DD297664A5 - TUMOR NECROSIS FACTOR ALPHA AND BETA RECEPTORS - Google Patents

Abstract

The present invention relates to tumor necrosis factor receptor proteins, DNAs and expression vectors encoding TNF receptors, and methods of producing TNF receptors as recombinant cell culture products.

Description

For this 6 pages drawings

description

This application is a continuation-in-part of USSN 421,417, filed October 13, 1989 and pending, which is a continuation-in-part of the now discontinued USSN 405,370 of September 11, 1989, which is a continuation part of the US Pat is now discontinued USSN 403,241 of September 5, 1989.

The present invention relates generally to cytokine receptors, particularly to tumor necrosis factor receptors. Tumor Necrosis Factor-a (TNFa, also known as Cachectin) and Tumor Necrosis Factor-β (TNFβ, also known as Lymphotoxin) are homologous endogenous secretory proteins in mammals that are capable of producing a variety of effects on a large number of animals Exercise cell types. The great similarities in the structural and functional characteristics of this

both cytokines have led to their common designation as "TNF." Complementary cDNA clones encoding TNFα (Pennlca et al., Nature 312: 724, 1984) and TNFβ (Gray et al., Nature 312: 721, 1984) , have already been isolated and allow further structural and biological characterization of TNF.

TNF proteins initiate their biological activity on cells by binding to specific TNF receptor (TNF-R) proteins expressed on the plasma membrane on TNF-responsive cells. For TNFα and TNFβ, human cervical carcinoma cell line ME-180 (Aggarwal et al., Nature 318: 665, 1985) was shown to bind to a common receptor for the first time. Size estimates for the TNF-R, as determined by affinity labeling studies, ranged from 54-175 kDa (Creasey et al., Proc. Natl. Acad., USA 84: 3293, 1987; Stauber et al., J. Biol 263: 19098, 1988; Hohmann et al., J. Biol. Chem. 264: 14927, 1989). Although the relationship between these TNF-R's of different molecular weights is unclear, Hohmann et al. (J. Biol. Chem. 264: 14927, 1989)), at least two different one cell surface receptors for TNF exist on different cell types. These receptors have an apparent molecular weight of about 8OkDa and about 55-60KDa, respectively. However, none of these publications reported the purification of cell surface TNF receptors to homogeneity.

In addition to the cell surface receptors for TNF, human urine soluble proteins have been identified that are capable of binding TNF (Peetre et al., Eur. J. Haematol. 41: 414, 1988; Seckinger et al. Exp. Media 167: 1511, 1988; Seckinger et al., J. Biol. Chem. 264: 11966, 1989; GB Patent Application No. 2218101 A Seckinger et al .; Engelmann et al., J. Biol. Chem. 264 : 11974.1989). The soluble urinary TNF-binding protein disclosed in GB 2218101A has a partial N-terminal amino acid sequence Asp-Ser-Val-Cys-Pro which is that described by Engelmann et al. (1989) later revealed partial sequence corresponds. The relationship of the above urinary soluble binding proteins was further elucidated after the original pus pending application of the present application (USSN 403,241) had already been filed as Engelmann et al. reported the identification and purification of a second distinct soluble TNF-binding protein from urine with an N-terminal amino acid sequence Val-Ala-Phe-Thr-Pro (J.Biol. Chem. 265: 1531, 1990). For the two in GB 2218101A and in the publications of Engelmann et al. The disclosed proteins were shown to be immunochemically related to two apparently different cell surface proteins by the ability of an antiserum against the binding proteins to prevent TNF binding to certain cells.

Recently, two separate groups have reported the molecular cloning and expression of a human 55 kDa TNF-R (Loetscher et al., Cell 61: 351, 1990; Schall et al., Cell 61: 361, 1990). The TNF-R of both groups has an N-terminal amino acid sequence corresponding to the partial amino acid sequence of the urinary binding protein described in GB 2218101A and by Engelmann et al. (1989) and Engelmann et al. (1990).

To elucidate the ratio of multiple forms of TNF-R and soluble TNF-binding proteins from urine, or the structural and biological features of TNF-R's and the role of TNF-R's in the response of different cell populations to stimulation by TNF or To study other cytokines, or to use the TNF-R's efficiently in therapy, diagnosis or testing, purified compositions of TNF-R were needed. However, such compositions are available in practicable yields only by cloning and expression of genes encoding receptors using recombinant DNA technology. Efforts to purify a TNF-R molecule for use in biochemical studies or to monkey and express mammalian genes encoding TNF-R are, however, hampered by the lack of a suitable source of the receptor protein or mRNA. Prior to the present invention, no cell lines were bekan.it constitutively and continuously expressing a high level of TNF-R, precluding purification of the receptor for sequencing or construction of gene libraries for cDNA cloning.

The present invention relates to isolated TNF receptors and DNA sequences encoding tumor necrosis factor (TNF-R) receptors in mammals, particularly human TNF-Rs. Such DNA sequences include (a) cDNA clones having a nucleotide sequence derived from the coding region of a native TNF-R gene; (b) DNA sequences capable of hybridizing with the cDNA clones of (a) under moderately stringent conditions and encoding biologically active TNF-R molecules; or (c) DNA sequences due to the genetic code relative to the DNA sequence defined in (a) and (b). are generated and which code for biologically active TNF-R molecules. In particular, the present invention relates to DNA sequences encoding soluble TNF receptors.

The present invention further relates to recombinant expression vectors comprising the above defined DNA sequences, recombinant TNA-R molecules produced using recombinant expression vectors, and methods of producing the recombinant TNF-R molecules using the expression vectors. The present invention further relates to isolated or purified protein compositions comprising TNF-R, especially those containing soluble forms of TNF-R.

The present invention further relates to compositions for use in the therapy, diagnosis or testing of TNF-R or for the production of antibodies to TNF-R comprising effective amounts of soluble native or recombinant receptor protein produced according to the above methods. Due to the ability of TNF to bind specifically to TNF receptors (TNF-R's), purified TNF-R compositions will be useful in diagnostic assays for TNF as well as for generating antibodies to the TNF receptor for use in diagnosis and therapy , In addition, purified TNF receptor compositions can be used directly in therapy for binding or capturing TNF, thus providing a means of regulating the immune activity of these cytokines

 These and other aspects of the present invention are explained by the following detailed description.

figure description Figure 1 is a schematic representation of the coding region of various cDNAs useful for human and murine TNF-Rs

encode. The leader sequence is hatched and the transmembrane area is bold.

Figure 2 A-2 B shows the partial cDNA sequence and the deduced amino acid sequence of the human TNF-R clone 1. Die Nucleotides are numbered beginning at the beginning of the 5 'untranslated region. The amino acids are from the beginning of

Signal peptide sequence numbered. The putative signal peptide sequence is represented by amino acids -22 to -1. The N-terminal leucine of the mature TNF-R protein is underlined at position 1. The predicted transmembrane region of amino acids 23β-265 is also underlined. The C-terminal of various soluble TNF-R's are marked with an arrow (|). Figure 3A-3C shows the cDNA sequence and deduced amino acid sequence of the murine TNF-R clone 11. The putative signal peptide sequence is represented by amino acids -22 to -1. The N-terminal valine of the mature TNf-R protein is underlined at position 1. The predicted transmembrane region of amino acids 234-265 is also underlined.

definitions

As used herein, the terms "TNF receptor" and "TNF-R" refer to proteins having amino acid sequences that are substantially similar to native mammalian TNF receptor amino acid sequences, and which are biologically active as defined below are that they are capable of binding TNF molecules and transducing a biological signal initiated by the binding of a TNF molecule to a cell, or anti-TNF-R antibodies raised against TNF-R of natural origin ( that is, "non-recombinant") can be generated by cross-reacting. The full-length mature human TNF-R is a glycoprotein with a molecular weight of approximately 80 kilodaltons (kDa). As used throughout the specification, the term "mature" refers to a protein that is expressed in a leaderless form that may be present in full length transcripts of a native gene.

Experiments using COS cells transfected with a full for TNF-rt length cDNA encoding showed daßTNF-R ¹²⁶ J-TNFa with an apparent K, of approximately 5 χ 10 ^β M ^"1 band, and in that TNF-R ^U6 J-TNFβ with an apparent K of approximately 2χ10 * M ~ 'The terms "TNF receptor" or "TNF-R" encompass analogs or subunits of native proteins having at least 20 amino acids that are at least slightly higher have biological activity with TNF-R in common, for example, soluble TNF-R constructs without a transmembrane region (which are secreted from the cell), but their ability to bind TNF is, but is not limited to, various bioequivalent protein and amino acid analogs will be described in detail below.

The nomenclature used here for TNF-R analogs follows the convention of naming the protein (for example, TNF-R) preceded by either hu (for human) or mu (for murine) \ A and a Δ (to designate deletions ) and the number of the C-terminal amino acid is adjusted wc Ίβη. For example, TNF-RA235 refers to a human TNF-R having Asp ²³⁵ as the C-terminal amino acid (ie, a polypeptide having the sequence of amino acids 1-235 of Figure 2A). In the absence of any human or murine species designation, TNF-R generally refers to mammalian TNF-R. Likewise, in the absence of any specific designation for deletion mutants, the term TNF-R refers to all forms of TNF-R, including mutants and analogs that possess the biological activity of TNF-R. "Soluble TNF-R" or "sTNF-R" as used in connection with the present invention refers to proteins or substantially equivalent analogs having an amino acid sequence corresponding to all or part of the extracellular region of native TNF-R For example, huTNF-RA235, huTNF-RA185, and huTNF-RA163, or amino acid sequences substantially similar to the sequences of amino acids 1-163, amino acids 1-185, or amino acids 1-235 of Figure 2A, are biologically active in that they bind to the ligand TNF. Equivalent soluble TNF-Rs include polypeptides encoded by one or more substitutions, deletions or additions vary and retain the ability to bind or TNF to inhibit TNF signal transduction activity via cell-surface-bound TNF receptor proteins be from these ^{sequences! '*'} " Isweise huTNF-RAx, where χ is selected from the group comprising each of the amino acids 163-235 of Figure 2A. Analogous deletions can be performed on muTNF-R. The inhibition of TNF signal transduction activity can be determined by transfecting the cells with recombinant TNF-R DNAs to obtain recombinant receptor expression. The cells are then contacted with TNF and the resulting metabolic effects examined. If there is an effect attributable to the action of the ligand, then the recombinant receptor has signal transduction activity. Exemplary methods for assaying whether a polypeptide has signal transduction activity are described by Idzerda et al., J. Exp. Med. 171: 861 (1990); Curtis et al., Proc. Natl. Acad. Be. USA 86: 3045 (1989); Prywes et al., EMBOJ. 5: 2179 (1986) and Chou et al., J. Biol. Chem. 262: 1842 (1987). Alternatively, primary cells or cell lines expressing an endogenous TNF receptor and having a detectable biological response to TNF could be used.

