DE10027218A1 - Detecting heterogeneous nucleic acid sequences in organisms and cells, useful for detecting and identifying genetically modified organisms or their products - Google Patents

Abstract

Simultaneously detecting one or more heterogeneous nucleic acids (I), introduced into organisms and cells, where (I) includes at least one artificial sequence (II) that allows both determination of the identity of (I) and selective replication, and (II) are detected, and optionally identified, by hybridization to a chip and/or by sequencing, is new. An Independent claim is also included for a chip for use in the new process.

Description

The present invention relates to a method for the (simultaneous) detection of a or more in one or more organisms or in one or more cells externally introduced nucleic acid (s), the introduced nucleic acid (s) (a) Artificial sequence (s) that include proof of identity of the introduced nucleic acid (s) and the selective multiplication allows / allow, comprehensive examination of the organism (s) or the cell (s) the presence of the artificial sequence (s) and, if necessary, identification the artificial sequence (s) by means of hybridization with a chip and / or Sequencing. The invention also relates to a method for the detection of a nucleic acid introduced into an organism or a cell, the introduced nucleic acid comprises at least one artificial sequence which with at least one universal primer under stringent hybridization conditions hybridized, comprising the steps of: (a) amplifying the region of the introduced nucleic acid, which (ai) between the at least one artificial Sequence and a sequence in the introduced nucleic acid or (aii) between at least two artificial sequences, or that in (ai) or (aii) defined sequences using PCR or another amplification method Use of the at least one universal primer and a primer which under stringent hybridization conditions with the sequence introduced in the Nucleic acid hybridizes, or using the at least one universal Primers; and (b ') transfer of the amplification product or the coded one Translation product on at least one chip on which is in an orderly fashion Pattern receptors are located that are the amplification product, a single strand thereof or specifically bind the encoded translation product, and incubation under Conditions that require a detectable binding of the receptor to the Amplification product, the single strand thereof or the encoded translation product allow; and (c ') demonstrating whether binding of the amplification product, the  Single strand of it or the encoded translation product to the receptor has taken place; and / or (b ") optionally cleavage of the amplification products with a restriction enzyme cleaving in the region of the primer binding site and Ligation of amplification products to a concatemer; and / or (c ") Sequencing of the amplification product or the concatater. Finally The invention relates to a chip that carries out the implementation of the invention Procedure allowed.

DNA is a naturally occurring molecule that is naturally linear Disk serves. A sequence of four nucleotides comprising the bases Adenine, guanine, cytosine and thymine carry the genetic information found in 64 different codon triplets encoded 20 amino acids. In addition to the pure Sequence information also carries structural information at the RNA level and the colinear proteins. Also the way the molecules interact among themselves on the functional level is already in the DNA as information fixed.

The information content of DNA in organisms is complex enzymatic apparatus strictly preserved and with high precision from generation passed on to generation. Nature thus receives the genetic information about Millions of years very stable, but it evacuates organisms for evolutionary reasons a low error rate leading to sequence divergences in different types leads.

Alien DNA can also be found in organisms using genetic engineering methods be introduced, which can then be inherited stably in the same way. Such Organisms that are genetically equipped with additional functions are called transgenic or genetically modified organisms (GMOs). Alien DNA in transgenic organisms can consist of natural sequences that consist of Organisms are isolated. Natural sequences are through evolutionary processes resulting sequence sequences. Artificial DNA sequences can by Manipulations of the organism are derived from natural sequences for example "in vitro" mutagenesis. The reference system also plays a role. A natural DNA sequence from one organism to another, alien Organism that is not brought into this organism in terms of position  and / or the sequence occurs creates an artificial gene sequence in it changed system. One brought about by genetic engineering methods Change the position of a DNA sequence within an organism and even within a species is also artificial in a strict definition.

The immense number of possible combinations of the four nucleotides in Different sequence variants create sequence spaces that are natural only a fraction of the molecules found in the organisms become. The development of the genomes with their information content is therefore historical.

DNA sequences can therefore also be completely artificial sequence sequences. Artificial sequence sequences are not found in nature and are not through evolutionary processes emerged. Come up to a certain length certain DNA sequence sequences but also purely statistically in different Organisms.

Synthetic DNA can come from both natural, through evolutionary processes Sequences of sequences, derived from these, by human influence arisen, artificially modified sequence variants, as well as from complete artificial sequence sequences exist. Purely artificial DNA sequence sequences can only be made synthetically as there are no natural sources for them. Fully synthetic DNA can contain any information if it is stable in Organisms are introduced, are also passed on stably and in genetically changed or modified organisms result.

Functional, artificial, synthetic sequences can be used for partial or encode fully artificial genes that, for example, functional RNAs (e.g. Suppressor RNA or ribozymes), artificial epitopes, affinity-mediating Carry sequences or enzymatic activities. The expression of the Function (e.g. epitope) in target cells could be assigned to the detection make artificial gene labeling much easier. So one with natural or artificial synthetic sequences equipped transgenic organism carry both functional transgenes and mere sequence labels, their information content is not in functional RNA molecules and protein must flow.  

