DE102004043782A1

DE102004043782A1 - Polypeptides and methods for specific binding of prions

Info

Publication number: DE102004043782A1
Application number: DE200410043782
Authority: DE
Inventors: Carsten Korth; Sirik Rutger Leliveld
Original assignee: DUESSELDORF H HEINE, University of; Heinrich Heine Universitaet Duesseldof
Current assignee: DUESSELDORF H HEINE, University of; Heinrich Heine Universitaet Duesseldof
Priority date: 2004-09-08
Filing date: 2004-09-08
Publication date: 2006-03-09
Also published as: WO2006026977A3; WO2006026977A2

Abstract

Die Erfindung betrifft Polypeptide mit mindestens einem Sequenzmotiv, die spezifisch an die pathologische Isoform eines Prionproteins binden, sowie deren Verwendungen und ein Verfahren zur spezifischen Bindung der pathologischen Isoform eines Prionproteins (PrP·sc·) an ein Biomolekül, wobei die Bindung durch Inkubation des Biomoleküls mit einer auf die Anwesenheit des pathologischen Prionproteins zu untersuchenden Probe durchgeführt wird. Das Sequenzmotiv besteht aus mindestens 9 aufeinanderfolgenden Octameren einer mit dem Kupfer-bindenden, repetitiven Octamer eines Prionproteins (PrP) zumindest homologen und/oder überlappenden Aminosäuresequenz, und enthält zusätzlich einen löslichen Bestandteil. Das bindende Sequenzmotiv stellt praktisch eine Art Schalter dar, der die Bindungseigenschaften für PrP·c· und PrP·Sc· in Abhängigkeit von Metallionen-Konzentration und pH-Wert steuert. Das Polypeptid bzw. Sequenzmotiv kann dabei unterschiedliche Stellungen bzw. Konformationen annehmen: NULL (pH APPROX 4.5), OFF (ohne Cu/Zn, pH 7.5)) oder ON (mit Cu/Zn, pH 7.5). In Abhängigkeit von den Bedingungen kann das Sequenzmotiv PrP·C· oder PrP·Sc· entweder schwach (+/-), stark (+) oder überhaupt nicht (-) binden. (A = normales Peptid, B = erfindungsgemäßes Polypeptid bzw. Sequenzmotiv mit 14 Octameren).The invention relates to polypeptides having at least one sequence motif which bind specifically to the pathological isoform of a prion protein, and to their uses and a method for the specific binding of the pathological isoform of a prion protein (PrP · sc ·) to a biomolecule, wherein the binding by incubation of the biomolecule is carried out with a sample to be examined for the presence of the pathological prion protein. The sequence motif consists of at least 9 consecutive octamers of an amino acid sequence at least homologous and / or overlapping with the copper-binding, repetitive octamer of a prion protein (PrP), and additionally contains a soluble component. The binding sequence motif is in effect a type of switch which controls the binding properties for PrP · c · and PrP · Sc · as a function of metal ion concentration and pH. The polypeptide or sequence motif can assume different positions or conformations: NULL (pH APPROX 4.5), OFF (without Cu / Zn, pH 7.5)) or ON (with Cu / Zn, pH 7.5). Depending on the conditions, the sequence motif may bind PrP · C · or PrP · Sc · either weakly (+/-), strongly (+) or not at all (-). (A = normal peptide, B = polypeptide of the invention or sequence motif with 14 octamers).

Description

Die Erfindung betrifft Polypeptide mit mindestens einem Sequenzmotiv, die spezifisch an die pathologische Isoform eines Prionproteins binden. Die Erfindung betrifft auch Nukleinsäuren, die für diese Polypeptide kodieren, sowie Vektoren und Zellen, die diese Moleküle enthalten. Die Erfindung betrifft darüber hinaus ein antigenbindendes Peptid, das spezifisch an die Polypeptide bindet. Die Erfindung betrifft ferner einen Kit und eine pharmazeutische Zusammensetzung, sowie deren Verwendungen, und ein Verfahren zur spezifischen Bindung der pathologischen Isoform eines Prionproteins (PrP^Sc) an ein Biomolekül, wobei die Bindung durch Inkubation des Biomoleküls mit einer auf die Anwesenheit des pathologischen Prionproteins zu untersuchenden Probe durchgeführt wird.The invention relates to polypeptides having at least one sequence motif which bind specifically to the pathological isoform of a prion protein. The invention also relates to nucleic acids encoding these polypeptides, as well as vectors and cells containing these molecules. The invention further relates to an antigen-binding peptide which binds specifically to the polypeptides. The invention further relates to a kit and a pharmaceutical composition, and their uses, and a method for specific binding of the pathological isoform of a prion protein (PrP ^Sc ) to a biomolecule, wherein the binding by incubation of the biomolecule with an on the presence of the pathological prion protein to examining sample is performed.

Übertragbare spongiforme Enzephalopathien wie beispielsweise die Creutzfeldt-Jakob-Krankheit (CJD) beim Menschen, Scrapie bei Schafen und Ziegen, CWD bei Hirschen sowie BSE bei Rindern sind neurodegenerative Erkrankungen des zentralen Nervensystems, die sich durch lange Inkubationszeiten auszeichnen und auch artübergreifend übertragen werden können. Der Erreger dieser Erkrankungen, das Prion, ist ein infektiöses Molekül, das aus der fehlgefalteten Isoform eines normalen Prionproteins (PrP) besteht und während des Krankheitsverlaufes in zunehmendem Maße das physiologische Prionprotein (PrP^C) in die pathogene, fehlgefaltete Isoform (PrP^Sc) konvertiert. Das pathologische bzw. pathogene Prionprotein (PrP^Sc) stimmt hinsichtlich des Molekulargewichts und der Aminosäuresequenz mit dem normalen Wirtsprotein (PrP^C) überein. PrP^C weist aber überwiegend α-helikale Sekundärstrukturen auf, ist löslich und mittels Protease verdaubar. PrP^Sc weist dagegen hauptsächlich β-Faltblattstrukturen auf, ist unlöslich und kann von Proteasen nur in geringem Maße abgebaut werden. Allerdings wurde auch Protease-sensitives PrP^Sc beschrieben (Safar et al., 1998). Die pathogene Isoform PrP^Sc ist in der Lage, das physiologische PrP^C durch einen bisher unbekannten Mechanismus in die pathologische Isoform PrP^Sc zu konvertieren, d. h. die Faltung bzw. Sekundärstruktur des Prionproteins zu ändern.Transmissible spongiform encephalopathies such as Creutzfeldt-Jakob disease (CJD) in humans, scrapie in sheep and goats, CWD in deer and BSE in cattle are neurodegenerative diseases of the central nervous system that are characterized by long incubation periods and can be transmitted across species. The causative agent of these diseases, the prion, is an infectious molecule that consists of the misfolded isoform of a normal prion protein (PrP) and increasingly converts the physiological prion protein (PrP ^C ) into the pathogenic, misfolded isoform (PrP ^Sc ) during the course of the disease , The pathologic prion protein (PrP ^Sc ) is consistent with the normal host protein (PrP ^C ) in terms of molecular weight and amino acid sequence. However, PrP ^C predominantly has α-helical secondary structures, is soluble and digested by protease. In contrast, PrP ^Sc mainly has β-sheet structures, is insoluble, and can only be degraded by proteases to a limited extent. However, protease-sensitive PrP ^{Sc has also been} described (Safar et al., 1998). The pathogenic isoform PrP ^Sc is able to convert the physiological PrP ^C into the pathological isoform PrP ^Sc by a previously unknown mechanism, ie to change the folding or secondary structure of the prion protein.

Die N-terminale Domäne des Prionproteins enthält vier hochkonservierte Kupferbindende Octamere (Octarepeats), wie beispielsweise die Aminosäuresequenz Pro-His-Gly-Gly-Gly-Trp-Gly-Gln von Position 60 bis 91 der Aminosäuresequenz des Prionproteins des syrischen Hamsters (Burns et al., 2003). Diese Octarepeat-Region bindet Kupfer kooperativ (Brown et al., 1997; Garnett und Viles, 2003; Hornshaw et al., 1995; Stöckel et al., 1998) und ändert durch die Bindung von Kupfer seine Konformation (Viles et al., 1999). Es konnte ferner gezeigt werden, dass das Einführen zusätzlicher Octamere in die Octarepeat-Region (expanded octarepeats) mit der genetisch bedingten Form der Creutzfeldt-Jakob-Krankheit, d.h. der spontanen nicht-infektiösen Form der Erkrankung, in Verbindung steht, wobei die zusätzlichen Octamere die Wahrscheinlichkeit der spontanen Konversion von nativem PrP^C in die pathologische Form erhöht (Campbell et al., 1996; Collinge et al., 1992; Owen et al, 1989). Spätere Untersuchungen zur Rolle der verlängerten Octarepeat – Domain wurden an dem entsprechenden Homologen des Maus PrP (MoPrP-14OR) durchgeführt (Chiesa et al., 1998; Chiesa et al., 2000).The N-terminal domain of the prion protein contains four highly conserved copper-binding octamers (octarepeats), such as the amino acid sequence Pro-His-Gly-Gly-Gly-Trp-Gly-Gln from position 60 to 91 of the amino acid sequence of the Syrian hamster prion protein (Burns et al., 2003). This octarepeate region binds copper cooperatively (Brown et al., 1997, Garnett and Viles, 2003, Hornshaw et al., 1995, Stöckel et al., 1998) and alters its conformation by binding copper (Viles et al. 1999). It has also been shown that the introduction of additional octamers into the Octarepeat region (expanded octarepeats) is associated with the genetic form of Creutzfeldt-Jakob Disease, ie the spontaneous non-infectious form of the disease, with the additional octamers increases the likelihood of spontaneous conversion of native PrP ^C into the pathological form (Campbell et al., 1996, Collinge et al., 1992, Owen et al, 1989). Subsequent studies on the role of the extended octarepeate domain were performed on the corresponding homologue of mouse PrP (MoPrP-14OR) (Chiesa et al., 1998, Chiesa et al., 2000).

Aufgrund der artübergreifenden Übertragbarkeit der Erkrankungen, beispielweise vom Rind (BSE) auf den Menschen (vCJD) werden in Schlachthöfen post mortem – Tests auf das Vorhandensein der pathologischen Erreger in geschlachteten Tieren durchgeführt, damit infizierte Tiere nicht in die Nahrungskette gelangen können. Da die Übertragung der Erkrankungen auch über infiziertes Blut erfolgen kann, wäre es ferner wünschenswert, einen Frühtest (ante mortem) zur Untersuchung von Körperflüssigkeiten zur Verfügung zu stellen oder eine effektive Methode zur Untersuchung von Blutproben zu schaffen, um infizierte, subklinische Patienten zu identifizieren und beispielsweise deren Blut im Falle einer Blutspende aussortieren zu können.by virtue of cross-species transferability of diseases, for example, from bovine (BSE) to humans (vCJD) are used in slaughterhouses post mortem - tests on the presence of pathogens in slaughtered Animals performed, infected animals can not enter the food chain. There the transfer the diseases too infected blood, it would also be desirable to an early test (ante mortem) for the study of body fluids available or an effective method for examining blood samples to identify infected, subclinical patients and, for example, sort out their blood in the case of a blood donation to be able to.

Aus der WO 01/00235 A1 sind beispielsweise isolierte Zelloberflächenproteine bekannt, die Prionproteine binden. Es wird vorgeschlagen, diese Proteine zur Diagnose und Therapie von durch Prione hervorgerufene Erkrankungen zu verwenden.Out WO 01/00235 A1 are, for example, isolated cell surface proteins known to bind the prion proteins. It is suggested this Proteins for diagnosis and treatment of prions To use diseases.

Aus der EP 0 822 828 B1 ist ebenfalls ein isoliertes Protein bekannt, das an Prionproteine bindet. Die aus 17 Aminosäureresten bestehende Aminosäuresequenz Tyr-His-Val-Ala-Thr-Lys-Ala-Pro-His-His-Gly-Pro-Cys-Arg-Ser-Ser-Ala, die in dem Protein enthalten ist, kann als isoliertes Peptid zur Bindung von Prionproteinen verwendet werden.From the EP 0 822 828 B1 Also, an isolated protein is known that binds to prion proteins. The 17 amino acid residue amino acid sequence Tyr-His-Val-Ala-Thr-Lys-Ala-Pro-His-His-Gly-Pro-Cys-Arg-Ser-Ser-Ala contained in the protein may be isolated as an isolated Peptide used for binding prion proteins.

