DE10014412A1 - Expression vectors for the enrichment of a recombinantly produced protein in different cell compartments - Google Patents

Expression vectors for the enrichment of a recombinantly produced protein in different cell compartments

Info

Publication number
DE10014412A1
DE10014412A1 DE2000114412 DE10014412A DE10014412A1 DE 10014412 A1 DE10014412 A1 DE 10014412A1 DE 2000114412 DE2000114412 DE 2000114412 DE 10014412 A DE10014412 A DE 10014412A DE 10014412 A1 DE10014412 A1 DE 10014412A1
Authority
DE
Germany
Prior art keywords
desired protein
host
expression
composition
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
DE2000114412
Other languages
German (de)
Inventor
Klaus Duering
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MPB Cologne GmbH Molecular Plant und Protein Biotechnology
Original Assignee
MPB Cologne GmbH Molecular Plant und Protein Biotechnology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MPB Cologne GmbH Molecular Plant und Protein Biotechnology filed Critical MPB Cologne GmbH Molecular Plant und Protein Biotechnology
Priority to DE2000114412 priority Critical patent/DE10014412A1/en
Priority to AU2001237217A priority patent/AU2001237217A1/en
Priority to PCT/DE2001/000133 priority patent/WO2001073085A1/en
Publication of DE10014412A1 publication Critical patent/DE10014412A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C12N15/8258—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon for the production of oral vaccines (antigens) or immunoglobulins

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to an expression vector (A) characterized by containing at least two copies of a gene encoding a desired protein in functional combination with a promoter, or to a composition (B) comprising at least two expression vectors containing at least one copy of a gene encoding a desired protein in functional combination with a promoter. The individual gene copies are characterized in that (a) they encode the desired protein (I) as a fusion protein with a desired localization signal (II); (b) the (I) encoding portion of the individual gene copies being substantially identical, the (II) encoding portion however being different. Once the expression vector (A) or the composition (B) is introduced into a host, the desired protein is transported to different compartments of the host. The invention further relates to a composition (C) comprising at least one expression vector localized in the plastids and one expression vector localized in the mitochondria, both containing at least one copy of a gene encoding the desired protein functionally linked with a promoter. The individual expression vectors are characterized in that the individual gene copies are substantially identical and the desired protein is expressed in the plastids or the mitochondria of the host. The inventive expression vectors/compositions are used in methods that allow to increase the production rate of recombinant proteins.

Description

Die vorliegende Erfindung betrifft einen Expressionsvektor (A), der dadurch gekennzeichnet ist, daß er mindestens zwei Kopien eines für ein gewünschtes Protein kodierenden Gens jeweils mit einem Promotor funktionell verknüpft enthält, oder eine Zusammensetzung (B), die mindestens zwei Expressionsvektoren umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Genkopien dadurch gekennzeichnet sind, daß sie (a) für das gewünschte Protein (I) als Fusionsprotein mit einem gewünschten Lokalisierungssignal (II) kodieren; wobei (b) bei den einzelnen Genkopien der für (I) kodierende Anteil im wesentlichen identisch, der für (II) kodierende Anteil jedoch unterschiedlich ist, wobei nach Einschleusen des Expressionsvektors (A) oder der Zusammensetzung (B) in einen Wirt das gewünschte Protein in unterschiedliche Kompartimente des Wirts transportiert wird. Die vorliegende Erfindung betrifft auch eine Zusammensetzung (C), die mindestens einen in Plastiden lokalisierten und einen in Mitochondrien lokalisierten Expressionsvektor umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Expressionsvektoren dadurch gekennzeichnet sind, daß die einzelnen Genkopien im wesentlichen identisch sind und das gewünschte Protein in Plastiden und Mitochondrien des Wirts exprimiert wird. Die vorliegende Erfindung betrifft auch die Kombination der vorstehenden Ausführungsformen. Die erfindungsgemäßen Expressionsvektoren/Zusammensetzungen finden Verwendung in einem Verfahren, das die Steigerung der Produktionsrate für rekombinante Proteine erlaubt.The present invention relates to an expression vector (A), which is characterized in that is that it has at least two copies of a gene encoding a desired protein each functionally linked to a promoter, or a composition (B), which comprises at least two expression vectors, each having at least one copy of one functionally linked to a promoter for a gene encoding a desired protein included, the individual gene copies are characterized in that they (a) for the desired protein (I) as a fusion protein with a desired localization signal (II) encode; where (b) in the individual gene copies the part coding for (I) in essentially identical, but the coding for (II) is different, whereby after Introducing the expression vector (A) or the composition (B) into a host desired protein is transported into different compartments of the host. The The present invention also relates to a composition (C) which comprises at least one in Plastids located and an expression vector located in mitochondria, each with at least one copy of a gene coding for a desired protein contain a promoter linked functionally, the individual expression vectors are characterized in that the individual gene copies are essentially identical and the desired protein is expressed in plastids and mitochondria of the host. The The present invention also relates to the combination of the above embodiments. The expression vectors / compositions according to the invention are used in a process that allows the production rate for recombinant proteins to be increased.

Inzwischen werden die meisten Proteine von kommerziellem Interesse in pro- oder eukaryotischen Wirtsorganismen rekombinant hergestellt. Während die Expressionsraten in prokaryotischen Organismen, insbesondere in Bakterien, oft sehr hoch sind (bis zu 50% des Gesamtproteins), werden in eukaryotischen Zellen oft nur geringe Expressionsraten erzielt (deutlich unter 1% bis höchstens zu wenigen Prozenten im Vergleich zu dem löslichen Gesamtprotein). Somit ist die Expression eines gewünschten Proteins in Bakterien in vielen Fällen bevorzugt. Allerdings tritt hier oft das Problem der Bildung von "inclusion bodies" (Einschlußkörpern) auf, in denen das überproduzierte Protein in denaturierter Form vorliegt. Die natürlichen Biosynthese-Apparate von Pflanzenzellen sind in der Lage, auch solche, z. T. komplexe, Proteine zu synthetisieren, die der Expression in prokaryotischen Zellen nicht zugänglich sind. Allerdings sind die Expressionsraten in Pflanzenzellen oft sehr gering und in verschiedenen Kompartimenten dieser Zellen auch unterschiedlich. Dies wurde z. B. bei rekombinanten scFv-Antikörpern in transgenen Pflanzen hinsichtlich der Kompartimente Cytoplasma, Apoplast und endoplasmatisches Retikulum (ER) untersucht (Conrad und Fiedler, Plant Molecular Biology 38 (1998), 101-109). Es zeigte sich, daß eine cytoplasmatische Expression von scFv-Antikörpern kaum realisierbar war, nur in Einzelfällen konnten überhaupt Expressionsraten nachgewiesen werden, wobei diese allerdings extrem gering waren. Die subzelluläre Lokalisation im endoplasmatischen Retikulum (ER) führte dagegen sowohl in Samen von Tabak oder Arabidopsis (Conrad und Fiedler, supra) als auch in Kartoffelknollen (Artsaenko et al., Molecular Breeding 4 (1998), 313-319) zu einer effizienteren Produktion des Fremdproteins. Apoplastische Expression konnte ebenfalls nachgewiesen werden, wenn auch nur mit etwa einem Zehntel der Menge im Vergleich zur Lokalisation im ER.Meanwhile, most proteins of commercial interest in pro- or eukaryotic host organisms recombinantly produced. While the expression rates in prokaryotic organisms, especially in bacteria, are often very high (up to 50% of the Total protein), only low expression rates are often achieved in eukaryotic cells (well below 1% to at most a few percent compared to the soluble one Total protein). Thus, the expression of a desired protein in bacteria is many Preferred cases. However, the problem of the formation of "inclusion bodies" often arises here. (Inclusion bodies) in which the overproduced protein is present in denatured form. The natural biosynthesis apparatus of plant cells is able to e.g. T. complex to synthesize proteins that express expression in prokaryotic cells are not accessible. However, the expression rates in plant cells are often very low and also different in different compartments of these cells. This was e.g. B. in the case of recombinant scFv antibodies in transgenic plants with regard to the compartments  Cytoplasm, apoplast and endoplasmic reticulum (ER) examined (Conrad and Fiedler, Plant Molecular Biology 38 (1998), 101-109). It turned out that one cytoplasmic expression of scFv antibodies was hardly feasible, only in In individual cases, expression rates could be detected at all were extremely low, however. The subcellular localization in the endoplasmic Reticulum (ER), however, resulted in both seeds of tobacco or Arabidopsis (Conrad and Fiedler, supra) and in potato tubers (Artsaenko et al., Molecular Breeding 4 (1998), 313-319) for more efficient production of the foreign protein. Apoplastic expression could also be demonstrated, if only with a tenth of the amount compared to the location in the ER.

Andererseits ist bekannt, daß in der Natur bestimmte Proteine in mehrere subzelluläre Kompartimente einer Zelle gleichzeitig sortiert werden. So wird z. B. in Erbsen die Glutathion-Reduktase aufgrund des Vorhandenseins einer einzigen Prosequenz sowohl in Chloroplasten als auch in Mitochondrien transportiert (Creissen et al., Plant Journal 8 (1995), 167-175). Bezüglich der rekombinanten Produktion von Proteinen, beispielsweise in Pflanzenzellen, ist allerdings zu betonen, daß ein bestimmtes Kompartiment einer Pflanzenzelle aus biologischen und physikalischen Gründen nur eine begrenzte Speicherfähigkeit für ein zu produzierendes Protein aufweist, da der notwendige physikalische Speicherplatz mit anderen Proteinen geteilt werden muß. Außerdem sind teilweise bei Proteinfaltung und -transport Chaperone und Rezeptoren beteiligt. Bei hohen Expressionsraten kann demzufolge eine Überlastung des Transportapparates oder der Speicherkapazität der Pflanzenzelle eintreten. Dies hat zur Folge, daß deren maximal mögliche Fremdproteinbiosynthese-Kapazität aufgrund der eingeschränkten Leistungsfähigkeit des Transkriptions- und Translationsapparates nicht vollständig ausgenutzt wird. Schließlich gibt es in Pflanzenzellen neben dem Kerngenom und dessen Transkriptions- und Translationsapparat zwei weitere Genome mit (zumindest teilweise) eigenständigen Transkriptions- und Translationsapparaten, nämlich die der Plastiden und Mitochondrien. Erfolgt eine Integration des Fremdgens allerdings ausschließlich in eines dieser Genome, so wird nur ein Teil der maximal möglichen Fremdproteinbiosynthese- Kapazität des zellulären Stoffwechsels genutzt. Außerdem wird durch ein Expressionskonstrukt mit nur einem definierten Targetting-Signal nur das Speicherpotential eines subzellulären Kompartimentes genutzt. Die vorstehend beschriebenen Probleme hinsichtlich der Effizienz der rekombinanten Herstellung von Proteinen in Eukaryoten, insbesondere Pflanzen, wirdn bisher nicht bzw. nur wenig zufriedenstellend gelöst. Auch beschränkte sich die Fachliteratur bisher nur auf die Schilderung von Experimenten hinsichtlich der vergleichenden Bestimmung der Expressionsraten in einzelnen subzellulären Kompartimenten.On the other hand, it is known that in nature certain proteins are divided into several subcellular ones Compartments of a cell are sorted simultaneously. So z. B. in peas Glutathione reductase due to the presence of a single prosequence in both Chloroplasts as well as transported in mitochondria (Creissen et al., Plant Journal 8 (1995), 167-175). Regarding the recombinant production of proteins, for example in Plant cells, however, it should be emphasized that a certain compartment of a Plant cell only a limited one for biological and physical reasons Has storage capacity for a protein to be produced, since the necessary physical space must be shared with other proteins. Also are partly involved in protein folding and transport of chaperones and receptors. At high Expression rates can consequently overload the transport apparatus or the Enter the storage capacity of the plant cell. As a result, their maximum possible foreign protein biosynthesis capacity due to the limited Performance of the transcription and translation apparatus is not complete is exploited. After all, there are plant cells in addition to the nuclear genome and its Transcription and translation apparatus two additional genomes with (at least partially) independent transcription and translation apparatus, namely that of the plastids and Mitochondria. However, the foreign gene is only integrated into one of these genomes, only a part of the maximum possible foreign protein biosynthesis is Capacity of the cellular metabolism used. In addition, a Expression construct with only one defined targeting signal only the storage potential of a subcellular compartment. The problems described above regarding the efficiency of recombinant production of proteins in eukaryotes, Plants, in particular, have so far not been solved, or only to a somewhat unsatisfactory degree. Also  So far, the specialist literature has only been limited to the description of experiments with regard to the comparative determination of the expression rates in individual subcellular compartments.

Somit liegt der Erfindung im wesentlichen das technische Problem zugrunde, Mittel zur Steigerung der Ausbeute von in Eukaryoten rekombinant hergestellten Fremdproteinen zur Verfügung zu stellen.Thus, the invention is essentially based on the technical problem, means for Increasing the yield of foreign proteins recombinantly produced in eukaryotes To make available.

Die Lösung dieses technischen Problems wird durch die Bereitstellung der in den Patentansprüchen gekennzeichneten Ausführungsformen erreicht.The solution to this technical problem is provided by the Claims characterized embodiments achieved.

