstelle. Das PCR Fragment wurde gereinigt und mit der Restriktionsendonuklea se BamHI geschnitten. Dieses DNA Fragment wurde als Insert verwendet, und in den zuvor mit der Restriktionsendonuklease BgIII linearisierten Vektor pQE60YAAD#2 kloniert.With The oligonucleotides KaM 416 and KaM 417 became a polymerase Chain reaction performed. The template DNA was genomic DNA of the mold Aspergillus used nidulans. The resulting PCR fragment contained the coding Sequence of the hydrophobin gene dewA and an N-terminal factor Xa Proteinase interface. The PCR fragment was purified and washed with the restriction endonuclease se BamHI cut. This DNA fragment was used as an insert, and previously with the restriction endonuclease BglII linearized vector pQE60YAAD # 2 cloned.
Der
so enstandene Vektor #508 kann zur Expressions eines Fusionsproteins
bestehend aus, YAAD::Xa::dewA::HIS6 verwendet
werden.
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
KaM417:
CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGCThe resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS 6 .
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
Beispiel 3Example 3
Klonierunq von yaad-Hydrophobin RodA-His6 Cloning of yaad hydrophobin RodA-His 6
Die
Klonierung des Plasmids #513 erfolgte analog zu Plasmid #508 unter
Verwendung der Oligonukleotide KaM 434 und KaM 435.
KaM434:
GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC
KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGGThe cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC
KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG
Beispiel 4Example 4
Klonierung von yaad-Hydrophobin BASF1-His6 Cloning of yaad hydrophobin BASF1-His 6
Die Klonierung des Plasmids #507 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.The Cloning of plasmid # 507 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM 417 and KaM 418.
Als
Template DNA wurde ein künstlich
synthetisierte DNA Sequenz – Hydrophobin
BASF1 -eingesetzt (siehe Anhang).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG
C
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAGAs template DNA, an artificially synthesized DNA sequence - hydrophobin BASF1 - was used (see Appendix).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 5Example 5
Klonierung von yaad-Hydrophobin BASF2-His6 Cloning of yaad hydrophobin BASF2-His 6
Die Klonierung des Plasmids #506 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM 417 und KaM 418.The Cloning of plasmid # 506 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM 417 and KaM 418.
Als
Template DNA wurde ein künstlich
synthetisierte DNA Sequenz – Hydrophobin
BASF2 -eingesetzt (siehe Anhang).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
KaM418:
CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAGAs template DNA, an artificially synthesized DNA sequence - hydrophobin BASF2 - was used (see Appendix).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG
Beispiel 6Example 6
Klonierung von yaad-Hydrophobin SC3-His6 Cloning of yaad hydrophobin SC3-His 6
Die Klonierung des Plasmids #526 erfolgte analog zu Plasmid #508 unter Verwendung der Oligonukleotide KaM464 und KaM465.The Cloning of plasmid # 526 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM464 and KaM465.
Als
Template DNA wurde cDNA von Schyzophyllum commune eingesetzt (siehe
Anhang).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
KaM465:
GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGTThe template DNA used was Schyzophyllum commune cDNA (see Appendix).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT
Beispiel 7Example 7
Fermentation des rekombinanten E.coli Stammes yaad-Hydrophobin DewA-His6 Fermentation of the recombinant E. coli strain yaad hydrophobin DewA-His 6
Inokulation von 3ml LB Flüssigmedium mit einem yaad-Hydrophobin DewA-His6 exprimierenden E.coli Stamm in 15ml Greiner Röhrchen. Inkubation für 8h bei 37°C auf einem Schüttler mit 200 UpM. Je 2 1l Erlenmeyer Kolben mit Schikanen und 250ml LB Medium (+ 100μg/ml Ampicillin) werden mit jeweils 1 ml der Vorkultur angeimpft und 9h bei 37°C auf einem Schüttler mit 180 UpM inkubiert.Inoculation of 3ml LB liquid medium with a yaad-hydrophobin DewA-His 6 expressing E. coli strain in 15ml Greiner tubes. Incubate for 8 h at 37 ° C on a shaker at 200 rpm. 2 1 l Erlenmeyer flasks with baffles and 250 ml LB medium (+ 100 μg / ml ampicillin) are each inoculated with 1 ml of preculture and incubated for 9 h at 37 ° C. on a shaker at 180 rpm.
13.5l LB-Medium (+100μg/ml Ampicillin) in einem 20l Fermenter mit 0,5l Vorkultur (OD600nm 1:10 gegen H2O gemessen) animpfen. Bei einer OD60nm von ~3.5 Zugabe von 140ml 100mM IPTG. Nach 3h Fermenter auf 10°C abkühlen und Fermentationsbrühe abzentrifugieren. Zellpellet zur weiteren Aufreinigung verwenden.13.5 l LB medium (+ 100 μg / ml ampicillin) in a 20 l fermenter with 0.5 l preculture (OD 600nm 1:10 measured against H 2 O). At an OD 60nm of ~ 3.5 add 140ml 100mM IPTG. After 3 h fermenter, cool to 10 ° C and centrifuge the fermentation broth. Use cell pellet for further purification.