The term "isolated" or "purified" as used in connection with the description for defining the purity of TNF-R protein or protein compositions means that the protein or protein composition is substantially free of other natural or endogenous proteins And less than about 1%, by mass, of protein contaminants left over from the manufacturing process. However, such compositions may contain other proteins added as stabilizers, carriers, corrigents, or co-therapeutics. TNF-R is "isolated" when detectable as a single protein band in a polyacrylamide gol by silver staining.

The term "substantially similar" when used to define either amino acid or nucleic acid sequences means that a given sequence, such as a mutant sequence, differs from a reference sequence by one or more substitutions, deletions or additions, the net effect of which is to obtain the biological activity of the TNF-R protein, as can be determined, for example, in one of the TNF-R binding tests as described in Example 1 (see below) Alternatively, nucleic acid subunits and analogues "im substantially similar to the specific DNA sequences disclosed herein when (a) the DNA sequence is derived from the coding region of a native mammalian TNF-R gene; (B) the DNA sequence for hybridization with DNA sequences according to (a) under moderately stringent conditions (5O ⁰ C, 2 χ SSC) capable of and encodes biologically active TNF-R molecules; or DNA sequences which are degenerate as a result of the genetic code relative to the DNA sequences defined in (a) or (b) and which code for biologically active TNF-R molecules.

"Recombinant" as used herein means that a protein is obtained with recombinant (e.g., microbial or mammalian) expression systems.

"Microbial" refers to recombinant proteins produced in bacterial or fungal (e.g., yeast) expression systems In the case of a product, "recombinant microbial" refers to a protein produced in a microbial expression system that is substantially free of native endogenous substances. That in most bacterial

Cultures, for example E. coli generated protein will be glycan-free. Yeast-expressed proteins may have a different glycosylation pattern from expression in mammalian cells.

"Biologically active", as it is used throughout the specification as a feature of TNF receptors, means that a particular molecule shares sufficient amino acid sequence uniformity with the embodiments disclosed in the present invention so that it is capable of binding detectable levels of TNF TNF stimulus to the cell, for example, as a component of a hybrid receptor construct, or with enti-TNF-R antibodies, which are generated against TNF-R natural (ie, not recombinant) reason, cross-react biologically active TNF receptors capable of binding more than 0.1 nM of TNF per nmol receptor, more preferably of more than 0.5 nmol of TNF per nmol receptor in standard binding assays (see below). "Isolated DNA Sequence" means a DNA Polymer in the form of a separate fragment or as part of a larger DNA construct derived from DNA which is at least once it has been isolated in substantially pure form, d. h., free of contaminating endogenous materials and in an amount or concentration that enables the identification, manipulation and recovery of the sequence and nucleotide sequence components by standard biochemical techniques, for example using a cloning library. Such sequences are preferably provided in the form of an open reading frame that is uninterrupted by internal untranslated sequences or introns, which are typically present in eukaryotic genes. The genomic DNA containing the relevant sequences could be used as a source of the coding sequences. Sequences of untranslated DNA may be present in the 5 'or 3' region of the open reading frame where they do not interfere with the manipulation or expression of the coding regions. "Nucleotide. Equation "refers to a heteropolymer of deoxyribonucleotides DNA sequences encoding the proteins of the invention may also be assembled from cDNA fragments and short oligonucleotide linkers or from a series of oligonucleotides so as to provide a synthetic gene that expresses in a recombinant transcription unit can be.

Isolation of cDNAs encoding TNF-R

The coding sequence of the TNF-R is obtained by isoprene of a complementary DNA (cDNA) sequence encoding TNF-R from a recombinant cDNA or genomic DNA library. A cDNA library is preferably constructed by obtaining polyadenylated mRNA from a specific cell line expressing mammalian TNF-R, such as the human fibroblast cell line WI-26 VA4 (ATCC CCL 95.1), and mRNA as a template for synthesis double-stranded cDNA is used. The double-stranded cDNA is then packaged into a recombinant vector which is introduced into a suitable E. coli strain and propagated. Likewise, murine or other mammalian cell lines expressing TNF-R can be used. TNF-R sequences contained in the cDNA can be readily identified by screening (reading) the library with a suitable nucleic acid probe capable of hybridizing with the TNF-R cDNA. Alternatively, the DNAs encoding TNF-R proteins can be assembled by ligating synthetic oligonucleotide subunits corresponding to all or part of the sequence of Figures 2 A-2 B or 3A-3C to provide a complete coding sequence.

The human TNF receptor cDNAs of the invention were isolated by the method of direct expression cloning. A cDNA library was constructed by first isolating cyioplasmic mRNA from the human fibroblast cell line WI-26 VA4. The polyadenylated RNA was isolated and used to prepare double-stranded cDNA. Purified cDNA fragments were then ligated into pCAV / NOT vector DNA containing regulatory sequences derived from pDC 201 (a derivative of pMLSV, described by Cosman et al., Nature 312: 768, 1984), SV40 and cytomegalovirus DNA, as described in detail below in Example 2. pCAV / NOT has been deposited with the American Type Culture Collection with the accession number ATCC 68014. The pCAV / NOT vectors containing Wl 26-VA4 cDNA fragments were transformed into E. coli DH 5α. The transformants were streaked to provide approximately 800 colonies per plate. The resulting colonies were harvested and each pool used to generate plasmid DNA for transfection into COS-7 cells, essentially as described by Cosman et al. (Nature 312: 768, 1984) and Luthman et al. (Nucl. Acid Res. 11: 1295, 1983). Biologically active cell surface TNF receptor-expressing transformants were identified by examining their ability to bind ¹²⁵ J-TNF. For this screening approach, transfected COS-7 cells were incubated with medium containing " ⁵ " J-TNF, cells were washed to remove unbound labeled TNF, and the cell monolayers were contacted with X-ray film to determine the levels of TNF. Binding, as disclosed by Sims et al., Science 241: 585 (1988), thus detected transfectants appear as black foci against a relatively light background.

Using this approach, approximately 240,000 cDNAs were tested in pools of approximately 800 cDNAs until assay of a transfectant pool indicated positive foci for TNF binding. A frozen stock solution of bacteria from this positive pool was grown in culture and streaked to provide individual colonies that were screened until a single clone (clone 11) was identified that was capable of direct synthesis of a surface protein with detectable TNF-binding activity , The sequence of the cDNA clone 11 isolated by this method is shown in Figs. 3A-3C.

Additional cDNA clones can be isolated from cDNA libraries of other mammalian species by hybridization between species. For use in hybridization, the DNA encoding TNF-R may be covalently labeled with a detectable substance, such as a fluorescent group, a radioactive atom or a chemiluminescent group, using methods known to those skilled in the art. Such samples could also be used for the in vitro diagnosis of particular conditions.

Like most mammalian genes, mammalian TNF receptors are likely to be encoded by mul'i-exon genes. Alternative mRNA constructs that can be attributed to various mRNA splice events subsequent to transcription and that share large identical or similar regions with the cDNAs claimed herein will be considered to be within the scope of the herein-claimed cDNAs are considered to be in the field of considered present invention. Additional mammalian TNF-R cDNAs are isolated using appropriate human TNF-R DNA sequences as probes for screening a particular mammalian cDNA library by hybridization between species. * ''

Proteins and analogues

The present invention relates to isolated recombinant mammalian TNF-R polypeptides. Isolated TNF-R polypeptides of the present invention are substantially free of contaminating materials of natural or endogenous origin and contain less than about 1% by mass of protein contaminants resulting from the production process. The native human TNF-R molecules are recovered from cell lysates as glycoproteins of apparent molecular weight in the SDS-PAGE of approximately 80 kilodaltons (kDa). The TNF-R polypeptides of the invention may not have associated glycosylation in the native pattern.

For example, mammalian TNF-R of the invention include primate, human, mouse, canine, feline, bovine, ovine, equine and porcine TNF-R. Mammalian TNF-Rs can be obtained by hybridization between the species using a single-stranded cDNA derived from the human TNF-R DNA sequence as a hybridization probe to isolate TNF-R cDNAs from mammalian cDNA libraries.

Derivatives of TNF-R within the scope of this invention further include various structural forms of the primary protein having retained biological activity. Due to the presence of ionizable amino and carboxyl groups, the TNF-R protein may be present, for example, in the form of acidic or basic salts or in neutral form. Likewise, individual amino acid residues can be modified by oxidation or reduction.

