DE102005014843A1 - Use of hydrophobin for treating surfaces such as hardened mineral building materials, natural stones, artificial stones or ceramics - Google Patents

Abstract

Use of hydrophobin (I) for treating surfaces such as hardened mineral building materials, natural stones, artificial stones or ceramics. An independent claim is included for a surface coating comprising (I).

Description

use of hydrophobins for surface treatment from hardened mineral building materials, natural stone, artificial stone and ceramics The The present invention relates to the use of hydrophobins for the treatment of the surface from hardened mineral building materials, natural stone, artificial stone or ceramics, a Process for the treatment of such surfaces and surfaces of hardened mineral building materials, natural stone, artificial stone or ceramics, which have a coating comprising hydrophobins.

It is known, surfaces indoors and outdoors be provided with coatings that the durability and / or the appearance of the surface to improve. Such coatings are intended, for example have a preservative effect, repel moisture, prevent soiling or allow easier cleaning of the surface.

in this connection it can be permanent coatings, such as the Lotus effect imitated coatings act as EP-A 933,388.

It but can also be a temporary protection. Such a, temporary, dirt-repellent effect, for example, by substances in a cleaner formulation can be achieved which during cleaning the surface be applied. For example, this may be cleaner for tiles act.

WHERE 03/002620 discloses the use of (meth) acrylic acid dialkylaminoalkyl esters as soil-release polymers for hard surfaces, For example, fine stone floors or stainless steel surfaces. The disclosed formulations contain from 0.1 to 5% by weight of the polymer.

DE-A 100 61 897 discloses detergents containing hydrophilic, silicate-containing Particles that contribute to improved soil release Simultaneous reduction of re-soiling. The Particles are deposited on the surface of the substances to be cleaned and change so the surface properties.

hydrophobins are small proteins of about 100 to 150 amino acids that are characteristic for filamentous mushrooms, for example, Schizophyllum commune. They point in all Rule 8 cysteine units on.

hydrophobins have a pronounced affinity to interfaces and are therefore suitable for coating surfaces. So let yourself For example, Teflon using hydrophobins to obtain a hydrophilic surface coat.

Hydrophobins can be isolated from natural sources. However, it is also possible to synthesize non-naturally occurring hydrophobins by means of chemical and / or biotechnological-technical production processes. Our older registration DE 102005007480.4 discloses a preparation process for hydrophobins that are not found in nature.

in the The state of the art is the use of hydrophobins for various purposes Applications have been proposed.

WHERE 96/41882 proposes the use of hydrophobins as emulsifiers, thickeners, surface-active Substances for Hydrophilizing Hydrophobic Surfaces Improvement of water resistance hydrophilic Substrates for the preparation of oil-in-water emulsions or of water-in-oil emulsions in front. Furthermore, pharmaceutical applications such as the production of ointments or creams, as well as cosmetic applications such as skin protection or the production of hair shampoos or hair rinses.

EP-A 1 252 516 discloses the coating of windows, contact lenses, Biosensors, medical devices, containers for carrying out Try or for storage, ship hulls, solid particles or Frame or body of passenger car with a hydrophobin containing solution at a temperature of 30 to 80 ° C.

WHERE 03/53383 discloses the use of hydrophobin for treating of keratin materials in cosmetic applications.

WHERE 03/10331 discloses a hydrophobin coated sensor, for example a measuring electrode to which non-covalently further substances, e.g. electroactive substances, antibodies or enzymes are bound.

None The cited documents disclose the surface treatment of hardened mineral Building materials, natural stone, artificial stone or ceramics.

task The invention was to provide novel techniques for treating such surfaces to provide at least one dirt repellent and / or hydrophobicizing and / or preserving effect can be achieved can.

Accordingly the use of hydrophobins to treat surfaces has been found where it is at the surfaces around the surface of a material from the group of hardened mineral building materials, natural stone, artificial stone or ceramics. In a preferred embodiment For this purpose, a formulation of a hydrophobin and at least a solvent used.

In A second aspect of the invention has been a method of treatment of surfaces found, where you have the surface with at least one hydrophobin in contact, and it is at the surface around the surface of a material from the group of hardened mineral building materials, natural stone, artificial stone or ceramics is.

In A third aspect of the invention has been described with at least one hydrophobin coated surface from hardened mineral building materials, natural stone, artificial stone or ceramics found.

Surprisingly was found to be extremely low Quantities of hydrophobins to an effective, stain-resistant and / or hydrophobing and / or preserving treatment of surfaces from hardened mineral building materials, stones or ceramics are sufficient.

More specifically, the following is to be accomplished for the invention:
According to the invention, at least one hydrophobin is used to treat the surface of hardened mineral building materials, natural stone, artificial stone or ceramics. It is of course also possible to use a mixture of a plurality of different hydrophobins.

