DD285611A5 - INTERCELLULAR ADHESION MOLECULES AND THEIR BINDING LIGANDS - Google Patents

Abstract

The invention relates to a soluble, functional derivative of ICAM-1 and to processes for its preparation and its use for the treatment of inflammation. {ICAM-1 derivatives; soluble; functional; adhesion molecule; intercellular drugs; Treatment of inflammations}

Description

For this 18 pages drawings

Field of application of the invention

The invention relates to a soluble, functional derivative of ίΓΑΜ-1 and its use as a medicament. The derivatives prepared according to the invention are intercellular adhesion molecules, such as ICAM-1, involved in the process by which populations of lymphocytes recognize and adhere to cellular substrates so that they can migrate to sites of inflammation and react with the cells in inflammatory reactions , The present invention also targets ligand molecules that can bind these intercellular adhesion molecules, a screening analysis for these ligands, and the applications of this intercellular adhesion molecule, ligandon molecules, and screening analysis.

Characteristic of the known state of the art

This application is a partial continuation of the Ui patent applications Serial No. 07 / 045,963, filed May 4, 1987, 07/115798, filed Nov. 2, 1987, 07/155943, the on May 16, 1988, 07 / 188,915, filed May 3, 1988, 07/250446, filed September 28, 198G, and 07 / 324,481, filed May 16, 1989. This invention has been partially developed with government support. The government has certain rights to this invention.

Leukocytes must be able to attach to cell substrates to adequately protect the host from foreign invaders, such as bacteria or viruses. An excellent review of the defense system is given by Eisen, H.W. (in: Microbiology, 3rd Ed., Ed. Harper & Row, Philadelphia, PA [1980], pp. 290-295 and 381-418). You must be able to walk on endothelial cells of incipient inflammation. In addition, they must adhere to antigen-presenting cells, so that a normal specific immune reaction can take place, and finally they must adhere to suitable target cells, so that the lysis of virus-infected or tumor cells can take place.

Recently, leukocyte surface molecules involved in mediating such adhesion have been identified using hybridoma technique. Briefly, monoclonal antibodies have been identified that are sensitive to human T-toes (Davignon, D. et al., Proc. Natl. Acad. Sci. USA 78: 4535-4539 [1981]) and mouse spleen cells (Springer, T. et al Eur. J. Immunol. 9: 301-306 [1979]), which bind to leukocyte surfaces and prevent the adhesion-related functions described above (Springer, T. et al., Fed. Proc.44: 2660 to 2663 [1985J] , The molecules identified by these antibodies have been termed Mac-1 and lymphocyte function-associated antigen-1 (LFA-1). Mac-1 is a heterodimer found on macrophages, granulocytes and large granular lymphocytes. LFA-1 is a heterodimer present on most lymphocytes (Springer, T.A., et al., Immunol. Re. 68: 111-135 [1982]). These two molecules, as well as a third molecule, ρ 150.95 (with a similar tissue distribution as Mac-1), play a role in cell adhesion (Keizer, G. et al., Eur. J. nvtiunol. 15: 1142-1147 [1985 ]).

It has been found that the leukocyte molecules described above are members of a related family of glycoproteins (Sanchez-Madrid, F. et al., J.Exper.Med.158: 1785-1803); (Keizer, G. et al., Eur. J. Immunol. 15: Ί142 to 1147 [1985]). This family of glycoproteins consists of heterodimers composed of an alpha-ketetto and a beta-chain. While the alpha-chains of the individual antigens differ from each other, it has been found that the beta-chain is highly consistent (Sanchez-Madrid, F. et al., J. Exper. Med.158; 1785-1803 [1983]). The beta chain of the protein family (sometimes referred to as "CD 10") was found to have a molecular weight of 95kd, while that of the alpha chains varied between 150kd and 180kd (Springer, T., Fed. Proc.44: 2660). 2663 [1985]). Although the alpha subunits of the membrane proteins do not share the extensive homology of the beta subunits, a close analysis of the alpha subunits of the glycoproteins has revealed that they have considerable similarities. and beta subunits was given by Sanchez-Madrid, F. et al. (J. Exper. Med., 158: 586-602 [1983], J.Exper. Med., 158: 1785-1803 [1983]).

A group of individuals were identified who were unable to express normal levels of members of this adhesion protein family on the leukocyte cell surface (Anderson, DC et al., Fed. Proc. 44: 2671 to 2677 [1985]; Anderson, DC et al , J. Inf., DIs. 152: 669-689 [1985]). Lymphocytes from these patients had in vitro defects similar to those of normal subjects whose antibody LFA-1 family had been affected by molecules.

In addition, due to the inability of their cells to adhere to cell substrates, cHse individuals have been unable to produce normal immunoassay (Anderson, DC et al., J. Infect.DIs 162: 668-689 [19851; Anderson, DC et al., Fed. Proc. 44: 2671 to 2677 [1985]). These data indicate that immune responses are attenuated when lymphocytes are unable to adhere in a normal manner due to the lack of functional adhesion molecules of the LFA-1 family. In summary, therefore, the ability of lymphocytes to maintain the health and viability of one animal requires that they be able to adhere to other cells (for example, endothelial cells). It has been found that this attachment causes cell-cell contacts, in which specific receptor molecules are involved, which at the cell surface of the lamphocytes are able to adhere to endothelial cells, to other lymphocytes as well as to other nonvascular cells. It has been found that the receptor molecules of the cell surface are closely related. People whose lymphocytes lack these cell surface receptor molecules have chronic and recurrent infections as well as other clinical symptoms, including unlikely antibody response.

Since lymphocyte adhesion is involved in the process by which foreign tissue is recognized and rejected, understanding of this process is critically important in the fields of organ transplantation, tissue transplantation, allergy, and oncology.

Object of the invention

By the method according to the invention pharmacologically extremely valuable soluble functional derivatives of ICAM-1 are provided.

Explanation of the essence of the invention

The object of the present invention is to find intercellular adhesion molecules through which populations of lymphocytes recognize and adhere to cellular substrates, so that they can migrate to sites of inflammation and react with the cells in inflammatory reactions, as well as processes for the production of soluble to provide functional ICAM-1 derivatives.

The invention relates to intercellular adhesion molecule-1 (ICAM-1) and its functional derivatives. The invention also relates to antibodies and fragments of antibodies which can inhibit the function of ICAM-1, as well as other inhibitors of ICAM-1 function, and to assays for identifying these inhibitors. Moreover, the invention relates to diagnostic and therapeutic applications of the molecules described above.

In particular, the invention relates to the intercellular adhesion molecule ICAM-1 or its functional derivatives, which are substantially free of natural contaminants. In addition, the invention relates to the molecules which are additionally capable of binding to a molecule present on the surface of a lymphocyte.

The invention also relates to the intercellular adhesion molecule ICAM-1 and its derivatives which are detectably labeled

In addition, the invention relates to a recombinant DNA molecule capable of ICAM- ¹ . or to express its functional derivative.

The invention also relates to a method for obtaining ICAM-1 in a substantially pure form, which consists of the following steps:

(a) solubilization of ICAM-1 from the membranes of cells expressing ICAM-1 to produce a solubilized ICAM-1 preparation,

(b) introducing the solubilized ICAM-1 preparation into an affinity matrix, the matrix containing antibodies capable of binding to ICAM-1,

(c) allowing the binding of ICAM-1 to the antibody of the affinity matrix,

(d) removing any compound that is unable to bind the antibody from the matrix and

(e) recovering the ICAM-1 in substantially pure form by eluting ICAM-1 from the matrix.

The invention also relates to an antibody capable of binding to a molecule selected from the group consisting of ICAM-1 and a functional derivative of ICAM-1. The invention also includes a hybridoma capable of producing such an antibody.

The invention also relates to a hybridoma cell capable of producing the monoclonal antibody R6-5-D6. The invention also relates to a method for the production of a desired hybridoma which produces an antibody capable of binding to the molecule ICAM-1, which consists of the following steps:

(a) Immunization of an animal with a cell expressing ICAM-1

(b) fusing the animal's spleen cells with a myeloma cell strain,

(c) allowing the formation of anti-sexing hybridoma cells by the fused spleen and myeloma cells and

(d) "screening" the hybridoma cells for the desired hybridoma that can produce an antibody capable of binding to ICAM-1.

The invention also relates to hybridoma and to antibodies produced by hybridoma obtained by the above method.

The invention also relates to a method of identifying a non-immunoglobulin antagonist of intercellular adhesion comprising the steps of:

(a) incubating a non-immunoglobulin agent, which may be an antagonist of intercellular adhesion, with a lymphocyte preparation, the lymphocyte preparation containing a plurality of cells capable of aggregating or aggregating;

(b) Examination of the lymphocyte preparation to determine if the presence of the agent is the agglomeration of the lymphocyte preparation

Inhibiting cells of the lymphocyte preparation; The inhibition of aggregation identifies the agent as one Antagonists of intercellular adhesion. Elf indung also relates to a method of treating inflammation resulting from a reaction of the specific The defense system results in a mammal being composed of a person in need of such treatment

administer sufficient amount of an anti-inflammatory agent to suppress inflammation; the anti-inflammatory agent is selected from the group consisting of an antibody capable of binding to ICAM-1; a fragment of an antibody capable of binding to ICAM-1; ICAM-1; a functional derivative of ICAM-1 and a non-immunoglobulin antagonist of ICAM-1.

The invention also includes the method of treating inflammation described above, wherein the Non-immunoglobulin antagonist of ICAM-1 is another non-immunoglobulin antagonist of ICAM-1 than LFA-1. The invention is also directed to a method of suppressing the metastasis of hematopoietic tumor cells, wherein

the cell requires a functional member of the LFA-1 family to migrate, which method is to provide a patient in need of such treatment with a sufficient amount of an anti-inflammatory agent to suppress the disease

Administer metastasis; In this case, the anti-inflammatory agent is selected from the group consisting of a Antibody capable of binding to ICAM-1; a fragment of an antibody capable of binding to ICAM-1; ICAM-1;

a functional derivative of ICAM-1 and a non-immunoglobulin antagonist of ICAM-1.

The invention also includes the above-described method of suppressing the metastasis of a hemotopoietic A tumor cell, wherein the non-immunoglobulin antagonist of ICAM-1 is another non-immunoglobulin antagonist of ICAM-1

than LFA-1.

The invention also includes a method for suppressing the growth of an ICAM-1 expressing tumor cell,

which is to give a patient, who needs such a treatment, a sufficient amount of a toxin for

Suppressing this growth, wherein the toxin is selected from the group consisting of a

toxin-derived antibody capable of binding to ICAM-1; a toxin-derived fragment of an antibody which can bind to ICAM-1; a toxin-derived member of the LFA-1 family of molecules and a toxin-derived functional derivative of a member of the LFA-1 family of molecules.

The invention is also directed to a method for suppressing the growth of an LFA-1 expressing tumor cell,

which is to give a patient, who needs such a treatment, a sufficient amount of a toxin for

Suppressing this growth, wherein the toxin is selected from the group consisting of a

toxin-derived ICAM-1 and a toxin-derived functional derivative in ICAM-1.

Furthermore, the invention is directed to a method for diagnosing the presence and location of an inflammation,

which corresponds to a reaction of the specific defense system in mammals suspected of having such inflammation, this method consisting of

(a) administering to a person and a person a composition containing a detectably labeled binding ligand capable of identifying a cell expressing ICAM-1

(b) detecting the binding ligand.

In addition, the invention provides a method for diagnosing the presence and location of inflammation resulting from a reaction of the specific defense system in a mammal suspected of having such inflammation, which consists in:

(a) incubating a tissue sample of the subject with a composition containing a detectably labeled binding ligand capable of identifying a cell expressing ICAM-1, and

(b) to detect the binding ligand.

The invention also relates to a method of diagnosing the presence and location of an ICAM-1 expressing endoparial tower cell in a mammal suspected of having such a cell which consists in

(a) administering to the individual a composition containing a detectably labeled binding ligand capable of binding to ICAM-1, the ligand being selected from the group consisting of an antibody and a fragment of an antibody, said fragment in is able to bind to ICAM-1, and

(b) to detect the binding ligand.

The invention also relates to a method of diagnosing the presence and location of an ICAM-1 expressing tumor cell in a mammal suspected of having a cell which consists in

(a) incubating a subject tissue sample with a composition containing a detectably labeled binding ligand capable of binding ICAM-1, the ligand being selected from the group consisting of an antibody and a fragment of an antibody; is able to bind to ICAM-1, and

(b) to detect the binding ligand.

The invention also relates to a method of diagnosing the presence and location of a tumor cell expressing a member of the LFA-1 family of molecules in a subject suspected of having a cell which consists in:

(a) administer to a person a composition comprising a detectably labeled binding ligand capable of binding to a member of the LFA-1 family of molecules, the ligand being selected from the group consisting of ICAM-1 and a functional Derivative of ICAM-1, and

(b) to detect the binding ligand.

The invention also relates to a method of diagnosing the presence and location of a tumor cell expressing a member of the LFA-1 family of molecules in a subject suspected of having a cell which consists in:

(a) incubating a tissue sample of the subject in the presence of a detectably aortic binding ligand capable of binding to a member of the LFA-1 family of molecules, the ligand being selected from the group consisting of ICAM antibodies; 1 and a functional derivative of ICAM-1, and

(b) detect the binding ligand bound to a member of the LFA-1 family of molecules present in the tissue sample.

In addition, the invention relates to a pharmaceutical composition consisting of

(a) an anti-inflammatory agent selected from the group consisting of: an antibody capable of binding to ICAM-1; a fragment of an antibody capable of binding to ICAM-1; ICAM-I, a functional derivative of ICAM-1 and a non-immunoglobulin antagonist of ICAM-1, and

(b) at least one immunosuppressive agent selected from the group consisting of dexamethasone, azathioprine and cyclosporin A.

Ausführungsbelsplole

Short description of the training:

Fig. 1 shows in schematic form the adhesion between a normal and an LFA-1 deficient cell.

Fig. 2 shows in schematic form the process of normal Z normal cell adhesion.

Figure 3 shows the kinetics of cell aggregation in the absence (X) or presence of 50ng / ml PMA (O).

Fig.4 shows the coaggregation between LFA-1 ~ and LFA-1 ⁺ cells. Carboxyfluorescein diacetate-labeled, EBV-transformed cells (10 ⁴ ), as si? indicated in the figure (solid bars) or JY cells (open bars) mixed in the presence of PMA with ^10s unlabeled autologous cells. After 1.5 hours, the labeled cells, as aggregates or free, were numbered using the qualitative analysis of Example 2. The percentage of labeled cells in aggregates is shown. One of two representative experiments will be shown.

Fig.5 shows d'o immunoprecipitation of ICAM-1 and LFA-1 from JY cells. Triton X-100 lysates of JY cells (lanes 1 and 2) or control lysis buffer (lanes 3 and 4) were immunoprecipitated with antibody capable of binding to ICAM-1 (lanes 1 and 3) or with antibodies that can bind to LFA-1 (lanes 2 and 4). Panel A shows results under reducing conditions; Panel B shows results obtained under nonconductive conditions. The molecular weight standards were run in web S.

Figure 6 shows the kinetics of IL-1 and gamma-interferon effects on ICaM-1 expression in human dermal fibroblasts. Human Dermal Fibroblasts were grown to a density of 8 × 10 ⁴ cells / 0.32 cm ² wells. IL-I (10 units / ml, closed circles) or recombinant gamma-interferon (10 units / ml, open rectangles) were added. and at the time indicated the sample was cooled to 4 "C and an indirect bond analysis was performed The standard deviation did not exceed 10%.

Figure 7 shows the concentration dependence of IL-1 and gamma interferon effects on ICAM-1. Human dermal fibroblasts were grown to a density of 8 x 10 ⁴ cells / 0.32 cm ² well. IL-2 (open circle), recombinant human IL-1 (open rectangle), recombinant mouse IL-1 (solid rectangle), recombinant human gamma-interferon (solid circles), and recombinant beta-interferon (open triangle) were used in the and incubated for a period of 4 hours (IL-1) or 16 hours (beta and gamma interferon). The results given are the mean values of quadruplicate determinations; the standard deviation did not exceed 10%.

Figure 8 shows the nucleotide and amino acid sequence of ICAM-1 cDNA. The first ATG is at position 58. Translated sequences corresponding to ICAM-1-tryptine peptides are underlined. The hydrophobic putative signal peptide and transmembrane sequences were strongly underlined. N-linked glycosylation sites are boxed. The polyadenylation signal AATAAA at position 2976 is marked with a prime at the top. The sequence shown stands for the HL-60 cDNA clone. The endothelial cell cDNA was sequenced over most of the length and showed only minor differences.

Figure 9 shows the ICAM I homologous domains and relationship to the immunoglobulin supergene family. (A) Alignment of 5 homologous domains (D1 -5). Two or more identical residues aligned are boxed. Residues obtained two or more times in NCAM domains, as well as residues obtained in domains of sets C2 and C1, were aligned with the ICAM-1 internal repeats. The location of the predicted β-strands in the ICAM-1 domain is indicated by bars and lower case letters over the alignments, and the known location of the β-strands in immunoglobulin C areas is indicated by bars and capital letters under orientation. The position oo. putative disulfide bridge within the ICAM-1 domains is designated by S-S. (B-D) alignment of protein domains homologous to the ICAM-1 domains; Proteins were first aligned by screening NBRF Daton bases using the FASTP program. The protein sequences are MAG, NCAM, T cell receptor alpha subunit V domain, IgMp chain and alpha 1 B glycoprotein.

Fig. 10 shows a schematic comparison of secondary structures of ICAM-1 and MAG.

FIG. 11 shows the binding of LFA-1-positive, EBV-transformed B lymphoblastoid cells to ICAM-1 in planar membranes.

Fig. 12 shows the binding of LFA-1-positive T-I lymphoblasts and T-lymphoma cells to ICAM-1 in plastified vesicles.

FIG. 13 shows the inhibition of the binding of JY-B lymphoblastoid cells to ICAM-1 in plastified bubbles by pretreatment of the cells or vesicles with monoclonal antibodies.

Figure 14 shows the effect of temperature on T lymphoblast binding to ICAM-1 in plastified blisters.

Figure 15 shows the divalent cation requirements for binding of T-lymphoblasts to ICAM-1 in plastic bound vesicles.

Figure 16 shows the effect of anti-adhesion antibodies on the ability of peripheral blood mononuclear cells to proliferate in response to recognition of the T cell-associated antigen OKT3. "OKT3" indicates the addition of the antigen.

Figure 17 shows the effect of anti-adhesion antisera on the ability of peripheral blood mononuclear cells to proliferate in response to recognition of the non-specific T cell receptor, concanavalin A. "CONA" indicates the addition of concanavalin A.

Figure 18 shows the effect of anti-adhesion antibodies on the ability of peripheral blood mononuclear cells to proliferate in response to recognition of the keyhole limpet hemocyanin antigen. The addition of the keyhole porcine hemocyanin to the cells is indicated by "KLH".

Figure 19 shows the effect of anti-adhesion antibodies on the ability of peripheral blood mononuclear cells to proliferate in response to detection of the tetanus toxoid antigen. The addition of the tetanus toxoid antigen to the cells is indicated by "AGN".

Fig.20 shows the binding of the monoclonal antibodies RR1 / 1, R6.5, LB2 unr! CL203 on ICAM-1 deletion mutants.

Figure 21 shows the binding of ICAM-1 deletion mutants to LFA-1.

Figure 22 shows the epitopes recognized by the monoclonal anti-ICAM-1 antibodies RR1 / 1, R6.5, LB2 and CL203.

Fig. 23 shows the binding capacity of the mutants of ICAM-1 domain 2 on LFA-1.

Fig. 24 shows the binding capacity of mutants of ICAM-1 domain 3 to LFA-1.

Figure 25 shows the binding capacity of the mutants of ICAM-1 domain 1 to LFA-1.

Figure 26 shows the orientation of the ICAM amino terminal domains.

One aspect of the present invention relates to the discovery of a natural binding ligand to LFA-1. Molecules such as the LFA-1 family involved in the process of cell adhesion are referred to as "adhesion molecules." The natural binding ligand of the present invention is referred to as "intercellular adhesion molecule-I" or "ICAM-1." ICAM-1 ICAM-1 is not a heterodimer The present invention relates to ICAM-1 and its "functional derivatives". A "functional derivative" of ICAM-1 is a compound that has a biological activity (functional or structural) substantially similar to a biological activity of ICAM-1. The term "functional derivatives" is intended to mean "fragments", "variants "," Analog "or" chemical derivatives "of a molecule. By a \ "fragment \" of a molecule such as ICAM-1 is meant any polypeptide submenu of the molecule. \ "Particularly preferred are fragments of ICAM-1 which have ICAM-1 activity and are soluble (ie, not membrane bound) \" a variant \ "of a molecule Like ICAM-1, one understands a molecule that is substantially similar in structure and function to either the entire molecule or its fragment. One molecule is said to be "substantially similar" to another molecule if both molecules have substantially similar structures, or if both molecules have similar biological activity, so two molecules, if they exhibit similar activity, are considered as variants, since this one Is used in the present application even if the structure of one molecule is not found in the other, or if the sequence of amino acid residues is not identical. "Analog" of a molecule such as ICAM-1 is understood to mean one. molecule substantially similar in function to either the entire molecule or its fragment. In the present application, one molecule is referred to as a "chemical derivative" of another molecule if it additionally contains chemical components that are not normally part of the molecule. Such components can improve the solubility, absorption, biological half-life of the molecule, etc. Alternatively, the components may decrease the toxicity of the molecule, eliminate or attenuate any potential undesired side effect of the molecule, etc. Components that can produce such an effect are described in Remington's Pharmaceutical Sciences (1980). "Toxin-derived" molecules make up a special class of molecules "Chemical derivatives". A "toxin-derived" molecule is a molecule (such as ICAM-1 or an antibody) that contains a toxin component. The binding of such a molecule to a cell brings the toxin component into the immediate vicinity of the cell and thus promotes the death of the cell. Any suitable toxin component can be used; However, it is advantageous to use such toxins as, for example, the Rintintoxin, diphtheria toxin, radioisotopic toxins, membrane channel-forming toxins and the like. Methods for coupling such components to a molecule are well known in the art. An antigenic molecule such as ICAM-1 or members of the LFA-1 family of molecules are naturally expressed on the surface of lymphocytes. Thus, the introduction of such cells into a suitable animal, for example by intraperitoneal injection, etc., results in the production of antibodies capable of binding to ICAM-1 or members of the LFA-1 family of molecules. If desired, the serum of such an animal can be removed and used as a source of polygonal

Antibodies are used that can bind these molecules. However, it is advantageous to remove the splenocytes from such animals to fuse such spleen cells with a myeloma cell strain, and to form hybridoma cells that secrete monoclonal antibodies that bind to ICAM-1 or members of the LFA-1 family of molecules can admit.

The hybridoma cells obtained in the manner described above can be "screened" by a variety of methods to identify desired hybridoma cells that secrete antibodies that can bind to either ICAM-1 or LFA-1 family members of molecules.

In a preferred "screening" analysis, such molecules are identified by their ability to inhibit aggregation or aggregation of cells transformed with Epstoin-Barr virus. Antibodies that can inhibit this aggregation are then further screened to see if they prevent this aggregation by binding to ICAM-1 or to a member of the LFA-1 family of molecules ^ s means can be used with which ICAM-1 can be distinguished from the LFA-1 family of molecules. For example, the antigen bound by the antibody can be analyzed by immunoprecipitation and polyacrylamide gel electrophoresis. When the bound antigen is a member of the LFA-1 family of molecules, it can be seen that the immunoprecipitated antigen is a dimer, whereas a single molecular weight species must be immunoprecipitated when the bound antigen is ICAM-1. Alternatively, between the antibodies that bind to members of the LFA-1 family of molecules and those that bind to ICAM-1, one can distinguish by screening for the ability of the antibody to target such cells as The ability of an antibody (known to inhibit cell aggregation) to bind to granulocytes indicates that the antibody is able to bind granulocytes that excrete LFA-1 but not ICAM-1. The lack of such binding is indicative of an antibody capable of recognizing ICAM-1. The ability of an antibody to bind to a cell, such as a granulocyte, can be detected by means generally found in this art These agents include immunoassay, cell agglutination, filter binding studies, antibody precipitation, etc.

Alternatively, the antiaggregatory antibodies of the present invention can be identified by measuring their ability to differentially bind to cells expressing ICAM-1 (such as activated endothelial cells) and their ability to bind to cells, the ICAM-1 do not express. As those skilled in the art will readily appreciate, the above analyzes may be modified or performed in a different order to yield a variety of potential screening assays, each of which is capable of producing antibodies that bind to ICAM-1 can identify and distinguish between molecules compared to members of the LFA-1 family of molecules.