The primary amino acid structure can be modified by forming covalent or aggregative conjugates with other chemical groups, for example, glycosyl groups, lipids, phosphates, acetyl groups, or the like, or by creating amino acid sequence mutants. Covalent derivatives are prepared by linking certain functional groups to TNF-R amino acid side chains or the N- or C-termini. Other derivatives of TNF-R within the scope of this invention include covalent or aggregative conjugates of TNF-R or its fragments with other proteins or polypeptides, for example by synthesis in recombinant culture as N-terminal or C-terminal fusions. For example, the conjugated peptide may be a signal (or leador) polypeptide sequence at the N-terminal region of the protein, co-translationally or post-translationally transferring the protein from the site of its synthesis to the site of its function inside or outside the cell membrane or Wall (for example the yeast a-factor leader). TNF-R protein fusions may include attached peptides (eg, poly-His) to facilitate purification or identification of TNF-R. The amino acid sequence of the TNF receptor can be further linked to the peptide Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK) (Hopp et al., Bio / Technology 6: 1204, 1988). The latter sequence is highly antigenic and provides an epitope that is reversibly bound by a specific monoclonal antibody, allowing a rapid assay and facilitating the purification of the expressed recombinant protein. This sequence is also specifically cleaved by bovine mucosa enterokinase on the residue immediately following Asp-Lys mating. Fusion proteins protected with this peptide may also be resistant to intracellular degradation in E. coli. TNF-R derivatives can also be used as immunogens, reagents in receptor-based immunoassays, or as binding agents for affinity purification methods of TNF or other binding ligand. TNF-R derivatives can be further obtained by cross-linking agents, for example N-maleimidobenzoyl succinimide ester and N-hydroxysuccinimide, at cysteine and lysine residues. TNF-R proteins can also be covalently linked by reactive side groups to various insoluble substrates, such as cyanogen bromide activated, bisoxirane activated, carbonyldiimidazole activated or tosyl activated agarose structures, or by adsorption to polyolefin surfaces (with or without glutaraldehyde crosslinking). Upon binding to a substrate, TNF-R can be used to selectively bind anti-TNF-R antibody or TNF (for testing or purification purposes).

The present invention further includes TNF-R in or without associated native-pattern glycosylation. TNF-R expressed in yeast or mammalian expression systems, such as COS-7 cells, may be similar or slightly different in molecular weight and glycosylation pattern to the native molecule, depending on the expression system. Expression of TNF-R DNAs in bacteria, such as E. coil, results in non-glycosylated molecules. Functional mutant analogs of mammalian TNF-R with inactivated N-glycosylation sites can be prepared by oligonucleotide synthesis and ligation or by site-directed mutagenesis techniques. These analog proteins can be produced in homogeneous form with reduced carbohydrates in good yield using yeast expression systems. N-glycosylation sites in eukaryotic proteins are characterized by the amino acid triplet Asn-ApZ, where Ai is any amino acid except Pro, and Z is Ser or Thr. In this sequence, asparagine provides a side-chain amino group for covalent attachment of carbohydrates. Such a site can be eliminated by substitution of Asn or Z for another amino acid, deletion of Asn or Z, or insertion of a non-Z amino acid between Ai and Z or an amino acid other than Asn between Asn and A ₁ . TNF-R derivatives may also be obtained by mutations of TNF-R or its subunits. A TNF-R mutant, as referred to herein, is a TNF-R homologous polypeptide, but has a different amino acid sequence from native TNF-R as a result of deletion, insertion or substitution.

Bioequivalent analogs of TNF-R proteins can be constructed, for example, by introducing various substitutions of residues or sequences or deleting terminal or internal residues from sequences that are not required for biological activity. For example, cysteine residues (e.g., Cys " ⁸ ) may be deleted or replaced with other amino acids to prevent the formation of unnecessary or incorrect intramolecular disulfide bridges upon renaturation." Other mutagenesis approaches include modification of adjacent dibasic amyloid residues to expression in yeast systems with KEX2 protease activity In general, substitutions should be made conservatively, ie, the preferred replacement amino acids are those whose physicochemical characteristics are similar to those of the residues to be replaced. Similarly, if a deletion or insertion strategy is employed, the potential effect of the deletion or insertion should be Substantially similar polypeptide sequences as defined above generally comprise a similar number of amino acid sequences, although C-terminal truncations are used for the purpose of cons tion of soluble TNF-R's will contain fewer amino acid sequences. To obtain the biological activity of TNF-R, deletion and substitution will preferably result in homologous or conservatively substituted sequences, meaning that a given residue is replaced by a biologically similar residue. Examples of conservative substitutions include substitutions of one aliphatic radical with another,

for example, VaI ₁ Leu or Ala for each other, or substitutions of one polar residue for another such as between Lys and Arg; Giu and Asp; or GIn and Asn. Other such conservative substitutions, for example, substitution of whole regions with similar hydrophobicity features, are well known. In addition, particular amino acid differences between human, murine and other mammalian TNF-Rs are an indication of additional conservative substitutions that can be made without altering the essential biological properties of TNFR. Subunits of TNF-R can be terminated by deletion! ' or internal residues or sequences. Particularly preferred sequences include those in which the transmembrane region and intracellular domains of TNF-R are deleted or substituted by hydrophilic residues and facilitate the secretion of the receptor into the cell culture medium. The resulting protein is referred to as a soluble TNF-R molecule that retains its ability to bind to TNF. A particularly preferred soluble TNF-R construct is TNF-R Δ235 (the sequence of amino acids 1-235 of Figure 2A) which encompasses the entire extracellular region of TNF-R and terminates with Asp ²³⁶ immediately adjacent to the transmembrane region. Additional amino acids can be deleted from the transmembrane region while retaining TNF binding activity. For example, in huTNF-RA183, which comprises the sequence of amino acids 1-183 of Figure 2A, and in TNF-R Δ163, which comprises the sequence of amino acids 1-163 of Fugur 2A, the ability to bind TNF ligands is obtained as determined by the binding assays described in Example 1 below. However, TNF-RA142 has not retained the ability to bind TNF ligand. This indicates that one or both of the Cys ¹⁶⁷ · and Cys ¹⁶³ residues is required to form an intramolecular disulfide bridge for the correct folding of TNF-R. Cys ¹⁷⁸ , deleted without any apparent deleterious effect on the ability of soluble TNF-R to bind TNF, does not appear to be essential for the correct folding of TNF-R. Therefore, it would be expected that any deletion C-terminal from Cys' ^{63 would} result in a biologically active soluble TNF-R. The present invention encompasses those soluble TNF-R constructs which correspond to all or part of the extracellular region of TNF-R, ending with any Cys ¹⁶³ amino acid. Other C-terminal deletions, for example TNF-FA157, can be made by cutting TNF-R cDNA with appropriate restriction enzymes and, if necessary, by reconstructing specific sequences with synthetic oligonucleotide linkers. The resulting soluble TNF-R constructs are then inserted and expressed in appropriate expression vectors and tested for their ability to bind TNF as described in Example 1. Biologically active soluble TNF-R's resulting from such constructions are also considered to be within the scope of this invention.

Mutations of the nucleotide sequences constructed for the expression of analogous TNF-R, of course, must preserve the reading frame encoding in sequences, and preferably do not create complementary regions that could hybridize to secondary mRNA structures, such as loops or hairpin structures which would adversely affect translation of the receptor mRNA. Although a site of mutation may be predetermined, it is not necessary that the nature of the mutation per se be predetermined. For example, to select the optimal characteristics of mutants at a given site, random mutagenesis may be performed on the target codon and the expressed TNF-R mutants assayed for the desired activity.

Not all mutations of the nucleotide sequence encoding TNF-R will be expressed in the final product; For example, nucleotide substitutions may be made to speed up the expression, particularly to secondary structure loops in the transcribed mRNA (see EPA 75,444A ₁ which is hereby incorporated by reference) to avoid, or at codons provide expressed readily in the selected host strain, e.g. the well-known, preferred by E. coil codons for expression in ί. coil.

In certain locations, mutations may be introduced by synthesis of oligonucleotides containing a mutant sequence flanked by restriction sites that allow ligation to fragments of the native sequence. After ligation, the resulting engineered sequence encodes an analog with the desired amino acid insertion, substitution or deletion.

Alternatively, oligonucleotide-directed site-directed mutagenesis methods can be used to provide an altered gene in which certain codons are altered, depending on the substitution, deletion or insertion required. Exemplary methods for performing the above described changes are described by Walder et al. (Gene 42: 133, 1986); Bauer et al. (Gene 37: 73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981). U.S. Patent Nos. 4,518,584 and 4,737,462 disclose suitable methods; they are hereby incorporated by reference.

Both the monovalent forms and the polyvalent forms of TNF-R are useful for compositions and methods of the present invention. The polyvalent forms have multiple TNF-R binding sites for the TNF ligand. For example, a soluble TNF-R may consist of two tandem repeats of the amino acids 1-235 of Figure 2A separated by a linker region. Alternative polyvalent forms may also be constructed using conventionally known coupling methods, for example, by chemically coupling TNF-R to any clinically acceptable carrier molecule, a polymer selected from the group consisting of Ficoll, polyethylene glycol or dextran. Alternatively, TNF-R can be chemically coupled to biotin, and the biotin-TNF-R conjugate can then be exposed to avidin, resulting in tetravalent avidin / biotin / TNF-R molecules. TNF-R can also be covalently coupled to dinitrophenol (DNP) ocWTrinitrophenol (TNP) and the resulting conjugate precipitated with anti-DNP or anti-TNP IgM to form more decameric conjugates with a valence of 10 for TNF-R binding sites , Furthermore, rhoammombinant chimeric antibody molecules can be prepared in which the variable domains of one or both of the immunoglobulin heavy and light chains are substituted by TNF-R sequences, with simultaneously unmodified constant region domains.

For example, chimeric TNF-R / IgG, consisting of two chimeric genes-a TNF-R / human κ light chain chimera (TNF-R / C _X ) and a TNF-R / human Yi heavy chain chimera (TNF-R / C _Y _ i) - be generated. Following transcription and translation of the two chimeras Gsne, the gene products combine to form a single chimeric antibody molecule with bivalent TNF-R. Such polyvalent forms of TNF-R may increase the binding affinity for the TNF-R ligand. Other details concerning the construction of chimeric antibody molecules are disclosed in WO 89/09622 and EP 315062.