Aus der EP 0 616 613 B1 sind Fragmente von Prionproteinen mit zumindest einer antigenen Domäne eines Prionproteins bekannt. Die Fragmente werden in Form synthetischer Polypeptide beschrieben, wobei zahlreiche antigene Aminosäuresequenzen innerhalb dieser Polypeptide offenbart sind. Mit Hilfe der beschriebenen synthetischen Polypeptide können Prionproteine oder Antikörper gegen Prionproteine nachgewiesen werden.From the EP 0 616 613 B1 For example, fragments of prion proteins having at least one antigenic domain of a prion protein are known. The fragments are described in the form of synthetic polypeptides, wherein numerous antigenic amino acid sequences are disclosed within these polypeptides. With the aid of the synthetic polypeptides described, it is possible to detect prion proteins or antibodies to prion proteins.

Die DE 199 17 838 A1 offenbart ein Oligopeptid der Aminosäuresequenz Met-Ile-Phe-Ile-Val-Ala-Glu-Arg-Arg-Gln-Gly-Val-Leu-Thr-Leu-Gly-Ala-Val, das zur Diagnose und therapeutischen Behandlung von transmissiblen spongiformen Enzephalopathien und ähnlichen neurodegenerativen Erkrankungen verwendet werden kann.The DE 199 17 838 A1 discloses an oligopeptide of the amino acid sequence Met-Ile-Phe-Ile-Val-Ala-Glu-Arg-Arg-Gln-Gly-Val-Leu-Thr-Leu-Gly-Ala-Val which is used for the diagnosis and therapeutic treatment of transmissible spongiforms Encephalopathies and similar neurodegenerative diseases can be used.

Aus der DE 197 41 607 A1 sind ferner synthetische Polypeptide zur Diagnose und Therapie von Prionerkrankungen bekannt, welche immunogene Eigenschaften bzw. Bindungseigenschaften aufweisen, die denen des PrP^Sc entsprechen, welche jedoch nicht infektiös sind. Die Polypeptide enthalten zumindest eine Sequenz, die im nativen PrP^Sc an dessen Oberfläche angeordnet sind und dort eine Bindungsstelle bilden. Es sind in diesem Zusammenhang verschiedene Aminosäuresequenzen offenbart, die in den synthetischen Polypeptiden enthalten sein können. Eine dieser Aminosäuresequenzen ist beispielsweise die Sequenz Gly-Trp-Gly-Gln-Pro-His-Gly-Gly-Gly-Trp-Gly-Gln-Pro-His-Gly, die einer Sequenz aus der Octarepeat-Region eines Prionproteins entspricht. Es wird vorgeschlagen, mittels der beschriebenen Polypeptide in Probenmaterial möglicherweise enthaltenes PrP^Sc spezifisch zu binden und anschließend durch geeignete Tests nachzuweisen. Es wird ferner vorgeschlagen, die Polypeptide zu therapeutischen Zwecken einzusetzen.From the DE 197 41 607 A1 Furthermore, synthetic polypeptides are known for the diagnosis and therapy of prion diseases which have immunogenic properties or binding properties which correspond to those of the PrP ^Sc , but which are not infectious. The polypeptides contain at least one sequence, which are arranged in the native PrP ^Sc on its surface and form a binding site there. In this regard, various amino acid sequences are disclosed which may be included in the synthetic polypeptides. One of these amino acid sequences is, for example, the sequence Gly-Trp-Gly-Gln-Pro-His-Gly-Gly-Gly-Trp-Gly-Gln-Pro-His-Gly, which corresponds to a sequence from the octarepeate region of a prion protein. It is suggested then demonstrate using the polypeptides described in sample material possibly contained PrP ^Sc specifically bind and by appropriate tests. It is further proposed to use the polypeptides for therapeutic purposes.

Die im genannten Stand der Technik beschriebenen Polypeptide weisen allerdings keine ausreichende Spezifität für das pathologische PrP^Sc auf, so dass eine zuverlässige Unterscheidung zwischen der pathogenen Isoform und dem normalen Wirtsprotein (PrP^C) nicht mit ausreichender Zuverlässigkeit möglich ist. Darüber hinaus ist die Bindung an das PrP^Sc jeweils relativ schwach und nicht mit der Stabilität einer Bindung beispielsweise durch Antikörper vergleichbar.However, the polypeptides described in the cited prior art do not have sufficient specificity for the pathological PrP ^Sc , so that a reliable distinction between the pathogenic isoform and the normal host protein (PrP ^C ) is not possible with sufficient reliability. In addition, the binding to the PrP ^{Sc is in} each case relatively weak and not comparable to the stability of a binding, for example by antibodies.

Aufgabe der Erfindung ist es daher, Polypeptide und Verfahren zur Verfügung zu stellen, welche die spezifische Bindung der pathologischen Isoform eines Prionproteins (PrP^Sc) und somit eine eindeutige Unterscheidung zwischen dieser und der normal gefalteten Isoform des Prionproteins (PrP^C) zuverlässig ermöglichen.The object of the invention is therefore to provide polypeptides and methods which reliably enable the specific binding of the pathological isoform of a prion protein (PrP ^Sc ) and thus a clear distinction between this and the normally folded isoform of the prion protein (PrP ^C ).

Die Aufgabe wird erfindungsgemäß durch Polypeptide der eingangs genannten Art gelöst, bei denen das mindestens eine Sequenzmotiv aus mindestens 9 aufeinanderfolgenden Octameren einer mit dem Kupfer-bindenden, repetitiven Octamer eines Prionproteins (PrP) zumindest homologen und/oder überlappenden Aminosäuresequenz besteht, und das zusätzlich einen löslichen Bestandteil enthält. Es konnte überraschender Weise gezeigt werden, dass solche Polypeptide unter definierten Bedingungen sehr spezifisch und äußerst stabil an die krankheitsspezifische Isoform PrP^Sc binden. Die Bindung an das PrP^Sc ist dabei durch Zugabe einer chelatbildenden Substanz, beispielsweise EDTA, induzierbar, so dass die erfindungsgemäßen Polypeptide sehr gezielt und steuerbar eingesetzt werden können. In Abwesenheit divalenter Kationen bzw. der Anwesenheit eines entsprechenden Chelators und bei physiologischem pH-Wert binden die erfindungsgemäßen Polypeptide PrP^Sc mit sehr hoher Assoziationskonstante, während PrP^C unter diesen Bedingungen nur schwach gebunden wird, so dass nach differentiellem Waschen spezifisch detektiert werden kann. Ein besonderer Vorteil der erfindungsgemäßen Polypeptide liegt dabei darin, dass im Gegensatz zu den bisher bekannten Nachweisverfahren für PrP^Sc auf die Behandlung der Proben mit Protease verzichtet werden kann. Hierdurch werden die entsprechenden Nachweisverfahren deutlich sensitiver und zudem vereinfacht. Die mit steigender Zahl der Octamere zunehmende Unlöslichkeit des Sequenzmotivs wird durch die Fusion mit einem löslichen Bestandteil kompensiert, so dass insgesamt ein lösliches Polypeptid vorliegt, das zur Verwendung in standardisierten Testverfahren geeignet ist. Eine Verlängerung des Sequenzmotivs, d.h. eine Erhöhung der Anzahl der Octamere, führt dabei bis zu dem Punkt zu einer Erhöhung der Spezifität der erfindungsgemäßen Polypeptide, an dem die Polypeptide unlöslich bzw. nicht mehr handhabbar oder schwer herstellbar werden. Die erfindungsgemäßen Polypeptide ermöglichen also eine zuverlässige Unterscheidung zwischen der pathogenen Isoform (PrP^Sc) und dem normalen Wirtsprotein (PrP^C) und können somit insbesondere zur Diagnose von spongiformen Enzephalopathien, beispielsweise zum Nachweis von PrP^Sc in Blutproben, eingesetzt werden. Mit Hilfe der erfindungsgemäßen Polypeptide können beispielsweise Schnelltests an einer großen Anzahl von Tieren durchgeführt werden (Herdenuntersuchungen). Dabei kann die Untersuchung auf das Vorliegen einer Infektion mit PrP^Sc in einem frühen Stadium erfolgen (ante mortem), d.h. nicht nur an Hirnhomogenaten, sondern beispielsweise auch an Proben von Körperflüssigkeiten. Durch die Stärke der Bindung des PrP^Sc können mit Hilfe der erfindungsgemäßen Polypeptide Proben, beispielsweise Blutkonserven, ferner vollständig von den pathogenen Prionproteinen gereinigt werden. Es wäre auch denkbar, die erfindungsgemäßen Polypeptide, die zu diesem Zweck mit einer geeigneten Substanz gekoppelt sein müssten, einer zu untersuchenden Person zu applizieren und in einem bildgebenden (Imaging) Verfahren zur in vivo – Diagnostik, wie beispielsweise NMR-Spektroskopie, zu nutzen. In diesem Fall könnten neben den L-Formen der Polypeptide auch die D-Formen (Enantiomere) eingesetzt werden.The object is achieved by polypeptides of the type mentioned, in which the at least one sequence motif of at least 9 consecutive octamers of a copper-binding, repetitive octamer of a prion protein (PrP) at least homologous and / or overlapping amino acid sequence, and in addition a contains soluble ingredient. Surprisingly, it has been shown that such polypeptides bind very specifically and extremely stably to the disease-specific isoform PrP ^Sc under defined conditions. The binding to the PrP ^Sc is inducible by addition of a chelating substance, for example EDTA, so that the polypeptides according to the invention can be used in a very targeted and controllable manner. In the absence of divalent cations or the presence of a corresponding chelator and at physiological pH, the polypeptides according to the invention bind PrP ^Sc with a very high association constant, while PrP ^{C is} only weakly bound under these conditions, so that it can be detected specifically after differential washing. A particular advantage of the polypeptides according to the invention lies in the fact that, in contrast to the previously known detection methods for PrP ^Sc , the treatment of the samples with protease can be dispensed with. As a result, the corresponding detection methods are much more sensitive and also simplified. The increasing insolubility of the sequence motif with increasing number of octamers is compensated by the fusion with a soluble component, so that overall there is a soluble polypeptide which is suitable for use in standardized test methods. An extension of the sequence motif, ie an increase in the number of octamers, leads to an increase in the specificity of the polypeptides of the invention to the point where the polypeptides are insoluble or no longer manageable or difficult to produce. Thus, the polypeptides of the invention allow a reliable distinction between the pathogenic isoform (PrP ^Sc ) and the normal host protein (PrP ^C ) and can thus be used in particular for the diagnosis of spongiform encephalopathies, for example for the detection of PrP ^Sc in blood samples. With the aid of the polypeptides according to the invention, for example, rapid tests can be carried out on a large number of animals (herd investigations). The investigation may be based on the presence of an infection with PrP ^Sc at an early stage (ante mortem), ie not only on brain homogenates, but also, for example, on samples of body fluids. Due to the strength of the binding of PrP ^Sc can be using the polypeptides of the invention samples, such as blood preserves, further completely from the patho gen prion proteins are purified. It would also be conceivable to administer the polypeptides according to the invention, which for this purpose would have to be coupled with a suitable substance, to a person to be examined and to use them in an imaging method for in vivo diagnostics, such as, for example, NMR spectroscopy. In this case, in addition to the L-forms of the polypeptides and the D-forms (enantiomers) could be used.

Die Octamere der erfindungsgemäßen Polypeptide, die als repetitive Sequenz das für die Bindung an PrP^Sc essentielle Sequenzmotiv bilden, sind Homologe der Kupfer-bindenden, repetitiven Octamere natürlicher Prionproteine (PrP) und/oder überlappen mit deren Aminosäuresequenz. Die Octamere des Prionproteins (PrP) haben dabei die Grundsequenz Pro-His-Gly-Gly-Gly-Trp-Gly-Gln, wobei innerhalb der repetitiven Sequenz, d.h. der 4 Octarepeats, der Startpunkt der sich wiederholenden Sequenz variieren kann. Erfindungsgemäße Octamere können daher alle aus der Sequenz Trp-Gly-Gln-Pro-His-Gly-Gly-Gly-Trp-Gly-Gln-Pro-His-Gly-Gly-Gly ausschneidbaren Octamere sein. Homologe Octamere im Sinne der Erfindung sind dabei alle Octamere, die sich von der entsprechenden Sequenz eines natürlichen Prionproteins durch den Austausch einer oder mehrerer Aminosäuren unterscheiden, wobei die Struktur und/oder Funktionalität des Sequenzmotivs erhalten bleibt. Beispielsweise kann in einem oder mehreren Oligomer(en) die Aminosäure nach dem zweiten Glycin – Rest entweder Glycin oder Serin sein.The octamers of the polypeptides according to the invention, which form the sequence motif essential for binding to PrP ^Sc as a repetitive sequence, are homologs of the copper-binding, repetitive octamers of natural prion proteins (PrP) and / or overlap with their amino acid sequence. The octameres of the prion protein (PrP) have the basic sequence Pro-His-Gly-Gly-Gly-Trp-Gly-Gln, wherein within the repetitive sequence, ie the 4 Octarepeats, the starting point of the repeating sequence can vary. Octamers according to the invention can therefore be all octamers which can be excised from the sequence Trp-Gly-Gln-Pro-His-Gly-Gly-Gly-Trp-Gly-Gln-Pro-His-Gly-Gly-Gly. Homologous octamers within the meaning of the invention are all octamers which differ from the corresponding sequence of a natural prion protein by the exchange of one or more amino acids, the structure and / or functionality of the sequence motif being retained. For example, in one or more oligomers, the amino acid after the second glycine residue may be either glycine or serine.