The anti-inflammatory agents of the present invention can be produced by natural processes (such as the induction of an animal, a plant, fungi, bacteria, etc., non-immunoglobulin antagonists of ICAM-1, or by inducing an animal to produce polyclonal antibodies that can bind to ICAM-1); by synthetic methods (such as by using the Meerifield method to synthesize polypeptides to synthesize ICAM-1, functional derivatives of ICAM-1 or protein antagonists of ICAM-1 [immunoglobulin or non-immunoglobulin]); by the hybridoma technique (such as the production of monoclonal antibodies that can bind to ICAM-1) or by the recombinant technique (such as the production of the anti-inflammatory agents of the present invention in various hosts [ie, yeast, bacteria , Fungi, cultured mammalian cells, etc.] or from recombinant plasmids or viral vectors). The choice of the method to be used depends on such factors as appropriateness, desired yield, etc. It is not necessary to work with only one of the methods, processes or techniques described above, or techniques to produce a particular anti-inflammatory agent; The methods, processes and techniques described above can be combined to obtain a particular anti-inflammatory agent.

A. Identification of LFA-1 binding partner (ICAM-1)

1. Analyzes of LFA-1 Dependent Aggregation

Many cells transformed by Epstein-Barr virus have aggregation. This aggregation can be enhanced in the presence of phorbol esters. It has been found that this homotypic aggregation (ie aggregation involving only one cell type) is blocked by anti-LFA-1 antibodies (Rothlein, R. et al., J. Exper. Med. 163: 1132-1149 [1986]) , this reference is incorporated by reference. Thus, the extent of LFA-1-dependent binding can be determined by determining the extent of spontaneous or phorbol ester-dependent aggregate formation. An agent that inhibits LFA-1-dependent aggregation can be identified using analysis to determine whether the agent interferes with spontaneous or phorbol ester-dependent aggregation of Epstein-Barr virus transformed cells. Most of the cells transformed by the Epstein-Barr virus can be used in such an analysis as long as the cells are able to express the LFA-1 receptor molecule. Such cells can be prepared by the method of Springer, TA et al., J. Exper. Med. 166: 1901-1918 (1984), this reference being incorporated herein by reference. While LFA-1-dependent binding analysis of the present invention allows any of these cells to be used, it prefers to use cells of the JY cell strain (Terhost, CT et al., Proc. Natl. Acad. Sd. 910 [1176]). The cells can be cultured in a suitable culture medium; however, it is more advantageous to grow the cells in RMPI-1640 culture medium supplemented with 10% fetal calf serum and 50 μg / ml gentamycin (Gibco Laboratories, NY). The cells should be cultured under conditions suitable for the propagation of mammalian cells (ie at a temperature of generally 37 ⁰ C, in an atmosphere of 5% COj, at a relative humidity of 95%, etc.).

2. LFA-1 binding to ICAM-1

Human lymphocytes lacking the family of LFA-1 receptor molecules were identified (Anderson, DC et al., Fed. Proc. 44: 2671-2677 [1985]; Anderson, DC et al., J. Infect. DIs. 152: 668 -689 [1985]). It is said that these people suffer from a leukocyte adhesion defect (LAD). EBV-transformed cells of such individuals do not clump either spontaneously or at

Presence of phorbol esters in the aggregation analysis described in obGn. When such cells were mixed with LFA-1 expressing cells, aggregation could be observed (Rothlein, R. et al., J. Exper. Med. 163: 1132-1149 [1986]) (Figure 1). Importantly, these aggregates did not form when these cells were incubated in the presence of anti-LFA-1 antibodies. Thus, although aggregation required the presence of LFA-1, the ability of LFA-1 defective cells to form clumps of LFA-1-containing cells indicated that the LFA-1 binding partner was not LFA-1, but rather a hitherto undiscovered Zeiladhäsionsmolekül was. Fig. 1 shows the mechanism of cell adhesion.

B. Intercellular Adhesion Molecule (ICAM-I)

The novel intercellular adhesion molecule ICAM-1 was first identified and partially characterized by the method of Rothlein, R. et al., (J. Immunol., 137: 1270-1274 [1986]), and this reference is incorporated herein by reference. To detect the ICAM-1 molecule, monoclonal antibodies were prepared from spleen cells from mice immunized with cells of individuals having a genetic drug in LFA-1 expression. The resulting antibodies were "screened" for their ability to inhibit the aggregation of LFA-1 expressing cells (Figure 2). More specifically, concerning the ICAM-1 molecule, mice were challenged with EBV-transformed B cells from LAD-1. Immunized patients who did not express the LFA-1 antigen, then spleen cells of these animals were removed, fused with myeloma cells, and allowed to hybridoma cells which monoclonalally produce antibodies, followed by hybridoma cell monoclonal antibody EBV-transformed B cells from normal subjects expressing LFA-1 incubated to identify potential monoclonal antibodies capable of promoting the phorbol ester mediated, LFA-1-dependent, spontaneous aggregation of EBV-transformed B cells Since the hybridoma cells were derived from cells that had never encountered the LFA-1 antigen, no monoclonal antibodies were detected produced antibodies to LFA-1.

Consequently, any detected antibody that inhibited aggregation must be able to bind to an antigen that was not LFA-1 but was involved in the LFA-1 adhesion process. While any method of obtaining such monoclonal antibodies may be used, it is advantageous to recover ICAM-1 binding monoclonal antibodies by immunization of BALB / c mice using the methods described by Rothlein, R. et al. (J. Immunol., 137: 1270-1274 [1986]), and routes are described in Epsteln-Barr virus-transformed peripheral blood mononuclear cells of LFA-1-deficient individuals. Such cells are described by Springer, T.A. et al (J. Exper. Med. 160: 1901-1918 [1984]).

In a preferred method for the generation and detection of antibodies capable of binding to ICAM-1, mice were challenged with either EBV-transformed cells expressing both ICAM-1 and LFA-1, or preferably with TNF-activated endothelial cells immunizing ICAM-1 but not LFA-1. In the most preferred method of producing hybridoma cells producing anti-ICAM-1 antibodies, a Balb / c mouse was sequentially immunized with JY cells and with differentiated U 937 cells (ATCC CRL-1593). The spleen cells of these animals were removed, fused with myeloma cells and allowed development to antibody-producing hybridoma cells. The antibodies were screened for their ability to inhibit LFA-1-dependent, phorbol ester-induced aggregation of an EBV-transformed cell strain, for example, JY cells expressing both the LFA-1 receptor and ICAM-1 by Rothlein, R., et al., (J. Immunol., 137: 1270-1274 [1987]), antibodies which have been tested for their ability to inhibit such aggregation, si, v, are subjected to the phorbol ester-induced aggregation of a Cell strain, for example SKW3 (Dustin, M. et al., J. Exper. Med. 165: 672-692 (1987)), whose ability to spontaneously collagen in the presence of a phorbol ester is suppressed by antibodies which bind to LFA 1, but are not prevented by anti-ICAM-1 antibodies: antibodies that can inhibit the phorbol ester-induced aggregation of cells, such as JY cells, but not the phorbol ester-induced aggregation of Cells, such as SKW3 cells, can be prevented, are probably anti-ICAM-1 antibodies. Alternatively, antibodies capable of binding to ICAM-1 can be identified by "screening" for antibodies that can but do not inhibit LFA-1-dependent aggregation of LFA expression cells (such as JY cells) Cells that express LFA-1 but little or no ICAM-1 (such as normal granulocytes) or that bind to cells expressing ICAM-1 but not LFA-1 (such as TNF A further alternative is to immunoprecipitate cells expressing ICAM-1, LFA-1, or both, using antibodies that promote LFA-1-dependent aggregation of cells, such as JY cells. By SDS-PAGE or an equivalent method, some molecular characteristics of the molecule precipitated with the antibody can be prevented, and if the characteristic is the same as that of ICAM-1, then suppose that the antibody is an anti-ICAM-1 antibody.

Using monoclonal antibodies prepared as described above, the ICAM-1 double surface molecule was purified and characterized. ICAM-1 was purified from human cells or tissues using monoclonal antibody affinity chromatography. In one such method, a monoclonal antibody reactive with ICAM-1 is coupled to an inert column matrix. Any suitable method of effecting such coupling may be used, but preferably the method of Oettgen, H.C. a., J. BIoI. Chem. 259: 12034 [1984]). When a cell lysate is passed through the matrix, the existing ICAM-1 molecules are adsorbed and retained by the matrix. If the pH or the ion concentration of the column is changed, the bound ICAM-1 molecules can be eluted from the column. It is possible to work with any suitable matrix, but it is advantageous to use a Sepharose (Pharmacia) as the matrix material. The formation of column matrices and their use in protein purification are well known in the art.

As is known to those skilled in the art, the analyzes described above can be used to identify compounds capable of attenuating or preventing the rate or extent of cell adhesion. ICAM-1 is a cell surface glycoprotein expressed on non-hematopoietic cells, such as vascular endothelial cells, thymic epithelial cells, certain other epithelial cells and fibroblasts, and on hematopoietic cells, such as tissue macrophages, mitogen-stimulated T lymphocyte blasts, and germinalcentrated B cells and dendritic cells in tonsils, lymph nodes and Peyer's plates. ICAM-1 is strongly expressed on vascular endothelial cells in

T cell areas of lymph nodes and tonsils with reactive hyperplasia. On peripheral blood lymphocytes, ICAM-1 is expressed in small amounts. The phorbol ester-induced differentiation of some myelomonocytic cell somatic cells greatly increases ICAM-1 expression. Thus, ICAM-1 is preferably expressed at sites of inflammation, while in general, resting cells are not expressed. ICAM-1 expression on skin fibroblasts is increased three to five times by interleukin 1 or by gamma-interferon at 10 units / ml for 4 and 10 hours, respectively. The induction depends on protein and mRNA synthesis and is reversible. ICAM-1 has molecular weight heterogeneity in various cell types, with a molecular weight of 97 kd on fibroblasts, 114 kd on the myelomonocytic cell strain U 937 and 90 kd on the B lymphoblastoid cell JY. It has been found that ICAM-1 biosynthesis involves an intracellular precursor of approximately 73 kd. The non-N-glycosylated form resulting from tunikamycin treatment (which inhibits glycosylation) has a molecular weight of 55 kd. ICAM-1, isolated from phorbol ester-stimulated U937 cells or from fibroblast cells, yields an identical major product with a molecular weight of 60 kd after chemical deglycosylation. Monoclonal ICAM-1 antibodies inhibit the adhesion of phyiohaemaglutinin blasts to LFA-1-deficient cell strains. Pretreatment of fibroblasts, but not lymphocytes, with monoclonal antibodies capable of binding to ICAM-1 inhibits lymphocyte-fibroblast adhesion. It has been found that pretreatment of lymphocytes, but not τ fibroblasts, with antibodies to LFA-I also inhibits lymphocyte-fibroblast adhesion. ICmM-1 is thus the binding ligand of the complex CD 18 to leukocytes. It can be induced on fibroblasts and endothelial cells in vitro by inflammatory mediators, such as IL-1, gamma-interferon and the tornome necrosis factor, in a timeframe consistent with the infiltration of lymphocytes into inflammatory lesions in vitro (Dustin, ML et al., J. Immunol 137: 245-254 (1986); Prober, JS et al., J. Immunol 137: 1893-1896 [1936]). In addition, ICAM-1 is expressed on non-hemopoietic cells such as vascular endothelial cells, thymic epithelial cells, other epithelial cells and fibroblasts, and on hematopoietic cells such as tissue macrophages, mitogen-stimulated T lymphocyte blasts and germinalcentrated B cells and dendritic cells in tonsils, lymph nodes and Peyer's plates (Dustin, ML et al., J. Immunol., 137: 245-254 [1986]). IC.iM-1 is expressed on keratinocytes in benign inflammatory lesions such as allergic eczema, lichen planus, rash, urticaria and bullous diseases. Allergic skin reactions caused by the application of a hapten to the skin against which the patient is allergic also revealed strong ICAM-1 expression on the keratinocytes. In contrast, toxic spots on the skin showed no ICAM-1 expression on the keratinocytes. ICAM-1 is present on keratinocytes from biopsies of skin lesions of various dermatological disorders, and ICAM-1 expression is induced on lesions of allergic patching, while keratinocytes from toxic patch test lesions did not express ICAM-1.

ICAM-1 is therefore a cell substrate to which lymphocytes can attach so that the lymphocytes can migrate to sites of inflammation and / or perform various effector functions that contribute to this inflammation. This function includes production of the antibody, lysis of virus-infected target cells, etc. The term "inflammation" as used herein includes reactions of the specific and nonspecific defense system. As used herein, the term "specific defense system" means the component of the immune system, which responds to the presence of specific antigens. Inflammation is said to result from a response of the specific defense system when the inflammation is caused, mediated, or associated with a reaction of the specific defense system. Examples of inflammation resulting from a reaction of the specific defense system include the response to antigens such as the rubella virus, autoimmune diseases, delayed-type hypersensitivity reaction mediated by T cells (as seen, for example, in individuals who have a positive result in the mantaux test), psoriasis etc.

A "non-specific defense system response" is a response mediated by leukocytes that lack immunological memory, such as granulocytes and macrophages, In the present application, inflammation is said to be the result of a non-specific defense system response when it causes the inflammation One example of inflammation that results, at least in part, from a non-specific defense system response includes, for example, inflammation associated with such conditions as asthma, adult respiratory distress syndrome (ARDS). or multiple organ deficiency syndromes secondary to septicemia or trauma; reperfusion injury to myocardial or other tissues; acute glomerulonephritis; reactive aethritis; dermatoses with acute inflammatory components; acute purulent meningitis; Malignancy; Hemodialysis; leukapheresis; ulcerative colitis; Crohn's disease; necrotizing enterocolisHis; granulocyte-transfusion-associated syndromes and cytokine-induced toxicity.

According to the present invention, functional ICAM-1 derivatives, and in particular those derivatives having fragments or mutant variants of ICAM-1 having domains 1, 2 and 3, can be used in the treatment or therapy of such non-specific defense system responses. Particularly preferred for such treatment or therapy are ICAM-1 fragments or mutant variants containing domain 2 of ICAM-1. Particularly preferred for such treatment or therapy are ICAM-1 fragments or mutant variants containing domain 1 of ICAM-1.

C. Cloning of the CAM-1 gene

Any of a number of methods can be used to clone the ICAM-1 gene. One of these methods involves the analysis of a scrapbook vector library of cDNA inserts (derived from an ICAM-1 expressing cell) for the presence of an insert containing the ICAM-1 gon. Such analysis may be performed by transfecting cells with the vector and then assaying for expression of ICAM-1. The preferred method of cloning this gene involves determining the amino acid sequence of the ICAM-1 molecule. For this, the ICAM-1 protein can be purified and analyzed by automated sequencers. Alternatively, the molecule may be fragmented, for example with cyanogen bromide or with proteases such as papain, chymotrypsin or trypsin (Oike, Y. et al., J. Biol. Chem. 257: 9751-9758 [1982]; Liu, C. et al. Int. J. Pept. F-Vteln Res. 21: 209-215 [1983]). You can indeed the entire

However, it is advantageous to determine the sequence of the peptide fragments of the molecule. When the peptides are longer than 10 amino acids, the sequence information is generally sufficient to allow for the cloning of a gene such as the ICAM-1 gene.

The sequence of amino acid residues in a peptide is referred to herein using either the common three-letter designation or its one-letter designations. A list of these three- and one-letter designations is given in textbooks such as Biochemistry, Lehninger, A., Worth Publishers, New York, NY (1979). If such a sequence is listed vertically, the amino acid terminal residue must be at the top of the list, while the carboxy-terminal residue of the peptide should be at the bottom of the list. Similarly, if a horizontal listing is made, the amirioterminus must be at the left end, while the carboxy terminus should be to the right. The amino acid residues in a peptide can be separated by hyphens. These hyphens only facilitate the presentation of a sequence. As a purely illustrative example, the amino acid sequence is named

Gly-Ala-Ser-Phe

that an Ala residue is attached to the carboxy group of Gly, and that a Ser residue is linked to the Arboxy group of residue ALa and to the amino group of a Phe residue. The term also indicates that the amino acid sequence contains the tetrapeptide Gly-Ala-Ser-Phe. The term is not intended to limit the amino acid to this tetrapeptide but rather to (1) the tetrapeptide having one or more amino acid residues attached to either the amino or carboxy terminus, (2) the totrapeptide having one or more amino acid residues, both and (3) include the tetrapeptide with no additional amino acid residues associated with the amino and carboxy terminus. Once one or more suitable peptide fragments have been sequenced, the DNA sequences are examined which can encode them. Since the genetic code is degenerate, more than one codon may be used to encode a particular amino acid (Watson, JD, in: Molecular Biology of the Gene, 3rd Aur'l., WA Benjamin, Inc.). Menlo Park, CA [1977] p.356-357). The peptide fragments are analyzed to identify the sequences of amino acids that can be encoded by oligonucleotides with the lowest level of degeneracy. This is preferably achieved by the identification of sequences containing amino acids which are encoded by a single codon. Although occasionally such an amino acid sequence can only be encoded by a single oligonucleotide, often the amino acid sequence can be encoded by any of a number of similar oligonucleotides. Importantly, while all members of the series contain oligonucleotides that can encode the peptide fragment and thus contain potential the same nucleotide sequence as the gene encoding the peptide fragment, but only one member of the series contains a nucleotide sequence corresponding to this nucleotide sequence Gene is identical. Since this member is present in the series and can hybridize to the DNA even in the presence of the other members of the series, it is possible to use the unfractionated series of oligonucleotides in the same way as one would use a single oligonucleotide to clone the gene which encodes the peptide.

In a manner exactly analogous to that described above, one may employ an oligonucleotide (or a set of oligonucleotides) having a nucleotide sequence that is complementary to the oligonucleotide sequence or set of sequences that can encode the peptide fragment.

A suitable oligonucleotide or set of oligonucleotides capable of encoding a fragment of the ICAM-1 gene (or complementary to such oligonucleotide or set of oligonucleotides) are identified (using the method described above) , and synthesized and hybridized by known methods using a DNA or, preferably, a cDNA prepsate derived from human cells capable of expressing ICAM-1 gene sequences. Methods for nucleic acid hybridization are described by Maniatis, T., et al., In: Molecular Cloning, A Laboratory Manual (Molecular Cloning, Laboratory Manual), Cold Spring Harbor, NY (1982), and by Haymes, BD, et al., In: Nucleic Acid Hybridization , A Practical Approach), IRL Press, Washington, DC (1985), and these references are incorporated herein by reference. The source of DNA or cDNA used was preferably enriched for ICAM-1 sequences. This enrichment can a. simplest contact achieved with cDNA obtained by extracting RNA from cells which have been cultured under conditions which induce ICAM-1 synthesis (such as ^beispielswe; U937 se, which have been drawn in the presence of phorbol esters, etc.). Methods such as or similar to those described above have successfully cloned genes for human aldehyde dehydrogenases (Hsu, L.C., et al., Proc Natl Acad ScI. USA 82: 3771-3775 [1985]), fibronectin (Suzuki, et al. S., et al., Eur. Mol. BIoI. Organ. J. 4: 2519-2524 [1985]), the human estrogen receptor gene (Walter, P., et al., Proc. Natl. Acad., USA 82: 7889-7893 1985]), tissue-type plasminogen activator (Pennica, D., et al., Nature 301: 214-221 [1983]) and human complementary alkaline phosphatase placental DNA (Kam, W., et al., Proc. Natl. Acad. See, USA 82: 8715-8719 [1985]).

In a preferred alternative way of cloning the ICAM-1 gene, a library of expression vectors is made by cloning DNA, or preferably cDNA, from a cell which can express ICAM-1 into an expression vector. Subsequently, the library is "screened" for members capable of expressing a protein that binds to the anti-ICAM-1 antibody and that has a nucleotide sequence that can encode polypeptides having the same amino acid sequence as the ICAM ICAM-1 monoclonal gene obtained by the methods described above can be operably linked to an expression vector and introduced into bacterial or eukaryotic cells to form ICAM-1. Methods for such manipulations are disclosed by Maniatis, T., et al., Supra, and are well known in the art.

D. Applications of LFA-1 Dependent Aggregation Analyzes

The above-described analysis, with which it is possible to measure LFA-1-dependent aggregation, can be used to identify agents which act as antagonists to suppress the extent of LFA-1-dependent aggregation. These antagonists may act by affecting the ability of LFA-1 or ICAM-1,

to mediate the aggregation. Thus, these agents include immunoglobulins, such as an antibody that can bind to either LFA-1 or ICAM-1. In addition, nonimmune globulin agents (i.e., chemical agents) can be screened using the analysis described above to immobilize them as antagonists of LFA-1 aggregation.

E. Applications of Antibodies that Bind to! CAM-1 Receptor Proteins

1. Anti-inflammatory agents

Monoclonal antibodies to members of complex CD18 inhibit many adhesion-dependent functions of leukocytes, including attachment to the fcndothel (Haskard, O-et al., J. Immunol 137: 2M! -2906 [1986]), of homotypic adhesions (US Pat. 16: 1132-1149 [1986]), antigen and mitogen-induced proliferation of lymphocytes (Davignon, D., et al., Proc. Natl. Aced -4539 [1981]), antibody formation (Fischer, A., et al., J. Immunol., 136: 3198-3203 [1986]), and of effector functions of all leukocytes, such as lytic activity of cytotoxic T cells (Krensky, AM, et al. et al., J. Immunol., 132: 218ί> -2182 [1Ί84]), macrophages (Strassman, G., et al., J. Immunol., 136: 4328-4333 [1986]), and all cells dependent on antibody-dependent, cytotoxic reactions are involved (Kohl, S., et al., J. Immunol., 133: 2972-2973 [1984]). In all the above-mentioned actions, the antibodies inhibit the ability of the leukocytes to adhere to the corresponding cell substrate, which in turn stops the end result.

As stated above, the binding of ICAM-1 molecules to members of the I.EA-1 family of molecules is of central importance for cell adhesion. Through the process of adhesion, lymphocytes are able to constantly monitor an animal for the presence of foreign antigens. Although these processes are usually desirable, they are also the cause of organ graft clearance, rejection of tissue grafting, and many autoimmune diseases. Consequently, any means by which cell attachment could be alleviated or prevented would be highly desirable in organ transplant recipients, tissue grafts, or autoimmune patients. Monoclonal antibodies capable of binding to ICAM-1 are very useful as anti-inflammatory agents in mammals. Significantly, these agents differ from the general antiinflammatory agents in that they can selectively inhibit adhesion and have no side effects such as nephrotoxicity that occur with conventional agents. Monoclonal antibodies that can bind to ICAM-1 can therefore be used to prevent organ or tissue rejections or to modify autoimmune responses without the risk of side effects in the treated mammals.

Importantly, the use of monoclonal antibodies capable of recognizing ICAM-1 provides the opportunity to perform organ transplants even between individuals with HLA mismatch.

2. Suppressor of delayed hyperactivity reaction

Since ICAM-1 molecules are primarily expressed at sites of inflammation, e.g., sites associated with a delayed hypersensitivity reaction, antibodies (particularly monoclonal antibodies) that can bind to ICAM-1 molecules have therapeutic potential in attenuating or preventing them reactions. This potential therapeutic application can be used in two ways. First, a patient having a delayed hypersensitivity reaction may be administered a composition containing a monoclonal antibody to ICAM-1. For example, such compositions could be administered to a human who has come into contact with such antigens as poison ivy, poison oak, etc. In the second embodiment, the monoclonal antibody capable of binding to ICAM-1 is administered to a patient in conjunction with an antigen to prevent a subsequent inflammatory response. Thus, the additional administration of an antigen with an ICAM-1 binding monoclonal antibody can cause a subject to temporarily tolerate the final challenge with that antigen.

3. Therapy in a chronic inflammatory disease

Since LAD patients lacking LFA-1 do not elicit an inflammatory response, it is believed that the antagonist of the natural ligand of LFA-1, ICAM-1, also prevents an inflammatory response. The ability of antibodies to inhibit inflammation ICAM-1 forms the basis for their therapeutic use in the treatment of chronic inflammatory diseases and autoimmune diseases such as lupus eryththematosus, autoimmune thyroiditis, experimental allergic encephalomyelitis (EAE), multiple sclerosis , some forms of diabetes, the Reynaud syndrome, rhsumatoid arthritis, etc. Such antibodies could. ·> I am used for therapy in the treatment of psoriasis. In general, monoclonal antibodies that can bind to ICAM-1 can be used in the treatment of the diseases currently being treated with steroid therapy.