Die vorliegende Erfindung betrifft ein Verfahren, das die bisher im Stand der Technik vorhandenen Beschränkungen in der Effizienz der Fremdproteinbiosynthese in Eukaryoten, insbesondere in Pflanzenzellen, minimiert. So bietet sich für das "Molecular Farming" in transgenen Pflanzen durch die vorliegende Erfindung die Möglichkeit, wesentliche Erhöhungen der Expressionsraten fremder Proteine zu erreichen. Im Gegensatz zu den bisherigen Vorgehensweisen wird dabei das zu produzierende Protein nicht in ein einziges subzelluläres Kompartiment geleitet und nur das Speicherpotential dieses einen Kompartimentes genutzt, vielmehr werden in einer Ausführungsform zwei oder mehrere homologe Gene für die Expression eines definierten Proteins in die Wirtszelle eingebracht, wobei sich die dadurch kodierten Proteine darin unterscheiden, daß sie Targetting-Signale (Lokalisierungssignale) für unterschiedliche subzelluläre Kompartimente enthalten. Beispielsweise kann ein diagnostischer scFv-Antikörper durch Fusion mit einem Signalpeptid in den Apoplasten, gleichzeitig aber auch durch Fusion mit einem anderen Signalpeptid und mit dem KDEL-Targetting-Signal im ER lokalisiert werden. Somit werden beispielsweise die Speicherpotentiale des ER und des Apoplasten gleichzeitig genutzt. Weiterhin können zusätzlich Gene eingebracht werden, die für vakuolär oder im Golgi- Apparat lokalisierte scFv-Antikörper kodieren. Somit können in diesem Ausführungsbeispiel der vorliegenden Erfindung die Speicherpotentiale von vier subzellulären Kompartimenten miteinander kombiniert werden. In einer alternativen Ausführungsform werden die Fremdproteine nicht durch nukleäre Expression und Transport in Organellen, d. h. Plastiden oder Mitochondrien, produziert, sondern die entsprechenden Gene werden durch direkte Transformation von Plastiden oder Mitochondrien mittels geeigneter Vektoren in diese Organellen eingeschleust und das für das betreffende Protein kodierende Gen direkt in diesen Kompartimenten exprimiert. Beide Vorgehensweisen können kombiniert werden, d. h. in einer weiteren Ausführungsform der vorliegenden Erfindung wird das Speicherpotential von bestimmten Kompartimenten, z. B. von Plastiden oder Mitochondrien, dadurch effizienter ausgenutzt, daß sowohl eine Organellen- als auch eine Kerntransformation mit den entsprechenden Genen durchgeführt wird, also die direkte Proteinsynthese in Organellen mit der nukleären Proteinsynthese und nachfolgendem Transport des Proteins in die Organellen, d. h. Plastiden und Mitochondrien, mittels geeigneter Signalsequenzen kombiniert wird. Mit der vorliegenden Erfindung können somit die einzelnen Speicherkapazitäten typischer Speicherkompartimente, wie z. B. der Plastiden, des endoplasmatischen Retikulums oder von Speichervakuolen, kombiniert und synergistisch ausgenutzt werden.The present invention relates to a method that has been used in the prior art existing restrictions in the efficiency of foreign protein biosynthesis in eukaryotes, minimized especially in plant cells. So offers for "Molecular Farming" in transgenic plants by the present invention the possibility of essential To achieve increases in the expression rates of foreign proteins. In contrast to the previous approaches do not combine the protein to be produced into one subcellular compartment and only the storage potential of this one Compartments used, rather two or more are used in one embodiment homologous genes for the expression of a defined protein introduced into the host cell, the proteins encoded thereby differ in that they have targeting signals (Localization signals) for different subcellular compartments. For example, a diagnostic scFv antibody can be fused with a Signal peptide in the apoplasts, but at the same time also by fusion with another Signal peptide and localized with the KDEL targeting signal in the ER. So be For example, the storage potentials of the ER and the apoplast are used simultaneously. In addition, genes can be introduced that are suitable for vacuolar or in the Golgi Encode apparatus-localized scFv antibodies. Thus, in this embodiment of the present invention the storage potentials of four subcellular compartments can be combined with each other. In an alternative embodiment, the Foreign proteins not by nuclear expression and transport in organelles, d. H. Plastids or mitochondria, but the corresponding genes are produced by direct Transformation of plastids or mitochondria into these using suitable vectors Organelles introduced and the gene coding for the protein in question directly into expressed in these compartments. Both approaches can be combined, i. H.  In a further embodiment of the present invention, the storage potential of certain compartments, e.g. B. plastids or mitochondria, thereby exploited more efficiently that both an organelle and a nuclear transformation with the corresponding genes is carried out, i.e. the direct protein synthesis in Organelles with the nuclear protein synthesis and subsequent transport of the protein into the organelles, d. H. Plastids and mitochondria, using suitable signal sequences is combined. With the present invention, the individual Storage capacities of typical storage compartments, such as B. the plastids, the endoplasmic reticulum or storage vacuoles, combined and synergistic be exploited.

Somit betrifft eine Ausführungsform der vorliegenden Erfindung einen Expressionsvektor (A), der dadurch gekennzeichnet ist, daß er mindestens zwei Kopien eines für ein gewünschtes Protein kodierenden Gens jeweils mit einem Promotor funktionell verknüpft enthält, oder eine Zusammensetzung (B), die mindestens zwei Expressionsvektoren umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Genkopien dadurch gekennzeichnet sind, daß sie (a) für das gewünschte Protein (I) als Fusionsprotein mit einem gewünschten Lokalisierungssignal (II) kodieren, wobei (b) bei den einzelnen Genkopien der für (I) kodierende Anteil im wesentlichen identisch, der (II) kodierende Anteil jedoch unterschiedlich ist, wobei nach Einschleusen des Expressionsvektors (A) oder der Zusammensetzung (B) in einen Wirt das gewünschte Protein in unterschiedliche Kompartimente des Wirts transportiert wird.Thus, one embodiment of the present invention relates to an expression vector (A), which is characterized in that it has at least two copies of one for one desired protein-encoding gene each functionally linked to a promoter contains, or a composition (B), the at least two expression vectors comprises, each at least one copy of a coding for a desired protein Contain genes linked functionally to a promoter, with the individual gene copies characterized in that they are (a) for the desired protein (I) as a fusion protein encode with a desired location signal (II), where (b) in the individual Gene copies the portion coding for (I) essentially identical, the portion coding for (II) however, is different, whereby after the expression vector (A) or the Composition (B) in a host the desired protein in different Compartments of the host is transported.

Eine alternative Ausführungsform der vorliegenden Erfindung betrifft eine Zusammensetzung (C), die mindestens einen in Plastiden lokalisierten und einen in Mitochondrien lokalisierten Expressionsvektor umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gans mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Expressionsvektoren weiter dadurch gekennzeichnet sind, daß die einzelnen Genkopien im wesentlichen identisch sind und das gewünschte Protein in den Mitochondrien und Plastiden des Wirts exprimiert wird.An alternative embodiment of the present invention relates to one Composition (C) which has at least one localized in plastids and one in Mitochondria localized expression vector, each containing at least one copy a goose coding for a desired protein with a promoter functional contain linked, the individual expression vectors further thereby are characterized in that the individual gene copies are essentially identical and that desired protein is expressed in the host's mitochondria and plastids.

In einer bevorzugten Ausführungsform der vorliegenden Erfindung sind die beiden vorstehenden Ausführungsformen kombiniert, d. h., es wird sowohl eine Organellen- als auch eine Kerntransformation mit den für das gewünschte Protein kodierenden Genen durchgeführt, also die direkte Proteinsynthese in Organellen, d. h. in Plastiden und Mitochondrien, mit der nukleären Proteinsynthese und nachfolgendem Transport des Proteins in die Organellen durch die Verwendung von Expressionsvektoren, bei denen das gewünschte Protein mit geeigneten Signalsequenzen verknüpft ist, kombiniert. Vektoren bzw. Vektorsequenzen, die die Expression des gewünschten Proteins in Organellen, d. h. in Plastiden oder Mitochondrien, erlauben, sind dem Fachmann bekannt. Beispielsweise wird auf Svab et al., Proc. Natl. Acad. Sci. USA 87 (1990) 8526-8530; Khan and Maliga, Nature Biotechnology 1 (1999), 910-915; Sidorov et al., Plant Journal 19 (1999), 209- 216 verwiesen.In a preferred embodiment of the present invention, the two are combined above embodiments, d. that is, it becomes both an organelle and also a nuclear transformation with the genes coding for the desired protein carried out, ie the direct protein synthesis in organelles, d. H. in plastids and  Mitochondria, with the nuclear protein synthesis and subsequent transport of the Protein into the organelles through the use of expression vectors in which the desired protein is linked with suitable signal sequences, combined. Vectors or vector sequences that express the expression of the desired protein in organelles, d. H. in Allow plastids or mitochondria are known to the person skilled in the art. For example on Svab et al., Proc. Natl. Acad. Sci. USA 87: 8526-8530 (1990); Khan and Maliga, Nature Biotechnology 1 (1999), 910-915; Sidorov et al., Plant Journal 19 (1999), 209- 216 referenced.

Der hier gebrauchte Ausdruck "im wesentlich identisch" bezüglich der einzelnen Genkopien bedeutet, daß die davon kodierten Proteine zumindest über die gleiche biologische Aktivität verfügen. Die einzelnen Genkopien können z. B. Modifikationen enthalten, die für die Expression des Gens, beispielsweise in Abhängigkeitt von der Expression in bestimmten Organellen, von Vorteil sind; vgl. dazu auch den nachstehenden Abschnitt zu "gene silencing".The expression "essentially identical" used here with regard to the individual gene copies means that the proteins encoded by it have at least the same biological activity feature. The individual gene copies can e.g. B. contain modifications for the Expression of the gene, for example depending on the expression in certain Organelles, are beneficial; see. also refer to the following section silencing ".

Verfahren zur Konstruktion der Expressionsvektoren, die für das gewünschte Gen in exprimierbarer Form enthalten, sind dem Fachmann bekannt und beispielsweise auch in gängigen Standardwerken beschrieben (vgl. z. B. Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2. Aufl. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Die erfindungsgemäßen Expressionsvektoren können auf einem Plasmid, Cosmid, Virus, Bacteriophagen oder einem anderen in der Gentechnik üblichen Vektor basieren. Diese Vektoren können weitere Funktionseinheiten besitzen, die eine Stabilisierung des Vektors im Wirtsorganismus bewirken. Ferner können bei Verwendung einer Pflanze als Wirtsorganismus "left border"- und "right border"-Sequenzen agrobakterieller T-DNA enthalten sein, wodurch eine stabile Integration in das Erbgut von Pflanzen ermöglicht wird. Ferner kann eine Terminationssequenz vorhanden sein, die der korrekten Beendigung der Transkription sowie der Addition einer Poly-A-Sequenz an das Transkript dient. Derartige Elemente sind in der Literatur beschrieben (vgl. Gielen et al., EMBO J. 8 (1989), 23-29) und beliebig austauschbar.Method of constructing the expression vectors necessary for the desired gene in contain expressible form are known to the person skilled in the art and, for example, also in common standard works (see e.g. Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). The expression vectors according to the invention can be on a plasmid, cosmid, Virus, bacteriophages or another vector common in genetic engineering. These vectors can have further functional units that stabilize the Cause vector in the host organism. Furthermore, when using a plant as Host organism "left border" and "right border" sequences of agrobacterial T-DNA be included, which enables stable integration into the genome of plants. Furthermore, a termination sequence can be present which enables the correct termination of the Transcription and the addition of a poly-A sequence to the transcript is used. Such Elements are described in the literature (cf. Gielen et al., EMBO J. 8 (1989), 23-29) and interchangeable.

Die mit dem gewünschten Protein zu fusionierende Signalsequenz richtet sich nach dem Zellkompartiment, in das der Transport des Proteins erfolgen soll. Geeignete Signalsequenzen (Signalpeptide) und für diese kodierenden DNA-Sequenzen sowie Verfahren zur Verknüpfung mit dem gewünschten Protein, z. B. einem scFv-Antikörper, auf eine solche Weise, daß sowohl das Protein noch aktiv ist als auch der Transport in das gewünschte Zellkompartiment erfolgt, sind dem Fachmann bekannt. Beispielsweise wird auf das Signalpeptid der α-Amylase aus Gerste hinsichtlich des Apoplasten (Düring et al., Plant Journal 3 (1993), 587-598), auf die Kombination aus Maus-Signalpeptid und KDEL-ER- Retentionssignal hinsichtlich des ER (Artsaenko et al., supra), auf das Targetting einer Säuger-α-2,6-Sialyltransferase hinsichtlich des Golgi-Apparats (Wee et al., Plant Cell IV (1998), 1759-1768, auf das Vakuolen-Lokalisierungssignal einer vakuolären Chitinase aus Gurke hinsichtlich der Vakuolen (Neuhaus et al., Proc. Natl. Acad. Sci. USA 88 (1991), 10362-10366), auf das Ferredoxin-Transitpeptid hinsichtlich der Chloroplasten und Plastiden, und auf das Transitpeptid von Tryptophanyl-t RNA-Snthetase aus Hefe hinsichtlich der Mitochondrien (Schmitz and Lonsdale, Plant Cell 1 (1989), 783-791) verwiesen.The signal sequence to be fused with the desired protein depends on the Cell compartment into which the protein is to be transported. Suitable Signal sequences (signal peptides) and for these coding DNA sequences as well Methods of linking to the desired protein, e.g. B. an scFv antibody such a way that both the protein is still active and the transport into it  desired cell compartment takes place, are known to the person skilled in the art. For example, on the signal peptide of the α-amylase from barley with regard to the apoplast (Düring et al., Plant Journal 3 (1993), 587-598), on the combination of mouse signal peptide and KDEL-ER Retention signal regarding the ER (Artsaenko et al., Supra), on the targeting of a Mammalian α-2,6-sialyltransferase with respect to the Golgi apparatus (Wee et al., Plant Cell IV (1998), 1759-1768, on the vacuole localization signal of a vacuolar chitinase Cucumber for vacuoles (Neuhaus et al., Proc. Natl. Acad. Sci. USA 88 (1991), 10362-10366), on the ferredoxin transit peptide for chloroplasts and Plastids, and on the transit peptide of tryptophanyl-t RNA snthetase from yeast with regard to mitochondria (Schmitz and Lonsdale, Plant Cell 1 (1989), 783-791) referred.