Beispiel 8Example 8
Reinigung des rekombinanten Hydrohobin-FusionsproteinsPurification of the recombinant Hydrophobin Fusion Protein
- (Reinigung von Hydrophobin-Fusionsproteinen, die ein C-terminales His6-tag besitzen)(Purification of hydrophobin fusion proteins containing a C-terminal Own His6 tag)
100
g Zellpellet (100 – 500
mg Hydrophobin) werden mit 50 mM Natriumphosphatpuffer, pH 7,5 auf
200 ml Gesamtvolumen aufgefüllt
und resuspendiert. Die Suspension wird mit einem Ultraturrax Typ T25
(Janke und Kunkel; IKA-Labortechnik) für 10 Minuten behandelt und
anschliessend für
1 Stunde bei Raumtemperatur mit 500 Einheiten Benzonase (Merck,
Darmstadt; Best.-Nr. 1.01697.0001) zum Abbau der Nukleinsäuren inkubiert.
Vor dem Zellaufschluss wird mit einer Glaskartusche (P1) filtriert.
Zum Zellaufschluß und
für das
Scheren der restlichen genomischen DNA werden zwei Homogenisatorläufe bei 1.500
bar durchgeführt
(Microfluidizer M-110EH; Microfluidics Corp.). Das Homogenisat wird
zentrifugiert (Sorvall RC-5B, GSA-Rotor, 250 ml Zentrifugenbecher,
60 Minuten, 4°C,
12.000 Upm, 23.000 g), der Überstand
auf Eis gestellt und das Pellet in 100 ml Natriumphosphatpuffer,
pH 7,5 resuspendiert. Zentrifugation und Resuspendieren werden dreimal
wiederholt, wobei der Natriumphosphatpuffer bei der dritten Wiederholung
1 % SDS enthält.
Nach der Resuspension wird für
eine Stunde gerührt
und eine abschliessende Zentrifugation durchgeführt (Sorvall RC-5B, GSA-Rotor, 250 ml Zentrifugenbecher,
60 Minuten, 4°C,
12.000 Upm, 23.000 g). Gemäß SDS-PAGE
Analyse ist das Hydrophobin nach der abschliessenden Zentrifugation
im Überstand
enthalten (
- Spur 1: Auftrag Nickel-Sepharose Säule (1:10 Verdünnung)
- Spur 2: Durchlauf = Eluat Waschschritt
- Spuren 3-5: OD 280 Maxima der Elutionsfraktionen
- Lane 1: Order nickel-Sepharose column (1:10 dilution)
- Lane 2: run = eluate wash step
- Lanes 3-5: OD 280 maxima of the elution fractions
Das
Hydrophobin der
Beispiel 9Example 9
Technische Prüfung; Charakterisierung des Hydrophobins durch Kontaktwinkeländerung eines Wassertropfens auf GlasTechnical exam; characterization of the hydrophobin by changing the contact angle of a water drop on glass
Substrat:substrate:
- Glas (Fensterglas, Süddeutsche Glas, Mannheim):Glass (window glass, South German Glass, Mannheim):
- Konzentration Hydrophobin: 100 μg/mLConcentration of hydrophobin: 100 μg / mL
- Inkubation von Glasplättchen über Nacht (Temperatur 80°C) in 50mM Na-Acetat pH 4 + 0,1 % Tween 20 danach Beschichtung waschen in destilliertem Wasser danach Inkubation 10min/80°C/1% SDS-Lösung in dest. Wasser Waschen in dest. WasserIncubation of glass slides overnight (Temperature 80 ° C) in 50 mM Na acetate pH 4 + 0.1% Tween 20 after that coating wash in distilled water then incubate for 10 min / 80 ° C / 1% SDS solution in dist. water Washing in dist. water
Die Proben werden an der Luft getrocknet und der Kontaktwinkel (in Grad) eines Tropfens von 5 μl Wasser bestimmt.The Samples are dried in air and the contact angle (in degrees) a drop of 5 μl Water determines.
Die Kontaktwinkelmessung wurde auf einem Gerät Dataphysics Contact Angle System OCA 15+, Software SCA 20.2.0. (November 2002) bestimmt. Die Messung erfolgte gemäss den Herstellerangaben.The Contact angle measurement was done on a Dataphysics Contact Angle device System OCA 15+, Software SCA 20.2.0. (November 2002). The Measurement was carried out according to the manufacturer's information.