A GMO is usually defined by the new gene function that it has in the Gives the cell a functional transgene (e.g. herbicide resistance). An artificial one However, from a biological point of view, genetic marking is functionally neutral additional piece of DNA, the sequence of which does not play a biologically active role. she is nothing but an artificial genetic marker, regardless of the type of Detection reaction.

The definition of a genetically modified organism (GMO) is independent of the function of genetic modification to be formally strict. Such a Organism is genetically modified but not necessarily transgenic.

In the age of modern biotechnology and genetic engineering, in which the Production of genetically modified organisms of all kinds is becoming more and more routine work, and in which an industrial exploitation of the Benefits of these organisms in the long run are inevitable, there is a big one Need, the organisms produced or introduced vectors using a simple, fast and inexpensive procedure to be clearly identified or to prove. This sets a corresponding marking of the organisms or Vectors ahead.

The technical problem underlying the present invention was therefore To provide ways and means to meet this need. This technical problem is characterized by that in the claims Embodiments solved.

The present invention thus relates to a method for (simultaneous) detection one or more in one or more organisms or in one or more Foreign nucleic acid (s), the inserted nucleic acid (s) (an) artificial sequence (s) that include proof of identity of the introduced nucleic acid (s) and the selective multiplication allows / allow, comprehensive examination of the organism (s) or the cell (s) the presence of the artificial sequence (s) and, if necessary, identification the artificial sequence (s), by means of hybridization with a chip and / or Sequencing.  

The term "externally introduced nucleic acid, the artificial sequence (s) "means that the nucleic acid consists exclusively of an artificial Sequence exists, or (an) artificial sequence (s) in addition to others Contains sequences.

The term “artificial sequence” denotes in the sense of the present invention Sequences whose nucleotide sequence is not a naturally occurring one Is nucleotide sequence. This term also includes naturally occurring ones Sequences whose nucleotide sequence by molecular biological methods was changed. It is of course also conceivable for a genetic marker to combine artificial sequences with naturally occurring sequences (see below).

Preferably, a non-naturally occurring nucleotide sequence is a sequence which as such or as part of a longer sequence are not stored in any database is.

The method according to the invention advantageously allows using a informative, artificial genetic marking (1) organisms (e.g. Bacterial strains, plant varieties or animals that are vegetative or by cloning can be increased) (2) phenotypic features in the genome of organisms, that correlate with chromosomal areas and (3) genetically engineered Quickly and easily detect or identify transgenic constructs. In addition, products from transgenic organisms can also be identify if the transgenic constructs are genetically labeled accordingly. For example, the artificial sequence can be chosen to be a artificial, i.e. non-occurring epitope coded as part of the Translation product of the transgene is expressed. By means of appropriate Antibody can then be the translation product and, if necessary, its origin be clearly identified. An identification of such translation products or in the event that the product of the transgenic organism is an RNA, of course also take place at the RNA level. Methods can essentially be used for this be used in the present description in connection with the detection be discussed at the DNA level.

The method according to the invention thus allows, by means of artificial genetic Marking and its central registration systematics and transparency in the  Diversity of breeding-related organisms and genetic engineering, with to bring different transgenic constructs to modified organisms. Here can answer legal questions such as copyright protection, but also questions of genetic engineering safety can be answered. So it's easy for example, transgenic material based on a genetic marker in Detect foods, especially if this genetic mark is already known to a surveillance authority.

The artificial genetic labeling of organisms in chromosomes and Episomes, as well as in organelles using synthetic DNA, can, as I said, anywhere be of advantage where you have to deal with legal issues very precise proof of the origin and identity of organisms is necessary do. On the one hand, copyrights encoded in DNA can affect us Data as tags e.g. B. on certain proprietary legal claims certain transgenic organisms (GMOs) are of great importance, if you suffer economic losses through abuse of property rights fear.

Non-transgenic, stable varieties in plants (e.g. breeding, varieties, selections, which are propagated or cloned vegetatively, such as bulbs) and different breeds in clonable animals and bacterial strains are to clearly identify artificial genetic markers, if necessary To assert legal claims.

For example in fermentation processes in the production of food or in the pharmaceutical industry is the use of genetically artificially labeled Organisms possible. In addition to simplified methods of regular maintenance, for example in the precise identification of fermentatively active bacteria Properties are also possible through the use of artificial genetics marked bacteria or fungal strains, get information about the defined To provide composition of mixed populations.

In the same way it is possible by means of an aytific genetic marking Cell populations used ex vivo for genetic manipulation for gene therapy and / or Immunotherapy can be used to permanently mark and destiny to track cell populations in the organism in vivo.  

For the genetic differentiation and identification of organisms, the Part with complex procedures genetic differences in the genetic makeup of the different organisms analyzed. With artificial genetic markings this time-consuming work can be avoided.

Using bioinformatics, one can also apply algorithms with which artificial sequences for genetic labeling are selected, if possible have no natural occurrence or are not known in nature.

