EP1315834A2 - Artificial marking using synthetic dna - Google Patents
Artificial marking using synthetic dnaInfo
- Publication number
- EP1315834A2 EP1315834A2 EP01949371A EP01949371A EP1315834A2 EP 1315834 A2 EP1315834 A2 EP 1315834A2 EP 01949371 A EP01949371 A EP 01949371A EP 01949371 A EP01949371 A EP 01949371A EP 1315834 A2 EP1315834 A2 EP 1315834A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- nucleic acid
- primer
- amplification
- artificial sequence
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
Definitions
- the present invention relates to a method for the (simultaneous) detection of one or more nucleic acid (s) introduced foreign into one or more organisms or into one or more cells, wherein the introduced nucleic acid (s) (an) artificial sequence (s) comprises / allow the identification of the introduced nucleic acid (s) and the selective multiplication / allow, including the examination of the organism (s) or the cell (s) for the presence of the artificial sequence (s), and identification if necessary the artificial sequence (s) by means of hybridization with a chip and / or sequencing.
- the invention also relates to a method for the detection of a nucleic acid introduced foreign into an organism or a cell, the introduced nucleic acid comprising at least one artificial sequence which hybridizes with at least one universal primer under stringent hybridization conditions, which comprises the following steps: (a) amplification the region of the introduced nucleic acid which is (ai) between the at least one artificial sequence and a sequence in the introduced nucleic acid or (aii) between at least two artificial sequences, or the sequences defined in (ai) or (aii) by means of PCR or another amplification method using the at least one universal primer and a primer which hybridizes under stringent hybridization conditions with the sequence in the introduced nucleic acid, or using the at least one universal primer; and (b ') transferring the amplification product or the encoded translation product onto at least one chip on which there are arranged in an ordered pattern receptors which specifically bind the amplification product, a single strand thereof or the encoded translation product, and incubation under conditions which provide detect
- DNA is a naturally occurring molecule that in nature serves as a linear data carrier.
- a sequence of four nucleotides, including the bases adenine, guanine, cytosine and thymine, carries the genetic information encoding 20 amino acids in 64 different codon triplets.
- the DNA also carries structural information at the level of the RNA and the colinear proteins. The type of interaction of the molecules with one another at the functional level is also already defined as information in the DNA.
- Alien DNA can also be introduced into organisms using genetic engineering methods, which can then be stably inherited in the same way. Such organisms with additional functions are called transgenic or genetically modified organisms (GMOs).
- GMOs transgenic or genetically modified organisms
- Foreign DNA in transgenic organisms can consist of natural sequences that are isolated from organisms. Natural sequences are sequence sequences created by evolutionary processes. Artificial DNA sequences can be derived from natural sequences by manipulating the organism, for example by "in vitro" mutagenesis. The reference system also plays a role. A natural DNA sequence from one organism to another, alien organism that is not in this organism in terms of position and / or the sequence occurs, creates an artificial gene sequence in this modified system.
- a change in the position of a DNA sequence within an organism and also within a species caused by genetic engineering methods is also artificial in a strict definition.
- the immense number of possible combinations of the four nucleotides in different sequence variants gives rise to sequence spaces that are only partially realized by naturally occurring molecules in the organisms. The development of the genomes with their information content is therefore historical.
- DNA sequences can therefore also be completely artificial sequence sequences. Artificial sequence sequences are not found in nature and are not the result of evolutionary processes. Up to a certain length, certain DNA sequence sequences also occur in various organisms from a purely statistical point of view.
- Synthetic DNA can consist both of natural sequence sequences created by evolutionary processes, from these derived, artificially modified sequence variants created by human influence, as well as from completely artificial sequence sequences. Purely artificial DNA sequence sequences can only be produced synthetically, since there are no natural sources for them. Completely synthetic DNA of any information content, if it is stably introduced into organisms, can also be passed on stably and result in genetically modified or modified organisms.
- Functional, artificial, synthetic sequence sequences can code for partially or completely artificial genes which contain, for example, functional RNAs (for example suppressor RNA or ribozymes), artificial epitopes, affinity-mediating sequences or enzymatic activities.
- the expression of the function (eg epitope) in target cells could significantly facilitate the detection of the assigned artificial gene label.
- a transgenic organism equipped with natural or artificial synthetic sequences can carry both functional transgenes as well as mere sequence markings, the information content of which does not have to flow into functional RNA molecules and protein.
- a GMO is usually defined by the new gene function, which gives it a functional transgene in the cell (e.g. herbicide resistance).
- An artificial genetic marker is a functionally neutral additional piece of DNA, the sequence of which does not play a biologically active role. It is nothing more than an artificial genetic marker, regardless of the type of detection reaction.
- GMO genetically modified organism
- the present invention relates to a method for the (simultaneous) detection of one or more nucleic acid (s) introduced externally into one or more organisms or into one or more cells, wherein the introduced nucleic acid (s) (an) artificial sequence (s) ) which comprise the detection of the identity of the introduced nucleic acid (s) and the selective multiplication, comprising the examination of the organism (s) or the cell (s) for the presence of the artificial sequence (s) and, if necessary, identification the artificial sequence (s), by means of hybridization with a chip and / or sequencing.
- the fact that the term “simultaneous" is enclosed in parentheses means that simultaneity is an optional feature that is preferred at the same time.
- the term "externally introduced nucleic acid which comprises an artificial sequence (s)” means that the nucleic acid consists exclusively of an artificial sequence or contains an artificial sequence (s) in addition to other sequences.
- artificial sequence denotes sequences whose nucleotide sequence is not a naturally occurring nucleotide sequence. This term also includes naturally occurring sequences, the nucleotide sequence of which has been changed by molecular biological methods. It is of course also conceivable to combine artificial sequences with naturally occurring sequences for genetic labeling (see below).
- a non-naturally occurring nucleotide sequence is a sequence that is not stored as such or as part of a longer sequence in any database.
- the method according to the invention advantageously allows, by means of an informative, artificial genetic marking (1) organisms (for example bacterial strains, plant varieties or animals which can be propagated vegetatively or by cloning), (2) phenotypic features in the genome of organisms which have chromosomal regions correlate and (3) genetically engineered transgenic constructs to identify and identify quickly and easily. Products from transgenic organisms can also be identified if the transgenic constructs are genetically labeled accordingly.
- the artificial sequence can be chosen such that it encodes an artificial epitope, that is to say which does not occur in nature, and which is expressed as part of the translation product of the transgene.
- the translation product and, if appropriate, its origin can then be clearly identified by means of appropriate antibodies.
- Such translation products can, of course, also be identified at the RNA level if the product of the transgenic organism is an RNA.
- methods can be used for this, which are discussed in the present description in connection with the detection at the DNA level.
- the method according to the invention thus makes it possible, by means of artificial genetic labeling and its central registration, to bring systematics and transparency into the diversity of organisms which have been changed as a result of breeding and organisms which have been modified by genetic engineering with different transgenic constructs. Legal questions such as copyright protection, but also questions of genetic engineering security can be answered here. It is therefore easy to detect, for example, transgenic material on the basis of a genetic label in food, in particular if this genetic label is already known to a surveillance authority.
- Non-transgenic, stable varieties in plants e.g. varieties, varieties, selections that are vegetatively propagated or cloned, such as bulbs
- various varieties in clonable animals and bacterial strains must be clearly identified by means of artificial genetic markings in order to make legal claims, if necessary ,
- bioinformatics algorithms can also be used to select artificial sequences for genetic labeling that have as few natural occurrences as possible or are not known in nature.
- Eukaryotes go through meiosis in sexual reproduction, which is
- chromosomes are redistributed and mixed. But also within coupling groups (chromosomes) phenotypic inheritance
- Character combinations after sexual processes play a role provided that the marker can be positioned at appropriate loci on the chromosomes and integrated stably, for example by "site directed in vivo mutagenesis".
- GMOs with wild populations or processes of horizontal gene transfer can be determined. As a rule, however, you will be able to prove and prove the normal case with the method. There is usually no unwanted gene transfer between different species and transgenes, like other genes, are extremely stable and do not stray. In the case of genetic manipulation in modern plant breeding, however, it would be possible to use the method according to the invention to identify and avoid unwanted horizontal gene transfer and to eliminate corresponding transgenes.
- a significant advantage of using artificial genetic markings over the classic proof of the identity of different transgenic gene constructs of different origins in GMOs is the independence of the proof of the type of construct.
- Transgenic constructs can be identical or very similar in a wide variety of companies. In this case, it is difficult or impossible to get any information about the creator of the construct, even with a transparent company policy. But even with very different constructions, you may have no information about the exact configuration of the sequences involved. The commonly used generalized detection reaction for the transgenes may fail. In addition, it could be advantageous for companies to store all data for the construction of a transgene in a database and to ensure that the public can identify the transgene construct by means of an artificial genetic marking, but otherwise not to disclose the type of construct.
- the identity of organisms can be clearly represented with the help of genetic markings. Quantitative detection methods could also offer the opportunity to show the relative abundance of organisms (e.g. mixtures of different fermentatively active bacteria in food technology).
- the particular advantages of the artificial genetic labeling of tear genes lie in the direct access to the identification of a transgenic construct as Such through a clear possibility of assigning information to the construct, in the independence of the detection of the respective transgene construct, and in the possibility of the central and systematic recording and administration of transgenes.
- the artificial sequence (s) are restriction endonuclease recognition sites, transcription promoter sequences and / or replication initiators (ORIs).
- the presence of the artificial sequence (s) is examined by means of PCR, LCR or another amplification method.
- Methods for the detection of the artificial sequences are known to the person skilled in the art and include the PCR (polymerase chain reaction) technique, the DNA array technique and sequencing methods of DNA. But also detection methods such as "beach displacement" amplification, LCR (ligase chain reaction), RFLP (restriction fragment length polymorphism) or AFLP (amplified fragment length polymorphism) in connection with optical (e.g. fluorescence, chemiluminescence or bioluminescence), electrical or mass spectrometric Detection (MALDI-TOF) are suitable to detect the artificial sequences.
- detection methods such as “beach displacement” amplification, LCR (ligase chain reaction), RFLP (restriction fragment length polymorphism) or AFLP (amplified fragment length polymorphism) in connection with optical (e.g. fluorescence, chemiluminescence or bioluminescence), electrical or mass spectrometric Detection (MALDI-TOF) are suitable to detect the
- any DNA fragment can be reproduced, for example, by means of the PCR method to such an extent that it increases beyond the background of genomic DNA and can thus be analyzed.
- linear amplification methods are also suitable for carrying out the method according to the invention.
- the artificial sequence includes a promoter, for example, "run off" transcripts can be generated after suitable linearization, the presence or information content of which can be directly detected or analyzed, for example by means of hybridization with a chip.
- the detection of defined DNA fragments in naturally occurring DNAs depends on the location of various ideal sequence parameters in the natural base sequences (e.g. compatible PCR primer sequences, restriction sites (polymorphisms), LCA-compatible sequences etc.). This is different with artificial, freely definable sequences.
- the choice of the PCR primer pairs necessary for the detection of any artificially generated DNA sequence has significantly greater degrees of freedom here than in natural sequences.
- the base sequence of the primer sequences to be used is freely definable.
- the combination of different primer sequences to form primer pairs for the detection reaction of the synthetic partially or completely artificial sequence between the primers is also freely definable and only has to meet functional requirements (e.g. compatibility of the primers in the PCR reaction).
- the present invention relates to a method, preferably additionally with the technical features of the first embodiment described above, for the detection of a nucleic acid introduced foreign into an organism or a cell, wherein the introduced nucleic acid comprises at least one artificial sequence which is associated with at least one universal primer hybridized under stringent hybridization conditions, comprising the following steps: (a) amplification of the introduced nucleic acid region that is
- Allow receptor to the amplification product, the single strand thereof or the encoded translation product
- Amplification products to a concatemer and or
- the detection of the nucleic acid introduced externally can only be carried out via the at least one artificial sequence or else include sequences in the introduced nucleic acid.
- Nucleic acid over the at least one universal primer hybridizes to two artificial sequences or two regions of the artificial sequences or to one artificial sequence within the introduced nucleic acid and to another artificial sequence or to regions of the artificial sequences (FIG. 1B). The resulting
- Amplification products can thus also sequences of the introduced
- Nucleic acid and artificial sequences include or only from artificial
- a universal primer can be used, which serves both as a 5 'and 3' primer, or two universal primers of different sequences, one primer as a 5 'primer and the other Primer serves as a 3 'primer.
- the amplification products preferably consist exclusively of artificial sequences. From a length of 80 base pairs, sequences are created that have been statistically unique in their nucleotide sequence on Earth since their creation (Prof. Werner Arber, Nobel Prize winner). Thus, the artificial sequence (s) used according to the invention is / are preferably 80 base pairs or longer.
- Primers which are suitable for carrying out the method according to the invention can consist exclusively of naturally occurring nucleotides (i.e. deoxyribonucleotides and / or ribonucleotides), but can also include nucleotide analogs or modified nucleotides (mixed polymers). Modified nucleotides are known to the person skilled in the art and include, for example, 5,6-dihydrouridine, ribothymidine, inosine or 1-methylguanosine. In addition, the nucleotides of the primers need not be linked to one another via phosphodiester bonds, but can also be linked to one another via phosphothioate or methylphosphonate bonds.
- PNA Peptide nucleic acids
- PCR polymerase chain reaction
- the term “universal primer” means that this or the artificial sequence or the region thereof to which this primer hybridizes is designed in such a way that it generally allows the detection of the nucleic acid introduced externally, regardless of the Type and function of the nucleic acid introduced. In other words, this primer is used to answer the question of whether, for example, a certain food contains transgenic material.
- Stringent hybridization conditions are known in the art and will be able to be easily determined to be used in the primer or probe as a function of, for example, the length (see, for example, Sambrook et al., Molecular Cloning, a Laboratory Manual, 2 nd edition (1989), CSH Press , Cold Spring Harbor, NY; Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1989) or Higgins and Harnes, Nucleic Acid Hybridization, a Practical Approach, IRL Press Oxford, Washington DC (1985)).
- Persistent hybridization conditions are, for example, hybridization in 6 X SSC and 0.1% SDS at 65 ° C or in 50% formamide and 4 X SSC at 42 ° C and subsequent washing in 0.1 X SSC and 0.1% SDS at 65 ° C.
- Non-stringent hybridization conditions are, for example, hybridization and subsequent washing in 4 X SSC and 1% SDS at 50 ° C.
- the nucleic acid introduced contains at least one further artificial sequence which hybridizes with at least one special primer under stringent hybridization conditions, the at least one special primer with another primer and that under stringent hybridization conditions with another sequence in the introduced one Nucleic acid hybridizes, or with a further special primer, which hybridizes with another artificial sequence under stringent hybridization conditions, allows the amplification of a region of the introduced nucleic acid, which comprises the at least one artificial sequence.
- the further artificial sequences to which the special primers hybridize are always arranged on the corresponding DNA strand on the ⁇ ′ side to the artificial sequences to which the universal primers hybridize.
- the term “special primer” means that detection of an externally introduced one. Nucleic acid using these primers is specific for the type and / or function of the nucleic acid introduced. In other words, in contrast to the universal primer, which generally allows the detection of all transgenes labeled in this way, the special primer serves to either either a specific transgenic construct or a group of transgenic constructs, which, for example, from a certain company (originator) were produced.
- the at least two sequences and / or the at least two further sequences are spatially separated from one another.
- This embodiment advantageously makes it possible, for example by means of PCR, to amplify larger sequence sections in which more extensive information can be stored.
- the data recorded in step (c) are stored in digitized form.
- the storage takes place in one
- This embodiment allows artificial genetic markings of cells and living beings to be recorded centrally for the purpose of transparency and monitoring, and genetic engineering data is available worldwide and in a uniform system
- Legislators can ensure that transgenes are only legally permissible and that they can be subsequently constructed and marketed if they have been registered and their identity can be proven by a clear artificial genetic marking.
- the ZKBS Central Commission for Biosafety in Germany
- the nucleic acid introduced encodes a (poly) peptide.
- polypeptide encompasses both polypeptides or proteins which have a length of approximately 50 to several hundred amino acids and peptides which have a length of approximately 5 to 50 amino acids.
- the peptides are preferably artificial peptides, that is to say non-naturally occurring peptides which, for example, represent artificial epitopes.