4. Diagnostic and prognostic applications

Since ICAM-1 is primarily expressed at sites of inflammation, monoclonal antibodies that can bind to ICAM-1 can be used to visualize or visualize sites of infection and inflammation in a patient. In this application, the monoclonal antibodies are detectably labeled by the use of radioisotopes, affinity tags (such as biotin, avidin, etc.), fluorescence labels, paramagnetic atoms, etc. Dio methods for this labeling are well known in the art. A review of the clinical use of antibodies in diagnostic visualization is provided by Grosiman, H. B., Urol. CIIn. North Amer. 13: 465-474 [1986]), Unger, E.C., et al. Invest. Radiol.20: 693-700 [1985]) and Khaw, B.A, et al., Science 205: 295-297 [1980]). The presence of inflammation can also be detected by the use of sensing ligands, such as mRNA or DNA, that bind to ICAM-1 gene sequences or to ICAM-1 mRNA sequences from cells that express ICAM-1. Methods for carrying out these hybridization analyzes are described by Maniatis, T., (εϊ?} Ϊ́6 obon).

Detection of foci of such detectably labeled antibodies is indicative of a site of inflammation or tumor development. In one embodiment, this assay is performed after inflammation by taking tissue or blood samples and incubating those samples in the presence of detectably labeled antibodies. In a preferred embodiment, this method is applied in a non-invasive manner by the application of magnetic visualization, fluorography, etc. practiced. Such a diagnostic test can be used in the monitoring of organ transplant recipients to detect early signs of potential tissue rejection. Such studies may also be used in an effort to determine the presidency of individuals for rhoumatoid arthritis or other chronic inflammatory diseases.

5. Addition in the Introduction of Antigenic Material Provided for Therapeutic or Diagnostic Purposes Immunological actions on therapeutic or diagnostic agents such as bovine insulin, interferon, tissue type plasminogen activator, or mouse monoclonal antibody spoil significantly affect the therapeutic or diagnostic value of such agents cause such diseases as the serum sickness. Such a situation can be alleviated by the use of the antibodies of the present invention. In this embodiment, the antibodies would be administered in conjunction with the therapeutic or diagnostic agent. The addition of antibodies prevents the recipient from recognizing the agent, thereby preventing the recipient from inducing an immune response thereto. The lack of such an immune response enables the patient to include additional administrations of the therapeutic or diagnostic agent.

F. Applications of the Intercellular Adhesion Molecule (ICAM-1)

ICAM-1 is a binding partner of LFA-1. As such, ICAM-1 or its functional derivative can be used interchangeably with antibodies that can bind to LFA- ⁴ , this interchangeable use is possible in the treatment of diseases. Consequently, these molecules can be used in solubilized form to inhibit inflammation, organ rejection, rejection of engraftment, and so on. ICAM-1 or its functional derivative can be used in the same way as anti-ICAM antibodies to reduce the immunogenicity of therapeutic or diagnostic agents.

ICAM-1, its functional derivatives and its antagonists can be used to block the metastasis or proliferation of tumor cells that express on their surfaces ICAM-1 or LFA-1. To achieve this goal, a variety of methods can be used c-n. For example, hematopoietic cell migration requires LFA-MCAM-1 binding. Antagonists of this binding thus suppress this wall and block the metastasis of cells of a tumor of the leukocyte family. Alternatively, a patient may be administered toxin-derived molecules that can bind either ICAM-1 or a member of the LFA-1 family of molecules. When such toxin-derived molecules bind to tumor cells expressing ICAM-1 or a member of the LFA-1 family of molecules, the presence of the toxin kills the tumor cells, thereby inhibiting the proliferation of the tumor.

G. Applications of Human Immunoglobulin Antagonists of ICAM-1 Dependent Adhesion

ICAM-1-dependent adhesion can be suppressed by non-immunoglobulin antagonists capable of binding to ICAM-1 or LFA-1. An example of a non-immunoglobulin antagonist of ICAM-1 is LFA-1. An example of a non-immunoglobulin antagonist that forms on LFA-1 is ICAM-1. Using the analyzes described above, other non-immunoglobulin antagonists can be identified; and be cleaned. Non-immunoglobulin antagonists of ICAM-1-dependent adhesion can be used for the same purposes as antibodies to LFA-1 or antibodies to ICAM-1.

H. Administration of the Compositions of the Invention

The therapeutic effects of ICAM-1 can be achieved by administering to a patient the complete ICAM-1 molecule or any therapeutically active peptide fragment thereof.

ICAM-1 and its functional derivatives are known either synthetically, obtained using the recombinant DNA technique or by proteolysis. The therapeutic benefits of ICAM-1 can be enhanced by the use of the functional derivatives of ICAM-1, which contain additional amino acid residues added to enhance coupling to the carrier or to enhance the activity of ICAM-1. The scope of the present invention is also intended to include functional derivatives of ICAM-1 lacking certain amino acid residues or containing altered amino acid residues as long as these derivatives have the maturity to affect cellular adhesion.

Both the antibodies of the present invention and the ICAM-1 molecule disclosed herein are characterized as being "substantially free of natural contaminants" when the preparations in which they are contained are substantially free of substances with which These products occur normally and naturally.

The present invention relates to antibodies and their biologically active fragments (both polygonal and monoclonal) capable of binding to ICAM-1. Such antibodies can be produced either by an animal, by a tissue culture or by means of the recombinant DNA technique.

When administering antibodies or their fragments capable of binding to ICAM-1 to a patient or when administering ICAM-1 (or its fragment, variant or derivative) to a recipient patient, the dosage of the administered agent varies Depending on such factors as age, weight, height, sex, general medical condition, past history of the patient, etc. In general, it is advisable to administer to the recipient a dose of the antibody which ranges from about 1 pg / kg to 10 mg / kg (body weight of the patient) is sufficient, although a lower or higher dosage is possible. When administering ICAM-1 molecules or their functional derivatives to a patient, it is advantageous to administer these molecules in a dosage that is also between about 1 pg / kg and 10mg / kg (body weight of the patient), albeit a lower one or higher dosage is possible. As indicated below, when the anti-ICAM-1 antibody is supplemented with an anti-ICAM-1 antibody, the therapeutically effective dose can be lowered

Anti-LFA-1 antibody is administered. In the present application, it is said that a compound is additionally administered with a second compound when administration of the two compounds is timed to a point that both compounds can be detected simultaneously in the patient's serum.

Both the antibody capable of binding to ICAM-1 and ICAM-1 itself can be administered to the patient intravenously, intramuscularly, subcutaneously, enterally or parenterally. Upon administration of the antibody or ICAM-1 by injection, this administration may be by continuous infusion or by single or multiple doses.

The anti-inflammatory agents of the present invention should be administered to recipient individuals in an amount sufficient to suppress inflammation. An amount is said to be sufficient to "suppress" inflammation if the dosage, route of administration, etc., to the agent are sufficient to attenuate or prevent the inflammation.

The anti-ICAM-1 antibody or its fragment may be administered alone or in combination with one or more additional immunosuppressants (especially to a recipient of an organ or tissue graft). Administration of such compound (s) may be for either "prophylactic" or "therapeutic" purposes. In prophylactic administration, the immunosuppressant compound (s) are given prior to an inflammatory reaction or inflammatory symptom (e.g., before, at, or shortly after the time of organ or tissue transplantation, but in any event prior to any sign of organ rejection). Prophylactic administration of the compound (s) serves to prevent or attenuate a possible subsequent inflammatory response (such as rejection of a transplanted organ or tissue, etc.). In therapeutic administration, the immunosuppressive compound (s) are given at the beginning (or shortly after such onset) of a symptom of actual inflammation (such as organ or tissue rejection). Therapeutic administration of the compound (s) serves to attenuate any actual inflammation (such as rejection of a transplanted organ or tissue). The anti-inflammatory agents of the present invention may therefore be administered either prior to the onset of inflammation (to suppress, for example, expected inflammation) or after the onset of inflammation.

A composition is said to be "pharmacologically acceptable" if the recipient patient can tolerate its administration. It is said that such agent is administered in a "therapeutically effective amount" when the amount administered is physiologically significant. An amount is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient.

The antibody and ICAM-1 molecules of the present invention can be processed by known methods to produce pharmaceutically useful compositions whereby these substances or their functional derivatives are combined in admixture with a pharmaceutically acceptable carrier vehicle. Suitable vehicles and their preparation, including other human proteins, e.g. human serum albumin is described, for example, in Remington's Pharmaceutical Sciences (16th Ed., Osol, A., eds., Mack, Easton, PA (198O)) to prepare a pharmaceutically acceptable composition suitable for effective administration these compositions comprise an effective amount of the anti-ICAM-1 antibody or ICAM-1 molecule and its functional derivatives together with a suitable amount of the carrier vehicle.

To control the duration of the effect, additional pharmaceutical methods can be used. Controlled release preparations can be prepared by the use of polymers to complex with or absorb the anti-ICAM-1 antibody or ICAM-1 or its functional derivatives. The controlled release may be exercised by selecting appropriate macromolecules (for example, polyesters, polyamino acids, polyvinyl, pyrrolidone, ethylene vinyl acetate, methyl cellulose, carboxymethyl cellulose or protamine, sulfate) and the concentration of the macromolecules, as well as the containment control methods. Another possible method of controlling the duration of action by controlled release preparations is to include anti-ICAM-1 antibodies or ICAM-1 molecules or their functional derivatives in particles of a polymeric material such as polyesters, polyamino acids, hydrogels poly (lactic acid ) or ethylene-vinyl acetate copolymers. All in all, to include dioser agents in polymeric particles, it is possible to include this material in microcapsules prepared, for example, by coacervation or interfacial polymerization, such as hydroxymethylcellulose or gelatin microcapsules or in colloidal drug delivery systems For example, liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules, or in macroemulsions. These methods are disclosed in Remington's Pharmaceutical Sciences (1980). Having now generally described the invention, it should be further illustrated by reference to the following examples which are intended to be illustrative and in no way limit the invention unless expressly stated.

example 1 Breeding of mammalian cells In general, the EBV-transformed and hybridoma cells of the present invention were grown in a culture medium RMP11640 supplemented with 2OmM L-glutamine, 50pg / ml gentamicin and 10% fetal bovine sera (or calf fetal sera); the Cells were grown at 37 ^° C. in an atmosphere with 5% CO2 and a humidity of 95%. To detect Epstein-Barr virus transformants (EBV transformants), 10 ^e peripheral blood mononuclear cells,

T cells were withdrawn / ml in RPMI 1640 medium supplemented with 20% fetal calf serum (FCS) and 50 ng / ml gentamicin for 16 hours with EBV-containing, supernatant layer of B95-8 cells incubator (Thorley -Lawson,

D.A., et al., J. Exper. Med. 146: 495 [1977]). The cells were added in aliquots of 0.2 ml in 10 microtiter wells. The Medium was replaced with RPMI 1640 medium (supplemented with 20% fetal calf serum and 50μg / π ^ \ gentamicin) until Cell growth was detected. Cells grew in most wells and were expanded in the same medium. Phytohemoglutinin (PHA) blasts were injected at 10 ° C / ml in RPMM 640 medium (supplemented with 20% fetal calf serum),

which determined a dilution of PHA-P of 1: 800 (Difco Laboratories, Inc., Detroit, MI). PHA strains were identified with

Interleukin 2-conditioned medium (IL-2 conditioned medium) dilated and weekly pulsed with PHA

Cantrsll, D.A., et al., J. Exper., Med., 158: 1895 (1983)). The method described above was reported by Springer, T., et al.

J. Exper. Med. 160: 1901-1918 (1984), and this reference is hereby incorporated by reference. The cells obtained by the method described above are then "screened" with anti-LFA-1 antibodies to determine if they express the LFA-1 antigen. Such antibodies are described by Sanchez-Madrid, F., et al. Exper. Med. 158: 1785 (1983).

example Analyzes of cell aggregation and adhesion

To determine the extent of cellular adhesion, aggregation studies or aggregation analyzes were made. The cell strains used in these studies were washed twice with the RPM11640 medium containing 5 mM Hepes buffer (Sigma Chemical Co., St. Louis) and re-suspended at a concentration of 2 x 10 ^e cells / ml. To flat bottomed microtiter plates with 96 vertebrae (# 3596, Costar, Cambridge, MA), 50 μM of the corresponding monoclonal antibody supernatant layer or 50 μM of the complete medium with or without purified monoclonal antibody, 50 μ! the complete Medkms with 200 ng per ml Phorbolesterphorbolmyristatazetat (PMA) and 100μΙ of cells with a concentration of 2 x 10, where ^s cells / ml in complete medium. Pas gave a final concentration of 50 ng / ml PMA and 2 × 10 ⁵ cells / well. The cells were able to settle spontaneously and the degree of aggregation was determined at different times. The rating ranged from 0 to 5+, with 0 indicating that substantially no cells were present in bundles; 1 + indicated that less than 10% cells were present in aggregates; 2+ indicated that less than 50% of the cells had aggregated; 3+ indicated that up to 100% of the cells formed small, loose bunches; 4+ indicated that up to 100% of the cells clustered in larger clusters, and 5+ indicated that 100% of the cells formed large, very compact aggregates or clumps. To obtain a more quantitative determination of cell adhesion, reagents and cells were added in the same order as above to 5 ml polystyrene tubes. The tubes were placed on a Kreiselrüttler in a frame, and treated at 37 ⁰ C. After 1 hour at 200 rpm, 10 μl of the cell suspension was placed in a hemocytometer and the number of free cells was quantified. D !: percentage aggregation was determined by the following equation:

", _ ... ... (No. of free cells 1

% Aggregation = 100 χ \ 1 -τ; -; - I

\ No. of use cells /

The number of use cells in the above formula is the number of cells per millimeter of a control tube containing only cells and complete medium that were not incubated. The number of fre'.on cells in the above equation is equal to the number of unmatched cells per ml of experimental tubes. These procedures were described by Rothlein, R., et al., J. Exper. Med. 163: 1132-1149 (1986).

Example 3 LFA-1-dependent cell aggregation

The qualitative aggregation study from Example 2 was carried out using a cell strain JY transformed with the Epstein-Barr virus. After the addition of PMA to the culture medium in the microtiter plates, the aggregation of the cells was observed. Video time-force imaging revealed that the JY cells were motile at the bottom of the microtiter wells and had active membrane ruffling and pseudopod movement. The contact between the dummy feet of adjacent cells often led to the cells sticking together. When the liability was extended, the region of the cell phone contact moved to the Uropod. The contact could be maintained in spite of strong Zallbewegungen and the tugging of the cells in opposite directions. The major difference between PMA-treated and untreated cells appeared to be the stability of these contacts after they had formed. With PMA, cell clusters developed and increased in size as additional cells adhered to their periphery. As a second method for measuring the adhesion, the quantitative examination described in Example 2 was used. Cell suspensions were shaken for 2 hours at 200 rpm, transferred to a hemocytometer and counted for cells that were not shaped into clumps. In the absence of PMA, 42% (SD - 20%, N = 6) of the JY cells were pooled after 2 hours, while JY cells incubated under identical conditions with 50ng / ml PMA accounted for 87% of the Cells (SD = 8% N = 6) in aggregates. Kinetic studies of aggregation showed that PMA increased the rate and magnitude of aggregation at all time points studied (Figure 3).

Example 4 Inhibition of cell aggregation using anti-LFA-1 monoclonal antibodies

In order to study the effect of anti-LFA-1 monoclonal antibodies on PMA-induced cell aggregation, these antibodies were added to cells that had been incubated according to the qualitative aggregation study of Example 2. The monoclonal antibodies were found to inhibit cell aggregation in both the presence and absence of PMA. Both the F (ab ') ₂ and the Fab' fragments of the monoclonal antibodies to Jie alpha chain of LFA-1 were able to inhibit cell aggregation. While substantially 100% of the cells formed clots when the anti-LFA-1 antibody was absent, only less than 20% of the cells were contained in clumps when the antibody was added. The results of this experiment have been described by Rothlein, R., et al. (J. Exper. Med. 163: 1132-1149 [1986]).

Example 5 Cellular aggregation causes the LFA-1 receptor

In the manner described in Example 1, EBV-transformed lymphoblastoid cells of patients were prepared. These cells were "screened" for monoclonal antibodies that could recognize LFA-1, and the cells were found to be LFA-1 deficient.

The qualitative aggregation study described in Example 2 was performed using the cu. "Written, LFA-1-deficient cells applied. Such cells did not clump together in the presence of PMA.

Example 6 The discovery of ICAM-1

The LFA-1 deficient cells of Example 5 were labeled with carboxyfluorescein diacetate (Patarroyp, M., et al., Cell Immunol 63: 237-248 [1981]). The labeled cells were mixed at a ratio of 1:10 with autologous or JY cells, and the percentage of fluorescently-labeled cells in the aggregates was determined by the method of Rothlein, R., et al. a., J. Exper. Med. 163: 1132-1149 (1986). It was found that the LFA-1 deficient cells were capable of co-aggregation with LFA-1 expressing cells (Fig.4).

In order to determine whether LFA-1 is important only in the formation of aggregates or in their maintenance, antibodies which are able to bind to LFA-1 have been added to the already formed aggregates in the manner described above. It was found that the addition of the antibody severely disrupted the preformed agglomerations. Video time-lapse recordings confirmed that addition of the monoclonal antibodies to the preformed agglomerations began within 2 hours ί of their disruption (Table 1). Following the addition of mone .donalen antibodies to LFA-1, the pseudopodial movements and changes in the shape of individual cells within the aggregates persisted unchanged. Individual cells gradually separated from the edge of the aggregation; after 8 hours the cells were predominantly dispersed. In video time-lapse recordings, the breakup of the previously formed aggregates by LFA-1 monoclonal antibodies appeared to be equivalent to the aggregation process in the absence of monoclonal LFA-1 antibodies when decayed.

Table 1 Ability of monoclonal anti-LFA-1 antibodies, previously

disrupted PMA-induced JY cell aggregates

Exp. Aggregation valuation

2 hours * 18 hours

mAb + mAb

1 4+ 4+ H- "

2 3+ 4+ 1+ ^c

3 5+ 5+ 1+ ^d

The aggregation in qualitative microtiter plate analysis was visually evaluated. If anti-I.FA-1 was present throughout the analysis period, the aggregation was less than 1 +.

a amount of aggregation just before the addition of the monoclonal

Antibodies at 2 hours, b TS1 / 18 + TS1 / 22 c TS1 / 18 d TS1 / 22

Example 7 The demand for divalent ions for LFA-1-dependent aggregation

LFA-1-dependent adhesions between cytotoxic T cells and targets always require the presence of magnesium (Martz, E., J. Cell, BIoI 84: 584-598 (1980)). PMA-induced JY cell aggregation was examined for divalent cation dependence. JY cells did not clump together (using the study of Example 2) when the medium was free of calcium or magnesium ions. The addition of dibasic magnesium already supported aggregation at such low concentrations as 0.3 mM. The addition of calcium ions alone had little effect. However, it has been found that calcium ions enhance the ability of magnesium ions to promote PMA-induced aggregation. When 1.25 mM calcium ions were added to the medium, even concentrations as low as 0.02 mM magnesium ions were sufficient to aid in aggregation. These data showed that LFA-1 dependent aggregation of cells requires magnesium ions and that calcium ions alone are insufficient, but with the magnesium ions they produce a synergistic effect to allow aggregation.

Example 8

Isolation of hybridoma cells capable of expressing anti-ICAM-1 monoclonal antibodies Monoclonal antibodies capable of binding to ICAM-1 were prepared by the method of Rothlein, R., et al., J. Chem. Immunol. 137: 1270-1274 (1986), and this reference is hereby incorporated by reference. Thus, 3 BALB / C mice were intraperitoneally immunized with EBV-transcribed, peripheral blood mononuclear cells from LFA-1-deficient individuals (Springer, TA, et al., J. Exper. Med. 160: 1901 [1984]). For each immunization, approximately 10 ⁷ cells were used in 1 ml of RPM 11640 medium. L'.e immunizations were performed 45.29 and 4 days prior to removal of the spleen cells from the mice to produce the desired hybridoma cell strains. On day 3 before the removal of the spleen cells, the mice additionally received 10 ⁷ cells in 0.15 ml of medium (intravenously).

The isolated spleen cells from the animals described above were fused with myeloma cells P3X73 Ag 8,653 in a ratio of 4: 1 according to the protocol of Galfre, G., et al., Nature 266: 550 (1977). Aliquots of the resulting hybridoma cells were introduced into 96-well microtiter plates. The supernatant hybridoma layers were grown on

Inhibition of aggregation was "screened" and a disrupting hybridoma (out of more than 600 wells tested) was cloned and subcloned by limiting dilution This subclone was designated RR1 / 1.1.1 (hereinafter abbreviated to "RR1 / 1").

It was consistently found that monoclonal antibody RR1 / 1 inhibits PMA-stimulated aggregation of the LFA-1 expressing cell strain JY. The monoclonal RR1 / 1 antibody suppressed the clustering to the same extent or slightly less than some monoclonal antibodies to the LFA-1 alpha or beta subunits. In contrast, the monoclonal control antibody against HLA, which is abundantly expressed on JY cells, did not inhibit aggregation. The antigen bound by monoclonal antibody RR1 / 1 is called intercellular adhesion molecule-1 (ICAM-1).

Example 9

Use of Monoclonal Antl-ICAM-1 Antibodies to Characterize the ICAM-1 Molecule In order to determine the nature of ICAM-1, and in particular to determine whether ICAM-1 is different from LFA-1, have been used of the human antibody RR1 / 1 cell proteins immunoprecipitated. The immunoprecipitation was carried out according to the method of Rothlein, R. et al. (J. Immunol., 137: 1270-1274 [1986]). JY cells were transfected with 5 x 10 ⁷ cells / ml in 1% Triton X-100, 0, 14m NaCl, 10 mM Tris, pH 8.0, with freshly added 1 mM phenylmethylsulfonyl fluoride, 0.2 units per ml of trypsin inhibitor-apatinin ( Lysis buffer) lysieri for 20 minutes at 4 ° C. The lysates were centrifuged for 10 min at 10,000xg and precleared with 50μl of a 50% suspension of CNBr-activated, glycine-quenched Sepharose C1-4B for one hour at 4 ° C. One milliliter of the lysate was immunoprecipitated with 20 μl of a 50% suspension of the monoclonal antibody RR1 / 1 coupled to Sepharose C1-4B (1 mg / ml) overnight at 4 ° C (Springer, TA et al., J. Exp. Med.160: 1901 [1984]). Sepharose-bound antibodies (monoclonal) were prepared using CNBr activation of Sepharose CL-4B in carbonate buffer according to the method of March, Sua (Anal. Biochem. 60: 149 [1974]). The washed immunoprecipitates were subjected to SDS-PAGE and silver staining by the method of Morrissey, JH, Anal. Biochem. 17: 307 (1981).

After elution of Profine with SDS sample buffer (Ho, MKua, J.BIol.Chem.258: 636 [1983]), at 100 ⁰ C, the samples were divided in half and subjected to electrophoresis (SDS 8% PAGE) reducing (Figure 5A) or non-reducing (Figure 5B) conditions. Bands of molecular weights of 50kd and 25kd corresponded to the heavy and light chain of immunoglobulins from the monoclonal antibody Sepharose (Figure 5 A, lane 3). Variable amounts of other bands in the 25 to EOkd range were also observed, but could not be observed in hair leukemia cell precipitate which gave only a 90 kd molecular weight band. It was found that the alpha subunit was 177kd and the beta subunit was 95kd of LFA-1 under both reducing (Figure 5A, lane 2) and nonreducing (Figure 5B, lane 2) conditions of ICAM -1 hiking differently. To determine the effect of monoclonal antibody RR1 / 1 on PHA lymphoblast aggregation, the qualitative aggregation study described in Example 2 was used. Thus, T-cell blast cells were stimulated with PHA for 4 days, washed thoroughly, and then cultured for 6 days in the presence of an IL-2 conditioned medium. It was found that PHA stayed inside during this 6-day culture and did not contribute to the aggregation study. In three different studies with different T-cell blast preparations, monoclonal ICAM-1 antibodies consistently inhibited aggregation (Table 2).

Table 2

Inhibition of PMA-stimulated PHA lymphoblast aggregation by the monoclonal RR1 / 1 antibody "

Exp. PMA MAb% Aggregation% Ligation "

-14 ^d 39 39 2 '

78 36

-14 -19

96

51

¹ Aggregation of PHA-induced lymphoblasts stimulated with 50ng / ml PMA was quantified indirectly

microscopically counting the number of unmatched cells described in Example 2. ^b Percent inhibition relative to cells treated with PMA and monoclonal antibody X63. ^c Aggregation was measured one hour after co-addition of the monoclonal antibody and PMA. The cells were shaken at 175 rpm.

