DD232510A1 - METHOD FOR PRODUCING LAMBDA BLV RECOMBINANT CLONES - Google Patents
METHOD FOR PRODUCING LAMBDA BLV RECOMBINANT CLONES Download PDFInfo
- Publication number
- DD232510A1 DD232510A1 DD27046384A DD27046384A DD232510A1 DD 232510 A1 DD232510 A1 DD 232510A1 DD 27046384 A DD27046384 A DD 27046384A DD 27046384 A DD27046384 A DD 27046384A DD 232510 A1 DD232510 A1 DD 232510A1
- Authority
- DD
- German Democratic Republic
- Prior art keywords
- blv
- dna
- leu
- pro
- lambda
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Anwendungsgebiet der Erfindung ist die Veterinaermedizin, speziell die Diagnose und die Immunprophylaxe der enzootischen Rinderleukose. Die Erfindung hat das Ziel, eine biotechnologische Herstellung von BLV-Proteinen zu ermoeglichen, die dann als Antigene fuer die Diagnostik und Immunprophylaxe der enzootischen Rinderleukose verwendet werden koennen. Aus permanent BLV-infizierten foetalen Lammnierenzellen wurde die DNA, die im Genom drei BLV-Proviren enthaelt, isoliert und mit der Restriktionsendonuklease EcoRI fragmentiert. Die BLV-DNA-haltigen Fragmente wurden elektrophoretisch angereichert und in die DNA des lambda-Spi-Selektionsvektors 2558 eingefuegt. Nach in vitro-Verpackung wurden die Rekombinantenphagen auf dem Selektionswirt E. coli Q359 ausplattiert. Mittels Filterhybridisierung konnten aus 500 000 Rekombinanten-Klonen vier BLV-DNA-haltige Phagenklone isoliert werden. Mit dem erfindungsgemaessen Verfahren werden BLV-DNA-Klone enthalten, die ca. 90% des BLV-Provirus und zusaetzlich 5-flankierende zellulaere Sequenzen enthalten. Diese flankierenden zellulaeren Sequenzen haben regulative Eigenschaften, die fuer eine Expression von BLV-Polypeptiden mit hoher Ausbeute notwendig sind.The field of application of the invention is veterinary medicine, especially the diagnosis and immunoprophylaxis of enzootic bovine leucosis. The aim of the invention is to enable biotechnological production of BLV proteins, which can then be used as antigens for the diagnosis and immunoprophylaxis of enzootic bovine leucosis. From permanently BLV-infected fetal lamb kidney cells, the DNA, which contains three BLV proviruses in the genome, was isolated and fragmented with the restriction endonuclease EcoRI. The BLV DNA-containing fragments were electrophoretically enriched and inserted into the DNA of the lambda Spi selection vector 2558. After in vitro packaging, the recombinant phage were plated on the selection host E. coli Q359. By means of filter hybridization, four BLV-DNA-containing phage clones could be isolated from 500,000 recombinant clones. The inventive method will contain BLV DNA clones containing about 90% of the BLV provirus and additionally 5-flanking cellulase sequences. These flanking cellular sequences have regulatory properties necessary for high yielding expression of BLV polypeptides.
