DD275478A1 - PREPARATION FOR EXPRESSION VECTORS FOR THERMOINDUCIBLE GENE EXPRESSION IN GRAMPOSITIVE BACTERIAL HOST - Google Patents

Abstract

The invention relates to a method for the construction and testing of novel vector plasmids useful for thermoinducible expression of gene products in Gram positive bacterial hosts. It aims to provide for the first time such vectors for efficient expression of gene products in Gram-positive host organisms by means of thermoinduction. The object of this aim is achieved by creating a restriction site by directed in vitro mutagenesis immediately upstream of the reading frame of the lambda cI857 repressor gene, using this restriction site the cI857 gene with expression signals operable in gram-positive microorganisms, preferably the expression unit the Staphylokinase gene of the S. aureus phage 42D, and at the same time thereby expression vectors are generated, with which under the control of the lambda PR promoter, a thermoinduzable expression of selected genes in gram-positive host organisms is durchfuehrbar ist. In the preferred embodiment of Invention, the expression vectors pBS52, pBS71 and pBS72 obtained, which succeed in a thermoinducible expression of alpha-amylase or staphylokinase in Bacillus.

Description

Field of application of the invention

The invention relates to a method for constructing and testing vector plasmids useful for thermoinducible expression of gene products in Gram positive bacterial hosts. These plasmids can advantageously be used for the expression of secretory proteins that can be regulated by changing the cultivation temperature of the hosts.

The invention offers potential uses in genetic engineering as well as in other fields of molecular biology and downstream in the pharmaceutical and chemical industry, whose products are used in turn in human and veterinary medicine as well as in plant and animal production, and in food production.

Characteristic of the known state of the art

The industrial production of active ingredients using genetically modified microorganisms has an ever-increasing importance, since it offers the opportunity to perform both a mass production of difficult to access proteins as well as to produce new, previously unknown drugs biotechnologically or known to modify. Since the 1970s, genes from prokaryotes and eukaryotes have been isolated in ever-increasing numbers and cloned and expressed in microbial, especially bacterial, hosts such as E. coli (see, for example, E. LWinnacker, Gene and Klone, Verlag Chemie, Weinheim, 1984). , Primarily turn inducible E. coli, Switchable display that is at a desired time of cultivation, expression systems developed - to address the disadvantages that arise when gene products are to be marked, which inhibit the growth of the host organism or are even toxic to the producing strain, were. Under these particular expression systems diethermoregulierten have the advantage that they can be turned on (approximately 30 ⁹ C to 42 ° C) by a simple shift of the cultivation temperature. In comparison to the metabolite concentration-regulated, chemically inducible expression systems, such. As the Iac or frp operon, they require no addition of a specific, usually expensive to produce inductor. Of the temperature-change inducible expression systems, the promoter-repressor system of the early E. coli Z phage lambda genes has been studied most intensively (see Ptashne, M., A Genetic Switch, Gene Control and Phage Lambda, Cell Press & Blackwell Sci. Publ., 1986) so that it is considered a classical model of thermoregulated gene expression in E. coli hosts.

In this model, regulation takes place at the transcriptional level. It is based on the temperature-dependent formation or destruction of the complex of a temperature labile Cl repressor protein with the operator regions of the DNA sequence of the P _L or PR promoter region of the phage lambda. At temperatures below 30 ^° C., the repressor is in a conformation which causes its binding to the operator sequence and thus the prevention of transcription by sterically influencing the interaction of the RNA polymerase with the promoter sequence. At higher temperature, the repressor protein denatures and dissociates from the operator. At 42 ^° C., all repressor molecules are inactivated, releasing the promoter for transcription initiation and switching on the expression of the gene fused to this promoter. Since the lambda promoters Pl and Pr are strong E. coli / APromotors, the lambda promoter-repressor system has been used for the efficient expression of heterologous genes in this host. This principle solution was exemplified in the expression of the genes for alpha, beta and gamma human interferons, for T4 DNA ligase, for human interleukin 2, for animal growth hormones and for human Cu / Zn superoxide dismutase (See, for example, Remaut E. et al., (1983) Gene 22, 103-113, Devos R. et al., (1983) Nucl. Acids Res.11, 4307-4323, Simons G et al., [1984] Gene 28 , 55-64, George HJ, et al., [1985] DNA 4,273-281, Hartman JR et al., [1986] Proc. Natl. Acad., USA 83,7142-7146, and patent DD 251787). In the cited patent, the insertion of transcription terminators downstream of the gene to be excised in conjunction with the use of high-copy replicons to avoid the frequently occurring in E. coli under induction conditions plasmid instabilities and to further increase the yield of the polypeptide to be produced described.

As hosts for the thermo-regulatable lambda system, hitherto exclusively Gram-negative microorganisms, in particular E. coli strains, have been used (see Murooka Y. & Mitani I. [1985] J. Biotechnol., 2.303-316, Davison J. et al. [1987] Gene 60,227-235).

For Bacillus , only two examples of thermoregulable gene expression have been described to date. Both are analogous to the lambda system on the de / repression of an early promoter of Bacillus si / bf / 7 / s phage 0105 by a repressor protein of this phage. These are firstly the temperature-labile Cts23 repressor protein (Osburne MS et al., [1985] J. Bacteriol., 163, 1101-1108) and, secondly, the non-temperature-sensitive wild-type repressor protein whose gene is on a temperature-sensitive replicon (Dhaese P. et al., (1984) Gene 32, 181-194, GB 2166743).

For both constructions, the major drawback is that the regulatable early promoter of B.subtHls phage O105 has to be considered weak compared to other known B. subtiHs promoters . The level of expression, which has hitherto been demonstrated only by the example of an antibiotic resistance gene, is an order of magnitude below the performance of the known B.subtiHs promoters spoOI or spo02 (compare Osburne et al., Supra). Both constructions also have the disadvantage that no full, but only a 24f ache repression of the expression rate can be achieved (persistence of a residual activity). In both cases, the repressor gene and the promoter / operator region are still located on two separate plasmids, so that at the same time two antibiotics must be supplemented to maintain the selection pressure. Moreover, in the case of the binary system with the temperature-sensitive replicon, the derepression can occur only after several generations of growth of the culture at 42 ° C, after the C-0105 repressor plasmid has been diluted out.

In the attempts to establish the efficient promoter-repressor system of E. coli lambda in B.subtilis, a Gram-positive host, which is due to a number of advantages for the production of genetic engineering increasingly important, so far could not thermoinduzierbare Gene expression can be achieved (Murooka Y. et al., [1986] Appl. Microbiol., Biotechnol., 24, 504-508). The reason for this is to be seen in the fact that it has not been possible to bring the lambda Cl repressor protein in this host system for expression.

Object of the invention

The invention aims to provide for the first time expression vectors for efficient thermoinducible expression of gene products in Gram positive bacterial hosts.

-β- 275 478 Explanation of the nature of the invention

The invention has for its object to describe a multistage gene engineering method can be constructed with the stable expression vectors for a thermoinducible expression of gene products in Gram positive bacterial hosts.