Für die Expression des für das gewünschte Protein kodierenden Gens geeignete Promotoren sind dem Fachmann bekannt und dazu zählen beispielsweise bei der Verwendung einer Pflanze als Wirtsorganismus der Cauliflower Mosaic Virus 35S Promotor (Odell et al., Nature 313 (1995), 810-812) der Agrobacterium tumefaciens Nopalin Synthase Promotor und der Mannopin Synthase Promotor (Harpster et al., Molecular and General Genetics 212 (1988), 182-190). Das für das gewünschte Protein kodierende Gen kann auch mit einem induzierbaren Promotor verknüpft sein, was z. B. die Steuerung der Synthese des gewünschten Proteins z. B. in einer transgenen Pflanze, zu einem gewünschten Zeitpunkt erlaubt, wie bei der nachstehend beschriebenen Nach-Ernte- Produktionstechnologie. Geeignete Promotoren sind dem Fachmann bekannt und dazu zählen beispielsweise der anaerob induzierbare Gap C4 Promotor aus Mais (Bülow et al., Molecular Plant-Microbe Interactions 12 (1999), 182-188), PR-Promotoren, wie L- Phenylalanin Ammonium Lyase-, Chalcon Synthase- und "Hydroxyproline rich glycoprotein"- Promotoren induzierbar durch Ethylen (Ecker and Davies, Proc. Natl. Acad. Sci. USA 84 (1987), 5202-5210) und durch Dexamethason induzierbares chimäres Transkriptions- Induktionssystem (Kunkel et al., Nature Biotechnology 17 (1990), 916-918), IncW- Promotor aus Mais, induzierbar durch Sucrose oder D-Glucose (Chen et al., Proc. Natl. Acad. Sci. USA 96 (1999), 10512-10517. Ergänzend wird auf Datla et al., Biotechnology Annual Review 3 (1997), 269-290 und Gatz and Denk, Trends in Plant Science 3 (1998), 352-358 verwiesen.Suitable for the expression of the gene coding for the desired protein Promoters are known to the person skilled in the art and include, for example, the Use of a plant as the host organism of the Cauliflower Mosaic Virus 35S promoter (Odell et al., Nature 313 (1995), 810-812) of Agrobacterium tumefaciens nopalin Synthase promoter and the mannopine synthase promoter (Harpster et al., Molecular and General Genetics 212 (1988), 182-190). The gene coding for the desired protein can also be linked to an inducible promoter, which z. B. the control of Synthesis of the desired protein e.g. B. in a transgenic plant desired time, as with the post-harvest Production technology. Suitable promoters are known to the person skilled in the art and for this purpose include, for example, the anaerobically inducible Gap C4 promoter from maize (Bülow et al., Molecular Plant-Microbe Interactions 12 (1999), 182-188), PR promoters, such as L- Phenylalanine ammonium lyase, chalcon synthase and "hydroxyproline rich glycoprotein" - Promoters inducible by ethylene (Ecker and Davies, Proc. Natl. Acad. Sci. USA 84 (1987), 5202-5210) and chimeric transcription inducible by dexamethasone Induction system (Kunkel et al., Nature Biotechnology 17 (1990), 916-918), IncW- Maize promoter inducible by sucrose or D-glucose (Chen et al., Proc. Natl. Acad. Sci. USA 96: 10512-10517 (1999). In addition, Datla et al., Biotechnology Annual Review 3 (1997), 269-290 and Gatz and Denk, Trends in Plant Science 3 (1998), 352-358.

Zur Herstellung der Expressionsvektoren zur Einführung in Wirtsorganismen, z. B. Pflanzen, stehen eine große Anzahl von Klonierungsvektoren zur Verfügung, die ein Replikationssignal für E. coli und ein Markergen zur Selektion transformierter Bakterienzellen enthalten. Beispiele für derartige Vektoren sind pBR322, pUC-Serien, M13mp-Serien, pACYC184, etc.. Die gewünschte Sequenz kann an einer passenden Restriktionsschnittstelle in den Vektor eingeführt werden. Der erhaltene Vektor wird für die Transformation von E. coli-Zellen verwendet. Transformierte E. coli-Zellen werden in einem geeigneten Medium gezüchtet, anschließend geerntet und lysiert. Der Vektor wird dann wiedergewonnen. Als Analysemethode zur Charakterisierung der gewonnenen Vektor-DNA werden im allgemeinen Restriktionsanalysen, Gelelektrophoresen und weitere biochemisch­ molekularbiologische Methoden eingesetzt. Nach jeder Manipulation kann die Vektor-DNA gespalten und gewonnene DNA-Fragmente können mit anderen DNA-Sequenzen verknüpft werden. Jede Vektor-DNA-Sequenz kann in den gleichen oder anderen Vektoren kloniert werden.To produce the expression vectors for introduction into host organisms, e.g. B. plants, a large number of cloning vectors are available, the one Replication signal for E. coli and a marker gene for the selection of transformed bacterial cells contain. Examples of such vectors are pBR322, pUC series, M13mp series,  pACYC184, etc. The desired sequence can be on a suitable Restriction interface to be introduced into the vector. The vector obtained is used for the Transformation of E. coli cells used. Transformed E. coli cells are in one grown in a suitable medium, then harvested and lysed. The vector will then recovered. As an analysis method to characterize the vector DNA obtained are generally restriction analyzes, gel electrophoresis and other biochemical molecular biological methods used. After each manipulation, the vector DNA cleaved and DNA fragments obtained can be linked to other DNA sequences become. Each vector DNA sequence can be cloned in the same or different vectors become.

Für die Einführung der vorstehenden Expressionsvektoren in eine Pflanzzelle stehen eine Vielzahl von Techniken zur Verfügung. Diese Techniken umfassen die Transformation von Pflanzenzellen mit T-DNA unter Verwendung von Agrobacterium tumefaciens oder Agrobacterium rhizogenes als Transformationsmittel, die Fusion von Protoplasten, die Injektion, die Elektroporation von DNA, die Einbringung von DNA mittels der biolistischen Methode sowie weitere Möglichkeiten.One stands for the introduction of the above expression vectors into a plant cell Variety of techniques available. These techniques include transforming Plant cells with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as a transformation agent, the fusion of protoplasts, the Injection, the electroporation of DNA, the introduction of DNA using the biolistic Method as well as other possibilities.

Bei der Injektion und Elektroporation von DNA in Pflanzenzellen werden an sich keine speziellen Anforderungen an die verwendeten Vektoren gestellt. Es können einfache Plasmide, wie z. B. pUC-Derivate, verwendet werden. Sollen aber aus derartig transformierten Zellen ganze Pflanzen regeneriert werden, sollte ein selektierbarer Marker vorhanden sein. Geeignete selektierbare Marker sind dem Fachmann bekannt und dazu zählen beispielsweise das Neomycinphosphotransferase II-Gen aus E. coli (Beck et al., Gene 19 (1982), 327-336), das Sulfonamid-Resistenzgen (EP-369637) und das Hygromycin-Resistenzgen (EP-186425). Je nach Einführungsmethode für die gewünschten Gene in die Pflanzenzelle können weitere DNA-Sequenzen erforderlich sein. Wird z. B. für die Transformation der Pflanzenzelle das Ti- oder Ri-Plasmid verwendet, so muß mindestens die rechte Begrenzung, häufig jedoch müssen die rechte und linke Begrenzung der Ti- und Ri-Plasmid T-DNA als Flankenbereich mit den einzuführenden Genen verbunden werden.When injecting and electroporating DNA into plant cells, none of them special requirements for the vectors used. It can be simple Plasmids such as B. pUC derivatives can be used. But from such transformed cells whole plants should be regenerated, a selectable marker to be available. Suitable selectable markers are known to the person skilled in the art and for this purpose include, for example, the neomycin phosphotransferase II gene from E. coli (Beck et al., Gene 19 (1982), 327-336), the sulfonamide resistance gene (EP-369637) and that Hygromycin resistance gene (EP-186425). Depending on the implementation method for the desired Genes in the plant cell may require additional DNA sequences. Is z. B. for the transformation of the plant cell using the Ti or Ri plasmid must at least the right boundary, but often the right and left boundary the Ti and Ri plasmid T-DNA as a flank region with the genes to be introduced get connected.

Werden für die Transformation Agrobakterien verwendet, muß die einzuführende DNA in spezielle Vektoren kloniert werden, und zwar entweder in einen intermediären Vektor oder in einen binären Vektor (vgl. dazu auch die nachstehenden Beispiele 1 bis 3). Die intermediären Vektoren können aufgrund von Sequenzen, die homolog zu Sequenzen in der T-DNA sind, durch homologe Rekombination in das Ti- oder Ri-Plasmid der Agrobak­ terien integriert werden. Dieses enthält außerdem die für den Transfer der T-DNA notwendige vir-Region. Intermediäre Vektoren können nicht in Agrobakterien replizieren. Mittels eines Helferplasmids kann der intermediäre Vektor auf Agrobacterium tumefaciens übertragen werden. Binäre Vektoren können sowohl in E. coli als auch in Agrobakterien replizieren. Sie enthalten ein Selektionsmarker-Gen und einen Linker oder Polylinker, welche von der rechten und linken T-DNA Grenzregion eingerahmt werden. Sie können direkt in die Agrobakterien transformiert werden. Das als Wirtszelle dienende Agrobakterium sollte ein Plasmid, das eine vir-Region trägt, enthalten. Die vir-Region ist für den Transfer der T-DNA in die Pflanzenzelle notwendig. Zusätzliche T-DNA kann vorhanden sein. Das derartig transformierte Agrobakterium wird zur Transformation von Pflanzenzellen verwendet.If Agrobacteria are used for the transformation, the DNA to be introduced must be in special vectors are cloned, either in an intermediate vector or into a binary vector (see also Examples 1 to 3 below). The intermediate vectors can be due to sequences that are homologous to sequences in  of the T-DNA are, by homologous recombination in the Ti or Ri plasmid, the Agrobak teries are integrated. This also contains those for the transfer of T-DNA necessary vir region. Intermediate vectors cannot replicate in agrobacteria. Using a helper plasmid, the intermediate vector can be on Agrobacterium tumefaciens be transmitted. Binary vectors can be found in E. coli as well as in Agrobacteria replicate. They contain a selection marker gene and a linker or polylinker, which are framed by the right and left T-DNA border regions. You can can be transformed directly into the agrobacteria. The Agrobacterium serving as the host cell should contain a plasmid bearing a vir region. The vir region is for the transfer the T-DNA into the plant cell. Additional T-DNA may be present. The Agrobacterium transformed in this way becomes the transformation of plant cells used.

Für den Transfer der DNA in die Pflanzenzelle können Pflanzen-Explantate zweckmäßigerweise mit Agrobacterium tumefaciens oder Agrobacterium rhizogenes cokultiviert werden. Aus dem infizierten Pflanzenmaterial (z. B. Blattstücke, Stengelsegmen­ te, Wurzeln, aber auch Protoplasten oder Suspensions-kultivierte Pflanzenzellen) können dann in einem geeigneten Medium, welches Antibiotika oder Biozide zur Selektion transformierter Zellen enthalten kann, wieder ganze Pflanzen regeneriert werden. Die so erhaltenen Pflanzen können dann auf Anwesenheit der eingeführten DNA untersucht werden. Alternative Systeme zur Transformation von monokotylen Pflanzen sind die Transformation mittels des biolistischen Ansatzes, die elektrisch oder chemisch induzierte DNA-Aufnahme in Protoplasten, die Elektroporation von partiell permeabilisierten Zellen, die Makroinjektion von DNA in Blütenstände, die Mikroinjektion von DNA in Mikrosporen und Pro-Embryonen, die DNA-Aufnahme durch keimende Pollen und die DNA-Aufnahme in Embryonen durch Quellung (zur Übersicht: Potrykus, Physiol. Plant (1990), 269-273). Während die Transformation dikotyler Pflanzen über Ti-Plasmid-Vektorsysteme mit Hilfe von Agrobacterium tumefaciens wohl etabliert ist, weisen neuere Arbeiten darauf hin, daß auch monokotyle Pflanzen der Transformation mittels auf Agrobacterium basierender Vektoren sehr wohl zugänglich sind.Plant explants can be used to transfer the DNA into the plant cell expediently with Agrobacterium tumefaciens or Agrobacterium rhizogenes be co-cultivated. From the infected plant material (e.g. leaf pieces, stem segments te, roots, but also protoplasts or suspension-cultivated plant cells) then in a suitable medium, which antibiotics or biocides for selection can contain transformed cells, whole plants can be regenerated again. The so Plants obtained can then be examined for the presence of the introduced DNA become. Alternative systems for the transformation of monocotyledonous plants are Transformation using the biolistic approach, which was electrically or chemically induced DNA uptake in protoplasts, the electroporation of partially permeabilized cells that Macroinjection of DNA into inflorescences, microinjection of DNA into microspores and Pro-embryos, the DNA uptake by germinating pollen and the DNA uptake in Embryos by swelling (for an overview: Potrykus, Physiol. Plant (1990), 269-273). During the transformation of dicotyledonous plants using Ti plasmid vector systems of Agrobacterium tumefaciens is well established, recent work suggests that also monocot plants of transformation using Agrobacterium based Vectors are very accessible.