Description
Abb. 1 b FGB-10-4-3' von 1 bis 226 : Teilsequenz gp30Fig. 1 b FGB-10-4-3 'from 1 to 226: partial sequence gp30
AATTGG GAT CTG GGG CTC ACT GCC TGG CTG CGA GAA ACC ATT CATTCT Asn-Trp-Asp-Leu-Gly-Leu-Thr-Als-Trp-Val-Ars-Glu-Thr-Ile-His-Ser-GTTCTAAGCCTGTTCCTATTAGCCCTTTTTTTGCTCTTCCTGGCCCCC Val-Leu-Ser-Leu-Phe-Leu-Leu-Als-Leu-Phe-Leu-Leu-Phe-Leu-Als-Pro-AATTGG GAT CTG GGG CTC ACT GCC TGG CTG CGA GAA ACC ATT CATTCT Asn-Trp-Asp-Leu-Gly-Leu-Thr-As-Trp-Val-Ars-Glu-Thr-Ile-His-Ser-GTTCTAAGCCTGTTCCTATTAGCCCTTTTTTGCTCTTCCTGGCCCCC Val-Leu -Ser-Leu-Phe-Leu-Leu-Als-Leu-Phe-Leu-Leu-Phe-Leu-As-pro-
TGC CTG ATA AAA TGC TTG ACC TCT CGC CTTTTA AAG CTC CTC CGG CAG Cys-Leu-Ile-Lys-Cys-Leu-Thr-Ser-Ars-Leu-Leu-Lys-Leu-Leu-Ars-Gln-TGC CTG ATA AAA TGC TTG ACC TCT CGC CTTTTA AAG CTC CTC CGG CAG Cys-Leu-Ile-Lys-Cys-Leu-Thr-Ser-Ars-Leu-Leu-Lys-Leu-Leu-Ars-Gln-
GCTCCCCACTTCCCTGAAATCTCCTTAACTCCTAAACCCGATTCTGAT Ala-Pro- H is-Phe-Pro-G Iu-I le-Ser- Leu -Th r-Pro-Ly s-Pro-Asp-Ser-Asp-GCTCCCCACTTCCCTGAAATCTCCTTAACTCCTAAACCCGATTCTGAT Ala-ProHis-Phe-Pro-G Iu-I le-Ser-Leu-Th r-Pro-Ly s-Pro-Asp-Ser-Asp
TAT CAG GCC TGG CTA CCA TCT GCA CCA GAG ATC Tyr-Gln-Ala-Leu-Leu-Pro-Ser-Ala-Pro-Glu-Ile-TAT CAG GCC TGG CTA CCA TCT GCA CCA GAG ATC Tyr-Gln-Ala-Leu-Leu-Pro-Ser-Ala-Pro-Glu-Ile-
Hierzu 1 Seite ZeichnungFor this 1 page drawing
Anwendungsgebiet der Erfindung ist die Veterinärmedizin, speziell die Diagnose und die Immunprophylaxe der enzootischen Rinderleukose.The field of application of the invention is veterinary medicine, especially the diagnosis and immunoprophylaxis of enzootic bovine leucosis.
Für die bereits durchgeführten molekularen Klonierungen von DNA des bovinen Leukämievirus (BLV) beschriften die einzelnen Autoren prinzipiell verschiedene Wege.For the already performed molecular cloning of bovine leukemia virus (BLV) DNA, the individual authors principally label different routes.
1. Liebscher et al. (WP 153893) klonierten c-DNA, die durch Umschreibung von viraler RNA mittels reverser Transkriptase erhalten worden war, sowie nichtintegrierte BLV-DNA im Plasmid pBR 322.1. Liebscher et al. (WP 153893) cloned c-DNA obtained by transcription of viral RNA by reverse transcriptase and unintegrated BLV DNA in plasmid pBR 322.
Sie isolierten Klone, deren BLV-DNA-Inserte max. eine Größe von 1400 Bp aufwiesen.They isolated clones whose BLV DNA inserts were max. had a size of 1400 bp.
In dem erwähnten Patent wird weiterhin vermutet, aber nicht experimentell belegt, daß die in zellulärer DNA integrierte BLV-DNA herausgeschnitten und ebenfalls zur Klonierung von BLV-Nukleotidsequenzen verwendet werden kann.The referenced patent further suggests, but not experimentally, that the BLV DNA integrated into cellular DNA can be excised and also used to clone BLV nucleotide sequences.
2. Deschamps et al. (J.Virol. 40,605 [1981]) und Sagata et al. (Gene 26,1 [1983]) setzten für die Klonierung integrierte BLV-DNA ein, die aus BLV-induzierten Tumoren isoliert worden war. Das Provirus konnte in einem lambda-Vektorfast komplett kloniert werden. Es wurde jedoch gezeigt, daß aus Tumor-DNA isolierte Proviren zahlreiche Punktmutationen und auch Deletionen aufweisen, diese DNA-Sequenzen also nicht mehr denen des infektiösen Virus entsprechen.2. Deschamps et al. (J. Virol 40, 605 [1981]) and Sagata et al. (Gene 26, 1 [1983]) used BLV DNA integrated into the cloning that had been isolated from BLV-induced tumors. The provirus could be almost completely cloned in a lambda vector. However, it has been shown that proviruses isolated from tumor DNA have numerous point mutations and also deletions, so that these DNA sequences no longer correspond to those of the infectious virus.
3. Kashmiri et al. (J.Virol. 49,583 [1984]) gelang es, aus BLVnnfizierten Fledermaus-Lungenzellen nichtintegrierte provirale BLV-DNA zu isolieren und in einem lambda-Vektor zu klonieren.3. Kashmiri et al. (Virol J., 49, 583 [1984]) succeeded in isolating non-integrated proviral BLV DNA from BLVnfected bat lung cells and cloning it in a lambda vector.
