DE102005036341A1 - Use of hydrophobin for treating soil-repellent of hard surface e.g. tiles, floors, armatures, wash basin, showering tubs, bath tubs, toilets, shower cubicles, bathroom furniture, furniture, mirrors, table-ware, cutlery and glasses - Google Patents

Abstract

Use of hydrophobin for hard surface soil-repellent treatment. Independent claims are included for: (1) a method for hard surface soil-repellent treatment comprising contacting the surface with a composition the hydrophobin and the solvent; (2) cleaning agents for hard surfaces comprising at least one hydrophobin, at least one detergent and a solvent; and (3) a hard surface comprising soil-repellent coating, where the coating contains hydrophobin.

Description

The The present invention relates to the use of hydrophobins for dirt-repellent treatment of hard surfaces, in particular in combination with a surface cleaning, a procedure for dirt repellent Treatment of hard surfaces, Cleaning agent for hard surfaces as well as hard surfaces with a dirt-repellent, Hydrophobine coating.

It is known, hard surfaces, such as glass, ceramics or floors with dirt-repellent Coatings to provide. These equipments are said to have the dirt adhesion at least complicate the pollution of surfaces and facilitate subsequent cleanings. For example, fats, oils or lime residues should be lighter removable be, or it should be the appearance of dried traces of water during drainage be avoided by water.

in this connection it can be permanent, dirt-repellent coatings, for example to act on the lotus effect imitated coatings.

It but can also be a temporary protection. Such a, temporary dirt repellent Effect, for example, by substances in a cleaner formulation can be achieved, which are applied when cleaning the surface. basics Areas of application of such cleaners are household applications, like cleaner for the kitchen or sanitary area, but also industrial applications, such as cleaners for the Car wash.

EP-A 467,472 discloses a composition for increasing the hydrophilicity of hard Surfaces, for example, surfaces in the household, to facilitate cleaning in subsequent cleaning steps to reach. The formulation contains a water-soluble, ionic or nonionic polymer, for example a cationic one Polymer with quaternized ammonium alkyl methacrylate units. The disclosed detergent formulations contain 0.02 to 5 wt. % of the polymer.

WHERE 03/002620 discloses the use of (meth) acrylic acid dialkylaminoalkyl esters as soil-release polymers for hard surfaces, For example, fine stone floors or stainless steel surfaces. The disclosed detergent formulations contain from 0.1 to 5 wt. % of the polymer.

DE-A 100 61 897 discloses detergents containing hydrophilic, silicate-containing Particles that contribute to improved soil release Simultaneous reduction of re-soiling. The Particles are deposited on the surface of the substances to be cleaned and change so the surface properties.

hydrophobins are small proteins of about 100 to 150 amino acids that are characteristic for filamentous mushrooms, for example, Schizophyllum commune. They point in all Rule 8 cysteine units on.

hydrophobins have a pronounced affinity to interfaces and are therefore suitable for coating surfaces. So let yourself For example, Teflon using hydrophobins to obtain a hydrophilic surface coat.

hydrophobins can from natural Sources are isolated. It can but of course not occurring hydrophobins by means of chemical and / or biotechnological Manufacturing process can be synthesized. Our older application DE 102005007480.4 discloses a preparation process for hydrophobins that are not in of nature.

in the The state of the art is the use of hydrophobins for various purposes Applications have been proposed.

WHERE 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active Substances for Hydrophilizing Hydrophobic Surfaces Improvement of water resistance hydrophilic substrates, for the preparation of oil-in-water emulsions or water-in-oil emulsions in front. Furthermore, pharmaceutical applications such as the production of ointments or creams, as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses.

EP-A 1 252 516 discloses the coating of windows, contact lenses, Biosensors, medical devices, containers for carrying out Try or for storage, ship hulls, solid particles or Frame or body of passenger car with a hydrophobin containing solution at a temperature of 30 to 80 ° C.

WHERE 03/53383 discloses the use of hydrophobin for treating of keratin materials in cosmetic applications.

WO 03/10331 discloses a sensor coated with hydrophobin, for example a measuring electrode, to which non-covalently further substances, eg electroactive substances, antibodies or enzymes, are disclosed me are bound.

None The cited documents disclose the use of hydrophobins for dirt-repellent treatment of hard surfaces.

task It was the object of the invention to provide novel techniques for soil release to deliver.

Accordingly was the use of hydrophobins for stain-resistant treatment hard surfaces found. In a preferred embodiment of the invention the dirt-repellent treatment in combination with a cleaning the surface performed.

In In a second aspect, the invention relates to a method for stain-resistant Treatment of hard surfaces, where you have the surface with a composition comprising at least one hydrophobin as well at least one solvent brings in contact.

In In a third aspect, the invention relates to a cleaning agent for hard Surfaces, which at least one hydrophobin, at least one surfactant and at least one solvent includes.