The term "hydrophobins" in the context of this invention is to be understood below as meaning polypeptides of the general structural formula (I) X _n -C ¹ -X _1-50 -C ² -X _0-5 -C ³ -X _1-100 -C ⁴ -X _1-100 -C ⁵ -X _1-50 -C ⁶ -X _0-5 -C ⁷ -X _1-50 -C ⁸ -X _m (I) where X is selected for each of the 20 naturally occurring amino acids (Phe, Leu, Ser, Tyr, Cys, Trp, Pro, His, Gln, Arg, Ile Met, Thr, Asn, Lys, Val, Ala, Asp, Glu, Gly) can stand. Here, the indices standing at X each represent the number of amino acids, C stands for cysteine, and the indices n and m independently of one another represent natural numbers between 0 and 500, preferably between 15 and 300.

The Polypetids are further characterized by the property that after coating a glass surface, they increase the size of the glass Contact angle of a water drop of at least 20 °, preferably at least 25 ° and particularly preferably 30 ° cause.

The cysteines named C ¹ to C ⁸ may either be present in reduced form or form disulfide bridges with one another. Particularly preferred is the intramolecular formation of CC bridges, in particular those having at least one, preferably 2, more preferably 3 and most preferably 4 intramolecular disulfide bridges.

Preference is given to hydrophobins of the general formula (II) X _n -C ¹ -X _3-25 -C ² -X _0-2 -C ³ -X _5-50 -C ⁴ -X _2-35 -C ⁵ -X _2-15 -C ⁶ -X _0-2 -C ⁷ -X _3-35 -C ⁸ -X _m (II) used for carrying out the present invention, wherein X, C and the indices standing at X have the above meaning, the subscripts n and m are numbers between 0 and 300, and the proteins are further characterized by the above-mentioned contact angle change.

Particular preference is given to hydrophobins of the general formula (III) X _n -C ¹ -X _5-9 -C ² -C ³ -X _11-39 -C ⁴ -X _2-23 -C ⁵ -X _5-9 -C ⁶ -C ⁷ -X _6-18 -C ⁸ -X _m (III) where X, C and the indices standing at X have the above meaning, the indices n and m are numbers between 0 and 200, and the proteins continue to be distinguished by the abovementioned contact angle change.

The radicals X _n and X _m may be peptide sequences that are naturally also linked to a hydrophobin. However, it may also in either or both of peptide sequences that are not naturally associated with a hydrophobin, including such radicals X are _N and / or X to understand _m, in which a naturally occurring in a hydrophobin peptide sequence by a non- naturally occurring in a hydrophobin peptide sequence is extended.

If X _n and / or X _m are naturally non-hydrophobic peptide sequences, such sequences are generally at least 20, preferably at least 35, more preferably at least 50, and most preferably at least 100 amino acids in length. Such a residue, which is not naturally linked to a hydrophobin, will also be referred to below as a fusion partner. This is to say that the proteins consist of a hydrophobin part and a fusion partner part, which in nature do not coexist in this form. Such proteins should also be referred to as fusion proteins.

The fusion partner portion can be selected from a variety of proteins. It is also possible to link a plurality of fusion partners with a hydrophobin part, for example at the amino terminus (X _n ) and at the carboxy terminus (X _m ) of the hydrophobic bin part. However, it is also possible, for example, to link two fusion partners with a position (X _n or X _m ) of the protein according to the invention.

Especially suitable fusion partners are polypeptides that are naturally in microorganisms, in particular in E. coli or Bacillus subtilis occurrence. examples for Such fusion partners are the sequences yaad (SEQ ID NO: 15 and 16), yaae (SEQ ID NOs: 17 and 18), and thioredoxin. Well suited also fragments or derivatives of these named sequences that only a part, preferably 70-99%, especially preferred 80-98% of said sequences, or in which individual amino acids, or Nucleotides opposite changed the said sequence are.

The used according to the invention Proteins can also be modified in their polypeptide sequence, for example by glycosylation, acetylation or by chemical cross-linking for example with glutaric dialdehyde.

A Property of the invention used Proteins is the change of surface properties, when the surfaces be coated with the proteins. The change of surface properties let yourself experimentally determine that the contact angle of a water drop measured before and after coating a surface with the protein and the difference between the two measurements is determined.

The execution Contact angle measurements are known in principle to the person skilled in the art. The exact experimental conditions for measuring the contact angle are shown in the experimental part. Among the mentioned there Conditions have the proteins used in the invention Property, the contact angle of a drop of water on a glass surface by at least 20 °, preferably at least 25 °, especially preferably at least 30 ° to enlarge.

in the Hydrophobin part of the previously known hydrophobins are the positions of polar and nonpolar amino acids conserved, which manifests itself in a characteristic hydrophobicity plot. differences in biophysical properties and hydrophobicity led to Classification of previously known hydrophobins in two classes, I and II (Wessels et al., 1994, Ann. Rev. Phytopathol., 32, 413-437).

The Assembled membranes from Class I hydrophobins are high grade insoluble (even opposite 1% SDS at elevated Temperature) and can only by concentrated trifluoroacetic acid (TFA), or formic acid again be dissociated. In contrast, the assembled forms of class II hydrophobins less stable. You already can by 60% ethanol, or 1% SDS (at room temperature) again disbanded become.

A comparison of the amino acid sequences shows that the length of the region between cysteine C ³ and C ^{4 is} significantly shorter in class II hydrophobins than in class I hydrophobins. Class II Hydrophobins also have more charged amino acids than class I.