^d A negative number indicates the percentage increase in aggregation

 Aggregation was measured one hour after co-addition of the monoclonal antibody and PMA. The cells were pelleted at 200 μg for 1 min, incubated at 37 ° C. for 15 min, gently re-suspended and 45 min at 10 rpm

shaken

 Cells were pretreated with PMA at 37X for 4 hours. After addition of the monoclonal antibody, the tubes were incubated stationary at 37 ° C for 20 min and shaken at 75 rpm for 100 min.

control 9 control 51 HLA-A, B 58 LFA-1 Alpha 31 ICAM-1 31 control 10 control 78 LFA-1 beta 17 ICAM-1 50 - 7 control 70 HLA-A, B 80 LFA-3 83 LFA-1 Alpha 2 LFA-1 beta 3 ICAM-1 34

Monoclonal LFA-1 antibodies were consistently more disruptive than monoclonal ICAM-1 antibodies, whereas monoclonal HLA-A, B and LFA-3 antibodies had no effect. These results show that of the monoclonal antibodies tested, only those capable of binding to LFA-1 or ICAM-1 are able to inhibit cell adhesion.

Example 10 Preparation of Monoclonal Antibody to ICAM-1

immunization

A Balb / C mouse was immunized intraperitoneally (ip) with 0.5 ml 2 χ 10 ⁷ JY cells in RPMI medium 103 Tqge and 24 days prior to fusion. On days 4 and 3 prior to fusion, the mice were immunized ip with 10 ⁷ cells of PMA-differentiated cells U937 in 0.5 ml of RPMI medium.

Differentiation of U937 cells

U937 cells (ATCC CRL-1593) were prepared by incubation at 5 x 10 ml in RPMI medium containing 10% fetal bovine serum, 1% glutamine and 50 μg / ml gentamycin (complete medium) containing 2 ng / ml phorbol-12-myristata acetate (PMA ) was differentiated in a sterile polypropylene container. On the third day of this incubation, half of the volume of the medium was withdrawn and replaced with fresh complete medium containing PMA. On day 4, the cells were removed, washed and prepared for immunization.

Merger or merger

Spleen cells from the immunized mice were fused in a 4: 1 ratio to Galfre's myeloma cells P3 χ 63 Ag8.653, inter alia (Nature 266: 550 [1977]). Following fusion, the cells were plated in 96 well flat bottom microtiter plates at a concentration of 10 ⁶ spleen cells / well.

Selection for antl-ICAM-1-positive cells

After one week 50μΙ of the obscuring layer were screened in the qualitative aggregation study of Example 2 using JY and SKW-3 as aggregating cell strains The cells from the supernatant layers containing the aggregation of JY cells but not the SKW 3 cells were selected and cloned twice using the limiting dilution.

This experiment led to the identification and cloning of three separate hybridoma strains that produce anti-ICAM-1 monoclonal antibodies. The antibodies produced by this hybridoma was IgG ₂ a, IgG _{2 b} bzwl IgM. The hybridoma cell strain producing the anti-ICAM-1 antibody IgG _{2 was} named R6'5'D6'E9'B2. The antibody produced by the preferred hybridoma cell strain was designated R 6'5'D6'E9'B 2 (hereinafter referred to as "R6-5-D6").

Example 11

Expression and regulation of ICAM-1

To measure ICAM-1 expression, a radioimmunoassay was developed. In this study, purified RR1 / 1 was iodinated to a specific activity of 10μΟί / μρ using iodogen. In 96-well plates, endothelial cells were grown and treated as described for each experiment. The plates were cooled at 4 ⁰ C, to which they have been added for a period of 0.5 to 1 hour in a refrigerator, not directly on ice. The monolayers were washed three times with cold complete media and then incubated for 30 min at 4 ° C with ¹²⁵ I-RR1 / 1. Then the monolayers were washed three times with complex medium. The bound ¹²⁶ I was released using 0.1 N NaOH and counted. The specific activity of ^'26 I-RR1 / 1 was adjusted using unlabeled RR1 / 1 to obtain a linear signal over the range of antigen densities found in this study. The nonspecific binding was determined in the presence of a thousand-fold excess of unlabelled RR1 / 1 and subtracted from the total binding resulting in specific binding.

ICAM-1 expression, as measured using the radioimmunoassay described above, increases in human umbilical vein endothelial cells (HUVEC) and endothelial human venous saphenous (HSVEC) cells by IL-I, TNF, LPS and IFN-gamma (Table 3). Endothelial cells of the saphenous vein were used in this study to confirm the results of umbilical vein endothelial cells in cultured large vein endothelial cells derived from adult tissue. Basal ICAM-1 expression is two-fold higher in endothelial cells of the saphenous vein than in umbilical vein endothelial cells. When umbilical vein endothelial cells are exposed to recombinant IL-1 alpha, IL-1 beta and TNF gamma, ICAM-1 expression increases 10 to 20 fold. IL-1 alpha, TNF and LPS were the most potent inducers, IL-1 - was less potent on a weight basis and also at saturation levels for the response (Table 3). At a concentration of 100 ng / ml, IL-I Beta increased ICAM-1 expression 9-fold on HUVEC and 7,3-fold on HSVEC, with a 15ng / ml half-maximal increase. At a concentration of 50 ng / ml, rTNF increased ICAM-1 expression 16-fold on HUVEC and 11-fold on HSVEC with half-maximal effects at 0.5 ng / ml. Interferon gamma produced a significant 5.2-fold increase in ICAM-1 expression on HUVEC or 3.5-fold on HSVEC at 10,000 units / ml. The effect of LPS was similar at a concentration of ^ g / ml on the order of rTNF. Paired combinations of these mediators resulted in additive or slightly under additive effects on ICAM-1 expression (Table 3). Cross-titration of rTNF with rIL-1 beta or rlFiM gamma did not result in synergism between these at suboptimal or optimal concentrations.

Since LPS enhanced ICAM-1 expression on endothelial cells at a level sometimes found in culture media, the possibility that ICAM-I basal expression might be due to LPS was investigated. When examining various serum costs, it was found that the low endotoxin serum gave a 25% lower ICAM-1 basal expression. All results reported here are for endothelial cells raised in low endotoxin serum. However, inclusion of the LPS neutralizing antibiotic polymyxin B at a concentration of η lOpg / ml only reduced ICAM-1 expression by a further 25% (Table 3). The increase in ICAM-1 expression when treated with IL-1 or TNF was not effected by the presence of 1 μg / ml polymyxin B, consistent with the low endotoxin levels in these preparations (Table 3).

Table 3 Antl ICAM monoclonal antibodies

Condition (16h) '"! • specifically bound (CPM) _ 9x HSVEC _ 7.3x - HUVEC 16X 1132 + 31 11,2x control "03 ± 11 16X 8,320 ± 766 9.2x IOOng / nilrlL-1 beta 5,680 ± 633 15x - 3.5x 50ng / mlrlL-1 alpha 9910 ± 538 5; 2x 12 690 ± 657 14x 50 ng / mlrTNF alpha 9 650 ± 1500 24x 10,459 ± 388 10x 10 ng / mlLPS 9530 ± 512 23X 4 002 ± 664 7.4x 10ng / mlrlFN gamma 3120 ± 308 13X 16269 ± 660 14x rIL-1 beta + rTNF 1469 ± 1410 24X 10,870 ± 805 12x rlL-1 Beta + LPS 13 986 ± 761 22X 8401 ± 390 10x rlL-1 beta + rlFN gamma 7,849 ± 601 17X 16141 ± 1272 - rTNF + LPS 15364 ± 1241 - 13,238 ± 761 - rTNF + rlFN gamma 13480 ± 1189 11X 10987 + 668 - LPS + IFN gamma 10 206 ± 320 2 O x - - Polymyxin B (10 mg / ml) 480 ± 23 13X - Polymyxin B + rlL-1 5 390 ± 97 1.1x - Polymyxin B + rTNF 9,785 ± 389 - 1 mg / ml LPS 7 598 ± 432 Polymyxin B + LPS 510 ± 44

The upregulation of ICAM-1 expression on HVEC and HSVEC-HUVEC or HSVEC was introduced into a 96-well 1: 3 plate from a confluent monolayer and allowed to grow to confluency. Then the cells were treated with the indicated materials or media for 16 hours and RIA was made as in the methods. All points were determined fourfold.

Example 12

Kinetics of interleukin-1 and gamma-interferon induc- tion of ICAM-1

The kinetics of interleukin-1 and gamma-interferon effects on ICAM-1 expression on dermal fibroblasts were determined using the goat anti-mouse IgC binding assay of Dustin, ML, et al., J.Imiviunol 137: 245-254 (19861), and this reference is incorporated by reference In order to perform this binding assay, human dermal fibroblasts were placed in a 96-well microtiter plate to a density of 2.8 x 10 ⁴ cells / well (0.32 cm ²⁾ is drawn. the cells were washed twice with medium RPM11640 supplemented as in example 1. in addition, the cells were washed once with Hanks balanced salt solution (HBSS), 1OmM HEPES, 0.05% NaN ₃ and 10% heat-inactivated fetal bovine serum washed. washing with this binding buffer was done at 4 ⁰ C. to each well was 50μΙ the corresponding Supernatants Hybridomschicht with X63 and W6 / 32 as negtiver or positive control and the above-50μΙ be added binding buffer added. After incubation at 4 ° C with gentle stirring and for 30mins. For ^example , the wells were washed twice with the binding ^buffer and the second antibody, ^I26I goat anti-mouse IgG, was added with 100 nCi in 100 μl. The ^12S I goat anti-mouse antibody was prepared using Jodogen (Pierce) according to the method of Fraker, PJ, et al. (Biochem. Biophys. Res. Commun. 80: 84 (1978)). After 30 min at 4 ° C, the wells were washed twice with 200 μM binding buffer, and the cell layer was solubilized by the addition of 100 μM of 0.1 N NaOH. This and a ΙΟΟμΙ wash were counted in a Beckman 5500 gamma counter. Specific bound counts per minute were calculated as (cpm with monoclonal antibody) - (cpm with X63) (cpm = count / min). All steps, including induction with special reagents, were performed in quadruplicate.

The effect of interleukin 1 with a half-life for induction of ICAM-1 of 2 hours was faster than that of gamma-interferons with a half-life of 3.75 hours (Figure 6). The timing of the quiescent decline of ICAM-1 appeared to be dependent on the cell cycle or rate of cell growth. For resting cells, the effects of interleukin 1 and gamma interferon are stable for 2 to 3 days, whereas in log phase cultures ICAM-1 expression remains near the baseline for approximately 2 days after removal of these inducing agents.

The dose-response curves for the induction of ICAM-1 by recombinant mouse and human interleukins and recombinant human gamma-interferon are shown in FIG. It has been found that gamma interferon and interleukin have similar concentration dependencies with approximately identical effects at 1 ng / ml. The recombinant human and mouse interleukin 1 also have similar curves, but are much less effective than human interleukin-1 preparations in inducing expression of ICAM-1.

Cyclohexamide, an inhibitor of protein synthesis, and actinomycin D, an inhibitor of mRNA synthesis, abolish the effects of interleukin 1 and gamma-interferon on the expression of ICAM-1 on fibroblasts (Table 4). In addition, tunikamycln, an inhibitor of N-linked glycosylation, inhibited the effect of interleukin 1 by only 43%. These results indicate that protein and mRNA synthesis, but not N-linked glycosylation, are required for increases in the expression of ICAM-1 stimulated by interleukin 1 and gamma interferon.

Table 4

Effect of cycloheximide, actinomycin D and tunikamycin on the induction of ICAM-1 by IL-I and gamma-IFN on human dermal fibroblasts *

treatment ¹²⁵ l goat anti-mouse IgG, specific Anti-ICAM-1 Anti-HLA-A, B, C bound (cpm) 1524 ± 140 11928 ± 600 1513 ± 210 10,678 ± 471 Control (4 h) 1590 + 46 12,276 ± 608 + Cycloheximi 1461 ± 176 12340 ± 940 + Actinomycin D T «.VT -L. LIW 12155 ± 510 + Thunikamycin 1619 ± 381 12676 ± 446 iL 1 (1OEh./iiiii{4ii/ 1613 ± 88 , 12294 ± 123 + Cycloheximide 3084 ± 113 13434 ± 661 + Actinomycin D 4659 ± 109 23,675 ± 500 + Tunikamycin 1461 ± 59 10,675 ± 800 IFN-Y (10Eh / ml) (18h) 1326 ± 186 12,089 ± 500 + Cycloheximide + Actinomycin D

a Human fibroblasts were drawn 0.32 cm ^/] 2u recess to a density of 8 x 10 'cells. The treatments were carried out in a final volume of 50μΙ containing the indicated reagents. Cycloheximide, actinomycin D and tunikamycin were added at the same time as the cytokines at 20 pg / ml, 10μΜ and 2pg / ml, respectively. All points are the mean of each vijr wells + SD (standard deviation).

Example 13

The tissue distribution of ICAM-1

Histochemical studies were performed on frozen tissue of human organs to determine the distribution of ICAM-1 in thymus, lymph nodes, iliac, skin, kidneys and liver. To perform this analysis, frozen tissue sections {4 pm strong) of normal human tissue were fixed in acetone for 10 min and stained with the monoclonal antibody TR1 / 1 by an immunoperoxidase technique using the avidin-biotin complex method (Vectort Laboratories, Burlingame , CA), available from Cerf-Bensussan, N., et al (J. Immunol., 130: 2615 [1983]). After incubation with the antibody, the sections were sequentially incubated with biotinylated horse anti-mouse IgG and avidin biotinylated peroxidase complex. Finally, the sections were dipped in a solution containing 3-amino-9-ethylcarbazole (Aldrich Chemical Co., Inc., Milwaukee, WI) to cause a color reaction. The sections were then fixed in 4% formaldehyde for 5 minutes and counterstained with hematoxylin. The controls include sections which have been incubated with unrelated monoclonal antibodies in place of the RR1 / 1 antibody.

It has been found that ICAM-1 has a distribution very similar to that of histocompatibility major complex (MHC) antigens, class II. Most of the blood vessels (small as well as large) in all tissues stained the endothelial rollers with the ICAM-1 antibody. Vascular endothelial staining was more intense in the interfoliotic (paracortical) sections of the lymph nodes, tonsils and Peyer's plaques than in the vessels of the kidneys, liver and normal skin. In the liver, the color was mainly confined to the sunusoidal lining cells; the hepatocytes and endothelial cell lining of most of the protal veins and arteries were not stained.

In the thymusmark, a diffuse staining of large cells and a dendritic staining scheme were observed. In the Krotex, the staining pattern was focal and predominantly dendritic. Thymocytes were not stained. In the peripheral lymphoid tissue, the germ middle cells of the secondary lymphoid follicles were intensely stained. In some lymphoid follicles, the staining pattern was predominantly dendritic with no discernible staining of the lymphocytes. In addition, a pale staining of the cells in the mantle zone was observed. In addition, dendritic cells with cytoplasmic extensions (interlocking cells of the reticulum) and a small number of lymphocytes in the intorfollicular or paracortical sections were stained with the ICAM-1 binding antibody.

Macrophage-like cells were stained in the lymph nodes and lamina propria of the small intestine. Fibroblast-like (spiral) cells and dendritic cells scattered in the basal tissue of most of the organs studied were stained with the ICAM-1 binding antibody. No staining was detected in the Langerhans indeterminant cells in the epidermis. No staining was detected in smooth muscle tissue.

The staining of the epithelial cells was consistently visible in the mucosa of the tonsils. Although hepatocytes, bile duct epithelium, intestinal epithelial cells and kidney tubular epithelial cells did not stain in most circumstances, sections of normal kidney tissue made from a nephrectomy specimen with renal cell carcinoma had staining of many tubular proximal cells for ICAM -1 on. These tubular epithelial cells also stained with an anti-HLA-DR binding antibody.

In conclusion, ICAM-1 becomes expression on non-hematopoietic cells, such as vascular dothelial cells, and on hematopoietic cells, such as tissue macrophages and mitogen-stimulating T-lymphocyte blasts. It has been found that ICAM-1 is expressed in small amounts on peripheral blood lymphocytes.

Example 14 Purification of ICAM-1 by monoclonal antibody affinity chromatography General cleaning scheme

ICAM-1 was purified from human cells or tissue using monoclonal antibody affinity chromatography. First, the monoclonal antibody RR1 / 1, which is reactive with ICAM-1, was purified and coupled to an inert co-ion matrix. This antibody was from Rothlein; R., et al., J, Immunol. 137: 1270-1274 (1986), and by Dustin, M. L, et al., J. Immunol. 137: 245 (1986). ICAM-1 was solubilized by lysing the cells in a nonionic detergent, Triton X-100, at approximately neutral pH from cell membranes. The cell lysate with the solubilized ICAM-1 was then passed through precolumns designed for this purpose. To remove substances that nonspecifically bind to the material of the column matrix, and then through the monoclonal antibody column matrix, which could bind ICAM-1 to the antibody. The antibody column was then washed with a series of purifying buffer washings of increasing pH so that the pH increased to 11.0. During these washes, ICAM ₁ -I remained bound to the antibody matrix, while non-binding and weakly binding contaminants were removed. The bound ICAM-1 was then eluted specifically from the column using a purification buffer of pH 12.5.

Purification of Monoclonal Antibody RR1 / 1 and Covalent Coupling to Sepharose CL-4B

The anti-ICAM-1 monoclonal antibody RR1 / 1 was purified from the ascites fluid of hybridoma-bearing mice or from the supernatant layers of hybridoma culture by standard methods of ammonium sulfate precipitation or protein-1 affinity chromatography (Ey et al., Immunochem. 15: 429 [197B]). The purified IgG or rat IgG (Sigma Chemical Co., St. Louis, Mo.) was covalently attached to Sepharose CL-4B (Pharmacia., Inc.) using a modification of the method of March et al. (Anal. Biochem., 60: 149 [1974]). Upsala, Sweden). Briefly, Sepharose CL-4B was washed in distilled water, activated with 40mg / ml CNBr in 5M K ₂ HPO ₄ (pH about 12) for 5 minutes and then washed thoroughly with 0.1mM HCl at 4 ° C. The filtered, activated Sepharose was re-suspended with an equal volume of the purified antibody (2-10 mg / ml in 0.1 M NaHCO 3, 0.1 M NaCl). The suspension was incubated at 4 ^° C. for 18 hours with gentle rotation from one end to the other. Then the supernatant layer was checked for unbound antibody by absorbance at 280 nm and the remaining reactive sites on the activated sepharose were saturated to 0.05 M by the addition of glycine. The coupling efficiency was usually higher than 90%.

Resistance to solubility of membranes prepared from human spleen

All preliminary steps were carried out at 4 ° C. Frozen human spleen (fragments to 200g) from patients with hairy cell leukemia were thawed on ice in 200 ml Tris-saline (5OmM Tris, 0.14m NaCl, pH 7.4 at 4 ⁰ C) thawed containing 1 mM phenylmethylsulfonyl fluoride (PMSF), 0 , 2 units / ml aprotinin and 5 mM iodoacetamide. The tissue was cut into small pieces and homogenized at 4 ⁰ C in a Tekmar homogenizer with drive. The volume was then brought to 300 ml with Tris-saline and 100 ml of 10% Tween 40 (polyoxyethylene sorbitan monopalmitate) in Tris-saline added, giving a final concentration of 2.5% Tween 40.

To make membranes, the homogenate was extracted from Teflon using three strokes of a Dounce homogenizer or preferably a Potter-Elvejhen homogenizer and then centrifuged at 10OOx g for 15 minutes. The supernatant layer was retained and the pellet was re-extracted with 200 ml of 2.5% Tween 40 in Tris saline. After centrifuging at 1000χ g for fifteen minutes, the supernatant layers of both extractions were combined and centrifuged at 15,000xg for one hour to pellet the membranes. The membranes were washed by resuspension in 200 ml Tris saline and centrifuged at 15,000 x g for one hour. The membrane pellet was resuspended in 200 ml Tris saline and homogenized with a motorized homogenizer and Teflon pestle until the suspension was uniformly cloudy. The volume was then brought to SO4 with Tris-saline and N-lauroylsarcosine was added to a final concentration of 1%. After stirring at 4 ° C for 30 minutes, the insoluble matter in the purification lysate was removed by centrifugation at 15,000 x g for 1 hour. Then, the layer Supernatants Triton X-100 was added to a final concentration of 2% was added and the lysate was stirred at 4 ⁰ C for one hour.

Detergent solubilization of JY-B lymphoblastoid cells

EBV-transformed R lymphoblastoid cell strain JY was grown in medium RPM11640 containing 10% fetal calf serum (FCS) and 10mM HePES to an approximate density of O, 8-1.0 x 10 ^beta cells / ml. To increase the cell surface expression of ICAM-1, phorbol-12-myrista M 3-acetate (PMA) at a concentration of 25 ng / ml was added 8 to 12 hours prior to harvesting the cells. Sodium vanadate (50μΜ) was also added to the cultures at this time. The seeds were pelleted by centrifuging at 500 x g for 10 minutes and washed twice in Hanks balanced salt solution (HBSS) by resuspension and centrifugation. The cells (approximately 5 g per 5 L of culture) were dissolved in 50 mL lysis buffer (0.14 M NaCl, 50 mM Tris, pH 8.0.1% Triton X-100, 0.2 units / mL aprotinin, 1 mM PMSF, 50 μM Sodium vanadate) by stirring at 4 ° C for 30 minutes. Undecomposed cores and insoluble debris were removed by centrifugation at 1000 x g, followed by centrifuging the supernatant layer at 1500GOx g for one hour and filtering the supernatant layer through 3 mm Whatman filter paper.

AffinrtStschromatcgrafle from ICAM-1 for structural investigations

For bulk purification of ICAM-1 used for structural studies, one column was added to 10 ml of RR 1/1 Sepharose CL-4B (coupled at 2.5 mg of antibody / ml of gel). ml precursors of CN-activated, glycine quenched Sepharose CL-4 frit rat IgG coupled to Sephan.se CL-4B (2 mg / ml). The columns were connected in series with 10 column volumes of lysis buffer, 10 column volumes of a buffer of pH 12.5 (50 mM triethylamine, 0.1% Triton X-100, pH 12.5 at 4 ° C). prewashed, followed by equilibration with 10 column volumes of lysis buffer. One liter of the human spleen purification lysate was filled at a flow rate of 0.5-1.0 ml / min. The two precursors were used to remove nonspecific binding material from the lysate before passing through the RR1 / 1 Sepharose column.

After loading, the column of RR 1/1-Sepharose and bound ICAM-1 was washed successively at a flow rate of 1 ml / min with a minimum of 5 column volumes of each of the following: 1) lysis buffer, 2) 20 mM Tris, pH 3. Value 8.0 / 0.14 M NaCl / 0.1% Triton X-100.3) 20 mM glycine, pH 10.0 / 0.1% Triton X-100 and 4) 50 mM triethylamine, pH 11 , 0 / 0.1% Triton X-100. All wash buffer solutions contained 1 mM PMSF and 0.2 units / ml aprotinin. After washing, the remaining bound ICAM-1 was washed with 5 column volumes of an elution buffer eluted (5OmM triethylamine / 0.1% Triton X-100, pH 12.5 at 4 ⁰ C) at a flow rate of 1 ml / 3rnin. The eluted ICAM-1 was collected in 1 ml fractions and immediately neutralized by the addition of 0.1 ml of 1M Tris, pH 6.7. Fractions containing ICAM-1 were identified by SDS-polyacrylamide-electrophoresis of ΙΟ-μΙ-AlJs (Springer et al., J. Exper. Med. 160: 1901 [1984]), followed by silver staining (Morrissey, JH, Annal. former 117: 307 [1981 D. Under these conditions, the mass of ICAM-1 eluted in about one column volume and was more than 90% pure, as determined from the silver-stained electropherograms (a small amount of IgG, from Af. The fractions containing ICAM-1 were pooled and concentrated about twentyfold using Centricon-30 microconcentrators (Amicon, Danvers, MA) .The purified ICAM-1 was purified by Lowry's method. Protein analysis quantified using an ethanol-engineered aliquot of the pooled amount: from 200g of human spleen about 500μc of pure ICAM-1 was produced.

About 200 pg of the purified ICAM-1 was subjected to a second purification step by preparative SDS-polyacrylamide gel electrophoresis. The band representing ICAM-1 was visualized by soaking the gel in 1M KCl. The gel region containing ICAM-1 was then excised and electroeluted by the method of Hunkapiller et al., Meth. Enzymol, 91: 227-236 (1983). The purified protein was greater than 98% pure as evidenced by SDS-PAGE and silver staining.