- the (poly) peptide is a fusion protein.
- Nucleic acid a transgene or an artificial sequence.
- the artificial sequence advantageously allows quick and simple detection of the presence of the transgene in a sample.
- the artificial sequence can also serve the author to identify the transgene as a transgene that he has developed and produced.
- the nucleic acid introduced consists exclusively of an artificial sequence, then, as also discussed above, it allows, for example, organisms and / or phenotypic features to be identified or detected in the genome of an organism.
- the nucleic acid introduced is or contains a recognition code.
- the recognition code can represent a combinatorial coding or contain an encrypted text, ie a text which is translated into a nucleic acid sequence.
- the identification code is encrypted.
- information in the sequence enclosed by primer pairs is only limited by the ability of the PCR reaction to deliver sufficient amplified material of appropriate length for the detection reaction. Usually one would assume about 50 bp to about 1000 bp coding capacity. However, one could imagine much longer sequences if necessary.
- information can be stored in an artificial, synthetic DNA sequence, such as the name of the creator of the GMOs, the date of authorship, the variant of the artificially genetically labeled organism or the variant of the transgene, or both, the code of the copyright ( e.g. patent number) and / or references to the documentation of the organism, for example a website, database or a publication.
- the author is assigned primer pairs for the amplification of the enclosed artificial sequence, whose identity only he knows.
- primer pairs for these primer pairs, in a second stage he can now fill the DNA sequence between the primers with information that (a) only represents a recognition code (signature) or (b) carries information encoded directly in DNA or (c) information carries, which is additionally cryptographically encrypted, so that a Interested parties cannot read and identify the data even if they have the primers for amplifying the corresponding PCR fragment and know the primary code (b), with which alphanumeric characters can be converted into DNA-coded information.
- signature recognition code
- b carries information encoded directly in DNA
- information carries which is additionally cryptographically encrypted
- this company could have an interest in allowing third parties (e.g. the supervisory authority) to prove that the GMO is identified as being genetically modified. Further information, which concerns the exact identity of the transgenic organism, can only be collected if this proof is approved by them.
- the company would provide a monitoring authority with the PCR primers for identification, with which the genetically labeling DNA fragment as such e.g. can be demonstrated using array technologies.
- the surveillance authority thus represents the level of central recording, the task of which is to control and identify transgenic material.
- the exact identity of the organism and further information about this organism would remain encrypted in the hands of the company, or would only be accessible via a central database register. That the author represents the level of decentralized recording. Using the additional information, he can check whether third parties are using his material.
- the information density of array technologies is so large that a large number of centrally recorded, artificial genetic markings can be displayed on a carrier for the detection of the corresponding transgene constructs.
- a coding sequence can then also be sequenced, decoded and, if necessary, decrypted to prove individual detailed information.
- the encryption is cryptographic encryption.
- the receptor is a protein, preferably a glycoprotein, a specifically binding RNA or a peptide, preferably an artificial peptide or an antibody, a derivative or fragment thereof.
- Suitable antibodies can be polyclonal or monoclonal. Fragments or derivatives of antibodies and methods for their production are known to the person skilled in the art. Antibody fragments include, for example, F ab , F (ab . ) 2 , F v , F d or dAb fragments. Antibody derivatives include, for example, scFv.
- the antibody, the derivative or the fragment thereof binds double-stranded DNA in a sequence-specific manner.
- the receptor is a single-stranded DNA.
- the length of the single-stranded DNA can vary as long as it allows specific hybridization with the nucleic acids to be examined. That the single-stranded DNA can be an oligonucleotide approximately 12 to 30 nucleotides in length or a polynucleotide approximately 30 to several hundred nucleotides in length.
- the term "specifically hybridize” means that under stringent hybridization conditions (see above) only nucleic acid molecules which have a complementary nucleotide sequence hybridize with one another.
- steps (a), (b ") and (c") are carried out before steps (a), (b ") and (c"): (i) Cleavage of the nucleic acids which have been previously provided with a sequence tag with a restriction enzyme that doesn't cut in the day; (ii) isolation of the tagged fission products; (iii) halving the fission products and ligation of the halves with different ones
- Suitable tags are affinity tags that allow the isolation of the cleavage products.
- the restriction enzyme used in step (i) has a recognition sequence of preferably 7, 6 or 4 nucleotides.
- the Velculescu et al. (Science 270 (1995), 484-487), the SAGE technique described is particularly suitable as a detection method for the method according to the invention, since it allows an efficient and simultaneous detection of a large number of transgenic constructs. Detection using chip technology, on the other hand, only allows qualitative or semi-quantitative detection of transgenes. Since SAGE technology allows quantitative detection, it is also particularly suitable as an additional detection method for relevant questions.
- the method according to the invention not only allows qualitative detection of transgenes, i.e. the answer to the question of whether, and if so, which transgenes of which company are present in a sample, but also a quantitative proof, i.e. answering the question of how many transgenes from a company are present in a sample.
- the transcription activity of the transgenes at the RNA level can also be analyzed by means of the sequence tag. For this, the RNA is reverse transcribed using a primer that hybridizes to the sequence tag. The RNA is then present in the concatemer according to its frequency.
- the invention also relates to a sequencing station and suitable software which allow the method according to the invention to be carried out.
- the nucleic acids introduced are double-stranded cDNAs, and the following step is carried out before step (i) carried out: Generation of double-stranded cDNA from mRNA of the organism or of the cell using a 3 ' ⁇ primer provided with a sequence tag.
- linkers (v) cleavage of the ligation product from (iv) with a type II restriction enzyme which has the binding site in the linkers and cleaves in the cDNA so that a region of the cDNA remains connected to the linker; and (vi) head-to-tail ligation of the cDNA fragments.
- the restriction enzyme used in step (ii) has a recognition sequence of preferably 7, 6 or 4 nucleotides.
- the 3 'primer is an oligo-dT primer, a universal or a special primer.
- these primers are also suitable for making statements about the transcription activity of the corresponding transgene.
- the tag is biotin or
- affinity-imparting agents which are polymerase-compatible are also suitable for carrying out the method according to the invention.
- the above range comprises 8 to 20 nucleotides. In a most preferred embodiment, the above includes
- the present invention relates to a chip as defined above.
- the chip according to the invention is advantageously suitable for analyzing in one work step which one or hundreds of
- Transgenic companies are included in a product. Because of the high
- Nucleic acid. artificial sequence.
- I ⁇ primer that hybridizes in the externally introduced nucleic acid.
- ⁇ universal primer that hybridizes to the artificial sequence.
- Figure 2 Schematic representation of how different primer pairs can be arranged around a genetic marker.
- Pi and Pi ' are universal primers.
- P 2 ... P n and P 2 '... P n ' are special primers.
- the genetic marking should include the name of the author of the GMO, the date of the authorship, the name of the variant of the artificially genetically marked organism, the name of the variant of the transgene Patent application number and references to the documentation of the organism included.
- the information to be encrypted and encoded is, for example:
- This information is encrypted using a cryptographic method and then encoded in DNA using a quadruplet code:
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for (simultaneously) detecting one or more nucleic acid(s) introduced from the exterior into one or more organisms or into one or more cells, whereby the introduced nucleic acid(s) comprise(s) (an) artificial sequence(s), which enable(s) the detection of the identity of the introduced nucleic acid(s) and the selective multiplication. The inventive method involves the examination of the organism(s) or the cell(s) for the presence of the artificial sequence(s) and optionally involves the identification of the artificial sequence(s) by means of hybridization using a chip and/or sequencing. The invention also relates to method for detecting a nucleic acid that is introduced from the exterior into an organism or a cell, whereby the introduced nucleic acid comprises at least one artificial sequence, which is hybridized with at least one universal primer under stringent hybridization conditions. Said method comprises the following steps: (a) amplification of the area of the introduced nucleic acid, which is located (ai) between the at least one artificial sequence and a sequence in the introduced nucleic acid or (aii) between at least two artificial sequences, or amplification of the sequences defined in (ai) or (aii) by means of PCR or another amplification method while using the at least one universal primer and a primer, which hybridizes with the sequence in the introduced nucleic acid under stringent hybridization conditions, or while using the at least one universal primer, and; (b') transferring the amplification product or the coded translation product to at least one chip on which receptors are situated in an ordered pattern, said receptors specifically binding the amplification product, a single strand thereof or the coded translation product, and carrying out incubation under conditions, which enable a detectable binding of the receptor to the amplification product, to the single strand thereof or to the coded translation product, and; (c') detecting whether a binding of the amplification product, of the single strand thereof or of the coded translation product to the receptor has occurred, and/or; (b") optionally cleaving the amplification products with a restriction enzyme that cleaves in the area of the primer binding site, and carrying out ligation of amplification products to form a concatemer, and/or; (c") sequencing the amplification product or the concatemer. Lastly, the invention relates to a chip, which enables the implementation of the inventive method.
Description
Artifizielle genetische Markierung mit synthetischer DNA Artificial genetic labeling with synthetic DNA
Die vorliegende Erfindung betrifft ein Verfahren zum (gleichzeitigen) Nachweis einer oder mehrerer in einen oder mehrere Organismen oder in eine oder mehrere Zellen fremd eingeführten Nucleinsäure(n), wobei die eingeführte(n) Nucleinsäure(n) (eine) artifizielle Sequenz(en) umfaßt/umfassen, die den Nachweis der Identität der eingeführten Nucleinsäure(n) und die selektive Vermehrung erlaubt/erlauben, umfassend die Untersuchung des Organismus/der Organismen oder der Zelle(n) auf das Vorhandensein der artifiziellen Sequenz(en), und gegebenenfalls Identifizierung der artifiziellen Sequenz(en) mittels Hybridisierung mit einem Chip und/oder Sequenzierung. Die Erfindung betrifft außerdem ein Verfahren zum Nachweis einer in einen Organismus oder eine Zelle fremd eingeführten Nucleinsaure, wobei die eingeführte Nucleinsaure mindestens eine artifizielle Sequenz umfaßt, die mit mindestens einem universellen Primer unter stringenten Hybridisierungsbedingungen hybridisiert, das die folgenden Schritte umfaßt: (a) Amplifikation des Bereichs der eingeführten Nucleinsaure, der sich (ai) zwischen der mindestens einen artifiziellen Sequenz und einer Sequenz in der eingeführten Nucleinsaure oder (aii) zwischen mindestens zwei artifiziellen Sequenzen befindet, oder der in (ai) oder (aii) definierten Sequenzen mittels PCR oder einer anderen Amplifikationsmethode unter Verwendung des mindestens einen universellen Primers und eines Primers, der unter stringenten Hybridisierungsbedingungen mit der Sequenz in der eingeführten Nucleinsaure hybridisiert, oder unter Verwendung des mindestens einen universellen Primers; und (b') Übertragung des Amplifikationsproduktes oder des codierten Translationsproduktes auf mindestens einen Chip, auf dem sich in einem geordneten Muster Rezeptoren befinden, die das Amplifikationsprodukt, einen Einzelstrang davon oder das codierte Translationsprodukt spezifisch binden, und Inkubation unter Bedingungen, die eine nachweisbare Bindung des Rezeptors an das Amplifikationsprodukt, den Einzelstrang davon oder das codierte Translationsprodukt erlauben; und (c') Nachweis, ob eine Bindung des Amplifikationsproduktes, des
Einzelstrangs davon oder des codierten Translationsproduktes an den Rezeptor stattgefunden hat; und/oder (b") gegebenenfalls Spaltung der Amplifikationsprodukte mit einem im Bereich der Primerbindungsstelle spaltenden Restriktionsenzym und Ligation von ' Amplifikationsprodukten zu einem Concatemer; und/oder (c") Sequenzierung des Amplifikationsproduktes oder des Concatemers. Schließlich betrifft die Erfindung einen Chip, der die Durchführung der erfindungsgemäßen Verfahren erlaubt.The present invention relates to a method for the (simultaneous) detection of one or more nucleic acid (s) introduced foreign into one or more organisms or into one or more cells, wherein the introduced nucleic acid (s) (an) artificial sequence (s) comprises / allow the identification of the introduced nucleic acid (s) and the selective multiplication / allow, including the examination of the organism (s) or the cell (s) for the presence of the artificial sequence (s), and identification if necessary the artificial sequence (s) by means of hybridization with a chip and / or sequencing. The invention also relates to a method for the detection of a nucleic acid introduced foreign into an organism or a cell, the introduced nucleic acid comprising at least one artificial sequence which hybridizes with at least one universal primer under stringent hybridization conditions, which comprises the following steps: (a) amplification the region of the introduced nucleic acid which is (ai) between the at least one artificial sequence and a sequence in the introduced nucleic acid or (aii) between at least two artificial sequences, or the sequences defined in (ai) or (aii) by means of PCR or another amplification method using the at least one universal primer and a primer which hybridizes under stringent hybridization conditions with the sequence in the introduced nucleic acid, or using the at least one universal primer; and (b ') transferring the amplification product or the encoded translation product onto at least one chip on which there are arranged in an ordered pattern receptors which specifically bind the amplification product, a single strand thereof or the encoded translation product, and incubation under conditions which provide detectable binding allow the receptor to the amplification product, the single strand thereof, or the encoded translation product; and (c ') demonstrating whether binding of the amplification product, the Single strand of it or the encoded translation product to the receptor has occurred; and / or (b ") optionally cleaving the amplification products with a restriction enzyme cleaving in the region of the primer binding site and ligation of ' amplification products to a concatemer; and / or (c") sequencing the amplification product or the concatamer. Finally, the invention relates to a chip which allows the method according to the invention to be carried out.
DNA ist ein natürlich vorkommendes Molekül, das in der Natur als linearer Datenträger dient. Eine Sequenzabfolge von vier Nucleotiden, umfassend die Basen Adenin, Guanin, Cytosin und Thymin, trägt die genetische Information, die in 64 verschiedenen Codontripletts 20 Aminosäuren codiert. Neben der reinen Sequenzinformation trägt die DNA auch Strukturinformation auf der Ebene der RNA und der colinearer Proteine. Auch die Art der Wechselwirkung der Moleküle untereinander auf der Funktionsebene ist als Information in der DNA bereits festgelegt.DNA is a naturally occurring molecule that in nature serves as a linear data carrier. A sequence of four nucleotides, including the bases adenine, guanine, cytosine and thymine, carries the genetic information encoding 20 amino acids in 64 different codon triplets. In addition to the pure sequence information, the DNA also carries structural information at the level of the RNA and the colinear proteins. The type of interaction of the molecules with one another at the functional level is also already defined as information in the DNA.
Der Informationsgehalt der DNA wird in Organismen durch einen komplexen enzymatischen Apparat streng konserviert und mit hoher Präzision von Generation zu Generation weitergetragen. Die Natur erhält somit die genetische Information über Jahrmillionen sehr stabil, aber sie räumt den Organismen aus Gründen der Evolution eine geringe Fehlerrate ein, die zu Sequenzdivergenzen in verschiedenen Arten führt.The information content of DNA is strictly preserved in organisms by a complex enzymatic apparatus and passed on from generation to generation with high precision. Nature thus receives the genetic information very stably over millions of years, but for evolutionary reasons it grants the organism a low error rate, which leads to sequence divergences in different species.