In In a fourth aspect, the invention relates to hard surfaces which have a hydrophobin comprehensive, dirt-repellent coating.

Surprisingly was found to be extremely low Quantities of hydrophobins to an effective, stain-resistant Treatment of hard surfaces are sufficient.

More specifically, the following is to be accomplished for the invention:
The term "hard surfaces" is known to those skilled in the art and is not or only slightly compressible surfaces, in particular smooth surfaces, for example surfaces of glass, ceramics, metals, such as stainless steel or brass, enamel, plastic and / or. Examples of painted surfaces include the surface of painted automotive bodies or the surface of household appliances, and the hard surfaces may be, in particular, typical household surfaces such as the surface of tiles, floors, fixtures, sinks, etc. Shower trays, bathtubs, toilets, shower cubicles, bathroom furniture, kitchen furniture such as tables, chairs, cupboards, work surfaces or other furniture, mirrors, windows, crockery, cutlery, glasses, porcelain items or the surfaces of household appliances such as washing machines, dishwashers, cookers or dunes tabzugshauben.

Of the Term "dirt repellent" is the expert known. By means of a dirt-repellent treatment of a surface becomes their pollution prevents or at least impedes and / or the replacement of dirt from the surface facilitated. Dirt is in a known manner around all types of unwanted contamination from hard surfaces with solid and / or liquid Substances. Examples of dirt include fats, oils, egg whites, leftovers, dust or Earth. Contamination can also be limescale deposits such as dried-up traces of water that are due to the water hardness form. Further examples include residues of cleaning and care products for body care or insoluble Lime soaps resulting from such cleaning and care products in conjunction with water hardness can form and that are on hard surfaces such as sinks, shower panels or bathtubs can knock down.

According to the invention is for Dirt-repellent treatment of hard surfaces at least one hydrophobin used. It can only be one hydrophobin or a mixture of several, various hydrophobins are used.

The term "hydrophobins" in the context of this invention is to be understood below as meaning polypeptides of the general structural formula (I) X _n -C ¹ -X _1-50 -C ² -X _0-5 -C ³ -X _1-100 -C ⁴ -X _1-100 -C ⁵ -X _1-50 -C ⁶ -X _0-5 -C ⁷ -X _1-50 -C ⁸ -X _m (I) where X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, Gln, Arg, Ile Met, Thr, Asn, Lys, Val, Ala, Asp, Glu, Gly) can stand. X may be the same or different. Here, the indices standing at X each represent the number of amino acids, C stands for cysteine, alanine, serine, glycine, methionine or threonine, at least four of the amino acids denoted C being cysteine, and the indices n and m are independent of each other for natural numbers of 0 and 500, preferably 15 to 300.

The polypetides according to formula (I) are further characterized by the property that at room temperature after coating a glass surface, they increase the contact angle of a water droplet of at least 20 °, preferably at least 25 °, more preferably at least 30 °, and most preferably at least 35 °, in each case compared with the contact angle ei an equal drop of water with the uncoated glass surface.

The amino acids designated C ¹ to C ⁸ are preferably cysteines; but they can also be replaced by other amino acids of similar space filling, preferably by alanine, serine, threonine, methionine or glycine. However, at least four, preferably at least 5, more preferably at least 6 and in particular at least 7, of the positions C ¹ to C ^{8 should} consist of cysteines. Cysteines can either be reduced in the proteins according to the invention or form di-sulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those with at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges. In the exchange of cysteines described above by amino acids of similar space filling, it is advantageous to exchange in pairs those C positions which are capable of forming intramolecular disulfide bridges with one another.

If in the positions indicated by X, also cysteines, serines, alanines, Glycine, methionine or threonine can be used for numbering corresponding to the individual C positions in the general formulas change.

Preference is given to hydrophobins of the general formula (II) X _n -C ¹ -X _3-25 -C ² -X _0-2 -C ³ -X _5-50 -C ⁴ -X _2-35 -C ⁵ -X _2-15 -C ⁶ -X _0-2 -C ⁷ -X _3-35 -C ⁸ -X _m (I) used for carrying out the present invention, wherein X, C and the indices standing at X have the above meaning, the subscripts n and m are numbers between 0 and 300, and the proteins are further characterized by the above-mentioned contact angle change.

Particular preference is given to hydrophobins of the general formula (III) X _n -C ¹ -X _5-9 -C ² -C ³ -X _11-39 -C ⁴ -X _2-23 -C ⁵ -X _5-9 -C ⁶ -C ⁷ -X _6-18 -C ⁸ -X _m (III) where X, C and the indices standing at X have the above meaning, the indices n and m are numbers between 0 and 200, the proteins continue to be characterized by the contact angle change mentioned above, and at least 6 of the C named amino acids is cysteine. Most preferably, all amino acids C are cysteine.