Final cleaning of ICAM-1 for functional investigations

ICAM-1 for use in functional studies was purified from purification lysates of JY cells as described above but with the following modifications and on a smaller scale (a 1 ml column of RR1 / 1 Sepharose). All solutions contained 50 mM sodium vanadate. After the column was washed with a pH 11.0 buffer containing 0.1% Triton X-100, the column was washed once more with five column volumes of the same buffer, replacing 0.1 % Triton X-1001% n-octyl-beta-D-glucopyranoside (octylglucoside). The octyl glucoside eliminator displaces the ICAM-1-bound Triton X-100 and, unlike Triton X-100, can subsequently be removed by dialysis. Thereafter, the ICAM-1 was eluted with a pH 12.5 buffer containing 1% octylglucoside instead of 0.1% Triton X-100, and analyzed and concentrated as described above.

Example 15 Characteristics won gerigtigt \ M ·!

ICAM-1, which is from the human. Iz isolate migrated in SDS-polyacrylamide gels as a broad band with M from 72,000 to 91,000. ICAM-1 isolated from JV cells also migrated as a broad band with M, from 76500 to 97000. These M, Values are within the indicated range for ICAM-1 immunoprecipitated from different cell sources: M, = 90,000 for JY cells, 114,000 for myelomonolytic cell strain U937, and 97,000 for fibroblasts (Dustin, et al., J. Immunol 137: 245 1986]).

This broad range of Μ, values has been attributed to a broad but variable degree of glycosylation. The non-glycosylated precursor has an M, value of 55,000 (Dustin et al.). The protein isolated from JY cells or human spleen retains its antigenic activity as evidenced by the ability to re-bind the original affinity column, and by immunoreaction with RR 1/1 sepharose and SDS-polyacrylamide. electrophoresis. To generate U-Tt peptide fragments from ICAM-1, approximately 200 pg of 2mM dithiothreitol / 2% SDS were reduced, followed by alkylation with 5 mM iodoacetic acid. The protein was precipitated with ethanol and (in 0.1 M NH ₄ CO ₃ / 0.1 mM CaCl ₂ A), 1% Zwittergent 3-14 and redissolved at 37 ⁰ C for 4 hours with 1% (wt Calbiochem) ./Gew.) trypsin digested, followed by an additional digestion with 1% trypsin at 37 ⁰ C for a period of 12 hours. The tryptin peptides were purified by reverse phase HPLC using a 0.4cm χ 15cm C4 column (Vydac). The peptides were eluted with a linear gradient from 0% to 60% acetonitrile in 0.1% trifluoroacetic acid. Selected ^J Pept e were subjected to sequence analysis on a gas phase Mikrosequenzator (Applied Biosystems). The sequence information obtained from this study is shown in Table 5.

Table 5 Amino acid sequences of ICAM-1 tryptols

amino 50 a 50b 46 a Follow with low conflict 46 b X peptides K AA Ambiguities in the episode; more probable amino acid is named first J U O M1 acid- [TA /] A (V / A) Episode with very low confidence e V L e major peptide A L V L test F S Q P e 45 N L Smaller peptide G L T L / E 1 L I T A L S ¹ P D S G L P (G) 2 T S F A F T L V I P 3 V L P P P V R L e G / Y 4 Y G L L A T P V T N / L cn P W P P P Y Q T P (N) 6 T P I I N G G C P / V (Q) 7 S V G (G) V - L S K (E) 8th e e (G) T / L D e T (D) 9 A S D / P L S L S 10 G / S V V - F F C 11 A T D K S e D 12 G V W P A -Q 13 Q K T P 14 V / L S K 15 i A 16 P 17 X 18 Q 19 L 20 21 () = I] = / a = b

Example 16

Cloning the ICAM-1 gene

The gene for ICAM-1 can be cloned using any of a number of methods. For example, the amino acid sequence information obtained by sequencing tryptin peptides of ICAM-I (Table 5) may be used to identify an oligonucleotide sequence that would correspond to the ICAM-1 gene. Alternatively, the ICAM-1 gene can be cloned using an anti-ICAM-1 antibody to determine clones that produce ICAM-1.

Cloning the gene for ICAM-1 using oligonucleotide probes using the genetic code (Watson, JD, in: Molecular Biology of the Gene, 3rd ed., WA Benjamin Inc., Menlo Park, CA M 977) ]), one or more different oligonucleotides could be identified, all of which would be able to encode the ICAM-1 tryptin peptides. The likelihood that a particular oligonucleotide will actually represent the actual ICAM-1 coding sequence can be determined by considering a-normal base pairing relationships and the frequency with which a particular codon is actually used (to encode a particular amino acid) in eukaryotic cells become. These "code usage rules" are described by Lathe, R., et al., J. Molec., BIoI, 183: 1-12 (1985) Using the "code usage rules" of Lathe, a single oligonucleotide or set of oligonucleotides is identified. which contain a theoretically "most likely" nucleotide sequence (ie, the least redundant nucleotide sequence) capable of encoding the ICAM-1 tryptin peptide sequences.

The oligonucleotide or set of oligonucleotides containing the theoretically "most likely" sequence that can encode the ICAM-1 fragments is used to identify the sequence of a complementary oligonucleotide or set of oligonucleotides capable of hybridizing to the oligonucleotide. most likely "sequence or hybridize the set of sequences. An oligonucleotide containing such a complementary sequence can be used as a probe to identify and isolate the ICAM-1 gene (Maniatis, T., et al., Molecular Cloning, A Laboratory Manual, Molecular Cloning ), Cold Spring Harbor Press, Cold Spring Harbor, NY [1982]).

As described above in Section C, it is possible to clone the ICAM-1 gene from eukaryotic DNA preparations which are believed to contain this gene. To identify and clone the gene encoding the ICAM-1 protein, a DNA library is screened for its ability to hybridize to the oligonucleotides described above. Since it is likely that in a normal diploid cell only two copies of the gene for ICAM-1 are included, and because it is possible that the ICAM-1 gene has large, non-transcribed, intervening sequences (introns), their cloning is not desirable For example, it is advantageous to isolate ICAM I coding sequences from a cDNA library prepared from the mRNA of an ICAM-1 producing cell instead of starting from the genomic DNA. Suitable DNA or cDNA preparations are enzymatically cleaved or randomly cut and ligated into recombinant vectors. The ability of these recombinant vectors to hybridize to the oligonucleotide probes described above is then measured. Methods for hybridization are described, for example, in Maniatis, T., Molecular Cloning. A Laboratory Manual "(Moleculares

Kk.tieren. Laboratory Manual), Cold Spring Harbor Press, Cold Spring Harbor, NY (1982), or Haymes, BT, et al., Nucleic Acid Hybridization. A Practical Approach), IRL Press, Oxford, England (1985) Vectors determined to be suitable for such hybridization are then analyzed to the extent and nature of ICAM-1 determine -sequences tu, which are contained in them. From a purely statistical considerations starting, a gene such as that which encodes the ICAM-1 molecule, lotidsonde be unambiguously identified (via Hyhridisierungssichtuna) using a Oligonuc ¹ with only 18 Nuklootiden could.

Thus, in summary, Jen states that the actual identification of the ICAM-1 peptide sequences allows the identification of a theoretically most likely * DNA sequence or set of such sequences capable of encoding such a peptide. By constructing an oligonucleotide complementary to this theoretical sequence (or by constructing a set of oligonucleotides that are complementary to the set of "most likely" oligonucleotides), one obtains a DNA molecule or set of DNA molecules, the (dta) as Probe can (serve) to identify and isolate the ICAM-1 gene.

Using the ICAM-1 peptide sequences from Table 5, the sequence of the "most likely" sequence of an oligonucleotide capable of encoding the AA and J pepids was determined (Tables 6 and 7, respectively) were synthesized and probed for use as probes to isolate ICAM-1 gene sequences. "Suitable size-selected cDNA libraries were prepared from the poly (A) ⁺ RNA from PMA-induced HLA. A size-selected cDNA library was prepared using Pol. A) ⁺ RNA from PMA-induced HL-60 cells by the method of Gubler, U., et al. G ene25: 263-269 [1983]) and Corbi, A., et al. (EMBO J. β: 4023-4028 [198?]), Which references are incorporated herein by reference.

A size-selected cDNA library was prepared using poly (A) ⁺ RNA from umbilical vein endothelialis which had been stimulated for 4 hours with δμρ / ηιΙ PS. The RNA was extracted by homogenizing the cells in 4 M guanidinium isothiocyanate and by ultracentrifuging the supernatant layer through a CsCl gradient (Chirgwin, JM, et al., Blechern 18: 5294-5299 [1979]). Poly (A) ⁺ RNA was also added to the mixture of all RNA species using oligo (dT) -cellulose chromatography (Type 3, Collaborative Research) (Aviv, H., et al., Proc. Natl. Acad. See, USA 69: 1408-1412 [1972]).

Table 6 The most likely nucleotide sequence of complementary oligonucleotide capable of carrying the ICAM-1 To encode AA peptide

amino acid residue ICAM-I-AA- likely Komplemen from ICAM-1 peptide Episode to the codie tary episode tion of the AA peptide 5 ' 3 ' 162 Glu G C A T G C 163 Leu C G T A G ^f C 164 Asp G C A T C G 165 Leu C G T A G C 166 bad C G G C G C 167 Per C G C G C G 168 Gin C G A T G C 169 Gly G C G C C G 170 Leu C G T A G C 171 Glu G C A T G C 172 Leu C G T A G C

Continuation of Table 6

amino acid residue ICAM-1 AA likely Komplemen vonlCAM-1 Poptid FolgezurCodie- tary episode rungdesAA peptide 173 Phe τ · A T A T A 174 Glu G C A T G C 3 ' 5 ' 175 As η A T A T C G 176 Thr A T C G C G 177 Ser U. A C G A 3 ' CJL

Table 7

The most likely nucleotide sequence of complementary oligonucleotide capable of encoding the ICAM-1 J peptide

amino acid residue ! CAM-1 AA- likely Komplemen from ICAM-1 peptide Episode to the codie tary episode tion of AA pept id 5 ' 3 ' 19 Val G C T A G C 20 Thr A T A G C G 21 Cys T A G C c ' G 22 Ser T A C G c G 23 Thr A T C G C G 24 Ser T A C G C G 25 Cys T Q G C T A 26 Asp G C A T C G 27 gin C G A T G C 28 Per C G C G C G 29 Lys A T A T 3 ' CJL

The first cDNA strand was synthesized using 8% g of poly (A) ⁺ RNA, avian myeloblastosis virus reverse transcriptase (Life Sciences) and an O! Igo (dT) starter. The DNA-RNA hybrid was digested with RNase H (BRL) and the second strand was synthesized using DNA polymerase I (New England Biolabs). The product was methylated with Eco R 1 methylase (New England Biolabs), blunt-end ligated to Eco R 1 linker (New England Biolabs), digested with Eco RI and size-selected on a low melting point agarose gel. cDNA greater than 500bp was ligated to Xgt 10, which had previously been digested with Eco R1 and dephosphorylated (Stratagene). The ligation product was then packaged (Stratagene gold).

Subsequently, the umbilical vein endothelial and HL-60 cDNA libraries were plated at a concentration of 20,000 PFU / 150mm plate. Recombinant DNA was transferred in duplikater shape Nitrozellulosfilter, denatured in 0.5 M NaOH / 1.5M NaCl, neutralized in 1 M Tris, pH 7.5 / 1.5M NaCl and baked for two hours at 8O C ^0th (See Benton, WD et al., Science 196: 180-182 (1977)). The filters were prehybridized and hybridized in 5x SCC containing 5X Denhardt's solution, 50 mM NaPO ₄ and 1 pg / ml salmon sperm DNA. Prehybridization was for one hour at 45 ° C.

Hybridization was performed using 32 bp non-codogenic oligonucleotides ('5-TTGGGCTGGTCACAGGAGGTGGAGCAGGTGAC) or 47 bp (5').

GAGGTGTTCTCAAACAGCTCCAGOCCCTGGGGCCGCAGGTCCAGCTC) based on the ICAM-1 tryptin peptides J and AA, respectively, as described above (Tables 6 and 7) (Lathe, R "J. Molec. Biol. 183: 1-12 (1985)). The oligonucleotides were end-labeled with Y- ( ³² P) ATP using T4 polynucleotide kinase and conditions recommended by the manufacturer (New England Biolabs). After the H / bridisierung overnight, the filters were washed at 45 ⁰ C for a period of 30 minutes, twice with 2x SCC / 0.1% SDS. Phages from the plaques were isolated, hybridized, and were purified by successive replating and "screening."

Cloning the gene for ICAM-1 using an anti-ICAM-1 antibody Alternatively, the gene for ICAM-1 can also be cloned using an anti-ICAM-1 antibody. DNA, preferably cDNA, is extracted and purified from a cell capable of expressing ICAM-1. The purified cDNA is fragmented (by shearing, endonuclease digestion, etc.) to create a pool of DNA or cDNA fragments. DNA or cDNA fragments from this pool are then cloned in an expression vector to create a genomic library of expression vectors whose elements each contain a unique, cloned DNA or cDNA fragment.

Examples

Anylse of the cDNA clones

Phage DNA from positive clones was digested with Eco R1 and assayed using a cDNA from a clone as a transmission after Southern analysis. Maximum size cDNA inserts were subcloned into the Eco R1 site of the plasmid vector pGEM4Z (Progema) because they hybridized crosswise. HL-60 subclones containing the cDNA in both orientations were deleted by exonuclease III digestion (Henikoff, S., Gene 28: 351-35911984 |) using the manufacturer's recommendations (Erase-a-Base, Progema ) were applied. Progressively deleted cDNA was then cloned and subjected to dideoxynucleotide chain termination sequencing (Sanger, F., et al., Proc. Natl. Acad. Sei. USA 74: 5463-5467 (1977)) according to the manufacturer's recommendations (Sequenase, US Biochemical). The HL-60 cDNA 5 'and coding regions were completely sequenced on both strands and the 3' Boreich was approximately 70% sequenced on both strands. A representative endothelial cDNA was sequenced over most of the length by "shotgun" cloning of 4 bp recognition restriction enzyme fragments.

The cDNA sequence of an HL-60 and an endothelial cell DNA was determined (FIG. 8). The 3023bp sequence contains a short, 5'-untranslated region and a 1.3kb 3 'untranslated region with a consensus polyadenylation signal at position 2966. The longest open reading frame starts with the first ATG at position 58 and ends with a TGA-terminating triplet at position 1653. The identity between the transferred amino acid sequence and the sequences determined from 8 different tryptine peptides, giving a total of 91 amino acids (which are underlined in Figure 8), confirmed that authentic ICAM-1 cDNA clones were isolated. The amino acid sequences of ICAM-1 tryptine peptides are shown in Table 8.

Table 8

Amino acid sequences of ICAM-1 tryptine peptides

Peptide residues sequence

J 14-29 XGSVL VTCSTSCDQPK

U 30-39 L L G I E T P L IP) (K)

50 78-85 (T) F L T V Y X T

X 89-95 VELAPLP

AA 161-182 X ELDLRPQGLE -

LFEXTS APXQL

K 232-246 LNPTVTYGXDSFSAK

45 282-295 SFPAP NV (T / l) LXKPQ (V / L)

- indicates that the sequence will continue on the next line.

Underlined sequences were used to prepare oligonucleotide probes.

Hydrophobicity analysis (Kyte, J., et al., J. Molec. Biol. 157: 105-132 (1982)) suggests that there are 27 residual signal sequences. The assignment of + 1-glutamine is consistent with the inability to obtain an N-terminal sequence on 3 different ICAM-1 protein preparations; Glutamine can cyclize to pyroglutamic acid, resulting in a blocked N-terminus. The translate sequence from 1 to 453 is predominantly hydrophilic, followed by a 24 residue of a hydrophobic, presumed transmembrane region. The transmembrane domain is immediately followed by several charged residues, which are contained in the remainder of a probable cytoplasmic domain.

The predicted size of the mature polypeptide chain is 55,219 daltons, which is in excellent agreement with the observed size of 55,000 for deglycosylated ICAM-1 (Dustin, M.L., et al., J. Immunol., 137: 245-254 (1986)). Eight N-terminal glycosylation sites are predicted. The lack of asparagine in the tryptine peptide sequences of 2 of these sites confirms their glycosylation and extracellular orientation. Assuming 2,500 daltons per high mannose N-linked carbohydrate, the ICAM-1 precursor is predicted to be 75,000 daltons, which is contrasted by a six-fold observation of 73,000 da tons (Dustin, ML, et al., J. Immunol 137: 245-254 (1986).) Following conversion of this mannose to complex carbohydrate, the mature ICAM-1 glycoprotein, depending on the cell type, is 76 to 114 kd in size (Dustin, M.L., et al., J. Immunol 137: 245-254 [1986]). Consequently, ICAM-1 is a highly glycosylated, but otherwise typical integral membrane protein.

Example 18

ICAM-1 is an integrin-binding element of the immunoglobulin supergene family. The protein alignment program microgenie has been used to target ICAM-1 internal repeats (Queen, C, et al., Nucl. Acid. P.ss. 12: 581-59911984)). followed by an inspection. Alignment of ICAM-1 to IgM, N-CAM, and MAG was performed using the Microgenie and ALIGN programs (Dayhoff, MO, et al., Method Enzymol., 91: 524-545 (19331).) Four protein sequence data bases derived from National Biomedical Research Foundation, were tested for protein sequence similarities using the program FASTP by Williams and Pearson (Lipman, DJ, et al., Science 227: 1435-143911985).

Since ICAM-1 is a ligand of Integi in, it was unexpected that it should be a member of the immunoglobulin supergene family. However, the inspection of the ICAM-1 sequence shows that it meets all criteria for belonging to the immunoglobulin supergene family. These criteria are discussed below.

The entire extracellular domain of ICAM-1 is formed from 5 homologous immunoglobulin-like domains shown aligned in Figure 9A. Domains 1 to 4 are 88.97.99 and 99 residues, respectively, and thus have the typical size of the Ig domain; Domain 5 is shortened within 68 residues. Searching the NBRF seed base using the FASTP program yielded significant homologies with members of the immunoglobulin supergene family, including the IgM and IgG C domains, the T cell receptor alpha subunit variable domain, and the alpha-1 Beta-glycoprotein (Figure 9 BD).

Using the above information, the amino acid sequence of ICAM-1 was compared to the amino acid sequences of other members of the immunoglobulin supergene family.

Three types of Ig superfamily domains, V, C1 and C 2, have been differentiated. Both the V and C domains are constructed from 2-β arrays linked together by the disulfide bond within the domain; V domains contain 9 antiparallelo β strands, while C domains have 7 strands. Constant domains were divided into C1 and C2 sets based on the characteristic residues shown in Figure 9A. The Ci set includes proteins involved in antigen recognition. The C2 set includes various Fc-receptors and proteins incorporated into the call-adhesion, including CD2, LFA-1, MAG and NCAM. It has been found that the ICAM-1 domains are most homologous with the domains of the C2 set which bring ICAM-1 into this set; This is reflected in the greater similarity of the residues obtained in the C2 domains to those in the CI domains, which is shown for the β-chains in Figure 9, β-strands B-F. In addition, the ICAM-1 domains aligned much better with the β strands A and G of the C2 domain than with these strands in the V and CI domains; this allowed a good alignment across the entire strength of the C2 domain. Alignments with the C2 domain of NCAM, MAG and alpha 1 beta-glycoprotein are shown in Figures 9B and 9C; the identity was between 28% and 33%. Alignments with a T cell receptor V "with an identity of 27% and the IgN C domain 3 with 34% identity are also shown (Figures 9 B, 9 D). One of the most important characteristics of immunoglobulin domains are the disulfide-bonded cysteines that span the B and F-β strands that stabilize the β-sheet layer construction; in ICAM-1, the cysteines are conserved in all cases except strand f in domain 4, where there is a leucine that can be directed into the layered construction and stabilize contact, as for some other V and C2 set domains is proposed. The distance between the cysteines (43, 50, 52 and 37 residues) is the same as that described for the C2 set.

To test for the presence of cross-chain disulfide bonds in ICAM-1, endothelial cell ICAM-1 was subjected to SDS-PAGE under reducing and non-reducing conditions. Endothelial cell ICAM-1 was used because it has less glycosylation heterogeneity than JY or hair cell spleen ICAM-1 and allows greater sensitivity to shifts in M. Therefore, ICAM-1 from endothelial cell cultures of Nabeivans stimulated with LPS (5pg / ml) for 16 hours was purified by immunoaffinity chromatography as described above. Azetonausgefälltes ICAM-1 was dissolved in a Prohenpuffer (Laemmli, UK, Nature 227: 680-685 (1970) is reacted with 0.25% 2-mercaptoethanol or 25 mM Jodazetamid again to the suspension and brought 5min at 100 ⁰ C for the duration of the. Samples were subjected to SDS-PAGE 4670 and silver staining 4613. Endothelial cell ICAM-1 had an apparent M, value of 100kd under reducing and 96kd under nonreducing conditions, strongly suggesting the presence of intermediate chain disulphides in the original ICAM-1.

The use of the primary sequence to predict the secondary structure (Chou, PY, et al., Biochem. 13: 211-245 (19741) showed the 7 expected strands β in each ICAM-1 domain, labeled ag above in Fig. 9A which exactly matches the prediction for an immunoglobulin domain and corresponds to the positions AH in immunoglobulins (Figure 9A, bottom). In domain 5, the A and C strands are missing, but these edges of the arcs may be absent however, these arcs still form, with strand D perhaps taking the place of strand C, as suggested for some other C2 domains, and the characteristic disulfide bond between the B and F strands would be unaffected

Size of the domain, sequence homology, cysteines obtained forming the intermediate duplexes disulfide bond, and the predicted β-arch structure all the conditions for the association of ICAM-1 to the immunoglobulin supergene family.

ICAM-1 was found to be most homologous with the NCAM and MAG glycoproteins of the C2 set. This is particularly interesting since both NCAM and MAG mediate cell-cell adhesion. NCAM is important in neuronal-neuronal interactions (Cunninghan, BA, et al., Science 236: 799-806 (19871), while MAG is important in neuron-oligodendrocyte and oligodendrocyte-oligodendrocyte interactions during myelination (Poltorak 105: 1893-1899 [1987]). The cell surface expression of NCAM and MAG is regulated during development of the nervous system or myelination analogously to the regulated induction of ICAM-1 in inflammation ( Springer, TA, et al., Ann., Rev. Immunol., 5: 223-252 [1987]), ICAM-1, NCAM (Cunningham, B., U.S., Science 236: 799-806, 119871), and MAG (Salzer, LJ, et al., J. Cell BIoI 104: 957-965 [1987]) are similar in overall structure as well as homologous, since each is an integral membrane glycoprotein constructed from 5 C2-daemons forming the N-terminal extracellular region Although NCAM has some non-lg-like sequences between the let Two C2 daemons and the transmembrane domain are present. ICAM-1 aligns to full length, including transmembrane and cytoplasmic domains, with a 21% identity with MAG; the same percent identity is found comparing the 5 domains of ICAM-1 and NCAM-1. A schematic comparison of the secondary structures of ICAM-1 and MAG is shown in FIG. Comparisons from one domain to another show that the level of homogeneity between domains within the ICAM-1 and NCAM molecules (x ± sd 21 ± 2.8% and 18.6 ± 3.8%, respectively) is the same is like the level of homogeneity comparing ICAM-1 domains with NCAM and MAG domains (20.4 ± 3.7 and 21.9 ± 2.7, respectively). Although there is evidence for alternative splicing in the C-terminal regions of NCAM (Cunningham, B., et al., Science 236: 799-806 [1987J; Bartheis, D., et al., EMBO J. 6: 907-914 [1987]) and MAG (Lai, C, et al., Proc Natl Acad., USA 84: 4377-4341 [1987]) were able to sequence endothelial or HL-60 ICAM-1 clones or no evidence is found on testing the ICAM-1 protein main body and precursors on a variety of cell types (Dustin, ML, et al., J. Immunol 137: 245-254 [1986]).