According to the invention, this object is achieved in its basic feature as follows:

Using sections of standard genetic engineering operations of DNA recombination and introduction of DNA into bacterial receptors, the procedure is initiated by assaying in a target DNA provided that contains both the complete gene for the Cl 857 repressor protein (shorthand: c / 857 gene ) and the coy promoter region of E. coli Z / phage lambda in a native arrangement, a restriction site is generated immediately upstream of the reading frame of the c / 857 repressor gene by directed in vitro mutagenesis, and the target DNA so modified is recovered becomes. After this step I, the modified target DNA containing the mutagenized lambda P _R -c / 857 region (shorthand: mutagenized partial sequence) is inserted into a plasmid vector which replicates in Gram-positive bacterial hosts and a gene to be expressed (shorthand : Target gene). In this way intermediate plasmids of the pBS family are obtained (step II). In the subsequent step III, the lambda c / 857 gene is linked using the generated restriction site with expression signals that are functional in Gram-positive bacterial hosts. Clones with the recombinant plasmids obtained in this way are phenotypically checked for thermoinducibility of the expression of the target gene. Cloning in each case into a bacterial recipient yields the amount of the expression vectors of the pBS50 family which are required for the final step IV of the process.

In completion of the process, if necessary, the box of the target gene of the expression vectors of the pBS 50 family obtained in step III is substituted by an alternative gene box. The clones with recombinant plasmids of the pBS71 / 72 and pBS81 / 82 family obtained in this step IV are phenotypically checked for thermoinducibility of the expression of the alternative gene and the gene product produced in this way in submerged cultivation of the recombinant gram positive hosts used is collected if necessary.

In a further embodiment of this basic feature of the invention, the target DNA used in step I with the Pr promoter region and the c / 857 repressor gene is prepared from a recombinant phage, preferably from a recombinant Eco // phage of the M 13 family or alternatively from the native E.co/Z phage lambda or from a recombinant plasmid vector. Into this target DNA, a DNA segment is inserted by the known sub-method of directed in vitro mutagenesis immediately upstream of the reading frame of the c / 857 repressor gene, which contains a hexanucleotide recognition sequence for a restriction enzyme, so for the enzymes BgIIl or Sal I, but preferably for the BamHI restrictase.

The modified target DNA or mutagenized partial sequence is subsequently obtained from the replicative (double-stranded) form of the donor used, preferably from the replicative form of the M13 phage used, on a restriction fragment and kept ready for the subsequent step II.

For this step II, the mutagenized partial sequence is now integrated into a promoter-search plasmid replicating in gram-positive bacterial hosts. The successful cloning of the mutagenized partial sequence is recognizable by the expression of the indicator gene (target gene). As indicator gene here is preferably resorted to an amy gene box. The intermediate plasmids of the pBS family thus obtained are isolated from the recombinant Gram-positive bacterial hosts and provided for the subsequent step III of the described method. This step consists in inserting in at least one of these pBS intermediate plasmids, using the inserted restriction site for an enzyme with a hexanucleotide recognition sequence, a DNA fragment which comprises the native expression signals of a bacterial gene or a bacteriophage gene which are functional in gram-positive bacterial hosts , preferably a gene of a Staphylococcus aureus phage. Clones of the gram-positive bacterial recipients with the thus obtained recombinant expression vectors of the pBS 50 family are examined by means of a phenotypic screening for thermoinducibility of the expression of the respective target gene. Subsequently, the required amounts of DNA of these vectors are obtained from cultures of the recombinant recipient and provided for the possibly required final step IV of the process.

In this step, in at least one expression vector of the pBS50 family, the box of the indicator gene is substituted by an alternative gene box for an intracellular or secretory protein of pro- or eukaryotic origin. Preferably, this substitution is by a gene box for a secretory protein from a bacterium or bacteriophage. The recipient clones with the expression vectors of the pBS71 / 72 and pBS80 / 81 families thus prepared in step IV are again screened for thermoinducibility of the expression of the alternative structural gene by phenotypic screening. From cultures of these recombinant Gram-positive bacterial hosts, the required amounts of plasmid DNA of these expression vectors are obtained.

For the phenotypic screening for thermoinducibility of the expression of the target gene contained on the respective pBS expression vector - alternative genes of the above labeling are now generally understood as target genes under the aspect described here - is a microorganism strain of the genus Bacillus, preferably a strain of the species Bacillus subtilis, used. The gene product which can be produced with these vectors is collected, if necessary, after submerged cultivation of the recombinant gram-positive hosts used.

For carrying out the phenotypic screening as well as for the expression of the respective target gene, a thermo-induction step is carried out either at the beginning of the main culture or in the early growth phase of the used, with a pBS shuttle expression vector transformed, gram-positive bacterial host strain. Preferably, the increase in the cultivation temperature of 28 ° C to 30 ° C to 37 ⁰ C to 42 "C takes place within a time interval of 3 minutes. Then, cultivation is still continued in each case up to 30 hours.

In the preferred embodiment, in the start part of the process, the c / 857 repressor gene of the £ co / Z phage lambda is linked to those expression signals which are realized in cells of B. subtilis so as to express the temperature-sensitive repressor protein for the first time in this host system can. Because the natural DNA sequence of lambda phage

in this region has no restriction site for such a linkage, a BamHI site is now generated in a first step immediately upstream of the reading frame of the cA857 gene. The starting sequence is the DNA of the recombinant phage

M 13tg 730 (P _R cA857 / fn) Pstl

used.

This phase was obtained by inserting into the singular PstI site of the polylinker of the DNA of the literature-known E. coli phage M13 tg 130 a 1783 bp DNA fragment which is the complete gene for the temperature-labile CI-857 repressor protein of the Bacteriophage lambda in the native arrangement to the promoters P _RM and Pr contains. The sequence of the P _R promoter region, including the RBS of the lambda cro gene, is also linked to the N-terminal partial sequence of a human / 7 hβ gene on this insert (FIG. 1). The recombinant M 73 phage thus constituted was obtained by the method of an earlier invention of VNII Genetika (USSR), which relates to the construction of vectors for the expression of hlfnβ in E. coli under the control of lambda signals.

To generate the BamHI site, the known in vitro mutagenesis method using a 43mer oligodeoxynucleotide provided in this case is used. This oligonucleotide is constructed so that the DNA sequence to be inserted, which in the preferred embodiment of the invention contains the desired BamHI site, is flanked by two sequences each having a sequence which is sufficiently stable for hybridization to that intended Insertion site adjacent nucleotides of the cAausgangssequenz guaranteed. In the preferred embodiment of the invention, an oligonucleotide of the following sequence is used:

5 'GGTGATAGATTTAAGGAGGGATCCATAATGAGCACAAAAAGA 3';

this contains the recognition site for the restriction enzyme BamHI in the newly inserted sequence (underlined twice) immediately upstream of the reading frame of the Lambda c / 857 repressor gene. The flanking regions complementary to the starting strand of the coding strand comprise 16 nucleotides each in the 5 'region 14 and in the 3' region. With the 43mer Oligodeoxvnukleotid outlined above, the single-stranded DNA of the starting phage

M 13tg 730 (P _R c / -857 / rn) Pstl

hybridized, which in turn was recovered from supernatants of a transfected E. coli plasmid, duD host organism, preferably the strain E. coll RZ1032. By choosing this host, the strand encoding the c / gene of DNA complemented and ligated after hybridization contains uridine bases instead of thymidine bases. Subsequently, an E. coli is transfected with this DNA with the wild-type alleles ung ⁺ , dut ⁺ , preferably the strain E. coHIG 1. The Λί 73 DNA recovered from the resulting transfected clones is analyzed by sequence analysis for the presence of the newly inserted sequence and for its correct incorporation into the intended position of the starting sequence. Those clones that have these properties contain the as

M 13tg 730 (Pr BamHI c / -857 / ftißJPstl

designated recombinant phage.