The radicals X _n and X _m may be peptide sequences that are naturally also linked to a hydrophobin. However, one or both residues may also be peptide sequences that are not naturally linked to a hydrophobin. including such radicals X _N and / or X _m are to be understood, in which a naturally occurring in a hydrophobin peptide sequence is extended by a non-naturally occurring in a hydrophobin peptide sequence.

If X _n and / or X _m are naturally non-hydrophobic peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length. Such a residue, which is not naturally linked to a hydrophobin, will also be referred to below as a fusion partner. This is to say that the proteins consist of a hydrophobin part and a fusion partner part, which in nature do not coexist in this form.

The fusion partner portion can be selected from a variety of proteins. Several fusion partners can also be linked to a hydrophobin part, for example at the amino terminus (X _n ) and at the carboxy terminus (X _m ) of the hydrophobin part. However, it is also possible, for example, to link two fusion partners with a position (X _n or X _m ) of the protein according to the invention.

Especially suitable fusion partners are polypeptides that are naturally occur in microorganisms, in particular in E. coli or Bacillus subtilis. examples for Such fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NOs: 17 and 18), and thioredoxin. Well suited also fragments or derivatives of these named sequences that only a part, preferably 70-99%, more preferably 80-98% of said Include sequences, or in which individual amino acids, or Nucleotides opposite changed the said sequence are.

The used according to the invention Proteins can also be modified in their polypeptide sequence, for example by glycosylation, acetylation or by chemical cross-linking for example with glutaric dialdehyde.

One property of the proteins used in the invention is the change in surface properties when the surfaces are coated with the proteins. The change in surface properties can be experimentally determined by measuring the contact angle of a water drop before and after coating a surface with the protein, and the differences of the two measurements is determined.

The execution Contact angle measurements are known in principle to the person skilled in the art. The exact experimental conditions for measuring the contact angle are shown in the experimental part. Among the mentioned there Conditions have the proteins used in the invention Property, the contact angle of a water droplet on a glass surface by at least 20 °, preferably at least 25 °, more preferably at least 30 ° to enlarge.

in the Hydrophobin part of the previously known hydrophobins are the positions of polar and nonpolar amino acids conserved, which manifests itself in a characteristic hydrophobicity plot. differences in biophysical properties and hydrophobicity led to Classification of previously known hydrophobins in two classes, I and II (Wessels et al., 1994, Ann. Rev. Phytopathol., 32, 413-437).

The Assembled membranes from Class I hydrophobins are high grade insoluble (even opposite 1% SDS at elevated Temperature) and can only by concentrated trifluoroacetic acid (TFA), or formic acid again be dissociated. In contrast, the assembled forms of class II hydrophobins less stable. You already can by 60% ethanol, or 1% SDS (at room temperature) are redissolved.

A comparison of the amino acid sequences shows that the length of the region between cysteine C ³ and C ^{4 is} significantly shorter in class II hydrophobins than in class I hydrophobins. Class II Hydrophobins furthermore have more charged amino acids than class I.

Especially preferred hydrophobins for execution of the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basf1, basf2, which are structurally described in the Sequence Listing below are characterized. It may also be just parts or derivatives act on it. It can too several hydrophobins, preferably 2 or 3, the same or different Structure linked together and with a corresponding suitable polypeptide sequence naturally not associated with a hydrophobin.

Especially suitable for implementation The present invention further provides the fusion proteins with the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the one for it coding nucleic acid sequences, in particular the sequences according to SEQ ID NO: 19, 21, 23. Also, proteins derived from the in SEQ ID NO. 20, 22 or 24 polypeptide sequences represented by exchange, Insertion or deletion of at least one, up to 10 preferred 5, more preferably 5% of all amino acids, and the biological Possess at least 50% property of the source proteins, are particularly preferred embodiments. The biological property of the proteins is already here described change the contact angle by at least 20 ° understood.

The used according to the invention Polypeptides can be prepared chemically by known methods of peptide synthesis, for example, by Merrifield solid phase synthesis.

Naturally occurring Hydrophobins can be made from natural Isolate sources using appropriate methods. Exemplary on the way et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882.

The production of fusion proteins can preferably be carried out by genetic engineering methods in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined in such a way that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence. Such a manufacturing process is in our earlier application DE 102005007480.4 disclosed.

suitable Host organisms (production organisms) for said production process can while prokaryotes (including the archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, particularly preferred Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec., Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells) and the like.

in the Within the scope of the present invention, expression constructs, obtained under the genetic control of regulatory nucleic acid sequences, one for a polypeptide used according to the invention coding nucleic acid sequence, and vectors comprising at least one of these expression constructs be used for the production of hydrophobins.

Preferably, constructs used include a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream, and optionally also far the usual regulatory elements, each operatively linked to the coding sequence.

Under an "operational Linking "one understands the Sequential arrangement of promoter, coding sequence, terminator and optionally other regulatory elements such that each of the regulative elements have their function in the expression of the coding Sequence can meet as intended.