ICAM-1 acts as a ligand for LFA-1 in lymphocyte interactions with a variety of different cell types. Lymphocytes bind to ICAM-1 incorporated into artificial membrane layers, and this causes LFA-1 on the lymphocytes, directly demonstrating the interaction of LFA-1 with ICAM-1 (Marlin, SD, et al., Cell 51: 813- 819 [1987]). LFA-1 is a leukocyte integrin and has no immunoglobulin-like characteristics. The leukocyte integrins comprise an integrin subfamily. The other two subfamilies mediate cell-matrix interactions and recognize the sequence RGD within the ligands, which include fibronectin, vitronectin, collagen and fibrinogen (Hynes, RO, Cell 48: 549-554 [1987], Ruoslathi, E., et al , Science 238: 491-497 [1987]). The leukocyte integrins are expressed only on leukocytes, are involved in cell-to-cell interactions, and the only known ligands are ICAM-1 and iC3b, a fragment of complement component C3 which has no immunoglobulin-like characteristics and is recognized by Mac-1 (Kishimoto, TM , et al., in: Leucocyte Typing III (Leucocyte Typing III), McMichael, Eds., Springer-Verlag, New York [1987]; Springer, TA, et al., Ann Rev. Immunol. 5: 223-252 [1986]; Anderson, DC, et al., Ann. Rev. Med. 38: 175-194 [1987]). Based on sequence analysis, possible peptides within the ICAM-1 sequence recognized by LFA-1 are shown in Table 9.

Table 9

Peptides within the ICAM-1 sequence that may be recognized by LFA-1

-L-R-G-R-L-R-L-

-R-G-E-K-E-L-K-R-E-P-

-L-R-G-E-K-E-L-K-R-E-P-A-V-G-E-P-A-E-

-P-R-G-G-S

-P-G-N-N-R-K-

-Q-E-D-S-E-P-M-

-T-P-E-R-V-E-L-A-P-L-P-S-

-R-R-D-H-H-G-A-N-F-S

-D-L-R-P-Q-o-L-E-

ICAM-1 is the first example of a member of the immunoglobulin supergene family that binds to an integrin. Although these families both play an important role in cell adhesion, interaction between them has not been expected to date. However, interactions within the immunoglobulin gene superfamily are quite common. It is quite possible that further examples of interactions between the integrin and the immunoglobulin family are found. LFA-1 recognizes a ligand other than ICAM-1 (Springer, TA, et al., Ann Rev. Immunol 5: 223-252 [1987]), and the leukocyte integrator Mac-1 recognizes a ligand different in adhesion from C3bi neutrophils (Anderson, DC, et al., Ann. Rev. Med. 38: 175-194 [1987]). In addition, purified MAG-containing vesicles bind to Neurii & n which are MAG and, consequently, MAG must be capable of heterophilic interaction with a diverse receptor (Poltorak, M "et al., J. Cell Biol. 105: 1893-1899 [1987]). , The role of NCAM in interactions between nerves and nerves and between nerves and muscles has been attributed to homophilic NCAM-NCAM interactions (Cunningham, B., et al., Science 236: 799-806 [1987]). The important role of MAG in interactions between adjacent Schwann cell loop loops, which enclose axons during myelin sheath formation, may be due to interaction with a different receptor or to homophilic MAG-MAG interactions. Homology with NCAM and the frequent occurrence of domain-to-domain interactions within the immunoglobulin supergene family raises the possibility that ICAM-1 might interfere with both homophilic interactions and heterophilic ICAM-1 LFA-i interactions. Binding of B lymphoblast cells co-expressing similar densities of LFA-1 and ICAM-1 to ICAM-1 in

However, artificial or cellular monolayers can be completely inhibited by pretreatment of B lymphoblast with LFA-1 MAb, while adhesion is unaffected by pretreatment of B lymphoblasts with ICAM-1 MAb. Pretreatment of the monolayer with ICAM-1 MAb completely abolishes binding (Dustin, M. L., et al., J. Immunol 137: 245-254 [1986]; Marlin, S.D., et al., Cell 51: 813-819 [19871]. These results show that ICAM-1 homophiles Wechselwi. tions, if any, must be weaker than the heterophile interactions with LFA-1. The possibility that the leukocyte integrins recognize ligands in a fundamentally different way is consistent with the presence of a sequence of 180 residues in the alpha subunits, which may be important in ligand binding and is absent in the RGD-recognizing integrins (Corbi, et al. A., et al., EMBO J. 6: 4023-4028 [1987]). Although it has been stated that Mac-1 recognizes the RGD sequence present in iC3b 5086, there is no RGD sequence in ICAM-1 (Figure 8). This is consistent with the fact that the fibronectin peptide GRGDSP and the control peptide GRGESP do not inhibit the adhesion of ICAM-1 and LFA-1 (Marlin, SD, et al., Cell 51: 813-819 (1987)), but have related consequences such as PRGGS and RGEKE , are present in ICAM-1 in regions that are said to form a loop between the β strands a and b of domain 2 and c and d, respectively, of domain 2 (Figure 9) and thus accessible for recognition are. It is interesting that the homologous MAG molecule contains an RGD sequence between domains 1 and 2 (Poltorak, M., et al., J. Cell Biol. 105: 1893-1899 [1987I]; Salzer, J.L., et al., J. Cell. BiOI. 104: 957-965 [1987]).

Example 19

Southern and North-Blo '

Southern blots were performed using 5 \ ig genomic DNA extracted from three cell strains:

BL2, a Burkitt's lymphoma cell strain (a gift from Dr. Gilbert Lenoir); JY and Er-LLC, EBV-transformed B lymphoblastoid cell strains.

The DNA was digested with five times the manufacturer's recommended levels of Bam H1 and Eco R1 endonucleases (New England Biolabs). After electrophoresis through a 0.8% agarose gel, the DNA was transferred to a nylon membrane (Zeta probe, BioRad). The filter was prehybridized and hybridized by standard methods using ICAM cDNA of HL-CO labeled by random startup with alpha ( ³² P) d-XTP (Boehringer, Mannheim).

Northern blots were performed using 20 μg of total RNA or 6 μg of poly (A) ⁺ RNA. The RNA was denatured and electrophoresed through a 1% agarose-formaldehyde gel and electro-transferred to the zeta probe.

The filters were prehybridized and hybridized in the manner described above (Staunton, DE, et al., EMBO J. 6: Γ, 695-3701 [1987] 1, wherein the HL-60 cDNA sone of ³² P-labeled oligonucleotide probes (the described above) were used.

The Southern blots using the 3 kb cDNA probe and the DNA digested with Barn H1 and Eco RI had single protruding hybridization fragments of 20 and 8kb, respectively, suggesting a single gene and suggesting that the largest Part of the coding information is present within 8kb. There are no signs of restriction fragment polymorphism in blots from 3 different cell strains.

Example 20

Expression of the ICAM-1 gene

An "expression vector" is a vector capable of expressing (due to the presence of suitable transcriptional and / or translational control sequences) a DNA or a cDNA molecule that has been cloned into the vector, and in this way Expression of cloned sequences occurs when the expression vector is introduced into a suitable host cell If a prokaryotic expression vector is used, then a suitable host cell would be processed for each prokaryotic expression vector, then a suitable host cell would be any Similarly, when working with a eukaryotic expression vector, any eukaryotic cell capable of expressing the kionated sequences would be an appropriate host cell Can contain sequences and there these sequences In prokaryotic cells, it is important that preferably cDNA from a cell that can express ICAM-1 be used to create a library of prokaryotic genomic expression vectors. Methods for the production of cDNA and for the development of a genomic library are described by Maniatis, T., et al. (Molecular Cloning, A Laboratory Manual [Molecular Cloning, Laboratory Manual]), Cold Spring Harbor Press, Cold Spring Harbor, NY (1982).

The library of genomic expression vectors described above is used to create a library of host cells (each containing a member of the library). The expression vector can be introduced into the host cell in any of a variety of ways (i.e., transformation, transfection, protoplast fusion, electroporation, etc.). The Bai κ of the cells containing the expression vectors is amplified by cloning, and their members are individually analyzed (using immunoassay) to see if they produce a protein suitable for binding to an anti-ICAM antibody.

The expression vectors of the cells that produce a protein that can bind an anti-ICAM-1 antibody are then further analyzed to see if they express (and thus contain) the entire ICAM-1 gene, if they are only one Fragment of the ICAM-1 gene expressing (and thus containing) or expressing (and thus containing) a gene whose product is immunologically related to ICAM-1 but which is not ICAM-1. Such analysis may be performed by any suitable method, but it is advantageous to determine the nucleotide sequence of the DNA or cDNA fragment that has been cloned into the expression vector. These nucleotide sequences are then assayed for being capable of encoding polypeptides having the same amino acid sequence as the tryptin digestion fragments of ICAM-1 (Table 5). An expression vector containing a DNA or cDNA molecule encoding the ICAM-1 gene can therefore be recognized by (i) the ability to direct expression of a protein that binds to the anti-ICAM1 antibody and (ii) the presence of a nucleotide sequence capable of encoding each of the tryptin fragments of ICAM-1. The cloned DNA molecule of such an expression vector can be removed from the expression vector and isolated in pure form.

Example 21

Functional activities of purified ICAIVM

In cells, ICAM-1 normally acts as a surface protein associated with the cell membrane. The function of the purified ICAM-1 was therefore tested after the molecule had been reconstituted by dissolving the protein in detergent-solubilized lipids into artificial lipid membranes (liposomes or vesicles), followed by removal of the detergent by dialysis. ICAM-1, purified from JY cells as described above and eluted in detergent octyl glucoside, was reconstituted into vesicles and the ICAM-1-containing vesicles were fused to glass coverslips or plastic culture wells to allow detection of the cells which bind to the protein.

Preparation of plan membranes and plastic-bound bubbles

Bubbles were made by the method of Gay u. a., (J. Immunol., 136: 2, 026 (1986)). Briefly, phosphatidylcholine and cholesterol were dissolved from the egg in chloroform and mixed in a molar ratio of 7: 2. The lipid mixture was dried to a thin film, rotating under a stream of nitrogen gas, then lyophilized for one hour to remove any traces of chloroform. Then the lipid film was dissolved in 1% octyl glycoside / 0.14 M NaCl / 20 mM Tris (pH 7.2) to a final concentration of 0.1 mM phosphatidylcholine. To each milliliter of the dissolved lipids was added about 10 μg of purified ICAM-1 or human glycophorin (Sigma Chemical Co., St. Louis, MO) as the control membrane glycoprotein. Subsequently, the protein-lipid cleaning solution was dialyzed at 4 ° C by three changes of a 200 volume of 20 mM Tris / 0.14 M NaCl, pH 7.2, and a change of HBSS. Planimembranes were prepared by the method of Bria, et al., Proc. Natl. Acad. Be. USA 81: 6159 (1984). Glass cover slices (11 mm diameter) were boiled for 15 minutes in a 1: 6 dilution of 7X detergent (Linbro), washed overnight in distilled water, soaked in 70% ethanol and air dried. A δΟμΙ drop of vesicle suspension containing either ICAM-1 or glycophorin was placed in the bottom of a series of recessed wells in a 24-well plate and gently slid onto the prepared glass coverslips. After 20 to 30 minutes incubation at room temperature, the recessed wells were filled with HBSS and the coverslips were inverted to bring the plano-membranes face-up. Subsequently, the recessed wells were thoroughly washed with HBSS to remove unbound vesicles. The surface of the Planarmembranen was never exposed to the air.

In the course of experiments with plan membranes fused to glass surfaces, it was found that vesicles containing ICAM-1 bind directly to the plastic surface of the multi-welled tissue culture plates and retain their functional activity, as that of the specific Cell binding is illustrated. These bubbles are hereafter referred to as "plasticized bubbles" (PBV) because the nature of the lipid vesicles bound to the plastic has not been determined Plastic-bound vesicles are made by adding 30μΙ of the vesicle suspension directly to the bottom of recessed wells in tissue culture dishes 96 recessed wells (Falcon) followed by incubation and washing as described for plan membranes.

Zelladhäslonsuntersuchungen

Cell adhesion studies were carried out using planar membranes or plastic-bound vesicles in substantially the same manner, however, the number of cells and volumes were reduced to one fifth of the values in planographic membrane studies in the PBV study.

T-lymphocytes from normal controls and from a patient with Leukocyte adhesion deficiency (LAD patient), the cells do not express ^LFA-1: older (Anderson, D. C, inter alia, J. Infect Dis. 152:. 668 [1985]), were prepared by culturing peripheral blood mononuclear cells with 1 pg / ml concanavalin-1 (Con A) in RPM 11640 medium plus 20% FCS at a concentration of 5 × 10 ⁵ cells / ml for 3 days. The cells were then washed twice with RPMI and once with 5 mM methyl alpha-D-mannopyranoside to remove the remaining lectin from the cell surface. The cells were cultured in RPMI / 20% FCS containing 1 ng / ml recombinant IL-2 and used 10 to 22 days after the start of culture. To determine cell binding to planemembrane or PBV, Con-A blasts, T-lymphoma SKW-3 and EBV-transformed B lymphoblastoid cell strains JY (LFA-1 positive) and LFA-1 deficient lymphoblastoid cell strain (BBN) were used. (derived from Patient 1, Springer, TA, et al., J.Exper.Med. 160: 1901-1908 | 19861) by incubation of 1 χ 10 ⁷ cells in 1 ml RPM11640 / 10% FCS with 10OpCi of Na ⁵¹ CrO ₄ for the duration of radiolabeled of one hour at 37 ⁰ C, followed by four washes with RPM11640 to remove nichteinbezogenes marking material. In monoclonal antibody blocking experiments, cells or plasticized vesicles were pretreated with 20pg / ml of purified antibody in RPM11640 / 10% FCS at 4 ° C for 30 minutes, followed by 4 washes to remove unbound antibody. In experiments on the effects of divalent cations on cell binding, the cells were ²⁺ -free HBSS plus 10% washed once with Ca ² *, Mg dialyzed FCS, and the indicated concentrations were CaCl and MgCl were added. In all experiments, the cells and plan membranes or PBV were preequilibrated at the appropriate temperature (4 ⁰ C, 22 ⁰ C or 37 ⁰ C) in the appropriate assay buffer.

To determine cell binding to purified ICAM-1, ^s ' Cr-labeled cells (5 x 10 ⁵ EBV transformants in plan membrane analyzes, 1 x 10 ⁶ EBV transformants or SKW-3 cells, 2 x 10 ⁵ Con-A -Blaste in PBV analyzes) for 2 minutes at 25 × g to plan membranes or PBV, followed by incubation at 4 ⁰ C, 22 ° C or 37 ⁰ C. After incubation, unbound cells were removed by eight cycles of filling and aspiration with buffer preequilibrated to the appropriate temperature. Bound cells were quantitated by solubilizing the contents of the recessed wells with 0.1 N NaOH / 1% Triton X-100 and counting in a gamma counter. The p -uual cell binding was determined by dividing the cpm value of bound lines by the cpm value assigned to the input cells. For plan membrane determinations, the input cpm was corrected according to the ratio of the surface area of the cover plates versus the effective surface area of the culture wells.

In these studies, EBV-transformed B lymphoblastoid cells, SKW-3 T lymphoma cells and Con A-T lymphoblasts bound specifically to ICAM-1 in artificial membranes (Figures 11 and 12). The binding was specific because the cells bound very poorly to control membranes or vesicles containing equivalent amounts of another human cell surface glycoprotein, glycophorin. In addition, binding was produced on LFA-1-positive EBV transformants and Con-A blasts, while no binding on their LFA-1 negative counterparts occurred on a significant scale, indicating that the binding was due to the presence of LFA-1 was dependent on the cells.

Both the specificity of cell binding and the dependence on cellular LFA-1 were confirmed in monoclonal antibody blocking experiments (Figure 13). The binding of JY cells could be suppressed by 97% when the ICAM-1-containing PBV were pretreated with the monoclonal anti-ICAM-1 antibody RR1 / 1. Pretreatment of cells with the same antibody had little effect. Conversely, monoclonal anti-LFA-1 antibody TS1 / 18 suppressed binding by 96%, but only with treatment of the cells but not PBV. A control antibody, TS2 / 9, which is reactive with LFA-3 (another lymphocyte surface antigen), had no significant inhibitory effect, either in the pretreatment of the cells or that of PBV. This experiment demonstrates that ICAM-1 mediates the observed cell adhesion even in the artificial membranes rather than any minor contaminant, and that the adhesion is dependent on LFA-1 present at the binding cell.

Binding of cells to ICAM-1 in artificial membranes also revealed two other characteristics of the LFA-1-dependent adhesion system: temperature dependence and fc-fc of divalent cations. As shown in Fig. 14, Con-A blasts bound-most effective at 37 ⁰ C, at 22 ⁰ C and partly at 4 ⁰ C very poorly to ICAM-1 in PBV. As shown in Figure 15, binding was completely dependent on the presence of divalent cations. At physiological concentrations, Mg ²⁺ alone was sufficient for maximal cell binding, while Ca ² 'alone could only move a very low binding level. In contrast, Mg ^{2+ was} synergistic at only one-tenth of the normal concentration combined with Ca ² * and gave maximal binding.

In summary, the specificity of cell binding to purified ICAM-1 incorporated into artificial membranes, the specific inhibition of monoclonal antibodies, and the requirements of temperature and presence of divalent cations demonstrate that ICAM-1 is a specific ligand for the LFA -1-dependent adhesion system is.

Example 22 Expression of ICAM-1 and HLA-DR in allergic and toxic flare test reactions

Skin biopsies from five normal subjects were examined for their expression of ICAM-1 and HLA-DR. Although it was found that the endothelial cells in some blood vessels usually expressed ICAM-1, they did not become ICAM-1 expression on keratinocytes of normal skin. On keratinocytes from normal skin biopsies, no staining was detected for HLA-DR. The kinetics of expression of ICAM-1 and class II antigens were then examined on cells in biopsies of mucous and toxic skin lesions. Half of six subjects examined were found to have keratinocytes expressing ICAM-1 after hapten had been applied four hours previously (Table 10). With hapten exposure time, there was an increase in the percentage of ICAM-1 expression on keratinocytes expression and staining intensification, indicating greater ICAM-1 expression per keratinocyte for up to 48 hours. In fact, some of the keratinocytes stained positive for ICAM-1 in all biopsies at this time. After 72 hours (24 hours after removal of the hapten), ICAM-1 on the keratinocyte expression was still expressed in seven of the eight subjects, while ICAM-1 expression in one person disappeared between 48 and 72 hours.

Table 10 Kinetics of induction of ICAM-1 and HLA-DR on keratinocytes from allergic stain test biopsies

Time after the stain Number d. Just Just ICAM-1 and application (h) biopsies ICAM-1 HLA-DR HLA-DR Normal skin 5 0 0 0 allergic patch test 4 6 3 ' 0 0 8th 9 3 0 0 24 8th 7 0 0 48 " 8th 5 0 3 72 8th 6 0 1

a Samples were considered positive if at least small bunches of keratinocytes were stained. b All stains were removed at this time.

Histology had the staining scheme for ICAM-1 on keratinocytes from biopsies taken four hours after application of the hapten, usually in the form of small bunches or bunches. After 48 hours, ICAM-1 became expression on the surface of the majority of keratinocytes, with no difference detectable between the middle and the edge of the lesion. The intensity of staining decreased as the keratinocytes approached the stratum corneum. This was noted in biopsies taken from both the middle and the edge of the lesions. At this time, the stain test was also positive (infiltration, erythema and blisters). There were no differences in ICAM-1 expression when different haptens were applied to sensitive individuals. In addition to the keratinocytes, some mononuclear cells and endothelial cells also expressed at the site of the lesion ICAM-1.

The expression of HLA-DR on the keratinocytes of allergic skin lesions was less common than that of ICAM-1. None of the subjects studied had lesions with keratinocytes that resolved within 24 hours of application of the hapten

stained positive for HLA-DR. In fact, only 4 biopsy specimens had keratinocytes expressing HLA-DR, and no biopsy rat had keratinocytes staining positive for HLA-DR and not for ICAM-1 (Table 10).

In contrast to the allergic stain test lesion had the toxic stain test lesion, which with croton oil or sodium lauryl sulfate

Keratinocytes showed little, if any, ICAM-1 on their surface at each of the time points tested (Table 11). In fact, 48 hours after the spot application, the optimal time for the

ICAM-1 expression in allergic stain test studies, only one on 14 toxic patch test subjects Keratinocytes expressing ICAM-1 lesion. Also in contrast to the allergic stain test biopsies was

no HLA-DR expressed on the keratinocytes from toxic stain lesions.

These data indicate that ICAM-1 is immune-based rather than inflammatory on a toxic basis

Thus, expression of ICAM-1 can be used to distinguish between inflammations on an immune and toxic basis, for example, in acute kidney failure in kidney transplant patients, where it is difficult to determine whether the rejection or nephrotoxicity of the kidney transplantation immunosuppressive, therapeutic agent. Kidney biopsy and determination of the regulation of expression of ICAM-1 then allow for the distinction between immune rejection and those due to toxicity reactions that are not immune-based.

tables Kinetics of the Incorporation of ICAM-1 and HLA-DR on Keratinocytes from Toxic Stain Test Biopsies

Time after the stain Number d. Just Just ICAM-1 and application (h) biopsies ICAM-1 HLA-DR HLA-DR 4 4 0 0 0 8th 3 1- 0 0 24 3 1 0 0 48 ^b 14 1 0 0 72 3 1 0 0

a samples were considered positive if at least small bundles of keratinocytes were stained. b All stains were removed at this time.

Example 23 Expression of ICAM-1 and HLA-DR in benign skin diseases Cells from skin biopsies from lesions of patients with various types of inflammatory skin diseases were recorded

examined the expression of ICAM-1 and HLA-DR. Part of the keratinocytes in biopsies of allergic contact dermatitis,

Pemphigoid / pemphigus and lichen planus expressed ICAM-1. Biopsies of Liehen planus showed the most intense staining

a pattern similar or even greater in allergic stain test biopsies at 48 hours (Table 12). In

Conformity with the allergic stain test results revealed the most intense ICAM-1 staining in sites with strong

In addition, 8 of the 11 biopsies of Liehen planus tested were positive for expression of HLA-DR on keratinocytes.

The expression of ICAM-1 on keratinocytes from skin biopsies from patients with rash and urticaria was less

pronounced. Only four out of seven patients tested in these conditions had keratinocytes expressing ICAM-1 at the lesion site. Expression of HLA-DR was only seen in one patient, and that in conjunction with the

Expression of ICAM-1 detected. Endothelial cells and part of the mononuclear cell infiltrate of all tested benign inflammatory skin diseases

expressed ICAM-1 to varying degrees.

Table 12 Expression of ICAM-1 and HLA-DR on keratinocytes of benign skin diseases

diagnosis Number d. Just Just ICAM-1 and cases ICAM-1 HLA-DR HLA-DR Allergic Contact dermatitis 5 3 ¹ 0 2 Lying planus 11 3 0 8th pemphigoid / pemphigus 2 2 0 0 rash 3 2 0 0 urticaria 4 1 0 1

a Samples were considered positive if at least small bundles of keratinocytes were stained.

Example 24 Expression of ICAM-1 on keratinocytes of psoriatls «. η skin infections The expression of ICAM-1 in skin biopsies from 5 patients * lit psoriasis was assessed before onset and regularly during one PUVA treatment investigated. Biopsies were of 5 Pa '. "; with classical histology-confirmed psoriasis

won. The biopsies were taken consecutively before and during the indicated time of PUVA preparation.

PUVA was given 3 to 4 times a week. The biopsies were taken from the edge of psoriatic spots in five patients

In addition, biopsies of clinically normal skin were made in four of the patients.

Fresh skin biopsy specimens were frozen and stored in liquid nitrogen. Six micrometer cryostat Sections were air-dried overnight at room temperature, fixed in acetone for 10 minutes, and either stained immediately

or wrapped in aluminum foil and stored at -8O ⁰ C until dying.

The following method was used for dyeing. Sections were incubated with monoclonal antibody and stained by a three-step immunoperoxidase method (Stein, H., et al., Adv. Cancer Res. 42: 67-147 [1984]) using a diaminobenzidine-HjO ₂ substrate. Tonsils and lymph nodes were used as positive controls for anti-ICAM-1 and HLA-DR staining. Tissue stained in the absence of primary antibody served as a negative control. The monoclonal antibodies to HLA-DR were purchased from Becton Dickinson (Mountainview, California). The monoclonal anti-ICAM-1 antibody was R6-5-D6. Peroxidase-conjugated rabbit anitmouse IG and peroxidase-conjugated porcine anti-rabbit IG were purchased from DAKAPATTS, Copenhagen, Denmark. Diaminobenzidine tetrahydrochloride was purchased from Sigma (St. Louis, Mo.).