In the second step of the preferred embodiment, the mutagenized lambda DNA sequence, including the PR promoter region, is transferred to a plasmid vector. For this purpose, the literature-known S.subf / 7 / s promoter search plasmid pKB8 (molecular size 6.6 kb, marker: MLS resistance gene) is used, which is the promoterless α-amylase structural gene from B. amyloliquefaciens {amyF) with native RBS as indicator gene for Promoterinsertionen carries (sa Fig.3). The provision of this plasmid for the uptake of the mutagenized lambda DNA sequence has the following advantages:

- A unique PstI site is available for insertion (the mutagenized DNA sequence including the PR promoter region can be obtained as a PstI fragment);

- insert-containing recombinant plasmids are already in the phenotypic screening of the recipient strain on the basis of the a-amylase formation recognizable (as a result of the linkage of the lambda P _R promoter sequence with the amyF structural gene takes place in a-amylase-negative Rsubt / V / s-recipient strains Amylase formation under control of the lambda P _R promoter);

- The fusion of the lambda PR promoter region with the a / nyf indicator already produces a construction that can be used in the following steps as a model for the detection and characterization of temperature- inducible gene expression in B.subtilis (the formation of secretory a -Amylase can easily be subjected to qualitative and quantitative testing).

To convert the mutagenized lambda sequence, a 1794 bp PstI fragment is obtained from the replicative form of the DNA of the M 13tg 730 (Pr BamHI cl- 857 / rnβ) PstI fragment, on which now a BamHI site is inserted between the reading frame of the c / 857 repressor gene and the P _RM promoter region (see Fig. 1). This fragment, which also contains the lambda P _R promoter, is inserted into the unique Pst I site of the S.subf / 7 / s promoter-finding plasmid pKB8. Upon transformation of an α-amylase-negative B.subf / 7 / s recipient, preferably strain 21 amyA recEA, among the erythromycin-resistant and amylase-forming clones, those containing the novel intermediate plasmid designated pBS 10 are identified. On this plasmid, the mutagenized lambda DNA sequence derived from the M 73 phage is inserted upstream of the α-amylase structural gene such that amylase expression occurs under the control of the lambda P _R promoter region (see also Figs. 3).

Amylase-negative β.subf / 7 / s strains harboring pBS10 are expected to constitute constitutively a-amylase both at temperatures below and above 30 ° C (see Fig. 5). The intermediate plasmid pBS 10 has the advantage of including a lambda DNA sequence on which a site directed mutagenesis BamHI site is placed upstream of the reading frame of the c / 857 repressor gene.

In a third method step of the preferred embodiment of the invention, this BamHI restriction site is used to link the d-repressor gene now to B.subtilis cell- efficient expression signals . For this purpose, the signals of the staphylokinase expression unit (sak-EE) of S. aureus Pbagen 42 D are used. The sak-EE donor used is the recombinant E. coli expression vector pBB 209 (molecular size 3154 bp, marker: ampicillin resistance gene, see Fig. 3), which has a unique BamHI site for fusion immediately downstream of the sak EE having a gene to be expressed. This vector has become available following the method of a previous application of the Central Institute, which relates to the production of expression vectors for expression of mature gene products.

Linkage of the sak EE to the c / 857 repressor gene is discussed in the strategy of construction of E. coli / B. sufcf / 7 / s shuttle vectors were performed by fusing the B. subf / V / s intermediate plasmid pBS 10 with the E. coli expression vector pBB209. It is advantageously accomplished by sequentially transforming strains from both host systems without screening the clones of the first transformed host. This procedure is based on the fact that

by replication and expression of ampicillin resistance in the E. coli host system as well

- by replication and expression of MLS resistance in the S.subf / 7 / s host system

after passage of the recombinant plasmid population by strains from both host systems, those shuttle vectors containing both antibiotic resistance genes and replication origins are highly likely to be probed, whereby in phenotypic screening each of the two hosts is already checked for the presence and inducibility of P _n -amyf model gene fusion can be.

This strategy makes use of the advantage that, in cases where primary transformant clones with the sought-after recombinant plasmids can not readily be phenotypically identified, a simple selection by transformation of a strain from the second host system instead of a complex search for these chimeras the total population of plasmids obtained after transformation of the first host is feasible. In realization of this cloning strategy, the intermediate plasmid pBS 10 is partially cleaved with the restrictase BamHI in such a way that predominantly linearized plasmid molecules are formed, which are subsequently ligated with the vector pBB209, also opened with BamHI. From the ampicillin-resistant clones obtained after transformation of strain E. coli TG1 at 30 ^° C., ie under permissive conditions (avoidance of structural plasmid instabilities in this host), a complete preparation of their plasmid DNA is obtained, with which an amylase negative B. subtillic strain, preferably strain 21 amy4 recE4.

The screening of the obtained 3, subtl / s clones is based on the expected inducibility of the lambda PR promoter: Among the erythromycin-resistant clones, consequently those are selected which, after cultivation at temperatures below 30 ° C., are not amylase form, however, they can ausprägen after conversion to cultivation temperatures above 37 ⁰ C. Such clones are then characterized for their plasmid DNA content. A representative of the shuttle vectors obtained in this manner in the preferred embodiment and designated pBS 52 (molecular size 11.4 kb; marker: MLS resistance gene and ampicillin resistance gene) is shown in FIG. As intended, the c / -857 repressor gene on it is now under the control of the sak-EE. According to the method, this shuttle vector also has the advantage that it includes the a / nyF structural gene fused to the lambda P _R promoter region and thus can already be used in B.subtiliswte also in E co // for the characterization of the induction behavior ( this circumstance could be used to advantage in the screening of the transformant clones for finding such plasmids). Another peculiarity of this vector is that, as a result of the cloning and selection steps carried out (keyword: partial BamH! Restriction), the orientation of the internal BamHI fragment derived from the intermediate plasmid pBS 10 has reversed with the P _R -amyF model box. As a result, while maintaining the operability of this construction, the relation of the restriction sites on the shuttle plasmid pBS52 changes as compared to the intermediate plasmid pBS 10, resulting in further advantageous possibilities for subsequent work on the fusion of the R p promoter region with another model gene (see below).

Amylase-negative S.subf / V / s host strains harboring pBS52 are now able to express the amyf model gene by temperature shift. This inducibility is based on the classic lambda promoter-repressor model attributable to the fact that at cultivation temperatures below 30 ⁰ C, the lambda P _R promoter formed by the constitutively under control of the sak-EE , with the operator regions of the P _R -. Promotors interacting CI-857 repressor protein is repressed, whereupon the amyf gene is not read. As a result of a Temperturshifts to at least 37 ⁰ C, the conformation of the temperature-labile repressor molecules is changed so that they detach from the P _R operator region and now release the transcription of the amyf gene.