Expression of recombinant TNF-R

The present invention relates to recombinant expression vectors to amplify the DNA encoding TNF-R or ex | rimieren. Recombinant expression vectors are replicable DNA constructs having synthetic or cDNA-derived DNA fragments encoding for Suugetler TNF-R or bioequivalent analogs suitably linked to a suitable transcriptional or translational regulatory element derived from mammalian, Microwave, viral or insect genes is obtained. A transcriptional unit generally comprises an assembly of (1) a genetic element or elements having a regulatory role in gene expression, such as transcriptional promoters or enhancers, (2) a structural or coding sequence which transcribes into mRNA and becomes protein-translation, and (3) suitable transcription and translation initiation and termination sequences, as described in detail below. Such regulatory elements may include an operator sequence to direct transcription, a sequence encoding suitable mRNA ribosome binding sites. The ability to replicate in a host, which is generally transmitted through an origin of replication, and a selection gene to facilitate the detection of transformants may be additionally provided. DNA regions are then suitably linked together if they are functionally related to each other. For example, the DNA for a signal peptide (secretory leader) is suitably linked to the DNA for a polypeptide when expressed as a precursor which participates in the secretion of the polypeptide. A promoter is suitably linked to a coding sequence if it controls the transcription of the sequence. A ribosome binding site is suitably linked to a coding sequence if it is arranged to allow translation. In general, a suitable compound means "to be adjacent" and, in the case of the secretory leader, adjacent and in frame. "Structural elements intended for use in yeast expression systems preferably comprise a leader sequence that regulates extracellular secretion of the translated protein by the protein Alternatively, where the recombinant protein is expressed in the leader or transport sequence, it may contain an N-terminal methionine residue, such residue optionally being cleaved from the expressed recombinant protein to provide a final product.

DNA sequences encoding mammalian TNF receptors to be expressed in a microorganism will preferably not contain introns that could prematurely terminate transcription of the DNA into mRNA; however, premature termination of transcription may be desirable, for example, if it resulted in mutants having beneficial C-terminal truncations, for example, deletion of a transmembrane region to obtain a soluble receptor that is not bound to the cell membrane. Due to the degeneracy of the code, there may be considerable variation in the nucleotide sequences encoding the same amino acid sequence. Other embodiments include sequences capable of hybridizing to the sequences of cDNA provided for grouting under moderately stringent conditions (5O ⁰ C, 2 χ SSC) are capable and other sequences associated with such Sequonzen that biologically active TNF receptor polypeptides encode, hybridize or degenerate.

Recombinant TNF-R DNA is expressed or amplified in a recombinant expression system comprising a substantially homogeneous monoculture of a suitable host microorganism, for example bacteria such as E. coil, or yeast such as S. cerevlslae which stably integrates into the chromosomal DNA (by transformation or transfection) contain a recombinant transcription unit or carry the recombinant transcription unit as part of a resident plasmid. In general, the cells constituting a system are descendants of a single ancestor transformant. Recombinant expression systems, as defined herein, express heterologous protein upon induction of regulatory elements linked to the DNA sequence or gene to be expressed.

Transformed host cells are cells that have been transformed or trarfected with TNF-R vectors that have been constructed using recombinant DNA techniques. Transformed host cells normally express TNF-R, but host cells that have been transformed for the purpose of cloning or amplifying TNF-R DNA do not need to repress TNF. Expressed TNF-R will be deposited in the cell membrane or secreted into the culture supernatant, depending on the TNF-R DNA selected. Suitable host cells for the expression of mammalian TNF-R include prokaryotes, yeast or higher eukaryotic cells under the control of suitable promoters. Prokaryotes include Gram-negative or Gram-positive organisms, such as E. coil or bacilli. Higher eukaryotic cells include established mammalian cell lines as described below. Furthermore, cell-free translation systems could be used to generate mammalian TNF-R using RNAs derived from the DNA constructs of the present invention. Suitable cloning and expression vectors for use in bacterial. Fungal, yeast and mammalian cell hosts are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, New York, 1985), the relevant disclosure of which is hereby incorporated by reference.

For expression of TNF-R, prokaryotic expression hosts may be used which do not require extensive proteolytic and disulfide processing. Prokaryotic expression vectors generally comprise one or more phenotypically selectable markers, for example, a gene encoding proteins that confer antiblotic resistance or provide an autotrophic requirement, and an origin of replication recognized by the host to ensure amplification in the host , Suitable prokaryotic hosts for transformation include E. coil. Bacillus subtilis, Salmonella typhlmurlum and various species within the genera Pseudomonas, Streptomyces and Staphylococcus, and optionally others may be used as well.

Useful expression vectors for use in bacteria may include a selectable marker and a bacterial origin of replication derived from commercially available plasmids containing genetic elements of the well-known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, WI, USA). These pBR322 "backbone sections are combined with a suitable promoter and the structural sequence to be expressed. E. coli is typically transformed using derivatives of pBR322, a plasmid derived from an E. coli species (Bolivar et al., Gene 2: 95, 1977). pBR322 contains genes for ampicillin and tetracycline resistance and therefore provides a simple means of identifying transformed cells.

Promoters normally used in recombinant microwave expression vectors include the β-lactamase (penileyline) and lactose promoter system (Chang et al., Nature 275: 615, 1978; and Goeddel et al., Nature 281: 544, 1979), the tryptophan ( trp) promoter system (Goeddel et al., Nucl. Acids Res. 8: 4057, 1980; and EPA 36,766) and the tac promoter (Manlatis, Molecular Cloni g: A Laboratory Manual, Cold Spring Harbor Laboratory, p. 1982). Particularly useful bacterial expression systems utilize the phage λ P _L promoter and the thermolabile El 857 ts repressor. Plasmid vectors available from the American Type Culture Collection which incorporate derivatives of the XP _L promoter include the plasmid pHUB2, which is expressed in E. coli strain JMB9 (ATCC 37092), and pPLc28, which is expressed in E. coli RR1 (ATCC 53082) is included.

Recombinant TNF-R proteins may also be expressed in yeast host cells, preferably those of the species Saccharomyces, for example Saccharomyces cerevlslae, exp- ^! be miert. Yeasts of other genera, for example Pichla or Kluyveromyces, may also be used. Yeast vectors generally contain an origin of replication of 2μ yeast plasmid or an autonomously replicating sequence (ARS), a promoter, a DNA encoding TNF-R, sequences for polyadenylation and transcription termination, and a selection gene. Preferably, yeast vectors include an origin of replication and selectable markers that permit transformation of both yeast and E. coli, such as the E. coli ampicillin resistance gene and the S. cerevisyl TRP1 or UHA3 gene, which is a selection marker for a yeast mutant strain which lacks the ability to grow on tryptophan, and a promoter derived from a highly expressed yeast gene to induce transcription of the downstream structural sequence. The presence of the TRP1 or URA3 defect in the yeast host cell genome is an environment suitable for detecting transformation by growth in the absence of tryptophan or uracil. Suitable promoter sequences in yeast vectors include the promoters for metalothionin, 3-phosphoglycerate kinase (Hitzeman et al., J. Org Biol. Chem. 255: 2073, 1980) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7: 149, 1968; and Holland et al., Biochem. 17: 4900, 1978), for example Enolase, glyceraldehyde-S-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPA 73,657.

Preferred yeast vectors can be assembled using DNA sequences from pUC18 for selection and replication in E. coli (Amp 'gene and origin of replication) and yeast DNA sequences including the glucose-repressible ADH2 promoter and the a-factor secretory leader peptide. The ADH 2 promoter is described by Russell et al. (J. Biol. Chem. 258: 2674, 1982) and Beier et al. (Nature 300: 742, 1982). The yeast a-factor leader peptide, which controls the secretion of heterologous protein, can be inserted between the promoter and the structural gene to be expressed. See, for example, Kurjan et al., Cell 30: 933, 1982; and Bitter et al., Proc. Natl. Acad. Be. USA 81: 5330, 1984. The leader sequence can be modified to contain one or more useful restriction sites near its 3 'end to facilitate fusion of the leader sequences with foreign genes.

Suitable protocols for the transformation of yeast are known in the art; An exemplary method is described by Hinnen et al., Proc. Natl. Acad. Be. USA 75: 1929, 1978, using in a selection medium consisting of 0.67% yeast nitrogen base, 0.5% casaminoacids, 2% glucose, 10 μg / ml adenine, and 20 μg / ml uracil for Trp ⁺ Transformants, or in a 0.67% YNB-containing medium with amino acids and bases, described by Sherman et al., Laboratory Course Manual for Methods at Yeast Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1986, for URA ⁺ Transforms is selected.

The host cells transformed with the ADH2 promoter-bearing vectors can be grown for expression in a rich medium containing 1% yeast extract, 2% peptone and 1% or 4% glucose supplemented with 80 μg / ml adenine and βΟμρ / ηηΙ uracil. The derepression of the ADH 2 promoter occurs after depletion of glucose in the medium. A crude yeast supernatant is harvested by filtration and stored at 4 prior to further purification ^0C.

For expression of recombinant protein, various mammalian or insect cell culture systems can be advantageously used. Expression of recombinant protein in mammalian cells is particularly preferred because such proteins are generally correctly folded, appropriately modified and fully functional. Examples of suitable mammalian host cell lines include the monkey kidney cell COS-7 line described by Gluzman (Cell 23: 175,1981) and other cell line capable of expressing suitable vectors, for example L cells, C127,3T3, Chinese hamster ovary (CHO ), HeLa and BHK cell lines. Mammalian expression vectors may include non-transcribed elements, for example, an origin of replication, a suitable promoter and an enhancer linked to the gene to be expressed, as well as other 5 'or 3' flanking, non-transcribed sequences and 5 '' or 3 'untranslated Sequences, such as the necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcription termination sequences. Baculovirus systems for the production of heterologous proteins in insect cells have been reviewed by Luckow and Summers, Bio / Technology 6:47 (1988).