Eukaryotes go through meiosis in sexual reproduction, which is Genetic material in particular the chromosomes are redistributed and mixed. But also within coupling groups (chromosomes) of phenotypic inheritance Material recombined by crossover. Only if genetic markers are very close with a gene or a group of genes that have the phenotypic influences has the properties of the organism is Recombination probability of the genetic exchange of markers with the responsible genes small enough to ensure the safety of the cosegregation of Ensure markers and marked.

Artificial genetic labeling with synthetic DNA can be used in identification and the detection of phenotypic properties when selecting suitable ones Character combinations after sexual processes play a role, provided it succeeds in marking the corresponding loci on the chromosomes position and integrate it stably, for example through "site directed in vivo mutagenesis ".

In environmental law, the artificial genetic marking and its analysis could Control of GMOs in the identification of the origin and type of transgenic Material will be improved sustainably.

In particular, it is possible with such methods to achieve maximum transparency about the spread of transgenes.

The exact identity and origin of a transgene and its spread could be for risk assessment in the event of proof of vertical gene transfer of a GMOs determined with wild populations or processes of horizontal gene transfer become.

As a rule, however, the method is also used to describe the normal case and can prove. Usually there is no unwanted gene transfer  between different species and transgenes, like other genes, are extremely stable and do not stray. With genetic manipulation in the Modern plant breeding could, however, be achieved by means of the invention Identify, avoid and prevent unwanted horizontal gene transfer eliminate corresponding transgenes.

Enzymatic fermentation can be achieved through modern molecular Evolution systems u. a. new genes for enzymatic variants with improved ones Properties arise. Labeled strains that carry such genes are easy to distinguish from contaminants by artificial genetic labeling. For example, transgenes could be encoded in DNA in this way Wear version numbers or update numbers.

A clear advantage of using artificial genetic markers compared to the classic proof of the identity of different transgener Gene constructs of different origins in GMOs is the independence of the Evidence of the type of construct. Transgenic constructs can different companies to be identical or very similar. In this case you get one has no or only difficult information about the originator of the construct with a transparent company policy. But also with very different constructions did u. Under certain circumstances, no information about the exact configuration of those involved Sequences. The commonly used one may fail generalized detection reaction for the transgenes. In addition, it could be for Companies will benefit from having all the data for the construction of a transgene in one To store database and the public a possibility of identification of the To ensure transgenic construct by means of an artificial genetic marking, but otherwise not disclose the type of construct.

The identity of organisms is clear with the help of genetic markings representable. Quantitative detection methods could also offer the opportunity show relative frequencies of organisms (e.g. mixtures of different fermentatively active bacteria in food technology).

The special advantages of the artificial genetic labeling of transgenes lie in the direct access to the identification of a transgenic construct as such through a clear possibility of assigning information to the Construct, in the independence of the detection of the respective transgenic construct,  and the possibility of central and systematic recording and administration of transgenes.

In a preferred embodiment, the artificial (s) are Sequence (s) restriction endonuclease recognition sites, transcription promoter sequences and / or replication initiators (ORIs).

However, other cis-active elements for performing the inventive method can be used.

In a further preferred embodiment, the presence of the artificial sequence (s) using PCR, LCR or another Amplification method examined.

Methods for the detection of the artificial sequences are known to the person skilled in the art and include the PCR (polymerase chain reaction) technique, the DNA array technique and DNA sequencing methods. But also detection methods like for example "strand displacement" amplification, LCR (Ligase chain reaction), RFLP (restriction fragment length polymorphism) or AFLP (amplified fragment length polymorphism) in connection with optical (e.g. fluorescence, Chemiluminescence or bioluminescence), electrical or Mass spectrometric detection (MALDI-TOF) are suitable, the artificial Detect sequences.

For the detection of an artificial genetic marking of organisms with synthetic DNA, it is assumed that e.g. B. using the PCR method can reproduce any DNA fragment to such an extent that it can be transmitted via the Background of genomic DNA is increased and can thus be analyzed.

However, linear amplification methods are also suitable for performing the inventive method. For example, if the artificial sequence includes one Promoter, can "run off" after appropriate linearization - Transcripts are generated, their presence or information content proven directly by means of hybridization with a chip or can be analyzed.

The detection of defined DNA fragments is for naturally occurring DNAs (e.g. genomic DNA) from the location of various ideal  Sequence parameters depending on the natural base sequences (e.g. compatible PCR primer sequences, restriction sites (polymorphisms), LCA compatible sequences etc.). This is the case with artificial, freely definable sequences different.

The choice of to detect any artificially generated DNA sequence necessary PCR primer pairs have significantly greater degrees of freedom than in natural sequences. The base sequence of the primer sequences to be used is freely definable. The combination of different primer sequences to form primer pairs for the detection reaction of the synthetic between the primers partially or completely artificial sequence is also freely definable and must only functional requirements (e.g. compatibility of the primers in the PCR reaction) fulfill.