Examples for operational linkable Sequences are targeting sequences as well as enhancers, polyadenylation signals and the same. Other regulative elements include selectable ones Markers, amplification signals, origins of replication, and the like. suitable regulatory sequences are e.g. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

In addition to These regulatory sequences may be the natural regulation of these sequences be present before the actual structural genes and optionally genetically modified have been so natural Regulation switched off and the expression of genes was increased.

One preferred nucleic acid construct contains advantageously also one or more of the already mentioned "enhancer" sequences, functionally linked to the promoter, which increased one Expression of the nucleic acid sequence enable. Also at the 3'-end the DNA sequences can additional advantageous Sequences are inserted, as are other regulatory elements or terminators.

The nucleic acids can be contained in one or more copies in the construct. In the construct can even more markers, such as antibiotic resistance or auxotrophs complementing genes, optionally for selection on the construct be included.

advantageous Regulatory sequences for the method are for example in promoters such as cos-, tac-, trp, tet, trp-tet, lpp, lac, lpp-lac, laclq-T7, T5, T3, gal, trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter that are beneficial in gram-negative bacteria application Find. Further advantageous regulatory sequences are, for example in the gram-positive promoters amy and SP02, in the yeast or Fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH included.

It can also artificial Promoters for the Regulation be used.

The nucleic acid construct is advantageously for expression in a host organism into a vector, such as a plasmid or a phage inserted, which allows optimal expression of genes in the host. Among vectors are out of the box Plasmids and phages also all other vectors known in the art, So z. Viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA, and the Agrobacterium system to understand.

These Vectors can autonomously replicated in the host organism or replicated chromosomally become. These vectors represent a further embodiment of the invention Suitable plasmids are, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III''3-B1, tgt11 or pBdCl, in Streptomycespl J101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL2 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHlac +, pBIN19, pAK2004 or pDH51. The said plasmids provide a small selection of possible Plasmids. Other plasmids are known in the art and may, for example from the book Cloning Vectors (Eds. Pouwels P.H. et at. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).

Advantageous contains the nucleic acid construct for Expression of the other genes contained additionally 3'- and / or 5'-terminal regulatory sequences to increase expression, depending on the host organism selected and gene or genes for optimal expression selected become.

These Regulatory sequences are designed to target the expression of genes and enable protein expression. For example, depending on the host organism, this may mean that the gene is expressed or overexpressed after induction, or that it is immediately expressed and / or overexpressed.

The Regulatory sequences or factors can preferably the Gene expression of the introduced Positively influence genes and thereby increase them. So can a reinforcement of the regulatory elements advantageously at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. But there is also a reinforcement Translation possible, for example, by improving the stability of the mRNA.

In a further embodiment of the Vector, the vector containing the nucleic acid construct or the nucleic acid can also be advantageously introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA may consist of a linearized vector such as a plasmid or only of the nucleic acid construct or the nucleic acid.

For an optimal Expression of heterologous genes in organisms, it is advantageous the nucleic acid sequences according to the specific "codon usage" used in the organism. The "codon usage" can be on the basis of computer evaluations of other, known genes of the concerned Easily detect organism.

The Production of an expression cassette takes place by fusion of a suitable promoter with a suitable coding nucleotide sequence as well as a terminator or Polyadenylation signal. For this purpose, conventional recombination and cloning techniques are used, as described, for example, in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusion, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).

The recombinant nucleic acid construct or Gene construct is expressed for expression in a suitable host organism, advantageously inserted into a host-specific vector which has a optimal expression of the genes in the host allows. Vectors are the specialist well known and can for example, from "Cloning Vectors "(Pouwels P.H. et al., Eds., Elsevier, Amsterdam-New York-Oxford, 1985) become.

With The vectors can be used to produce recombinant microorganisms. which transforms, for example, with at least one vector are used and for the production of the polypeptides used in the invention can be. Advantageously, the above-described recombinant constructs introduced and expressed in a suitable host system. there are preferably known in the art known cloning and transfection methods, such as co-precipitation, Protoplast fusion, electroporation, retroviral transfection and the like, used to bind said nucleic acids in respective expression system for expression. Suitable systems For example, in Current Protocols in Molecular Biology, F. Anubel et al., Ed., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

It Homologously recombined microorganisms can be produced. To For example, a vector is made that contains at least a portion of a to be used according to the invention Contains gene or a coding sequence, wherein optionally at least an amino acid deletion, Addition or substitution has been introduced to the sequence to change, z. B. functionally disrupted ("knockout" - vector). The introduced sequence can z. B. also be a homologue of a related microorganism or from a mammalian, yeast or insect source. The homologous recombination Alternatively, the vector used may be configured such that mutated or otherwise the endogenous gene upon homologous recombination changed but the functional protein is still encoded (eg upstream regulatory area so changed that the Expression of the endogenous protein is changed). The modified section of the invention used Gene is in the homologous recombination vector. The construction of suitable vectors for homologous recombination is z. As described in Thomas, K. R. and Capecchi, M.R. (1987) Cell 51: 503.