The amount of the formed and secreted α-amylase can be easily determined in the qualitative and quantitative tests. In Figure 5, for the strain S. subtilis 21 amy 4 recE4 transformed in the preferred embodiment of the method with pBS52, in each case the amylase titers are compared with no induction of the formation kinetics after induction. As the results clearly show, the onset of α-amylase expression of this recombinant host is triggered solely by the shift of the cultivation temperature from 3O ⁰ C to 42 ⁰ C. This effect was reproduced at two different induction times. It is also characteristic that the expression of amylase begins immediately after induction and lasts until late in the stationary growth phase of the culture, so that a long-lasting product formation phase can be achieved. This induction behavior as well as the achieved expression level of about 100 mg / l in the case of secretory α-amylase demonstrate the performance of the novel temperature-regulated expression system obtained according to the method in B. subf / 7 / s hosts.

In the second section of the preferred embodiment, the established inducible B. subr / 7 / s expression system is probed involving another model gene. For this purpose, the structural gene of staphylokinase of Staphylococcus aureus phage 42D (sa / c gene) is used. This choice offers the advantage (as in the case of the α-amylase gene) that the formation of the secretory SAK gene product can easily be subjected to a qualitative and quantitative test. Recombinant carrier plasmids, such as рВВООО and pBB 301, which include the above-mentioned saic gene, have become available following the procedure of a prior application of the Central Institute.

The donor of the sa.sup.1 gene box is preferably the E. coli plasmid pBB301, a derivative of pDB 17, one of these sac recombinant carrier plasmids. Plasmid pBB301 (molecular size 4007 bp; marker: ampicillin resistance gene) is characterized by containing the promoterless safr gene box, including the native SD sequence, inserted into the Hincll site of the

Polylinker of the Eco / Z cloning vector pUC18 is inserted (Fig.6). For fusion with promoters, under the control of which the acidic structural gene is to be expressed, u.a. the restriction site for the enzyme PstI from the pUC18 polylinker available.

On the shuttle plasmid pBS52, the carrier of the inducible expression system, such a restriction site is positioned downstream of the P _R promoter region (here fusion site with the amyF model gene). Optionally, in a prepared process step by reduction of this vector, ie in the steps

Cleavage of the Eco / Z / asubf / V / s shuttle plasmid pBS52 with PstI,

- self-ligation of the resulting fragments,

Selection of the clones obtained after transformation of an a-amylase-negative B.subivV / s strain and

- Verification of these clones on the absence of amylase formation of the PstI Restrilktionsort downstream of the P _R promoter unikalisiert.

This procedure offers the advantage that in a simple way

- Of the two resulting after cleavage with Pstl plasmid components only the sought, P _R- containing component is selected by autonomous replication in B. subtilis (the second component is not autonomously replicable in B. subr / 7 / s hosts) and

Clones with reduced S.subf / 7 / s plasmids from the likewise selected clones with the starting plasmid pBS52 (which can be obtained by reconstitution of both fragments or by incomplete restriction) are already detectable in the phenotypic screening of the respective host (on the basis of the absence an α-amylase synthesis).

With the partial step described above it was possible to obtain that all selected amylase-negative, erythromycin-resistant clones of the host strain B. subtilis 21 amy4 recE 4 contained reduced plasmids of the desired structure, which were identified as pBS60 (molecular size 4.9 kb; Resistance genes) (see also Fig. 6). On these S.subf / 7 / s expression plasmids, downstream of the lambda P _R promoter, is a unique PstI site, which is useful for fusion with a gene to be expressed.

In a next method step of the second section of the preferred embodiment, the lambda Pp promoter region is now linked to the safc model gene. For this purpose, the two plasmids pBS 60 and pBB 301 are fused via their unique PstI site. It is possible, after direct cloning in B. subtilis, the clones with the desired recombinant plasmids, which cause the expression of the sa / c gene under the control of the PR promoter, already in the phenotypic screening on the basis of SAK formation on agar Recognize test plates.

From the SAK-positive B. SubF / 7 / s transformant clones by a representative selected and examined for its plasmid DNA content. The structure of the thus obtained F.co///S. subf / 7 / s shuttle plasmid, designated pBS70 (molecular size 8.9kb; marker: MLS and ampicillin resistance gene), is shown in FIG. This plasmid mediates constitutive SAK expression of the B. SubF / 7 / s-recipient strains, because it has been spun by the vector reduction in the preparatory step, the c / -857 repressor gene from pBS52 (so be no repressor formation and thus the lambda PR promoter can not be repressed).

To establish a temperature-inducible SAK expression system, shuttle plasmids are then constructed which include both the saf promoter model fused to the P "promoter and the c / 857 repressor gene linked to the sak EE . In the preferred embodiment, the ρsch-amyF model gene of pBS 52 is substituted by the pBS70 ub-sak gene box. This step is carried out by after deletion of those two EcoRI fragments of pBS52 which encode the Pn-amyF gene box (see Fig. 4), the PR-safr model gene taken from the pBS70 as a 1.8 kb EcoRI fragment with the thus obtained pBS 52 main fragment is fused. The clones of hosts expressing the desired recombinant E. coli / B. subtilis shuttle plasmids of both insert orientations pBS71 and pBS72 (molecular size: 10.8 kb, markers: MLS and ampicillin resistance genes, see Fig. 6) are again detectable in phenotypic screening on the basis of the inducibility of SAK expression.

Another approach to the construction of shuttle plasmids, including both components of the inducible SAK expression system, is realized by the transfer of the sa / r EE c / 857 gene box from pBS52 to the shuttle plasmid pBS70. For this purpose, the c / -857 repressor gene fused with the sak-EE is preferably taken off as a 2.6 kb Pvull fragment from pBS52 and inserted into the unique EcoRV site of pBS70. After transformation of B. subtilisbzw. Eco / Z are identified in a one-step procedure in phenotypic screening now those clones that are SAK-positive at 37 ⁰ C, but SAK-negative at 30 ⁰ C. Such clones contain a plasmid with the inducible SAK expression system consisting of the Рщ-sak and the sa / c-EE cA857 gene box as partial components. Clones of this nature are subsequently characterized for their plasmid DNA content. The structure of the E coli / B thus obtained . subf / 7 / s shuttle plasmids of both insert orientations designated pBS80 and pBS81 (molecular size 11.5kb; markers: MLS and ampicillin resistance gene) are shown in Fig.6.

B. subtilis and E.co/Z- host strains containing pBS80, do not form staphylokinase at cultivation temperatures below 30 ⁰ C, but after temperature shift to at least 37 ⁰ C capable of SAK formation. This behavior has already been used to advantage in the above-mentioned phenotypic screening.