Bei der Anwendung der erfindungsgemäßen Expressionsvektoren/Zusammensetzungen (Kombinationen) ist zu beachten, daß bei der Produktion therapeutischer Proteine die Homogenität des produzierten Proteins nicht beeinträchtigt wird und nur solche subzellulären Kompartimente miteinander gekoppelt werden, die keine Beeinträchtigung der Qualität des produzierten Proteins herbeiführen. Andererseits ist bei diagnostischen Proteinen oder Proteinwerkstoffen hierhin a priori keine Beeinträchtigung gegeben, so daß sich das erfindungsgemäße Verfahren bzw. die erfindungsgemäßen Expressionsvektoren insbesondere für derartige Proteine mit niedrigeren wirtschaftlichen Gewinnspannen eignen, weil hierbei die Expressionsraten einen wesentlich höheren Einfluß auf die wirtschaftliche Realisierbarkeit haben als bei therapeutischen Proteinen. Dem Problem eines potentiellen "gene silencing" bei Vorhandensein mehrerer gleicher Gene, z. B. in einer transgenen Pflanzenzelle/einer transgenen Pflanze, kann der Fachmann dadurch entgegengewirken, daß z. B. bei mehreren Kern-kodierten Fremdgenen für dasselbe Protein der Einsatz der möglichen unterschiedlichen Codons für eine Aminosäure unter Berücksichtigung der in einem bestimmten Organismus bevorzugten Codons eine unterschiedliche Nucleinsäuresequenz für die verschiedenen Gene z. B. in Form synthetisch hergestellter Gene benutzt wird.When using the expression vectors / compositions according to the invention (Combinations) it should be noted that in the production of therapeutic proteins the Homogeneity of the protein produced is not affected and only such Subcellular compartments are coupled with each other that do not affect the  To bring about the quality of the protein produced. On the other hand, diagnostic Proteins or protein materials are not impaired a priori, so that the method according to the invention or the expression vectors according to the invention particularly suitable for such proteins with lower economic margins, because here the expression rates have a much higher influence on the economic Feasibility than with therapeutic proteins. The problem of a potential "Gene silencing" when several identical genes are present, e.g. B. in a transgenic Plant cell / a transgenic plant, the expert can counteract this by that z. B. in the case of several core-coded foreign genes for the same protein, the use of possible different codons for an amino acid taking into account the in a particular codon preferred a different codon Nucleic acid sequence for the various genes e.g. B. in the form of synthetically produced Gene is used.

In einer bevorzugten Ausführungsform enthalten die erfindungsgemäßen Expressionsvektoren bzw. die diese umfassenden Zusammensetzungen (Kombinationen) Lokalisierungssignale für die Lokalisierung im endoplasmatischen Retikulum (ER), im Apoplasten, im Golgi-Apparat, in Plastiden, in Peroxisomen, in Mitochondrien und/oder in Vakuolen. Es wird auf vorstehende Ausführungen hinsichtlich Signalsequenzen (Signalpeptide) verwiesen. Besonders bevorzugt sind als Lokalisierungssignale das KDEL- ER-Targeting-Peptid, das Golgi-Lokalisierungssignal der β-1,2-N- Acetylglucosamintransferase (GnTI), die kleine Untereinheit der Ribulose-Biphosphat- Carboxylase und/oder das vakuoläre Targeting-Signal SKNPIN.In a preferred embodiment, the inventive Expression vectors or the compositions (combinations) comprising them Localization signals for localization in the endoplasmic reticulum (ER), in Apoplasts, in the Golgi apparatus, in plastids, in peroxisomes, in mitochondria and / or in Vacuoles. It will refer to the above statements regarding signal sequences (Signal peptides). The KDEL- ER targeting peptide, the Golgi localization signal of the β-1,2-N- Acetylglucosamine transferase (GnTI), the small subunit of ribulose biphosphate Carboxylase and / or the vacuolar targeting signal SKNPIN.

Bei den in dem erfindungsgemäßen Verfahren nützlichen Eukaryoten handelt es sich vorzugsweise um Pflanzen. Dabei kann es sich prinzipiell um Pflanzen jeder beliebigen Pflanzenspezies handeln, d. h. sowohl monokotyle als auch dikotyle Pflanzen. Der hier verwendete Begriff "Pflanze" umfaßt auch Pilze, Moose und Algen. Bevorzugt handelt es sich um Nutzpflanzen, z. B. um Pflanzen wie Weizen, Gerste, Reis, Mais, Zuckerrübe, Zuckerrohr, Brassicaceen, Leguminosen, Tabak oder Kartoffel. Besonders bevorzugt als transgene Pflanzen sind Brassicaceen, Leguminosen und Kartoffel. Die für die Expression des gewünschten Proteins gewünschten Pflanzenteile betreffen im Prinzip jedes beliebige Pflanzenteil, jedenfalls Vermehrungsmaterial und Ernteprodukte dieser Pflanzen, beispielsweise Früchte, Samen, Knollen, Wurzelstöcke, Sämlinge, Stecklinge etc. Ferner betrifft die vorliegende Erfindung auch Pflanzensamen, eine Pflanzenzelle oder eine Pflanze, die einen erfindungsgemäßen Expressionsvektor oder eine erfindungsgemäße Zusammensetzung enthält.The eukaryotes useful in the method according to the invention are preferably around plants. In principle, it can be any plant Act plant species, d. H. both monocot and dicot plants. This here The term "plant" used also includes fungi, mosses and algae. It is preferred are useful plants, e.g. B. plants such as wheat, barley, rice, corn, sugar beet, Sugar cane, brassica, legumes, tobacco or potato. Particularly preferred as Transgenic plants are brassicaceae, legumes and potatoes. The one for expression The desired protein parts of the desired protein basically affect any one Part of the plant, in any case propagation material and harvest products of these plants, for example fruits, seeds, tubers, rhizomes, seedlings, cuttings etc.  Furthermore, the present invention also relates to plant seeds, a plant cell or a Plant which has an expression vector according to the invention or one according to the invention Contains composition.

Schließlich betrifft die vorliegende Erfindung ein Verfahren zur Steigerung der Produktionsrate eines gewünschten Proteins in einem Wirt, vorzugsweise einer Pflanze, das dadurch gekennzeichnet ist, daß zur simultanen Expression des für das gewünschte Protein kodierenden Gens in verschiedenen Kompartimenten des Wirts und/oder zum simultanen Transport des gewünschten Proteins in verschiedene Kompartimente des Wirts der Wirt mit dem erfindungsgemäßen Expressionsvektor und/oder der erfindungsgemäßen Zusammensetzung transformiert und das gewünschte Protein aus dem Wirt gewonnen wird. Geeignete Verfahren zur Gewinnung des Proteins und der am besten geeigneten Pflanzenteile in Abhängigkeit von der Lokalisierung des Proteins sind dem Fachmann bekannt und z. B. auch in den nachstehenden Beispielen 1 bis 3 beschrieben.Finally, the present invention relates to a method for increasing the Production rate of a desired protein in a host, preferably a plant, which is characterized in that for the simultaneous expression of the for the desired Protein encoding gene in different compartments of the host and / or simultaneous transport of the desired protein into different compartments of the host the host with the expression vector according to the invention and / or the one according to the invention The composition is transformed and the desired protein is obtained from the host. Suitable methods for obtaining the protein and the most suitable ones Plant parts depending on the location of the protein are known to the person skilled in the art known and z. B. also described in Examples 1 to 3 below.

Die vorliegende Erfindung zeichnet sich dadurch aus, daß in einem Wirt, insbesondere einer Pflanze, eine hohe Expressionsrate eines gewünschten Proteins erreicht werden kann, ohne daß es zu physiologischen Störungen im Zellhaushalt und damit im Wachstum und der Lebensfähigkeit des Wirts kommt. Dies wird durch die Verwendung der vorstehenden Expressionsvektoren bzw. Zusammensetzungen (Kombinationen) erreicht, vor allem aber auch durch die Kombination der vorliegenden Erfindung hinsichtlich der multiplen subzellulären Lokalisation des gewünschten Proteins beispielsweise mit der Nach-Ernte-Produktionstechnologie (vgl. dazu das nachstehende Beispiel 3), bei der die Expression des für das gewünschte Protein kodierenden Gens erst nach Ernte der Pflanze bzw. bestimmter Pflanzenteile erfolgt. Bei dieser durch den Anmelder entwickelten Technologie erfolgt die Induktion der Expression, beispielsweise die Induktion des zu aktivierenden Promotors, über chemische Stimuli (z. B. Veränderung der Zusammensetzung der umgebenden Gasphase, vorzugsweise anaerobe Induktion, Vernebelung von Lösungen fester induzierender (Bio-)chemikalien oder Verwendung flüchtiger Substanzen und deren gleichmäßige Verteilung im Reaktionsraum) oder Aufhebung der funktionellen Inhibition der Transkription des betreffenden Fremdgens im transgenen Wirtsorganismus (z. B. durch Insertion von transkriptionsinhibierenden Sequenzen zwischen Promotor und zu exprimierendem Gen, welche extern steuerbar entfernt oder inaktiviert werden können). Diese Vorgehensweise ist vor allem im Hinblick auf transgene Pflanzen von Interesse, die hierfür ein hervorragend geeignetes Bioreaktor-System darstellen, vor allem da der großflächige Anbau von Kulturpflanzen und die großtechnische Verarbeitung großer Pflanzenmengen, z. B. für die Öl - und Stärkegewinnung, etabliert sind. Solches, unter Einbezug der Nach-Ernte-Produktions-Technologie beispielsweise für die Produktion hochwertiger Proteine oder anderer (bio-)chemischer Substanzen in großem Maßstab eröffnet neue (bio)medizinische und technologische Anwendungsgebiete. Außerdem kann bei dieser Vorgehensweise das Pflanzengewebe, beispielsweise beim Einsatz eines gasförmigen Induktionsstimulus, intakt und unzerstört bleiben, da es nicht zerkleinert werden muß. Ferner kommt es zu einer sehr gleichmäßigen und schnellen Verteilung des Induktionsstimulus um das Gewebe herum, wie auch zwischen den Zeilen im Zellverband.The present invention is characterized in that in a host, in particular a plant, a high expression rate of a desired protein can be achieved can, without causing physiological disturbances in the cell household and thus in growth and the viability of the host comes. This is done by using the above expression vectors or compositions (combinations) achieved, but above all by the combination of the present invention in terms of multiple subcellular localization of the desired protein, for example with the Post-harvest production technology (see Example 3 below) in which the Expression of the gene coding for the desired protein only after harvesting the plant or certain parts of plants. In this developed by the applicant Technology is the induction of expression, for example the induction of the activating promoter, via chemical stimuli (e.g. change in composition the surrounding gas phase, preferably anaerobic induction, nebulization of solutions solid inducing (bio) chemicals or use of volatile substances and their uniform distribution in the reaction space) or removal of the functional inhibition of the Transcription of the foreign gene in question in the transgenic host organism (e.g. by Insertion of transcription-inhibiting sequences between the promoter and expressing gene, which can be removed or deactivated in an externally controllable manner). This approach is of particular interest with regard to transgenic plants that represent an excellently suitable bioreactor system, especially since the large-scale cultivation of crops and large-scale processing of large  Plant quantities, e.g. B. for oil and starch production, are established. Such, under Inclusion of post-harvest production technology, for example for production high-quality proteins or other (bio-) chemical substances on a large scale opens up new (bio) medical and technological fields of application. Besides, can with this procedure the plant tissue, for example when using a gaseous induction stimulus, remain intact and undamaged since it is not crushed must become. Furthermore, there is a very even and rapid distribution of the Induction stimulus around the tissue, as well as between the rows in the cell structure.