Especially preferred hydrophobins for execution of the present invention are the hydrophobins of the type dewA, rodA, hypA, hypB, sc3, basf1, basf2, in the sequence listing below structurally characterized. It may just be about parts or derivatives thereof. There may also be several hydrophobins, preferably 2 or 3, identical or different structure with each other connected and with a corresponding suitable polypeptide sequence naturally not associated with a hydrophobin.

Especially suitable for implementation The present invention further provides the fusion proteins with the polypeptide sequences shown in SEQ ID NO: 20, 22, 24 and the one for it coding nucleic acid sequences, in particular the sequences according to SEQ ID NO: 19, 21, 23. Also, proteins derived from the in SEQ ID NO. 22, 22 or 24 polypeptide sequences represented by Exchange, insertion or deletion of at least one, all the way through to 10, preferably 5, more preferably 5% of all amino acids, and that the biological property of the source proteins still too at least 50% are particularly preferred embodiments. The biological property of the proteins is already here described change the contact angle by at least 20 ° understood.

The used according to the invention Polypeptides can be prepared chemically by known methods of peptide synthesis, for example, by Merrifield solid phase synthesis.

Naturally occurring Hydrophobins can be made from natural Isolate sources using appropriate methods. Exemplary on the way et. al., Eur. J Cell Bio. 63, 122-129 (1994) or WO 96/41882 directed.

The preparation of non-naturally occurring fusion proteins can preferably be carried out by genetic engineering processes in which a nucleic acid sequence coding for the fusion partner and a hydrophobin part, in particular DNA sequence, are combined so that the desired protein is produced in a host organism by gene expression of the combined nucleic acid sequence becomes. Such a manufacturing process is in our earlier application DE 102005007480.4 disclosed.

suitable Host organisms (production organisms) for said production process can while prokaryotes (including the archaea) or eukaryotes, especially bacteria including halobacteria and methanococci, fungi, insect cells, plant cells and mammalian cells, particularly preferred Escherichia coli, Bacillus subtilis, Bacillus. megaterium, Aspergillus oryzea, Aspergillus nidulans, Aspergillus niger, Pichia pastoris, Pseudomonas spec., Lactobacilli, Hansenula polymorpha, Trichoderma reesei, SF9 (or related cells), etc.

object of the invention are also Expression constructs containing under genetic control regulatory nucleic acid sequences one for an inventively used Polypeptide-encoding nucleic acid sequence, and vectors comprising at least one of these expression constructs.

Preferably include inserted constructs 5'-upstream of the respective coding Sequence one promoter and 3'-downstream one Terminator sequence and optionally other common regulatory elements, each operatively linked with the coding sequence.

Under an "operational Linking "one understands the Sequential arrangement of promoter, coding sequence, terminator and optionally other regulatory elements such that each the regulatory elements have their function in the expression of the coding Sequence can meet as intended.

Examples of operably linked sequences are targeting sequences as well as enhancers, polyad nylierungssignale and the like. Other regulatory elements include selectable markers, amplification signals, origins of replication, and the like. Suitable regulatory sequences are for. As described in Goeddel, Gene Expression Technolgy: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

In addition to These regulatory sequences may be the natural regulation of these sequences be present before the actual structural genes and optionally genetically modified have been so natural Regulation switched off and the expression of genes was increased.

One preferred nucleic acid construct contains advantageously also one or more of the already mentioned "enhancer" sequences, functionally linked to the promoter, which increased one Expression of the nucleic acid sequence enable. Also at the 3'-end the DNA sequences can additional advantageous sequences are inserted, such as further regulatory Elements or terminators.

The nucleic acids can be contained in one or more copies in the construct. In the construct can still other markers, such as antibiotic resistance or complementing Au xotrophien Genes, optionally be included for selection on the construct.

advantageous Regulatory sequences for the method are for example in promoters such as cos-, tac-, trp-, tet, trp, tet, lpp, lac, lpp-lac, laclq-T7, T5, T3, gal, trc, ara, rhaP (rhaPBAD) SP6, lambda PR or imlambda P promoter that are beneficial in gram-negative bacteria application Find. Further advantageous regulatory sequences are, for example in the gram-positive promoters amy and SP02, in the yeast or Fungal promoters ADC1, MFalpha, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH included. It can too artificial Promoters for the regulation can be used.

The nucleic acid construct is advantageously for expression in a host organism into a vector, such as a plasmid or a phage inserted, which allows optimal expression of genes in the host. Among vectors are out of the box Plasmids and phages also all other vectors known in the art, So z. Viruses, such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA, and the Agrobacterium system to understand.

These Vectors can autonomously replicated in the host organism or replicated chromosomally become. These vectors represent a further embodiment of the invention Suitable plasmids are, for example, in E. coli pLG338, pACYC184, pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pKK223-3, pDHE19.2, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III''3-B1, tgt11 or pBdCl, in Streptomyces pIJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL2 or pBB116, in yeasts 2alpha, pAG-1, YEp6, YEp13 or pEMBLYe23 or in plants pLGV23, pGHlac +, pBIN19, pAK2004 or pDH51. The plasmids mentioned make a small selection of possible plasmids dar. Further plasmids are known in the art and can, for example from the book Cloning Vectors (Eds. Pouwels P.H. et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018).