Dieser BLV-DNA-Klon ist der erste, der die komplette und unveränderte BLV-Sequenz enthält.This BLV DNA clone is the first to contain the complete and unaltered BLV sequence.
Um die BLV-Sequenzen jedoch für eine biotechnologische Proteinherstellung einsetzen zu können, ist es nötig, sie in sog.However, in order to use the BLV sequences for biotechnological protein production, it is necessary to use them in so-called.
Expressionsvektoren, die u.a. geeignete Regulationssequenzen enthalten müssen, einzufügen.Expression vectors, i.a. include appropriate regulatory sequences.
Die Erfindung hat das Ziel, eine biotechnologische Herstellung von BLV-Proteinen zu ermöglichen, die dann als Antigene für die Diagnostik und Immunprophylaxe der enzootischen Rinderleukose verwendet werden können.The aim of the invention is to enable biotechnological production of BLV proteins, which can then be used as antigens for the diagnosis and immunoprophylaxis of enzootic bovine leucosis.
Der Erfindung liegt die Aufgabe zugrunde, einen BLV-DNA-Klon zu isolieren, der den größten Teil des BLV-Provirus sowie angrenzende zelluläre Regulationssequenzen enthält. Dieser BLV-DNA-Klon soll geeignet sein, nach Kopplung mit Vektoren, in pro-oder eukaryotischen Zellsystemen BLV-Polypeptide zu exprimieren.The invention has for its object to isolate a BLV DNA clone containing most of the BLV provirus and adjacent cellular regulatory sequences. This BLV DNA clone should be capable of expressing, after coupling with vectors, in pro- or eukaryotic cell systems BLV polypeptides.
Das erfindungsgemäße Verfahren zur Herstellung von lambda-BLV-Rekombinanten zeichnet sich dadurch aus, daß man aus kultivierten fötalen Lammnierenzellen (FLK, fetal lamb kidney), die permanent mit dem bovinenLeukämiervirus infiziert sind und in ihrer zellulären DNA pro hapioidem Genom drei Proviren in integriertem Zustand enthalten, die Gesamt-DNA isoliert und mit der Restriktionsendonuklease Eco Rl fragmentiert, diese Fragmente elektrophoretisch auftrennt und die BLV-DNA enthaltende Fraktion gewinnt.The method of producing lambda BLV recombinants according to the present invention is characterized by comprising three proviruses in an integrated state from cultured fetal lamb kidney (FLK) permanently infected with the bovine leukemia virus and in its cellular DNA per hapioid genome containing the total DNA isolated and fragmented with the restriction endonuclease Eco Rl, these fragments are separated by electrophoresis and the fraction containing BLV DNA wins.
Dann wird DNA aus geeigneten lambda-Vektorphagen isoliert und ebenfalls mit Eco Rl gespalten. Anschließend werden beide Fraktionen gemischt und mit T4-Ligase ligiert, die entstandene Rekombinationen-DNA mit Verpackungsextrakten inkubiert, die dadurch gebildeten infektiösen Rekombinantenphagen auf einem geeigneten Bakterienrasen ausplattiert, auf dem Rasen entstehende Plaques mittels Filterhybridisation unter Verwendung einer radioaktiven BLV-Sonde auf Anwesenheit von BLV-DNA geprüft. Die positiven Klone werden selektiert, Ausplattierung und Filterhybridisation gegebenenfalls wiederholt. Eine besonders vorteilhafte Ausführungsform des Verfahrens besteht darin, die Phagen-DNA aus dem Spilambda-Selektionsvektor 2558 zu gewinnen und die Ausplattierung auf dem Wi rtE.coliQ359 durchzuführen. Da sich auf dem Wirt Q359 nur Spi-Vektor-Rekombinanten vermehren können, nicht aber der Vektor-Wildtyp, kann die sonst vor der Ligation der Insert-DNA mit dem Vektor nötige, sehr aufwendige Isolation der lambda-„Phagenarme" entfallen.Then DNA is isolated from suitable lambda vector phage and also cleaved with Eco RI. Subsequently, both fractions are mixed and ligated with T4 ligase, the resulting recombinant DNA incubated with packaging extracts, the infectious recombinant phage formed thereby plated on a suitable bacterial lawn, turf plaques produced by filter hybridization using a radioactive BLV probe for the presence of BLV DNA tested. The positive clones are selected, plating and filter hybridization optionally repeated. A particularly advantageous embodiment of the method is to recover the phage DNA from the spilambda selection vector 2558 and perform the plating on the WiRtE.coliQ359. Since only Spi vector recombinants can multiply on the host Q359, but not the vector wild type, the very complex isolation of the lambda "phage arms" that would otherwise be necessary before the ligation of the insert DNA with the vector can be dispensed with.