Somit ist eine bevorzugte Ausführungsform des erfindungsgemäßen Verfahrens dadurch gekennzeichnet, daß die Expression des für das gewünschte Protein kodierenden Gens erst nach der Ernte des Wirts erfolgt, wobei das für das gewünschte Protein kodierende Gen so auf den Expressionsvektoren inseriert ist, daß dessen Expression erst in Anwesenheit einer induzierenden Verbindung (Induktor) erfolgt und das Inkontaktbringen mit dem Induktor nach der Ernte des Wirts erfolgt. Geeignete Vorgehensweisen sind dem Fachmann bekannt. Der Induktor kann z. B. über die Veränderung der den Wirtsorganismus umgebenden Gasphase, eine Vernebelung einer Lösung eines Induktors oder ein aktives Überströmen mit einem flüchtigen Induktor erfolgen. Bei der Veränderung der Gasphase kann es sich z. B. um einen Sauerstoffentzug handeln, wobei dann für die Expression ein unter anaeroben Bedingungen aktiver Promotor verwendet wird, z. B. der GapC4-Promotor aus Mais (Bülow et al., supra). Die Induktion der Expression des für das gewünschte Protein kodierenden Gens kann auch durch Aufhebung der funktionellen Hemmung der Transkription und/oder Translation erfolgen, beispielsweise dadurch, daß bei den erfindungsgemäßen Expressionsvektoren zwischen dem Promotor und dem Gen eine Nucleinsäure inseriert ist, die dadurch gekennzeichnet ist, daß sie die Transkription und/oder Translation des Gens verhindert und nach Induktion exzisiert werden kann, was zur Expression des Gens führt. Diese Nucleinsäure kann z. B. eine durch eine induzierbare Rekombinase exzisierbare Nucleinsäure sein. Die exzisierbare Nucleinsäure und die Rekombinase können Bestandteile des Rekombinase-LBD-Systems (WO 95100555) sein.This is a preferred embodiment of the method according to the invention characterized in that the expression of the gene coding for the desired protein takes place only after the host has been harvested, the coding for the desired protein Gene is so inserted on the expression vectors that its expression only in Presence of an inducing compound (inductor) takes place and the contacting with the inductor after harvesting the host. Appropriate procedures are the Known specialist. The inductor can e.g. B. about the change of the host organism surrounding gas phase, nebulizing a solution of an inductor or an active Overflow with a volatile inductor. When changing the gas phase can it be z. B. is an oxygen deprivation, then a for expression promoter used under anaerobic conditions, e.g. B. the GapC4 promoter from maize (Bülow et al., supra). Induction of expression for the desired protein coding gene can also be done by removing the functional inhibition of the Transcription and / or translation take place, for example, in that the Expression vectors according to the invention between the promoter and the gene one Nucleic acid is inserted, which is characterized in that it is the transcription and / or translation of the gene is prevented and what can be excised after induction leads to expression of the gene. This nucleic acid can e.g. B. one by an inducible Recombinase excisable nucleic acid. The excisable nucleic acid and the Recombinase can be part of the recombinase LBD system (WO 95100555).

Die folgenden Beispiele erläutern die Erfindung.The following examples illustrate the invention.

Beispiel 1example 1 Produktion von scFv(ox)-Antikörpern im ER, im Apoplasten, im Golgi-Apparat und in Plastiden von transgenen KartoffelknollenProduction of scFv (ox) antibodies in the ER, in the apoplast, in Golgi apparatus and in plastids from transgenic potato tubers

Die in Artsaenko et al. (supra) beschriebene cDNA, die für einen im endoplasmatischen Retikulum (ER) lokalisierten scFv(ox)-Antikörper mit KDEL-ER-Targetting-Sequenz kodiert, wird mittels einer Linker-Ligation (am 5'-Ende mit CATGCCATGGCATG [5'- phosphoryliertes Oligonucleotid]), am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid] derart modifiziert, daß sie am 5'-Ende eine NcoI-Restriktionsschnittstelle und am 3'-Ende eine XbaI-Restriktionsschnittstelle aufweist. Nach Verdau des Plasmids pRT 100 (Töpfer et el. (1987) Nucleic Acids Research 15, 5890) mit NcoI und XbaI wird das scFv-kodierende DNA-Fragment in diesen Expressionsvektor inseriert. Es wird das Plasmid pRT 100/scFv(ox)ER erhalten. Nach Spaltung mit HindIII wird die Expressionskassette 35S-scfv(ox)ER Isoliert.The artsaenko et al. (supra) cDNA described for an endoplasmic Reticulum (ER) localized scFv (ox) antibody encoded with KDEL-ER targeting sequence,  is by means of a linker ligation (at the 5'-end with CATGCCATGGCATG [5'- phosphorylated oligonucleotide]), at the 3'-end with GCTCTAGAGC [5'-phosphorylated Oligonucleotide] modified such that they have an NcoI restriction site and has an XbaI restriction site at the 3 'end. After digesting the plasmid pRT 100 (Töpfer et el. (1987) Nucleic Acids Research 15, 5890) with NcoI and XbaI will DNA fragment encoding scFv is inserted into this expression vector. It becomes the plasmid pRT 100 / scFv (ox) ER obtained. After cleavage with HindIII, the expression cassette 35S-scfv (ox) ER Isolated.

In einer weiteren Klonierung wird die cDNA für den scFv(ox)-Antikörper ohne die kodierende Sequenz für das KDEL-ER-Targetting-Signal (Artsaenlko et al., (supra)) mittels einer Linker- Ligation (am 5'-Ende mit CATGCCATGGCATG [5'-phosphoryliertes Oligonucleotid]; am 3'- Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5'-Ende eine NcoI-Restriktionsschnittstelle und am 3'-Ende eine XbaI-Restriktionsschnittstelle aufweist. Nach Verdau des Plasmids pRT 100 mit NcoI und XbaI wird das scFv-kodierende DNA-Fragment in diesen Expressionsvektor inseriert. Es wird das Plasmid pRT 100/scFv(ox)AP erhalten. Nach Spaltung mit HindIII wird die Expressionskassette 35S-scFv(ox)AP isoliert.In a further cloning, the cDNA for the scFv (ox) antibody without the coding Sequence for the KDEL-ER targeting signal (Artsaenlko et al., (Supra)) using a linker Ligation (at the 5'-end with CATGCCATGGCATG [5'-phosphorylated oligonucleotide]; at the 3'- End modified with GCTCTAGAGC [5'-phosphorylated oligonucleotide]) in such a way that it am An NcoI restriction site at the 5 'end and one at the 3' end XbaI restriction site. After digesting the plasmid pRT 100 with NcoI and XbaI the scFv-encoding DNA fragment is inserted into this expression vector. It the plasmid pRT 100 / scFv (ox) AP is obtained. After cleavage with HindIII, the Expression cassette 35S-scFv (ox) AP isolated.

Für die Lokalisierung des scFv(ox)-Antikörpers im Golgi-Apparat wird das Signalpeptid in Plasmid pRT 100/scFv(ox)AP durch das Golgi-Lokalisierunggssignal der β-1,2-N- Acetylglucosaminyltransferase (GnTI) aus Kaninchen (Burke et el., J. BioLChem. 267 (1992), 24433-24440) ersetzt. Dazu wird mittels einer PCR-Reaktion die dafür kodierende DNA-Sequenz so modifiziert, daß sie am 5'-Ende eine NcoI-Schnittstelle und am 3'-Ende die GTCGAC-Sequenz aufweist, für die eine SaII-Schnittstelle codiert. Für die PCR- Reaktion wird das folgende Primerpaar verwendet:
5'-GnTI-Primer: CCATGGATGCTGAAGAAGCAGTCTGCTGG
3'-GnTI-Primer: GTCGACACGTGTCCAGAAGAAGAGGAGGAGFor the localization of the scFv (ox) antibody in the Golgi apparatus, the signal peptide in plasmid pRT 100 / scFv (ox) AP is determined by the Golgi localization signal of the β-1,2-N-acetylglucosaminyltransferase (GnTI) from rabbits (Burke et el., J. BioLChem. 267 (1992), 24433-24440). For this purpose, the DNA sequence coding therefor is modified by means of a PCR reaction in such a way that it has an NcoI interface at the 5 'end and the GTCGAC sequence for which a SaII interface codes at the 3' end. The following primer pair is used for the PCR reaction:
5'-GnTI primer: CCATGGATGCTGAAGAAGCAGTCTGCTGG
3'-GnTI primer: GTCGACACGTGTCCAGAAGAAGAGGAGGAG

Die cDNA für den reifen scFv(ox)-Antikörper wird mittels einer Linker-Ligation (am 5'-Ende mit CCGTCGACAT [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5'-Ende eine SaII-Schnittstelle und am 3'-Ende eine XbaI-Restriktionsschnittstellle aufweist. Beide cDNA-Fragmente werden mit NcoI + SaII bzvv. SaII + XbaI verdaut, so daß überhängende Enden entstehen. Die erhaltenen cDNA-Fragmente werden gleichzeitig in den mit NcoI und XbaI geöffneten Vektor pRT 100 inseriert. Es wird das Plasmid pRT 100/scFv(ox)GO erhalten. Nach Spaltung mit HindIII wird die Expressionskassette 35S-scFv(ox)GO isoliert.The cDNA for the mature scFv (ox) antibody is by means of a linker ligation (at the 5 'end with CCGTCGACAT [5'-phosphorylated oligonucleotide] and at the 3'-end with GCTCTAGAGC [5'-phosphorylated oligonucleotide]) modified such that it has a 5'-end SaII site and at the 3 'end has an XbaI restriction site. Both cDNA fragments are labeled with NcoI + SaII and / or. SaII + XbaI digested so that overhanging  Ends arise. The cDNA fragments obtained are simultaneously in the with NcoI and XbaI open vector pRT 100 inserted. It becomes the plasmid pRT 100 / scFv (ox) GO receive. After cleavage with HindIII, the expression cassette 35S-scFv (ox) GO is isolated.

Für den Transport des cytoplasmatisch synthetisierten scFv(ox)-Antikörpers in Chloroplasten wird eine für ein Transitpeptid-scFv(ox) kodierendes cDNA-Fragment erzeugt. Dazu wird die cDNA für das Transitpeptid aus dem für die kleine Untereinheit der Ribulose- Bisphosphat-Carboxylase kodierenden Gens (Anderson et al., Biochemical Journal 240 (1986), 709-715) mittels einer PCR-Peaktion so modifiziert, daß am 5'-Ende eine NcoI-Schnittstelle und am 3'-Ende die GTCGAC-Sequenz, die für eine SaII-Schnittstelle kodiert, eingefügt werden. Dafür wird das folgende Primerpaar verwendet:
5'-rbcI Primer: CCATGGCTTCTATGATATCCTCTTCAG
3'-rbcI Primer: GTCGACGCACTTTACTCTTCCACCATTGCFor the transport of the cytoplasmic synthesized scFv (ox) antibody in chloroplasts, a cDNA fragment coding for a transit peptide scFv (ox) is generated. For this purpose, the cDNA for the transit peptide from the gene coding for the small subunit of ribulose bisphosphate carboxylase (Anderson et al., Biochemical Journal 240 (1986), 709-715) is modified by means of a PCR reaction in such a way that on 5 ' -End an NcoI interface and at the 3 'end the GTCGAC sequence, which codes for a SaII interface, are inserted. The following primer pair is used for this:
5'-rbcI primer: CCATGGCTTCTATGATATCCTCTTCAG
3'-rbcI primer: GTCGACGCACTTTACTCTTCCACCATTGC

Die cDNA für den reifen scFv(ox)-Antikörper wird mittels einer Linker-Ligation am 5'-Ende mit CCGTCGACAT [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5' Ende eine SaII-Schnittstelle und am 3'-Ende eine XbaI-Restriktionsschnittstelle aufweist. Beide cDNA-Fragmente werden mit NcoI + SaII bzw. SaII + XbaI verdaut, so daß überhängende Enden entstehen. Die erhaltenen cDNA-Fragmente werden gleichzeitig in den mit NcoI und XbaI geöffneten Vektor pRT 100 inseriert. Es wird das Plasmid pRT 100/scFv(ox)CH erhalten. Nach Spaltung mit HindIII wird die Expressionskasette 35S-scFv(ox)CH isoliert.The cDNA for the mature scFv (ox) antibody is generated by means of a linker ligation at the 5 'end with CCGTCGACAT [5'-phosphorylated oligonucleotide] and at the 3'-end with GCTCTAGAGC [5'-phosphorylated oligonucleotide]) modified such that they have a SaII site and at the 3 'end has an XbaI restriction site. Both cDNA fragments are digested with NcoI + SaII or SaII + XbaI, so that overhanging Ends arise. The cDNA fragments obtained are simultaneously in the with NcoI and XbaI open vector pRT 100 inserted. It becomes the plasmid pRT 100 / scFv (ox) CH receive. After cleavage with HindIII, the 35S-scFv (ox) CH expression cassette is isolated.

Der binäre Vektor pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-589; Porsch et al., Plant Molecular Biology 37 (1998), 581-585) wird mit HindIII geöffnet. Alle vier vorstehend beschriebenen Expressionskassetten (35S-scFv(ox)ER, 35S-scFv(ox)AP, 35S-scFv(ox)GO" und 35S-scFv(ox)CH) werden gleichzeitig In die HindIII-Schnittstelle des binären Vektors ligiert Die eindeutige Identifizierung positiver Klone, die alle vier Fragmente enthalten, erfolgt durch DNA-Sequenzierung. Es wird der binäre Vektor pSR 8-30/scFv(ox)EAGC erhalten.The binary vector pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-589; Porsch et al., Plant Molecular Biology 37 (1998), 581-585) is opened with HindIII. All four above described expression cassettes (35S-scFv (ox) ER, 35S-scFv (ox) AP, 35S-scFv (ox) GO " and 35S-scFv (ox) CH) are simultaneously inserted into the HindIII site of the binary vector ligated The unique identification of positive clones containing all four fragments done by DNA sequencing. It becomes the binary vector pSR 8-30 / scFv (ox) EAGC receive.