In another embodiment, the present invention relates to a method, preferably additionally with the technical features of the first embodiment described above, for the detection of a nucleic acid introduced into an organism or a cell, wherein the introduced nucleic acid comprises at least one artificial sequence which is associated with at least one universal primer hybridized under stringent hybridization conditions, comprising the following steps:

• a) Amplification of the region of the introduced nucleic acid that is
  • a) between the at least one artificial sequence and a sequence in the nucleic acid introduced or
  • b) is located between at least two artificial sequences, or the sequences defined in (ai) or (aii) by means of PCR or another amplification method using the at least one universal primer and a primer which hybridizes with the sequence in the introduced nucleic acid under stringent hybridization conditions , or using the at least one universal primer; and
• b) (b ') transmission of the amplification product or the coded Translation product on at least one chip on which is in a ordered pattern receptors that are the amplification product, a  Bind single strand thereof or specifically the encoded translation product, and incubation under conditions that demonstrate detectable binding of the Receptor to the amplification product, the single strand thereof or that allow encoded translation product; and
• c) (c ') Evidence of binding of the amplification product, the single strand thereof or the encoded translation product to the receptor has taken place; and or
• d) (b ") optionally cleaving the amplification products with a in the range of Restriction enzyme cleaving the primer binding site and ligation of Amplification products to a concatemer; and or
• e) (c ") sequencing of the amplification product or the concatater.

The detection of the externally introduced nucleic acid can take place exclusively via the at least one artificial sequence or else include sequences in the introduced nucleic acid. For example, for amplification, the universal primer that hybridizes to the at least one artificial sequence or a part thereof can be combined with a primer that hybridizes to another artificial or non-artificial sequence in the introduced nucleic acid ( FIG. 1A). In this case the amplification would result in an amplification product which comprises both sequences of the introduced nucleic acid and artificial sequences. As an alternative to this, the detection of the nucleic acid introduced externally can take place via the at least one universal primer. In this case, the at least one universal primer hybridizes to two artificial sequences or two regions of the artificial sequences or to one artificial sequence within the introduced nucleic acid and to another artificial sequence or to regions of the artificial sequences ( FIG. 1B). The resulting amplification products can thus also comprise sequences of the introduced nucleic acid and artificial sequences or can consist only of artificial sequences. For the amplification, a universal primer can be used, which serves both as a 5 'and 3' primer, or two universal primers with different sequences, one primer as a 5 'primer and the other primer as a 3' primer serves. The amplification products preferably consist exclusively of artificial sequences. From a length of 80 base pairs, sequences are created that have been statistically unique in their nucleotide sequence on Earth since their creation (Prof. Werner Arber, Nobel Prize winner). Thus, the artificial sequence (s) used according to the invention is / are preferably 80 base pairs or longer.

Primers which are suitable for carrying out the method according to the invention, can consist only of naturally occurring nucleotides (i.e. Deoxyribonucleotides and / or ribonucleotides), but also nucleotide analogs or modified nucleotides include (copolymers). Modified nucleotides are Known to those skilled in the art and include, for example, 5,6-dihydrouridine, ribothymidine, Inosine or 1-methylguanosine. The nucleotides of the primers also do not have to can be linked together via phosphodiester bonds, but also be linked together via phosphothioate or methylphosphonate bonds. Peptide nucleic acids (PNA) can also be used as primers. The stake such primers can optimize hybridization conditions, stringency, Hybridization kinetics, specificity, selectivity, and hybridization efficiency serve. The principle of the polymerase chain reaction (PCR) is known to the person skilled in the art. The It is thus clear to the person skilled in the art that primer pairs which are described in the present description as Suitable for PCR amplification, consist of a primer attached to one DNA strand hybridizes, and another primer that is complementary DNA strand hybridizes.

The term "universal primer" in the sense of the present invention means that this or the artificial sequence or the region thereof to which this primer hybridized, is designed so that it generally provides evidence of third party imports Nucleic acid allows regardless of the type and function of the introduced nucleic acid. In other words, this primer serves the question to answer whether, for example, transgenes in a certain food Material is included.

Stringent hybridization conditions are known in the art and the length can be simply determined to be used in the primer or probe of the function of, for example, (see, for. Example, Sambrook et al., Molecular Cloning, a Laboratory Manual, 2 ^nd edition (1989) , CSH Press, Cold Spring Harbor, NY; Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1989) or Higgins and Hames, Nucleic Acid Hybridization, a Practical Approach, IRL Press Oxford, Washington DC (1985)).

Stringent hybridization conditions are, for example, hybridization in 6 × SSC and 0.1% SDS at 65 ° C or in 50% formamide and 4 × SSC at 42 ° C and subsequent washing in 0.1 × SSC and 0.1% SDS at 65 ° C. Unstringent Hybridization conditions are, for example, hybridization and subsequent Wash in 4 × SSC and 1% SDS at 50 ° C.