Zumindest ein Octamer der erfindungsgemäßen Polypeptide ist vorzugsweise aus der Gruppe der Aminosäuresequenzen gemäß Seq ID Nrn. 9 bis 24 ausgewählt. Dabei können innerhalb des Sequenzmotivs entweder gleiche Oligomere repetitiv miteinander verbunden oder unterschiedliche Oligomere miteinander kombiniert sein.At least an octamer of the polypeptides of the invention is preferably from the group of amino acid sequences according to Seq ID Nos. 9 to 24 selected. It can within the sequence motif, either identical oligomers are repetitive linked together or different oligomers combined be.

Vorzugsweise ist die Struktur der erfindungsgemäßen Polypeptide derart ausgebildet, dass sie spezifisch an eine der Aminosäuresequenzen Trp-Gly-Gln-Pro-His-Gly-Gly-Gly-Trp, Gly-Gln-Pro-His-Gly-Gly-Gly-Trp oder Trp-Gly-Gln-Pro-His-Gly-Gly-Gly, oder eine sich, vorzugsweise 4-mal, wiederholende Abfolge einer dieser Sequenzen bindet. Diese Sequenzbereiche innerhalb der Octarepeat-Region des PrP^Sc haben sich als bevorzugte Bindungsstellen für die erfindungsgemäßen Polypeptide erwiesen. Folglich ist die Interaktion des Sequenzmotivs der erfindungsgemäßen Polypeptide mit diesen Sequenzen für die spezifische Bindung des PrP^Sc von besonderer Bedeutung.Preferably, the structure of the polypeptides of the invention is designed to be specific to one of the amino acid sequences Trp-Gly-Gln-Pro-His-Gly-Gly-Gly-Trp, Gly-Gln-Pro-His-Gly-Gly-Gly-Trp or Trp-Gly-Gln-Pro-His-Gly-Gly-Gly, or a sequence, preferably 4 times, of one of these sequences. These sequence regions within the Octarepeat region of PrP ^Sc have proven to be preferred binding sites for the novel polypeptides. Consequently, the interaction of the sequence motif of the polypeptides according to the invention with these sequences is of particular importance for the specific binding of the PrP ^Sc .

Um eine ausreichend hohe Assoziationskonstante der Bindung an PrP^Sc zu gewährleisten, sollte das Sequenzmotiv in bevorzugter Ausgestaltung der Erfindung aus 10 bis 32, vorzugsweise 14 oder 16, Octameren bestehen. Eine solch hohe Anzahl von Octarepeats ist für die spezifische Unterscheidung zwischen PrP^C und PrP^Sc besonders vorteilhaft, wobei die Spezifität der erfindungsgemäßen Polypeptide mit steigender Anzahl von Octameren verbessert werden kann.In order to ensure a sufficiently high association constant of the binding to PrP ^Sc , the sequence motif in a preferred embodiment of the invention should consist of 10 to 32, preferably 14 or 16, octamers. Such a high number of octarepeats is particularly advantageous for the specific distinction between PrP ^C and PrP ^Sc , whereby the specificity of the polypeptides according to the invention can be improved with increasing number of octamers.

Als besonders vorteilhaft für die Anwendbarkeit der erfindungsgemäßen Polypeptide hat sich ferner herausgestellt, dass der lösliche Bestandteil Glutathion-S-Transferase (GST) ist.When especially advantageous for the applicability of the polypeptides of the invention has also been found that the soluble Component glutathione-S-transferase (GST) is.

Erfindungsgemäß bevorzugt sind dabei Polypeptide, die mit einer der Aminosäuresequenzen gemäß Seq ID Nrn. 1 bis 8 zumindest 90 % Homologie aufweisen.According to the invention preferred are polypeptides with one of the amino acid sequences according to Seq ID Nos. 1 to 8 have at least 90% homology.

Wenn ein zusätzlich gebundener, detektierbarer Bestandteil, vorzugsweise ein fluoreszierender, radioaktiver oder enzymatisch nachweisbarer Bestandteil, in dem erfindungsgemäßen Polypeptid enthalten ist, kann dieses auf einfache Art und Weise mit Hilfe von standardisierten Methoden detektiert und somit in jeder Form von Nachweisverfahren verwendet werden.If an additional bound, detectable component, preferably a fluorescent, radioactive or enzymatically detectable ingredient in which polypeptide of the invention This can be done in a simple way with the help detected by standardized methods and thus in any form be used by detection methods.

Die Erfindung umfasst ferner ein Nukleinsäuremolekül, mit einer Nukleotidsequenz, die für ein Polypeptid kodiert, wobei die Nukleotidsequenz ausgewählt ist aus der Gruppe bestehend aus

a) einer isolierten oder künstlichen Nukleotidsequenz, welche für das Polypeptid nach einem der Ansprüche 1 bis 9 kodiert,
b) einer Nukleotidsequenz, die zusätzlich zu einer Sequenz, die für ein lösliches Polypeptid kodiert, zumindest 9 aufeinanderfolgende Abschnitte gemäß Seq ID Nr. 25 als Insert enthält, und
c) einer Nukleotidsequenz, welche sich von den Nukleotidsequenzen gemäß a) oder b) durch den Austausch zumindest eines Codons gegen ein synonymes Codon unterscheidet.

The invention further includes a nucleic acid molecule having a nucleotide sequence encoding a polypeptide, wherein the nucleotide sequence is selected from the group consisting of

a) an isolated or artificial nucleotide sequence which codes for the polypeptide according to one of claims 1 to 9,
b) a nucleotide sequence which contains, in addition to a sequence which codes for a soluble polypeptide, at least 9 consecutive sections according to SEQ ID NO. 25 as insert, and
c) a nucleotide sequence which differs from the nucleotide sequences according to a) or b) by the exchange of at least one codon for a synonymous codon.

Da es aufgrund der Degeneriertheit des genetischen Codes möglich ist, bestimmte Codons durch andere Codons zu ersetzen, welche für die gleiche Aminosäure kodieren, ist die Erfindung nicht auf ein spezifisches Nukleinsäuremolekül beschränkt, das für ein Polypeptid gemäß der Erfindung kodiert, sondern schließt alle Nukleinsäuremoleküle ein, die für ein funktionelles Polypeptid kodieren. Die Erfindung schließt ferner Nukleinsäuremoleküle ein, die sich aufgrund von alternativem Splicing eines gemeinsamen prä-mRNA Moleküls von der als "Wildtyp" anerkannten Sequenz unterscheiden. Derartige Splicing-Mechanismen umfassen die alternative Verwendung von Exons, d.h. Nukleinsäuresequenzen, die für eine Aminosäuresequenz kodieren, die alternative Anordnung von Exons sowie das "nicht-Entfernen" von Introns, d.h. intervenierenden Sequenzen, die normalerweise nicht für eine Aminosäuresequenz kodieren, aus dem mRNA-Molekül.Since it is possible due to the degeneracy of the genetic code to replace certain codons with other codons which code for the same amino acid, the invention is not limited to a specific nucleic acid molecule which encodes, but includes, a polypeptide according to the invention all nucleic acid molecules encoding a functional polypeptide. The invention further includes nucleic acid molecules which differ from the sequence recognized as "wild-type" due to alternative splicing of a common pre-mRNA molecule. Such splicing mechanisms include the alternative use of exons, ie, nucleic acid sequences that encode an amino acid sequence, the alternative arrangement of exons, and the "non-removal" of introns, ie, intervening sequences that do not normally code for an amino acid sequence, from the mRNA -Molecule.

Die erfindungsgemäßen Nukleinsäuremoleküle können "operativ" mit einer regulatorischen Sequenz verknüpft sein, um die Expression des Nukleinsäuremoleküls zu ermöglichen. Ein Nukleinsäuremolekül wird als "fähig zur Expression einer Nukleinsäuresequenz" bezeichnet, wenn es Sequenzelemente umfasst, die Informationen hinsichtlich der Regulation von Transkription und/oder Translation enthalten, und diese Elemente "operativ" mit der das Polypeptid kodierenden Nukleinsäuresequenz verknüpft sind. Eine operative Verknüpfung ist eine Verknüpfung, bei der die regulatorischen Sequenzelemente und die proteinkodierende Sequenz derart verbunden sind, dass Genexpression möglich ist. Die genaue Beschaffenheit der zur Genexpression erforderlichen regulatorischen Bereiche kann zwischen verschiedenen Spezies variieren. In der Regel umfassen diese Bereiche jedoch einen Promotor, der in Prokaryonten aus dem Promotor per se besteht, d.h. DNA-Elemente, welche die Transkriptionsinitiation steuern, sowie aus DNA-Elementen, die nach ihrer Transkription in mRNA den Beginn der Translation regulieren. Solche Promotoren schließen normalerweise 5' nicht-kodierende Sequenzen ein, die an der Initiation von Transkription und Translation beteiligt sind, wie zum Beispiel die -35/-10-Elemente und das Shine-Dalgarno Element in Prokaryonten oder die TATA-Box, CAAT-Sequenzen und 5'-Capping-Elemente in Eukaryonten. Diese Regionen können ferner auch Enhancer- oder Repressorelemente enthalten sowie translatierte Signalsequenzen, um die native Polypeptidkette in ein spezielles Kompartiment der Wirtszelle zu dirigieren. Zusätzlich können auch die 3' nicht-kodierenden Regionen regulatorische Elemente enthalten, die an der Termination der Transkription, der Polyadenylierung und ähnlichem beteiligt sind. Falls diese Terminationssequenzen in einer speziellen Wirtszelle nicht oder nur unzureichend funktionell sind, können sie durch Signale ersetzt werden, die in der betreffenden Zelle ausreichend funktionell sind. Ein Nukleinsäuremolekül gemäß der Erfindung kann demnach eine regulatorische Sequenz, insbesondere eine Promotorsequenz umfassen. In einer anderen bevorzugten Ausführungsform umfasst das Nukleinsäuremolekül gemäß der Erfindung eine Promotorsequenz sowie eine Transkriptionsterminationssequenz. Geeignete prokaryontische Promotoren sind zum Beispiel der lacUV5-Promotor oder der T7-Promotor. Beispiele für geeignete eukaryontische Promotoren sind der SV40-Promotor oder der CMV-Promotor.The Nucleic acid molecules according to the invention may be used "operatively" with a regulatory Sequence linked be to allow the expression of the nucleic acid molecule. A nucleic acid molecule is said to be "capable of expressing a nucleic acid sequence" when It includes sequence elements containing information regarding regulation of transcription and / or translation, and these elements "operatively" with the polypeptide coding nucleic acid sequence connected are. An operative link is a link in which the regulatory sequence elements and the protein-coding Sequence are connected such that gene expression is possible. The exact nature of the regulatory gene required for gene expression Areas can vary between different species. Usually however, these regions include a promoter that is in prokaryotes from the promoter per se, i. DNA elements representing transcription initiation control, as well as DNA elements, after their transcription into mRNA regulate the beginning of translation. Such promoters usually close 5 'non-coding Sequences involved in the initiation of transcription and translation involved, such as the -35 / -10 elements and the Shine-Dalgarno element in prokaryotes or the TATA box, CAAT sequences and 5'-capping elements in eukaryotes. These regions can also contain enhancer or repressor elements as well as translated Signal sequences to the native polypeptide chain in a special To direct the compartment of the host cell. In addition, the 3 'noncoding regions can also be used contain regulatory elements involved in the termination of transcription, polyadenylation and the like involved. If these termination sequences in a special Host cells are not or only insufficiently functional, they can be replaced by signals sufficient in the cell concerned are functional. A nucleic acid molecule according to the invention may therefore have a regulatory sequence, in particular a promoter sequence include. In another preferred embodiment, the nucleic acid molecule according to the invention comprises a promoter sequence and a transcription termination sequence. Suitable prokaryotic promoters are, for example, the lacUV5 promoter or the T7 promoter. Examples of suitable eukaryotic Promoters are the SV40 promoter or the CMV promoter.