Advantageous contains the nucleic acid construct For expression of the other genes contained additionally 3'- and / or 5'-terminal regulatory Sequences to increase expression, depending on the selected host organism and gene or genes for optimal expression selected become.

These Regulatory sequences are designed to target the expression of genes and enable protein expression. For example, depending on the host organism, this may mean that the gene is expressed or overexpressed after induction, or that it expresses immediately and / or overexpressed becomes.

The Regulatory sequences or factors can preferably the Gene expression of the introduced Positively influence genes and thereby increase them. So can a reinforcement of the regulatory elements advantageously at the transcriptional level by using strong transcription signals such as promoters and / or enhancers. But there is also a reinforcement Translation possible, for example, by improving the stability of the mRNA.

In a further embodiment of the vector, the vector containing the nucleic acid construct or the nucleic acid can also advantageously be introduced into the microorganisms in the form of a linear DNA and integrated into the genome of the host organism via heterologous or homologous recombination. This linear DNA can be from a linearized vector such as a plasmid or only from the nucleus acid construct or the nucleic acid consist.

For an optimal Expression of heterologous genes in organisms, it is advantageous the nucleic acid sequences according to the specific "codon usage" used in the organism. The "codon usage" can be on the basis of computer evaluations of other, known genes of the concerned Easily detect organism.

The Production of an expression cassette takes place by fusion of a suitable promoter with a suitable coding nucleotide sequence as well as a terminator or Polyadenylation signal. For this purpose, conventional recombination and cloning techniques are used, as described, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusion, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).

The recombinant nucleic acid construct or gene construct is for expression in a suitable host organism, advantageously inserted into a host-specific vector which has a optimal expression of the genes in the host allows. Vectors are the specialist well known and can for example from "Cloning Vectors" (Pouwels P.H. et al., eds, Elsevier, Amsterdam-New York-Oxford, 1985) become.

With The vectors can be used to produce recombinant microorganisms. which transforms, for example, with at least one vector are used and for the production of the polypeptides used in the invention can be. Advantageously, the above-described recombinant constructs introduced and expressed in a suitable host system. there are preferably known in the art known cloning and transfection methods, such as co-precipitation, Protoplast fusion, electroporation, retroviral transfection and the like, used to the said nucleic acids in the respective Expression system for expression. Suitable systems will be for example in Current Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997, or Sambrook et al. Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

It Homologously recombined microorganisms can be produced. To For example, a vector is made that contains at least a portion of a to be used according to the invention Contains gene or a coding sequence, wherein optionally at least an amino acid deletion, Addition or substitution has been introduced to the sequence to change, z. B. functionally disrupted ("knockout" vector). The introduced sequence can z. B. also be a homologue of a related microorganism or from a mammal, Be derived yeast or insect source. The homologous recombination Alternatively, the vector used may be configured such that mutated or otherwise the endogenous gene upon homologous recombination changed but the functional protein is still encoded (eg upstream regulatory area so changed that the Expression of the endogenous protein is changed). The modified section of the invention used Gene is in the homologous recombination vector. The construction of suitable Vectors for homologous recombination is z. As described in Thomas, K.R. and Capecchi, M.R. (1987) Cell 51: 503.

When recombinant host organisms for the invention used nucleic acid or the nucleic acid construct In principle, all prokaryotic or eukaryotic organisms come in question. Advantageously, microorganisms are used as host organisms like bacteria, fungi or yeasts used. Advantageous are gram-positive or gram-negative bacteria, preferably bacteria of the family Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Streptomycetaceae or Nocardiaceae, particularly preferred bacteria of the genera Escherichia, Pseudomonas, Streptomyces, Nocardia, Burkholderia, Salmonella, Agrobacterium or Rhodococcus used.

The in the manufacturing process for Organisms used for fusion proteins vary depending on the host organism attracted or bred in the manner known in the art. microorganisms are usually in a liquid Medium containing a carbon source mostly in the form of sugars, a Nitrogen source mostly in the form of organic nitrogen sources like yeast extract or salts like ammonium sulfate, trace elements like Iron, manganese and magnesium salts and optionally vitamins contains at temperatures between 0 and 100 ° C, preferably between 10 to 60 ° C below Attracted oxygen fumigation. In this case, the pH of the nutrient fluid be kept at a fixed value, that is regulated during the cultivation be or not.

The Cultivation can be batch, semi-batch or continuous respectively. nutrient can too Beginning of the fermentation submitted or semicontinuously or continuously fed in become. The enzymes can according to the method described in the examples from the organisms be isolated or used as crude extract for the reaction.

The used according to the invention Polypeptides or functional, biologically active fragments thereof can be obtained by a recombinant process in which a Cultured polypeptide-producing microorganism, optionally the expression of the polypeptides induced and these from the culture isolated. The polypeptides can so also in large-scale scale produced if desired. The recombinant Microorganism can be cultured and fermented by known methods become. Bacteria can for example in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9 be increased. Suitable cultivation conditions are, for example in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).