In a preferred embodiment of the method according to the invention contains the nucleic acid introduced has at least one further artificial sequence which starts with at least one special primer under stringent hybridization conditions hybridizes, wherein the at least one special primer with a further primer, the under stringent hybridization conditions with a further sequence in the introduced nucleic acid hybridized, or with another special primer, the under stringent hybridization conditions with another artificial Hybridizes sequence, the amplification of a region of the introduced Allows nucleic acid that comprises the at least one artificial sequence.

Thus, the other artificial sequences to which the special primers are attached hybridize on the corresponding DNA strand always 5 'to the arranged artificial sequences to which the universal primers hybridize.

In the context of the present invention, the term “special primer” means that a Detection of an externally introduced nucleic acid using these primers specifically for is the type and / or function of the nucleic acid introduced. In other words, in Contrary to the universal primer, which generally detects all of these Allowing labeled transgenes, the special primer serves to either specific transgenic construct or a group of transgenic constructs, for example manufactured by a certain company (originator), to prove.

When proving copyright, for example on a transgene and the Possibility of detecting various transgenes in environmental law different needs of the users of the method.

While special, i.e. individual, author-specific primer pairs all Transgenic constructs of a particular author from the totality of all authors amplify is the purpose of universal primer pairs of all Control bodies to be known, so that regardless of the respective originator  Transgenic constructs can be amplified. Special primer pairs can, however desired to be kept secret by the authors.

Different pairs of primers can be nested around the respective marking ( FIG. 2). Since the 5'-flanking special primer sequences can be determined experimentally using the universal primers, it is particularly important in this embodiment that the assignment to individual companies is only known to the control authorities.

In a further preferred embodiment, the at least two Sequences and / or the at least two further sequences spatially separated from each other.

This embodiment advantageously makes it possible, for example by means of PCR amplify larger sections of sequence in which more extensive information can be saved.

In another preferred embodiment, those recorded in step (c) are Data stored in digitized form.

In a particularly preferred embodiment, the storage takes place in one Central storage.

This embodiment allows artificial genetic labeling of cells and centrally record living beings for the purpose of transparency and surveillance and genetic engineering data worldwide and in a uniform system for Marking and management of transgenes to save.

By storing all available data of registered transgenes, the Central store easy control over inventory, type and originator of Transgenes. All data could be managed in a "trust center".

Legislators can ensure that transgenes are only legally permitted and subsequently constructed and placed on the market if they have been registered and their identity by a clear artificial genetic marking is provable. The origin of the gene construct (originator), the type of construct (the gene sequences used), the date of the  Registration, the organism into which the gene construct has been introduced, etc., d. H. all data relating to the transgene must be traceable.

The ZKBS (= Central Commission for Biosafety in Germany) could to make such a proposal to the legislator, which will then also apply throughout Europe and can be implemented worldwide.

In another preferred embodiment of the method according to the invention the inserted nucleic acid encodes a (poly) peptide.

For the purposes of the present invention, the term “(poly) peptide” encompasses both Polypeptides or proteins that are approximately 50 to several hundreds in length Have amino acids as well as peptides that are approximately 5 to 50 in length Have amino acids. The peptides are preferably artificial peptides, ie not naturally occurring peptides, which represent artificial epitopes, for example.

In a particularly preferred embodiment, the (poly) peptide is a Fusion protein.

In a further particularly preferred embodiment, the one introduced Nucleic acid a transgene or an artificial sequence.

If the nucleic acid introduced is a transgene, as discussed above, the artificial sequence advantageously a quick and easy detection the presence of the transgene in a sample. In addition, the artificial sequence also serve the originator, the transgene as one of them identify developed and manufactured transgenes.

If the nucleic acid introduced consists exclusively of an artificial sequence, thus, as also discussed above, it allows, for example, organisms and / or identify phenotypic features in the genome of an organism or to prove.

In an additional preferred embodiment of the invention The method, the nucleic acid introduced is or contains a recognition code.  

The identification code can represent a combinatorial coding or one contain encrypted text, d. H. a text into a nucleic acid sequence is translated.

In a particularly preferred embodiment, the identification code encrypted.

A genetic marking of organisms using an encrypted message in DNA molecules can be different by one authorized person Techniques or combinations of these are easily demonstrated nowadays and can also be easily decrypted using the appropriate decryption key is known.

There is a considerable amount in the sequence enclosed by primer pairs Coding potential for information that is only limited by the Performance of the PCR reaction, enough amplified material to provide the appropriate length for the detection reaction. Usually one would assume approx. 50 bp to approx. 1000 bp coding capacity. But you could at If necessary, introduce much longer sequences. As mentioned in an artificial, synthetic DNA sequence information is stored like for example the name of the creator of the GMOs, the date of the Authorship, the variant of the artificially genetically marked organism or the Variant of the transgene or both, the code of the copyright (e.g. Patent number) and / or references to the documentation of the organism, for example a website, database or publication.