Die Nukleinsäuremoleküle gemäß der Erfindung können ferner in einem Vektor oder einem anderen Klonierungsvehikel enthalten sein, wie zum Beispiel Phagen, Phagemiden, Cosmiden, Baculoviren oder künstlichen Chromosomen. In einer bevorzugten Ausführungsform ist das Nukleinsäuremolekül in einem Vektor enthalten, insbesondere in einem Expressionsvektor. Ein derartiger Expressionsvektor kann neben den oben bereits beschriebenen regulatorischen Sequenzen und der Nukleinsäuresequenz, die ein Polypeptid umfassen, die von einem Organismus stammen, der mit dem zur Expression verwendeten Wirt kompatibel ist, sowie weiterhin mindestens einen Selektionsmarker, der einen selektierbaren Phänotyp auf eine transformierte Zelle überträgt, umfassen. Eine große Zahl geeigneter Vektoren, z.B. pBluescript, pUC18, pET oder pcDNA3, ist detailliert beschrieben und kommerziell erhältlich.The Nucleic acid molecules according to the invention can further contained in a vector or other cloning vehicle such as phages, phagemids, cosmids, baculoviruses or artificial Chromosomes. In a preferred embodiment, the nucleic acid molecule is in one Vector, in particular in an expression vector. Such a Expression vector can be in addition to the regulatory described above Sequences and the nucleic acid sequence, which comprise a polypeptide derived from an organism, the compatible with the host used for expression, as well as at least one selection marker that has a selectable phenotype transmits a transformed cell. A big Number of suitable vectors, e.g. pBluescript, pUC18, pET or pcDNA3, is described in detail and commercially available.

DNA-Moleküle, die für ein Polypeptid gemäß der Erfindung kodieren, und insbesondere ein Vektor, der die kodierende Sequenz eines solchen Polypeptids enthält, können in eine Zelle transformiert werden, die zur Expression dieser DNA-Moleküle geeignet ist. Die Transformation kann dabei mit Hilfe etablierter Standardverfahren durchgeführt werden. Die Erfindung betrifft daher auch eine Zelle, die ein erfindungsgemäßes Nukleinsäuremolekül oder einen dieses enthaltenden Vektor enthält.DNA molecules that for a Polypeptide according to the invention and in particular a vector encoding the coding sequence contains such a polypeptide, can be transformed into a cell suitable for expression of these DNA molecules is. The transformation can be done using established standard methods carried out become. The invention therefore also relates to a cell comprising a nucleic acid molecule according to the invention or a contains this vector containing.

Die transformierten Wirtszellen werden unter Bedingungen kultiviert, die zur Expression der Nukleotidsequenzen, die für ein Polypeptid gemäß der Erfindung kodieren, geeignet sind. Die verwendeten Wirtszellen können prokaryontischen Ursprungs sein, wie z.B. Escherichia coli (E. coli) oder Bacillus subtilis, oder eukaryontischen Ursprungs, wie etwa Saccharomyces cerevisiae, Pichia pastoris, SF9 oder High5 Insektenzellen, immortalisierte Säugetierzelllinien (z.B. HeLa-Zellen oder CHO-Zellen) oder primäre Säugetierzellen.The transformed host cells are cultured under conditions those for expression of the nucleotide sequences that are useful for a polypeptide according to the invention encode, are suitable. The host cells used can be prokaryotic Be originated, such. Escherichia coli (E. coli) or Bacillus subtilis, or of eukaryotic origin, such as Saccharomyces cerevisiae, Pichia pastoris, SF9 or High5 insect cells, immortalized Mammalian cell lines (e.g., HeLa cells or CHO cells) or primary Mammalian cells.

Die erfindungsgemäßen Polypeptide können beispielsweise mittels eines Verfahrens hergestellt werden, dass die folgenden Schritte umfasst:

(a) Klonieren eines erfindungsgemäßen Nukleinsäuremoleküls in einen geeigneten Vektor, und
(b) Einbringen des rekombinanten Vektors in eine geeignete Wirtszelle oder einen geeigneten Zellextrakt.

The polypeptides according to the invention can be prepared, for example, by means of a process comprising the following steps:

(a) cloning a nucleic acid molecule of the invention into a suitable vector, and
(b) introducing the recombinant vector into a suitable host cell or cell extract.

Die erfindungsgemäßen Polypeptide können aber auch synthetisch hergestellt werden.The polypeptides of the invention can but also synthetically produced.

Schritt (a) kann dabei mit einem Nukleinsäuremolekül durchgeführt werden, das nur für das Polypeptid kodiert. Alternativ kann er aber auch mit einem Nukleinsäuremolekül durchgeführt werden, in dem das Polypeptid operativ mit einer regulatorischen Sequenz verknüpft ist. Optional kann das Nukleinsäuremolekül gemäß der Erfindung auch mit einem Fusionspartner verknüpft sein, wie etwa einem Affinitätsepitop, das eine einfache Reinigung und/oder Detektion des rekombinanten Proteins erlaubt. Die Expression der so klonierten Nukleinsäuremoleküle kann in einer rekombinanten Zelle oder einem Zellextrakt erfolgen, die/der alle für die Transkription und Translation erforderlichen Faktoren enthält.step (a) can be carried out with a nucleic acid molecule which codes only for the polypeptide. Alternatively, however, it can also be carried out with a nucleic acid molecule in which the polypeptide operatively linked to a regulatory sequence. Optionally, that can Nucleic acid molecule according to the invention also be associated with a fusion partner, such as an affinity epitope, this is a simple purification and / or detection of the recombinant Protein allowed. The expression of the thus-cloned nucleic acid molecules can take place in a recombinant cell or a cell extract, the / all for contains the factors required for transcription and translation.

Die Erfindung umfasst auch ein antigenbindendes Peptid, insbesondere Antikörper oder Fragmente von Antikörpern, welches spezifisch an das erfindungsgemäße Polypeptid bindet. Bevorzugt sind dabei monoklonale Antikörper sowie entsprechende F_ab- bzw. scFv-Fragmente, mit denen die erfindungsgemäßen Polypeptide spezifisch nachgewiesen werden können.The invention also encompasses an antigen-binding peptide, in particular antibodies or fragments of antibodies, which specifically binds to the polypeptide according to the invention. Preference is given to monoclonal antibodies and corresponding F _ab and scFv fragments with which the polypeptides according to the invention can be specifically detected.

Die Erfindung umfasst ferner ein Kit, welches das Polypeptid nach der Erfindung, ein erfindungsgemäßes Nukleinsäuremolekül, einen dieses enthaltenden Vektor, zumindest eine Zelle, wie oben beschrieben, und/oder das antigenbindendes Peptid enthält. Ein solcher Kit wird vorzugsweise zum Nachweis der pathologischen Isoform eines Prionproteins (PrP^Sc) verwendet, beispielsweise in Form eines „ante mortem"- Schnelltests zur Herdenuntersuchung.The invention further comprises a kit which contains the polypeptide according to the invention, a nucleic acid molecule according to the invention, a vector containing it, at least one cell as described above, and / or the antigen-binding peptide. Such a kit is preferably used to detect the pathological isoform of a prion protein (PrP ^Sc ), for example in the form of an "ante mortem" rapid test for herd examination.

Die Erfindung umfasst ebenfalls eine pharmazeutische Zusammensetzung, welche das erfindungsgemäße Polypeptid, das Nukleinsäuremolekül nach der Erfindung, einen dieses enthaltenden Vektor und/oder das antigenbindende Peptid, sowie vorzugsweise übliche Hilfs- und/oder Trägerstoffe, enthält. Die pharmazeutischen Zusammensetzung wird bevorzugt zur therapeutischen oder präventiven Behandlung von spongiformen Enzephalopathien verwendet.The Invention also encompasses a pharmaceutical composition, which the polypeptide of the invention, the nucleic acid molecule according to Invention, a vector containing this and / or the antigen-binding Peptide, and preferably conventional Auxiliaries and / or carriers, contains. The pharmaceutical composition is preferred for therapeutic or preventive Treatment of spongiform encephalopathies used.

Die Aufgabe wird erfindungsgemäß ferner durch ein Verfahren der eingangs genannten Art gelöst, bei dem als Biomolekül zumindest das Sequenzmotiv des erfindungsgemäßen Polypeptids eingesetzt wird und bei dem die Inkubation unter Anwesenheit einer chelatbildenden Substanz erfolgt, wobei die Fraktion der Probe mit dem gebundenen pathologischen Prionprotein (PrP^Sc) anschließend von der Fraktion der Probe mit gebundenen normalen Prionprotein (PrP^C) getrennt wird. Mit dem erfindungsgemäßen Verfahren, bei dem die Biomoleküle spezifisch und sehr stabil an die krankheitsspezifische Isoform PrP^Sc binden, kann die pathologische Form des Prionproteins spezifisch und zuverlässig nachgewiesen werden. Die Bindung der Biomoleküle an das PrP^Sc ist dabei durch die Zugabe der chelatbildenden Substanz, d. h. also durch das Abfangen von Metallionen, induzierbar. Das erfindungsgemäße Verfahren ist damit selektiv und gezielt steuerbar. In Abwesenheit divalenter Kationen und bei physiologischem pH-Wert bindet das Sequenzmotiv der erfindungsgemäßen Polypeptide PrP^Sc mit sehr hoher Assoziationskonstante, während PrP^C unter diesen Bedingungen nur schwach gebunden wird, so dass PrP^Sc beispielsweise nach differentiellem Waschen, d.h. der Behandlung mit einer definierten Waschlösung, spezifisch detektiert werden kann. Das Waschen sollte dabei unter harschen Bedingungen erfolgen, d.h. Bedingungen, unter denen gebundenes PrP^C vollständig ausgewaschen wird, während die Bindung an das PrP^Sc erhalten bleibt. Aufgrund der besonders starken Bindung des PrP^Sc durch das Sequenzmotiv der erfindungsgemäßen Polypeptide ist eine Trennung der Fraktionen unter sehr stringenten Bedingungen möglich, was die Spezifität des Verfahrens in vorteilhafter Weise erhöht. Ein besonderer Vorteil des erfindungsgemäßen Verfahrens liegt auch darin, dass im Gegensatz zu den bisher bekannten Nachweisverfahren für PrP^Sc auf die Behandlung der Proben mit Protease verzichtet werden kann. Hierdurch wird das erfindungsgemäßen Verfahren deutlich vereinfacht und zudem kostengünstiger. Das erfindungsgemäße Verfahren ermöglicht also eine zuverlässige Unterscheidung zwischen der pathogenen Isoform (PrP^Sc) und dem normalen Wirtsprotein (PrP^C) und dient somit insbesondere der Diagnose von spongiformen Enzephalopathien, beispielsweise dem Nachweis von PrP^Sc in Blutproben. Mit Hilfe des erfindungsgemäßen Verfahrens können beispielsweise Schnelltests an einer großen Anzahl von Tieren durchgeführt werden (Herdenuntersuchungen). Dabei kann die Untersuchung auf das Vorliegen einer Infektion mit PrP^Sc in einem frühen Stadium erfolgen (ante mortem), d.h. nicht nur an Hirnhomogenaten, sondern beispielsweise auch an Proben von Körperflüssigkeiten. Es wäre auch denkbar, das erfindungsgemäße Verfahren in Form eines bildgebenden (Imaging) Verfahrens zur in vivo – Diagnostik, wie beispielsweise NMR-Spektroskopie, zu nutzen. Als Biomoleküle werden dabei entweder die erfindungsgemäßen Polypeptide oder andere Moleküle eingesetzt, die zumindest das bindungsspezifische Sequenzmotiv der erfindungsgemäßen Polypeptide enthalten.The object is further achieved according to the invention by a method of the type mentioned, in which at least the sequence motif of the polypeptide according to the invention is used as the biomolecule and in which the incubation takes place in the presence of a chelating substance, wherein the fraction of the sample with the bound pathological prion protein (PrP ^Sc ) is subsequently separated from the fraction of the sample bound with normal prion protein (PrP ^C ). With the method according to the invention, in which the biomolecules bind specifically and very stably to the disease-specific isoform PrP ^Sc , the pathological form of the prion protein can be detected specifically and reliably. The binding of the biomolecules to the PrP ^Sc is inducible by the addition of the chelating substance, ie by the trapping of metal ions. The inventive method is thus selectively and selectively controllable. In the absence of divalent cations and at physiological pH, the sequence motif of the polypeptides according to the invention binds PrP ^Sc with very high association constant, while PrP ^{C is} only weakly bound under these conditions, so that PrP ^Sc for example after differential washing, ie the treatment with a defined washing solution , can be specifically detected. The washing should be carried out under harsh conditions, ie conditions under which bound PrP ^{C is} completely washed out, while the binding to the PrP ^Sc is retained. Due to the particularly strong binding of PrP ^Sc by the sequence motif of the polypeptides of the invention, a separation of the fractions is possible under very stringent conditions, which advantageously increases the specificity of the method. A particular advantage of the method according to the invention is also that, in contrast to the previously known detection methods for PrP ^Sc , the treatment of the samples with protease can be dispensed with. As a result, the inventive method is significantly simplified and also cheaper. Thus, the method according to the invention makes possible a reliable distinction between the pathogenic isoform (PrP ^Sc ) and the normal host protein (PrP ^C ) and thus serves in particular for the diagnosis of spongiform encephalopathies, for example the detection of PrP ^Sc in blood samples. With the aid of the method according to the invention, rapid tests can be carried out on a large number of animals, for example (herd investigations). The investigation may be based on the presence of an infection with PrP ^Sc at an early stage (ante mortem), ie not only on brain homogenates, but also, for example, on samples of body fluids. It would also be conceivable to use the method according to the invention in the form of an imaging method for in vivo diagnostics, such as, for example, NMR spectroscopy. Either the polypeptides according to the invention or other molecules which contain at least the binding-specific sequence motif of the polypeptides according to the invention are used as biomolecules.