Unbehandeltes Glas ergab einen Kontaktwinkel von 30 ± 5°; eine Beschichtung mit dem funktionellen Hydrophobin gemäss Beispiel 8 (yaad-dewA-his6) ergab Kontaktwinkel von 75 ± 5°.Untreated glass gave a contact angle of 30 ± 5 °; a coating with the functional hydrophobin according to Example 8 (yaad-dewA-his 6 ) gave contact angles of 75 ± 5 °.
Teil B:Part B:
Verwendung der Hydrophobine zur schmutzabweisenden Beschichtung von harten Oberflächenuse hydrophobins for dirt-repellent coating of hard surfaces
Verwendete Lösung:Used solution:
Für die anwendungstechnischen Versuche wurde eine Lösung des gemäß Beispiel 8 hergestellten Fusionsproteines yaad-Xa-dewA-his (SEQ ID NO: 19) in Wasser eingesetzt. Konzentration des Hydrophobins in Lösung: 100 μg/ml (0,01 Gew. %).For the application technology Attempts became a solution of the example 8 produced fusion protein yaad-Xa-dewA-his (SEQ ID NO: 19) used in water. Concentration of hydrophobin in solution: 100 μg / ml (0.01 Weight%).
Verwendete harte Oberfläche:Hard surface used:
Keramikfliese, weiss glänzend, 10 cm × 15 cm (Fa. Novocker), mit Ethanol und Wasser abgewischt.Ceramic tile, White shiny, 10 cm × 15 cm (Novocker), wiped with ethanol and water.
Verwendeter Schmutz:Used dirt:
Für die Tests wurde IKW-Ballastschmutz verwendet (gemäß Seifen, Fette, Öle, Wachse (SÖFW) -Journal, 124. Jg., 14/98, S. 1029)For the tests IKW ballast dirt was used (according to soaps, fats, oils, waxes (SÖFW) Journal, 124.Jg., 14/98, p. 1029)
Durchführung der BehandlungCarrying out the treatment
Auf eine Fliese wurden 2 g der oben erwähnten, wässrigen Hydrophobinlösung mit einer Konzentration von 100 μg/ml aufgetropft (1,3 μm Hydrophobin/cm2) und mit einem Tuch leicht verrieben, so dass die gesamte Oberfläche bedeckt war. Die Fliese wurde daraufhin liegend für 24 h an Luft getrocknet.On a tile, 2 g of the above-mentioned aqueous hydrophobin solution having a concentration of 100 μg / ml was dropped (1.3 μm hydrophobin / cm 2 ) and gently rubbed with a cloth so that the entire surface was covered. The tile was then dried lying for 24 h in air.
Anschließend wurde die Fliese mit Wasser abgespült und für 3 × 10 min in ein Becherglas mit Wasser gestellt. Für jedes Spülen wurde frisches Wasser verwendet. Die Fliese wurde dann stehend an Luft getrocknet.Subsequently was rinsed the tile with water and for 3 × 10 min in a beaker with water. Fresh water was used for each rinse. The tile was then dried standing in air.
Kontaktwinkelmessung und schmutzabweisende WirkungContact Angle Measurement and dirt-repellent effect
Auf der behandelten Fliese wurde mit einem Wassertropfen ein Kontaktwinkel von 56° gemessen (Mittelwert aus 10 Messungen). Eine unbehandelte Fliese im Vergleich zeigt einen Kontaktwinkel von 20°. Die Fliese wurde also deutlich hydrophobiert.On The treated tile became a contact angle with a drop of water measured from 56 ° (mean from 10 measurements). An untreated tile in comparison shows one Contact angle of 20 °. The tile was so clearly hydrophobic.
Auf die behandelte Fliese und zum Vergleich auch auf eine unbehandelte wurden mit einer Transferpipette jeweils 50, 100 und 200 μg IKW-Ballastschmutz punktförmig aufgetragen und für eine h bei Raumtemperatur getrocknet.On the treated tile and for comparison also on an untreated In each case 50, 100 and 200 μg of IKW ballast soil were removed with a transfer pipette punctual applied and for dried for one h at room temperature.
Die Fliesen wurden dann 3 × mit jeweils 500 ml Wasser gespült. Während sich von der unbehandelten Oberfläche der Schmutz dabei nicht ablöste, konnte von der mit Hydrophobin vorbehandelten Kachel eine teilweise Schmutzablösung beobachtet werden.The Tiles were then 3 times with each rinsed 500 ml of water. While Not dirt from the untreated surface could replace Partial soil release from the hydrophobin pretreated tile is observed.
Die Vorbehandlung mit Hydrophobin führte somit zu einer geringeren Schmutzhaftung.The Pretreatment with hydrophobin thus resulted to a lower dirt adhesion.