Der Expressionsvektor pSR 8-30/scFv(ox)EAGC wird zur Transformation von E. coli SM10 verwendet. Transformanten werden mit Agrobacterium GV 3101 gemischt und über Nacht bei 28°C inkubiert (Koncz und Schell, Molecular and General Genetics 204 (1986), 383-396; Koncz et al., Proc. Natl. Acad. Sci. USA 84 (1987), 131-135). Es wird auf Carbenicillin selektioniert, wobei das hierfür notwendige bIa-Gen in den vorstehenden Expresssionsvektoren vorliegt. Selektionsklone von Agrobacterium tumefaciens werden auf abgeschnittenen und mehrfach an der Mittelrippe eingeritzten Blättern der Kartoffelpflanze cv. Désirée aufgebracht und die Blätter werden 2 Tage bei 20°C im Dunkeln inkubiert. Danach werden die Agrobakterien abgewaschen und den Kartoffelblättern Pflanzenwuchsstoffe zugesetzt, so daß bevorzugt Sprosse regenerieren. Ferner werden durch die Zugabe von Kanamycin 100 mg/l in das Pflanzenmedium nicht-transformierte Zellen in den Kartoffelblättern abgetötet. Heranwachsende Sprosse werden abgeschnitten und auf das Medium ohne Pflanzenwachstumsstoffe, aber mit Kanamycin, bewurzelt. Die weitere Kultivierung der Kartoffelpflanzen erfolgt in üblicher Weise.The expression vector pSR 8-30 / scFv (ox) EAGC is used to transform E. coli SM10 used. Transformants are mixed with Agrobacterium GV 3101 and overnight incubated at 28 ° C (Koncz and Schell, Molecular and General Genetics 204 (1986), 383-396;  Koncz et al., Proc. Natl. Acad. Sci. USA 84: 131-135 (1987). It is based on carbenicillin selected, the bIa gene required for this in the above Expression vectors are present. Selection clones of Agrobacterium tumefaciens are on leaves of the potato plant cut off and carved several times on the midrib cv. Désirée applied and the leaves are incubated for 2 days at 20 ° C in the dark. Then the agrobacteria are washed off and the potato leaves Plant growth substances added, so that preferably regenerate shoots. Furthermore untransformed by the addition of kanamycin 100 mg / l in the plant medium Cells in the potato leaves killed. Growing shoots are cut off and rooted on the medium without plant growth substances, but with kanamycin. The further cultivation of the potato plants is carried out in the usual way.

Der Nachweis des exprimierten scFv-Antikörpers in transgenem Blatt- und Knollenmaterial wird durch Antikörper, die an scFv oder Protein L binden, im Western Blot bzw. ELISA erbracht. Hierzu wird das Gesamtprotein des Kartoffelmaterials isoliert und in die entsprechenden Nachweisverfahren eingesetzt. Im Vergleich zu den in Artsaenko et al. (supra) publizierten Ergebnissen zur Knollen-Expression von scFv(ox) ausschließlich im ER (Expressionsraten von bis zu 2% des löslichen Gesamtproteins) werden durch die simultane Expression in insgesamt vier Kompartimenten bis zu 5% scFv(ox)-Antikörper-Protein vom löslichen Gesamtprotein erreicht.Detection of the expressed scFv antibody in transgenic leaf and tuber material is by antibodies that bind to scFv or protein L in a Western blot or ELISA rendered. For this purpose, the total protein of the potato material is isolated and into the appropriate detection methods used. Compared to the in Artsaenko et al. (supra) published results on tuber expression of scFv (ox) exclusively in the ER (Expression rates of up to 2% of the total soluble protein) are characterized by the simultaneous Expression in a total of four compartments up to 5% scFv (ox) antibody protein from total soluble protein reached.

Beispiel 2Example 2 Produktion von scFv(ox)-Antikörpern durch nukleäre Transformation für die Expression im ER und in Vakuolen und plastidäre Transformation für die Expression in PlastidenProduction of scFv (ox) antibodies by nuclear transformation for expression in ER and vacuoles and plastid transformation for the Expression in plastids

Für die Herstellung eines Plastiden-Transformationsvektors wird Chloroplasten-DNA (cp-DNA) aus 8 Wochen alten Tabakpflanzen, angezogen im Gewächshaus, nach dem Verfahren von Koladner und Tewarl (Biochim. Biophys. Acta 404 (1975), 372-390) isoliert. Die isolierte Chloroplasten-DNA wird mit BgIII verdaut und die entstandenen BgIII- Fragmente werden "shot gun" in den mit BarnHI geöffneten Vektor pBluescriptKS (Stratagene) kloniert. Über Kolonie-Hybridisierung wird ein Klon identifiziert, der das BgIII- Fragment mit den ndhF-, rpI32 und trnL-Genen enthält (Shinozaki et al., EMBO J. 5 (1986), 2043-2049; 4.656bp-Fragment, Nucleotide Nr. 111515-116171). Es wird das Plasmid pBKSnrt erhalten. Chloroplast DNA is used to produce a plastid transformation vector (cp-DNA) from 8-week-old tobacco plants, grown in a greenhouse, after the Methods by Koladner and Tewarl (Biochim. Biophys. Acta 404 (1975), 372-390) isolated. The isolated chloroplast DNA is digested with BgIII and the resulting BgIII- Fragments are shot gun in the pBluescriptKS vector opened with BarnHI (Stratagene) cloned. A clone is identified via colony hybridization, which clones the BgIII- Contains fragment with the ndhF, rpI32 and trnL genes (Shinozaki et al., EMBO J. 5 (1986), 2043-2049; 4,656bp fragment, nucleotides No. 111515-116171). It becomes the plasmid pBKSnrt received.  

In die HincII-Schnittstelle des 4.656bp-BgIII-Fragments im Plasmid pBKSnrt wird das Gen für den scFv(ox)-Antikörper aus Artsaenka et al. (supra) unter die Kontrolle des psbA-Promotors und des psbA-Terminationssignals (Shinozaki et al., supra) aus Tabak kloniert. Dafür wird die cDNA für den reifen scFv(ox)-Antikörper mittels einer Linker-Ligation am 5'-Ende mit CGCGAATTC [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GACTAAGCTT [5'-phosphoryliertes Oligonucleotid] derart modifiziert, daß sie am 5'-Ende eine EcoRI-Schnittstelle und am 3'-Ende eine HindIII-Restriktionsschnittstelle aufweist. Dieses cDNA-Fragment wird nach Verdau mit EcoRI und HindIII in das Plasmid pBluescriptSK (Stratagene) kloniert. Es wird das Plasmid pBSK/scFv(ox) erhalten. Der 5'- Bereich des psbA-Gens (Plastiden-spezifischer Promotor) wird aus Chloroplasten-DNA von Tabak durch eine PCR-Reaktion amplifiziert. Dafür wird folgendes phosphoryliertes Primerpaar verwendet:
psbA1 Primer: GTCATGTTATACTGTTG (Nucleotide 1700-1684, Shinozaki et al., supra)
psbA2 Primer: GGTAAAATCTTGGTTTATTTAATCATC (Nucleotide 1596-1622, Shinozaki et al., supra)The gene for the scFv (ox) antibody from Artsaenka et al. Is inserted into the HincII site of the 4,656 bp BglII fragment in the plasmid pBKSnrt. (supra) under the control of the psbA promoter and the psbA termination signal (Shinozaki et al., supra) from tobacco. For this, the cDNA for the mature scFv (ox) antibody is modified in this way by means of a linker ligation at the 5'-end with CGCGAATTC [5'-phosphorylated oligonucleotide] and at the 3'-end with GACTAAGCTT [5'-phosphorylated oligonucleotide], that it has an EcoRI site at the 5 'end and a Hind III restriction site at the 3' end. After digestion with EcoRI and HindIII, this cDNA fragment is cloned into the plasmid pBluescriptSK (Stratagene). The plasmid pBSK / scFv (ox) is obtained. The 5 'region of the psbA gene (plastid-specific promoter) is amplified from chloroplast DNA from tobacco by a PCR reaction. The following phosphorylated primer pair is used for this:
psbA1 primer: GTCATGTTATACTGTTG (nucleotides 1700-1684, Shinozaki et al., supra)
psbA2 primer: GGTAAAATCTTGGTTTATTTAATCATC (nucleotides 1596-1622, Shinozaki et al., supra)

Das PCR-Produkt wird "blunt end" in die SmaI-Schnittstetle des Vektors pBSK/scFv(ox) kloniert. Es wird das Plasmid pBSK/psbA-scFv(ox) erhalten. Der 3'-Bereich des psbA-Gens (Terminationssignal) wird ebenfalls über eine PCR-Reaktion amplifiziert. Dazu wird folgendes phosphoryliertes Primerpaar verwendet:
psbA3 Primer: AGTCTATGTAAGTAAAATAC (Nucleotide 401-420, Shinozaki et al., supra)
psbA4 Primer: CCTGGCCTAGTCTATAGGAG (Nucleotide 530-511, Shinozaki et al., supra)The PCR product is cloned "blunt end" into the SmaI section of the vector pBSK / scFv (ox). The plasmid pBSK / psbA-scFv (ox) is obtained. The 3 'region of the psbA gene (termination signal) is also amplified via a PCR reaction. The following phosphorylated primer pair is used for this:
psbA3 primer: AGTCTATGTAAGTAAAATAC (nucleotides 401-420, Shinozaki et al., supra)
psbA4 primer: CCTGGCCTAGTCTATAGGAG (nucleotides 530-511, Shinozaki et al., supra)

Das PCR-Produkt wird "blunt end" in die aufgeschnittene und aufgefüllte SaII-Schnittstelle des Vektors pBSK/psbA-scFv(ox) inseriert. Es wird das Plasmid pBSK/psbA-scFv(ox)-PgbA erhalten. Die Expressionskassette wird aus diesem Plasmid durch Verdau mit BamHI und KpnI herausgeschnitten, aufgefüllt und "blunt end' in die HincII-Schnittstelle des Vektors pBSKnrt kloniert. Es wird das Plasmid pBSKnrt/scFv(ox) erhalten. In die SnaBI-Schnittstelle des 4.656bp-BgIII-Fragments des Plasmids pBSKnrt/scFv(ox) wird weiterhin als Selektionsmarker das nptII-Gen unter die Kontrolle des psbA-Promotors und des psbA-Terminationssignals aus Tabak kloniert. Dafür wird das nptII-Gen mit einer PCR- Amplifizierung aus dem Vektor pCR2.1 (Invitrogen) isoliert. Dazu wird folgendes Primerpaar verwendet:
Kan1-Primer: CCGAATTCCAAGAGACAGGATGAGGATC
Kan2-Primer: CGCGAAGCTTCAATTCAGAAGAACTCAAGThe PCR product is inserted "blunt end" into the cut and filled SaII interface of the vector pBSK / psbA-scFv (ox). The plasmid pBSK / psbA-scFv (ox) -PgbA is obtained. The expression cassette is cut out of this plasmid by digestion with BamHI and KpnI, filled in and blunt end cloned into the HincII site of the vector pBSKnrt. The plasmid pBSKnrt / scFv (ox) is obtained. In the SnaBI site of 4.656bp -BgIII fragment of the plasmid pBSKnrt / scFv (ox), the nptII gene is also cloned as a selection marker under the control of the psbA promoter and the psbA termination signal from tobacco, for which purpose the nptII gene is PCR amplified from the vector pCR2.1 (Invitrogen) isolated using the following primer pair:
Kan1 primer: CCGAATTCCAAGAGACAGGATGAGGATC
Kan2 primer: CGCGAAGCTTCAATTCAGAAGAACTCAAG

Das PCR-Produkt wird über EcoRI- und HindIII-Verdau in das Plasmid pBluescriptSK (Stratagene) kloniert. Es wird das Plasmid pBSK/NPT erhalten. Der 5'-Bereich des psbA-Gens (wie vorstehend beschrieben isoliert) wird "blunt end' in die SmaI-Schnittstelle des Vektors pBSK/NPT kloniert. Es wird das Plasmid pF3SK/psbA-NPT erhalten. Der 3'- Bereich des pshA-Gens (Terminationssignal) wird (wie vorstehend beschrieben) ebenfalls "blunt end' in die aufgeschnittene und aufgefüllte SaII-Schnittstelle des Vektors pBSK/psbA-NBT inseriert, wobei das Plasmid pBSK/psbA-NPT-psb erhalten wird. Die Expressionskassette wird aus diesem Plasmid mit BamHI und KpnI herausgeschnitten, aufgefüllt und "blunt end" in die SnaBI-Schnittstelle des Vektors pBKSnrt/scFv(ox) kloniert, wodurch das Plasmid pBKSnrt/scFv(ox)-NPT erhalten wird.The PCR product is digested into the plasmid pBluescriptSK via EcoRI and HindIII digestion (Stratagene) cloned. The plasmid pBSK / NPT is obtained. The 5 'area of the psbA gene (isolated as described above) is blunt ended in the SmaI site of the vector pBSK / NPT cloned. The plasmid pF3SK / psbA-NPT is obtained. The 3'- Region of the pshA gene (termination signal) is also (as described above) "blunt end 'into the cut and filled SaII interface of the vector pBSK / psbA-NBT is inserted, whereby the plasmid pBSK / psbA-NPT-psb is obtained. The Expression cassette is cut out of this plasmid with BamHI and KpnI, filled in and "blunt end" cloned into the SnaBI interface of the vector pBKSnrt / scFv (ox), whereby the plasmid pBKSnrt / scFv (ox) -NPT is obtained.