The Cells then become, if the polypeptides are not in the culture medium be secreted, open-minded and the product according to known Protein isolation method recovered from the lysate. The cells can optionally by high-frequency ultrasound, by high pressure, such. In a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or digested by combining several of the listed methods become.

A Purification of the polypeptides can be carried out by known, chromatographic Be achieved, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, as well as other common ones Methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are, for example in Cooper, F.G., Biochemical Working Methods, Water de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.

Advantageous it may be to isolate the recombinant protein vector systems or oligonucleotides that encode the cDNA for particular nucleotide sequences extend and for that changed Polypeptides or fusion proteins encode, for example, a serve easier cleaning. Such suitable modifications include anchors that act as anchors, such as the hexa-histidine anchor known modification or epitopes recognized as antigens of antibodies can be (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (N.Y.) Press). Further suitable tags are z. HA, calmodulin-BD, GST, MBD; Chitin-BD, Streptavidin-BD-Avi-tag, Flag tag, T7 etc. These anchors can for attaching the proteins to a solid support, such as. B. a polymer matrix, serve, for example, be filled in a chromatography column can be used, or on a microtiter plate or on another carrier can be. The corresponding cleaning protocols are from the commercial affinity tag providers available.

The Proteins produced as described can be used both directly as fusion proteins and after cleavage and separation of the fusion partner used as "pure" hydrophobins become.

If a separation of the fusion partner is provided, it recommends a potential cleavage site (specific recognition site for proteases) into the fusion protein between hydrophobin part and fusion partner part install. Particularly suitable cleavage sites are those peptide sequences otherwise suitable neither in the hydrophobin part nor in the fusion partner part what can easily be determined with bioinformatic tools leaves. For example, BrCN cleavage on methionine are particularly suitable or protease-mediated cleavage with factor Xa, enterokinase, Thrombin, TEV cleavage (Tobacca etch virus protease).

at the invention with hydrophobins surfaces to be treated it is the surface of a material hardened from the group mineral building materials, natural stone, artificial stone or ceramics. such surfaces are especially in the construction sector, both indoors and outdoors to find.

For the purposes of this invention, "hardened mineral building materials" are to be understood as meaning stone-like masses which are obtainable by mixing essentially inorganic building materials with water, followed by curing on the basis of chemical and / or physical reactions they can be hydraulically hardening building materials that harden both in the air and in the water, or they can be air-hardening building materials that harden only in air. Furthermore, it may be, for example, steam-hardened building materials.

Examples such hardened In particular, building materials include concrete or mortar made from cements, such as Portland cement, clay cement or pozzolanic cement and mixtures thereof with gross surcharges such as sand, gravel, gravel or expanded materials and water are available. You can in a known manner, further inorganic and / or organic Excipients, such as concrete liquefiers include. Further examples hardened Building materials include gypsum, lime or plasters for indoor and outdoor use.

at Natural stones are naturally occurring rocks like sandstone, granite, gneiss, slate, lime or marble. These can both as broken stones in irregular shape or in shape molded components are used, for example as bricks, Windowsills, Steps, parapets, Doorpost Panels for cladding, floor slabs, roof tiles, decorative elements or sculptures.

at Artificial stones are components analogous to natural stones can be used but not from natural Sources come, but are usually manufactured industrially. Examples include bricks, clinker, sand-lime bricks, concrete blocks, Aerated concrete blocks or expanded clay blocks.

Of the Term "ceramic" is the expert known in principle. It is a collective term for products, which are composed of non-metallic inorganic compounds and normally made ready for use by high temperature processes become.

It Ceramics may be clay-ceramic materials which at least 20% by weight of clay mineral in the raw mixture and special ceramic materials, which are either clay mineral free or have only a low clay mineral content. It may be to trade fine ceramic or heavy clay materials, as well porous or dense materials. Ceramic materials can be known in principle Fashion glazes. The glazes can also be colored.

Examples clay-ceramic materials include building ceramic products such as Bricks or clinker, clay pipes, firebricks, roof tiles, pottery, Pottery, limestone, feldspar, stoneware, hard porcelain, Soft porcelain or tiles, which of course can also be glazed.

Examples Special ceramic products include silica stones, clay-bound Silicon carbide, cast-melted bricks, oxide-ceramic insulating materials, ceramic filters, carbide-ceramic materials, electroceramics, Magnetoceramics or dental ceramics.

Further Details about ceramics can for example, Büchner et al., "Industrielle Inorganic chemistry", VCH Verlag, Weinheim, New York 1986, p. 431-476.

Of course, the surfaces be composed of several different materials. When Example is referred to a tiled wall, which is a surface Ceramic tiles and grout includes. The surfaces can Also different materials, such as embedded metal parts include.

to use according to the invention of hydrophobins for treating said surfaces, the Hydrophobins are used in bulk. Preference is given to Hydrophobins but as formulations or compositions in at least a suitable solvent used.

The Selection of hydrophobins for carrying out the invention is not limited. It can a hydrophobin or several different can be used. The skilled person makes a suitable choice. For example, fusion proteins, such as yaad-Xa-dewA-his (SEQ ID NO: 19) or yaad-Xa-rodA-his (SEQ ID NO: 21) are used.

at the solvents for formulations it may be water and / or organic solvents. Of course you can too Solvent mixtures be used. The type of solvent depends for example on the hydrophobin, the type of treating surface as well as the application and will be selected by the expert.