The results of the study indicate that the endothelial cells in some blood vessels express ICAM-1 in both diseased and normal skin, but the intensity of staining and the number of blood vessels expressing ICAM-1 are elevated in psoriatic skin lesions. In addition, the pattern of expression of ICAM-1 in keratinocytes from untreated psoriatic skin lesions in the five patients studied varied from only small bunches of stained cells to numerous stained keratinocytes. In the course of PUVA treatment, ICAM-1 expression was indicated ^; two of the patients (pations 2 and 3) showed a marked decrease preceding or coincident with the clinical response (Table 13). Decreases and increases in ICAM-1 expression occurred in patients 1.4 and 5 during PUVA treatment, which correlated with clinical remissions and relapses. No normal expression of ICAM-1 was observed on normal H .dt keratinocytes before or after PUVA treatment. This indicates that PUVA treatments do not induce the expression of ICAM-1 on keratinocytes of normal skin. Noteworthy was also the observation that the density of the mononuclear cell infiltrate was related to the amount of ICAM-1 expression on the keratinocytes. This involved both the decreased number of mononuclear cells in lesions during PUVA treatment, although expression of ICAM-1 became vanishingly small, as well as the increased number of mononuclear cells during PUVA treatment when expression of ICAM-1 the keratinocytes was more pronounced. Endothelial cells and mononuclear skin cells are also ICAM-1 positive. In clinically normal skin, expression of ICAM-1 was limited to endothelial cells without keratinocyte labeling.

In summary, these results indicate that expression of ICAM-1 on keratinocytes prior to treatment was pronounced and correlated with a dense, mononuclear, cellular cell infiltrate. During PUVA treatment, a marked reduction in ICAM-1 staining accompanies clinical improvement. Histologically, the Dermalinfiltrat decreases significantly. If clinical relapse is evident during treatment, ICAM-1 expression on the keratinocytes and density of dermalin filtrate also increase. When clinical remission was observed during treatment, there was a concomitant decrease in ICAM-1 staining on keratinocytes and decreased dermalalin filtrate.

The expression of ICAM-1 on the keratinocytes thus corresponded to the density of the mononuclear cellular infiltrate in the dermis. These data indicate that the clinical response to PUVA treatment resulted in a marked reduction in the expression of ICAM-1 on the keratinocytes, in parallel with a slightly weaker decrease in mononuclear cells. This indicates that expression of ICAM-1 on the keratinocytes is responsible for the initiation and maintenance of dermal signaling, and that PUVA treatment downregulates the expression of ICAM-1, which in turn attenuates the dermal filtrate and inflammatory response , The data also indicate that the expression of HLA-DR on the keratinocytes is variable during PUVA treatment. The expression of ICAM-1 on the keratinocytes of psoriatic lesions is related to the clinical severity of the lesion as well as the size of the dermalin filtrate. ICAM-1 thus plays a critical role in psoriasis, and its inhibition of its expression and / or its suppression of its interaction with the CD18 complex on mononuclear cells is an effective treatment for the disease. In addition, monitoring of the expression of ICAM-1 On keratinocytes an effective tool of diagnosis and prognosis as well as to assess the course of therapy in psoriasis.

33-285 C11

Table 13

Sequential expression of ICAM-1 by the keratinocytes in psoriatic skin lesions (PS) and clinically normal skin (N) before and during PUVA treatment

Time before and during PUVA treatment.

Patient no

 1 2

PS PS

3 hp

4 hp

5 hp

0 1 day

1 week

2 weeks

3 weeks

4 weeks 5-6 weeks 7 weeks 10 weeks

* 0

+ + + Many positive keratinocytes

+ + A percentage of positive keratinocytes

+ Focal positive keratinocytes

(+) A few scattered positive keratinocytes

- No positive staining

• Clinical remission

0 Clinical reversal

Example 25 Expression of ICAM-1 and HLA-DR in malignant skin diseases

In contrast to lesions of benign skin diseases, expression of ICAM-1 on keratinocytes from malignant skin lesions was much more variable (Table 14). In the investigated 23 cases of cutaneous T-cell lymphoma ICAM-1-positive keratinocytes were identified in only 14 cases.

Keratinocytes from biopsies from lesions of fungal mycoses have tended to lose expression of ICAM-1 as the disease progresses to more advanced stages. In contrast, expression of ICAM-1 was observed on a different proportion of mononuclear cell infiltrate from most of the cutaneous T cell lymphoma lesions.

In the remaining lymphomas examined, four out of eight had keratinocytes expressing ICAM-1. Of the 29 patients with malignant skin disease, 5 had keratinocytes expressing HLA-DR without expressing ICAM- '(Table 14).

Table 14

Expression of ICAM-1 and HLA-DR on the K'.ratinozytes of Malignant Skin Diseases

diagnosis Number d. Just Just ICAM-1 and cases ICAM-1 HLA-DR HLA-DR CTCL, MFI 8th 1· 0 4 CTCL, MFII-III 10 1 2 5 CTCL, SS 3 1 0 2 CTCL, Big Cell 2 0 2 0 CBCL 2 0 0 1 skin leukemia 3 1 1 1 Histiocytosis X 1 0 0 0

a Samples were considered positive if at least small bundles of keratinocytes were stained.

Example 26

Effect of anti-ICAM-1 antibodies on the proliferation of human peripheral blood mononuclear cells Human peripheral blood mononuclear cells are induced to proliferate by the presence and recognition of antigens or mitogens. Certain molecules, such as mitogen, concanavalin A or T cell-binding antibody OKT3, cause nonspecific proliferation of peripheral blood mononuclear cells. Human peripheral blood mononuclear cells are heterogeneous in that they are composed of subpopulations of fragments capable of recognizing specific antigens. When a peripheral blood mononuclear cell capable of recognizing a particular specific antigen encounters that antigen, the proliferation of this subpopulation of the mononuclear cell is induced. The tetanus toxoid and limpet hemocyanin are examples of antigens recognized by subpopulations of peripheral, mononuclear cells, but not all peripheral, mononuclear cells in sensitized individuals.

The ability of the monoclonal anti-ICAM-1 antibody R6-5-D6 to inhibit proliferative responses of human peripheral blood mononuclear cells in systems known to require cell-cell adhesion was tested ,

Peripheral blood mononuclear cells were purified on Ficoll-Paque gradients (Pharmacia) according to the manufacturer's instructions. After capturing the interface, the cells were washed three times with RPM11640 medium and into 96-well flat-bottomed microtiter plates to a concentration of 10 ⁶ cells / ml in RPMI medium supplemented with 10% bovine fetal serum, 2 mM glutamine and Genamicin (50 μg / ml), pulled.

Antigen, either T cell mitogen, concanavalin A (0.25pg / ml); the T-cell binding antibody, OKT3 (0.001 pg / ml); Limpet hemocyanin (10 g / ml) or tetanus toxoid (1: 100 dilution of source) was added to the cells grown in the manner described above using the anti-ICAM antibody (R6-5-D6; 5g / ml) either present or absent. Cells were cultured for 3.5 days (experiment with concanavalin A), 2.5 days (experiment with O1K3) and 5.5 days (limpet hemazanin and tetanus toxoid experiment, respectively) before investigations were performed.

Eighteen hours before completion of the study, 2.5 μC of ³ H-thymidine was added to the cultures. Cell proliferation was assessed by measuring the incorporation of thymidine into the DNA by the peripheral blood mononuclear cells.

The included thymidine was collected and counted in a liquid scintillation counter (Merluzzi et al.

J. Immunol. 139: 166-168 [1987]). The results of these experiments are shown in Fig. 16 (experiment with concanavalin A), Fig. 17 (experiment with OTK3), Fig. 18 (experiment with limpet hemocyanin) and in Fig. 19 (experiment with tetanus toxoid).

The anti-ICAM-1 antibody was found to inhibit proliferative responses to non-specific T cell mitogen, ConA, nonspecific T cell-associated antigen, OKT 3, and the specific antigens limpet hemocyanin and tetanus toxoid in mononuclear cells. Inhibition by the anti-ICAM-1 antibody was comparable to that of the anti-LFA-1 antibody, suggesting that ICAM-1 is a functional ligand of IFA-1 and that the antagonism of ICAM-1 specific responses of the defense system.

Example 27 Effect of the anti-ICAM-1 antibody on the mixed lymphocyte reaction

As stated above, ICAM-1 is necessary for efficient cellular interactions during an immune response mediated by LFA-1-dependent cell adhesion. The induction of ICAM-1 in immune or inflammatory diseases allows the interaction of leukocytes with endothelial cells and leukocytes among themselves.

When lymphocytes from two unrelated individuals are cultured in the presence of each other, blast transformation and cell proliferation of the lymphocytes are observed. This response of a population of lymphocytes to the presence of a second population of lymphocytes is known as the mixed lymphocyte reaction (MLR) and is analogous to the response of lymphocytes to the addition of mitogens (Immunology, Science of Self-Nonself Discrimination from the distinction between self and nonself], Klein, J., John Wiley & Sons, NY [1982], p.453-458).

Experiments were performed to determine the effect of monoclonal anti-ICAM antibodies on the human mixed lymphocyte reaction (MLR). These experiments were performed as follows.

Peripheral blood was obtained from normal, healthy donors using venipuncture. The blood was collected in heparinized tubes and diluted at room temperature in the ratio of 1: 1 with the balanced salt solution (BSS) of Puck G (GIBCO). The blood mixture was layered in an amount of 20 ml over 15 ml of Ficoll-Hypaque density gradient (Pharmacia, density = 1.078, room temperature) and centrifuged at 1000 g for 20 minutes. Then the boundary layer was picked up and washed three times in pucks G. The cells were counted on a hemacytometer and incubated in a culture medium RPM11640 (GIBCO) containing 0.5% gentamicin, 1 mM L-glutamine (GIBCO) and 5% heat-inactivated (56 ° C, 36 minutes) human AB sera (Flow Laboratories ) (hereinafter referred to as RPMI culture medium) was returned to suspension.

In these experiments, mouse anti-ICAM-1 (R6-5-D6) was used. All monoclonal antibodies (prepared from the ascites from Jackson Immuno Research Laboratory, Boston, MA) were used as purified IgG preparations.

Peripheral blood mononuclear cells (PBMC) were grown in the medium to a concentration of 6.25 x 10 ⁵ cells / ml in Linbro round bottom microliter bottles (# 76-013-05). Stimulator cells from a separate donor were irradiated with 100OR and cultured with the responder cells at the same concentration. The total volume per culture was 0.2 ml. As controls, pure responder cells and a stimulator cell were used. The culture plates were incubated at 37 ° C in a 5% CO ₂ humidified air atmosphere for 5 days. The wells were pulsed with 5 μίί tritiated thymidine ( ³ HT) (New England Nuclear) for the last 18 hours of culture. In some cases, a two-way MLR was performed. It worked according to the same protocol, except that the cells of the second donor were not inactivated by irradiation.

Cells were harvested onto glass fiber filters using a multi-sample automatic harvesting device (Skatron, Norway), rinsing with water and methanol. The filters were oven dried and counted in Aquasol in a Beckman Flint Scintillation Counter (LS-3801). Results are reported as CPM mean ± standard error for 6 individual cultures.

Table 15 shows that purified monoclonal anti-ICAM-1 antibodies prevented the MLR in a dose-dependent manner, revealing significant suppression. Purified mouse IgG had little or no suppressive effect. The suppression of MLR by the monoclonal anti-ICAM-1 antibody occurs when the antibody is added to the cultures within the first 24 hours (Table 16).

Table 15

Effect of anti-ICAM-1 antibody on one-way lymphocyte repression

Responder cells' Stimulator cells ^b Antibody* ³ HT inclusion CPM value) + + - 445 ^H i 143 140 ± 17 698 ± 72 + + - 42626 ± 1579 + + + + + + mlgG (10 μg) mlflG (0.4 μg) mlgg (0.02 μg) 36882 ± 1823 (14%) 35500 ± 1383 (17%) 42815 ± 124Γ (0%) + + + + + + R6-5-D6 (10.0 μρ) R6-5-D6 (0.4 μg) R6-5-D6 (0.03 μg) 8250 ± 520 (81%) 16142 ± 8F, 8 (62%) 28844 ± 1780 (32%)

a Responder cells (6.25 χ 1OVmI)

b stimulator cells (6.25 x IOVml, irradiated at 1000R)

c Purified monoclonal antibody to ICAM-1 (R6-5-D6) or purified (it MSuse-IgG (mlgG) with a

Final concentration in given values (pg / ml) d mean ± standard error of five to six cultures, numbers in parentheses indicate the percent inhibition of MLR.

Table 16

Time of addition of anti-ICAM-1

R / S ^ Additions " ³ HT Inclusion (CPM)

Time of addition of medium or antibody TagO day1 day 2

Medium 205 ^d ± 14 476 ± 132 247 ± 75 - + Modium 189 ± 16 nd 'nd + - Medium 1860 ± 615 nd + + Medium 41063 ± 2940 45955 ± 2947 50943 ± 3072 + + R6-5-D6 17781 ± 1293 38409 ± 1681 47308 ± 2089 (57%) ^f (16%) (7%)

a responder cells (6.25 x lOVml)

b stimulator cell (6.25 χ lOVml, irradiated at 1000R)

c culture medium or purified monoclonal antibody to ICAM-1 (R6-5-D6) at a concentration of

10pg / ml was added on day 0 and at 24 hour intervals. D mean ± standard error of 4-6 cultures end = not performed f Percentual ligation

In conclusion, the ability of the antibody to ICAM-1 to suppress the MLR reveals that the monoclonal anti-ICAM-1 antibody is of therapeutic use in acute transplantation rejection. Monoclonal ICAM-1 antibodies are also useful in related immune-responsive disorders that are dependent on LFA-I / ICAM-1 regulated cell-to-cell interactions.

The experiments described herein demonstrate that the addition of the monoclonal antibody to ICAM-1 inhibits the mixed lymphocyte reaction (MLR) when added during the first 24 hours of the reaction. In addition, ICAM-1 is up-regulated on human peripheral blood monocytes in in vitro culture.

In addition, it has been found that ICAM-1 is not expressed on resting human peripheral blood lymphocytes or monocytes. ICAM-1 is upregulated on monocytes from cells grown alone or from cells grown to cells from an unrelated donor in a mixed lymphocyte reaction using conventional flow cytometric analyzes (Figure 20) , This upregulation of iCAM-1 on vionocytes may be considered an indication of inflammation, especially when ICAM-1 is on fresh monocyte.

is expressed by persons with acute or chronic inflammation.

The specificity of ICAM-1 for activated monocytes and the ability of the antibody * u ICAM-1 to inhibit MLR suggest that monoclonal ICAM-1 antibodies may have diagnostic and therapeutic potential in the acute rejection of transplants and related, immune-triggered disorders in which intercellular interactions are necessary.

Example 28 Synergistic effects of the combined administration of AntllCAM-1 and Antl-LFA-1 antibodies

As shown in Example 27, the MLR is inhibited by the anti-ICAM-1 antibody. The MLR is optionally also suppressed by the anti-LFA-1 antibody. To determine whether the combined administration of anti-ICAM-1 and anti-LFA-1 antibodies would have an increased or synergistic effect, an MLR analysis (performed as in Example 27) was presented Concentrations of the two antibodies were performed.

This MLR study showed that the combination of anti-ICAM-1 and anti-LFA-1 antibodies, at concentrations where none of the antibodies alone drastically inhibits fviLR, is much more potent in inhibiting M'.R Reaction is (Table 17). It is clear from this finding that therapies involving the co-administration of d'js anti-ICAM-1

Antibody (or fragments thereof) and anti-LFA-1 antibody (or fragments thereof) are an improved anti-inflammatory therapy. Such improved therapy allows administration of lower doses of the antibody than would otherwise be therapeutically effective, and is particularly important under circumstances where high levels of individual antibodies elicit an anti-idiotype response.

Tebelle 17

Effect of different doses of anti-ICAM-1 ur.d (R3.1) anti-LFA-1 on the mixed lymphocyte reaction

Anti-IC / · \ 1-1 Percent inhibition 0.02 0.1 0.5 2.5 concentration (R6-5-D6) 31 54 69 70 (Mg / mL) 0 28 48 62 71 Anti-LFA-1 0 0,004 30 50 64 72 0.0 1 7 64 75 84 86 0.0008 0 7 91 92 92 92 0.0004 29 13 90 92 93 91 0.02 92.6 38 0.1 93 90 0.5 90

Example 29

Additive effects of the combined administration of suboptimalon doses of anti-ICAM-1 and other immunosuppressive agents in the MLR

As shown in Example 28, the MLR is inhibited by combinations of anti-ICAM-1 and anti-LFA-1 antibodies. To determine whether the combined administration of anti-ICAM-1 and other immunosuppressive agents (such as dexamethasone, azathioprine, cykiosporin A or steroids such as prednisone, etc.) would also have enhancing effects, MLR studies were performed using suboptimal concentrations (ie, of concentrations lower than the optimal concentration at which the agent would be administered to a single person alone) of R6-5-D6 in conjunction with other immunosuppressive agents according to the protocol in Example 27. The data show that the inhibitory effects of R6-5-D6 are at least additive with the inhibitory effects of suboptimal doses of dexamethasone (Table 18), azathioprine (Table 19) and Zykiosporin A (Table 20). This implies that the anti-ICAM-1 antibodies can be effective in lowering the necessary doses of the known immunosuppressants and thus reducing their toxic side effects. When using an anti-ICAM-1 antibody (or its fragment) to achieve this immune suppression, it is possible to administer the antibody (or its fragment) either with a single additional immunosuppressant or with a combination of more than one additional immunosuppressant Means to combine.

Table 18

Effect of anti-ICAM-1 and dexamethasone on the human mixed lymphocyte reaction

group Inhibitor. (Ng / ml) HT inclusion (CPM) Percent inhibition Media Simulators (S) Respondoren (R) RxS I I I 156 101 4461 34199 I I I RxS R6-5-D6 26224 23 RxS Dex (50) 14153 59 RxS R6-5-D6 (8) 4-Dex (50) 7759 77

Dax: Dexamethasone

Table 19

Effect of anti-ICAM-1 and azathioprine on the human mixed lymphocyte reaction

group Inhibitor (ng / ml) ³ HT inclusion (CPM) Percent inhibition Media Simulators (S) Respondorei. (R) RxS I I I 78 174 3419 49570 I I I RxS R6-5-D6 (8) 44374 11 RxS Azathioprine (1) 42710 14 RxS R6-5-D6 (8) + azathioprine (1; 34246 31

Table 20 Effect of anti-ICAM-1 and cyclosporin A on human MLR

group Inhibitor (ng / ml) ³ HT inclusion (CPM) Percent inhibition Media Simulators (S) Respondoren (R) RxS - 87 2Q6 987 31640 I I I RxS R6-5-D6 (8) 26282 17 RxS CyA (IO) 23617 25 IXS R6-5-D6 (8) + CyA (IO) 19204 39

CyA: Cyclosporine A

Example 30

Effect of Antl ICAM-1 antibody in suppressing rejection of transplanted allogeneic organs In order to demonstrate the effect of the anti-ICAM-1 antibody in suppressing the rejection of allograft organs, allogeneic kidneys were obtained by cynomolgus monkey method by Cosimi u. a. (Transplant Proc. 13: 499-503 [1981J) transplanted with the modification that valium and ketamine were used as anesthetics. Kidney transplantation was carried out essentially according to the following scheme. Heterotrophic kidney allografting was performed on 3 to 5kg cynomolgus monkeys, essentially as described by Marquet (Marquet et al., Medical Primatology, Part II, Basel, Karger, p. 125 [1972]) After anesthetizing with valium and ketamine. End-to-side anastomoses of the donor kidney vessels were performed on a patch of the aorta or vena cava using Prole Thread 7-0. Dio donor urethra was spatulated and implanted into the bladder by extravesicular approach (Taguchi, Y., et al., Dausset et al. (Hsg.): "Advances in Transplantation", Baltimore, Williams & Wilkins, p. Renal function was assessed by weekly or biweekly serum creatinine determinations, biopsies of the allograft were frequently performed for histopathological examination, and complete autopsies were performed on non-surviving recipients, with most recipients undergoing bilateral nephrectomy at the time of transplantation and subsequent uremic death was considered to be the endpoint of allograft survival, with some recipients undergoing unilateral native nephrectomy and contralateral ureteralization at the time of transplantation, and when allo-graft rejection occurred Removed autologous ureter, which helped restore normal renal function and the ability to continue immunological surveillance of the recipient animal.

The monoclonal antibody R6-5-D6 was administered daily at a dose of 1-2 mg / kg / day for 12 days starting two days before transplantation. The serum levels of creatinine were regularly reviewed to monitor rejection. The effect of the anti-ICAM-1 antibody on immune system rejection of the allogeneic kidneys is shown in Table 21.

Table 21

Activity of R6-5-D6 in prolonging kidney allograft survival in prophylactic protocols in cynomolgus monkeys "

monkey Dosage of R6-5-D6 Survival days / (Mg / kg) aftercare Control 1 _ 8th Control 2 - 11 Control 3 - 11 Control 4 - 10 Control 5 - 9 Control 6 - 10 M15 1.0 20 M19 1.0 7 ^b M17 1.0 30 M 25 1.5 29 M 23 1.0 11 ^C M 27 2.0 34 M7 0.5 22 M11 0.5 26 M10 0.5 22 M8 0.5 26 "

β Monkeys were given R6-5-D6 for 12 consecutive days starting 2 days before transplantation.

b cause of death is unknown. There were signs of latent malaria, c renal renal infarction, the life of August 15, 1988 still.

The results show that R6-5-D6 is effective in prolonging the life of monkeys receiving allogeneic kidney transplants.

Example 31

Effect of Antl-ICAM-1 Antibody in Suppressing the Acute Repulsion of Transplanted Organs. In order to demonstrate that the anti-ICAM-1 antibodies are effective in an acute model of transplant rejection, R6-5-U6 also became a therapeutic candidate or acute renal rejection model tested. In this model, monkey kidney transplantation (using the protocol given in Example 30) was transfected with 15 mg / kg cyclosporin A (CyA) intramuscularly perioperatively until stable renal function was achieved. The dose of CyA was then decreased bi-weekly in increments of 2.5 mg / kg until the rejection occurred, as indicated by an increase in blood creatinine level. At that time, R6-5-D6 was administered for 10 days and the duration of survival was monitored. It is important to note that in this protocol the dose of CyA remains suboptimal as it will not change once the acute rejection event occurs. In this model, previous controls (N = 5) that did not use antibodies survived 5 to 14 days after the onset of the rejection event. So far, six animals were tested according to this protocol using R6-5-D6 'Table 22). Two of these animals are still alive (M 12-31 days and M 5 47 days after administration of R6-5-D6). Two animals survived R6-5-D6 38 and 55 days after initiation of therapy, and two animals died for reasons other than acute rejection (one animal died of CyA toxicity and the other died because of H6-5 therapy). D6 was started under anesthesia). This model comes closer to the clinical situation in which R6-5-D6 would be used first.

Table 22

Activity of R6-5-D6 in prolonging the survival of renal allografts in therapeutic protocols in cynomolgus monkeys ¹

monkey Day of the rejection Survival days / event ¹¹ aftercare controls' 14-98 5-14 M 24 41 38 M21 34 4 ' M3 41 55 M9 12 11 ' M12 37 > 31 ' M5 26 > 47 '

A monkeys received over 10 consecutive days after the onset of rejection

1-2 mg / kg, day b. And the creatinine level in the reduction of

Increasing CyA dosage and starting therapy with R6-5-D6, c Five animals were treated using the therapeutic described above

Protocol tested, but using no rescue therapy. The Survival days / aftercare represent the survival days after the

Creatinine levels had started to rise, d died under anesthesia. Creatinine levels were too low, e Degraded from CyA toxicity. Creatinine levels were too low, f was still alive on August 15, 1988.

Example 22

Genetic Construction and Expression of Shortened Derivatives of ICAM-1 In its natural state, ICAM-1 is a cell membrane-bound protein containing an extracellular region of 5 immunoglobulin-like domains, a transmembrane domain, and a cytoplasmic domain. It was desirable to functionally construct derivatives of ICAM-1 lacking the transmembrane domain and / or the cytoplasmic domain so as to produce a soluble, secreted form of ICAM-1. These functional derivatives were constructed by oligonucleotide-directed mutagenesis of the ICAM-1 gene, followed by expression in monkey cells after transfection with the mutant gene.

Mutations in the ICAM-1 gene resulting in amino acid substitutions and / or truncated derivatives were made by the method of Kunkel, T., (Proc. Netl. Aced., U.S.A. 82: 488-492 (1985)). ICAM-1 cDNA prepared in the above-described manner was digested with restriction endunucleases Sa11 and Kpn 1, and the resulting 1.8 kb DNA fragment was subcloned into the plasmid vector CDM8 (Seed, B., et al Proc Natl Acad ScI USA 84: 3365-3369 [1987J]. Subsequently, this construct, referred to as pCD1.8C, was transformed into a "" strain of E. coli (BW313 / P3). "Transformants became infected by infection with helper phage R408 (Stratagene®) Mutant ICAM-1 cDNAs were then generated by starting a second strand synthesis with an oligonucleotide containing mismatched bases, and then transforming an ung ⁺ host (MC1061 / P3) with the resulting heteroduplex by "screening" with newly created endonuclease restriction sites introduced by the mutant oligonucleotide. The mutant ICAM-1 protein was expressed by transfecting Cos-7 cells with the mutant DNA in the eukaryotic expression vector CDM8 using the DEAE-dextran standard method (Seiden, RF, et al., In: Current Protocols in Molecular Biology (Current Protocols in Mol Molecular Biology), Ausubel, FM, et al., eds., pp. 9.2.1-9.2.6 (1987)).