In the first stage of a two-stage system for the encryption of Copyright data in a DNA code for the artificial genetic labeling of The originator of the sequence gets primer pairs for the amplification of the organisms included artificial sequence, whose identity only he knows. For these primer pairs, he can now in a second stage the between the primers fill lying DNA sequence with information that (a) is only a recognition code Represents (signature) or (b) carries information encoded directly in DNA or (c) one Carries information that is additionally cryptographically encrypted so that a Interested parties cannot read and identify the data even if they can Has primer for the amplification of the corresponding PCR fragment and the  Primary code (b) knows information encoded with the alphanumeric characters in DNA can be implemented.

It might be interesting for a biotechnology company to have the data of one Transgene or an organism cannot initially be identified in detail for third parties close. The supervisory authority would like to make transgenic as easy as possible Can prove material from different origins.

However, this company may have an interest in providing proof from third parties (e.g. the Authority) to allow the GMO in its capacity being genetically modified is identified. Further information that the only then can the exact identity of the transgenic organism be affected if this evidence is approved by them. The company would a monitoring authority in this case the PCR primer for identification Make available with which the genetically marking DNA fragment as such e.g. B. can be detected by means of array technologies. The The surveillance authority thus represents the level of the central recording, whose The task is to control and identify transgenic material. The exact Identity of the organism and further information about it Organism would continue to be encrypted in the hands of the company, or would only be accessible via a central database register. That is, the originator represents the level decentralized recording. By means of the further information he can check whether third parties use his material.

The information density of array technologies is so large that very many are central recorded, artificial genetic markings on a carrier for the detection of the corresponding transgene constructs can be mapped. As proof A coding sequence can then also provide individually detailed information sequenced, decoded and decrypted if necessary.

In a most preferred embodiment, encryption is one cryptographic encryption.

In another preferred embodiment of the method according to the invention the receptor is a protein, preferably a glycoprotein, a specific binding  RNA or a peptide, preferably an artificial peptide or an antibody Derivative or fragment thereof.

Suitable antibodies can be polyclonal or monoclonal. Fragments or derivatives of antibodies and methods for their production are known to the person skilled in the art. Antibody fragments include, for example, F _ab , F _{(ab) 2} , F _v , F _d or dAb fragments. Antibody derivatives include, for example, scFv.

In a particularly preferred embodiment, the antibody, the derivative, binds or the fragment thereof double-stranded DNA sequence-specific.

In a further preferred embodiment of the method according to the invention the receptor is a single-stranded DNA.

The length of single-stranded DNA can vary as long as it is specific Hybridization with nucleic acids to be examined allowed. That is, the single strand DNA can be an oligonucleotide approximately 12 to 30 nucleotides in length or a polynucleotide approximately 30 to several hundred in length Be nucleotides. The term "specifically hybridize" means that under stringent hybridization conditions (see above) only nucleic acid molecules hybridize with each other that have a complementary nucleotide sequence.

In another preferred embodiment, the chip is in everyone Position of the ordered pattern is a receptor with a different binding specificity. However, it is also conceivable that there are several positions on the chip Receptors with the same binding specificity.

In an additional preferred embodiment of the method according to the invention, the following steps are carried out before steps (a), (b ") and (c"):

• a) Cleavage of the introduced nucleic acids, previously with a sequence tag were provided with a restriction enzyme that does not cut in the day;
• b) isolation of the tagged fission products;
• c) halving of the fission products and ligation of the halves with different Linkers;  
• d) cleavage of the ligation product from (iii) with a type II restriction enzyme, that has the binding site in the linkers and in the inserted ones Nucleic acids cleave so that a portion of the nucleic acids introduced with remains connected to the linker; and
• e) head-to-tail ligation of the introduced nucleic acids.

Suitable tags are affinity tags that allow the isolation of the cleavage products. The restriction enzyme used in step (i) has a recognition sequence of preferably 7, 6 or 4 nucleotides.

The Velculescu et al. (Science 270 (1995), 484-487) described SAGE- Technology is particularly suitable as a detection method for the invention Procedure because it provides efficient and simultaneous detection of a large number allowed by transgenic constructs. Proof by means of chip technology, however allows only a qualitative or semi-quantitative detection of transgenes. There SAGE technology allows quantitative proof, it is included corresponding questions, therefore, especially as additional ones Detection method suitable.

In this embodiment, the method according to the invention does not allow only one qualitative detection of transgenes, d. H. answering the question of whether, and if yes, which transgenes of which company are present in a sample, but also quantitative evidence, d. H. answering the question how many A company's transgenes are present in a sample. Using the sequence tag can also analyze the transcription activity of the transgenes at the RNA level become. To do this, the RNA is primed to the sequence tag hybridized, reverse transcribed. The RNA is then in according to its frequency the concatemer available.

The invention also relates to a sequencing station and suitable software that the Allow implementation of the method according to the invention.

In a particularly preferred embodiment, the introduced ones Nucleic acids double stranded cDNAs, and before step (i) the following step carried out: generation of double-stranded cDNA from mRNA of the organism or the cell using a sequence tagged 3 'primer.  