Prefers it is the solvent to water or mixtures of water and water-miscible, organic Solvents. Examples of such organic solvents include water-miscible monohydric or polyhydric alcohols, such as methanol, Ethanol, n-propanol, i-propanol, ethylene glycol, propylene glycol or Glycerol. Furthermore, it may also be ether alcohols. Examples include monoalkyl ethers of (poly) ethylene or (poly) propylene glycols such as ethylene glycol monobutyl ether. Type and amount of water-soluble, organic solvents are chosen by the expert.

to Preparation of the invention used Composition can preferred in the synthesis, isolation and / or purification of Hydrophobins obtained aqueous solutions the hydrophobins are used. These may still depending on the purity Contain residues of excipients from the synthesis. Of course, the Hydrophobins but also first be isolated as a substance, for example by freeze-drying, and be formulated in a second step.

The The amount of hydrophobins in the formulation can be determined by those skilled in the art according to the type of surface and / or the application. But they are already relatively small Amounts sufficient to produce an effect, i. a change the properties of the surface to achieve. proven has an amount of 0.0001 to 1 wt.% With respect to the sum of all components the formulation, without the invention thus being limited to this area limited should be. Preferred is the amount of 0.0005 to 0.5% by weight, and more preferably 0.001 to 0.1% by weight.

The formulation may optionally further comprise further components, for example additives and / or adjuvants. Examples of such components include, in particular, surfactants, for example anionic, nonionic, amphoteric and / or cationic surfactants. Examples of other additives include acids or bases, for example, carboxylic acids or ammonia, buffer systems, polymers, inorganic particles such as SiO ₂ or silicates, dyes or biocides.

According to the invention Treatment of the surfaces made by placing the surface with hydrophobin or a Composition comprising at least one hydrophobin and at least a solvent brings in contact.

The "bringing into contact" can, for example by spraying, Brushing or rolling on or by dipping of the entire article in the formulation. The latter is naturally only at not built-in objects possible. The duration of treatment is determined by the person skilled in the art. She can do a few Seconds to several hours. The surface can rinsed after treatment to remove excess treatment solution, for example, with water.

The Treatment can also be done in combination with a surface cleaning. For this purpose, a cleaning agent is used, which at least a hydrophobin, at least one surfactant and at least one solvent includes.

The Treatment may be at temperatures below room temperature, at Room temperature or at elevated Temperatures are made, for example at 20 to 100 ° C, preferably 20 to 60 ° C.

To When treated with the composition, the treated surface is dried. The drying of the treated surface can, as it were, at room temperature, or it can also be at elevated temperatures be dried.

At the treatment and possibly the drying of the surface can a thermal treatment of the surface at elevated temperatures, for example at temperatures of up to 120 ° C connect. The thermal aftertreatment can of course also be combined with the Drying be made. The temperatures are preferably at a thermal post-treatment 30 to 100 ° C, more preferably 40 to 80 ° C and for example 50 to 70 ° C. The duration of treatment is determined by the person skilled in the art, for example from 1 minute to 10 hours. The thermal cal treatment can depending on the type of treatment, for example, by irradiating the surface with an IR emitter or blowing with warm air streams done.

By the inventive method is a surface selected from the group of hardened mineral building materials, natural stone, artificial stone or ceramics available, which has a coating comprising at least one hydrophobin. The coating is usually at least around a monomolecular layer of hydrophobin on the surface.

By the treatment according to the invention becomes at least a dirt-repellent and / or hydrophobicizing and / or preserving effect. As a rule, at least two of the advantages, in particular a combined hydrophobing and dirt repellency achieved. The hydrophobins are already in small amounts have a significant effect. As a rule, already leads the treatment with only 0.01 wt.% Hydrophobins containing Composition for an effective change of the surface.

The Dirt-repellent effect can be achieved by methods known in principle be determined, for example, by removing the detachability from dirt by rinsing off with water from one untreated and one treated with hydrophobins surface compares. The hydrophobing can be done in a known manner be determined by measuring the contact angle.

The Treatment according to the invention is particularly advantageous for ceramic surfaces, such as for tiles, on which both a dirt-repellent and a hydrophobic Effect can be achieved. This is especially true in wet rooms, like For example, bathrooms a significant advantage.