Auch artfremde DNA kann durch gentechnische Methoden in Organismen eingebracht werden, die dann in gleicher Weise stabil vererbt werden kann. Solche gentechnisch mit zusätzlichen Funktionen ausgestattete Organismen nennt man transgene oder gentechnisch veränderte Organismen (GVO). Artfremde DNA in transgenen Organismen kann aus natürlichen Sequenzfolgen bestehen, die aus Organismen isoliert werden. Natürliche Sequenzen sind durch evolutionäre Prozesse entstandene Sequenzfolgen. Artifizielle DNA-Sequenzen können durch Manipulationen des Organismus aus natürlichen Sequenzen abgeleitet werden durch beispielsweise "in vitro"-Mutagenese. Auch das Bezugssystem spielt eine Rolle. Eine natürliche DNA-Sequenz aus dem einen Organismus, in einen anderen, artfremden Organismus gebracht, die so nicht in diesem Organismus bezüglich der Position
und/oder der Sequenz vorkommt, erzeugt eine artifizielle Gensequenz in diesem veränderten System. Eine durch gentechnologische Methoden herbeigeführte Veränderung der Position einer DNA-Sequenzfolge innerhalb eines Organismus und auch innerhalb einer Art ist in strenger Definition auch artifiziell. Die immense Anzahl der Kombinationsmöglichkeiten der vier Nucleotide in verschiedenen Sequenzvarianten läßt Sequenzräume entstehen, die von natürlich vorkommenden Molekülen in den Organismen nur zu einem Bruchteil realisiert werden. Die Entwicklung der Genome mit ihrem Informationsgehalt ist daher historisch.Alien DNA can also be introduced into organisms using genetic engineering methods, which can then be stably inherited in the same way. Such organisms with additional functions are called transgenic or genetically modified organisms (GMOs). Foreign DNA in transgenic organisms can consist of natural sequences that are isolated from organisms. Natural sequences are sequence sequences created by evolutionary processes. Artificial DNA sequences can be derived from natural sequences by manipulating the organism, for example by "in vitro" mutagenesis. The reference system also plays a role. A natural DNA sequence from one organism to another, alien organism that is not in this organism in terms of position and / or the sequence occurs, creates an artificial gene sequence in this modified system. A change in the position of a DNA sequence within an organism and also within a species caused by genetic engineering methods is also artificial in a strict definition. The immense number of possible combinations of the four nucleotides in different sequence variants gives rise to sequence spaces that are only partially realized by naturally occurring molecules in the organisms. The development of the genomes with their information content is therefore historical.
DNA-Sequenzen können daher auch vollständig artifizielle Sequenzfolgen sein. Artifizielle Sequenzfolgen findet man so in der Natur nicht und sind nicht durch evolutionäre Prozesse entstanden. Bis zu einer bestimmten Länge kommen bestimmte DNA-Sequenzfolgen aber auch rein statistisch gesehen in verschiedenen Organismen vor.DNA sequences can therefore also be completely artificial sequence sequences. Artificial sequence sequences are not found in nature and are not the result of evolutionary processes. Up to a certain length, certain DNA sequence sequences also occur in various organisms from a purely statistical point of view.
Synthetische DNA kann sowohl aus natürlichen, durch evolutionäre Prozesse entstandenen Sequenzfolgen, aus diesen abgeleiteten, durch menschlichen Einfluß entstandenen, artifiziell modifizierten Sequenzvarianten, sowie aus vollständig artifiziellen Sequenzfolgen bestehen. Rein artifizielle DNA-Sequenzfolgen können nur synthetisch hergestellt werden, da es keine natürlichen Quellen für sie gibt. Vollständig synthetische DNA beliebigen Informationsgehalts kann, wenn sie stabil in Organismen eingebracht wird, ebenso stabil weitervererbt werden und in genetisch veränderten bzw. modifizierten Organismen resultieren.Synthetic DNA can consist both of natural sequence sequences created by evolutionary processes, from these derived, artificially modified sequence variants created by human influence, as well as from completely artificial sequence sequences. Purely artificial DNA sequence sequences can only be produced synthetically, since there are no natural sources for them. Completely synthetic DNA of any information content, if it is stably introduced into organisms, can also be passed on stably and result in genetically modified or modified organisms.
Funktionale, artifizielle, synthetische Sequenzfolgen können für teilweise oder vollständig artifizielle Gene codieren, die beispielsweise funktionale RNAs (z.B. Suppressor RNA oder Ribozyme), künstliche Epitope, affinitätsvermittelnde Sequenzen oder enzymatische Aktivitäten in sich tragen. Die Expression der Funktion (z.B. Epitop) in Zielzellen könnte den Nachweis der zugeordneten artifiziellen Genmarkierung wesentlich erleichtern. Somit kann ein mit natürlichen oder artifiziellen synthetischen Sequenzen ausgestatteter transgener Organismus sowohl funktionale Transgene in sich tragen, als auch bloße Sequenzmarkierungen, deren Informationsgehalt nicht in funktionstragende RNA-Moleküle und Protein fließen muß.
Üblicherweise wird ein GVO durch die neue Genfunktion definiert, die ihm ein in der Zelle funktionsfähiges Transgen verleiht (z.B. Herbizidresistenz). Eine artifizielle genetische Markierung hingegen ist biologisch gesehen ein funktionsneutrales zusätzliches Stück DNA, dessen Sequenz keine biologisch aktive Rolle spielt. Sie ist nichts als eine artifizielle genetische Markierung, unabhängig von der Art der Nachweisreaktion.Functional, artificial, synthetic sequence sequences can code for partially or completely artificial genes which contain, for example, functional RNAs (for example suppressor RNA or ribozymes), artificial epitopes, affinity-mediating sequences or enzymatic activities. The expression of the function (eg epitope) in target cells could significantly facilitate the detection of the assigned artificial gene label. Thus, a transgenic organism equipped with natural or artificial synthetic sequences can carry both functional transgenes as well as mere sequence markings, the information content of which does not have to flow into functional RNA molecules and protein. A GMO is usually defined by the new gene function, which gives it a functional transgene in the cell (e.g. herbicide resistance). An artificial genetic marker, on the other hand, is a functionally neutral additional piece of DNA, the sequence of which does not play a biologically active role. It is nothing more than an artificial genetic marker, regardless of the type of detection reaction.
Die Definition eines gentechnisch veränderten Organismus (GVO) ist unabhängig von der Funktion der genetischen Veränderung streng formal zu fassen. Ein solcher Organismus ist genetisch verändert aber nicht notwendigerweise transgen. Im Zeitalter der modernen Biotechnologie und Gentechnologie, in dem die- Herstellung von gentechnologisch veränderten Organismen unterschiedlichster Art immer mehr zur Routinearbeit wird, und in dem eine industrielle Verwertung des Nutzens dieser Organismen auf lange Sicht unumgänglich ist, besteht ein großer Bedarf, die hergestellten Organismen bzw. eingebrachten Vektoren mittels eines einfachen, schnellen und kostengünstigen Verfahrens eindeutig zu identifizieren bzw. nachzuweisen. Dies setzt eine entsprechende Markierung der Organismen bzw. Vektoren voraus.The definition of a genetically modified organism (GMO) is to be formulated strictly independently of the function of the genetic modification. Such an organism is genetically modified but not necessarily transgenic. In the age of modern biotechnology and genetic engineering, in which the production of genetically modified organisms of all kinds is becoming more and more routine, and in which industrial exploitation of the benefits of these organisms is inevitable in the long term, there is a great need to manufacture the organisms or . Uniquely identify or prove the vectors introduced by means of a simple, fast and inexpensive method. This requires a corresponding marking of the organisms or vectors.
Das der vorliegenden Erfindung zugrundeliegende technische Problem war somit, Mittel und Wege zur Verfügung zu stellen, die diesen Bedarf befriedigen.The technical problem on which the present invention is based was therefore to provide means and ways which satisfy this need.
Dieses technische Problem wird durch die in den Ansprüchen charakterisierten Ausführungsformen gelöst.This technical problem is solved by the embodiments characterized in the claims.
Somit betrifft die vorliegende Erfindung ein Verfahren zum (gleichzeitigen) Nachweis einer oder mehrerer in einen oder mehrere Organismen oder in eine oder mehrere Zellen fremd eingeführten Nucleinsäure(n), wobei die eingeführte(n) Nucleinsäure(n) (eine) artifizielle Sequenz(en) umfaßt/umfassen, die den Nachweis der Identität der eingeführten Nucleinsäure(n) und die selektive Vermehrung erlaubt/erlauben, umfassend die Untersuchung des Organismus/der Organismen oder der Zelle(n) auf das Vorhandensein der artifiziellen Sequenz(en) und gegebenenfalls Identifizierung der artifiziellen Sequenz(en), mittels Hybridisierung mit einem Chip und/oder Sequenzierung.
Dadurch, daß der Begriff "gleichzeitigen" in Klammern gefaßt ist wird bedeutet, daß die Gleichzeitigkeit ein optionales Merkmal ist, das gleichzeitig bevorzugt ist. Der Begriff "fremd eingeführte Nucleinsaure, die (eine) artifizielle Sequenz(en) umfaßt" bedeutet, daß die Nucleinsaure ausschließlich aus einer artifiziellen Sequenz besteht, oder (eine) artifizielle Sequenz(en) zusätzlich zu weiteren Sequenzen enthält.Thus, the present invention relates to a method for the (simultaneous) detection of one or more nucleic acid (s) introduced externally into one or more organisms or into one or more cells, wherein the introduced nucleic acid (s) (an) artificial sequence (s) ) which comprise the detection of the identity of the introduced nucleic acid (s) and the selective multiplication, comprising the examination of the organism (s) or the cell (s) for the presence of the artificial sequence (s) and, if necessary, identification the artificial sequence (s), by means of hybridization with a chip and / or sequencing. The fact that the term "simultaneous" is enclosed in parentheses means that simultaneity is an optional feature that is preferred at the same time. The term "externally introduced nucleic acid which comprises an artificial sequence (s)" means that the nucleic acid consists exclusively of an artificial sequence or contains an artificial sequence (s) in addition to other sequences.
Der Begriff "artifizielle Sequenz" bezeichnet im Sinne der vorliegenden Erfindung Sequenzen, deren Nucleotidsequenz keine natürlich vorkommende Nucleotidsequenz ist. Dieser Begriff umfaßt also auch natürlich vorkommende Sequenzen, deren Nucleotidsequenz durch molekularbiologische Methoden verändert wurde. Es ist natürlich auch vorstellbar, für eine genetische Markierung artifizielle Sequenzen mit natürlich vorkommenden Sequenzen zu kombinieren (siehe unten).In the context of the present invention, the term “artificial sequence” denotes sequences whose nucleotide sequence is not a naturally occurring nucleotide sequence. This term also includes naturally occurring sequences, the nucleotide sequence of which has been changed by molecular biological methods. It is of course also conceivable to combine artificial sequences with naturally occurring sequences for genetic labeling (see below).
Vorzugsweise ist eine nicht natürlich vorkommende Nucleotidsequenz eine Sequenz, die als solche oder als Teil einer längeren Sequenz in keiner Datenbank gespeichert ist.Preferably, a non-naturally occurring nucleotide sequence is a sequence that is not stored as such or as part of a longer sequence in any database.
Das erfindungsgemäße Verfahren erlaubt es vorteilhafterweise, mittels einer informativen, artifiziellen genetischen Markierung (1 ) Organismen (z.B. Bakterienstämme, Pflanzensorten oder Tiere, die vegetativ oder durch Klonierung vermehrt werden können), (2) phänotypische Merkmale im Genom von Organismen, die mit chromosomalen Bereichen korrelieren und (3) gentechnologisch hergestellte transgene Konstrukte schnell und einfach nachzuweisen bzw. zu identifizieren. Darüber hinaus lassen sich auch Produkte aus transgenen Organismen identifizieren, wenn die transgenen Konstrukte entsprechend genetisch markiert sind. Beispielsweise kann die artifizielle Sequenz so gewählt werden, άaß> sie ein artifizielles, also in der Natur nicht vorkommendes Epitop codiert, das als Teil des Translationsproduktes des Transgens exprimiert wird. Mittels entsprechender Antikörper kann dann das Translationsprodukt und gegebenenfalls dessen Herkunft eindeutig identifiziert werden. Eine Identifikation solcher Translationsprodukte oder im Falle, daß das Produkt des transgenen Organismus eine RNA ist, kann natürlich auch auf RNA-Ebene erfolgen. Hierfür können im wesentlichen Methoden verwendet werden, die in der vorliegenden Beschreibung in Zusammenhang mit dem Nachweis auf DNA-Ebene diskutiert werden.
Das erfindungsgemäße Verfahren erlaubt damit, mittels artifizieller genetischer Markierung und deren zentraler Registrierung Systematik und Transparenz in die Vielfalt von züchtungsbedingt veränderten Organismen und gentechnologisch, mit verschiedenen transgenen Konstrukten veränderten Organismen zu bringen. Hier können rechtliche Fragen wie des Urheberschutzes, aber auch Fragen der gentechnologischen Sicherheit beantwortet werden. Somit ist es einfach, beispielsweise transgenes Material anhand einer genetischen Markierung in Lebensmitteln nachzuweisen, insbesondere, wenn diese genetische Markierung bereits einer Überwachungsbehörde bekannt ist.The method according to the invention advantageously allows, by means of an informative, artificial genetic marking (1) organisms (for example bacterial strains, plant varieties or animals which can be propagated vegetatively or by cloning), (2) phenotypic features in the genome of organisms which have chromosomal regions correlate and (3) genetically engineered transgenic constructs to identify and identify quickly and easily. Products from transgenic organisms can also be identified if the transgenic constructs are genetically labeled accordingly. For example, the artificial sequence can be chosen such that it encodes an artificial epitope, that is to say which does not occur in nature, and which is expressed as part of the translation product of the transgene. The translation product and, if appropriate, its origin can then be clearly identified by means of appropriate antibodies. Such translation products can, of course, also be identified at the RNA level if the product of the transgenic organism is an RNA. Essentially, methods can be used for this, which are discussed in the present description in connection with the detection at the DNA level. The method according to the invention thus makes it possible, by means of artificial genetic labeling and its central registration, to bring systematics and transparency into the diversity of organisms which have been changed as a result of breeding and organisms which have been modified by genetic engineering with different transgenic constructs. Legal questions such as copyright protection, but also questions of genetic engineering security can be answered here. It is therefore easy to detect, for example, transgenic material on the basis of a genetic label in food, in particular if this genetic label is already known to a surveillance authority.
Die artifizielle genetische Markierung von Organismen in Chromosomen und Episomen, sowie in Organellen mittels synthetischer DNA kann, wie gesagt, überall dort von Vorteil sein, wo man es mit rechtlichen Fragestellungen zu tun hat, die einen sehr genauen Nachweis der Herkunft und Identität von Organismen notwendig machen. Zum einen können in DNA verschlüsselte Urheberrechte uns sonstige Daten als. Markierungen z.B. bei bestimmten proprietären Rechtsansprüchen auf bestimmte transgen veränderte Organismen (GVO) von großer Bedeutung sein, wenn man wirtschaftliche Einbußen durch den Mißbrauch von Eigentumsrechten zu befürchten hat.The artificial genetic labeling of organisms in chromosomes and episomes, as well as in organelles by means of synthetic DNA can, as I said, be of advantage wherever there are legal issues that require a very precise proof of the origin and identity of organisms do. On the one hand, copyrights encoded in DNA can give us other data as. Markings e.g. be of great importance for certain proprietary legal claims to certain transgenic organisms (GMOs), if one has to fear economic losses through the abuse of property rights.
Nicht transgene, stabile Sorten bei Pflanzen, (z.B. Züchtungen, Sorten, Selektionen, die vegetativ vermehrt oder kloniert werden, wie etwa Blumenzwiebeln) sowie verschiedene Züchtungen bei klonierbaren Tieren und Bakterienstämme sind mittels artifiziellen genetischen Markierungen eindeutig zu identifizieren, um gegebenenfalls Rechtsansprüche geltend zu machen.Non-transgenic, stable varieties in plants (e.g. varieties, varieties, selections that are vegetatively propagated or cloned, such as bulbs) as well as various varieties in clonable animals and bacterial strains must be clearly identified by means of artificial genetic markings in order to make legal claims, if necessary ,
Beispielsweise bei Fermentationsprozessen in der Herstellung von Lebensmitteln oder in der Pharmaindustrie ist der Einsatz von genetisch artifiziell markierten Organismen möglich. Neben vereinfachten Methoden der Stammpfiege, beispielsweise bei der präzisen Identifikation fermentativ aktiver Bakterien definierter Eigenschaften ist es auch möglich, durch den Gebrauch von artifiziell genetisch markierten Bakterien oder Pilzstämmen, sich Informationen über die definierte Zusammensetzung von Mischpopulationen zu verschaffen.For example, in fermentation processes in the production of food or in the pharmaceutical industry, the use of genetically artificially labeled organisms is possible. In addition to simplified methods of stem care, for example in the precise identification of fermentatively active bacteria with defined properties, it is also possible to obtain information about the defined composition of mixed populations by using artificially genetically marked bacteria or fungal strains.