By both embodiments, the functionality of the temperature-inducible expression system for B. subtilis including the repressor-controlled lambda PR promoter / operator region has been demonstrated with a second model gene , the sak gene of S. aureus phage 42D.

embodiments

The following statements are intended to illustrate in some examples the individual steps of the method for the production of expression vectors for the thermoinducible expression of genes in Gram positive bacterial hosts. However, they do not contain detailed information on the standard methods used in genetic engineering and microbiology (such as extraction of plasmid or phage DNA, cleavage of DNA with restriction enzymes, DNA sequence analysis, DNA hybridization, preparation and characterization of plasmid DNA using Agarose gel electrophoresis, recovery of DNA fragments from agarose gels, conversion of sticky ends into blunt ends,

Insertion of gene sequences into vector plasmids, execution of ligation reactions, transformation or transfection of bacterial recipient strains with plasmid or phage DNA and cultivation of microorganisms). Such methods are known to those skilled in the art and described in detail in a number of publications, for example in

- "Advanced Bacterial Genetics, a Manual for Genetic Engineering" (R.W. Davis, D. Botstein, J.R. Roth), Cold Spring Harbor Laboratory, New York, 1980;

Molecular Cloning, a Laboratory Manual (T. Maniatis, E. F. Fritsch, J. Sambrock), Cold Spring Harbor Laboratory, New York, 1982;

Monographs of the series "Methods in Enzymology", Acad. Press, Vol. 65 (1980), 68 (1980), 100 (1983, 101 (1983), 153 (1987), 154 (1987);

Monographs of the series "Methods in Microbiology", Acad. Press, Vol. 1 (1969), 2 (1970), ЗA (1970), 5B (1971), 6A (1971) and 18 (1984).

Example 1 Thermoinducible expression of the α-amylase gene (amyF) of Bacillus amyloliquefaciens in B.subtilis involving the plasmid pBS52

1.1. Generation of a BamHI restriction site in front of the lambda c / 857 repressor gene reading frame (step I)

The production of the BamHI site is carried out by the method of directed in vitro mutagenesis (Kunkel TA et al., Meth. Enzymof. [1987] 154,). The target sequence used is the DNA of the recombinant phage (M 13tg 130 (P _R cl-857 ifnβ) PstI (FIG. 1).

First, the required amount of single-stranded M13 DNA (about 10 pg) is isolated from the supernatant of a submerged culture of the above-mentioned phage Eco / i strain RZ1032, purified and dissolved in 1OmM TrisHCl buffer. By choosing this host, which is grown with the addition of 0.25% uridine / ml, this DNA contains uridine bases instead of thymidine bases. About 5цд this M 13-uridine-DNA is mixed with about 20 ng of 5'-phosphorylated 43mer oligodeoxyribonucleotide-hybridized following sequence (1 hour, 56 ⁰ C):

5 'GGTGATAGATTTAAGGAGGGATCCATAATGAGCACAAAAAGA 3'.

Subsequently, the template is converted in a manner known per se by a Klenow reaction with subsequent ligation into the double-stranded circular form of the M 13 DNA. Competent cells of the E. coli · recipient strain TG1 are transfected with samples of this DNA. Since this strain contains the ung ⁺ and duf ¹ "wild-type alleles, only the DNA strands that do not contain incorrectly incorporated uridine bases are replicated in the TG1 lines, thereby making clones with the mutagenized, the BamHI site From the supernatants (about 1 ml) of 12 E. coli TG 1 clones obtained in this way, about 10 × of single-stranded M13 DNA is prepared and dissolved in 10 ml of TrisHCl buffer These DNAs (about 1 μg each ) are subjected in a manner known per se to a DNA sequence analysis according to the chain termination method of Sanger et al., The clones are identified with the mutagenized lambda sequence (FIG Method proved so efficient that 40% of the recovered clones contained the desired recombinant phage M13tg 130 (P _R Bam HI c / -857 Delta ifnβ) PstI, which had the BamHI site before the reading frame of the c / 857 repressor gene.

From 100 ml of cell suspension of these E. coli IQ 1 clones, the double-stranded (replicative) form of the M 13 DNA is isolated in a manner known per se, dissolved in TrisHCl buffer and prepared for the subsequent step II.

1.2. Transfer of the mutagenized lambda c / 857 sequence to a plasmid vector (step II)

From about 5 % of the double-stranded M 13 DNA provided in step I, after cleavage with the restrictionase Pst I, the 1794 bp PstI-PstI fragment which comprises the mutagenized lambda c / 857 sequence and the lambda P _{R is obtained} . Contains promoter. For the cloning of this fragment, the promoter search plasmid pKB8 (FIG. 3) is selected. It contains a unique Pstl location in front of the promoterless a-amy indicator box. The required amount of pKB8 plasmid DNA (about 5 kD) is isolated from cultures of B. subtilis 2 \ amy4 recE4 (pKB8), purified and dissolved in TrishHCl buffer. The linearized with PstI plasmid pKB8 is ligated with the above 1794bp Pstl-Pstl fragment using T4 ligase. After transformation of B. subtilis 21 amy4 recE 4, among the amylase-positive clones those are identified which contain the new intermediate plasmid designated pBS 10. On this plasmid, the PstI fragment is inserted in the orientation indicated in Fig. 3, which effects the expression of the amy-indicator gene under P _R control. From submerged cultures of the above B. pBS10 contained B. subtilis strain required for the subsequent step amounts of plasmid DNA (about 5pg) are isolated, purified and dissolved in TrisHCl buffer.

1.3. Linkage of the lambda c / 857 repressor gene to expression signals of the sakA2 D gene operable in B. subtilis The BamHI site generated by directed in vitro mutagenesis in front of the reading frame of the lambda c / 857 repressor gene is now used to do this Gene to associate with the transcriptional and translational signals of the sak gene of the S. aureus phage 42D. These expression signals (sa / r-EE) are provided on the recombinant E. coli plasmid pBB209, which has a unique BamHI site downstream of the sa / c EE for fusion with a gene to be expressed (Figure 3). , The required amounts of pBB 209 plasmid DNA (about 5 ц d) are isolated from cultures of coli coli TG 1 (pBB 209), purified and dissolved in TrisHCl buffer. The linkage of the sak EE with the c / 857 gene occurs by fusion of the two provided vectors pBS 10 and pBB209. For this purpose, the pBS 10 DNA, which has 3 BamHI sites, is partially cleaved with the restriction enzyme BamHI in such a way that linearized pBS 10 molecules are formed predominantly at only one BamHI site. This limited restriction is achieved by incubating 2 × pBS 10-DNA for 2 minutes with 10 E of the restriction enzyme BamHI at 37 ° C. The restriction mixture is then ligated with the BamHI-linearized pBB209 molecules with the aid of T4 DNA ligase. Competent cells of E. coli TG1 are transformed with the ligation mixture obtained in this way. Here, the heat shock treatment is carried out at 32 ⁰ C to potential plasmid instabilities in this host under non-permissive conditions

submissions. From the totality of the obtained E co / i-TG 1 clones (without screening) a total plasmid DNA preparation (about Ю gd) is obtained. Competent numbers of S. subf / 7 / s21 amy4 recE 4 are then transformed with samples of this DNA pool (2 μg).

The S. subt / 7 / s clones obtained in this way are now first subjected to a phenotypic screening for thermoinducibility of the amylase expression. For this purpose, surface cultures are applied to agar plates containing in addition to the antibiotic erythromycin (about Юцд / гпІ) 0.15% of the substrate amylopectinazur. Amylase-forming clones can be recognized by the formation of a halo on these test plates. By parallel incubation of the surface cultures at 30 ⁰ C and 42 "C are those among the B.subf / 7 / s clones now selected, which, however, are negative Amy at 42 ° C Amypositiv, at 30 ⁰ C. This cloning and selection strategy proved so efficacious that an inducible clone could be identified among 100 clones examined, and from cultures of the S.subr / 7 / s clones identified as thermoinducible in phenotypic screening, the plasmid DNA was isolated, purified and purified in TrisHCl The expression plasmids of the pBS50 family obtained in this way are characterized by restriction with the enzymes BamHI, EcoRI, KpnI, Pvull, PstI, EcoRV, HindIII and their combinations A representative of these expression plasmids is the Eco / Z / Rsubr / V / s shuttle vector pBS52 On this plasmid is now the lambda c / 857 repressor gene under control of the sak EE and the amyf structural gene under control of the lambda P _R promoter (Figure 4).