Die Transformation von Kartoffelplastiden und die Selektion von transgenen Kartoffelpflanzen, die das vorstehend beschriebene Konstrukt in das Plastidengenom eingebaut haben, erfolgt nach den von Svab et al., supra, Carrer et al. (Mol. Gen. Genet. 241 (1993), 49-56) und Sidorov et al. (Plant J. (1999), supra beschriebenen Protokollen (biolistischer DNA-Transfer) mit dem Helium-betriebenen "Particle-Gun" Gerät PDS-1000/He (Du Pont Willmington, USA). Der Nachweis der Plastidentransformation erfolgt durch Isolierung plastidärer DNA und Hybridisierung mit dem scFv(ox)-Gen. Der Nachweis des produzierten scFv(ox)-Antikörpers erfolgt analog zu vorstehendem Beispiel 1.The transformation of potato plastids and the selection of transgenic ones Potato plants that incorporate the construct described above into the plastid genome installed, is carried out according to the by Svab et al., supra, Carrer et al. (Mol. Gen. Genet. 241 (1993), 49-56) and Sidorov et al. (Plant J. (1999), supra protocols described (biolistic DNA transfer) with the helium-operated "Particle Gun" device PDS-1000 / He (Du Pont Willmington, USA). The plastid transformation is verified by Isolation of plastid DNA and hybridization with the scFv (ox) gene. Evidence of The scFv (ox) antibody produced is carried out analogously to Example 1 above.

Die vorstehend beschriebene transgene Kartoffellinie, die das Gen für die plastidäre Expression des scFv(ox)-Antikörpers in den Plastiden enthält, wird weiterhin mit den beiden Expressionskassetten 35S-scFv(ox)ER aus Beispiel 1 und einer weiteren Expressionskassette 35S-scFv(ox)VA für die vakuoläre Lokalisation des produzierten scFv(ox)-Antikörpers transformiert. The transgenic potato line described above, which is the gene for plastid Expression of the scFv (ox) antibody contained in the plastids continues with the two Expression cassettes 35S-scFv (ox) ER from Example 1 and another Expression cassette 35S-scFv (ox) VA for the vacuolar localization of the produced transformed scFv (ox) antibody.  

Für die Klonierung der Expressionskassette 35S-scFv(ox)VA wird das Plasmid pSR9-12 ein Derivat des Plasmids pRT 100, welches stromabwärts vom CaMV 35S-Promotor die kodierende Sequenz für ein Maus IgG-Signalpeptid enthält, mit SaII und XbaI geöffnet. Die cDNA für den reifen scFv(ox)-Antikörper wird mittels einer Linker-Ligation (am 5'-Ende mit CCGTCGACTCTAAGAACCCAATTAAC [5'-phosphoryliertes Oligonucleotid) und am 3'- Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5'-Ende eine SaII-Schnittstelle und am 3'-Ende Ende eine XbaI-Restriktionsschnittstelle aufweist. Gleichzeitig wird damit die für das vakuoläre Targetting-Signal SKNPIN aus dem 20 kDa-Protein aus der Kartoffelknolle kodierende DNA-Sequenz (PT20; Kolde, Plant Cell Physiol. 40 (1999), 1152-1159) integriert. Dieses cDNA-Fragment wird mit SaII und XbaI verdaut, so daß überhängende Enden entstehen, und in den geöffneten Vektor inseriert. Es wird das Plasmid pSR9-12/scFv(ox)VA erhalten. Nach Spaltung mit HindIII wird die Expressionskassette 35S-scFv(ox)VA isoliert.The plasmid pSR9-12 is used for the cloning of the expression cassette 35S-scFv (ox) VA Derivative of plasmid pRT 100, which is the downstream of the CaMV 35S promoter contains coding sequence for a mouse IgG signal peptide, opened with SaII and XbaI. The cDNA for the mature scFv (ox) antibody is generated by means of a linker ligation (at the 5 'end with CCGTCGACTCTAAGAACCCAATTAAC [5'-phosphorylated oligonucleotide) and on 3'- End modified with GCTCTAGAGC [5'-phosphorylated oligonucleotide]) in such a way that it am A SaII site at the 5 'end and an XbaI restriction site at the 3' end having. At the same time, the for the vacuolar targetting signal SKNPIN from the 20 kDa protein from the potato tuber coding DNA sequence (PT20; Kolde, Plant Cell Physiol. 40 (1999), 1152-1159). This cDNA fragment is labeled with SaII and XbaI digested so that overhanging ends arise, and inserted into the open vector. It the plasmid pSR9-12 / scFv (ox) VA is obtained. After cleavage with HindIII, the Expression cassette 35S-scFv (ox) VA isolated.

Die beiden Expressionskassetten 35S-scFv(ox)ER und 35S-scFv(ox)VA werden gleichzeitig als HindIII-Fragmente in den mit HindIII geöffneten binären Vektor pSR 8-30hyg, ein Derivat des Vektors pSR 8-30, der anstelle des Neomycinphosphotransferare II-Gens das Hygromycinphosphotransferare-Gen enthält, ligiert. Die eindeutige Identifizierung positiver Klone, die beide Fragmente enthalten, erfolgt durch DNA-Sequenzierung. Es wird der binäre Vektor pSR 8-30hyg/scFv(ox)EV erhalten. Die Kartoffeltransformation erfolgt wie im vorstehenden Beispiel 1 beschrieben, wobei die Selektion mit 5 mg/l Hygromycin erfolgt. Der Nachweis des produzierten scFv(ox)Antikörpers erfolgt wie im vorstehenden Beispiel 1 beschrieben. Die Integration des vorstehend beschriebenen Konstrukts in das Kerngenom wird durch Isolierung kerngenomischer DNA und Hybridisierung mit dem scFv(ox)-Gen gemäß Standardverfahren nachgewiesen. Gegenüber Beispiel 1 kann die Menge des exprimierten scFv(ox) nochmals gesteigert werden, nämlich auf 8% scFv(ox)-Antikörper- Protein vom löslichen Gesamtprotein.The two expression cassettes 35S-scFv (ox) ER and 35S-scFv (ox) VA become simultaneous as HindIII fragments in the binary vector pSR 8-30hyg opened with HindIII, a derivative of the vector pSR 8-30, which instead of the neomycin phosphotransferare II gene Contains hygromycin phosphotransferare gene, ligated. The unique identification of positive Clones containing both fragments are made by DNA sequencing. It will be the binary vector pSR 8-30hyg / scFv (ox) EV obtained. The potato transformation takes place as in Example 1 described above, the selection being carried out with 5 mg / l hygromycin. The The scFv (ox) antibody produced is detected as in Example 1 above described. Integration of the construct described above into the nuclear genome is obtained by isolating nuclear genomic DNA and hybridizing with the scFv (ox) gene proven according to standard procedures. Compared to example 1, the amount of expressed scFv (ox) can be increased again, namely to 8% scFv (ox) antibodies Protein from total soluble protein.

Beispiel 3Example 3 Nach-Ernte-Produktion von scFv(ox)-Antiköpern durch anaerobe Expression im ER und im Golgi-ApparatPost-harvest production of scFv (ox) antibodies by anaerobic Expression in the ER and in the Golgi apparatus

Der anaerob induzierbare GapC4-Promotor aus Mais (DE 195 47 272) wird mittels einer PCR-Reaktion derart modifiziert, daß er am 5'-Ende eine HincII-Restriktionsschnittstelle und am 3'-Ende eine NcoI-Restriktionschnittstelle erhält. Für die PCR-Reaktion wird folgendes Primerpaar verwendet:
HincII-pGapC4 Primer: CATGTCAACACATAAGGAAGAAGAGGTAGAAAG
pGapC4-NcoI Primer: CATGCCATGGATCGATGACGGGGTTGGCGAGTGTGThe anaerobically inducible GapC4 promoter from maize (DE 195 47 272) is modified by means of a PCR reaction in such a way that it receives an HincII restriction site at the 5 'end and an NcoI restriction site at the 3' end. The following primer pair is used for the PCR reaction:
HincII-pGapC4 Primer: CATGTCAACACATAAGGAAGAAGAGGTAGAAAG
pGapC4-NcoI primer: CATGCCATGGATCGATGACGGGGTTGGCGAGTGTG

Die in Artsaenko et al. (supra) beschriebene cDNA, die für den im endoplasmatischen Retikulum (ER) lokalisierten scFv(ox)-Antikörper kodiert, wird mittels einer Linker-Ligation am 5'-Ende mit CATGCCATGGCATG [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucieotid] derart modifiziert, daß sie am 5'- Ende eine NcoI-Restriktionsschnittstelle und am 3'-Ende eine XbaI-Restriktionsschnittstelle aufweist. Aus dem Plasmid pRT 100 wird der CaMV 35S-Promotor mittels Restriktionsverdau mit HincII und XbaI entfernt. Stattdessen werden die beiden oben beschriebenen Nucleinsäurefragmente, die für den GapC4-Promotor und den scFv(ox)-Antikörper kodieren, inseriert. Es wird das Plasmid pRT 100GAP/scFv(ox)ER erhalten. Nach partieller Spaltung mit HindIII wird die Expressionskassette GAP-scFv(ox)ER isoliert.The artsaenko et al. (supra) cDNA described for the endoplasmic Reticulum (ER) localized scFv (ox) antibody is encoded using a linker ligation at the 5 'end with CATGCCATGGCATG [5'-phosphorylated oligonucleotide] and at the 3' end modified with GCTCTAGAGC [5'-phosphorylated oligonucleotide] in such a way that on the 5'- An NcoI restriction site at the end and an XbaI restriction site at the 3 'end having. The CaMV 35S promoter is made from the plasmid pRT 100 Restriction digest removed with HincII and XbaI. Instead, the two above described nucleic acid fragments for the GapC4 promoter and Encode scFv (ox) antibody. It becomes the plasmid pRT 100GAP / scFv (ox) ER receive. After partial cleavage with HindIII, the expression cassette becomes GAP-scFv (ox) ER isolated.

Für die anaerobe Expression des im Golgi-Apparat lokalisierten scFv(ox)-Antikörpers wird das Plasmid pRT 100/seFv(ox)GO aus Beispiel 1 mit HincII und NcoI verdaut. Dadurch wird der CaMV-35S Promotor entfernt. Statt dessen wird das vorstehend beschriebene PCR-modifizierte pGapC4-Promotorfragment inseriert. Es wird das Plasmid pRT 100GAP/scFv(ox)GO erhalten. Nach Spaltung mit HindIII wird die Expressionskassette GAP-scFv(ox)GO isoliert.For the anaerobic expression of the scFv (ox) antibody localized in the Golgi apparatus digested the plasmid pRT 100 / seFv (ox) GO from Example 1 with HincII and NcoI. This will the CaMV-35S promoter removed. Instead, the above is described PCR-modified pGapC4 promoter fragment inserted. It becomes the plasmid pRT 100GAP / scFv (ox) GO obtained. After cleavage with HindIII, the expression cassette GAP-scFv (ox) GO isolated.

Der binäre Vektor pSR 8-30 wird mit HindIII geöffnet. Beide vorstehend beschriebenen Expressionskassetten (GAP-scFv(ox)ER und GAP-scFv(ox)GO) werden gleichzeitig in die HindIII-Schnittstelle des binären Vektors ligiert. Die eindeutige Identifizierung positiver Klone, die beide Fragmente enthalten, erfolgt durch DNA-Sequenzierung. Es wird der binäre Vektor PSR 8-30GAP/scFv(ox)EG erhalten.The binary vector pSR 8-30 is opened with HindIII. Both described above Expression cassettes (GAP-scFv (ox) ER and GAP-scFv (ox) GO) are inserted into the HindIII interface of the binary vector ligated. The unique identification of positive Clones containing both fragments are made by DNA sequencing. It will be the binary vector PSR 8-30GAP / scFv (ox) EG obtained.

Der Expressionsvektor pSR 8-30GAP/seFv(ox)EG wird wie im vorstehenden Beispiel 1 beschrieben zur Transformation von Kartoffeln verwendet. Zum Nachweis der Expression des scFv-Antikörpers wird abgeschnittenes Blattmaterial bzw. intaktes (oder geschnittenes) Knollenmaterial mittels des "Anaerocult"-Systems (Fa. Merck, Darmstadt, Deutschland) wie bei Bülow et al. Molecular Plant-Microbe Interactions 12 (1999), 192-198 beschrieben induziert. Nach 40 Stunden wird das Blattmaterial entnommen und gemörsert. Der Nachweis des exprimierten scFv-Antikörpers wird wieder durch Antikörper, die an den scFv- Antikörper oder Protein L binden im Western Blot bzw. ELISA erbracht. Hierzu wird das Gesamtprotein des Kartoffelmaterials isoliert und in die entsprechenden Nachweisverfahren eingesetzt.The expression vector pSR 8-30GAP / seFv (ox) EG becomes as in Example 1 above described used to transform potatoes. For the detection of expression of the scFv antibody is cut off sheet material or intact (or cut) Bulb material using the "Anaerocult" system (Merck, Darmstadt, Germany) such as in Bülow et al. Molecular Plant-Microbe Interactions 12 (1999), 192-198 induced. After 40 hours, the leaf material is removed and ground. The  Detection of the expressed scFv antibody is again carried out by antibodies attached to the scFv Antibodies or protein L bind in a Western blot or ELISA. For this, the Total protein of the potato material isolated and in the corresponding detection methods used.