In gleicher Weise ist es möglich, mittels artifizieller genetischer Markierung Zellpopulationen, die ex vivo zur genetischen Manipulation für Gentherapie und/oder
Immuntherapie herangezogen werden, dauerhaft zu markieren und das Schicksal der Zellpopulationen im Organismus in vivo zu verfolgen.In the same way, it is possible, by means of artificial genetic labeling, for cell populations that are used ex vivo for genetic manipulation for gene therapy and / or Immunotherapy can be used to permanently mark and track the fate of cell populations in the organism in vivo.
Zur genetischen Differenzierung und Identifizierung von Organismen werden zumFor the genetic differentiation and identification of organisms, the
Teil mit aufwendigen Verfahren genetische Unterschiede in der Genausstattung der verschiedenen Organismen analysiert. Mit artifiziellen genetischen Markierungen kann diese aufwendige Arbeit vermieden werden.Part analyzed with complex procedures genetic differences in the genetic makeup of the different organisms. This laborious work can be avoided with artificial genetic markings.
Mittels der Bioinformatik kann man zusätzlich Algorithmen anwenden, mit denen artifizielle Sequenzen zur genetischen Markierung selektiert werden, die möglichst kein natürliches Vorkommen haben bzw. in der Natur gar nicht bekannt sind.Using bioinformatics, algorithms can also be used to select artificial sequences for genetic labeling that have as few natural occurrences as possible or are not known in nature.
Eukaryoten gehen bei der sexuellen Reproduktion durch die Meiose, wobei dasEukaryotes go through meiosis in sexual reproduction, which is
Erbgut insbesondere die Chromosomen neu verteilt und gemischt werden. Aber auch innerhalb von Kopplungsgruppen (Chromosomen) phänotypischer Vererbung wirdGenetic material in particular the chromosomes are redistributed and mixed. But also within coupling groups (chromosomes) phenotypic inheritance
Material durch Crossover neu rekombiniert. Nur wenn genetische Marker sehr nahe bei einem Gen oder einer Gengruppe liegen, das/die phänotypischen Einflüsse auf die Eigenschaften des Organismus hat/haben, ist dieMaterial recombined by crossover. Only if genetic markers are very close to a gene or a group of genes that has phenotypic influences on the properties of the organism is that
Rekombinationswahrscheinlichkeit des genetischen Austausches von Markem mit den verantwortlichen Genen gering genug, um die Sicherheit der Cosegregation vonThe probability of recombination of the genetic exchange of markers with the responsible genes is low enough to ensure the safety of the cosegregation of
Markern und Markiertem zu gewährleisten.Ensure markers and marked.
Artifizielle genetische Markierung mit synthetischer DNA kann bei der Identifikation und dem Nachweis von phänotypischen Eigenschaften bei der Selektion geeigneterArtificial genetic labeling with synthetic DNA can be more suitable in the identification and detection of phenotypic properties in the selection
Merkmalskombinationen nach sexuellen Prozessen eine Rolle spielen, sofern es gelingt, die Markierung an entsprechenden Loci auf den Chromosomen zu positionieren und stabil zu integrieren, beispielsweise durch "site directed in vivo mutagenesis".Character combinations after sexual processes play a role, provided that the marker can be positioned at appropriate loci on the chromosomes and integrated stably, for example by "site directed in vivo mutagenesis".
Im Umweltrecht könnte die artifizielle genetische Markierung und deren Analyse zurIn environmental law, the artificial genetic marking and its analysis could
Kontrolle von GVOs bei der Identifikation der Herkunft und Art von transgenemControl of GMOs in the identification of the origin and type of transgenic
Material nachhaltig verbessert werden.Material will be improved sustainably.
Insbesondere ist es mit solchen Verfahren möglich, ein Maximum an Transparenz über die Verbreitung von Transgenen zu schaffen.In particular, it is possible with such methods to create maximum transparency regarding the spread of transgenes.
Die genaue Identität und Herkunft eines Transgens und dessen Verbreitung könnte zur Risikoabschätzung im Falle des Nachweises eines vertikalen Gentransfer einesThe exact identity and origin of a transgene and its distribution could be used for risk assessment if vertical gene transfer is detected
GVO mit Wildpopulationen oder Prozesse des horizontalen Gentransfers ermittelt werden.
In der Regel aber wird man mit der Methode aber gerade auch den Normalfall be- und nachweisen können. Normalerweise findet kein ungewollter Gentransfer zwischen verschiedenen Arten statt und Transgene, wie andere Gene auch, sind äußerst stabil und vagabundieren nicht. Bei der genetischen Manipulation in der modernen Pflanzenzüchtung könnte man jedoch mittels des erfindungsgemäßen Verfahrens ungewollten horizontalen Gentransfer identifizieren, vermeiden und entsprechende Transgene eliminieren.GMOs with wild populations or processes of horizontal gene transfer can be determined. As a rule, however, you will be able to prove and prove the normal case with the method. There is usually no unwanted gene transfer between different species and transgenes, like other genes, are extremely stable and do not stray. In the case of genetic manipulation in modern plant breeding, however, it would be possible to use the method according to the invention to identify and avoid unwanted horizontal gene transfer and to eliminate corresponding transgenes.
Bei der enzymatischen Fermentation können durch moderne molekulare Evolutionssysteme u.a. neue Gene für enzymatische Varianten mit verbesserten Eigenschaften entstehen. Markierte Stämme, die solche Gene in sich tragen, sind durch artifizielle genetische Markierung leicht von Kontaminanten zu unterscheiden. Beispielsweise könnten Transgene auf diese Art und Weise in DNA codierte Versionsnummern bzw. Update-Nummern tragen.In enzymatic fermentation, modern molecular evolution systems can new genes for enzymatic variants with improved properties are created. Labeled strains that carry such genes are easily distinguished from contaminants by artificial genetic labeling. In this way, for example, transgenes could carry version numbers or update numbers encoded in DNA.
Ein deutlicher Vorteil der Verwendung artifizieller genetischer Markierungen gegenüber dem klassischen Nachweis der Identität verschiedener transgener Genkonstrukte unterschiedlicher Herkunft bei GVOs ist die Unabhängigkeit des Nachweises von der Art des Konstruktes. Transgene Konstrukte können bei verschiedensten Firmen identisch bzw. sehr ähnlich sein. In diesem Fall bekommt man keine oder nur schwer Informationen über den Urheber des Konstruktes auch bei transparenter Firmenpolitik. Aber auch bei sehr unterschiedlichen Konstrukten hat man u.U. keine Information über die genaue Konfiguration der beteiligten Sequenzen. Möglicherweise versagt dabei die üblicherweise verwendete generalisierte Nachweisreaktion für die Transgene. Darüber hinaus könnte es für Firmen von Vorteil sein, alle Daten für die Konstruktion eines Transgens in einer Datenbank zu hinterlegen und der Öffentlichkeit eine Identifikationsmöglichkeit des Transgenkonstruktes durch eine artifizielle genetische Markierung zu gewährleisten, ansonsten aber die Art des Konstruktes nicht offenzulegen.A significant advantage of using artificial genetic markings over the classic proof of the identity of different transgenic gene constructs of different origins in GMOs is the independence of the proof of the type of construct. Transgenic constructs can be identical or very similar in a wide variety of companies. In this case, it is difficult or impossible to get any information about the creator of the construct, even with a transparent company policy. But even with very different constructions, you may have no information about the exact configuration of the sequences involved. The commonly used generalized detection reaction for the transgenes may fail. In addition, it could be advantageous for companies to store all data for the construction of a transgene in a database and to ensure that the public can identify the transgene construct by means of an artificial genetic marking, but otherwise not to disclose the type of construct.
Die Identität von Organismen ist mit Hilfe von genetischen Markierungen eindeutig darstellbar. Quantitative Nachweisverfahren könnten auch die Gelegenheit bieten, relative Häufigkeiten von Organismen darzustellen (z.B. Gemische verschiedener fermentativ aktiver Bakterien in der Lebensmitteltechnologie). Die besonderen Vorteile der artifiziellen genetischen Markierung von Tränsgenen liegen also in dem direkten Zugang zur Identifikation eines Transgenkonstrukts als
solches durch eine eindeutige Möglichkeit der Zuordnung von Information zum Konstrukt, in der Unabhängigkeit des Nachweises vom jeweiligen Transgenkonstrukt, und in der Möglichkeit der zentralen und systematischen Erfassung und Verwaltung von Transgenen.The identity of organisms can be clearly represented with the help of genetic markings. Quantitative detection methods could also offer the opportunity to show the relative abundance of organisms (e.g. mixtures of different fermentatively active bacteria in food technology). The particular advantages of the artificial genetic labeling of tear genes lie in the direct access to the identification of a transgenic construct as Such through a clear possibility of assigning information to the construct, in the independence of the detection of the respective transgene construct, and in the possibility of the central and systematic recording and administration of transgenes.
In einer bevorzugten Ausführungsform sind oder umfassen die artifizielle(n) Sequenz(en) Restriktionsendonuclease-Erkennungsstellen, Transkriptionspromotersequenzen und/oder Replikationsinitatoren (ORIs).In a preferred embodiment, the artificial sequence (s) are restriction endonuclease recognition sites, transcription promoter sequences and / or replication initiators (ORIs).
Es können jedoch auch andere cis-aktive Elemente zur Durchführung des erfindungsgemäßen Verfahrens verwendet werden.However, other cis-active elements can also be used to carry out the method according to the invention.
In einer weiteren bevorzugten Ausführungsform wird das Vorhandensein der artifiziellen Sequenz(en) mittels PCR, LCR oder einer anderen Amplifikationsmethode untersucht.In a further preferred embodiment, the presence of the artificial sequence (s) is examined by means of PCR, LCR or another amplification method.
Methoden zum Nachweis der artifiziellen Sequenzen sind dem Fachmann bekannt und umfassen die PCR (Polymerasekettenreaktion)-Technik, die DNA-Arraytechnik und Sequenzierungsverfahren von DNA. Aber auch Nachweisverfahren wie beispielsweise die "Strand displacement" Amplifikation, LCR (Ligase chain reaction), RFLP (restriction fragment length polymorphism) oder AFLP (amplified fragment length polymorphism) in Verbindung mit optischer (z.B. Fluoreszenz, Chemilumineszenz oder Biolumineszenz), elektrischer oder massenspektrometrischer Detektion (MALDI-TOF) sind geeignet, die artifiziellen Sequenzen nachzuweisen.Methods for the detection of the artificial sequences are known to the person skilled in the art and include the PCR (polymerase chain reaction) technique, the DNA array technique and sequencing methods of DNA. But also detection methods such as "beach displacement" amplification, LCR (ligase chain reaction), RFLP (restriction fragment length polymorphism) or AFLP (amplified fragment length polymorphism) in connection with optical (e.g. fluorescence, chemiluminescence or bioluminescence), electrical or mass spectrometric Detection (MALDI-TOF) are suitable to detect the artificial sequences.
Für den Nachweis einer artifiziellen genetischen Markierung von Organismen mit synthetischer DNA geht man davon aus, daß man z.B. mittels der PCR-Methode jedes beliebige DNA-Fragment soweit vervielfältigen kann, daß es über den Hintergrund genomischer DNA hinaus vermehrt und dadurch analysierbar wird. Jedoch eignen sich auch lineare Amplifikationsmethoden zur Durchführung des erfindungsgemäßen Verfahrens. Umfaßt die artifizielle Sequenz beispielsweise einen Promotor, können gegebenenfalls nach geeigneter Linearisierung "run off"- Transkripte erzeugt werden, deren Vorhandensein bzw. Informationsgehalt beispielsweise mittels Hybridisierung mit einem Chip direkt nachgewiesen bzw. analysiert werden kann.
Der Nachweis definierter DNA-Fragmente ist bei natürlich vorkommenden DNAs (z.B. genomischer DNA) von der Lokalisation verschiedener idealer Sequenzparameter in den natürlichen Basenabfolgen abhängig (z.B. kompatible PCR-Primersequenzen, Restriktionsschnittstellen (Polymorphismen), LCA- kompatible Sequenzen etc.). Bei artifiziellen, frei definierbaren Sequenzen ist dies anders.For the detection of an artificial genetic labeling of organisms with synthetic DNA, it is assumed that any DNA fragment can be reproduced, for example, by means of the PCR method to such an extent that it increases beyond the background of genomic DNA and can thus be analyzed. However, linear amplification methods are also suitable for carrying out the method according to the invention. If the artificial sequence includes a promoter, for example, "run off" transcripts can be generated after suitable linearization, the presence or information content of which can be directly detected or analyzed, for example by means of hybridization with a chip. The detection of defined DNA fragments in naturally occurring DNAs (e.g. genomic DNA) depends on the location of various ideal sequence parameters in the natural base sequences (e.g. compatible PCR primer sequences, restriction sites (polymorphisms), LCA-compatible sequences etc.). This is different with artificial, freely definable sequences.
Die Wahl der zum Nachweis einer beliebigen, künstlich erzeugten DNA-Sequenz notwendigen PCR-Primerpaare hat hier deutlich größere Freiheitsgrade, als in natürlichen Sequenzen. Die Basenfolge der zu verwendenden Primersequenzen ist frei definierbar. Die Kombination verschiedener Primersequenzen zu Primerpaaren für die Nachweisreaktion der zwischen den Primern liegenden synthetischen teilweise oder vollständig artifiziellen Sequenz ist ebenso frei definierbar und muß nur funktionale Erfordernisse (z.B. Kompatibilität der Primer in der PCR-Reaktion) erfüllen.The choice of the PCR primer pairs necessary for the detection of any artificially generated DNA sequence has significantly greater degrees of freedom here than in natural sequences. The base sequence of the primer sequences to be used is freely definable. The combination of different primer sequences to form primer pairs for the detection reaction of the synthetic partially or completely artificial sequence between the primers is also freely definable and only has to meet functional requirements (e.g. compatibility of the primers in the PCR reaction).
In einer anderen Ausführungsform betrifft die vorliegende Erfindung ein Verfahren, vorzugsweise zusätzlich mit den technischen Merkmalen der vorstehend beschriebenen ersten Ausführungsform, zum Nachweis einer in einen Organismus oder eine Zelle fremd eingeführten Nucleinsaure, wobei die eingeführte Nucleinsaure mindestens eine artifizielle Sequenz umfaßt, die mit mindestens einem universellen Primer unter stringenten Hybridisierungsbedingungen hybridisiert, das die folgenden Schritte umfaßt: (a) Amplifikation des Bereichs der eingeführten Nucleinsaure, der sichIn another embodiment, the present invention relates to a method, preferably additionally with the technical features of the first embodiment described above, for the detection of a nucleic acid introduced foreign into an organism or a cell, wherein the introduced nucleic acid comprises at least one artificial sequence which is associated with at least one universal primer hybridized under stringent hybridization conditions, comprising the following steps: (a) amplification of the introduced nucleic acid region that is
(ai) zwischen der mindestens einen artifiziellen Sequenz und einer Sequenz in der eingeführten Nucleinsaure oder (aii) zwischen mindestens zwei artifiziellen Sequenzen befindet, oder der in (ai) oder (aii) definierten Sequenzen mittels PCR oder einer anderen Amplifikationsmethode unter Verwendung des mindestens einen universellen Primers und eines Primers, der unter stringenten Hybridisierungsbedingungen mit der Sequenz in der eingeführten Nucleinsaure hybridisiert, oder unter Verwendung des mindestens einen universellen Primers; und
(b') Übertragung des Amplifikationsproduktes oder des codierten(ai) between the at least one artificial sequence and a sequence in the introduced nucleic acid or (aii) between at least two artificial sequences, or the sequences defined in (ai) or (aii) by means of PCR or another amplification method using the at least one universal primer and a primer that hybridizes under stringent hybridization conditions with the sequence in the nucleic acid introduced, or using the at least one universal primer; and (b ') Transfer of the amplification product or the coded
Translationsproduktes auf mindestens einen Chip, auf dem sich in einem geordneten Muster Rezeptoren befinden, die das Amplifikationsprodukt, einenTranslation product on at least one chip on which there are receptors in an ordered pattern that the amplification product, one
Einzelstrang davon oder das codierte Translationsprodukt spezifisch binden, und Inkubation unter Bedingungen, die eine nachweisbare Bindung desSingle strand thereof or specifically bind the encoded translation product, and incubation under conditions that detect detectable binding of the
Rezeptors an das Amplifikationsprodukt, den Einzelstrang davon oder das codierte Translationsprodukt erlauben; undAllow receptor to the amplification product, the single strand thereof or the encoded translation product; and
(c') Nachweis, ob eine Bindung des Amplifikationsproduktes, des Einzelstrangs davon oder des codierten Translationsproduktes an den Rezeptor stattgefunden hat; und/oder(c ') detection of whether the amplification product, the single strand thereof or the encoded translation product has bound to the receptor; and or
(b") gegebenenfalls Spaltung der Amplifikationsprodukte mit einem im Bereich der(b ") optionally cleaving the amplification products with a in the range of
Primerbindungsstelle spaltenden Restriktionsenzym und Ligation vonRestriction enzyme cleaving the primer binding site and ligation of
Amplifikationsprodukten zu einem Concatemer; und/oderAmplification products to a concatemer; and or
(c") Sequenzierung des Amplifikationsproduktes oder des Concatemers.(c ") Sequencing of the amplification product or the concatenter.