In another preferred embodiment of the method according to the invention, the following steps are carried out before steps (a), (b ") and (c"):

• a) Generation of double-strand cDNA from mRNA of the organism or Cell using a 3 'tagged primer;
• b) cleavage of the cDNA with a restriction enzyme that does not cut in the day; (iii) isolation of the tagged cleavage products;
• c) halving of the fission products and ligation of the halves with different Linkers;
• d) cleavage of the ligation product from (iv) with a type II restriction enzyme, that has the binding site in the linkers and cleaves in the cDNA, so that a portion of the cDNA remain attached to the linker; and
• e) head-to-tail ligation of the cDNA fragments.

The restriction enzyme used in step (ii) has a recognition sequence of preferably 7, 6 or 4 nucleotides.

In a further particularly preferred embodiment, the 3 'primer is an oligo dT primer, a universal or a special primer.

Analogous to the primer mentioned above, which binds to the sequence tag, are suitable these primers also help to make statements about the transcription activity of the to make appropriate transgene.

In another particularly preferred embodiment, the tag is biotin or Digoxygenin.

However, the method according to the invention is also suitable other affinity-imparting agents that are polymerase compatible.

In an additional particularly preferred embodiment, the the above range 8 to 20 nucleotides.

In a most preferred embodiment, the above includes Range 9 to 14 nucleotides.  

Finally, the present invention relates to a chip as defined above. By means of the receptors located on the chip, each specific for one The chip according to the invention is advantageously suitable for companies one step to analyze which of hundreds of Transgenic companies are included in a product. Because of the high Capacity, it is conceivable that on the chip according to the invention all worldwide existing companies that are active in this industry, about their individual Receptor are represented.

The figures show:

Fig. 1 Schematic representation of the ways in which artificial sequences can be amplified. = foreign nucleic acid. = artificial sequence. = Primer that hybridizes in the externally introduced nucleic acid. = universal primer that hybridizes to the artificial sequence.

Fig. 2 Schematic representation of how different primer pairs can be arranged around a genetic marker. P ₁ and P ₁ 'are universal primers. P ₂ . , .P _n and P ₂ '. , .P _n 'are special primers.

The examples illustrate the invention.

example 1 Encryption of information using a cryptographic Process and subsequent coding using a Quadruplet codes in DNA

The genetic marking is said to be the name of the originator of the GMO, the date of the Authorship, the name of the variant of the artificially genetically marked Organism, the name of the variant of the transgene, the Patent application number and references to the documentation of the organism contain. The information to be encrypted and encoded is, for example:  Xgen AG, February 12, 1995, Zea mays 1234, construct 123456/99, PCT / EP99 / 12345, www.Xgen-AG.com/transparency

This information is encrypted using a cryptographic method and then encoded in DNA using a quadruplet code:
ATGA TATTGCCGTCTGTGCAA CGATGAAACCCAGGATTAGATGATCCAGATCAG TGATFCATGATGATCCACCACAGTGGGTGAGTTACCCACAGATTATTAACCACC CACATTGATGATGATTTTAAAGAGAGACATGAGAGAGACATCATGATCAGATGTT GATGTCACCAGTGATGCAGACGCAGTGATGACGACGACTGATGACGATGGAAA AGTAGATGACAGATGATCAGATGATGACACACGTAAAAAGATGAAAGTTTAGGA CCCAGATGAGG GATGGAGTAGCCACATG AT. , ,

Corn kernels available on the market can be classified as follows based on the presence of Examine Artificial Genetic Labeling: Two primers that match the above underlined sequences or complementary sequences in opposite directions Hybridize senses are hybridized to DNA isolated from the corn kernels. A PCR is then carried out. The PCR conditions such as B. Hybridization time and temperature, elongation time, etc. depend on that used primer and the DNA fragment to be amplified and can can be readily determined by a person skilled in the art (see Sambrook et al. and Ausubel et al., Ios. cit.). The amplification products are melted and the Single strands are transferred to a chip with 6144 different ones Single-stranded DNAs is populated under conditions that require hybridization allow. These conditions depend on the DNA to be hybridized Single strands and can also be determined by a specialist (see Sambrook et al. and Ausubel et al., loc. cit.). Evidence of existence The above sequence in the corn kernels is labeled by binding a peroxidase anti-ds DNA specific monoclonal antibodies detected.