A truncated functional derivative of ICAM-1 was prepared that lacks the transmembrane and cytoplasmic domains but contains the extracellular domain with all five immunoglobulin-like domains. A 30bp mutant oligonucleotide (CTC TCC CCC CGG TTC TAG ATT GTC ATC ATC) was used to add codons for the amino acids tyrosine (Y) and glutamic acid (E) at positions 452 and 4E3, respectively, into a phenylalanine (F) and a Translational stop codon (TAG) to transform. The mutant was isolated from the unique Xba 1 restriction site and designated Y ⁴⁵² EZFJAG. To express the mutant protein, COS cells were transfected with three mutant subclones (N ° 2, N ° 7 and N ° 8). Three days after transfection with the three mutant subclones, the supernatant layers of the cultures and the cell lysate were analyzed by immunoprecipitation with the monoclonal anti-ICAM-1 antibody RR1 / 1 and SDS-PAGE. ICAM-1

ISFI;

precipitated but not from the purification lysates of these cells. The molecular weight of the ICAM-1 'found in the supernatant culture layer was about 6 kd lower than the membrane form of ICAM-1, consistent with the size predicted from the mutant DNA. Consequently, this functional derivative of ICAM-1 is excreted as a soluble protein. In contrast, ICAM-1 was not immunoprecipitated from the supernatant layers of control cultures of cells transfected with native ICAM-1, demonstrating that the membrane form of ICAM-1 is not delivered by Cos cells. In addition, no ICAM-1 was immunoprecipitated from supernatant culture layers or cell lysates from negative, pseudo-transfected cells as a control. The truncated ICAM-1 secreted from transfected cells was purified by immunoaffinity chromatography with an ICAM-1 specific antibody (R6-5-D6) and tested for functional activity in a cell-binding assay. After dom cleaning in the presence of the purification octyl glycoside, preparations containing native ICAM-1 or the truncated, secreted form were diluted to a final concentration of 0.25% octylglucoside (one concentration below the critical micelle concentration of the detergent). These preparations of ICAM-1 were allowed to bind to the surfaces of 96-well plastic plates (Nunc) to produce ICAM-1 bound to a solid phase. After washing out the unbound material, approximately 75-80% and 83-88% of SKW-3 cells, respectively, that exhibited LFA-1 on their surfaces were specifically bound to the native or truncated forms of ICAM-1. These data demonstrate that the secreted, truncated, soluble form of the functional ICAM-1 derivative retained both immunological reactivity and the ability to mediate ICAM-1-dependent adhesion characteristic of native ICAM-1.

Similar methods were used to prepare a functional derivative of ICAM-1 lacking only the cytoplasmic domain. A 25bp oligonucleotide (TC AGC ACG TAC CTC TAG AAC CGC CA) was used to convert the codon for amino acid 476 (Y) to a TAG translation stop codon. The mutant was designated Y ⁴⁷⁶ ZTAG. Immunoprecipitation analysis and SDS-PAGE of Cos cells transfected with the mutant detected a membrane-bound form of ICAM-1 with a molecular weight about 3 kd smaller than the native form of ICAM-1. Indirect immunofluorescence of the mutant-transfected Cos cells revealed a punctate staining pattern similar to that of native ICAM-1 expressed on human LPS-stimulated endothelial cells. Finally, the cells transfected with the mutant DNA were specifically bound to purified LFA-I on plastic surfaces in a manner similar to Cos cells transfected with natural ICAM-1 DNA (Table 23).

Table 23

Ability of ICAM-1-t. <Expressing cells or a functional derivative of ICAM-1 to bind LFA-1

transfection % of ICAM-1 expressing cells that bind LFA-1 in the presence of: no antibody RR1 / 1 Pseudotransfection Native ICAM-1 Y ⁴⁷ VTAG 0 0 20 0 20 0

Example 33 Mapping de / functlone domfins of ICAM-1

Studies of ICAM-1 have shown that the molecule has 7 domains. Five of these domains are extracellular (domain 5 is closest to the cell surface, domain 1 is furthest from the cell surface), one domain is a transmembrane domain, and one domain is cytoplasmic (i.e., within the cell). To determine which domains are involved in the ability of ICAM-1 to bind to LFA-1, epitope mapping studies were performed. To perform such studies, various deletion mutants are prepared and characterized for their ability to bind to LFA-1. Alternatively, the assays may be performed using the anti-ICAM antibody known to interfere with the ability of ICAM-1 to bind LFA-1. Examples of such suitable antibodies include RR1 / 1 (Rothlein, R., et al., J. Immunol., 137: 1270-1274 (1986)), R6.5 (Springer, TA, et al., US Pat 07/250446), LB-2 (Clark, EA, inter alia, in: Leukocyte Typing I (leukocyte typing l |, A. Bernard et al., Eds., Springer-Verlag, pp. 339-346 [1984]) or CL203 (Staunton , DE, et al., Cell 56: 849-853 [1989]).

Deletion mutants of ICAM-1 can be produced in different ways. However, it is advantageous to produce such mutants via site-directed mutagenesis or by other recombinant means (such as the construction of ICAM-1 expressing gene sequences in which the sequences encoding particular protein regions have been deleted). Methods that can be used to prepare such mutants are well known in the art. Using these procedures, three ICAM-1 deletion mutants were prepared. The first mutant lacks amino acid residues F185 through P284 (i.e., "domain 3 deletion"). The second mutant lacks amino acid residues P284 through R451 (i.e., domain 4 and 5 deletion). The third mutant lacks the Y476 amino acid residues (i.e., cytoplasmic domain deletion). The results of these studies indicate that domains 1, 2 and 3 are dominantly involved in ICAM-1 interactions with anti-ICAM-1 antibodies and LFA-1.

Example 34 Effect of mutations in ICAM-1 on LFA-1 binding

The ability of ICAM-1 to interact with and bind LFA-1 is mediated by ICAM-1 amino acid residues present in domains 1 of the ICAM-1 molecule (Figures 8, 9 and 1) ). However, such interactions are supported by portions of amino acids present in domains 2 and 3 of ICAM-1. Thus, among the preferred functional derivatives of the present invention are soluble fragments of the ICAM-1 molecule containing domains 1, 2 and 3 of ICAM-1. Even more preferred are soluble fragments of molecule ICAM-1 containing domains 1 and 2 of ICAM-1. Most preferred are soluble fragments of the ICAM-1 molecule containing domain 1 of ICAM-1. Several amino acid residues within the first ICAM-1 domain are involved in the interaction of ICAM-1 and LFA-1. Substitutions of these amino acids by other amino acids alter the ability of ICAM-1 to bind LFA-1. These amino acid residues and the substitutions are shown in FIG. Figure 25 shows the effects of such mutations on the ability of the resulting mutant ICAM-1 molecule to bind to LFA-1. In Figures 23 to 25, residues are described with reference to the one-letter code for amino acids, followed by the position of the residue in the ICAM-1 molecule. For example, "E90" refers to the glutamic acid residue at position 90 of ICAM-1. "90V also refers to the dipeptide composed of the glutamic acid residue at position 90 and the valine residue at position 91. The substitution sequence is indicated to the right of the slash ("/"). Residues V4, R13, Q27, Q58, and D60S61 of ICAM-1 are involved in LFA-1 binding.

The replacement of these amino acids changed the ability of ICAM-1 to bind to LFA-1. For example, replacement of V4 by G results in the formation of a mutant ICAM-1 molecule that is less capable of binding to LFA-1 (Figure 25). Replacement of the residue R13 of ICAM-1 by E results in the formation of a mutant molecule with a significantly lower capacity to bind to LFA-1 (Figure 25). Replacement of residue Q58 of ICAM-1 by H results in the formation of a mutant molecule with a substantially normal capacity to bind to LFA-1 (Figure 25). K replacement of the D60S residue of ICAM-1 results in the formation of a mutant molecule with a significantly lower capacity to bind to LFA-1 (Figure 25). Glycosylation sites in the second domain are also involved in LFA-1 binding (Figure 23). Replacement of N103 by K or A155N by SV results in the formation of a mutant ICAM-1 molecule that is substantially unable to bind to LFA-1. In contrast, replacement of the glycosylation site N175 by A did not appear to significantly affect the capacity of the mutant ICAM-1 to bind to LFA-1

 Mutations in the third ICAM-1 domain did not significantly alter ICAM-I-LFA-I binding (Fig. 24).

Example 35

Multimeric forms of ICAM-1 with increased biologic half-cell affinity and emptying capability. Schematic molecules are constructed in which domains 1 and 2 of ICAM-1 are attached to the hinge region of the immunoglobulin heavy chain. Preferred constructions attach the C-terminus of ICAM-1 domain 2 to a segment of the immunoglobulin heavy chain gene, immediately N-terminal to the hinge region, thereby conferring segmental flexibility through the hinge region. Thus, ICAM domains 1 and 2 replace the Fab fragment of an antibody. Attachment to the heavy chains of the IgG class and the production of animal cells lead to the production of a chimeric molecule. The production of molecules containing heavy chains derived from IgA or IgM results in the production of higher multimericity molecules containing between 2 and 12 ICAM-1 molecules. The coexpression of the J chain gene in the animal cells expressing the heavy, chimeric ICAM-1 molecules allows for the proper assembly of IgA and IgM multimers predominantly leading to IgA molecules comprising 4 to 6 ICAM-1 Molecules and, in the case of IgM, about 10 ICAM-1 molecules. These chimeric molecules have several advantages. First, Ig molecules are designed for high cycling stability, and this can improve biological half-life.

In addition, the more muitimous nature of these engineered molecules allows them to interact with greater pronounced affinity for the rhinovirus as well as for the cell surface LFA-1, depending on the therapeutic context, thereby increasing the amount of recombinant protein needed to produce an effective Dose must be administered, greatly reduced. IgA and IgM are highly glycosylated molecules that are normally present in secretions at mucosal sites, such as in the nose. Their highly hydrophilic character helps to keep bacteria and viruses to which they bind from the mucous membrane, preventing the attachment of cells or crossing the epithelial cell membrane barrier. They can therefore have an increased therapeutic effectiveness. IgM and especially IgA are stable in a mucosal environment and they can increase the stability of ICAM-1 constructions. When such a functional ICAM-1 derivative is introduced into the bloodstream, it may also prolong the biological half-life. IgA does not fix the complement and would be ideal for those applications where it would be harmful. If IgG H chain chimerism is desired, it would be possible to mutate regions involved in attachment of the complement as well as interactions with Fc receptors.

Example 36

Generation of ICAM-1 mutants

OligonukleotidgerichteteMutagenese

The coding region of an ICAM-1 cDNA in a 1.8 kb Sal '-Kpni fragment was subcloned into the expression vector CDMB (Seed, B., et al., Proc. Natl. Acad ScI., USA 84: 3365-4 1369 (1987)). Starting from the method of Kunkel, T. (Proc.

Natl. Acad. ScI. USA 82: 488-492 [1985]), and the modifications of Staunton, D., et al. (Staunton, D.E., et al., Cell 52: 925-933 (1988)), this construction (pCD1.8) was used to generate a single-stranded, uracil-containing template that can be used in oligonucleotide-directed mutagenesis.

Briefly, E. coli strain XS127 was transformed with pCD1.8. Individual colonies were drawn to near saturation in 1 ml of Luria broth medium (LB medium) (Difco) containing 13 μg / ml ampicillin and b.w.g / ml tetracycline. There were 10Opg of the culture with the helper phage R408 (Strategene) with a multiplication of infection! (MOI) of 10 infected, and there were added 10 ml of the LB medium with ampicillin and cyclone Tetra for a 16-hour culture at 37 ⁰ C. After a one-minute

Centrifugation at 10000 rpm and filtering the supernatant layer through 0.22 μm, the phag suspension was used to infect E. coil BW313 / P3, which was then plated on LB agar plates (Difco) coated with ampicillin and tetracycles had been supplemented. Colonies were picked, approximately drawn to saturation in 1 ml of LB medium with ampicillin and tetracycline, and infected with the helper phage at an MOI of 10. The culture volume was then increased to 250 ml and the cells were grown overnight. Standard phage extraction isolated single-stranded DNA. M Utta n β oligonucleotides were phosphorylated and used with the pCDI .8 MAUiUe in a second strand synthesis reaction (Staunton, D.E., et al., Cell 52: 925-933 (1988)).

transfection

COS cells were seeded in 10 cm tissue culture plates so that they were 50% confluent in 16 to 24 hours. Then, the COS cells were washed once with TBS and incubated for 4 hours with 4 ml of RPMI medium containing 10% Nu sera (Collaborative), 5pg / ml chloroquine, 3pg of the mutant plasmid and 200 μg / ml DEAE-dextran sulfate. The cells were then washed with 10% DMSO / PBS followed by PBS and grown in culture media for 16 hours.

The culture media were replaced with fresh media, and 48 hours post-transfection the COS cells were trypsin / EDTA treated (Gibco) to suspension and spiked onto two 10 cm plates and tissue culture plates with 24 wells recessed for HRV binding. After 72 hours cells were harvested from the 10 cm plates with 5 mM EDTA / HBSS and processed for adhesion to LFA-1 coated plastics and immunofluorescence.

LFA-1 undHRV-Blndung

LFA-1 was purified from SKW-3 lysates by immunoaffinity chromatography on Sepharose TS2 / 4 LFA-1 mAb and eluted at pH 11.5 in the presence of 2mM MgCl ₂ and 1% octyl glycoside. LFA-1 (10pg per 200μl per 6 cm plate) was bound to bacteriological Petri dishes by dilution of octylglucoside in PBS (phosphate buffered saline) to 0.1% with 2mM MgCl ₂ and incubated overnight at 4 ° C. The plates were blocked with 1% BSA (bovine serum albumin) and stored in PBS containing 2 mM MgCl ₂ , 0.2% BSA, 0.025% azide and 50 μg / ml gentamycin. ⁶¹ Cr-labeled COS cells in PBS containing 5% FCS (fetal calf serum), 2 mM MgCl ₂ , 0.025% azide (buffer) were incubated with or without 5 μg / ml RR1 / 1 and R6.5 in LFA-1. coated microtiter plates at 25 ⁰ C for one hour. Non-adherent cells were removed by 3 washes with buffer. Adherent cells were eluted by the addition of EDTA 7U 10mM and subjected to gamma counting.

Results

Anti-ICAM-1 antibodies such as RR1 / 1, R6.5, LB-2 or CL2 ° 3 were identified. When these antibodies are able to inhibit the ICAM-1 function, they must be in a position to bind tu to a specific location in the ICAM-1 molecule which is also important for the ICAM-1 function. Thus, by making the above-described deletion motifs of ICAM-1 and determining the extent to which the anti-ICAM-1 antibodies can bind to the deletion, it is possible to determine whether the deleted domains are important to the function.

ICAM-1 is an integral membrane protein which is predicted to have the extracellular domain composed of 5 Ig-like C domains. In order to identify the domains involved in the binding of LFA-1, domain 3 and domains 4 and 5 (carboxyl terminal) were deleted by oligonucleotide-directed mutagenesis and functionally tested after expression in COS cells. In addition, the entire cytoplasmic domain was deleted to determine its potential impact on ICAM-1 interactions. As expected, deletion of the cytoplasmic region, Y476 / ·, did not result in a loss of RR1 / 1, R6.5, LB-2 and CL203 reactivity, whereas the deletion of domain 3, F185-R451 resulted in a reduction and Loss of CL203 reactivity leads (Figure 20). Thus, the CL203 epitope appears to be in domain 4 while RFU / 1, R6.5 and LB-2 appear to be in the two amino terminal domains.

All three deletion mutants show LFA-1 adhesion to the wild type (Figure 21). Also, amino acid substitutions were generated in the predicted beta turns in domains 1,2 and 3 and functionally tested after expression in COS cells. Epiiop R6.5 was thus localized to E111GGA in domain 2 and may also include E39 in domain 1, while RR1 / 1 and LB-2 are both dependent on R13 in domain 1 (Figure 22). In addition, RR1 / 1 binding is reduced by mutations in the D71GQS sequence. Mutations turning off N-linked glycosylation sites at N103 and N165 result in decreased flR1 / 1, R6.5 and LB-2 LFA-1 HRV binding. These mutations appear to affect processing to produce ICAM-1 dimers.

Other mutations in domains 2 or 3 did not result in altered LFA-1 adhesion (Figures 23 and 24). The amino acids in domain 1, R13 and D60, are both involved in the binding of LFA-1 (Figure 25).

Thus, LFA-1 and HRV binding appears to be a function of the amino terminal n, Ig-like domain of ICAM-1.

Fig. 26 shows a breakdown of the ICAM amino terminal domain.

While the invention has been described in conjunction with specific embodiments, it is to be understood that other modifications are possible, and the present application is intended to include all variants, applications or adaptations of the invention, generally following the principles of the invention, and also such variations from the present disclosure, which are known or will become common practice within the purview of the invention, and how they may be applied to the essential features illustrated, as set forth in the appended claims.

-42- 285 captions and legends

Fig. 1 - Adhesion between normal cell and LFA-1-deficient cell. Fig. 2 - Adhesion between normal cells.

Normal cell - Normal cell

Fig. 3 -Aggregation - Conglomeration

Time - time

Fig. 4 - Cells in aggregate - cells in the aggregation

EBVtransformed B cells - EBV-transformed B cells

Fig. 6 - " ⁶ l-specific binding - '" l-specific binding

Time (hours) - time (hours)

Fig. 7 - '- - specific binding -' "! -Specific binding

Cytokine concentration - cytokine concentration

Fig. 11 - LFA-1-positive, EBV-transformed B lymphoblastoid cells bind to planar membranes on ICAM-1.

Cells bound - Bound cells

Fig. 12 - LFA-1-positive, EBV-transformed B lymphoblastoid cells bind to ICAM-1 in plan membranes.

Cells bound - Bound cells

Glycophorin - glycophorin

Ab. 13 - Inhibition of binding of JY-B lymphoblastoid cells to ICAM-1 in plastified blisters by pretreatment of the cells or vesicles with monoclonal antibodies.

Cells bound - Bound cells

Pretreatment - pretreatment

None - None

Protein in vesicles - protein in vesicles

Cells - customs

Vesicles - bubbles

Fig. 14 - Effect of temperature on binding of T lymphoblast ANANCAM-1 in plastic bound vesicles.

Cells bound - Bound cells

Temperature - temperature

Protein in vesicles - protein in vesicles

Glycophorin - glycophorin

Fig. 15 - Demand for divalent cations for binding of T lymphoblasts to ICAM-1 in plastified vesicles.

Bound - Bound

Cone. - concentration

Protein in vesicles. - Protein in bubbles

Glycophorin - glycophorin

Fig. 16 - Effect of anti-adhesion antibody on OKT3-induced proliferation of human peripheral blood mononuclear cells.

None - None

Control mlgG - control mlgG

Fig. 17 - Effect of anti-adhesion antibody on the concanavalin A-induced proliferation of human peripheral blood mononuclear cells.

None - None

Fig. 18 - Effect of anti-adhesion antibody on KLH-induced proliferation of human peripheral blood mononuclear cells.

No treatment - No treatment

Fig. 19 - Effect of anti-adhesion antibody on tetanus toxoid-induced proliferation of human peripheral blood mononuclear cells.

Notreatment - No treatment

Fig. 20 - Mab-binding to ICAM-1 - Mab binding to ICAM-1 -

deletion mutants deletion mutants

Fig. 21 - Binding of the ICAM-1 deletion mutants to LFA-1.

Wild type bound - Bound to wild type

Fig. 22 - ICAM-1 Mab epitopes.

positive - positive

Fig. 23 - Binding of the ICAM-1 mutants of domain 2 to LFA-1.

Wild type bound - Bound to wild type

Fig. 2 - Binding of the ICAM-1 mutants of domain 3 to LFA-1.

Wildtypebound - Bound by wild type

Fig. 25 - Binding of the CAMAM-1 mutants of dominoi to LFA-1.

Wildtypebound - Bound by wild type

Fig. 26 - Homology of the ICAM amino terminal domains.

Claims (17)

1. Soluble, Functional Derivative of ICAM-1. 2. A derivative of ICAM-1 according to claim 1, characterized in that it is a fragment of ICAM-1 or a variant, an analog or a chemical derivative of such a fragment. 3. derivative of ICAM-1 according to claim 2, characterized in that it lacks the cytoplasmic domain of ICAM-1. 4. derivative of ICAM-1 according to claim 2 or 3, characterized in that it lacks the transmembrane domain of ICAM-1. 5. A derivative of ICAM-1 according to claim 2, characterized in that it contains domain 1 or domains 1 and 2 or domains 1,2 and 3. 6. The derivative of ICAM-1 according to any one of claims 1 to 5, characterized in that it is used for the preparation of a pharmaceutical composition for the treatment of inflammation resulting from a reaction of the specific or nonspecific defense system. A derivative of ICAM-1 according to any one of claims 1 to 5, characterized in that it is a hematopoietic tumor cell for use in the preparation of a pharmaceutical composition for the suppression of metastasis, which cell is a functional member of the LFA-1 family for migration needs, is used. 8. The derivative of ICAM-1 according to any one of claims 1 to 5, characterized in that it is used for the preparation of a pharmaceutical composition for inhibiting the growth of an LFA-1 expressing to a tumor cell. An anti-inflammatory agent for use in the preparation of a pharmaceutical composition to be used in conjunction with an immunosuppressive drug, preferably selected from dexamethasone, azathioprine and cyclosporin A, to treat inflammation resulting from a reaction of the specific abanneral system therethrough characterized in that said anti-inflammatory agent is selected from an antibody capable of binding to ICAM-1; a fragment of an antibody, which fragment is capable of binding to ICAM-1; ICAM-1; a functional derivative of ICAM-1 and a non-immunoglobulin antagonist of ICAM-1. 10. Anti-inflammatory agent according to claim 9, characterized in that it is a soluble, functional derivative of ICAM-1 according to one of claims 1 to 5. An anti-inflammatory agent for use in the manufacture of a pharmaceutical composition for the treatment of inflammation resulting from a reaction of the specific defense system to be used in conjunction with a second agent, characterized in that it is selected from an antibody derived from LFA -1 can bind; a functional derivative of an antibody, whereby the functional derivative can bind to LFA-1; and a non-immunoglobulin antagonist of LFA-1; wherein the anti-inflammatory agent is selected from an antibody capable of binding to ICAM-1; a fragment of an antibody, which fragment is capable of binding to ICAM-1; ICAM-1; a functional derivative of ICAM-1 and a non-immunoglobulin antagonist of ICAM-1. 12. An anti-inflammatory agent according to claim 11, characterized in that it is a soluble, functional derivative of ICAM-1 according to any one of claims 1 to 5. 13. Pharmaceutical composition, characterized by a) an anti-inflammatory agent selected from the group consisting of an antibody capable of binding to ICAM-1; a fragment of an antibody, which fragment is capable of binding to ICAM-1; ICAM-1; a functional derivative of ICAM-1 and a non-immunoglobulin antagonist of ICAM-1, and b) at least one immunosuppressive agent selected from the group consisting of dexamethasone, azathioprine and cyclosporin. 14. Pharmaceutical composition, characterized by a) a soluble, functional derivative of ICAM-1 according to any one of claims 1 to 5 and b) a conventional carrier or excipient. 15. Recombinant DNA molecule, characterized in that it is capable * to express a soluble functional derivative of ICAM-1 according to one of claims 1 to 5. 16. A process for the preparation of a soluble, functional derivative of ICAM-1, characterized in that a host organism is cultured, which is transformed by a recombinant vector, which a soluble, functional derivative of ICAM-1 according to one of claims 1 to 5 below Encoded conditions by which the derivative is expressed in the culture medium and secreted, and then the derivative is isolated. A method of diagnosing the presence and location of a tumor cell expressing a GMr d of the LFA-1 family of molecules in a subject suspected of having such a cell, characterized in that a) a tissue sample of the subject is incubated in the presence of a composition comprising a detectably labeled, soluble, functional derivative of ICAM-1 according to any one of • contains claims 1 to ύ , and b) detecting this binding ligand bound to a member of the LFA-1 family of molecules present in that tissue sample.