When recombinant host organisms for the invention used nucleic acid or the nucleic acid construct come in principle all prokaryotic or eukaryotic organisms in Question. Advantageously, microorganisms are used as host organisms like bacteria, fungi or yeasts used. Advantageous are gram-positive or gram-negative bacteria, preferably bacteria of the family Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferred bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus used.

The organisms used in the production process for fusion proteins are grown or bred, depending on the host organism, in a manner known to those skilled in the art. Microorganisms are usually in a liquid medium containing a carbon source usually in the form of sugars, a nitrogen source usually in the form of organic nitrogen sources such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese and magnesium salts and optionally vitamins Temperatures between 0 and 100 ° C, preferably between 10 to 60 ° C attracted under oxygen fumigation. In this case, the pH of the nutrient be kept at a fixed value, that is regulated during the breeding or not. The cultivation can be done batchwise, semi-batchwise or continuously. Nutrients can be presented at the beginning of the fermentation or fed in semi-continuously or continuously. The enzymes may be isolated from the organisms by the method described in the Examples or used as crude extract for the reaction.

The used according to the invention Polypeptides or functional, biologically active fragments thereof can be prepared by a recombinant process in which to cultivate a polypeptide-producing microorganism, optionally induces the expression of the polypeptides and these isolated from the culture. The polypeptides can thus also in large-scale scale produced if desired. The recombinant Microorganism can be cultured and fermented by known methods become. Bacteria can for example in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9 be increased. Specifically, suitable cultivation conditions for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).

The Cells then become, if the polypeptides are not in the culture medium be secreted, open-minded and the product according to known Protein isolation method recovered from the lysate. The cells can optionally by high-frequency ultrasound, by high pressure, such. In a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or digested by combining several of the listed methods become.

A Purification of the polypeptides can be carried out by known, chromatographic Be achieved, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as other common ones Methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are, for example in Cooper, F.G., Biochemical Working Methods, Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Publisher, New York, Heidelberg, Berlin.

Advantageous it may be to isolate the recombinant protein vector systems or oligonucleotides that encode the cDNA for particular nucleotide sequences extend and for that changed Polypeptides or fusion proteins encode, for example, a serve easier cleaning. Such suitable modifications include anchors that act as anchors, such as the hexa-histidine anchor known modification or epitopes recognized as antigens of antibodies can be (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (N.Y.) Press). Further suitable tags are e.g. HA, calmodulin BD, GST, MBD; Chitin-BD, Streptavidin-BD-Avi-tag, Flag tag, T7 etc. These anchors can for attaching the proteins to a solid support, such as. B. a polymer matrix, serve, for example, be filled in a chromatography column can be used, or on a microtiter plate or on another carrier can be. The corresponding purification protocols are from the commercial Affinity tag suppliers available.

The Proteins produced as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner used as "pure" hydrophobins become.

If a separation of the fusion partner is provided, it recommends a potential cleavage site (specific recognition site for proteases) into the fusion protein between hydrophobin part and fusion partner part install. Particularly suitable cleavage sites are those peptide sequences which are suitable, otherwise neither in the hydrophobin part nor in the fusion partner part what can easily be determined with bioinformatic tools leaves. Particularly suitable are, for example, BrCN cleavage on methionine, or protease-mediated cleavage with factor Xa, enterokinase, Thrombin, TEV cleavage (Tobacca etch virus protease).

to use according to the invention of hydrophobins for stain-resistant treatment of hard surfaces, the Hydrophobins can also be used in bulk. To be favoured but the hydrophobins as formulations or compositions in at least one suitable solvent used.

The Selection of hydrophobins for carrying out the invention is not limited. It can be Hydrophobin or several different can be used. Of the Professional makes a suitable choice. For example, fusion proteins, such as for example, yaad-Xa-dewA-his (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21) are used.

The solvents for formulations may be water and / or organic solvents. Of course, solvents can also be used mixtures are used. The type of solvent depends on the hydrophobin, the type of surface to be treated and the application and is selected accordingly by the expert. For household applications, water or aqueous formulations are generally preferred. In industrial applications, both aqueous and non-aqueous formulations come into question.

Prefers it is the solvent to water or mixtures of water and water-miscible, organic Solvents. Examples of such organic solvents include with water miscible monohydric or polyhydric alcohols, such as Methanol, ethanol, n-propanol, i-propanol, ethylene glycol, propylene glycol or glycerin. Furthermore, it may also be ether alcohols. Examples include monoalkyl ethers of (poly) ethylene or (poly) propylene glycols such as ethylene glycol monobutyl ether. Type and amount of water-soluble, organic solvents are chosen by the expert.

to Preparation of the invention used Composition can preferred in the synthesis, isolation and / or purification of the hydrophobins obtained aqueous solutions the hydrophobins are used. These may still depending on the purity Contain residues of excipients from the synthesis. Of course, the hydrophobins can but also first be isolated as a substance, for example by freeze-drying, and be formulated in a second step.