Es folgt ein Sequenzprotokoll nach WIPO St. 25.It follows a sequence listing according to WIPO St. 25. Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.This can from the official publication platform downloaded from the DPMA.
Claims (13)
Priority Applications (12)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE200510036341 DE102005036341A1 (en) | 2005-07-29 | 2005-07-29 | Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses |
CA002602155A CA2602155A1 (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
JP2008503492A JP5064376B2 (en) | 2005-03-30 | 2006-03-27 | How to use hydrophobin for antifouling treatment of hard surfaces |
BRPI0609541-0A BRPI0609541A2 (en) | 2005-03-30 | 2006-03-27 | use of hydrophobins, process for treating hard surfaces to repel dirt, cleaning agent, and hard surface |
US11/887,129 US20090305930A1 (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
PCT/EP2006/061069 WO2006103215A1 (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
DE502006007963T DE502006007963D1 (en) | 2005-03-30 | 2006-03-27 | USE OF HYDROPHOBINS FOR DIRT-TREATMENT TREATMENT OF HARD SURFACES |
MX2007012023A MX2007012023A (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment. |
AT06725335T ATE483009T1 (en) | 2005-03-30 | 2006-03-27 | USE OF HYDROPHOBINS FOR THE DIRT-REPELLENT TREATMENT OF HARD SURFACES |
EP06725335A EP1866401B1 (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
CN200680009940.0A CN101151359B (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
KR1020077023724A KR101250067B1 (en) | 2005-03-30 | 2006-03-27 | Use of hydrophobin for hard surface soil-repellent treatment |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE200510036341 DE102005036341A1 (en) | 2005-07-29 | 2005-07-29 | Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses |
Publications (1)
Publication Number | Publication Date |
---|---|
DE102005036341A1 true DE102005036341A1 (en) | 2007-02-01 |
Family
ID=37650410
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DE200510036341 Withdrawn DE102005036341A1 (en) | 2005-03-30 | 2005-07-29 | Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses |
Country Status (1)
Country | Link |
---|---|
DE (1) | DE102005036341A1 (en) |
-
2005
- 2005-07-29 DE DE200510036341 patent/DE102005036341A1/en not_active Withdrawn
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1866401B1 (en) | Use of hydrophobin for hard surface soil-repellent treatment | |
EP1866106B1 (en) | Use of hydrophobins for the surface treatment of hardened mineral building materials, natural stone, artificial stone and ceramics | |
EP1913123B1 (en) | Use of surface-active non-enzymatic proteins for washing textiles | |
EP1848733B1 (en) | Novel hydrophobin fusion products, production and use thereof | |
US20090117796A1 (en) | Method for coating fibre substrate surfaces | |
DE102005027139A1 (en) | New cysteine-depleted hydrophobin fusion proteins, their production and use | |
EP1848734A2 (en) | Method for coating surfaces with hydrophobins | |
DE102005048720A1 (en) | Use of proteins as an antifoam component in fuels | |
EP1893675B9 (en) | Hydrophobin as a coating agent for expandable or expanded thermoplastic polymer particles | |
WO2006103252A2 (en) | Use of hydrophobin as a phase stabiliser | |
DE102005025969A1 (en) | Reduction of evaporation rate of water in an open water reservoir, comprises mixing of hydrophobin fusion protein with water and/or biodegradable barrier liquid having hydrocarbon mixture | |
DE102005015043A1 (en) | Multilayer compound or coated substrate for sandwich foils packaging, comprises hydrophobin polypeptide as an adhesive agent arranged between two adjacent layers of the multilayer compound or between the coating and the substrate | |
DE102005036341A1 (en) | Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses | |
DE102005014844A1 (en) | Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses | |
WO2012004255A1 (en) | Composition containing a hydrophobin and method for cleaning hydrophobic surfaces | |
DE102005036339A1 (en) | Use of hydrophobin for treating surfaces such as hardened mineral building materials, natural stones, artificial stones or ceramics | |
DE102005005737A1 (en) | New hydrophobin polypeptide not connected in normal manner with an external hydrophobin useful for coating of a glass surfaces | |
DE102005014843A1 (en) | Use of hydrophobin for treating surfaces such as hardened mineral building materials, natural stones, artificial stones or ceramics | |
DE102005051515A1 (en) | Coating surfaces with hydrophobins involves coating with hydrophobin in form of fusion hydrophobin and using formulation with pH value of greater than or equal to 4 | |
DE102005026143A1 (en) | Coating fibrous substrates with hydrophobins, useful for soil-repellant finishing of textiles and leather | |
DE102005030786A1 (en) | Method for coating of fibrous substrates such as textile and leather substrates, comprises coating the fibrous substrates by hydrophobin |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
8139 | Disposal/non-payment of the annual fee |