In bevorzugter Ausführung des erfindungsgemäßen Verfahrens ist vorgesehen, dass als chelatbildende Substanz ein Komplexbildner für divalente Kationen, vorzugsweise Ethylendiamintetraessigsäure (EDTA), zugegeben wird. Durch das Abfangen der Metallionen, insbesondere von Cu²⁺-Ionen oder Zn²⁺-Ionen, wird die Spezifität des Verfahrens in vorteilhafter Weise induziert, so dass die pathologische Isoform des Prionproteins (PrP^Sc) gezielt nachgewiesen werden kann.In a preferred embodiment of the process according to the invention, it is provided that a complexing agent for divalent cations, preferably ethylenediaminetetraacetic acid (EDTA), is added as the chelating substance. By intercepting the metal ions, in particular Cu ²⁺ ions or Zn ²⁺ ions, the specificity of the method is advantageously induced so that the pathological isoform of the prion protein (PrP ^Sc) can be selectively detected.

In besonders vorteilhafter Ausgestaltung des erfindungsgemäßen Verfahrens ist vorgesehen, die Trennung der Fraktionen durch Waschen mit einer Lösung durchzuführen, die 0,1 bis 2,0 % Natriumdodecylsulfat (SDS), vorzugsweise 0,5 SDS, und/oder 1 bis 10 mol/l Harnstoff enthält.In particularly advantageous embodiment of the method according to the invention is provided, the separation of the fractions by washing with a solution perform, the 0.1 to 2.0% sodium dodecyl sulfate (SDS), preferably 0.5 SDS, and / or 1 to 10 mol / l of urea.

In weiterer Ausgestaltung des erfindungsgemäßen Verfahrens ist vorgesehen, dass das durch das Biomolekül gebundene Prionprotein durch die anschließende spezifische Bindung eines detektierbaren Moleküls nachgewiesen wird oder dass das durch das Prionprotein gebundene Biomolekül durch die anschließende spezifische Bindung eines detektierbaren Moleküls, insbesondere des antigenbindenden Peptids gemäß der Erfindung, nachgewiesen wird. Das detektierbare Molekül ist dabei vorzugsweise ein, insbesondere monoklonaler, Antikörper oder ein Fragment eines Antikörpers, der/das spezifisch an das Prionprotein oder das Biomolekül bindet. Das detektierbare Molekül kann entweder spezifisch an das Biomolekül oder das Prionprotein binden. Bevorzugt erfolgt der Nachweis des pathologischen Prionproteins (PrP^Sc) dabei mittels ELISA oder Dipstick-Technologie.In a further embodiment of the method according to the invention it is provided that the bound by the biomolecule prion protein is detected by the subsequent specific binding of a detectable molecule or that bound by the prion protein biomolecule by the subsequent specific binding of a detectable molecule, in particular of the antigen-binding peptide according to the invention , is demonstrated. The detectable molecule is preferably a, in particular monoclonal, antibody or a fragment of an antibody that binds specifically to the prion protein or the biomolecule. The detectable molecule can either bind specifically to the biomolecule or the prion protein. The detection of the pathological prion protein (PrP ^Sc ) preferably takes place by means of ELISA or dipstick technology.

Das pathologische Prionprotein (PrP^Sc) kann durch die Bindung an das, vorzugsweise immobilisierte, Biomolekül beispielsweise auch konzentriert oder aufgereinigt werden. Das Biomolekül wird dabei in vorteilhafter Ausgestaltung der Erfindung an ein geeignetes Säulenmaterial, eine Membran, Sepharose-Kügelchen (beads) oder Ähnliches gekoppelt, so dass auch größere Volumina der zu entsprechenden Probe behandelt werden können. Auf diese Weise können beispielsweise auch Blutproben vollständig von den pathogenen Prionproteinen gereinigt werden. Außerdem ist es möglich, größere Mengen des PrP^Sc zu reinigen, die dann zur Strukturbestimmung eingesetzt werden können.The pathological prion protein (PrP ^Sc ) can also be concentrated or purified, for example, by binding to the, preferably immobilized, biomolecule. The biomolecule is coupled in an advantageous embodiment of the invention to a suitable column material, a membrane, Sepharose beads or the like, so that larger volumes of the corresponding sample can be treated. In this way, for example, blood samples can be completely purified from the pathogenic prion proteins. In addition, it is possible to purify larger amounts of PrP ^Sc , which can then be used for structure determination.

In besonders vorteilhafter Ausgestaltung des erfindungsgemäßen Verfahrens wird die Bindung des Prionproteins an das Biomolekül bei einem pH-Wert > 7, vorzugsweise pH 7,5, durchgeführt, da bei niedrigem pH-Wert keine Bindung erfolgt bzw. diese schwächer wird.In particularly advantageous embodiment of the method according to the invention is the binding of the prion protein to the biomolecule in a pH> 7, preferably pH 7.5, performed, because at low pH, no binding occurs or it becomes weaker.

Das Sequenzmotiv des erfindungsgemäßen Polypeptids kann in immobilisierter Form zum Nachweis der pathologischen Isoform eines Prionproteins (PrP^Sc) oder zur Reinigung einer mit der pathologischen Isoform eines Prionproteins (PrP^Sc) infizierten Probe verwendet werden. Da bei Immobilisierung des Sequenzmotivs die Löslichkeit desselben keinen besonderen Einfluss auf die Funktionalität des Peptids hat, kann bei entsprechenden Anwendungen auf die Fusion mit einem löslichen Peptid verzichtet werden. Die Immobilisierung kann beispielsweise durch die Kopplung an ein geeignetes Säulenmaterial, eine Membran, Sepharose-Kügelchen (beads) oder Ähnliches erfolgen. Auf diese Weise immobilisierte Peptide können zum Nachweis von Prionerkrankungen oder der Reinigung von mit Prionproteinen infiziertem Material verwendet werden.The sequence motif of the polypeptide according to the invention can be used in immobilized form for the detection of the pathological isoform of a prion protein (PrP ^Sc ) or for the purification of a sample infected with the pathological isoform of a prion protein (PrP ^Sc ). Since the solubility of the sequence motif does not have a particular influence on the functionality of the peptide when immobilized on the sequence motif, fusion with a soluble peptide can be dispensed with in appropriate applications. Immobilization can be accomplished, for example, by coupling to a suitable column material, membrane, Sepharose beads or the like. Peptides immobilized in this way can be used to detect prion diseases or to purify prion protein-infected material.

Klonierung und Expression von Glutathion-S-Transferase (GST), die N-terminal an die physiologische (PrP^C, hier auch als „Wildtyp" bezeichnet) und die verlängerte Octarepeat (OR) – Domäne gekoppelt ist: Die verlängerte Octarepeat-Domäne (expOR), d.h. das bindungsspezifische Sequenzmotiv eines erfindungsgemäßen Polypeptids, die bzw. das aus 14 konsekutiven Octameren besteht, wurde aus den folgenden Oligomeren zusammengesetzt und kloniert:
ORfwd GGCTGGGGGCAGCCCCATGGTGGT mit 5' – Phosphat
ORrev CTGCCCCCAGCCACCACCATGGGG mit 5' – Phosphat
ORrevBamHI GGATCCGCGCGCGCGC mit 5' – Phosphat
ORfwdBamHI GCGCGCGCGCGGATCCCCCCATGGTGGT
ORrevEcoRI TCTCTCTCTCGAATTCTTATCA
ORfwdEcoRI GGCTGGGGGCAGTGATAAGAATTCGAGAGAGAGA mit 5' – PhosphatCloning and expression of glutathione-S-transferase (GST), which is N-terminally coupled to the physiological (PrP ^C , also referred to herein as "wild-type") and the extended octarepeat (OR) domain: the extended octarepeate domain (FIG. expOR), ie the binding-specific sequence motif of a polypeptide according to the invention, which consists of 14 consecutive octamers, was composed and cloned from the following oligomers:
ORfwd GGCTGGGGGCAGCCCCATGGTGGT with 5 '- phosphate
ORrev CTGCCCCCAGCCACCACCATGGGG with 5 '- phosphate
ORrevBamHI GGATCCGCGCGCGCGC with 5 '- phosphate
ORfwdBamHI GCGCGCGCGCGGATCCCCCCATGGTGGT
ORrevEcoRI TCTCTCTCTCGAATTCTTATCA
ORfwdEcoRI GGCTGGGGGCAGTGATAAGAATTCGAGAGAGAGA with 5 '- phosphate

Zunächst wurden zur Herstellung eines „Capping"-Fragmentes jeweils 25 μM der Oligonukleotide ORrevBamHI, ORfwdBamHI and ORrev vereinigt und mittels T4-Ligase ligiert (18 h, 16°C). Dieser "Capping-Mix" wurde dann in einem molaren Verhältnis von 1:50 zu 20 μM ORrev und ORfwd in 10 mM Tris pH 8 gegeben und für 1 Stunde bei 40°C inkubiert. Anschließend wurden 250 pmol ORrevBamHI, ORfwdBamHI, ORrevEcoRI und ORfwdEcoRI zugegeben und diese Mischung wiederum mit T4-Ligase ligiert (18 h, 16°C). Diese Vorgehensweise führte zu einer Reihe von DNA-Fragmenten mit untreschiedlichen Längen der Octarepeat-Domäne. Die Produkte mit einer Länge von 200 bis 500 bp, was ungefähr 8 bis 20 konsekutiven Octameren entspricht, wurden aus einem Agarose-Gel isoliert und mit BamHI and EcoRI verdaut.At first were for making a "capping" fragment respectively 25 μM of Oligonucleotides ORrevBamHI, ORfwdBamHI and ORrev combined and by means of T4 ligase ligated (18 h, 16 ° C). This "capping mix" was then in one molar ratio from 1:50 to 20 μM ORrev and ORfwd in 10 mM Tris pH 8 and incubated for 1 hour at 40 ° C. Subsequently were 250 pmol ORrevBamHI, ORfwdBamHI, ORrevEcoRI and ORfwdEcoRI added and this mixture in turn ligated with T4 ligase (18 h, 16 ° C). This procedure resulted to a series of DNA fragments with indefinite lengths of Octarepeat domain. The Products with a length from 200 to 500 bp, which is about 8 to 20 consecutive octamers were obtained from an agarose gel isolated and digested with BamHI and EcoRI.

Das „Wildtyp"-PrP-Octarepeat- (wtOR) Fragment wurde mittels PCR aus dem Vektor pET-11a(SyHaPrP(23-231)) amplifiziert und aus einem Agarose-Gel isoliert. Nach der Reinigung aus dem Agarose-Gelen wurden die verlängerten (expOR) und die „Wildtyp"-(wtOR) DNA-Fragmente im Leseraster mit der kodierenden Region der Glutathion-S-Transferase (GST) in den Expressionsvektor pGEX-4T-3 (Amersham) in die BamHI/EcoRI – Schnittstelle kloniert. In diesem Konstrukt ist der GST-Abschnitt (26 kDa) von seinem Fusionspertner durch eine Thrombin-Schnittstelle (LVPRGS) getrennt. Positive Klone wurden mittels automatischer Fluoreszenz-Sequenzierung ermittelt.The "wild type" -PrP octarepeate (wtOR) fragment was amplified by PCR from the vector pET-11a (SyHaPrP (23-231)) amplified and isolated from an agarose gel. After cleaning from the agarose gels were the extended (expOR) and the "wild type" (wtOR) DNA fragments in frame with the coding region of glutathione-S-transferase (GST) into the expression vector pGEX-4T-3 (Amersham) into the BamHI / EcoRI site cloned. In this construct, the GST section (26 kDa) of its fusion partner through a thrombin interface (LVPRGS) separated. Positive clones were detected by automated fluorescence sequencing determined.