In addition, the orientation of the internal BamHI fragment derived from the intermediate plasmid pBS 10 with the P _R -amyf model box was reversed by the cloning strategy carried out (keyword: partial BamHI restriction). For the functionality of the construction, however, this inversion was irrelevant.

1.4. Thermoinducible amylase expression by strain B. subtilis 21 amy4 recE4 (pBS52) The strain S.subf / 7 / s21 amy4 recE4 (pBS52) is now used to quantitatively evaluate thermoinducible amylase expression in submerged cultures. The culture medium is nutrient broth II, consisting of

pancreatic peptone (meat. gelatin, casein) 6.75 g / l

Protein hydrolyzate 1.75g / l

Yeast extract 1.50 g / l

NaCl 5.00 g / l

after sterilization for 12 minutes at about 120 ° C (pH 7.2 ± 0.3) with an addition of 80 ц d ampicillin / ml medium. The culture is stirred submerged on a rotary shaker (220 rpm).

The cultivation takes place in the stages pre- and main culture. First, a preculture (about 10mI) of a single colony of the above strain is inoculated and grown overnight at 30 ° C for 16 hours. From this preculture, several flasks each with 100 ml of culture medium 2% v / v inoculated and cultured as main cultures in 2 separate batches each at 30 ° C or 42 ⁰ C under otherwise identical conditions. The temperature shift takes place in one part of the pistons with the beginning, in a second part after the 4th hour of cultivation of the main cultures. As a control cultivated cultures of the constitutively amylase-forming strain S.subf /// s21 amy4 recE4 (pBS10) are carried under the same conditions. Of the cultures grown in parallel at 30 ^° C. or 42 ^° C. and induced at two different times, in each case 1 ml of sample are taken in each case after 2 to 4 hours of culturing. In these samples, the growth state of the culture is determined on the basis of the optical density at 600 nm and the enzymatic activity of the α-amylase by means of a colorimetric test. For the Amy test, 2 to 20 μΙ of the culture supernatant obtained after pelletizing the cells (5 '10 copm) or dilutions produced therefrom (up to 1: 200) are used. They are mixed with 300μΙ each of a 1% amylopectinazur solution containing 6OmM Na acetate (pH 5.0), and incubated at 37 ⁰ C for 30 minutes. The reaction is terminated by adding 1 ml of distilled water. Subsequently, the samples are sedimented (10 'lOkopm). In the supernatants, the absorbance is determined with a spectrophotometer at 600 nm against a Kontroilösung, which was prepared from the culture medium used. The values read and calculated according to the dilution are shown graphically (see Fig. 5).

The amylase titers determined after examination of the strain B.subtilis 21 amy4 recE4 (pBS52) demonstrate the high efficiency of the thermoinduction which can be achieved with the expression vector pBS 52 prepared according to the method. Compared with the previously known chemically or thermally inducible ß.subf / 7 / s-expression systems that allow only 100-fold induction rates, not amounted to the induction factor subtilis obtained in example, with the vector pBS52 1400. This induction repression degrees was used for this host previously described.

Example 2 Thermoinducible expression of the staphylokinase gene (safc42D) of S. aureus phage 42 D in B. subtilis , including the expression vectors pBS71 and ρBS72

The expression vectors pBS71 and pBS72 are constructed by substituting the sak gene for the amyf gene of pBS52. The starting plasmid used is the expression vector pBS52. The required amounts of pBS52 plasmid DNA (about 5 microns) are isolated from cultures of B.subtilis 2 "\ amy 4 recE4 (pBS 52), purified and dissolved in TrisHCl buffer.The donor of the sa * 42 D gene box is the The required amounts (about 5 mM) of plasmid DNA are recovered analogously from cultures of E. coWTG MpBB 301. On this plasmid, a unique PstI site is located upstream of the promoterless sakA2 D gene box. over which the sak42 D gene is linked to the lambda P promoter. For this purpose, the plasmid pBS is decomposed 52 with PstI in 2 fragments. This fragment mixture was ligated with the Pstllinearisierten plasmid pBB301 with the aid of T4 DNA ligase. with samples of the ligation mixture, competent cells of B. subtilis GB 500 are then transformed, and the successful fusion of the P _R promoter with the sa <r42D gene box is first investigated in a phenotypic screening.

For this, the obtained S.subf / 7 / s clones are cultured on agar media containing 10% skimmed milk and 1% human plasminogen. In order to exclude any possible misinterpretation caused by host proteases, control plates without plasminogen addition are carried along. Expression of staphylokinase encoded by the sak42 D gene causes lysis sites on the plasminogen-containing skim milk plates (no lysis sites on the protease control plates ).

From cultures of the thus identified Sak-positive B. subf /// s-GB500 clones, the plasmid DNA (about 5 mg each) is isolated, purified, dissolved in TrisHCl buffer and then with the restriction enzymes BamHI, EcoRI, EcoRV, Pst I, FVu II and their combinations. As expected, a representative of these plasmids, designated pBS70, contains the sak42 D gene box under the control of the lambda PR promoter (FIG. 6). About 2k pBS70 plasmid DNA is digested with EcoRI restriction into 2 fragments. From this mixture, the 1.8 kb EcoR I-EcoR I fragment containing the P _R -safc42 D box is isolated in a manner known per se after separation in the agarose gel and dissolved in TrisHCl buffer. In an analogous manner, the 8.9 kb EcoR l-EcoR I fragment is recovered from the plasmid pBS52 with the sa / cEE c / 857 cassette and dissolved in TrisHCl buffer. Both provided EcoR I fragments are now subjected to a ligation reaction with the aid of T4 DNA ügase. Competent cells of B. subtilis GB500 are transformed with samples of the ligation mixture obtained in this way. The erythromycin-resistant clones obtained are tested in the manner already described above (as surface cultures on SAK test plates) for the thermo-inducible expression of staphylokinase. From the recombinant S. subtilis GB 500 clones at 42 ⁰ C SAK-positive, those are selected that do not form SAC at 3O ⁰ C. As cultures of these clones, the plasmid DNA (about 5 cc each) is isolated, purified, dissolved in TrisHCl buffer and characterized with the enzymes BamH I, EcoR I, EcoRV, PstI and Pvu II (including their combinations). The plasmids pBS71 and pBS72 prepared in this way are shown in FIG.

They differ in the mutual orientation of the P _R -saA42 D and safcEE-c / 857 cassettes. B. subf / V / s GBSOO clones containing pBS71 or pBS 72 are capable of thermoinducible expression of staphylokinase. This inducibility has already been demonstrated in phenotypic screening.

Legends to the pictures

Fig.1

Structure of phage M 13tg 130 (P _R c / 857; 7h) Pstl. From the PstI insert a segment with the lambda promoter regions P _R and Prm in the wild-type DNA sequence is shown. The base substitution by the mutagenic oligonucleotide is indicated below the lambda sequence. OR: Рц operator boxes; mRNA start in E. coli according to Blattner Stdahlberg (1972) Nature (L) New Biol 237: 227; mRNA start in B. subtilis after Murooka et al. (1986) Appl Microbiol Biotechnol 24: 504-508.