The transcriptional translation control sequences in the expression vectors to be used for transformation of vertebrate cells can be provided from viral sources. For example, common promoters and enhancers are the DNA sequences derived from Polyoma, Adenovirus 2, Simian Virus 40 (SV40), and human cytomegalovirus. The DNA sequences derived from the SV40 viral genome, for example the SV40 origin of replication, the early and late promoter, enhancer, splice and polyadenylation sites can be used to identify the other genetic elements required for the expression of heterologous DNA sequences to provide. The early and late promoters are particularly useful because both can be readily obtained from the virus as a fragment which also contains the viral SV40 origin of replication (Fiers et al., Nature 273: 113, 1978). Smaller or larger SV40 fragments may also be used, provided that the approximately 250 bp sequence extending from the Hind3 site towards the Bg11 site located in the viral origin of replication is included. Further, the genomic TNF-R promoter, mammalian control and / or signal sequences may be used, provided that such control sequences are compatible with the chosen host cell. Additional details regarding the use of high expression vectors in mammals to produce a mammalian recombinant TNF receptor are described in Examples 2 and 7 below. Exemplary vectors can be constructed as disclosed by Okayama and Berg (Mol. Cell. Biol. 3: 280,1983).

A useful system for stable expression of mammalian receptor cDNAs in C127 mouse mammary epithelial cells can be constructed essentially as described by Cosman et al. (Mol. Immunol. 23: 935, 1986). In preferred embodiments of the present invention, recombinant expression vectors containing TNF-R cDNAs are stably integrated into the DNA of a host cell. Elevated levels of the expression product are obtained by selection of cell lines with amplified numbers of vector DNA. Cell lines with amplified numbers of vector DNA are selected, for example, by transforming a host cell with a vector comprising a DNA sequence coding for an enzyme inhibited by a known drug. The vector may further comprise a DNA sequence encoding a desired protein. Alternatively, the host cell may be treated with a second vector comprising a DNA sequence encoding the desired protein,

be co-transformed. The transformed or co-transformed host cells are then cultured with increasing concentrations of the known drug and thus selected for drug-resistant cells. Such drug-resistant cells survive in increased concentrations of the toxic agent by overproduction of the enzyme which is inhibited by the drug, often as a result of amplification of the gene encoding the enzyme. Where drug resistance is caused by an increase in the copy number of the vector DNA encoding the inhibitable enzyme, there is a co-amplification of the vector DNA encoding the desired protein (TNF-R) in the DNA of the host cell ,

A preferred system for such co-amplification uses the gene for dihydrofolate reductase (DHFR), which can be inhibited by the drug methothrexate (MTX). To achieve co-amplification, a host cell lacking an active DHFR-encoding gene is either transformed with a vector comprising a DNA sequence encoding DHFR and a desired protein, or co-transformed with a vector A vector comprising a DHFR-encoding DNA sequence and a vector comprising a DNA sequence encoding the desired protein. The transformed or co-transformed host cells are cultured in media containing increasing levels of MTX, and those cell lines that survive are selected.

A particularly preferred co-amplification system uses the gene for glutamine synthetase (GS), which is responsible for the synthesis of glutamate and ammonia, using the hydrolysis of ATP to ADP and phosphate to carry out the reaction. GS is inhibited by a variety of inhibitors, for example, methionine sulphoximine (MSX). TNF-R can therefore be produced in high concentrations by co-amplification of cells transformed with a vector comprising a DNA sequence for GS and a desired protein, or with a vector encoding a DNA coding for GS. Sequence, and a vector comprising a DNA sequence encoding the desired protein, cotransformed, culturing the host cells in media having increasing MSX levels, and selecting the surviving cells. The GS co-amplification system, suitable recombinant expression vectors and cell lines are described in the following PCT applications: WO 87/04462, WO 89/01036, WO 89/10404 and WO 86/05807. Recombinant proteins are preferred by co-amplification of DHFR or GS in a mammalian host cell, for example Chinese hamster ovary (CHO) cells, or alternatively in a mouse myeloma cell line, for example SP 2/0-AG14 or NSO, or a rat Myeloma cell line, for example YB2 / 3.0-Ag20, disclosed in PCT applications WO 89/10404 and WO 86/05807.

A preferred eukaryotic vector for the expression of TNF-R DNA is disclosed below in Example 2. This vector, designated pCAV / NOT, was derived from the mammalian expression vector pDC201 and contains regulatory sequences from SV40, adenovirus 2, and human cytomegalovirus.

Purification of recombinant TNF-R

Purified mammalian TNF receptors or analogs are prepared by culturing suitable host / vector systems for expression of the recombinant translation products of the DNAs of the invention and then purified from the culture medium or cell extracts.

For example, supernatants from systems secreting recombinant protein into the culture media may first be concentrated using commercially available protein concentration filters, for example, an Amicon or Millipor Pelllcon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a suitable cleaning matrix. For example, a suitable affinity matrix may comprise TNF or lectin or antibody molecules bound to a suitable support. Alternatively, an anion exchange resin may be used, for example, a matrix or a substrate having free diethylaminoethyl (DEAE) groups. These matrices may be of the acrylamide, agarose, dextran, cellulose or other type commonly used for protein purification. Alternatively, a cation exchange step may be used. Suitable cation exchangers include various insoluble matrices having sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred. Finally, one or more "reversed-phase" high pressure liquid chromatography (HP-HPLC) steps using hydrophobic RP-HPLC media, for example, silica gel with free methyl or other aliphatic groups, may be used to further purify a TNF. Some or all of the above purification steps may also be used in various combinations to provide a homogeneous recombinant protein.

A recombinant protein produced in a bacterial culture is usually isolated by an initial extraction from the cell pellets followed by one or more concentration steps, salting out, aqueous ion exchange, or size exclusion chromatography steps. Finally, high performance liquid chromatography (HPLC) can be used for the final purification steps. The microbial cells used to express recombinant mammalian TNF-R can be disrupted by any suitable method, including freezing and thawing cycles, sonication, mechanical disruption, or the use of cell lysing agents.

The fermentation of yeasts f / xing mammalian TNF-R as a secreted protein greatly facilitates purification. Secreted recombinant proteins derived from a large scale fermentation can be prepared by methods analogous to those described by Urdal et al. (J. Chromatog., 296: 171, 1984). This reference describes two consecutive "reversed-phase" HPLC steps for the purification of recombinant human GM-CSF on a preparative HPLC column.

In a recombinant culture, human TNF-R is synthesized by the presence of non-human cell constituents, including proteins, in amounts and of a character that depends on the purification steps performed to recover the human TNF-R from the culture. These components are usually derived from yeast, prokaryotic or non-human higher eukaryotes, and are preferably present in non-harmful contaminating amounts on the order of less than about 1% by weight. Further, recombinant cell culture allows the production of TNF-R, which is free of proteins normally associated with TNF-R as found in nature in the species from which it is derived, for example, in cells, Cell exudates or body fluids.

Therapeutic use of recombinant soluble TNF-R

The present invention relates to methods of using thorn-singicidal compositions comprising an effective amount of soluble TNF-R protein and a suitable diluent and carrier, and to methods of suppressing TNF-dependent inflammatory responses in humans which involve the use of an effective amount of soluble TNF. R protein.

For therapeutic use, purified soluble TNF-R protein is administered to a patient, preferably a human, for treatment in a manner appropriate to the indication. Thus, soluble TNF-R protein compositions can be administered by, for example, bolus injection, continuous infusion, sustained release from implants, or other suitable methods. Typically, a soluble TNF-R therapeutic agent will be applied in the form of a composition comprising purified protein in association with physiologically acceptable carriers, corrigents or diluents. Such carriers will not be toxic to the recipient at the dosages and concentrations employed. Typically, the preparation of such compositions involves the combination of TNF-R with buffers, antioxidants such as ascorbic acid, low molecular weight polypeptides (more than about 10 residues), proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents, for example, EDTA, glutathione and other stabilizers and corrigents. For example, neutral buffered saline or saline mixed with a species-specific serum albumin are adequate diluents. Preferably, the product is formulated as a lyophilizate using appropriate corrugating solutions (e.g., sucrose) as a diluent. Reasonable doses may have been determined in preliminary experiments. The amount and frequency of administration will, of course, depend on such factors as the nature and seriousness of the indication being treated, the response desired, the condition of the patient, and so on.

Soluble TNF-R proteins are administered for the purpose of inhibiting TNF-dependent responses. A variety of diseases or conditions are believed to be caused by TNF, such as cachexia and septic shock. In addition, other key cytokines (IL-1, IL-2 and other colony stimulating factors) may also induce significant production of TNF in the host. Soluble TNF-R compositions can therefore be used, for example, for the treatment of cachexia or septic shock or for the treatment of side effects associated with cytokine therapy. Because of the primary role that IL-1 and IL-2 play in the production of TNF, an X-combination therapy using IL-1 receptors and IL-2 receptors is preferred for the treatment of TNF-associated clinical indications his

 The following examples illustrate the invention without limiting it.

Examples

Example 1 Binding Tests

A. Radiolabeling of TNFα and TNFβ. Recombinants human TNFa in the form of a fusion protein containing bin hydrophilic octapeptide at the N-terminus was expressed in yeast as a secreted protein and purified by affinity chromatography (Hopp et al., Bio / Technology 6: 1204, 1988). Purified recombinant human TNFβ was purchased from R & D Systems (Minneapolis, MN). Both proteins were radiolabeled using the commercially available solid phase agent, IODO-GEN (Pierce). In this method 5pglODO-GEN were submitted to the bottom of a 10mm 75mm χ Glasrohras and incubated for 20 minutes at 4 ° C with 0.1 M 75μΙ Natriumphosphsi, pH 7.4 and 20μΙ (2mCi) Na ¹²⁶ J. This solution was then transferred to a second glass tube, dss Rpg TNFa (or TNFß) contained in 45μΙ PBS for 20 minutes at 4 ⁰ C. The reaction mixture was purified by gel filtration on a 2 ml bed volume of Sephadex G-25 (Sigma) equilibrated in Roswell Park Memorial Institute (RPMI) 1640 medium containing 2.5% (w / v) bovine serum albumin (BSA), 0.2% (w / v) Sodium azide and 10 mM Hepes pH 7.4 (binding medium), fractionated. Final pool of ¹²⁶ J-TNF C, it was 10 ^"7 M diluted to a working stock solution of 1 x in binding medium and stored for up to one month at 4 ° C without detectable loss of receptor binding activity. The specific activity is usually 1 x 10 ⁵ cpm / mmol TNF.