GST-OR-Fusionsproteine und ungekoppeltes GST (nur Vektor) wurden in Escherichia coli BL21(λDE3) exprimiert. Frische transformierte Zellen wurden in Luria-Bertoni-Medium bis zur mittleren log-Phase angezogen und mit 1 mM Isopropyl-β-D-Thiogalactopyranosid induziert. Nach 3 Stunden wurden die Zellen geerntet, in 50 mM Tris pH 8, 2 mM EDTA, 1 % NP-40, 0.1 mg/ml Lysozym (30 min, 30°C) lysiert und anschließend 30 Minuten mit Dnase I, 5 mM MgCl₂ bei 30°C inkubiert. Mit dem geklärten Lysat (30 min bei 10.000 g) wurde eine Glutathion-Sepharose-Säule (Amersham) beladen, die mit 50 mM Tris pH 8, 150 mM NaCl, 1 % NP-40, 0.2% Sarkosyl, 1 mM EDTA gewaschen und mit 50 mM Tris pH 8.5, 10 mM reduziertem Glutathion (GSH), 2 mM Dithiothreitol (DTT) bei Raumtemperatur eluiert wurde. Alle GST-Proteine wurden dann mit 50 mM Iodoaetamid für 30 min bei Raumtemperatur behandelt, um freie Cystein-Reste im GST-Abschnitt zu blocken. Anschließend wurden die GST-wtOR- und GST-expOR-Eluate auf 300 mM NaCl gebracht, mittels Filtration geklärt und auf eine Zn²⁺-Nitriloessigsäure-Agarose-Säule geladen (ungefähr 1 und 5 mg Protein pro ml Perlen für GST-expOR bzw. GST-wtOR). Die Metallaffinitätssäule wurde mit 20 mM Tris pH 8, 5 mM Imidazol, 300 mM NaCl gewaschen und mit 20 mM Tris pH 8, 200 mM Imidazol, 300 mM Imidazol eluiert. Nach Zugabe von 5 mM EDTA, wurden GST-wtOR und GST-expOR zweimal gegen Reinstwasser dialysiert (1:100, Snakeskin, Pierce).GST-OR fusion proteins and uncoupled GST (vector only) were expressed in Escherichia coli BL21 (λDE3). Fresh transformed cells were grown in Luria-Bertoni medium until mid-log phase and induced with 1 mM isopropyl-β-D-thiogalactopyranoside. After 3 hours, the cells were harvested, lysed in 50mM Tris pH 8, 2mM EDTA, 1% NP-40, 0.1mg / ml lysozyme (30min, 30 ° C) and then with Dnase I, 5mM MgCl for 30 min ₂ incubated at 30 ° C. The clarified lysate (30 min at 10,000 g) was loaded with a Glutathione Sepharose column (Amersham) washed with 50 mM Tris pH 8, 150 mM NaCl, 1% NP-40, 0.2% Sarkosyl, 1 mM EDTA, and eluted with 50 mM Tris pH 8.5, 10 mM reduced glutathione (GSH), 2 mM dithiothreitol (DTT) at room temperature. All GST proteins were then treated with 50 mM iodoacetamide for 30 min at room temperature to block free cysteine residues in the GST segment. Subsequently, the GST wtOR and GST-expOR eluates were brought to 300 mM NaCl, clarified by filtration and loaded onto a Zn ²⁺ nitriloacetic acid agarose column (approximately 1 and 5 mg protein per ml beads for GST-expOR resp GST-wtOR). The metal affinity column was washed with 20 mM Tris pH 8, 5 mM imidazole, 300 mM NaCl and eluted with 20 mM Tris pH 8, 200 mM imidazole, 300 mM imidazole. After addition of 5 mM EDTA, GST-wtOR and GST-expOR were dialysed twice against ultrapure water (1: 100, Snakeskin, Pierce).

GST, GST-wtOR and GST-expOR wurden in 50 mM NaHCO₃, pH 8.3, 1 % NP40 (0.1–0.5 mg/ml Protein, 4 mg Protein pro ml Perlen) für 2 Stunden bei Raumtemperatur kovalent an NHS-aktivierte Sepharose (Amersham) gekoppelt. Die „beads" wurden in 50 mM Hydroxylamin, pH 7.5 (30 min, Raumtemperatur) geblockt, und nacheinander mit 50 mM Tris, pH 8.8, 50 mM Na-Acetat, pH 4.6, 50 mM HEPES, pH 7.5, 1 % Sarkosyl, 2 mM EDTA und dann 50 mM HEPES, pH 7.5, 300 mM NaCl, 0.6% NP-40, 0.3% Sarkosyl gewaschen.GST, GST-WTOR and GST-Expor were in 50 mM NaHCO _3, pH 8.3, 1% NP40 (0.1-0.5 mg / ml protein, 4 mg protein per ml beads) for 2 hours at room temperature covalently attached to NHS-activated Sepharose ( Amersham) coupled. The "beads" were blocked in 50 mM hydroxylamine, pH 7.5 (30 min, room temperature), and washed successively with 50 mM Tris, pH 8.8, 50 mM Na acetate, pH 4.6, 50 mM HEPES, pH 7.5, 1% sarcosyl, 2mM EDTA and then 50mM HEPES, pH 7.5, 300mM NaCl, 0.6% NP-40, 0.3% Sarkosyl.

Nachweis von PrP^C und PrP^Sc in Hirnextract durch GST-Octarepeat-Fusionspeptide:
Homogenate des Gehirns von gesunden oder Scrapie-infizierten Hamstern wurden in 50 mM HEPES/Na-Acetat, pH 7.5/4.6, 300 mM NaCl, 0.6% NP40, 0.3% Sarkosyl (Puffer B/7.5 oder B/4.5) auf 1 % (w/v) verdünnt, mit Proteaseinhibitoren (Roche), 1 mM Phenylmethylsulfonylfluorid (PMSF) und 0–200 μM CuSO₄/ZnSO₄ oder 5 mM EDTA (Endkonzentrationen) versetzt und bei 10.000 g geklärt. 500 μl Extrakt wurde mit 20 μl Sepharose-gekoppeltem GST/GST-Octarepeat-Fusionspeptid gemischt and „end-over-end" über Nacht bei 4°C inkubiert. Die „beads" wurden gewaschen und dann 2x in Probenpuffer für die Natriumdodecylsulphat-Polyacrylamid-Gelelectrophorese (SDS-PAGE) gekocht. Die Hälfte der mit Scrapie-Extrakt inkubierten "beads" wurden gekocht, während die andere Hälfte zunächst in 20 μl Puffer B/7.5 mit 100 μg/ml Proteinase K (PK; Merck) für 1 Stunde bei 37°C (gestoppt mit 5 mM PMSF) inkubiert wurde. Die Proben auf 12.5%igen Criterion-Gelen (Biorad) aufgetrennt und auf Polyvinylidenfluorid geblottet. Alle Blots wurden mit dem monoklonalen Antikörper mAB 3F4, der Hamster-PrP erkennt, entwickelt.Detection of PrP ^C and PrP ^Sc in Hirnextract by GST Octarepeal Fusion Peptides:
Brain homogenates from healthy or scrapie-infected hamsters were incubated in 50 mM HEPES / Na acetate, pH 7.5 / 4.6, 300 mM NaCl, 0.6% NP40, 0.3% sarcosyl (buffer B / 7.5 or B / 4.5) to 1% ( w / v), added with protease inhibitors (Roche), 1 mM phenylmethylsulfonyl fluoride (PMSF) and 0-200 μM CuSO ₄ / ZnSO ₄ or 5 mM EDTA (final concentrations) and clarified at 10,000 g. 500 μl extract was mixed with 20 μl Sepharose-coupled GST / GST octarepeal fusion peptide and incubated "end-over-end" overnight at 4 ° C. The beads were washed and then 2x in sample buffer for the sodium dodecyl sulphate polyacrylamide Gel electrophoresis (SDS-PAGE). Half of the "beads" incubated with scrapie extract were boiled, the other half first in 20 μl Buffer B / 7.5 with 100 μg / ml proteinase K (PK; Merck) for 1 hour at 37 ° C (stopped with 5 mM PMSF) was incubated. The samples were separated on 12.5% Criterion gels (Biorad) and blotted onto polyvinylidene fluoride. All blots were developed with the monoclonal antibody mAB 3F4, which recognizes hamster PrP.

Die Erfindung wird im weiteren durch die folgenden Figuren beispielhaft näher erläutert.The The invention will be further exemplified by the following figures explained in more detail.

1 zeigt eine Western-Blot-Analyse der Bindung von PrP^C durch GST-wtOR-Fusionspeptide („Wildtyp") und erfindungsgemäße Polypeptide (GST-expOR-Fusionspeptide) in Abhängigkeit von der Metallionen- Konzentration bei physiologischem (A und B) und niedrigem (D) pH-Wert sowie das Lösen der Bindung (C). 1 shows a Western blot analysis of the binding of PrP ^C by GST-wtOR fusion peptides ("wild-type") and polypeptides according to the invention (GST-expOR fusion peptides) as a function of the metal ion concentration at physiological (A and B) and low ( D) pH and dissolution of the bond (C).

2 zeigt eine Western-Blot-Analyse der Bindung von PrP^Sc durch GST-wtOR-Fusionspeptide („Wildtyp") und erfindungsgemäße Polypeptide (GST-expOR-Fusionspeptide) in Abhängigkeit von der Anwesenheit von Metallionen bei physiologischem (A) und niedrigem (B) pH-Wert. 2 Figure 4 shows a Western blot analysis of the binding of PrP ^Sc by GST wtOR fusion peptides ("wild-type") and polypeptides of the invention (GST-expOR fusion peptides), depending on the presence of metal ions at physiological (A) and low (B) levels. PH value.

3 zeigt eine graphische Zusammenfassung der Bindungseigenschaften der GST-OR-Fusionspeptide für „Wildtyp" (A) und erfindungsgemäße Polypeptide (B). 3 Figure 4 shows a graphic summary of the binding properties of the GST-OR fusion peptides for "wild-type" (A) and polypeptides (B) of the invention.

4 zeigt eine Western-Blot-Analyse zur Bestimmung der kritischen Länge des Sequenzmotivs, die für die stabile Bindung der erfindungsgemäßen Polypeptide an PrP^Sc in Gegenwart von EDTA notwendig ist. 4 shows a Western blot analysis to determine the critical length of the sequence motif, which is necessary for the stable binding of the polypeptides of the invention to PrP ^Sc in the presence of EDTA.

5 zeigt einen Western-Blot zum Nachweis des differentiellen Auswaschens von PrP^C unter Bedingungen, bei denen PrP^Sc von terminal kranken Hamstern an immobilisierte erfindungsgemäße Polypeptide gebunden bleibt. 5 Figure 4 shows a Western blot for detection of differential washout of PrP ^C under conditions where PrP ^Sc of terminally ill hamsters remains bound to immobilized polypeptides of the invention.

6 zeigt einen Western-Blot zum Nachweis des differentiellen Auswaschens von PrP^C unter Bedingungen, bei denen PrP^Sc von gesunden Hamstern 42 Tage nach der Infektion an immobilisierte erfindungsgemäße Polypeptide gebunden bleibt. 6 Figure 3 shows a Western blot for detection of differential washout of PrP ^C under conditions in which PrP ^Sc of healthy hamsters remains bound to immobilized polypeptides of the invention 42 days after infection.

7 zeigt einen Western-Blot einer Peptidbank zur Kartierung potentieller Bindungsstellen für das erfindungsgemäße Polypeptid in der Octarepeat-Region des Prionproteins. 7 Figure 3 shows a western blot of a peptide library for mapping potential binding sites for the polypeptide of the invention in the octarepeate region of the prion protein.

1: Bindung von nativem PrP^C durch immobilisierte Polypeptide in Abhängigkeit von Metallionen-Konzentration und pH Wert. 1 : Binding of native PrP ^C by immobilized polypeptides as a function of metal ion concentration and pH.