Fig. 2

DNA sequence analysis of the mutagenized M 13tg 130 (Pr c / 857 / frisslPstI phage lanes 1-4 & 5-8 v. I. п.g.:. Mutagenized sequences with BamH I site wild-type sequence inserted nucleotides lanes 9-12: lambda wild-type sequence ATG: translation start of Lambda c / 857 gene.

Fig.3

Construction of the shuttle expression plasmid pBS52 for thermoregulatory Amy expression in B. subtilis and E. coli.

mayF: α-amylase structural gene of B. amyloliquefaciens with native RBS;

Pr: lambda Pp promoter region with cro-RBS and 144 bp of the / fnβ structural gene; the translation of the / fn reading frame becomes

terminated upstream of the ay-RBS; the Amy translation initiation is done by its own signals; Cl: Mutagenized Lambda c / 857 Genbox; EE: sa / r expression unit.

Fig. 4

Structure of the shuttle expression plasmid pBS52 for the thermoinducible Amy expression in B. subtilis and E. coli. The DNA sequence at the BamH I fusion site between the sak EE and the mutagenized lambda c / 857 sequence is shown in the upper part of the figure.

Fig. 5

Kinetics of a-amylase formation by B. subf / 7 / s21 amyA recEA with pBS 10 (constitutive) and pBS52 (thermoinducible). Overnight cultures (3O ⁰ C) were diluted 1:10 and incubated in Nbll medium at 3O ⁰ C or 42 ⁰ C under otherwise identical conditions. The temperature shift was either at the beginning of cultivation or after 4 h. At the times indicated samples were taken from the culture supernatant and determined in them the Amy titers colorimetrically.

Fig. Β

Construction of shuttle expression plasmids pBS71 and pBS 72 for thermoregulable Sak expression in S. subtilis and E. coli.

Claims (44)