B. Binding to intact cells. Binding assays with intact cells were performed by two methods. In the first method, the cells were first grown either in suspension (e.g., U 937) or by attachment to tissue culture plates (e.g., WI 26-VA4, COS expressing the recombinant TNF receptor). The attached cells were then removed by treatment with 5 mM EDTA10 minutes at 37 ⁰ C. The binding assay was then performed by the phthalate-oil separation method (Dower et al., J. Immunol., 132: 751, 1984) essentially as described by Park et al. (J. Biol. Chem. 261: 4177, 1986). Nonspecific binding of ¹²⁵ I-TNF was measured in the presence of a 200-fold or greater molar excess of unlabeled TNF. In the binding assays, sodium azide (0.2%) was included to inhibit the internalization of ¹²⁶ J-TNF by the cells. In the second method were incubated with the TNF-R-containing plasmid transfected COS cells expressing ^H ie TNF receptors on the surface tested for their ability to ^J-126 by means of the TNF in Sims et al. (Science 241: 585, 1988).

C. Solid Phase Binding Assays. The ability of TNF-R to stably adsorb to human nitrocellulose from detergent extracts of humanon cells while retaining TNF-binding activity provided a means of detecting TNF-R. The cell extracts were prepared by mixing a cell precipitate with a 2X volume of PBS containing 1% Triton X-100 and a cocktail of protease inhibitors (2 mM phenylmethylsulfonyl fluoride 10 μM pepstatin. 1 μM leupeptin, 2 mM o-phenanthroline and 2 mM EGTA) by vigorous mixing. The mixture was incubated on ice for 30 minutes, then centrifuged at 12,000xg for 15 minutes at 8 ° C to remove nuclei and other debris. 2 microliter aliquots of cell extracts were applied to dry BA 85/21 nitrocellulose membranes (Schleicher and Schuell, Keene, NH) and dried. The membranes were incubated in cell culture dishes for 30 minutes in Tris (0.05M) -buffered saline (0.15M) pH 7.5 with 3% w / v BSA to block non-specific binding sites. The membrane was then covered with 5 χ 10 "M ¹²⁶ J-TNF in PBS + 3% BSA and incubated for 2 hours at 4 ° C with shaking. At the end of this time, the membrane was washed three times in PQS, dried, and placed on a Kodak X-Omat AR membrane for 18 hours at -70 ° C.

Example 2 Isolation of Human TNF-R cDNA by Direct Expression of the Active Protein In COS-7 Cells

Various human cell lines were assayed for Ue expression of TNF-R based on their ability to bind ^I26 J-labeled TNF. When human fibroblast Zellir \ s Wl-26 VA4 was found that they expressed an acceptable number of receptors per cell. Equilibrium binding studies showed that the cell line has a biphasic binding of ¹²⁶ J-TNFmU at approximately 4,000 sites of high affinity (K ₁ = 1 x 10 ¹⁰ M ^-1 ) and 15,000 sites of low affinity (K. = 1 x 10 ⁸ M- ') Cell had.

Reverse transcription of polyadenylated mRNA was used to construct a non-sized cDNA Ba.iK isolating the polyadenylated mRNA from total RNA extracted from human fibroblasts of Wl26-VA4 cells using the cells in the presence of pokeweed mitogen using were waxed by standard methods (Gubler et al., Gene 25: 263, 1983; Ausübet et al., eds. Current Protocols in Molecular Biology, Vol. 1.1987). The cells were harvested by lysing the cells in a guanidine hydrochloride solution and the total RNA isolated as previously described (March et al., Nature 315: 641, 1985).

Poly A ⁺ RNA was isolated by OligodT cellulose chromatography and double-stranded cDNA was prepared by a method similar to that of Gubler and Hoffman (Gene 25: 263, 1983). Briefly, the poly A ⁺ RNA was converted with reverse transcriptase using OligodT as a primer into an RNA cDNA hybrid. The RNA-cDNA hybrid was then transferred to double-stranded cDNA using RNAase H in combination with DNA polymerase I. The resulting double-stranded cDNA was blunt-ended by T4 DNA polymerase. EcoRI 1 linker adapters (with an internal Not 1 site) attached to the blunt ended cDNA were phosphorylated at one end (Invitrogen). The linker-adapter cDNA was treated with T4 polynucleotide kinase to phosphorylate the 5 'protruding region of the linker adapter, and unligated linkers were removed by passing the cDNA over a Sepharose CL4B column. The linker adapter cDNA was ligated with an equimolar concentration of EcoR 1 cut and dephosphorylated arms of bacteriophage Agt 10 (Huynh et al., DNA Cloning: A Practical Approach Glover, ed., IRL Press, pp. 49-78). The ligated DNA was packaged into phage particles using commercially available kits to create a recombinant library (Stratagene Cloning Systems, San Diego, CA, USA). The recombinants were amplified by plating the phages on a bacterial lawn of E. coli strain C600 (hfl ").""From the resulting Xgt" 10 "cDNA library, phage DNA was purified and the cDNA inserts were excised by digestion with the restriction enzyme Not" 1 " After electrophoresis of the agarose gel digest, cDNAs greater than 2,000 bp were isolated.

The resulting oDNAs were ligated into the eucaryotic expression vector pCAV / NOT, which was designed to express cDNA sequences when inserted into its "multiple cloning site" after transfection into mammalian cells pCAV / NOT was isolated from pDC 201 (Fig. a derivative of pMLSV previously described by Cosman et al., Nature 312: 768, 1984), SV40 and cytomegalovirus DNA, and comprises in sequence the direction of transcription from the origin of replication: (1) SV40 sequences from positions 5171-270 inclusive (2) cytomegalovirus sequences including the promoter and enhancer regions (nucleotides 671 - +63 of the sequence published by Boechart et al., (Cell 41: 521, 1985)); (3) adenovirus 2 sequences containing the first exor and part of the intron between the first and second exon of the tripartite leader, the second exon and a part of the third exon of the tripart itleaders and a multiple cloning site (MCS) with restriction sites for Xho 1, Kpn 1, Sma 1, Not 1 and Bg11; (4) SV40 sequences from positions 4127-4100 and 2770-2533, which include the polyadenylation and termination signals for early transcription; (5) sequences derived from pBR322 and virus-associated sequences VAI and VAII from pDC 201, wherein the adenovirus sequences 10532-11156 contain the VAI and VAII genes, followed by pBR322 sequences of 4363-2486 and 1094-375 which contain the ampicillin. Contain resistance gene and the origin of replication. The resulting Wl26-VA4 cDNA library in pCAV / NOT was used to transform E. coli strain DH5a and the recombinants were streaked to provide approximately 800 colonies per plate and sufficient plates to provide approximately 50,000 total colonies per screening step , plated. From each plate, the colonies were scraped off, collected and plasmid DNA prepared from each pool. The pooled (pooled) DNA was then used to transfect a sub-confluent layer of monkey COS-7 cells using DEAE-dextran followed by chloroquine treatment as described by Luthr.ian et al. (Nucl. Acids Res., 11, 1295, 1983) and McCutcnan et al. (J. Natl. Cancer Inst. 41: 351, 1986). The cells were grown in culture for 3 days to allow transient expression of the inserted sequences. After 3 days, the cell culture supernatants were discarded and the cell monolayers in each plate examined for TNF binding as follows. 3ml of binding medium containing 1.2x10 "M ¹²⁸ J-labeled FLAG ⁿ -TNF was added to each plate and the plates were incubated at 4 ° C for 120 minutes, this medium was discarded, and each plate was washed once with cold binding medium. the no labeled TNF contained) and washed twice with cold PBS. the corners of each plate were then broken off, leading to a flat disk that ⁰ C (with an X-ray film for 72 hours at -7O using an intensifying screen intensifying screen) in contact TNF binding activity was visualized on the exposed film as a dark focus against a relatively uniform background.

After about 240000 recombinants of the library had been assayed in this manner, a transfectant pool was observed to have TNF-binding foci clearly visible against the background exposure. Frozen stock bacteria from the positive pool were then used to obtain plates of approximately 150 colonies. From these plates, replicas were made on nitrocellulose filters; the plates were then scraped off and plasmid ONA prepared and transfected as described above to identify a positive plate. Bacteria of individual colonies from the nitrocellulose replicas of this plate were grown in 0.2 ml cultures used to contain plasmid DNA, which was transfected into COS-7 cells as described above. In this way, a single clone, clone 1, was isolated which was able to induce the expression of human TNF-R in COS cells. The expression vector pCAV / NOT, which contains the TNF-R cDNA clone 1, has been deposited bsi of the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD 20852, USA with the accession number 68088 under the name pCAV / NOT-TNF-R ,

Example 3 Construction of cDNAs encoding soluble huTNF-RA235 A cDNA. which encodes soluble huTNF-RA235 (which has the sequence of amino acids 1-235 of Figure 2A) was Excision of an 840 bp fragment from pCAV / NOT-1 NF-R constructed with the restriction enzymes Not 1 and Pvu 2. Distress 1

cuts at the "multiple cloning site" of pCAV / NOT-TNF-R and Pvu2 cuts within the coding region of

TNF-R20 nucleotides 5 'from the transmembrane region. To reconstruct the 3 'end of the TNF-R sequences

2 oligonucleotides are synthesized and hybridized (annealed) to each other to create the following oligonucleotide linker:

Pvu2 BamHl BgI2

CTGAAGGGAGCACTGGCGACIiAGGATCCA GACTTCCCTCGTGACCGCTGATTCCTAGGTCTAG> »: aGluGlySerThrGlyAap £ ü £ k

This oligonucleotide linker has terminal Pvu 2 and Bg 12 restriction sites, regenerates 20 nucleotides of TNF-R, followed by a termination codon (underlined) and a BamH 1 restriction site (to facilitate isolation of all soluble TNF-R by Not 1 / BamH 1 digestion). This oligonucleotide was then probed with the 840bp Not 1 / Pvu 2 TN.M? Insert into Bg 12 / Not 1 cut pCAV / NOT ligand to result in psolhuTNF-RA235 / CAVNOT transfected into COS-7 cells as described above. This expression vector induced the expression of soluble human TNF-R capable of binding TNF.