(A) Binding of PrP C by Sepharose-Coupled Free GST, Normal (PrP C ) Mouse PrP (GST-MoPrP (52-98)), and a 14-octamer Polypeptide of the Invention (GST-MoPrP-14OR (52-98) ) in 50 mM HEPES, pH 7.5, 300 mM NaCl, 0.6% NP40, 0.3% Sarkosyl in the presence of 5 mM EDTA (ED) or 50-200 μM CuSO 4 .
(B) ditto, but with 50-200 μM ZnSO 4 . The analysis shows that both the polypeptide with the physiological sequence motif (GST-MoPrP (52-98)) and the polypeptide of the invention (MoPrP-14OR (52-98)) PrP C from the hamster extract of hamsters in the presence of copper or Zinc ions can bind, while the erfindungsmäße polypeptide, in contrast to the "normal", PrP C can bind even in the absence of metal ions.
(C) binding of PrP C by coupled to GSH-Sepharose normal (PrP C) mouse PrP (GST-MoPrP (52-98)) and polypeptide of the invention with 14 octamers (GST-MoPrP-14OR (52-98)) in 50 mM HEPES, pH 7.5, 150 mM NaCl, 0.5% Triton X-100, 0.5% DOC, 0-200 μM ZnSO 4 and detaching the bound PrP with 50 mM HEPES, pH 7.5, 150 mM NaCl, 1% Triton X- 100, 0.3% sarcosyl, 10mM EDTA. This experiment shows that the binding between the polypeptide according to the invention and the "normal" peptide and PrP C is reversible.
(D) Experiment in binding buffer with 50 mM Na-acetate, pH 4.6, 5 mM EDTA (ED) or 50-200 μM CuSO 4 . Lanes 1-3: Brain extract and Sepharose-coupled GST, GST-MoPrP (52-98) and GST-MoPrP-14OR (52-98) were preincubated with copper at pH 7.5 and then combined in acetate buffer at pH 4.6. It can be seen here that the binding of the normal ("wild-type") sequence motif to PrP C at low pH (4.6) also occurs in the absence of copper, ie it becomes independent of metal ions.

2: Bindung von PrP^Sc durch immobilisierte Polypeptide in Abhängigkeit vom pH-Wert und der Zugabe von Protease. 2 : Binding of PrP ^Sc by immobilized polypeptides as a function of pH and the addition of protease.

(A) Binding of PrP Sc from brain extract of scrapie-infected hamster by Sepharose-coupled free GST, normal ("wild-type") mouse PrP (GST-MoPrP (52-98), wt) and a polypeptide according to the invention with 14 octamers ( GST-MoPrP-14OR (52-98), exp) in 50mM HEPES, pH 7.5, 300mM NaCl, 0.6% NP40, 0.3% sarcosyl with 5mM EDTA or 200μM CuSO 4 . beads "in SDS-PAGE sample buffer immediately (below, -PK) or after digestion with proteinase K (above, + PK) detached.
(B) ditto, but in acetate buffer, pH 4.6.

Im Gegensatz zum "Wildtyp"-Sequenzmotiv (4OR) bindet das Sequenzmotiv der erfindungsgemäßen Polypetide (14OR) das pathologische PrP^Sc in Anwesenheit von EDTA bzw. in Abwesenheit von Metallionen bzw. Kupfer bei physiologischem pH-Wert und zwar unabhängig von einem Verdau mit Protease. Es ist ferner zu erkennen, dass die Bindung des erfindungsgemäßen 14OR-Polypeptids an PrP^Sc stärker ist als die Bindung zwischen PrP^Sc und dem normalen 4OR-Peptid, da diese einem Verdau mit Protease widersteht.In contrast to the "wild type" sequence motif (4OR), the sequence motif of the polypeptides according to the invention (14OR) binds the pathological PrP ^Sc in the presence of EDTA or in the absence of metal ions or copper at physiological pH independently of digestion with protease , It can also be seen that the binding of the 14OR polypeptide of the invention to PrP ^{Sc is} stronger than the binding between PrP ^Sc and the normal 4OR peptide, as it resists digestion with protease.

3: Zusammenfassung der Bindung von PrP^C und PrP^Sc unter unterschiedlichen Bedingungen. 3 : Summary of the binding of PrP ^C and PrP ^Sc under different conditions.

Das bindende Sequenzmotiv stellt praktisch eine Art Schalter dar, der die Bindungseigenschaften für PrP^C und PrP^Sc in Abhängigkeit von Metallionen-Konzentration und pH-Wert steuert. Das Polypeptid bzw. Sequenzmotiv kann dabei unterschiedliche Stellungen bzw. Konformationen annehmen: NULL (pH ~4.5), OFF (ohne Cu/Zn, pH 7.5)) oder ON (mit Cu/Zn, pH 7.5). In Abhängigkeit von den Bedingungen kann das Sequenzmotiv PrP^C oder PrP^Sc entweder schwach (+/–), stark (+) oder überhaupt nicht (–) binden.The binding sequence motif is a kind of switch that controls the binding properties of PrP ^C and PrP ^Sc as a function of metal ion concentration and pH. The polypeptide or sequence motif can assume different positions or conformations: NULL (pH ~ 4.5), OFF (without Cu / Zn, pH 7.5)) or ON (with Cu / Zn, pH 7.5). Depending on the conditions, the sequence motif PrP ^C or PrP ^Sc can bind either weakly (+/-), strongly (+) or not at all (-).

(A) normal peptide (4 + 1 octamer)
(B) Polypeptide of the invention or sequence motif (14 octamere)

4: Bestimmung der kritischen Länge des Sequenzmotivs, die für die Präzipitation von PrP^Sc in Gegenwart von EDTA notwendig ist. 4 : Determination of the critical length of the sequence motif necessary for the precipitation of PrP ^Sc in the presence of EDTA.

40 μl Sepharose-„beads" wurden kovalent mit Polypeptiden mit unterschiedlicher Anzahl von Octameren, hier GST-wtOR (HaPrP(52-98), ca. 5 mg/ml)), GST-8OR, GST-10OR oder GST-16OR, gebunden. 1 ml 1 % (w/v) Scrapie-infiziertes (263K-Stamm, vorgereinigt bei 10.000 × g, 5 min) Hirnhomogenat eines terminal erkrankten Syrischen Hamsters wurden dann mit den cross-gelinkten Sepharose-Octarepeat-Beads in 50 mM HEPES, pH 7.5, 300 mM NaCl, 0.5% NP40, 0.5% Sarkosyl, 5 mM EDTA oder 0.2 mM CuSO₄ inkubiert (12h bei 4°C). Die Sepharose-Beads wurden dann in dem Inkubationspufffer gewaschen und in eine Fraktion, die mit Protease (20 μg/ml, 37°C, 30 min) und eine, die ohne Protease behandelt wurde, aufgeteilt. Anschließend wurden die Proben mittels SDS-PAGE und Western-Blotting analysiert (Gel: 12.5%, detektiert mit mAB 3F4).40 μl of Sepharose "beads" were covalently linked to polypeptides having a different number of octamers, here GST-wtOR (HaPrP (52-98), about 5 mg / ml), GST-8OR, GST-10OR or GST-16OR, 1 ml (w / v) scrapie-infected (263K strain pre-purified at 10,000 xg, 5 min) brain homogenate from a terminally diseased Syrian hamster were then cross-linked with Sepharose octarepeal beads in 50 mM HEPES , pH 7.5, 300 mM NaCl, 0.5% NP40, 0.5% sarcosyl, 5 mM EDTA or 0.2 mM CuSO ₄ (12 h at 4 ° C.) The Sepharose beads were then washed in the incubation buffer and placed in a fraction containing Protease (20 μg / ml, 37 ° C, 30 min) and one that was treated without protease, then the samples were analyzed by SDS-PAGE and Western blotting (gel: 12.5%, detected with mAb 3F4).

Es wird hier deutlich, dass eine kritische Länge von mindestens 9 Octameren notwendig ist, um ausreichend PrP^Sc zu binden; vorzugsweise jedoch mehr als 10 Octamere bzw. Octarepeats, insbesondere 16 Octamere oder mehr.It becomes clear here that a critical length of at least 9 octamers is necessary to bind sufficient PrP ^Sc ; but preferably more than 10 octamers or octarepeats, especially 16 octamers or more.

5: Differentielles Auswaschen von PrP^C unter Bedingungen, bei denen PrP^Sc von terminal kranken Hamstern an immobilisierte erfindungsgemäße Polypeptide gebunden bleibt. 5 Differential washing out of PrP ^C under conditions in which PrP ^Sc of terminally ill hamsters remains bound to immobilized polypeptides of the invention.

Experiment wie bei 4, durchgeführt mit immobilisiertem erfindungsgemäßen Polypeptid (GST-16OR) mit verschiedenen finalen Waschschritten, zur Ermittlung der Waschbedingungen, die differentiell PrP^C, aber nicht PrP^Sc herunterwaschen.Experiment as at 4 performed with immobilized polypeptide of the invention (GST-16OR) with various final washes to determine the wash conditions which are differential in washing down PrP ^C but not PrP ^Sc .

Waschpuffer (Elutionsbedingungen):Wash buffer (elution conditions):

1. 10 M urea pH3.7
2. 20mM HEPES pH 7.5, 0.2% SDS
3. 20mM HEPES pH 7.5, 0.5% SDS
4. 20mM HEPES pH 7.5, 2% SDS

Es wird hier deutlich, dass beispielsweise die Waschpuffer 3 und 4 differentiell PrP^C in die lösliche Phase (S=Überstand) waschen, während PrP^Sc immobilisiert (P=Pellet) bleibt. Mittels sehr stringenter Waschbedingungen kann also eine spezifische Unterscheidung zwischen PrP^C und PrP^Sc erfolgen, da die Bindung der erfindungsgemäßen Polypeptide bzw. Sequenzmotive an PrP^Sc deutlich stärker ist, als an PrP^C. Nach Durchführung eines geeigneten Waschschrittes oder eines anderen Trennverfahrens, das die unterschiedlichen Assoziationskonstanten ausnutzt, kann also PrP^Sc mit Hilfe der erfindungsgemäßen Polypeptide bzw. des erfindungsgemäßen Verfahrens spezifisch nachgewiesen werden.It becomes clear here, for example, that wash buffers 3 and 4 differentially wash PrP ^C into the soluble phase (S = supernatant) while PrP ^Sc remains immobilized (P = pellet). By means of very stringent washing conditions, therefore, a specific distinction can be made between PrP ^C and PrP ^Sc , since the binding of the polypeptides or sequence motifs according to the invention to PrP ^{Sc is} markedly stronger than to PrP ^C. After carrying out a suitable washing step or another separation process which utilizes the different association constants, PrP ^Sc can therefore be specifically detected with the aid of the polypeptides according to the invention or the method according to the invention.

6: Differentielles Auswaschen von PrP^C unter Bedingungen, bei denen PrP^Sc von gesunden Hamstern nach 2/3 der Inkubationszeit an immobilisierte erfindungsgemäße Polypeptide gebunden bleibt. 6 Differential washing out of PrP ^C under conditions in which PrP ^Sc of healthy hamsters remains bound to immobilized polypeptides of the invention after 2/3 of the incubation period.

GST-16OR (ca. 4 mg/ml) wurde mit 20 μl Sepharose-„Beads" über Nacht in 1 ml 1 % normalem Hamsterhirnhomogenat oder Hirnhomogenat von Hamstern zum Zeitpunkt 42 Tage (von 60 Tagen) nach Inokulation mit Prionen (d.h. die Hamster sind noch neurologisch unauffällig, scheinbar "gesund") inkubiert (Inkubationspuffer: 50 mM HEPES, pH 7.5, 300 mM NaCl, 5 mM EDTA, 0.6% NP40, 0.3% Sarkosyl). Danach wurden die „Beads" 3-mal mit Inkubationspuffer gewaschen und anschließend mit 60 μl Elutionspufter (20 mM HEPES, pH 7.5, 1 mM EDTA und unterschiedliche Konzentrationen von SDS: 0.25, 0.5, 1.0, 1.5%) inkubiert. Das Eluat wurde dann mit SDS-PAGE (12.5% Gel) und Western-Blot (mAB 3F4) dargestellt. (B = Beads, Sup = Überstand)GST-16OR (about 4 mg / ml) was mixed with 20 ul Sepharose "beads" overnight in 1 ml 1% normal Hamster brain homogenate or brain homogenate of hamsters at the time 42 days (60 days) after inoculation with prions (i.e., the hamsters are still neurologically inconspicuous, apparently "healthy") incubated (incubation buffer: 50mM HEPES, pH 7.5, 300mM NaCl, 5mM EDTA, 0.6% NP40, 0.3% sarcosyl). Thereafter, the "beads" were incubated 3 times with incubation buffer washed and then with 60 μl Elution buffer (20 mM HEPES, pH 7.5, 1 mM EDTA and different Concentrations of SDS: 0.25, 0.5, 1.0, 1.5%). The eluate was then visualized by SDS-PAGE (12.5% gel) and Western blot (mAB 3F4). (B = beads, sup = supernatant)

Es ist zu erkennen, dass die Konzentration an Bead-gebundenem PrP^Sc (B) deutlich geringer ist als in 5, was auf die noch geringe Konzentration an PrP^Sc in diesem frühen Krankheitsstadium, das noch subklinisch, also symptomfrei ist, zurückzuführen ist. Das meiste PrP ist hier noch PrP^C, das unter den angegebenen Bedingungen herausgewaschen wird. Das Experiment beweist aber, dass das erfindungsgemäße Verfahren bzw. die erfindungsgemäßen Polypeptide geeignet sind, in einem Früherkennungstest, beispielsweise einem ante mortem – Schnelltest von Körperflüssigkeiten, PrP^Sc zu detektieren.It can be seen that the concentration of bead-bound PrP ^Sc (B) is significantly lower than in 5 , which is due to the still low concentration of PrP ^Sc at this early stage of the disease, which is still subclinical, ie symptom-free. Most PrP here is PrP ^C , which is washed out under the given conditions. However, the experiment proves that the method according to the invention or the polypeptides according to the invention are suitable for detecting PrP ^Sc in an early detection test, for example an ante mortem rapid test of body fluids.