Der Nachweis der fremd eingeführten Nucleinsaure kann ausschließlich über die mindestens eine artifizielle Sequenz erfolgen oder aber Sequenzen in der eingeführten Nucleinsaure mit einbeziehen. Beispielsweise kann für die Amplifikation der universelle Primer, der mit der mindestens einen artifiziellen Sequenz oder einemThe detection of the nucleic acid introduced externally can only be carried out via the at least one artificial sequence or else include sequences in the introduced nucleic acid. For example, for the amplification, the universal primer, the one with the at least one artificial sequence or one
Teil davon hybridisiert, mit einem Primer kombiniert werden, der an eine andere artifizielle oder nicht artifizielle Sequenz in der eingeführten Nucleinsaure hybridisiertPart of it hybridized, can be combined with a primer that hybridizes to another artificial or non-artificial sequence in the introduced nucleic acid
(Figur 1A). In diesem Fall würde die Amplifikation zu einem Amplifikationsprodukt führen, das sowohl Sequenzen der eingeführten Nucleinsaure als auch artifizielle(Figure 1A). In this case, the amplification would result in an amplification product that contains both sequences of the introduced nucleic acid and artificial ones
Sequenzen umfaßt. Alternativ dazu kann der Nachweis der fremd eingeführtenSequences. Alternatively, the proof of the third-party imported
Nucleinsaure über den mindestens einen universellen Primer erfolgen. In diesem Fall hybridisiert der mindestens eine universelle Primer an zwei artifizielle Sequenzen oder zwei Bereiche der artifiziellen Sequenzen oder an eine artifizielle Sequenz innerhalb der eingeführten Nucleinsaure und an eine weitere artifizielle Sequenz oder an Bereiche der artifiziellen Sequenzen (Figur 1B). Die dabei entstehendenNucleic acid over the at least one universal primer. In this case, the at least one universal primer hybridizes to two artificial sequences or two regions of the artificial sequences or to one artificial sequence within the introduced nucleic acid and to another artificial sequence or to regions of the artificial sequences (FIG. 1B). The resulting
Amplifikationsprodukte können somit ebenfalls Sequenzen der eingeführtenAmplification products can thus also sequences of the introduced
Nucleinsaure und artifizielle Sequenzen umfassen oder aber nur aus artifiziellenNucleic acid and artificial sequences include or only from artificial
Sequenzen bestehen. Für die Amplifikation kann ein universeller Primer verwendet werden, der sowohl als 5'- als auch 3'-Primer dient, oder aber zwei universelle Primer unterschiedlicher Sequenz, wobei der eine Primer als 5'-Primer und der andere
Primer als 3'-Primer dient. Vorzugsweise bestehen die Amplifikationsprodukte ausschließlich aus artifiziellen Sequenzen. Ab einer Länge von 80 Basenpaaren entstehen Sequenzen, die statistisch in ihrer Nucleotidsequenz auf der Erde seit ihrer Entstehung einzigartig sind (Prof. Werner Arber, Nobelpreisträger). Somit ist/sind die erfindungsgemäß verwendeten artifizielle(n) Sequenz(en) vorzugsweise 80 Basenpaare oder länger.Sequences exist. For the amplification, a universal primer can be used, which serves both as a 5 'and 3' primer, or two universal primers of different sequences, one primer as a 5 'primer and the other Primer serves as a 3 'primer. The amplification products preferably consist exclusively of artificial sequences. From a length of 80 base pairs, sequences are created that have been statistically unique in their nucleotide sequence on Earth since their creation (Prof. Werner Arber, Nobel Prize winner). Thus, the artificial sequence (s) used according to the invention is / are preferably 80 base pairs or longer.
Primer, die für die Durchführung des erfindungsgemäßen Verfahrens geeignet sind, können ausschließlich aus natürlich vorkommenden Nucleotiden bestehen (d.h. Desoxyribonucleotide und/oder Ribonucleotide), aber auch Nucleotidanaloga bzw. modifizierte Nucleotide umfassen (Mischpolymere). Modifizierte Nucleotide sind dem Fachmann bekannt und umfassen beispielsweise 5,6-Dihydrouridin, Ribothymidin, Inosin oder 1-Methylguanosin. Die Nucleotide der Primer müssen außerdem nicht über Phosphodiester-Bindungen miteinander verknüpft sein, sondern können auch über Phosphothioat- oder Methylphosphonat-Bindungen miteinander verknüpft sein. Als Primer können auch Peptid-Nucleinsäuren (PNA) verwendet werden. Der Einsatz solcher Primer kann der Optimierung von Hybridisierungsbedingungen, Stringenz, Hybridisierungskinetik, Spezifität, Selektivität, und Hybridisierungseffizienz dienen. Das Prinzip der Polymerase-Kettenreaktion (PCR) ist dem Fachmann bekannt. Dem Fachmann ist somit klar, daß Primerpaare, die in der vorliegenden Beschreibung als PCR-Amplifikations-tauglich offenbart sind, aus einem Primer bestehen, der an einen DNA-Strang hybridisiert, und einem weiteren Primer, der an den komplementären DNA-Strang hybridisiert.Primers which are suitable for carrying out the method according to the invention can consist exclusively of naturally occurring nucleotides (i.e. deoxyribonucleotides and / or ribonucleotides), but can also include nucleotide analogs or modified nucleotides (mixed polymers). Modified nucleotides are known to the person skilled in the art and include, for example, 5,6-dihydrouridine, ribothymidine, inosine or 1-methylguanosine. In addition, the nucleotides of the primers need not be linked to one another via phosphodiester bonds, but can also be linked to one another via phosphothioate or methylphosphonate bonds. Peptide nucleic acids (PNA) can also be used as primers. The use of such primers can serve to optimize hybridization conditions, stringency, hybridization kinetics, specificity, selectivity, and hybridization efficiency. The principle of the polymerase chain reaction (PCR) is known to the person skilled in the art. It is therefore clear to the person skilled in the art that primer pairs which are disclosed in the present description as being suitable for PCR amplification consist of a primer which hybridizes to a DNA strand and a further primer which hybridizes to the complementary DNA strand.
Der Begriff "universeller Primer" bedeutet im Sinne der vorliegenden Erfindung, daß dieser bzw. die artifizielle Sequenz oder der Bereich davon, an den dieser Primer hybridisiert, so konzipiert ist, daß er generell den Nachweis der fremd eingeführten Nucleinsaure erlaubt und zwar unabhängig von der Art und Funktion der eingeführten Nucleinsaure. Mit anderen Worten, dieser Primer dient dazu, die Frage zu beantworten, ob beispielsweise in einem bestimmten Lebensmittel transgenes Material enthalten ist.For the purposes of the present invention, the term “universal primer” means that this or the artificial sequence or the region thereof to which this primer hybridizes is designed in such a way that it generally allows the detection of the nucleic acid introduced externally, regardless of the Type and function of the nucleic acid introduced. In other words, this primer is used to answer the question of whether, for example, a certain food contains transgenic material.
Stringente Hybridisierungsbedingungen sind dem Fachmann bekannt und können in Abhängigkeit von beispielsweise der Länge des zu verwendenden Primers oder der Sonde einfach bestimmt werden (siehe, z.B., Sambrook et al., Molecular Cloning, a Laboratory Manual, 2nd edition (1989), CSH Press, Cold Spring Harbor, N.Y.;
Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1989) oder Higgins and Harnes, Nucleic Acid Hybridization, a Practical Approach, IRL Press Oxford, Washington DC (1985)). Stingente Hybridisierungsbedingungen sind beispielsweise Hybridisierung in 6 X SSC und 0,1% SDS bei 65°C oder in 50% Formamid und 4 X SSC bei 42°C und anschließendes Waschen in 0,1 X SSC und 0,1% SDS bei 65°C. Unstringente Hybridisierungsbedingungen sind beispielsweise Hybridisierung und anschließendes Waschen in 4 X SSC und 1 % SDS bei 50°C.Stringent hybridization conditions are known in the art and will be able to be easily determined to be used in the primer or probe as a function of, for example, the length (see, for example, Sambrook et al., Molecular Cloning, a Laboratory Manual, 2 nd edition (1989), CSH Press , Cold Spring Harbor, NY; Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1989) or Higgins and Harnes, Nucleic Acid Hybridization, a Practical Approach, IRL Press Oxford, Washington DC (1985)). Persistent hybridization conditions are, for example, hybridization in 6 X SSC and 0.1% SDS at 65 ° C or in 50% formamide and 4 X SSC at 42 ° C and subsequent washing in 0.1 X SSC and 0.1% SDS at 65 ° C. Non-stringent hybridization conditions are, for example, hybridization and subsequent washing in 4 X SSC and 1% SDS at 50 ° C.
In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens enthält die eingeführte Nucleinsaure mindestens eine weitere artifizielle Sequenz, die mit mindestens einem speziellen Primer unter stringenten Hybridisierungsbedingungen hybridisiert, wobei der mindestens eine spezielle Primer mit einem weiteren Primer, der unter stringenten Hybridisierungsbedingungen mit einer weiteren Sequenz in der eingeführten Nucleinsaure hybridisiert, oder mit einem weiteren speziellen Primer, der unter stringenten Hybridisierungsbedingungen mit einer weiteren artifiziellen Sequenz hybridisiert, die Amplifikation eines Bereiches der eingeführten Nucleinsaure erlaubt, der die mindestens eine artifizielle Sequenz umfaßt. Somit, sind die weiteren artifiziellen Sequenzen, an die die speziellen Primer hybridisieren, auf dem entsprechenden DNA-Strang immer δ'-seitig zu den artifiziellen Sequenzen angeordnet, an die die universellen Primer hybridisieren. Der Begriff "spezielle Primer" bedeutet im Sinne der vorliegende Erfindung, daß ein Nachweis einer fremd eingeführten. Nucleinsaure mittels dieser Primer spezifisch für die Art und/oder Funktion der eingeführten Nucleinsaure ist. Mit anderen Worten, im Gegensatz zu dem universellen Primer, der generell den Nachweis aller auf diese Weise markierten Transgene erlaubt, dient der spezielle Primer dazu, entweder ein spezifisches transgenes Konstrukt oder eine Gruppe von transgenen Konstrukten, die beispielsweise von einer bestimmten Firma (Urheber) hergestellt wurden, nachzuweisen.In a preferred embodiment of the method according to the invention, the nucleic acid introduced contains at least one further artificial sequence which hybridizes with at least one special primer under stringent hybridization conditions, the at least one special primer with another primer and that under stringent hybridization conditions with another sequence in the introduced one Nucleic acid hybridizes, or with a further special primer, which hybridizes with another artificial sequence under stringent hybridization conditions, allows the amplification of a region of the introduced nucleic acid, which comprises the at least one artificial sequence. Thus, the further artificial sequences to which the special primers hybridize are always arranged on the corresponding DNA strand on the δ ′ side to the artificial sequences to which the universal primers hybridize. For the purposes of the present invention, the term “special primer” means that detection of an externally introduced one. Nucleic acid using these primers is specific for the type and / or function of the nucleic acid introduced. In other words, in contrast to the universal primer, which generally allows the detection of all transgenes labeled in this way, the special primer serves to either either a specific transgenic construct or a group of transgenic constructs, which, for example, from a certain company (originator) were produced.
Beim Nachweis des Urheberrechts beispielsweise an einem Transgen und der Möglichkeit des Nachweises von verschiedenen Transgenen im Umweltrecht liegen unterschiedliche Bedürfnisse der Anwender der Methode zugrunde.
Während spezielle, also individuelle urheberspezifische Primerpaare alle Transgenkonstrukte eines bestimmten Urhebers aus der Gesamtheit aller Urheber zu amplifizieren vermögen, ist der Zweck von universellen Primerpaaren der, allen Kontrollinstanzen bekannt zu sein, so daß unabhängig vom jeweiligen Urheber alle Transgenkonstrukte amplifiziert werden können. Spezielle Primerpaare können wenn gewünscht von den Urhebern geheim gehalten werden.When proving copyright, for example, on a transgene and the possibility of proving different transgenes in environmental law, different needs of the users of the method are based. While special, i.e. individual, author-specific primer pairs are able to amplify all transgene constructs of a particular author from the totality of all authors, the purpose of universal primer pairs is to be known to all control instances, so that all transgene constructs can be amplified independently of the respective author. If desired, special primer pairs can be kept secret by the authors.
Verschiedene Primerpaare kann man um die jeweilige Markierung herumschachteln (Figur 2). Da mittels der universellen Primer die 5'-flankierenden speziellen Primersequenzen experimenteil ermittelt werden können, ist es in dieser Ausführungsform besonders wichtig, daß die Zuordnung zu individuellen Firmen nur den Kontrollbehörden bekannt ist.Different pairs of primers can be nested around the respective marking (FIG. 2). Since the 5'-flanking special primer sequences can be determined experimentally using the universal primers, it is particularly important in this embodiment that the assignment to individual companies is only known to the control authorities.
In einer weiteren bevorzugten Ausführungsform sind die mindestens zwei Sequenzen und/oder die mindestens zwei weiteren Sequenzen räumlich voneinander getrennt.In a further preferred embodiment, the at least two sequences and / or the at least two further sequences are spatially separated from one another.
Diese Ausführungsform ermöglicht es vorteilhafterweise, beispielsweise mittels PCR größere Sequenzabschnitte zu amplifizieren, in denen umfangreichere Informationen gespeichert werden können.This embodiment advantageously makes it possible, for example by means of PCR, to amplify larger sequence sections in which more extensive information can be stored.
In einer anderen bevorzugten Ausführungsform werden die in Schritt (c) erfaßten Daten in digitalisierter Form gespeichert.In another preferred embodiment, the data recorded in step (c) are stored in digitized form.
In einer besonders bevorzugten Ausführungsform erfolgt die Speicherung in einemIn a particularly preferred embodiment, the storage takes place in one
Zentralspeicher.Central storage.
Diese Ausführungsform erlaubt es, artifizielle genetische Markierungen von Zellen und Lebewesen zum Zwecke der Transparenz und Überwachung zentral zu erfassen und gentechnologische Daten weltweit und in einem einheitlichen System zurThis embodiment allows artificial genetic markings of cells and living beings to be recorded centrally for the purpose of transparency and monitoring, and genetic engineering data is available worldwide and in a uniform system
Markierung und Verwaltung von Transgenen zu speichern.Marking and management of transgenes to save.
Durch die Speicherung aller verfügbarer Daten registrierter Transgene ermöglicht derBy storing all available data of registered transgenes, the
Zentralspeicher eine leichte Kontrolle über Bestand, Art und Urheber vonCentral store easy control over inventory, type and originator of
Transgenen. In einem "trust center" könnten alle Daten verwaltet werden.Transgenes. All data could be managed in a "trust center".
Der Gesetzgeber kann dafür sorgen, daß Transgene nur dann rechtlich zulässig sind und folgend konstruiert und in den Verkehr gebracht werden dürfen, wenn sie
registriert worden sind und deren Identität durch eine eindeutige artifizielle genetische Markierung beweisbar ist. Die Herkunft des Genkonstruktes (Urheber), die Art des Konstruktes (die verwendeten Gensequenzen), das Datum der Registrierung, der Organismus, in den das Genkonstrukt eingebracht wurden, etc., d.h. alle Daten das Transgen betreffend, müssen nachvollziehbar sein. Die ZKBS (=zentrale Kommission für biologische Sicherheit in Deutschland) könnte dem Gesetzgeber einen solchen Vorschlag unterbreiten, der dann auch europaweit und weltweit umgesetzt werden kann.Legislators can ensure that transgenes are only legally permissible and that they can be subsequently constructed and marketed if they have been registered and their identity can be proven by a clear artificial genetic marking. The origin of the gene construct (originator), the type of construct (the gene sequences used), the date of registration, the organism into which the gene construct was introduced, etc., ie all data relating to the transgene, must be traceable. The ZKBS (= Central Commission for Biosafety in Germany) could make such a proposal to the legislator, which can then also be implemented Europe-wide and worldwide.