The The amount of hydrophobins in the formulation can be determined by those skilled in the art according to the type of surface and / or the application. But they are already relative small quantities sufficient to have a dirt repellent effect achieve. proven has a quantity of 0.0001 to 1 wt.% with respect to the sum of all components of the Formulation, without the invention being limited to this area should. Preferred is the amount of 0.0005 to 0.5% by weight, and more preferably 0.001 to 0.1% by weight.

Prefers if the composition used is a cleaning agent, such as glass cleaner, floor cleaner, all-purpose cleaner, Bathroom cleaner, rinse aid, Dishwashing liquid for manual or machine cleaning of dishes, machine cleaners, Metal degreaser, high pressure cleaner, alkaline cleaner, acid cleaner, top degreaser or dairy cleaner. The cleaning agent according to the invention comprises next to a solvent and at least one hydrophobin in a basically known manner and One or more surfactants in effective amounts.

at the compositions may also be pre- or post-treatment agents for hard surfaces, in particular for glass, Ceramics or floors act.

at The surfactants may be anionic, nonionic, amphoteric and / or cationic surfactants. Such surfactants and their each preferred use purpose are known in principle to those skilled in the art.

Examples anionic surfactants include fatty alcohol sulfates, alkyl ether sulfates, Alkanesulfonates, alkylbenzenesulfonates or alkyl phosphates. It can be the free acids or salts thereof.

Examples of nonionic surfactants include alkoxylated C ₈ -C ₂₂ alcohols, such as fatty alcohol alkoxylates or oxo alcohol alkoxylates, alkylphenol ethoxylates having C ₆ -C ₁₄ alkyl chains and from 5 to 30 moles of ethylene oxide units, alkyl polyglucosides having from 8 to 22 in the alkyl chain, alkylamine alkoxylates or alkylamide ethoxylates.

Examples amphoteric surfactants include alkyl betaines, alkyl amide betaines, aminopropionates, Aminoglycinates or amphoteric imidazolium compounds.

Examples of cationic surfactants include substituted or unsubstituted, straight-chain or branched quaternary ammonium salts, for example C _8-5 dialkyldimethylammonium halides, dialkoxydimethylammonium halides or long-chain alkyl imidazolium salts.

Further Examples of surfactants are described in DE-A 101 60 993, Sections [0056] to [0073] listed.

Of the The expert meets with regard to type and amount of surfactants one suitable selection. proven has an amount of 0.01 to 30 wt.% Surfactants with respect to Sum of all components of the formulation.

The formulation may optionally further comprise further components, for example additives and / or adjuvants. Examples of such components include acids or bases, for example, carboxylic acids or ammonia, buffer systems, polymers, inorganic particles such as SiO ₂ or silicates, dyes, fragrances or biocides. Further examples of additives are listed in DE-A 101 60 993, in particular Sections [0074] to [0131]. The person skilled in the art makes a suitable choice with regard to the type and amount of additional components, depending on the application.

According to the invention the dirt-repellent treatment of hard surfaces is vorgenom by bringing the hard surface into contact with a composition comprising at least one hydrophobin and at least one solvent.

The "bringing into contact" depends on the Type of object. It can, for example, by spraying, rinsing or Wipe the surface done with the composition or by dipping the entire article in the formulation. The latter is by nature only not built-in objects possible. The duration of treatment is determined by the person skilled in the art. She can do a few Seconds to several hours. The surface can rinsed after treatment to remove excess treatment solution, for example, with water.

The Dirt-repellent treatment can be particularly beneficial in combination with a cleaning, i. in the course of the actual cleaning process yourself. For this purpose, a cleaning agent is used, which as described above, at least one hydrophobin, at least one Surfactant and at least one solvent includes.

The Treatment may be at temperatures below room temperature, at Room temperature or at elevated Temperatures are made, for example at 20 to 100 ° C, preferably 20 to 60 ° C. Preferably, the treatment at temperatures of not more than 30 ° C, in particular 20 to 30 ° C.

To When treated with the composition, the treated surface is dried. The drying of the treated surface can, as it were, at room temperature, or it can also be at elevated temperatures be dried.

At the treatment and possibly the drying of the surface can a thermal treatment of the surface at elevated temperatures, for example at temperatures up to 120 ° C. The Of course, thermal aftertreatment can also be combined with the Drying be made. The temperatures are preferably at a thermal post-treatment 30 to 100 ° C, more preferably 40 to 80 ° C and for example 50 to 70 ° C. The duration of treatment is determined by the person skilled in the art; 1 min to 10 h.