Example 4 Construction of cDNAs encoding f Qr soluble huTNF-RA185 A cDNA encoding a soluble huTNF-RA185 (having the sequence of amino acids 1-185 of Figure 2A) was constructed, By excising a 640 bp fragment from pCAV / NOT-TNF-R with the restriction enzymes Not 1 and Bg 12. not1

cleaves in the "multiple cloning site" of pCAV / NOT-TNF-R and Bg 12 cuts within nucleotide 637 within the coding region of TNF-R, which is 237 nucleotides 5 'of the transmembrane region.

The following oligonucleotide linkers were synthesized:

Bgl2 5 · -GATCTGTAACGTGGTGGCCATCCCTGGGAATGCAAGCATGGATGC-a ·

ACATTGCACCACCGGTAGGGACCCTTACGTTCG IleCysAsnValValAlalleProGlyAsnAlaSerMetAspAla

notl

5 '- AGTCTGCACGTCCACGTCCCCCACCCGGIGAGC -3' TACCTACGTCAGACGTGCAGGTGCAGGGGGTGGGCCACTCGCCGG ValCysThrSerThrSerProThrArgEndt

The above oligonucleotide linkers reconstruct the 3 'end of the receptor molecule to nucleotide 706 followed by a termination codon (underlined). These oligonucleotides were then ligated to the 640bp Not 1 TNF-R insert in Not1 cut pCAVB / NOT to give the expression vector psolTNF-RA185 / CAVNOT, which was transfected into COS-7 cells as described above. This expression vector induced expression of soluble human TNF-R capable of binding TNF.

Example 5 Construction of cDNAs encoding soluble huTNF-RA163 A cDNA encoding a soluble huTNF-RA163 (having the sequence of amino acids 1-163 of Figure 2A) was constructed,

by excising a 640 bp fragment from pCAV / NOT-TNF-R with the restriction enzymes Not 1 and Bg 12 as described in Example 4. The following oligonucleotide linkers were synthesized:

BgI2 Notl 5'-GATCTGTlGaGC -3 '

ACAACTCGCCGG IIeCyaEnde

The above oligonucleotide linker reconstructs the 3 'end of the receptor molecule up to nucleotide 642 (amino acid 163) followed by a termination codon (underlined). The oligonucleotide was then ligated with the 640 bp Not 1TNF-R insert in Not 1 cut pCAV / NOT to give the expression vector psolTNF-RA163 / CAVNOT, which was transfected into COS-7 cells as described above. This expression vector induced the expression of soluble human TNF-R capable of binding TNF in the binding assays described in Example 1.

Example β

Construction of cDNAs encoding soluble huTNF-RA142

A cDNA encoding a soluble huTNF-RA142 (having the sequence of amino acids 1-142 of Figure 2A) was constructed by excising a 550 bp fragment from pCAV / NOT-TNF-R with the restriction enzymes Not 1 ui id AIwN 1 has been. AIwN 1 cuts within the TNF-R coding region at nucleotide 649. The following oligonucleotide linker was synthesized:

Bgl2 Notl

5'-CTGAAACATCAGACGTGGTGTGCAAGCCCTGT TAAA -a 'CTTGACTTTGTAGTCTGCACCACACGTTCGGGACAATTTCTAGA

End

The above oligonucleotide linker reconstructs the 3 'end of the receptor molecule to nucleotide 579 (amino acid 142), followed by a termination codon (underlined). This oligonucleotide was then ligated with the 550bp Not 1 / AlwN 1 TNF-R insert into Not 1 / Bg 12 cut pCAV / NOT to give the expression vector psolTNF-RA142 / CAVNOT, which transfected into COS-7 cells as described above has been. This expression vector did not induce the expression of soluble human TNF-R capable of binding TNR. It is believed that this particular construct failed to express biologically active TNF-Rs because one or more of the essential cysteine residues, such as Cys' ⁶⁷ or Cys ^163, are responsible for intramolecular binding (to form the correct tertiary structure of TNF R-molecule) were eliminated.

Example 7

Expression of soluble TNF receptors in CHO cells

Soluble TNF receptors have been expressed substantially in Chinese hamster ovary (CHO) cells using the glutamine synthetase (GS) gene amplification system, as described in PCT Application Nos. WO 87/04462 and WO 89/01, U36 is. Briefly, CHO cells were transfected with an expression vector containing the genes for both TNF-R and GS. CHO cells were selected for GS gene expression based on the ability of transfected DNA to confer resistance to low levels of methionine sulphoximine (MSX). The GS sequence amplification events in such cells are selected by increased MSX levels. In this way, contiguous TNF-R sequences are also amplified and increased TNF-R expression is achieved.

The vector used in the GS expression system was psolTNF-R / P6 / PSVLGS, which was constructed as follows. First, the vector pSVLGS.1 (described in PCT applications WO 87/04462 and WO 89/01036, available from Celltech, Ltd. Berkshire, UK) was cut with the restriction enzyme BanH 1 and dephosphorylated with calf intestinal alkaline phosphatase (CIAP) to prevent the vector from ligating with itself. The BamH 1 cut pSVLGS.1 fragment was then ligated with a 2.4 kb BamH 1 -Bg 12 fragment from pEE6hCMV (described in PCT Application No. WO 89/01036 also available from Celltech) labeled Bg 12, BamH 1 and Fsp 1 were cut to avoid two fragments of similar size so as to give a 11.2kb vector designated p6 / PSVLGS.1. pSVLGS.1 contains the selectable glutamine synthetase marker gene under the control of the SV40 late promoter. The BamH1-Bg12 fragment from pEE6hCMV contains the human cytomegalovirus major immediate early major promoter, a polylinker, and the SV40 early polyadenylation signal The soluble TNF-R coding sequences became p6 /PSVLGS.1 was added by excising a Not 1-BamH 1 fragment from the expression vector psolTNFR / CAVNOT (prepared according to Example 3 above), blunt-ended with Klenow enzyme, and ligated with Sma1-cut dephosphorylated p6 / PSVLGS.1 which put the encoded solTNF-R sequences under the control of the hCMV promoter, resulting in a single plasmid vector by transcribing the SV40 / GS and hCMV / solTNF-R transcriptional units in opposite directions This vector was designated as psolTNFR / p6 / PSVLGS.

psolTNF / p6 / PSVLGS was used to transfect CHO-K 1 cells (available from ATCC, Rochville, MD, under accession number CCL61) wio follows. A single layer of CHO-K 1 cells was subclenched in Minimum Essential Medium (MEM) 10X (Gibco: 330-1581 AJ) without glutamine and supplemented with 10% dialyzed fetal bovine serum (Gibco: 220-6300 AJ), 1mM Sodium pyruvate (Sigma), MEM nonessential amino acids (Gibco: 320-1140AG), 50OuM asparagine and glutamate (Sigma) and nucleosides (3OuM adenosine, guanosine, cytidine and uridine and 1OuM thymidine) (Sigma).

Approximately 1 x 10 ^β cells per 10 cm Petri throat were transfected with 10 μg psol TNFR / p6 / PSVLGS by the standard calcium phosphate precipitation method, essentially as described by Graham and van der Eb, Virology 52: 456 (1983) has been. Cells were glycerol shocked (50% glycerol in serum-free culture medium, approximately 1.5 minutes) essentially as described by Frost and Williams, Virology 91:39, (1978) and then serum-free at approximately 4 hours post-transfection Washed medium. One day later, the transfected cells were fed with fresh selective medium containing MSX at a final concentration of 25 μM. Colonies of MSX-resistant surviving cells became visible within 3-4 weeks. Surviving colonies were transferred to 24-well plates and grown to confluency in selective medium. Confluent well conditioned medium was then assayed for the activity of soluble TNF-R using the binding assay described in Example 1. These tests indicated that the colonies expressed biologically active soluble TNF-R.

To select for GS gene amplification, several MSX-resistant cell lines were transfected with psolTNFR / p6 / PSVLGS and grown at various concentrations of MSX. For each cell line, approximately 1x10 cells were plated in incrementally increasing concentrations of 100μΜ, 250μΜ, 500μΜ and 1mM MSX and incubated for 10-14 days. After 12 days, colonies appear which are resistant to higher levels of MSX. The surviving colonies were assayed for TNF-R activity using the binding assay described in Example 1. Each of these highly resistant cell lines contains cells derived from multiple independent amplification events. From these cell lines one or more of the most resistant cell lines were isolated. The amplified cells at high production rates were then cloned by limiting dilution cloning. Transfectant bulk cell cultures soluble soluble TNF-R.

Expression of soluble human TNF-Rs in yeast

Soluble human TNF-R were expressed in yeast with the expression vector XLY 432 derived from the yeast expression vector plXY120 and the plasmid pYEP352. plXY120 is identical to pYahuGM (ATCC 53157), except that it contains no cDNA insert and contains a polylinker / multiple cloning site without an Nco1 restriction site.

A TNF receptor-encoding DNA fragment suitable for cloning into the yeast expression vector plXY 120 was first amplified by polymerase chain reaction (PCR) amplification of the extracellular portion of the full length receptor from pCAV / NOT-TNF-R (ATCC 68088) The following primers were used in this PCR amplification:

5 'End Prime r

5 -TTCCGGTACCTTTGGATAAAAGAGACTACAAGGAC A3p718-> ProLeuA3pLysArgAapTyrLysAsp

GACGATGACAAGTTGCCCGCCCAGGTGGCATTTACA-3 'AspAapAspLys <TNF-R>

3 'Erel

5'-CCCGGGATCCHAGTCGCCAGTGCTCCCTTCAGCTGGG-S 'BamHl> End <TNF-R>

The 6 'end oligonucleotide primer used for amplification comprised an Asp718 restriction site at its 5' end, followed by nucleotides containing the 3 'end of the yeast--factor leader sequence (Pro-Leu-Asp Lys-Arg) and those encoding the 8 amino acids of the FLAG ^R peptide (AspTyrLysAspAspAspAspLys) fused to the sequence coding for the 5'-end of the mature receptor. The FLAG ^R peptide (Hopp et al., Bio / Technology 6: 1204, 1988) is a highly antigenic sequence that reversibly binds to monoclonal antibody M1 (ATCC HB 9259). The oligonucleotide used to generate the 3 'end of the PCR-derived fragment is the antisense strand of DNA encoding sequences encoding the open reading frame of the receptor for nucleotide 704 of the mature coding region (following the Asp residue which precedes the transmembrane domain) by introducing a TAA stop codon (underlined). The stop codon is then followed by a BamH 1 restriction site. The TNF-R encoding DNA sequences are then amplified by PCR, essentially as described by Innis et al. (Publisher), PCR Protocols: A Guide to Methods and Applications (Academic Press, 1990).