In einer anderen bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens codiert die eingeführte Nucleinsaure ein (Poly)peptid.In another preferred embodiment of the method according to the invention, the nucleic acid introduced encodes a (poly) peptide.
Der Begriff "(Poly)peptid" umfaßt im Sinne der vorliegenden Erfindung sowohl Polypeptide oder Proteine, die eine Länge von ungefähr 50 bis mehreren hundert Aminosäuren aufweisen, als auch Peptide, die eine Länge von ungefähr 5 bis 50 Aminosäuren aufweisen. Die Peptide sind vorzugsweise artifizielle Peptide, also nicht natürlich vorkommende Peptide, die beispielweise artifizielle Epitope darstellen.For the purposes of the present invention, the term “(poly) peptide” encompasses both polypeptides or proteins which have a length of approximately 50 to several hundred amino acids and peptides which have a length of approximately 5 to 50 amino acids. The peptides are preferably artificial peptides, that is to say non-naturally occurring peptides which, for example, represent artificial epitopes.
In einer besonders bevorzugten Ausführungsform ist das (Poly)peptid ein Fusionsprotein.In a particularly preferred embodiment, the (poly) peptide is a fusion protein.
In einer weiteren besonders bevorzugten Ausführungsform ist die eingeführteIn a further particularly preferred embodiment, the one introduced
Nucleinsaure ein Transgen oder eine artifizielle Sequenz.Nucleic acid a transgene or an artificial sequence.
Ist die eingeführte Nukleinsäure ein Transgen, so erlaubt, wie vorstehend diskutiert, die artifizielle Sequenz vorteilhafterweise einen schnellen und einfachen Nachweis des Vorhandenseins des Transgens in einer Probe. Darüber hinaus kann die artifizielle Sequenz auch dem Urheber dienen, das Transgen als ein von ihm entwickeltes und hergestelltes Transgen zu identifizieren.If the nucleic acid introduced is a transgene, as discussed above, the artificial sequence advantageously allows quick and simple detection of the presence of the transgene in a sample. In addition, the artificial sequence can also serve the author to identify the transgene as a transgene that he has developed and produced.
Besteht die eingeführte Nukleinsäure ausschließlich aus einer artifiziellen Sequenz, so erlaubt sie, wie ebenfalls oben diskutiert, beispielsweise Organismen und/oder phänotypische Merkmale im Genom eines Organismus zu identifizieren bzw. nachzuweisen.
In einer zusätzlichen bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens ist oder enthält die eingeführte Nucleinsaure einen Erkennungscode. Der Erkennungscode kann eine kombinatorische Codierung darstellen oder einen chiffrierten Text enthalten, d.h. einen Text, der in eine Nucleinsäuresequenz übersetzt ist.If the nucleic acid introduced consists exclusively of an artificial sequence, then, as also discussed above, it allows, for example, organisms and / or phenotypic features to be identified or detected in the genome of an organism. In an additional preferred embodiment of the method according to the invention, the nucleic acid introduced is or contains a recognition code. The recognition code can represent a combinatorial coding or contain an encrypted text, ie a text which is translated into a nucleic acid sequence.
In einer besonders bevorzugten Ausführungsform ist der Erkennungscode verschlüsselt.In a particularly preferred embodiment, the identification code is encrypted.
Eine genetische Markierung von Organismen mittels einer verschlüsselten Nachricht in DNA-Molekülen kann von einer autorisierten Person durch verschiedene Techniken oder Kombinationen aus diesen heutzutage leicht nachgewiesen und auch leicht dechiffriert werden, wenn der entsprechende Dechiffrierungs-schlüssel bekannt ist.Genetic labeling of organisms by means of an encrypted message in DNA molecules can easily be detected by an authorized person by various techniques or combinations of these today and can also be easily decrypted if the corresponding decryption key is known.
In der von Primerpaaren eingeschlossenen Sequenz liegt ein beträchtliches Kodierungspotential für Information, das nur begrenzt ist durch das Leistungsvermögen der PCR-Reaktion, genügend amplifiziertes Material entsprechender Länge für die Nachweisreaktion zu liefern. Üblicherweise würde man ca. 50 bp bis ca. 1000 bp Kodierungskapazität annehmen. Man könnte sich aber bei Bedarf durchaus wesentlich längere Sequenzen vorstellen. Wie erwähnt kann in einer artifiziellen, synthetischen DNA-Sequenz Informationen gespeichert werden wie beispielsweise der Namen der/des Urhebers der GVOs, das Datum der Urheberschaft, die Variante des artifiziell genetisch markierten Organismus oder die Variante des Transgens oder beides, der Code der Urheberrechte (z.B. Patennummer) und/oder Verweise auf die Dokumentation des Organismus, beispielsweise eine Webseite, Datenbank oder eine Publikation. In der ersten Stufe eines zweistufigen Systems zur Verschlüsselung von Urheberdaten in einem DNA-Code zur artifiziellen genetischen Markierung von Organismen bekommt der Urheber der Sequenz Primerpaare zur Amplifikation der eingeschlossenen artifiziellen Sequenz zugeordnet, deren Identität nur er kennt. Für diese Primerpaare kann er nun in einer zweiten Stufe die zwischen den Primern liegende DNA-Sequenz mit Informationen füllen, die (a) nur einen Erkennungscode (Signatur) darstellt oder (b) eine direkt in DNA codierte Information trägt oder (c) eine Information trägt, die zusätzlich noch kryptographisch verschlüsselt ist, so daß ein
Interessierter auch dann die Daten nicht lesen und identifizieren kann, wenn er die Primer zur Amplifikation des entsprechenden PCR-Fragmentes besitzt und den Primärcode (b) kennt, mit dem alphanumerische Zeichen in DNA-codierte Information umgesetzt werden kann.There is considerable coding potential for information in the sequence enclosed by primer pairs, which is only limited by the ability of the PCR reaction to deliver sufficient amplified material of appropriate length for the detection reaction. Usually one would assume about 50 bp to about 1000 bp coding capacity. However, one could imagine much longer sequences if necessary. As mentioned, information can be stored in an artificial, synthetic DNA sequence, such as the name of the creator of the GMOs, the date of authorship, the variant of the artificially genetically labeled organism or the variant of the transgene, or both, the code of the copyright ( e.g. patent number) and / or references to the documentation of the organism, for example a website, database or a publication. In the first stage of a two-stage system for encrypting author data in a DNA code for the artificial genetic marking of organisms, the author is assigned primer pairs for the amplification of the enclosed artificial sequence, whose identity only he knows. For these primer pairs, in a second stage he can now fill the DNA sequence between the primers with information that (a) only represents a recognition code (signature) or (b) carries information encoded directly in DNA or (c) information carries, which is additionally cryptographically encrypted, so that a Interested parties cannot read and identify the data even if they have the primers for amplifying the corresponding PCR fragment and know the primary code (b), with which alphanumeric characters can be converted into DNA-coded information.
Für eine Biotechnologiefirma könnte es durchaus interessant sein, die Daten eines Transgens oder eines Organismus für Dritte zunächst nicht detailliert identifizierbar zu machen. Die Überwachungsbehörde möchte aber möglichst einfach transgenes Material verschiedener Herkunft nachweisen können.For a biotechnology company, it could be interesting to make the data of a transgene or an organism unidentifiable for third parties. However, the monitoring authority would like to be able to detect transgenic material from various origins as simply as possible.
Diese Firma könnte aber ein Interesse daran haben, den Nachweis durch Dritte (z.B. die Überwachungsbehörde) zuzulassen, daß der GVO in seiner Eigenschaft genetisch verändert zu sein identifiziert wird. Weitergehende Informationen, die die genaue Identität des transgenen Organismus betreffen können aber nur dann erhoben werden, wenn dieser Nachweis durch sie genehmigt wird. Die Firma würde einer Überwachungsbehörde in diesem Fall die PCR-Primer zur Identifikation zur Verfügung stellen, mit der das genetisch markierende DNA-Fragment als solches z.B. mittels Arraytechnologien nachgewiesen werden kann. Die Überwachungsbehörde stellt somit die Ebene der zentralen Erfassung dar, deren Aufgabe es ist, transgenes Material zu kontrollieren und zu identifizieren. Die genaue Identität des Organismus aber und weitergehende Informationen über diesen Organismus würden weiter chiffriert in der Hand der Firma bleiben, oder wären nur zugänglich über ein zentrales Datenbankregister. D.h. der Urheber stellt die Ebene der dezentralen Erfassung dar. Mittels der weitergehenden Informationen kann er überprüfen, ob Dritte sein Material benutzen.However, this company could have an interest in allowing third parties (e.g. the supervisory authority) to prove that the GMO is identified as being genetically modified. Further information, which concerns the exact identity of the transgenic organism, can only be collected if this proof is approved by them. In this case, the company would provide a monitoring authority with the PCR primers for identification, with which the genetically labeling DNA fragment as such e.g. can be demonstrated using array technologies. The surveillance authority thus represents the level of central recording, the task of which is to control and identify transgenic material. However, the exact identity of the organism and further information about this organism would remain encrypted in the hands of the company, or would only be accessible via a central database register. That the author represents the level of decentralized recording. Using the additional information, he can check whether third parties are using his material.
Die Informationsdichte von Arraytechnologien ist so groß, daß sehr viele zentral erfaßte, artifizielle genetische Markierungen auf einem Träger zum Nachweis der korrespondierenden Transgenkonstrukte abgebildet werden können. Zum Nachweis individueller detaillierter Informationen kann eine codierende Sequenz dann auch sequenziert, decodiert und gegebenenfalls dechiffriert werden.The information density of array technologies is so large that a large number of centrally recorded, artificial genetic markings can be displayed on a carrier for the detection of the corresponding transgene constructs. A coding sequence can then also be sequenced, decoded and, if necessary, decrypted to prove individual detailed information.
In einer am meisten bevorzugten Ausführungsform ist die Verschlüsselung eine kryptographische Verschlüsselung.
In einer anderen bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens ist der Rezeptor ein Protein, vorzugsweise ein Glycoprotein, eine spezifisch bindende RNA oder ein Peptid, vorzugsweise ein artifizielles Peptid oder ein Antikörper, ein Derivat oder Fragment davon.In a most preferred embodiment, the encryption is cryptographic encryption. In another preferred embodiment of the method according to the invention, the receptor is a protein, preferably a glycoprotein, a specifically binding RNA or a peptide, preferably an artificial peptide or an antibody, a derivative or fragment thereof.
Geeignete Antikörper können polyklonal oder monoklonal sein. Fragmente bzw. Derivate von Antikörpern sowie Verfahren zu deren Herstellung sind dem Fachmann bekannt. Antikörperfragmente umfassen beispielsweise Fab-, F(ab.)2-, Fv-, Fd- oder dAb- Fragmente. Antikörperderivate umfassen beispielsweise scFv.Suitable antibodies can be polyclonal or monoclonal. Fragments or derivatives of antibodies and methods for their production are known to the person skilled in the art. Antibody fragments include, for example, F ab , F (ab . ) 2 , F v , F d or dAb fragments. Antibody derivatives include, for example, scFv.
In einer besonders bevorzugten Ausführungsform bindet der Antikörper, das Derivat oder das Fragment davon doppelsträngige DNA sequenzspezifisch.In a particularly preferred embodiment, the antibody, the derivative or the fragment thereof binds double-stranded DNA in a sequence-specific manner.
In einer weiteren bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens ist der Rezeptor eine Einzelstrang-DNA.In a further preferred embodiment of the method according to the invention, the receptor is a single-stranded DNA.
Die Länge der Einzelstrang-DNA kann variieren, solange sie eine spezifische Hybridisierung mit zu untersuchenden Nucleinsäuren erlaubt. D.h. die Einzelstrang- DNA kann ein Oligonucleotid mit einer Länge von ungefähr 12 bis 30 Nucleotiden oder ein Polynucleotid mit einer Länge von ungefähr 30 bis mehreren hundert Nucleotiden sein. Der Begriff "spezifisch hybridisieren" bedeutet dabei, daß unter stringenten Hybridisierungsbedingungen (siehe oben) nur Nucleinsäuremoleküle miteinander hybridisieren, die eine komplementäre Nucleotidsequenz aufweisen.The length of the single-stranded DNA can vary as long as it allows specific hybridization with the nucleic acids to be examined. That the single-stranded DNA can be an oligonucleotide approximately 12 to 30 nucleotides in length or a polynucleotide approximately 30 to several hundred nucleotides in length. The term "specifically hybridize" means that under stringent hybridization conditions (see above) only nucleic acid molecules which have a complementary nucleotide sequence hybridize with one another.
In einer anderen bevorzugten Ausführungsform befindet sich auf dem Chip in jeder Position des geordneten Musters ein Rezeptor mit einer anderen Bindungsspezifität. Es ist jedoch auch vorstellbar, daß sich an mehreren Positionen des Chips Rezeptoren mit der gleichen Bindungspezifität befinden.In another preferred embodiment, there is a receptor with a different binding specificity on the chip in each position of the ordered pattern. However, it is also conceivable that there are receptors with the same binding specificity at several positions on the chip.
In einer zusätzlichen bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens werden vor den Schritten (a), (b") und (c") folgende Schritte durchgeführt: (i) Spaltung der eingeführten Nucleinsäuren, die zuvor mit einem Sequenz-Tag versehen wurden, mit einem Restriktionsenzym, das nicht im Tag schneidet; (ii) Isolierung der mit dem Tag versehenen Spaltprodukte;
(iii) hälftige Teilung der Spaltprodukte und Ligation der Hälften mit verschiedenenIn an additional preferred embodiment of the method according to the invention, the following steps are carried out before steps (a), (b ") and (c"): (i) Cleavage of the nucleic acids which have been previously provided with a sequence tag with a restriction enzyme that doesn't cut in the day; (ii) isolation of the tagged fission products; (iii) halving the fission products and ligation of the halves with different ones
Linkern; (iv) Spaltung des Ligationsproduktes aus (iii) mit einem Typ II Restriktionsenzym, das die Bindungsstelle in den Linkern aufweist und in den eingeführtenlinkers; (iv) Cleavage of the ligation product from (iii) with a type II restriction enzyme which has the binding site in the linkers and in the introduced
Nucleinsäuren spaltet, so daß ein Bereich der eingeführten Nucleinsäuren mit dem Linker verbunden bleibt; und (v) head-to-tail-Ligation der eingeführten Nucleinsäuren. Geeignete Tags sind Affinitäts-Tags, die die Isolierung der Spaltprodukte erlauben. Das in Schritt (i) verwendete Restriktionsenzym besitzt eine Erkennungssequenz von vorzugsweise 7, 6 oder 4 Nucleotiden.Cleaves nucleic acids so that a portion of the inserted nucleic acids remains attached to the linker; and (v) head-to-tail ligation of the introduced nucleic acids. Suitable tags are affinity tags that allow the isolation of the cleavage products. The restriction enzyme used in step (i) has a recognition sequence of preferably 7, 6 or 4 nucleotides.
Die von Velculescu et al. (Science 270 (1995), 484-487) beschriebene SAGE- Technik eignet sich besonders als Nachweismethode für das erfindungsgemäße Verfahren, da sie einen effizienten und gleichzeitigen Nachweis einer großen Anzahl von Transgenkonstrukten erlaubt. Der Nachweis mittels Chip-Technologie hingegen erlaubt nur einen qualitativen bzw. semiquantitativen Nachweis von Transgenen. Da die SAGE-Technologie einen quantitativen Nachweis erlaubt, ist sie bei entsprechenden Fragestellungen somit auch besonders als zusätzliche Nachweismethode geeignet.The Velculescu et al. (Science 270 (1995), 484-487), the SAGE technique described is particularly suitable as a detection method for the method according to the invention, since it allows an efficient and simultaneous detection of a large number of transgenic constructs. Detection using chip technology, on the other hand, only allows qualitative or semi-quantitative detection of transgenes. Since SAGE technology allows quantitative detection, it is also particularly suitable as an additional detection method for relevant questions.