7: Mapping der potentiellen Bindungsstellen für das erfindungsgemäße Polypeptid in der Octarepeat – Region des PrP 7 : Mapping of Potential Binding Sites for the Polypeptide of the Invention in the Octarepeat Region of PrP

Eine Kartierung potentieller Bindungsstellen für das erfindungsgemäße Polypeptid in der Octarepeat – Region des Prionproteins wurde mit Hilfe einer Peptidbank ("gridded array of peptides", Jerini (Berlin)) in Form einer Zellulosemembran, auf der am C-terminus 13mer Peptide des Prionproteins des Syrischen Hamsters immobilisiert sind, welche sequentiell die gesamte PrP Aminosäuresequenz abdecken, d.h. insgesamt sind also 121 Peptide, durchgeführt. Diese Membran wurde wie ein Immunoblot verwendet. GST allein (Negativkontrolle), oder ein erfindungsgemäßes Polypeptid (GST-14OR) wurde in einer Konzentration von 40 μg/ml zusammen mit Kaninchen-anti-GST-Serum (1:5000) über Nacht bei 4°C inkubiert, anschließend gewaschen und 30 Minuten mit einem Ziegen-anti-Kaninchen-POD-Antikörper und ECL/Hyperfilm (Amersham) entwickelt.A Mapping of potential binding sites for the polypeptide of the invention in the Octarepeat region of the prion protein was purified by means of a peptide library ("gridded array of peptides ", Jerini (Berlin)) in the form of a cellulose membrane, on the C-terminus 13mer peptides of the prion protein of the Syrian hamster immobilized which sequentially cover the entire PrP amino acid sequence, i. in total ie 121 peptides. This membrane was used as an immunoblot. GST alone (negative control), or a polypeptide of the invention (GST-14OR) was co-administered with rabbit anti-GST serum at a concentration of 40 μg / ml (1: 5000) over Night at 4 ° C incubated, then washed and 30 minutes with a goat anti-rabbit POD antibody and ECL / Hyperfilm (Amersham) developed.

Es wird hier deutlich, dass GST allein eine gewisse Hintergrundaktivität der Detektionssubstanzen zeigt. GST-14OR bindet aber deutlich an das Hauptepitop WGQPHGGGW bzw. GQPHGGGW oder WGQPHGGG und zwar exakt in der Octarepeat-Region des PrP (Peptide 27/28/29, 31/32/33, 35/36/37 und 39/40/41; unterstrichen):

It becomes clear here that GST alone shows a certain background activity of the detection substances. However, GST-14OR binds clearly to the major epitope WGQPHGGGW or GQPHGGGW or WGQPHGGG, precisely in the octarepeat region of PrP (peptides 27/28/29, 31/32/33, 35/36/37 and 39/40/41 underlined):

Im Blot ist dabei zu erkennen, dass die Intensität der Bindung mit aufsteigender Nummer der Peptide jeweils abnimmt.in the Blot is about to recognize that the intensity of the bond with ascending Number of peptides decreases, respectively.

Referenzen:References:

Brown, D.R., Qin, K., Herms, J.W., Madlung, A., Manson, J., Strome, R., Fraser, P.E., Kruck, T., von Bohlen, A., Schulz-Schaeffer, W., et al. (1997). The cellular prion protein binds copper in vivo. Nature 390, 684-687.
Burns, C.S., Aronoff-Spencer, E., Legname, G., Prusiner, S. B., Antholine, W.E., Gerfen, G.J., Peisach, J. & Millhauser, G. L. (2003) Copper coordination in the full-length, recombinant prion protein. Biochemistry. 42, 6794-803.
Campbell, T.A., Palmer, M.S., Will, R.G., Gibb, W.R.G., Luthert, P.J., and Collinge, J. (1996). A prion disease with a novel 96-base pair insertional mutation in the prion protein gene. Neurology 46, 761-766.
Chiesa, R., Piccardo, P., Ghetti, B. & Harris, DA (1998) Neurological Illness in Transgenic Mice Expressing a prion protein with an insertional mutation. Neuron 21, 1339-1351.
Chiesa, R., Drisaldi, B., Quaglio, E., Migheli, A., Piccardo, P., Ghetti, B. & Harris, D.A. (2000) Accumulation of protease-resistant prion protein (PrP) and apoptosis of cerebellar granule cells in transgenic mice expressing a PrP insertional mutation. Proc. Natl. Acad. Sci. USA. 97, 5574-5579.
Collinge, J., Brown, J., Hardy, J., Mullan, M., Rossor, M.N., Baker, H., Crow, T.J., Lofthouse, R., Poulter, M., Ridley, R., of al. (1992). Inherited prion disease with 144 base pair gene insertion. 2. Clinical and pathological features. Brain 115, 687-710.
Garnett, A.P., and Viles, J.H. (2003). Copper binding to the octarepeats of the prion protein. Affinity, specificity, folding, and cooperativity: insights from circular dichroism. J Biol Chem 278, 6795-6802.
Hornshaw, M.P., McDermott, J.R., and Candy, J.M. (1995). Copper binding to the N-terminal tandem repeat regions of mammalian and avian prion protein. Biochem Biophys Res Commun 207, 621-629.
Owen, F., Poulter, M., Lofthouse, R., Collinge, J., Crow, T. J., Risby, D., Baker, H.F., Ridley, R.M., Hsiao, K., and Prusiner, S.B. (1989). Insertion into prion protein gene in family Creutzfeldt-Jakob disease. Lancet 1, 51-52.
Safar, J. et al. (1998), Nature Med. 4, 1157-1165.
stiletto, J., Safar, J., Wallace, A.C., Cohen, F.E., and Prusiner, S.B. (1998). Prion proteinually binds copper (II) ions. Biochemistry 37, 7185-7193.
Viles, J.H., Cohen, F.E., Prusiner, S.B., Goodin, D.B., Wright, P.E., and Dyson, H.J. (1999). Copper binding to the prion protein: structural implications of four identical cooperative binding sites. Proc Natl Acad Sci USA 96, 2042-2047.

SEQUENZPROTOKOLL

SEQUENCE LISTING

Claims

Polypeptide with at least one soluble Component and at least one sequence motif consisting of at least 9 consecutive octamers of one with the copper-binding, repetitive octamer of a prion protein (PrP) at least homologous and / or overlapping amino acid sequence consists.

Polypeptide according to claim 1, characterized in that that at least one octamer from the group of amino acid sequences according to Seq ID Nos. 9 to 24 selected is.

Polypeptide according to claim 1 or 2, characterized by a structure that is designed to be specific to the amino acid sequence Trp-Gly-Gln-Pro-His-Gly-Gly-Gly-Trp or a, preferably 4 times, repeating sequence of these Sequence binds.

Polypeptide according to claim 1 or 2, characterized by a structure that is designed to be specific to the amino acid sequence Gly-Gln-Pro-His-Gly-Gly-Gly-Trp or a, preferably 4 times, repeating sequence of these Sequence binds.

Polypeptide according to claim 1 or 2, characterized by a structure that is designed to be specific to the amino acid sequence Trp-Gly-Gln-Pro-His-Gly-Gly-Gly or a, preferably 4 times, repeating sequence of these Sequence binds.

Polypeptide according to one of Claims 1 to 5, characterized that the sequence motif from 10 to 32, preferably 14 or 16, octamers consists.

Polypeptide according to one of Claims 1 to 6, characterized that the soluble Component glutathione-S-transferase (GST) is.

Polypeptide according to one of Claims 1 to 7, characterized that this with one of the amino acid sequences according to Seq ID Nos. 1 to 8 has at least 90% homology.

Polypeptide according to one of Claims 1 to 8 by an additional bound, detectable constituent, preferably a fluorescent, radioactive or enzymatically detectable ingredient.

Nucleic acid molecule, with a Nucleotide sequence coding for encoding a polypeptide, wherein the nucleotide sequence is selected consisting of the group a) Isolated or artificial Nucleotide sequence, which for the polypeptide of any one of claims 1 to 9 encoded, b) Nucleotide sequence in addition to a sequence that for a soluble one Polypeptide encodes at least 9 consecutive sections according to Seq ID Contains No. 25 as an insert, c) Nucleotide sequence which differs from the nucleotide sequences according to a) or b) by exchanging at least one codon for a synonym Codon is different.

Nucleic acid molecule according to claim 10, wherein the nucleic acid molecule is operative is linked to at least one regulatory element.

Nucleic acid molecule according to claim 11, wherein the regulatory element is a promoter sequence and / or a transcription termination sequence.

Vector for the expression of a polypeptide in a suitable cell, wherein the nucleic acid molecule according to claim 10, 11 or Contains 12 in expressible form.

A cell comprising the polypeptide according to any one of claims 1 to 9, the nucleic acid molecule according to claim 10, 11 or 12 and / or the vector according to claim 13.

Antigen binding peptide, especially antibody or Fragments of antibodies, which is specific to the polypeptide according to one of claims 1 to 9 binds.

A kit comprising the polypeptide according to any one of claims 1 to 9, the nucleic acid molecule according to claim 10, 11 or 12, the vector of claim 13, at least one cell according to claim 14 and / or the antigen-binding peptide according to claim 15 contains.

Use of the kit according to claim 16 for the detection of the pathological isoform of a prion protein (PrP ^Sc ).

Pharmaceutical composition containing the polypeptide according to one of the claims 1 to 9, the nucleic acid molecule according to claim 10, 11 or 12, the vector according to claim 13 and / or the antigen-binding Peptide according to Claim 15, and also preferably customary auxiliaries and / or excipients, contains.

Use of the pharmaceutical composition according to claim 18 for the therapeutic or preventive treatment of spongiform Encephalopathies.

Method for specific binding of the pathological isoform of a prion protein (PrP ^Sc ) to a biomolecule, wherein the binding is carried out by incubation of the biomolecule with a sample to be examined for the presence of the pathological prion protein, characterized in that at least the sequence motif of the polypeptide as biomolecule one of claims 1 to 9 is used and that the incubation is carried out in the presence of a chelating substance, wherein the fraction of the sample with the bound pathological prion protein (PrP ^Sc ) is then separated from the fraction of the sample bound with normal prion protein (PrP ^C ).

Method according to claim 20, characterized in that that as a chelating substance a complexing agent for divalent Cations, preferably ethylenediaminetetraacetic acid (EDTA) is added.

Method according to claim 20 or 21, characterized that the separation of the fractions takes place by washing with a solution, the 0.1 to 2.0% sodium dodecyl sulfate (SDS), preferably 0.5% SDS, and / or 1 to 10 mol / l of urea.

A method according to claim 20, 21 or 22, characterized characterized in that the bound by the biomolecule prion protein by the subsequent one Specific binding of a detectable molecule is detected or that the biomolecule bound by the prion protein through the subsequent specific binding a detectable molecule, in particular the antigen-binding peptide according to claim 15 becomes.

Method according to claim 23, characterized that the detectable molecule a, preferably monoclonal antibody or a fragment of a antibody which specifically binds to the prion protein or biomolecule.

A method according to claim 23 or 24, characterized in that the detection of the pathological prion protein (PrP ^Sc ) by means of ELISA, Western blotting or dipstick technology.

A method according to claim 20, 21 or 22, characterized in that the pathological prion protein (PrP ^Sc ) is concentrated or purified by binding to the, preferably immobilized, biomolecule.

Method according to one of claims 20 to 26, characterized that the binding of the prion protein to the biomolecule in a pH> 7, preferably pH 7.5 becomes.

Use of the sequence motif of the polypeptide according to one of claims 1 to 9 in immobilized form for the detection of the pathological isoform of a prion protein (PrP ^Sc ) or for the purification of a sample infected with the pathological isoform of a prion protein (PrP ^Sc ).