The PCR-derived DNA fragment encoding soluble human TNF-R was subcloned into the yeast expression vector plXY120 by digesting the PCR-derived DNA fragment with the restriction enzymes BamH1 and Asp718, plXY120 with BamH1 and Asp718 was digested and the PCR fragment was ligated in vitro in the cut vector with T4 DNA ligase. The resulting construct (plXY424) joined the open reading frame of the FL />"" soluble TNF receptor in frame i; t of the complete a-factor leader sequence and placed expression in yeast under the control of the regulated yeast alcohol dehydrogenase (" ADH 2) promoter The identity of the nucleotide sequence of the soluble TNF receptor contained in plXY424 with that in cDNA clone 1 was verified by DNA sequencing using the dideoxynucleotide chain termination method., PlXY424 then became E. coli strain RR1 Soluble human TNF receptor was also expressed and secreted in yeast in a second vector, this second vector was obtained by recovering the E. coli PLXY421 plasmid and digesting with the restriction enzymes EcoR 1 and BamH 1 to isolate the fragment, dt s spanning the region encoding the ADH 2 promoter, the a-factor leader, the FLAG ^R- soluble TNF receptor, and the stop codon The enzyme was ligated in vitro to EcoR1 and BamH1 cut plasmid pYEP352 (Hill et al., Yeast 2: 163 [1986]) to give the expression plasmid plXY432, which was transformed into E. coli strain RR1.

To determine the secretion of soluble human TNF receptor from yeast tu, plXY424 was purified and introduced into a diploid S.cerevlslae yeast strain (XV2181) by electroporation and selected for obtaining the plasmid-borne yeast TRP1 ⁺ gene on media lacking tryptophan. To determine plXY432-mediated secretion of the receptor, the plasmid was introduced into the yeast strain PB149-6b by electroporation, followed by selection for the plasmid-borne URA3 ⁺ gene by growth on media containing no uracil. Overnight cultures were grown at 3O ⁰ C in appropriate selective media. The PB149-6b / plXY434 transformants were diluted in YEP-1% glucose medium and grown at 30 ° C for 38-40 hours. The supernatants were recovered by removal of the cells by centrifugation and filtered through 0.45μ FiItT.

The levels of secreted receptor in the supernatants were determined by immune dot blots. Briefly, 1 μΙ of supernatant and dilutions of supernatant were dropped on nitrocellulose filter and allowed to dry. After blocking non-specific protein binding with a 3% BSA solution, the filters were incubated with diluted M1 anti-FLAG ⁿ antibody, excess antibody was removed by washing, and then dilutions of horseradish peroxidase conjugated anti-mouse IgG antibodies with the Filtering incubated. After removal of excess secondary antibody, peroxidase substrates were added and allowed to develop a color for about 10 minutes before the substrate solution was removed.

The anti-FLAQ "reactive material found in the supernatants showed that a significant level of the receptor was secreted in both expression systems. Comparisons showed that the plXY432 system was about & x 16 times more soluble human TNF receptor than the plXY424 Supernatants were assayed for soluble TNF-R activity as described in Example 1 by determining their ability to bind ¹²⁵ J-TNFa and to block TNFa binding they contain significant levels of active soluble TNF-R.

Example 9 Isolation of murine TNF-R cDNAs Murine TNF-R cDNAs were isolated from a murine 7 B9 cell-derived cDNA library, an antigen-dependent one Helper T-cell line derived from C57BL / 6 mice, by cross-species hybridization with a human TNF-R Sample was carried out. The cDNA library was made iZAP (Stratagene, San Diego) essentially as in Example 2 above

constructed by isolating the polyadenylated RNA from 7B ',) cells.

A double-stranded human TNF-R cDNA sample was prepared by excising an approximately 3.5 kb Not 1 fragment from

human TNF-R clone 1 and ³² P-labeled cDNA using random primers (Boehringer-Mannheim).

The murine cDNA library was amplified once and totaled 900,000 plaque :) with the human TNF-R cDNA probe in

essentially as described in Example 2 examined. Approximately 21 positive plaques3 were purified and Bluescript plasmids containing inserts with EcoRI linkers were excised (Stntgene, San Diego). The nucleic acid

Sequencing of a portion of the murine TNF-R clone 11 indicated that the coding sequence of the murine TNF-R

is approximately 88% homologous with the corresponding nucleotide sequence of human TNF-R. A partial nucleotide sequence of the murine TNF-R cDNA clone 11 is shown in Figures 3A-3B.

Example 10 Preparing monoclonal antibodies against TNF-R Preparations of purified recombinant TNF-R, for example human TNF-R, or transfected COS cells containing a

express high levels of TNF-R are used to generate monoclonal antibodies to TNF-R using conventional methods such as those disclosed in U.S. Patent 4,411,993. Such antibodies are likely to be useful for interfering with TNF binding to TNF receptors, for example, to reduce toxic or other undesirable effects on TNF or as a component of diagnostic or research tests for TNF or soluble TNF receptor.

To immunize mice, the TNF-R immunogen is emulsified in complete Freund's adjuvant and in amounts in the Range of 10-100ug subcutaneously injected into Balb / c mice. 10-12 days later, the immunized animals are again with

supplemental immunogen emulsified in incomplete rondunds' adjuvant, and then periodically inoculated after a 1-2 week immunization schedule.

Serum samples for testing by dot blot assay (antibody sandwich) or ELISA (enzyme-linked immunosorbent assay)

were recovered periodically by retro-orbital bleeding or tail-tip excision. Other test methods are also suitable. Following detection of a suitable antibody titer, positive animals were given an intravenous injection of the antigen in saline. 3-4 days later, the animals were sacrificed, the splenocytes harvested and the murine one

Myeioma cell line NS1 fused. The hybridoma cell lines generated by this method were incubated in multiple microtiter wells. Plates plated in HAT selection medium (hypoxanthine, aminopterin and thymidine) to prevent proliferation of

fused cells, myeloma hybrids and spleen cell hybrids.

The hybridoma clones thus produced can be analyzed for their reactivity with TNF-R by means of ELISA, for example by Adaptations of the von Engvall et al., Immunochem. 8: 871 (1971) and U.S. Patent 4,703,004. Positive clones

are then injected into the peritoneal spaces of syngeneic Balb / c mice to elicit high-level ascites

Concentrations (> 1 mg / ml) of the anti-TNF-R monoclonal antibody. The resulting monoclonal antibody can

be purified by ammonium sulfate precipitation followed by molecular weight chromatography and / or affinity chromatography based on the binding of the antibody to protein A of Staphylococcus aureus.

Claims (18)

1. DNA sequence, characterized in that it encodes a biologically active TNP receptor (TNF-R) protein from mammals. 2. DNA sequence according to claim 1, selected from one of the following groups: a) cDNA clones with one of the coding region of a native TNF-R gene Mammalian derived nucleotide sequence;
b). DNA sequences capable of hybridizing with the clones of (a) under moderately stringent conditions (50 ^° C., 2 × SSC) and of biologically active TNF-R protein encode; and
c) DNA sequences that are degenerate due to the genetic code relative to the DNA sequences defined in a) and b) and encode biologically active TNF-R protein. The DNA sequence of claim 1, wherein the DNA sequence encodes a soluble human TNF-R protein. The DNA sequence of claim 3, wherein the soluble human TNF-R protein has an amino acid sequence comprising the sequence of amino acid residues 1-x of Figure 2A, wherein χ is selected from the group comprising amino acids 163-235 , The DNA sequence of claim 3, wherein the soluble human TNF-R protein comprises the sequence of amino acids 1-235 of Figure 2A. The DNA sequence of claim 3, wherein the soluble human TNF-R protein comprises the sequence of amino acids 1-185 of Figure 2A. The DNA sequence of claim 3, wherein the soluble human TNF-R protein comprises the sequence of amino acids 1-163 of Figure 2A. The DNA sequence of claim 3, wherein the amino acid residue 46 is selected from the group comprising He and Thr and the amino acid residue 118 is selected from the group consisting of VaI and He. 9. Recombinant expression vector comprising a DNA sequence according to any one of claims 1-7. A method of producing a purified mammalian TNFR receptor (TNF-R) protein, the method comprising coupling successive amino acid residues through the formation of peptide bonds to form a TNF-R polypeptide. The method of claim 9, wherein the TNF-R protein is a soluble human TNF-R protein. The method of claim 11, wherein the soluble human TNF-R protein has an amino acid sequence comprising the sequence of amino acid residues 1-x of Figure 2 A, wherein χ is selected from the group of amino acids 163-235. The method of claim 11, wherein the soluble human TNF-R protein has an amino acid sequence comprising the sequence of amino acid residues 1-235 of Figure 2A. The method of claim 11, wherein the soluble human TNF-R protein has an amino acid sequence comprising the sequence of amino acid residues 1-185 of Figure 2A. The method of claim 11, wherein the soluble human TNF-R protein has an amino acid sequence comprising the sequence of amino acid residues 1-163 of Figure 2A. 16. Use of a mammalian TNF-R protein for the manufacture of a medicament for the regulation of immune responses in mammals. Use of a mammalian TNF-R protein to prepare a pharmaceutical composition suitable for parenteral administration to a human patient for the regulation of immune responses. 18. Antibodies immunoreactive with mammalian TNF receptors.