The The following examples are intended to explain the invention in more detail:

Part A:

manufacturing and test of the invention used hydrophobins

example 1

Preliminary work for the cloning of yaad-His ₆ / yaaE-His ₆

Using the oligonucleotides Hal570 and Hal571 (Hal 572 / Hal 573), a polymerase chain reaction was carried out. As template DNA genomic DNA of the bacterium Bacillus subtilis was used. The PCR fragment obtained contained the coding sequence of the gene yaaD yaaE from Bacillus subtilis, and at the ends in each case a NcoI or BglII restriction cleavage site. The PCR fragment was purified and cut with the restriction endonucleases NcoI and BglII. This DNA fragment was used as an insert and cloned into the vector pQE60 from Qiagen, previously linearized with the restriction endonucleases NcoI and BglII. The resulting vectors pQE60YAAD # 2 / pQE60YaaE # 5 can be used to express proteins consisting of, YAAD :: HIS ₆ and YAAE :: HIS ₆ , respectively.
Hal570: gcgcgcccatggctcaaacaggtactga
Hal571: gcagatctccagccgcgttcttgcatac
Hal572: ggccatgggattaacaataggtgtactagg
Hal573: gcagatcttacaagtgccttttgcttatattcc

Example 2

Cloning of yaad hydrophobin DewA-His ₆

With The oligonucleotides KaM 416 and KaM 417 became a polymerase Chain reaction performed. The template DNA was genomic DNA of the mold Aspergillus used nidulans. The resulting PCR fragment contained the coding Sequence of the hydrophobin gene dewA and an N-terminal factor Xa Proteinase interface. The PCR fragment was purified and washed with the restriction endonuclease BamHI cut. This DNA fragment was used as an insert, and previously with the restriction endonuclease BglII cloned linearized vector pQE60YAAD # 2.

The resulting vector # 508 can be used to express a fusion protein consisting of, YAAD :: Xa :: dewA :: HIS ₆ .
KaM416: GCAGCCCATCAGGGATCCCTCAGCCTTGGTACCAGCGC
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCAT-GAAGTTCTCCGTCTCCGC

Example 3

Cloning of yaad hydrophobin RodA-His ₆

The cloning of plasmid # 513 was carried out analogously to plasmid # 508 using the oligonucleotides KaM 434 and KaM 435.
KaM434: GCTAAGCGGATCCATTGAAGGCCGCATGAAGTTCTCCATTGCTGC
KaM435: CCAATGGGGATCCGAGGATGGAGCCAAGGG

Example 4

Cloning of yaad hydrophobin BASF1-His ₆

The Cloning of plasmid # 507 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM 417 and KaM 418.

As template DNA, an artificially synthesized DNA sequence - hydrophobin BASF1 - was used (see Appendix).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 5

Cloning of yaad hydrophobin BASF2-His ₆

The Cloning of plasmid # 506 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM 417 and KaM 418.

As template DNA, an artificially synthesized DNA sequence - hydrophobin BASF2 - was used (see Appendix).
KaM417: CCCGTAGCTAGTGGATCCATTGAAGGCCGCATGAAGTTCTCCGTCTCCGC
KaM418: CTGCCATTCAGGGGATCCCATATGGAGGAGGGAGACAG

Example 6

Cloning of yaad hydrophobin SC3-His ₆

The Cloning of plasmid # 526 was carried out analogously to plasmid # 508 Use of the oligonucleotides KaM464 and KaM465.

The template DNA used was Schyzophyllum commune cDNA (see Appendix).
KaM464: CGTTAAGGATCCGAGGATGTTGATGGGGGTGC
KaM465: GCTAACAGATCTATGTTCGCCCGTCTCCCCGTCGT

Example 7

Fermentation of the recombinant E. coli strain yaad hydrophobin DewA-His ₆

Inoculation of 3 ml LB liquid medium with a yaad-hydrophobin DewA-His ₆ expressing E. coli strain in 15 ml Greiner tubes. Incubate for 8 h at 37 ° C on a shaker at 200 rpm. 2 1 l Erlenmeyer flasks with baffles and 250 ml LB medium (+ 100 μg / ml ampicillin) are each inoculated with 1 ml of preculture and incubated for 9 h at 37 ° C. on a shaker at 180 rpm.

13.5 l LB medium (+ 100 μg / ml ampicillin) in a 20 l fermenter with 0.5 l preculture (OD _600nm 1:10 measured against H ₂ O). At an OD _60nm of ~ 3.5 add 140ml 100mM IPTG. After 3 h fermenter, cool to 10 ° C and centrifuge the fermentation broth. Use cell pellet for further purification.

Example 8

Purification of the recombinant Hydrohobin fusion protein (purification of hydrophobin fusion proteins, the have a C-terminal His6 tag)

100 g cell pellet (100-500 mg hydrophobin) are made up to 200 ml total volume with 50 mM sodium phosphate buffer, pH 7.5 and resuspended. The suspension is treated with an Ultraturrax type T25 (Janke and Kunkel, IKA-Labortechnik) for 10 minutes and then for 1 hour at room temperature with 500 units of benzonase (Merck, Darmstadt, Order No. 1.01697.0001) to break down the nucleic acids incubated. Before cell disruption, filter with a glass cartridge (P1). For homogenization of the cells and for shearing the remaining genomic DNA, two homogenizer runs are carried out at 1500 bar (Microfluidizer M-110EH, Microfluidics Corp.). The homogenate is centrifuged (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g), the supernatant placed on ice and the pellet resuspended in 100 ml sodium phosphate buffer, pH 7.5 , Centrifugation and resuspension are repeated 3 times with the sodium phosphate buffer containing 1% SDS at the third repetition. After resuspension, stir for one hour and perform a final centrifugation (Sorvall RC-5B, GSA rotor, 250 ml centrifuge beaker, 60 minutes, 4 ° C, 12,000 rpm, 23,000 g). According to SDS-PAGE analysis, the hydrophobin is contained in the supernatant after the final centrifugation ( 1 ). The experiments show that the hydrophobin is probably contained in the form of inclusion bodies in the corresponding E. coli cells. 50 ml of the hydrophobin-containing supernatant are applied to a 50 ml Nickel-Sepharose High Performance 17-5268-02 column (Amersham) equilibrated with 50 mM Tris-Cl pH 8.0 buffer. The column is washed with 50 mM Tris-Cl pH 8.0 buffer and the hydrophobin is then eluted with 50 mM Tris-Cl pH 8.0 buffer containing 200 mM imidazole. To remove the imidazole, the solution is dialyzed against 50 mM Tris-Cl pH 8.0 buffer.