Als expressions-positiv ermittelte transgene Kartoffelpflanzen werden im Gewächshaus (im Topf oder im Erdbeet) oder im Freiland unter üblichen gartenbaulichen bzw. landwirtschaftlichen Bedingungen angebaut. Die Knollen werden nach üblicher Handhabung geerntet und gelagert. Für die Nach-Ernte-Produktion des scFv-Antikörpers werden die Knollen in einen Reaktionsbehälter aus Stahl (oder Kunststoff) verbracht, der unten ein Gaszufuhrventil und oben ein Gasabführventil aufwies. Die Raumluft im Behälter wird schnell durch Zufuhr von beispielsweise technischem Stickstoff (oder Kohlendioxid) verdrängt. Unter langsamem Luftstrom (1 m3 Gaszufuhr pro Stunde pro m2 Grundfläche) wird eine konstante Zusammensetzung der Gasphase im Reaktionsbehälter eingestellt. Nach 40 Stunden werden die Knollen aus dem Reaktionsbehälter entnommen, homogenisiert, der Festanteil wird abzentrifugiert und der wäßrige Überstand der chromatographischen Aufreinigung des scFv-Antikörpers zugeführt. Durch Vergleich von Proben vor und nach Sauerstoffentzug dieser transgenen Kartoffellinie mit den transgenen Kartoffellinien, die den scFv(ox)-Antikörper nur im ER exprimieren, zeigt sich, daß durch die kombinierte Expression in zwei Zellkompartimenten (hier: ER und Golgi-Apparat) deutlich höhere Expressionsraten erzielt werden.Transgenic potato plants that are found to be expression-positive are grown in the greenhouse (in a pot or in a straw bed) or in the open under normal horticultural or agricultural conditions. The tubers are harvested and stored after normal handling. For the post-harvest production of the scFv antibody, the tubers are placed in a reaction vessel made of steel (or plastic), which has a gas supply valve at the bottom and a gas discharge valve at the top. The room air in the container is quickly displaced by adding technical nitrogen (or carbon dioxide), for example. A constant composition of the gas phase in the reaction vessel is set with a slow air flow (1 m 3 gas supply per hour per m 2 base area). After 40 hours, the tubers are removed from the reaction vessel, homogenized, the solid is centrifuged off and the aqueous supernatant is used for the chromatographic purification of the scFv antibody. A comparison of samples before and after oxygen deprivation of this transgenic potato line with the transgenic potato lines which only express the scFv (ox) antibody in the ER shows that the combined expression in two cell compartments (here: ER and Golgi apparatus) clearly shows higher expression rates can be achieved.

Claims (11)

1. Expressionsvektor (A), dadurch gekennzeichnet, daß er mindestens zwei Kopien eines für ein gewünschtes Protein kodierenden Gens jeweils mit einem Promotor funktionell verknüpft enthält, oder Zusammensetzung (B), umfassend mindestens zwei Expressionsvektoren umfassend, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Genkopien dadurch gekennzeichnet sind, daß sie
  • a) für das gewünschte Protein (I) als Fusionsprotein mit einem gewünschten Lokalisierungssignal (II) kodieren; wobei
  • b) bei den einzelnen Genkopien der (I) kodierende Anteil im wesentlichen identisch, der (II) kodierende Anteil jedoch unterschiedlich ist,
wobei nach Einschleusen des Expressionsvektors (A) oder der Zusammensetzung (B) in einen Wirt das gewünschte Protein in unterschiedliche Kompartimente des Wirts transportiert wird.1. Expression vector (A), characterized in that it contains at least two copies of a gene coding for a desired protein each functionally linked to a promoter, or composition (B) comprising at least two expression vectors, each comprising at least one copy of a for contain the desired protein-encoding gene functionally linked to a promoter, the individual gene copies being characterized in that they
  • a) code for the desired protein (I) as a fusion protein with a desired localization signal (II); in which
  • b) in the individual gene copies the (I) coding part is essentially identical, but the (II) coding part is different,
wherein after the expression vector (A) or the composition (B) has been introduced into a host, the desired protein is transported into different compartments of the host. 2. Zusammensetzung (C), umfassend mindestens einen in Plastiden lokalisierten und einen in Mitochondrien lokalisierten Expressionsvektor, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Expressionsvektoren dadurch gekennzeichnet sind, daß die einzelnen Genkopien im wesentlichen identisch sind und das gewünschte Protein in Plastiden und Mitochondrien des Wirts exprimiert wird.2. Composition (C), comprising at least one localized in plastids and one expression vector localized in mitochondria, each containing at least one copy of a functionally linked to a promoter for a gene encoding a desired protein included, the individual expression vectors being characterized in that the individual gene copies are essentially identical and the desired protein in Plastids and mitochondria of the host is expressed. 3. Kombination, enthaltend den Expressionsvektor (A) nach Anspruch 1, und/oder die Zusammensetzung (B) nach Anspruch 1 und die Zusammensetzung (C) nach Anspruch 2.3. Combination containing the expression vector (A) according to claim 1, and / or Composition (B) according to claim 1 and composition (C) according to claim 2. 4. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach einem der Ansprüche 1 bis 3, wobei das Lokalisierungssignal ein solches für die Lokalisierung im endoplasmatischen Retikulum (ER), Apoplasten, Golgi-Apparat, in Plastiden, Mitochondrien, Peroxisosomen und/oder in Vakuolen ist.4. Expression vector (A), composition (B) or (C) or combination according to one of the Claims 1 to 3, wherein the localization signal is one for localization in the endoplasmic reticulum (ER), apoplasts, Golgi apparatus, in plastids, mitochondria, Peroxisosomes and / or in vacuoles. 5. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach Anspruch 4, wobei das Lokalisierungssignal das KDEL-ER-Targetting-Peptid ist, das Golgi- Lokalisierungssignal der β-1,2-N-Acetylglucosamintransferase (GnTI), die kleine Untereinheit der Ribulose-Biphosphat-Carboxylase und/oder das vakuoläre Targetting- Signal SKNPIN ist. 5. Expression vector (A), composition (B) or (C) or combination according to claim 4, where the localization signal is the KDEL-ER targeting peptide, the Golgi Localization signal of β-1,2-N-acetylglucosamine transferase (GnTI), the small one Subunit of ribulose-biphosphate carboxylase and / or the vacuolar targetting SKNPIN signal is.   6. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach einem der Ansprüche 1 bis 5, wobei der Wirt eine Pflanze ist.6. Expression vector (A), composition (B) or (C) or combination according to one of the Claims 1 to 5, wherein the host is a plant. 7. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach Anspruch 6, wobei die Pflanze eine Brassicacee, Leguminose oder Kartoffel ist.7. Expression vector (A), composition (B) or (C) or combination according to claim 6, the plant being a brassica, legume or potato. 8. Verfahren zur Steigerung der Produktionsrate eines gewünschten Proteins in einem Wirt, dadurch gekennzeichnet, daß zur simultanen Expression des das gewünschte Protein kodierenden Gens in verschiedenen Kompartimenten des Wirts und/oder zum simultanen Transport des gewünschten Proteins in verschiedene Kompartimente des Wirts der Wirt mit dem Expressionsvektor (A), der Zusammensetzung (E) oder (C) bzw. der Kombination nach einem der Ansprüche 1 bis 7 transformiert und das gewünschte Protein aus dem Wirt gewonnen wird.8. A method of increasing the production rate of a desired protein in a host. characterized in that for the simultaneous expression of the desired protein coding gene in different compartments of the host and / or for simultaneous Transport of the desired protein into different compartments of the host the expression vector (A), the composition (E) or (C) or the combination transformed one of claims 1 to 7 and the desired protein from the host is won. 9. Verfahren nach Anspruch 8, weiter dadurch gekennzeichnet, daß die Expression des das gewünschte Protein kodierenden Gens erst nach der Ernte des Wirts erfolgt, wobei das das gewünschte Protein kodierende Gen so vorliegt, daß dessen Expression erst in Anwesenheit einer induzierenden Verbindung erfolgt und das Inkontaktbringen mit der Verbindung nach der Ernte des Wirts erfolgt.9. The method according to claim 8, further characterized in that the expression of the desired protein-coding gene takes place only after the harvest of the host, which is the desired protein coding gene is present so that its expression only in Presence of an inducing compound and contacting the Connection is made after the host is harvested. 10. Verfahren nach Anspruch 8 oder 9, wobei der Wirt eine Pflanze ist.10. The method of claim 8 or 9, wherein the host is a plant. 11. Pflanzensamen, Pflanzenzelle oder Pflanze, die einen Expressionsvektor (A), eine Zusammensetzung (B) oder (C) bzw. eine Kombination nach einem der Ansprüche 1 bis 7 enthält.11. Plant seeds, plant cells or plants that contain an expression vector (A), a Composition (B) or (C) or a combination according to any one of claims 1 to 7 contains.
DE2000114412 2000-03-24 2000-03-24 Expression vectors for the enrichment of a recombinantly produced protein in different cell compartments Withdrawn DE10014412A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
DE2000114412 DE10014412A1 (en) 2000-03-24 2000-03-24 Expression vectors for the enrichment of a recombinantly produced protein in different cell compartments
AU2001237217A AU2001237217A1 (en) 2000-03-24 2001-01-10 Expression vectors for concentrating a recombinantly produced protein in different cell compartments
PCT/DE2001/000133 WO2001073085A1 (en) 2000-03-24 2001-01-10 Expression vectors for concentrating a recombinantly produced protein in different cell compartments

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE2000114412 DE10014412A1 (en) 2000-03-24 2000-03-24 Expression vectors for the enrichment of a recombinantly produced protein in different cell compartments

Publications (1)

Publication Number Publication Date
DE10014412A1 true DE10014412A1 (en) 2001-10-04

Family

ID=7636035

Family Applications (1)

Application Number Title Priority Date Filing Date
DE2000114412 Withdrawn DE10014412A1 (en) 2000-03-24 2000-03-24 Expression vectors for the enrichment of a recombinantly produced protein in different cell compartments

Country Status (3)

Country Link
AU (1) AU2001237217A1 (en)
DE (1) DE10014412A1 (en)
WO (1) WO2001073085A1 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FI864720A (en) * 1985-11-22 1987-05-23 Ciba Geigy Ag DIRECTIVE OF THE PLASTIC UNIT AND OF THE MITOKONDRIER.
EP0285646A4 (en) * 1986-09-26 1989-12-18 Calgene Inc Intracellular directed delivery of expression products.
EP0359617A3 (en) * 1988-09-02 1990-04-04 Plant Genetic Systems, N.V. Stress-tolerant plants
US5670349A (en) * 1993-08-02 1997-09-23 Virginia Tech Intellectual Properties, Inc. HMG2 promoter expression system and post-harvest production of gene products in plants and plant cell cultures

Also Published As

Publication number Publication date
WO2001073085A1 (en) 2001-10-04
AU2001237217A1 (en) 2001-10-08

Similar Documents

Publication Publication Date Title
DE69434312T2 (en) REGULATION OF PLANT GROWTH
WO1996023891A1 (en) Stress-tolerant plants and methods of producing the same
DE69636622T2 (en) TRANSFORMED EMBRYOID MICROSPORES FOR THE PRODUCTION OF FERTILES HOMOZYGOTEN PLANTS
CN102851306A (en) Transgenic aloe plants for production of proteins and related methods
DE69633568T2 (en) EXPRESSION CONTROL SEQUENCE FOR GENERAL AND EFFECTIVE GENE EXPRESSION IN PLANTS
WO2002012474A2 (en) Method of selection in host cells with eliminated dna sequences
WO2001012827A9 (en) Method for production of transgenic plants with increased tocopherol content
EP1272645B1 (en) Production of non-cariogenic sugars in transgenic plants
DE10047286B4 (en) Isomalt producing transgenic plant
DE10049267B4 (en) Method for producing or increasing resistance in organisms to biotic stress factors
DE69938144T2 (en) ANTIBODY-MEDIATED DERIVATION REGULATION OF PLANT PROTEINS
WO2001059135A1 (en) Method for influencing the pollen development by modifying the sucrose metabolism
DE10014412A1 (en) Expression vectors for the enrichment of a recombinantly produced protein in different cell compartments
DE4439748A1 (en) Method for changing the flowering behavior in plants
EP1458230A1 (en) Production of recombinant antibodies by means of fusion with elastin-like peptides
EP1144610B1 (en) Method for carrying out the controlled post-harvest production of proteins in plants
WO2005026366A1 (en) Novel endosperm-specific plant promoter for cultivated plants
DE10026845A1 (en) Triacylglycerol lipases
WO2001073086A2 (en) Method for genetically modifying a plant
WO2001088164A1 (en) Inducible elimination of dna sequences in plants
WO1999011805A1 (en) Recombinant dna molecules and method for increasing oil content in plants
WO2000060101A1 (en) Metabolic selection markers for plants
WO2003014364A1 (en) Method for influencing the acceptance of minerals in transgenic plants
DE10318087B4 (en) Genetic control of flowering time and pathogen attack in plants
WO2002066661A1 (en) Method for producing and transforming clusters of mitochondria

Legal Events

Date Code Title Description
OP8 Request for examination as to paragraph 44 patent law
8139 Disposal/non-payment of the annual fee