Claims (25)

1. Procedure for the (simultaneous) detection of one or more in one or several organisms or foreign introduced into one or more cells Nucleic acid (s), the introduced nucleic acid (s) being artificial Sequence (s) includes (s) proving the identity of the introduced nucleic acid (s) and the selective multiplication allows / allow, comprehensive examination of the organism (s) or the Cell (s) for the presence of the artificial sequence (s) and if necessary, identification of the artificial sequence (s) by means of Hybridization with a chip and / or sequencing. 2. The method of claim 1, wherein the artificial sequence (s) Restriction endonuclease recognition sites, transcription promoter sequences zen and / or replication initiators (ORIs) are or include. 3. The method of claim 1, wherein the presence of the artificial Sequence (s) using PCR, LCR or another amplification method is examined. 4. The method, preferably according to claim 1, for the detection of a nucleic acid introduced foreign into an organism or a cell, wherein the introduced nucleic acid comprises at least one artificial sequence which hybridizes with at least one universal primer under stringent hybridization conditions, which comprises the following steps:

• a) Amplification of the region of the introduced nucleic acid that is
  • a) between the at least one artificial sequence and a sequence in the nucleic acid introduced or
  • b) is located between at least two artificial sequences, or the sequences defined in (ai) or (aii) by means of PCR or another amplification method using the at least one universal primer and a primer which hybridizes with the sequence in the introduced nucleic acid under stringent hybridization conditions , or using the at least one universal primer; and
• b) (b ') transfer of the amplification product or the coded transition product onto at least one chip, on which there are in an ordered pattern receptors which specifically bind the amplification product, a single strand thereof or the coded translation product, and incubation under conditions which are detectable Allow binding of the receptor to the amplification product, the single strand thereof or the encoded translation product; and
• c) (c ') detection of whether the amplification product, the single strand thereof or the coded translation product has bound to the receptor; and or
• d) (b ") optionally cleaving the amplification products with a restriction enzyme cleaving in the region of the primer binding site and ligation of amplification products to a concatemer; and / or
• e) (c ") sequencing of the amplification product or the concatater.

5. The method of claim 4, wherein the introduced nucleic acid at least contains another artificial sequence that is associated with at least one special Primer hybridizes under stringent hybridization conditions, the at least one special primer with another primer that is under stringent hybridization conditions with a further sequence in the introduced nucleic acid hybridized, or with another special Primer that with another under stringent hybridization conditions artificial sequence hybridized, the amplification of a region of the introduced nucleic acid allows the at least one artificial sequence includes. 6. The method according to claim 4 or 5, wherein the at least two sequences and / or the at least two further sequences spatially apart are separated.   7. The method according to any one of claims 4 to 6, wherein the detected in step (c) Data are stored in digitized form. 8. The method according to claim 7, wherein the storage in a central memory he follows. 9. The method according to any one of claims 1 to 8, wherein the introduced Nucleic acid encodes a (poly) peptide. 10. The method of claim 9, wherein the (poly) peptide is a fusion protein. 11. The method of claim 9 or 10, wherein the introduced nucleic acid Is transgenic or an artificial sequence. 12. The method according to any one of claims 1 to 11, wherein the introduced Nucleic acid is or contains a recognition code. 13. The method of claim 12, wherein the identification code is encrypted. 14. The method according to claim 13, wherein the encryption is a is cryptographic encryption. 15. The method according to any one of claims 4 to 14, wherein the receptor Protein, preferably a glycoprotein, a specifically binding RNA or a peptide, or an antibody, a derivative or fragment thereof. 16. The method according to claim 15, wherein the antibody, the derivative or the Fragment thereof binds sequence-specific double-stranded DNA. 17. The method according to any one of claims 4 to 14, wherein the receptor Is single stranded DNA.   18. The method according to any one of claims 4 to 17, wherein in on the chip each position of the ordered pattern has a receptor with another Binding specificity. 19. The method according to any one of claims 4 to 14, wherein the following steps are carried out before steps (a), (b ") and (c"):

• a) cleavage of the introduced nucleic acids, which were previously provided with a sequence tag, with a restriction enzyme;
• b) isolation of the tagged fission products;
• c) halving of the cleavage products and ligation of the halves with different linkers;
• d) cleavage of the ligation product from (iii) with a type II restriction enzyme which has the binding site in the linkers and cleaves in the introduced nucleic acids, so that a region of the introduced nucleic acids remains connected to the linker; and
• e) head-to-tail ligation of the introduced nucleic acids.

20. The method of claim 19, wherein the introduced nucleic acids Are double-stranded cDNAs, and the following step is carried out before step (i) is: Generation of double-stranded cDNA from mRNA of the organism or the cell using a 3'- Primers. 21. The method according to any one of claims 4 to 14, wherein the following steps are carried out before steps (a), (b ") and (c"):

• a) Generation of double-strand cDNA from mRNA of the organism or the cell using a tagged 3 'primer;
• b) cleavage of the cDNA with a restriction enzyme;
• c) isolation of the tagged fission products;
• d) halving of the cleavage products and ligation of the halves with different linkers;
• e) cleavage of the ligation product from (iv) with a type II restriction enzyme which has the binding site in the linkers and cleaves in the cDNA so that a region of the cDNA remains connected to the linker; and
• f) head-to-tail ligation of the cDNA fragments.

22. The method according to claim 20 or 21, wherein the 3 'primer is an oligo-dT primer, is a universal or a special primer. 23. The method of claim 21 or 22, wherein the tag is biotin or digoxygenin is. 24. The method according to any one of claims 19 to 23, wherein the region comprises 8 to 20 nucleotides. 25. Chip as defined in one of claims 1 or 15 to 18.