In dieser Ausführungsform erlaubt das erfindungsgemäße Verfahren nicht nur einen qualitativen Nachweis von Transgenen, d.h. die Beantwortung der Frage, ob, und wenn ja, welche Transgene welcher Firma in einer Probe vorhanden sind, sondern auch einen quantitativen Nachweis, d.h. die Beantwortung der Frage, wieviele Transgene einer Firma in einer Probe vorhanden sind. Mittels des Sequenz-Tags kann auch die Transkriptionsaktivität der Transgene auf RNA-Ebene analysiert werden. Dazu wird die RNA mittels eines Primers, der an den Sequenz-Tag hybridisiert, revers transkribiert. Die RNA ist dann entsprechend ihrer Häufigkeit in dem Concatemer vorhanden.In this embodiment, the method according to the invention not only allows qualitative detection of transgenes, i.e. the answer to the question of whether, and if so, which transgenes of which company are present in a sample, but also a quantitative proof, i.e. answering the question of how many transgenes from a company are present in a sample. The transcription activity of the transgenes at the RNA level can also be analyzed by means of the sequence tag. For this, the RNA is reverse transcribed using a primer that hybridizes to the sequence tag. The RNA is then present in the concatemer according to its frequency.
Die Erfindung betrifft auch eine Sequenzierstation und geeignete Software, die die Durchführung des erfindungsgemäßen Verfahrens erlauben.The invention also relates to a sequencing station and suitable software which allow the method according to the invention to be carried out.
In einer besonders bevorzugten Ausführungsform sind die eingeführten Nucleinsäuren Doppelstrang-cDNAs, und vor Schritt (i) wird folgender Schritt
durchgeführt: Generierung von Doppelstrang-cDNA aus mRNA des Organismus oder der Zelle unter Verwendung eines mit einem Sequenz-Tag versehenen 3'~Primers.In a particularly preferred embodiment, the nucleic acids introduced are double-stranded cDNAs, and the following step is carried out before step (i) carried out: Generation of double-stranded cDNA from mRNA of the organism or of the cell using a 3 '~ primer provided with a sequence tag.
In einer anderen bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens werden vor den Schritten (a), (b") und (c") folgende Schritte durchgeführt:In another preferred embodiment of the method according to the invention, the following steps are carried out before steps (a), (b ") and (c"):
(i) Generierung von Doppelstrang-cDNA aus mRNA des Organismus oder der(i) Generation of double-strand cDNA from mRNA of the organism or the
Zelle unter Verwendung eines mit einem Tag versehenen 3'-Primers; (ii) Spaltung der cDNA mit einem Restriktionsenzym, das nicht im Tag schneidet; (iii) Isolierung der mit dem Tag versehenen Spaltprodukte; (iv) hälftige Teilung der Spaltprodukte und Ligation der Hälften mit verschiedenenCell using a 3 'tagged primer; (ii) cleavage of the cDNA with a restriction enzyme that does not cut in the day; (iii) isolation of the tagged cleavage products; (iv) halving the fission products and ligation of the halves with different ones
Linkern; (v) Spaltung des Ligationsproduktes aus (iv) mit einem Typ II Restriktionsenzym, das die Bindungsstelle in den Linkern aufweist und in der cDNA spaltet, so daß ein Bereich der cDNA mit dem Linker verbunden bleiben; und (vi) head-to-tail-Ligation der cDNA-Fragmente.linkers; (v) cleavage of the ligation product from (iv) with a type II restriction enzyme which has the binding site in the linkers and cleaves in the cDNA so that a region of the cDNA remains connected to the linker; and (vi) head-to-tail ligation of the cDNA fragments.
Das in Schritt (ii) verwendete Restriktionsenzym besitzt eine Erkennungssequenz von vorzugsweise 7, 6 oder 4 Nucleotiden.The restriction enzyme used in step (ii) has a recognition sequence of preferably 7, 6 or 4 nucleotides.
In einer weiteren besonders bevorzugten Ausführungsform ist der 3'-Primer ein oligo- dT-Primer, ein universeller oder ein spezieller Primer.In a further particularly preferred embodiment, the 3 'primer is an oligo-dT primer, a universal or a special primer.
Analog zu dem oben erwähnten Primer, der an den Sequenz-Tag bindet, eignen sich diese Primer auch dazu, Aussagen über die Transkriptionsaktivität des entsprechenden Transgens zu machen.Analogous to the primer mentioned above, which binds to the sequence tag, these primers are also suitable for making statements about the transcription activity of the corresponding transgene.
In einer anderen besonders bevorzugten Ausführungsform ist der Tag Biotin oderIn another particularly preferred embodiment, the tag is biotin or
Digoxygenin.Digoxygenin.
Zur Durchführung des erfindungsgemäßen Verfahrens eignen sich jedoch auch andere affinitätsvermittelnde Agenzien, die Polymerase-kompatibel sind.However, other affinity-imparting agents which are polymerase-compatible are also suitable for carrying out the method according to the invention.
In einer zusätzlichen besonders bevorzugten Ausführungsform umfaßt der obengenannte Bereich 8 bis 20 Nucleotide.
In einer am meisten bevorzugten Ausführungsform umfaßt der obengenannteIn an additional particularly preferred embodiment, the above range comprises 8 to 20 nucleotides. In a most preferred embodiment, the above includes
Bereich 9 bis 14 Nucleotide.Range 9 to 14 nucleotides.
Schließlich betrifft die vorliegende Erfindung einen Chip wie vorstehend definiert.Finally, the present invention relates to a chip as defined above.
Mittels der auf dem Chip befindlichen Rezeptoren, die jeweils spezifisch für einBy means of the receptors located on the chip, each specific for one
Unternehmen sind, eignet sich der erfindungsgemäße Chip vorteilhafterweise, in einem Arbeitsschritt zu analysieren, von welchem oder welchen von hunderten vonCompanies are, the chip according to the invention is advantageously suitable for analyzing in one work step which one or hundreds of
Unternehmen Transgene in einem Produkt enthalten sind. Aufgrund der hohenTransgenic companies are included in a product. Because of the high
Kapazität ist es vorstellbar, daß auf dem erfindungsgemäßen Chip alle weltweit existierenden Unternehmen, die in dieser Branche tätig sind, über ihren individuellenCapacity, it is conceivable that on the chip according to the invention, all companies existing worldwide that are active in this branch, about their individual
Rezeptor repräsentiert sind.Receptor are represented.
Der Inhalt der zitierten Dokumente wird hiermit per Verweisung inkorporiert.The content of the cited documents is hereby incorporated by reference.
Die Figuren zeigen:The figures show:
Figur 1 : Schematische Darstellung der Möglichkeiten, wie artifizielle Sequenzen amplifiziert werden können. ' 3 = fremd eingeführteFigure 1: Schematic representation of the ways in which artificial sequences can be amplified. '3 = imported from outside
Nucleinsaure. =artifizielle Sequenz. I~~ = Primer, der in der fremd eingeführten Nucleinsaure hybridisiert. ^ = universeller Primer, der an die artifizielle Sequenz hybridisiert.Nucleic acid. = artificial sequence. I ~~ = primer that hybridizes in the externally introduced nucleic acid. ^ = universal primer that hybridizes to the artificial sequence.
Figur 2: Schematische Darstellung, wie verschiedene Primerpaare um eine genetische Markierung herum angeordnet sein können. Pi und Pi' sind universelle Primer. P2 ... Pn und P2' ... Pn' stellen spezielle Primer dar.Figure 2: Schematic representation of how different primer pairs can be arranged around a genetic marker. Pi and Pi 'are universal primers. P 2 ... P n and P 2 '... P n ' are special primers.
Die Beispiele erläutern die Erfindung.The examples illustrate the invention.
BeispieM : Chiffrierung von Information mittels eines kryptographischen Verfahrens und anschließende Codierung mittels eines Quadruplettcodes in DNAExample: Encryption of information using a cryptographic method and subsequent coding using a quadruplet code in DNA
Die genetische Markierung soll den Namen des Urhebers des GVOs, das Datum der Urheberschaft, die Bezeichnung der Variante des artifiziell genetisch markierten Organismus, die Bezeichnung der Variante des Transgens, die
Patentanmeldungsnummer und Verweise auf die Dokumentation des Organismus enthalten. Die zu chiffrierende und codierende Information ist also beispielsweise:The genetic marking should include the name of the author of the GMO, the date of the authorship, the name of the variant of the artificially genetically marked organism, the name of the variant of the transgene Patent application number and references to the documentation of the organism included. The information to be encrypted and encoded is, for example:
Xgen AG, 12. 02. 1995, Zea mays 1234, Konstrukt 123456/99, PCT/EP99/12345, www.Xgen-AG.com/transparencyXgen AG, February 12, 1995, Zea mays 1234, construct 123456/99, PCT / EP99 / 12345, www.Xgen-AG.com/transparency
Diese Information wird mittels eines kryptographischen Verfahrens chiffriert und anschließend mittels eines Quadruplettcodes in DNA codiert:This information is encrypted using a cryptographic method and then encoded in DNA using a quadruplet code:
ATGATATTGCCGTCTGTGCAACGATGAAACCCAGGATTAGATGATCCAGATCAGATGATATTGCCGTCTGTGCAACGATGAAACCCAGGATTAGATGATCCAGATCAG
TGATFCATGATGATCCACCACAGTGGGTGAGTTACCCACAGATTATTAACCACCTGATFCATGATGATCCACCACAGTGGGTGAGTTACCCACAGATTATTAACCACC
CACATTGATGATGATTTTAAAGAGAGACATGAGAGAGACATCATGATCAGATGTTCACATTGATGATGATTTTAAAGAGAGACATGAGAGAGACATCATGATCAGATGTT
GATGTCACCAGTGATGCAGACGCAGTGATGACGACGACTGATGACGATGGAAAGATGTCACCAGTGATGCAGACGCAGTGATGACGACGACTGATGACGATGGAAA
AGTAGATGACAGATGATCAGATGATGACACACGTAAAAAGATGAAAGTTTAGGAAGTAGATGACAGATGATCAGATGATGACACACGTAAAAAGATGAAAGTTTAGGA
CCCAGATGAGGGATGGAGTAGCCACATGAT ...CCCAGATGAGGGATGGAGTAGCCACATGAT ...
Auf dem Markt erhältliche Maiskörner lassen sich wie folgt auf Vorhandensein der artifiziellen genetischen Markierung untersuchen: Zwei Primer, die an die obigen unterstrichenen Sequenzen bzw. komplementären Sequenzen in gegenläufigem Sinne hybridisieren werden an aus den Maiskörnern isolierte DNA hybridisiert. Anschließend wird eine PCR durchgeführt. Die PCR-Bedingungen wie z.B. Hybridisierungs-Zeit und -Temperatur, Elongationszeit, etc. hängen von dem verwendeten Primer und dem zu amplifizierenden DNA-Fragment ab und können ohne weiteres vom Fachmann bestimmt werden (siehe Sambrook et al. und Ausubel et al., los. cit.). Die Amplifikationsprodukte werden aufgeschmolzen und die Einzelstränge werden auf einen Chip übertragen, der mit 6144 unterschiedlichen Einzelstrang-DNAs bestückt ist und zwar unter Bedingungen, die eine Hybridisierung erlauben. Diese Bedingungen hängen von den zu hybridisierenden DNA- Einzelsträngen ab und können ebenfalls vom Fachmann bestimmt werden (siehe Sambrook et al . und Ausubel et al., loc. cit.). Der Nachweis des Vorhandenseins obiger Sequenz in den Maiskörnern wird durch Bindung eines Peroxidase-markierten anti-ds DNA spezifischen monoklonalen Antikörper nachgewiesen.
Commercially available maize kernels can be examined for the presence of the artificial genetic label as follows: Two primers which hybridize to the above underlined sequences or complementary sequences in the opposite sense are hybridized to DNA isolated from the maize kernels. A PCR is then carried out. The PCR conditions such as Hybridization time and temperature, elongation time, etc. depend on the primer used and the DNA fragment to be amplified and can easily be determined by a person skilled in the art (see Sambrook et al. And Ausubel et al., Los. Cit.). The amplification products are melted and the single strands are transferred to a chip which is equipped with 6144 different single-strand DNAs, under conditions which allow hybridization. These conditions depend on the DNA single strands to be hybridized and can also be determined by the person skilled in the art (see Sambrook et al. And Ausubel et al., Loc. Cit.). The detection of the presence of the above sequence in the maize kernels is verified by binding a peroxidase-labeled anti-ds DNA-specific monoclonal antibody.
Claims
1. Verfahren zum (gleichzeitigen) Nachweis einer oder mehrerer in einen oder mehrere Organismen oder in eine oder mehrere Zellen fremd eingeführten Nucleinsäure(n), wobei die eingeführte(n) Nucleinsäure(n) (eine) artifizielle Sequenz(en) umfaßt/umfassen, die den Nachweis der Identität der eingeführten Nucleinsäure(n) und die selektive Vermehrung erlaubt/erlauben, umfassend die Untersuchung des Organismus/der Organismen oder der Zelle(n) auf das Vorhandensein der artifiziellen Sequenz(en) und gegebenenfalls Identifizierung der artifiziellen Sequenz(en), mittels Hybridisierung mit einem Chip und/oder Sequenzierung.1. A method for the (simultaneous) detection of one or more nucleic acid (s) introduced externally into one or more organisms or into one or more cells, the introduced nucleic acid (s) comprising an artificial sequence (s) , which allows the detection of the identity of the introduced nucleic acid (s) and the selective multiplication, comprising the examination of the organism (s) or the cell (s) for the presence of the artificial sequence (s) and, if necessary, identification of the artificial sequence ( en), by means of hybridization with a chip and / or sequencing.
2. Verfahren nach Anspruch 1 , wobei die artifizielle(n) Sequenz(en) Restriktionsendonuclease-Erkennungsstellen, Transkriptionspromotersequenzen und/oder Replikationsinitiatoren (ORIs) sind oder umfassen.2. The method of claim 1, wherein the artificial sequence (s) are restriction endonuclease recognition sites, transcription promoter sequences and / or replication initiators (ORIs).
3. Verfahren nach Anspruch 1 , wobei das Vorhandensein der artifiziellen Sequenz(en) mittels PCR, LCR oder einer anderen Amplifikationsmethode untersucht wird.3. The method according to claim 1, wherein the presence of the artificial sequence (s) is investigated by means of PCR, LCR or another amplification method.