1. Production method for expression vectors for thermo-inducible gene expression in gram positive η bacterial hosts using standard methods of DNA recombination, the introduction of DNA into bacterial receptors, their cultivation and optionally the product recovery from such recombinant recipients, characterized in that in a target DNA prepared, carrying both the complete gene for the el 857 repressor protein (shorthand: cl857 gene) and the P _R promoter region of the E. coli phage lambda in a native arrangement, immediately upstream of the el 857 Reading frame insert a DSN segment for a restriction site by directed in vitro mutagenesis, and recover the thus modified target DNA for the subsequent step of the method (step I), - A partial sequence taken from said modified target DNA as a restriction fragment and containing the mutagenized (PR-cl8571 region (short: mutagenized partial sequence), into a PJasmidvektor replicating in gram-positive baJcterieJJen hosts with a gene to be expressed (shorthand: target gene) and Cloning in a gram positive bacterial recipient in each case the required amounts of DNA of the thus obtained intermediate plasmids of the pBS family wins (step II), Subsequently, in at least one selected pBS intermediate plasmid using the inserted restriction site, a DNA fragment with expression signals operable in gram-positive bacterial hosts (short word: EE) inserted, clones with the obtained recombinant plasmids using a phenotypic screening for thermoinducibility of the expression of the respective target gene checks and, by cloning in a bacterial recipient, obtains the required amounts of DNA of the expression vectors of the pBS 50 family thus obtained (step III), - Replaced then in at least one expression vector of the pBS50 family the box of the target gene by an alternative gene box, clones with the recombinant vectors obtained by means of a phenotypic screening for thermoinducibility of the expression of the respective alternative structural gene checked by multiplication in a bacterial recipient the required amounts DNA of the pBS70 or pBS80 family of expression vectors obtained in this way (step IV). 2. The method according to claim 1, characterized in that in step I, the target DNA with the Pn promoter region and the cl857 gene from the native E. coli phage lambda, from a recombinant phage or from a recombinant plasmid vector
provides. 3. The method according to claim 2, characterized in that a target DNA o. G. Provides texture from a recombinant DNA phage. 4. The method according to claim 3, characterized in that a target DNA o. G. Provides texture from a recombinant E. coli phage of the M 13 family. 5. The method according to claim 4, characterized in that the target DNA o. G. From the recombinant phage M13 tg 130 (Pr el857 AIFNβ) Pstl. 6. The method according to claim 1 to 5, characterized in that one inserts into the target DNA, a DNA segment having a hexanucleotide recognition sequence for a restriction enzyme. 7. The method according to claim 6, characterized in that one inserts into the target DNA, a DNA segment which the recognition sequence for one of the following restriction enzymes BamHI, BgIII or Sail
having. 8. The method according to claim 1 to 7, characterized in that one takes in step Il, the mutagenized partial sequence as Pstl-Pstl restriction fragment from a mutagenized recombinant Л / ИЗ phage. 9. The method according to claim 5 and 8, characterized in that the mutagenized partial sequence as 1794bp-Pstl-Pstl fragment from the mutagenized recombinant phage M13 tg 130 (P _R BamHI el857 AIFNß) takes Pstl. 10. The method according to claim 1 to 9, characterized in that one provides in step II for the uptake of the mutagenized partial sequence, a promoter Suchplasmid with an indicator gene. 11. The method according to claim 10, characterized in that one provides for the uptake of the mutagenized partial sequence, a promoter search plasmid with a unique PstI site in front of the indicator gene. 12. The method according to claim 1, characterized in that one provides for the uptake of the mutagenized partial sequence, a promoter search plasmid with a unique PstI site in front of a promoterless alpha-amylase gene (short word: amy). 13. The method according to claim 12, characterized in that is provided for the uptake of the mutagenized partial sequence, the promoter search plasmid pKB8 with promoterless amyF gene from Bacillus amyloliquefaciens. 14. The method according to claim 1,6,8 and 10, characterized in that in step III in at least one replicating in grampositive bacterial hosts pBS intermediate plasmid using the inserted site for a restriction enzyme with a hexanucleotide recognition sequence, a DNA fragment with inserted into gram-positive bacterial hosts functional native expression signals of a bacterial gene. 15. The method according to claim 1,6,8 and 10, characterized in that in step III in at least one replicating in Gram positive bacterial hosts pBS intermediate plasmid using the inserted site for a restriction enzyme with a hexanucleotide recognition sequence, a DNA fragment with inserted into gram-positive bacterial hosts functional native expression signals of a gene of a bacteriophage. 16. The method according to claim 15, characterized in that in step III in at least one pBS-Zwischenplasmid using the inserted site for a restriction enzyme with a hexanucleotide recognition sequence, a DNA fragment with functional expression in gram-positive bacterial hosts native expression signals of a gene of Staphylococcus aureus phages are inserted. 17. The method according to claim 16, characterized in that in step III in at least one pBS-Zwischenplasmid using the inserted site for a restriction enzyme with a hexanucleotide recognition sequence in a DNA fragment with the native in gram-positive bacterial hosts native expression signals of the staphylokinase gene S. aureus phage 42 D (short name: SAK-EE or EE) inserted. 18. The method according to claim 17, characterized in that in step III inserted into at least one pBS intermediate plasmid using the inserted site for a restriction enzyme with a hexanucleotide recognition sequence taken from a recombinant carrier plasmid SAK EE. Method according to claim 18, characterized in that in step III, in at least one intermediate pBS plasmid, using the inserted restriction enzyme site with a hexanucleotide recognition sequence, the SAK EE taken from a pBB series recombinant E. Coli carrier plasmid inserted. 20. The method according to claim 1,7,13,15,17 and 19, characterized in that in step III the intermediate plasmid pBS 10 (molecular size 8.4kb) using the inserted BamHI site with the 3154bp BamHI-linearized E. coli plasmid pBB209 to the ЕЕ-сІ / Рв-amyF) shuttle vector pBS52 (molecular size 11.4 kb) merged. - Checked this vector clones using a phenotypic screening for thermoinducibility of the expression of the amylase gene and this vector cloned in a Bacillus subtilis recipient. 21. The method according to claim 1 to 12 and 14 to 19, characterized in that substituted in step IV in at least one expression vector of the pBS50 family, the amy gene box by an alternative gene box for an intracellular protein. 22. The method according to claim 21, characterized in that in step IV in at least one expression vector of the pBS50 family substituting the amy gene box by an alternative gene box for an intracellular prokaryotic protein. 23. The method according to claim 1 to 12 and 14 to 19, characterized in that substituted in step IV in at least one expression vector of the pBS50 family, the amy gene box by an alternative gene box for a secretory protein. 24. The method according to claim 23, characterized in that substituted in step IV in at least one expression vector of the pBS50 family, the amy gene box by an alternative gene box for a secretory protein of a microorganism. 25. The method according to claim 24, characterized in that in step IV in at least one expression vector of the pBS50 family substituting the amy gene box by an alternative, from the DNA of a bacterium or a bacteriophage isolated gene box for a secretory protein. 26. The method according to claim 1, 20 and 24, characterized in that in step IV in an expression vector pBS52 the amvF gene box substituted by the sak42 D gene box. 27. The method according to claim 26, characterized in that one provides for the substitution in step IV, the sak24D gene box on a recombinant E. coli carrier plasmid. 28. Method according to claim 27, characterized in that, for the substitution in step IV, the sak42 D gene box is provided on an E. coli carrier plasmid of the pBB series. 29. The method according to claim 28, characterized in that one provides for the substitution in step IV, the sak42 D gene box on the carrier plasmid рВВЗОІ (molecular size 4077 bp). 30. The method according to claim 1 and 20 to 28, characterized in that in the initiation of step IV - isolated from the shuttle vector pBS52 a 4.9kb Pstl-Pstl-DNA fragment and - The resulting after circularization of this DNA, the P _n promoter without amyF gene containing intermediate plasmid pBS60 (molecular size 4.9kb, MLS resistance determinant) in a gram positive recipient cloned. 31. The method according to claim 30, characterized in that one clones the intermediate plasmid pBS60 in a Bacillus subtilis recipient. 32. The method according to claim 29,30 and 31, characterized in that one linearized both the carrier plasmid pBB301 and the intermediate plasmid pBS60 in their respective unique PstI cleavage site, both DNA sections are fused to the (P _R -sak) shuttle vector pBS70 (molecular size 8.9 kb) and this vector is cloned in a Bacillus subtilis recipient. 33. The method according to claim 29,30 and 31, characterized in that one the PstI-ionized pBB301 DNA with the 4.9 kb PstI-PstI DNA fragment from the vector pBS52 is fused directly to the (P _R -sak) shuttle vector pBS70 (molecular size 8.9 kb) and - This vector is cloned in a Bacillus subtilis recipient. 34. The method according to claim 20,32 or 33, characterized in that one - the fragment EcoRI-EcoRI fragment taken from the vector pBS70 as a 1.8 kb fragment (P _R -sak) -DNA block fused to the 8,9 kb EcoRI-EcoRI main fragment of the shuttle vector pBS 52, - The thereby obtained (EE-cl857 / P _R -sak) shuttle vectors pBS71 and pBS72 (molecule size 10.8kb each), which differ from each other by the orientation of the (P _R -sak) block, using a phenotypic Screenings for thermoinducibility of expression of the staphylokinase gene and both vectors cloned in a Bacillus subtilis recipient. 35. The method according to claim 20,32 or 33, characterized in that one - taken from the vector pBS52 as 2.6kb Pvull-Pvull fragment (EE-cI857) -DNS block fused with the EcoRV-linearized pBS70-DNA. - The obtained here (P _R -sak / EE-cl857) shuttle vectors pBS80 and pBS81 (molecule size 11.5kb each), which differ from each other by the orientation of the (EE-cl857) block, using a phenotypic screening checked for thermoinducibility of the expression of the staphylokinase gene and cloned both vectors in a Bacillus subtilis recipient. 36. The method according to claim 1, 20, 34 and 35, characterized in that one uses a microorganism strain of the genus Bacillus for the phenotypic screening for thermoinducibility of the expression of the target gene contained in the respective pBS expression vector. 37. The method according to claim 36, characterized in that one uses a microorganism strain of the species Bacillus subtilis for the phenotypic screening for thermoinducibility expression of the target gene contained in the respective pBS expression vector. 38. The method according to claim 1, 20 and 37, characterized in that for screening for thermoinducibility of the expression of the amylase gene in each case one of the two strains indicated below B. subtilis 21 amy4 recE4
B. subtilis 168 amy4 Ieu8 metB5
starts. 39. The method according to claim 1, 34, 35 and 37, characterized in that, for the screening for thermoinducibility of the expression of the staphylokinase 42 D gene, one of the following two strains is used B. subtilis DB104 or
B. subtilis GB 500
starts. 40. The method according to claim 1,20 and 38, characterized in that the phenotypic screening for thermoinducibility of the expression of the amylase gene on the recombinant host strains B. subtilis 21 amy4 recE4 (pBS52) or
B. subtilis 168 amy4 leu8 metB5 (pBS52)
applies. 41. The method according to claim 1, 34, 35 and 39, characterized in that the phenotypic screening for thermoinducibility of the expression of the staphylokinase 42 D gene on the recombinant host strains B. subtilis DB 104 (pBS71),
B. subtilis DB 104 (pBS 72),
B. subtilis DB 104 (ρ BS 80),
B. subtilis DB 104 (pBS81),
B. subtilis GB 500 (pBS71),
B. subtilis GB 500 (pBS 72),
B. subtilis GB500 (pBS80) or
B. subtilis GB 500 (pBS81)
applies. 42. The method according to claim 1 and 36 to 41, characterized in that in the phenotypic screening and / or in the expression of each target gene to be expressed by culturing the used, transformed with a pBS shuttle expression vector Gram-positive bacterial host strain at the beginning of the main culture performs a thermo-induction step. 43. The method according to claim 1 and 36 to 41, characterized in that in the phenotypic screening and / or in the expression of each target gene to be expressed by culturing the used, transformed with a pBS shuttle expression vector Gram-positive bacterial host strain in the early growth phase the main culture performs a thermo-induction step. 44. The method according to claim 42 or 43, characterized in that one realizes the thermo-induction step by a running within 3 minutes increasing the cultivation temperature of 28 ° C to 30 ⁰ C to 37 ° C to 42 ° C. For this 6 pages drawings