By the inventive method is a hard surface available, the one dirt-repellent coating comprising at least one hydrophobin having. The coating is usually at least around a monomolecular layer of hydrophobin on the surface.

The Dirt-repellent effect can be achieved by methods known in principle be determined, for example, by removing the detachability from dirt by rinsing off with water from an untreated and a hydrophobin treated surface.

The Hydrophobins have a clear effect even in small amounts on. Already the treatment with only 0.01 wt.% Hydrophobins containing Composition leads to a significantly improved soil removal.

The inventive, dirt-repellent treatment is particularly advantageous for ceramic surfaces, such as for example Tiles. Here can over the dirt-repellent effect also through the treatment a significant hydrophobization of the surface can be achieved. This is especially in wet rooms, such as bathrooms another advantage.

The The following examples are intended to explain the invention in more detail:

Part A:

manufacturing and test of the invention used hydrophobins

example 1

Preliminary work for the cloning of yaad-His ₆ / yaaE-His ₆

Using the oligonucleotides Hal570 and Hal571 (Hal 572 / Hal 573), a polymerase chain reaction was carried out. As template DNA genomic DNA of the bacterium Bacillus subtilis was used. The PCR fragment obtained contained the coding sequence of the gene yaaD / yaaE from Bacillus subtilis, and at the ends in each case an NcoI or BglII restriction cleavage site. The PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII. This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BgIII. The resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS ₆ and YAAE :: HIS ₆ , respectively.
Hal570: gcgcgcccatggctcaaacaggtactga
Hal571: gcagatctccagccgcgttcttgcatac
Hal572: ggccatgggattaacaataggtgtactagg
Hal573: gcagatcttacaagtgccttttgcttatattcc

Example 2

Cloning of yaad hydrophobin DewA-His ₆

With The oligonucleotides KaM 416 and KaM 417 became a polymerase Chain reaction performed. The template DNA was genomic DNA of the mold Aspergillus used nidulans. The resulting PCR fragment contained the coding Sequence of the hydrophobin gene dewA and an N-terminal factor Xa Proteinase interface. The PCR fragment was purified and washed with the restriction endonuclease se BamHI cut. This DNA fragment was used as an insert, and previously with the restriction endonuclease BglII linearized vector pQE60YAAD # 2 cloned.

The resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS ₆ .
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC

Example 3

Cloning of yaad hydrophobin RodA-His ₆

The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC
KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG

Example 4

Cloning of yaad hydrophobin BASF1-His ₆

The Cloning of plasmid # 507 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM 417 and KaM 418.

As template DNA, an artificially synthesized DNA sequence - hydrophobin BASF1 - was used (see Appendix).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCG C
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 5

Cloning of yaad hydrophobin BASF2-His ₆

The Cloning of plasmid # 506 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM 417 and KaM 418.

As template DNA, an artificially synthesized DNA sequence - hydrophobin BASF2 - was used (see Appendix).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 6

Cloning of yaad hydrophobin SC3-His ₆

The Cloning of plasmid # 526 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM464 and KaM465.

The template DNA used was Schyzophyllum commune cDNA (see Appendix).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT

Example 7

Fermentation of the recombinant E. coli strain yaad hydrophobin DewA-His ₆

Inoculation of 3ml LB liquid medium with a yaad-hydrophobin DewA-His ₆ expressing E. coli strain in 15ml Greiner tubes. Incubate for 8 h at 37 ° C on a shaker at 200 rpm. 2 1 l Erlenmeyer flasks with baffles and 250 ml LB medium (+ 100 μg / ml ampicillin) are each inoculated with 1 ml of preculture and incubated for 9 h at 37 ° C. on a shaker at 180 rpm.

13.5 l LB medium (+ 100 μg / ml ampicillin) in a 20 l fermenter with 0.5 l preculture (OD _600nm 1:10 measured against H ₂ O). At an OD _60nm of ~ 3.5 add 140ml 100mM IPTG. After 3 h fermenter, cool to 10 ° C and centrifuge the fermentation broth. Use cell pellet for further purification.

Example 8

Purification of the recombinant Hydrophobin Fusion Protein

• (Purification of hydrophobin fusion proteins containing a C-terminal Own His6 tag)

100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended. The suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Mer ck, Darmstadt; Order No. 1.01697.0001) for the degradation of the nucleic acids. Before cell disruption, filter with a glass cartridge (P1). For homogenization of the cells and for shearing the remaining genomic DNA, two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.). The homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g). According to SDS-PAGE analysis, the hydrophobin is contained in the supernatant after the final centrifugation ( 1 ). The experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells. 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml Nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl pH 8.0 buffer. The column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole. To remove the imidazole, the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.