4. Verfahren, vorzugsweise nach Anspruch 1 , zum Nachweis einer in einen Organismus oder eine Zelle fremd eingeführten Nucleinsaure, wobei die eingeführte Nucleinsaure mindestens eine artifizielle Sequenz umfaßt, die mit mindestens einem universellen Primer unter stringenten Hybridisierungsbedingungen hybridisiert, das die folgenden Schritte umfaßt: (a) Amplifikation des Bereichs der eingeführten Nucleinsaure, der sich4. The method, preferably according to claim 1, for the detection of a nucleic acid introduced foreign into an organism or a cell, wherein the introduced nucleic acid comprises at least one artificial sequence which hybridizes with at least one universal primer under stringent hybridization conditions, which comprises the following steps: ( a) Amplification of the area of the introduced nucleic acid that is
(ai) zwischen der mindestens einen artifiziellen Sequenz und einer(ai) between the at least one artificial sequence and one
Sequenz in der eingeführten Nucleinsaure oder (aii) zwischen mindestens zwei artifiziellen Sequenzen befindet, oder der in (ai) oder (aii) definierten Sequenzen mittels PCR oder einer anderen Amplifikationsmethode unter Verwendung des mindestens einen universellen Primers und eines Primers, der unter stringenten Hybridisierungsbedingungen mit der Sequenz in der eingeführten Nucleinsaure hybridisiert, oder unter Verwendung des mindestens einen universellen Primers; undSequence in the introduced nucleic acid or (aii) between at least two artificial sequences, or the sequences defined in (ai) or (aii) by means of PCR or another amplification method using the at least one universal primer and a primer which is used under stringent hybridization conditions the sequence in the introduced nucleic acid hybridized, or using the at least one universal primer; and
(b') Übertragung des Amplifikationsproduktes oder des codierten Translationsproduktes auf mindestens einen Chip, auf dem sich in einem geordneten Muster Rezeptoren befinden, die das Amplifikationsprodukt, einen Einzelstrang davon oder das codierte Translationsprodukt spezifisch binden, und Inkubation unter Bedingungen, die eine nachweisbare Bindung des Rezeptors an das Amplifikationsprodukt, den Einzelstrang davon oder das codierte Translationsprodukt erlauben; und(b ') transfer of the amplification product or the coded translation product onto at least one chip on which there are in an ordered pattern receptors which specifically bind the amplification product, a single strand thereof or the coded translation product, and incubation under conditions which detect the binding of the Allow receptor to the amplification product, the single strand thereof or the encoded translation product; and
(c") Nachweis, ob eine Bindung des Amplifikationsproduktes, des Einzelstrangs davon oder des codierten Translationsproduktes an den Rezeptor stattgefunden hat; und/oder(c ") evidence of whether binding of the amplification product, the single strand thereof or the coded translation product to the receptor has taken place; and / or
(b") gegebenenfalls Spaltung der Amplifikationsprodukte mit einem im Bereich der Primerbindungsstelle spaltenden Restriktionsenzym und Ligation von Amplifikationsprodukten zu einem Concatemer; und/oder(b ") optionally cleaving the amplification products with a restriction enzyme cleaving in the region of the primer binding site and ligation of amplification products to a concatemer; and / or
(c") Sequenzierung des Amplifikationsproduktes oder des Concatemers.(c ") Sequencing of the amplification product or the concatenter.
5. Verfahren nach Anspruch 4, wobei die eingeführte Nucleinsaure mindestens eine weitere artifizielle Sequenz enthält, die mit mindestens einem speziellen Primer unter stringenten Hybridisierungsbedingungen hybridisiert, wobei der mindestens eine spezielle Primer mit einem weiteren Primer, der unter stringenten Hybridisierungsbedingungen mit einer weiteren Sequenz in der eingeführten Nucleinsaure hybridisiert, oder mit einem weiteren speziellen Primer, der unter stringenten Hybridisierungsbedingungen mit einer weiteren artifiziellen Sequenz hybridisiert, die Amplifikation eines Bereiches der eingeführten Nucleinsaure erlaubt, der die mindestens eine artifizielle Sequenz umfaßt.5. The method according to claim 4, wherein the introduced nucleic acid contains at least one further artificial sequence which hybridizes with at least one special primer under stringent hybridization conditions, the at least one special primer with another primer, which under stringent hybridization conditions with a further sequence in the hybridized introduced nucleic acid, or with a further special primer, which hybridizes under stringent hybridization conditions with another artificial sequence, allows the amplification of a region of the introduced nucleic acid, which comprises the at least one artificial sequence.
6. Verfahren nach Anspruch 4 oder 5, wobei die mindestens zwei Sequenzen und/oder die mindestens zwei weiteren Sequenzen räumlich voneinander getrennt sind. 6. The method according to claim 4 or 5, wherein the at least two sequences and / or the at least two further sequences are spatially separated from one another.
7. Verfahren nach einem der Ansprüche 4 bis 6, wobei die in Schritt (c) erfaßten Daten in digitalisierter Form gespeichert werden.7. The method according to any one of claims 4 to 6, wherein the data recorded in step (c) are stored in digitized form.
8. Verfahren nach Anspruch 7, wobei die Speicherung in einem Zentralspeicher erfolgt.8. The method according to claim 7, wherein the storage takes place in a central memory.
9. Verfahren nach einem der Ansprüche 1 bis 8, wobei die eingeführte Nucleinsaure ein (Poly)peptid codiert.9. The method according to any one of claims 1 to 8, wherein the introduced nucleic acid encodes a (poly) peptide.
10. Verfahren nach Anspruch 9, wobei das (Poly)peptid ein Fusionsprotein ist.10. The method of claim 9, wherein the (poly) peptide is a fusion protein.
11. Verfahren nach Anspruch 9 oder 10, wobei die eingeführte Nucleinsaure ein Transgen oder eine artifizielle Sequenz ist.11. The method according to claim 9 or 10, wherein the introduced nucleic acid is a transgene or an artificial sequence.
12. Verfahren nach einem der Ansprüche 1 bis 11 , wobei die eingeführte Nucleinsaure ein Erkennungscode ist oder enthält.12. The method according to any one of claims 1 to 11, wherein the nucleic acid introduced is or contains a recognition code.
13. Verfahren nach Anspruch 12, wobei der Erkennungscode verschlüsselt ist.13. The method of claim 12, wherein the identification code is encrypted.
14. Verfahren nach Anspruch 13, wobei die Verschlüsselung eine kryptographische Verschlüsselung ist.14. The method of claim 13, wherein the encryption is a cryptographic encryption.
15. Verfahren nach einem der Ansprüche 4 bis 14, wobei der Rezeptor ein Protein, vorzugsweise ein Glycoprotein, eine spezifisch bindende RNA oder ein Peptid, oder ein Antikörper, ein Derivat oder Fragment davon.15. The method according to any one of claims 4 to 14, wherein the receptor is a protein, preferably a glycoprotein, a specifically binding RNA or a peptide, or an antibody, a derivative or fragment thereof.
16. Verfahren nach Anspruch 15, wobei der Antikörper, das Derivat oder das Fragment davon doppelsträngige DNA sequenzspezifisch bindet.16. The method of claim 15, wherein the antibody, the derivative or the fragment thereof binds double-stranded DNA sequence-specifically.
17. Verfahren nach einem der Ansprüche 4 bis 14, wobei der Rezeptor eine Einzelstrang-DNA ist. 17. The method according to any one of claims 4 to 14, wherein the receptor is a single-stranded DNA.
18. Verfahren nach einem der Ansprüche 4 bis 17, wobei sich auf dem Chip in jeder Position des geordneten Musters ein Rezeptor mit einer anderen Bindungsspezifität befindet.18. The method according to any one of claims 4 to 17, wherein there is a receptor with a different binding specificity on the chip in each position of the ordered pattern.
19. Verfahren nach einem der Ansprüche 4 bis 14, wobei vor den Schritten (a), (b") und (c") folgende Schritte durchgeführt werden:19. The method according to any one of claims 4 to 14, wherein the following steps are carried out before steps (a), (b ") and (c"):
(i) Spaltung der eingeführten Nucleinsäuren, die zuvor mit einem Sequenz-Tag versehen wurden, mit einem Restriktionsenzym;(i) cleavage of the introduced nucleic acids which have been previously tagged with a restriction enzyme;
(ii) Isolierung der mit dem Tag versehenen Spaltprodukte;(ii) isolation of the tagged fission products;
(iii) hälftige Teilung der Spaltprodukte und Ligation der Hälften mit verschiedenen Linkern;(iii) halving the cleavage products and ligating the halves with different linkers;
(iv) Spaltung des Ligationsproduktes aus (iii) mit einem Typ II Restriktionsenzym, das die Bindungsstelle in den Linkern aufweist und in den eingeführten Nucleinsäuren spaltet, so daß ein Bereich der eingeführten Nucleinsäuren mit dem Linker verbunden bleibt; und(iv) cleavage of the ligation product from (iii) with a type II restriction enzyme which has the binding site in the linkers and cleaves in the inserted nucleic acids, so that a region of the introduced nucleic acids remains connected to the linker; and
(v) head-to-tail-Ligation der eingeführten Nucleinsäuren.(v) head-to-tail ligation of the introduced nucleic acids.
20. Verfahren nach Anspruch 19, wobei die eingeführten Nucleinsäuren Doppelstrang-cDNAs sind, und vor Schritt (i) folgender Schritt durchgeführt wird: Generierung von Doppelstrang-cDNA aus mRNA des Organismus oder der Zelle unter Verwendung eines mit einem Sequenz-Tag versehenen 3'- Primers.20. The method according to claim 19, wherein the nucleic acids introduced are double-stranded cDNAs, and the following step is carried out before step (i): generation of double-stranded cDNA from mRNA of the organism or of the cell using a 3 'provided with a sequence tag - primers.
21. Verfahren nach einem der Ansprüche 4 bis 14, wobei vor den Schritten (a), (b") und (c") folgende Schritte durchgeführt werden:21. The method according to any one of claims 4 to 14, wherein the following steps are carried out before steps (a), (b ") and (c"):
(i) Generierung von Doppelstrang-cDNA aus mRNA des Organismus oder der Zelle unter Verwendung eines mit einem Tag versehenen 3'- Primers;(i) Generation of double-stranded cDNA from organism or cell mRNA using a tagged 3 'primer;
(ii) Spaltung der cDNA mit einem Restriktionsenzym;(ii) cleavage of the cDNA with a restriction enzyme;
(iii) Isolierung der mit dem Tag versehenen Spaltprodukte;(iii) isolation of the tagged cleavage products;
(iv) hälftige Teilung der Spaltprodukte und Ligation der Hälften mit verschiedenen Linkern; (v) Spaltung des Ligationsproduktes aus (iv) mit einem Typ II Restriktionsenzym, das die Bindungsstelle in den Linkern aufweist und in der cDNA spaltet, so daß ein Bereich der cDNA mit dem Linker verbunden bleiben; und(iv) split the split products in half and ligate the halves with different linkers; (v) cleavage of the ligation product from (iv) with a type II restriction enzyme which has the binding site in the linkers and cleaves in the cDNA so that a region of the cDNA remains connected to the linker; and
(vi) head-to-tail-Ligation der cDNA-Fragmente.(vi) head-to-tail ligation of the cDNA fragments.
22. Verfahren nach Anspruch 20 oder 21 , wobei der 3'-Primer ein oligo-dT-Primer, ein universeller oder ein spezieller Primer ist.22. The method of claim 20 or 21, wherein the 3 'primer is an oligo-dT primer, a universal or a special primer.
23. Verfahren nach Anspruch 21 oder 22, wobei der Tag Biotin oder Digoxygenin ist.23. The method of claim 21 or 22, wherein the tag is biotin or digoxygenin.
24. Verfahren nach einem der Ansprüche 19 bis 23, wobei der Bereich 8 bis 20 Nucleotide umfaßt.24. The method according to any one of claims 19 to 23, wherein the region comprises 8 to 20 nucleotides.
25. Chip wie in einem der Ansprüche 1 oder 15 bis 18 definiert. 25. Chip as defined in one of claims 1 or 15 to 18.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE10027218 | 2000-05-31 | ||
DE10027218A DE10027218A1 (en) | 2000-05-31 | 2000-05-31 | Detecting heterogeneous nucleic acid sequences in organisms and cells, useful for detecting and identifying genetically modified organisms or their products |
PCT/EP2001/006198 WO2001098533A2 (en) | 2000-05-31 | 2001-05-31 | Artificial marking using synthetic dna |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1315834A2 true EP1315834A2 (en) | 2003-06-04 |
Family
ID=7644364
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP01949371A Withdrawn EP1315834A2 (en) | 2000-05-31 | 2001-05-31 | Artificial marking using synthetic dna |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1315834A2 (en) |
AU (1) | AU2001270545A1 (en) |
DE (1) | DE10027218A1 (en) |
WO (1) | WO2001098533A2 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE10321480B4 (en) * | 2003-05-13 | 2005-07-21 | Universität Potsdam | Method for identifying cell lines |
CN100370035C (en) * | 2005-09-08 | 2008-02-20 | 中国疾病预防控制中心营养与食品安全所 | Transgene agricultural product DNA detection chip, its preparation method and application |
CN106367485B (en) | 2016-08-29 | 2019-04-26 | 厦门艾德生物医药科技股份有限公司 | Double label connector groups of a kind of more positioning for detecting gene mutation and its preparation method and application |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5429952A (en) * | 1988-02-02 | 1995-07-04 | Biocode, Inc. | Marking of products to establish identity and source |
US5846719A (en) * | 1994-10-13 | 1998-12-08 | Lynx Therapeutics, Inc. | Oligonucleotide tags for sorting and identification |
US5866330A (en) * | 1995-09-12 | 1999-02-02 | The Johns Hopkins University School Of Medicine | Method for serial analysis of gene expression |
WO1998055657A1 (en) * | 1997-06-05 | 1998-12-10 | Cellstore | Methods and reagents for indexing and encoding nucleic acids |
WO1999055886A1 (en) * | 1998-04-24 | 1999-11-04 | Genova Pharmaceuticals Corporation | Function-based gene discovery |
-
2000
- 2000-05-31 DE DE10027218A patent/DE10027218A1/en not_active Withdrawn
-
2001
- 2001-05-31 WO PCT/EP2001/006198 patent/WO2001098533A2/en not_active Application Discontinuation
- 2001-05-31 EP EP01949371A patent/EP1315834A2/en not_active Withdrawn
- 2001-05-31 AU AU2001270545A patent/AU2001270545A1/en not_active Abandoned
Non-Patent Citations (1)
Title |
---|
See references of WO0198533A2 * |
Also Published As
Publication number | Publication date |
---|---|
WO2001098533A9 (en) | 2002-09-19 |
AU2001270545A1 (en) | 2002-01-02 |
DE10027218A1 (en) | 2001-12-06 |
WO2001098533A2 (en) | 2001-12-27 |
WO2001098533A3 (en) | 2003-04-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Zane et al. | Strategies for microsatellite isolation: a review | |
STAM et al. | Microsatellite loci in eelgrass Zostera marina reveal marked polymorphism within and among populations | |
CN101346466B (en) | Improved targeted nucleotide exchange with LNA modified oligonucleotides | |
DE60025850T2 (en) | PROCESS FOR THE PRODUCTION OF OLIGONUCLEOTIDES, IN PARTICULAR FOR THE DETECTION OF AMPLIFIED RESTRICTION FRAGMENTS OBTAINED BY AFLP | |
DE60312875T2 (en) | GENOME DIVISION | |
DE60219199T2 (en) | ANALYSIS AND DETECTION OF MULTIPLE TARGET SEQUENCES USING CIRCULAR SAMPLES | |
Reiter et al. | The Reb1‐homologue Ydr026c/Nsi1 is required for efficient RNA polymerase I termination in yeast | |
Hausner | Introns, mobile elements, and plasmids | |
DE60213803T2 (en) | HAPPIER MAPPING | |
CN101310024A (en) | Method for high throughput screening of transposon tagging populations and massive parallel sequence identification of insertion sites | |
Lamb et al. | Plant chromosomes from end to end: telomeres, heterochromatin and centromeres | |
KR20220004980A (en) | How to identify functional elements | |
Kanizay et al. | Diversity and abundance of the abnormal chromosome 10 meiotic drive complex in Zea mays | |
CN115210370A (en) | RNA detection and transcription-dependent editing using reprogrammed tracrRNA | |
Curto et al. | Evaluation of microsatellites of Catha edulis (qat; Celastraceae) identified using pyrosequencing | |
Emsens et al. | Strong conditionality in plant-fungal community assembly after soil inoculation in post-agricultural grasslands | |
Resch et al. | Long‐term recovery of above‐and below‐ground interactions in restored grasslands after topsoil removal and seed addition | |
EP1315834A2 (en) | Artificial marking using synthetic dna | |
Fridjonsson et al. | Detection and mapping of mtDNA SNPs in Atlantic salmon using high throughput DNA sequencing | |
US20190218544A1 (en) | Gene editing, identifying edited cells, and kits for use therein | |
DE60202196T2 (en) | ORIENTATION-ORIENTED CONSTRUCTION OF PLASMIDES | |
Oberemok et al. | Contact unmodified antisense DNA (CUAD) biotechnology: list of pest species successfully targeted by oligonucleotide insecticides | |
Biondi et al. | Spread of the group II intron RmInt1 and its insertion sequence target sites in the plant endosymbiont Sinorhizobium meliloti | |
EP1865070A1 (en) | Method for marking a product using nucleic acids to determine its identity and origin | |
Jernigan et al. | Capillary electrophoresis single‐strand conformational polymorphisms as a method to differentiate algal species |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20021223 |
|
AK | Designated contracting states |
Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
D17P | Request for examination filed (deleted) | ||
R17P | Request for examination filed (corrected) |
Effective date: 20021223 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20041201 |