1 shows the purification of the prepared hydrophobin: Lane 1: Order Nickel-Sepharose column (1:10 dilution) Lane 2: Pass = eluate wash step Lanes 3-5: OD 280 maxima of the elution fractions

The hydrophobin of 1 has a molecular weight of about 53 kD. The smaller bands partially represent degradation products of hydrophobin.

Example 9

Technical exam; characterization of the hydrophobin by changing the contact angle of a water drop on glass

substrate:

• Glass (window glass, South German Glass, Mannheim): Concentration of hydrophobin: 100 μg / mL
• Incubation of glass slides overnight (Temperature 80 ° C) in 50 mM Na acetate pH 4 + 0.1% Tween 20 after that coating wash in distilled water then incubate 10min / 80 ° C / 1% SDS solution in least. water
• Washing in dist. water

The Samples are dried in air and the contact angle (in degrees) a drop of 5 μl of water certainly.

The Contact angle measurement was done on a Dataphysics Contact Angle device System OCA 15+, Software SCA 20.2.0. (November 2002). The Measurement was carried out according to the manufacturer's information.

Untreated glass gave a contact angle of 30 ± 5 °; a coating with the functional hydrophobin according to Example 8 (yaad-dewA-his ₆ ) gave contact angles of 75 ± 5 °.

Part B:

use hydrophobins for dirt-repellent coating of ceramic surfaces

Used solution:

For the application technology Attempts became a solution of the example 8 produced fusion protein yaad-Xa-dewA-his (SEQ ID NO: 19) used in water. Concentration of hydrophobin in solution: 100 μg / ml (0.01 Weight%).

Used ceramic Surface:

Ceramic tile, White shiny, 10 cm × 15 cm (from Novocker), wiped with ethanol and water.

Used dirt:

For the tests IKW ballast dirt was used (according to soaps, fats, oils, waxes (SFW) -Journal, 124.Jg., 14/98, p. 1029)

Carrying out the treatment

On a tile, 2 g of the above-mentioned aqueous hydrophobin solution having a concentration of 100 μg / ml was dropped (1.3 μm hydrophobin / cm ² ) and gently rubbed with a cloth so that the entire surface was covered. The tile was then dried lying for 24 h in air.

Subsequently was rinsed the tile with water and for 3 × 10 min in a beaker with water. Fresh water was used for each rinse. The tile was then dried standing in air.

Contact Angle Measurement and dirt-repellent effect

On The treated tile became a contact angle with a drop of water measured from 56 ° (Average of 10 measurements). An untreated tile in comparison shows a contact angle of 20 °. The tile was so clearly hydrophobic.

On the treated tile and for comparison also on an untreated In each case 50, 100 and 200 μg of IKW ballast soil were removed with a transfer pipette punctual applied and for dried for one h at room temperature.

The Tiles were then rinsed 3 times with 500 ml each of water. While from the untreated surface the dirt did not detach, was able to partially recover from the hydrophobin pretreated tile soil removal to be watched.

The Pre-treatment of the tile with hydrophobin thus resulted in a lower Dirt adhesion and to a hydrophobization of the ceramic surface.

Assignment of sequence names to DNA and polypeptide sequences in the sequence listing

It follows a sequence listing according to WIPO St. 25. This can from the official publication platform downloaded from the DPMA.

Claims (9)

Use of hydrophobins for the treatment of surfaces, characterized in that the surfaces are the surface of a material selected from the group of hardened mineral building materials, natural stone, artificial stone or ceramic. Use according to claim 1, characterized in that for the treatment of a composition comprising at least one hydrophobin and a solvent. Process for treating surfaces, at the one the surface with at least one hydrophobin in contact, characterized that it is at the surface around the surface of a material from the group of hardened mineral building materials, natural stone, artificial stone or ceramics is. Method according to claim 3, characterized in that for the treatment of a composition comprising at least one hydrophobin and a solvent. Method according to claim 3 or 4, characterized in that it is the solvent is about water. Method according to one the claims 3 to 5, characterized in that the amount of hydrophobins in the composition 0.0001 to 1 wt.% With respect to the sum of all components the formulation is. With at least one hydrophobin coated surface, thereby characterized in that the surface is the surface of a Materials selected from the group of hardened mineral building materials, natural stone, artificial stone or ceramics. Coated surface according to claim 7, characterized in that that the surface is dirt-repellent. Coated surface according to claim 7 or 8, characterized characterized in that the surface is hydrophobed.