• Spur 1: Auftrag Nickel-Sepharose Säule (1:10 Verdünnung)
• Spur 2: Durchlauf = Eluat Waschschritt
• Spuren 3-5: OD 280 Maxima der Elutionsfraktionen

1 shows the purification of the prepared hydrophobin:

• Lane 1: Order nickel-Sepharose column (1:10 dilution)
• Lane 2: run = eluate wash step
• Lanes 3-5: OD 280 maxima of the elution fractions

The hydrophobin of 1 has a molecular weight of about 53 kD. The smaller bands partially represent degradation products of hydrophobin.

Example 9

Technical exam; characterization of the hydrophobin by changing the contact angle of a water drop on glass

substrate:

• Glass (window glass, South German Glass, Mannheim):
• Concentration of hydrophobin: 100 μg / mL
• Incubation of glass slides overnight (Temperature 80 ° C) in 50 mM Na acetate pH 4 + 0.1% Tween 20 after that coating wash in distilled water then incubate for 10 min / 80 ° C / 1% SDS solution in dist. water Washing in dist. water

The Samples are dried in air and the contact angle (in degrees) a drop of 5 μl Water determines.

The Contact angle measurement was done on a Dataphysics Contact Angle device System OCA 15+, Software SCA 20.2.0. (November 2002). The Measurement was carried out according to the manufacturer's information.

Untreated glass gave a contact angle of 30 ± 5 °; a coating with the functional hydrophobin according to Example 8 (yaad-dewA-his ₆ ) gave contact angles of 75 ± 5 °.

Part B:

use hydrophobins for dirt-repellent coating of hard surfaces

Used solution:

For the application technology Attempts became a solution of the example 8 produced fusion protein yaad-Xa-dewA-his (SEQ ID NO: 19) used in water. Concentration of hydrophobin in solution: 100 μg / ml (0.01 Weight%).

Hard surface used:

Ceramic tile, White shiny, 10 cm × 15 cm (Novocker), wiped with ethanol and water.

Used dirt:

For the tests IKW ballast dirt was used (according to soaps, fats, oils, waxes (SÖFW) Journal, 124.Jg., 14/98, p. 1029)

Carrying out the treatment

On a tile, 2 g of the above-mentioned aqueous hydrophobin solution having a concentration of 100 μg / ml was dropped (1.3 μm hydrophobin / cm ² ) and gently rubbed with a cloth so that the entire surface was covered. The tile was then dried lying for 24 h in air.

Subsequently was rinsed the tile with water and for 3 × 10 min in a beaker with water. Fresh water was used for each rinse. The tile was then dried standing in air.

Contact Angle Measurement and dirt-repellent effect

On The treated tile became a contact angle with a drop of water measured from 56 ° (mean from 10 measurements). An untreated tile in comparison shows one Contact angle of 20 °. The tile was so clearly hydrophobic.

On the treated tile and for comparison also on an untreated In each case 50, 100 and 200 μg of IKW ballast soil were removed with a transfer pipette punctual applied and for dried for one h at room temperature.

The Tiles were then 3 times with each rinsed 500 ml of water. While Not dirt from the untreated surface could replace Partial soil release from the hydrophobin pretreated tile is observed.

The Pretreatment with hydrophobin thus resulted to a lower dirt adhesion.

It follows a sequence listing according to WIPO St. 25. This can from the official publication platform downloaded from the DPMA.

Claims (13)

Use of hydrophobins for dirt repellent Treatment of hard surfaces. Use according to claim 1, characterized in that the dirt-repellent treatment in combination with a cleaning of the surface is made. Use according to claim 2, characterized in that the treatment is a cleaning agent comprising at least one hydrophobin, a surfactant and a solvent starts. Process for stain-resistant treatment hard Surfaces, characterized in that the surface having a composition comprising at least one hydrophobin and a solvent in contact brings. Method according to claim 4, characterized in that it is in the composition a detergent comprising at least one hydrophobin Surfactant and a solvent is. Method according to claim 4 or 5, characterized in that the amount of hydrophobins in the composition 0.0001 to 1 wt.% With respect to the sum of all components the composition is. Method according to one the claims 4 to 6, characterized in that the treatment at temperatures below 30 ° C performs. Cleaning agent for hard surfaces, thereby in that the cleaning agent contains at least one hydrophobin, at least one surfactant and a solvent. Detergent according to claim 8, characterized in that at least one of the solvents is water. Cleaning agent according to claim 8 or 9, characterized characterized in that the amount of hydrophobins is 0.0001 to 1 wt. % in terms of is the sum of all components of the cleaning agent. Cleaning agent according to claim 8 or 9, characterized in that the amount of hydrophobins is from 0.001 to 0.1% by weight. % in terms of is the sum of all components of the cleaning agent. Hard surface, comprising a dirt-repellent coating, characterized in that the coating comprises at least one hydrophobin. Hard surface according to claim 12, characterized in that the surface by a method according to a the claims 4 to 7 available is.