Mit dem erfindungsgemäßen Verfahren werden BLV-DNA-Klone erhalten, die ca. 90% des BLV-Provirus enthalten (vom 5'-Ende ausbiszumEcoRI-Schnittort), dazu noch flankierende zelluläre Sequenzen. Der BLV-Rekombinanten-Klon Nr. HU-1 hatfolgende Eigenschaften:BLV DNA clones containing about 90% of the BLV provirus (from the 5 'end to the Eco RI site) plus flanking cellular sequences are obtained by the method of the present invention. The BLV recombinant clone No. HU-1 has the following properties:
— eine spezifische BLV-Sequenz von 8,1 kb LängeA specific BLV sequence of 8.1 kb length
— am 5'-Ende zelluläre flankierende Sequenzen von mindestens 2,4 kb Länge undAt the 5 'end, cellular flanking sequences of at least 2.4 kb in length and
— Restriktionsorte für Sac I, Sal I, Bam H1,Xhol und Hind III.- Restriction sites for Sac I, Sal I, Bam H1, Xhol and Hind III.
Die inserte spezifische BLV-Sequenz enthält die in Abb. 1 a-1 c abgebildeten Sequenzen.The insert-specific BLV sequence contains the sequences depicted in Fig. 1 a-1 c.
Die flankierenden zellulären Sequenzen am 5'-Ende haben regulative Eigenschaften, die für eine Expression von BLV-Polypeptiden mit hoher Ausbeute notwendig sind.The flanking 5 'end cellular sequences have regulatory properties necessary for high yielding expression of BLV polypeptides.
Die Restriktionsorte des BLV-Rekombinanten-Klons HU-1 sind in Abb. 2 dargestellt.Restriction sites of the BLV recombinant clone HU-1 are shown in FIG.
Der lambda-Rekombinanten-Klon HU-1 kann, g. g.f. nach erneuter Fragmentierung und Reklonierung in geeignete Expressionsvektoren, Polypeptide exprimieren. Eine Fragmentierung ist insbesondere dann zweckmäßig, wenn nicht sämtliche vom BLV-DNA-Rekombinanten-Klon HU-1 kodierten Polypeptide hergestellt werden sollen, sondern nur ausgewählte Vertreter.The lambda recombinant clone HU-1 can, g. G. F. after re-fragmenting and recloning into suitable expression vectors, expressing polypeptides. Fragmentation is particularly useful if not all of the BLV-DNA recombinant clone HU-1 encoded polypeptides to be produced, but only selected representatives.
Diese Polypeptide sind als Antigene für die Diagnostik und Immunprophylaxe der enzootischen Rinderleukose einsetzbar.These polypeptides are useful as antigens for the diagnosis and immunoprophylaxis of enzootic bovine leucosis.
Der BLV-DNA-Rekombinanten-Klon HU-1 wurde in der ZIMET-Hinterlegungsstelle unter der Nr. ZIMET11 085 hinterlegt.The BLV DNA recombinant clone HU-1 was deposited in the ZIMET depository under the number ZIMET11 085.
Die Erfindung soll nachfolgend durch ein Beispiel näher erläutert werden.The invention will be explained in more detail by way of example.
Alle Methoden wurden, falls nicht anders erwähnt, so wie von Maniatis et al. (Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. [1982]) beschrieben, durchgeführt. Präparation hochmolekularer FLK-DNAAll methods were, unless otherwise stated, as described by Maniatis et al. (Molecular Cloning: a laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. [1982]). Preparation of high molecular weight FLK DNA
Aus einer permanent BLV-infizierten fötalen Lammnierenzellinie (FLK, von der Maaten-Zellinie), die pro hapioidem Genom drei BLV-Proviren enthält und kontinuierlich BLV produziert, wurde nach BHn und Stafford (Nucleic Acids Research 3,2303 [1976]) hochmolekulare DNA mit einer durchschnittlichen Kettenlänge von « 80-100 kb präpariert. Dazu wurden die FLK-Zellen mit Natriumdodecylsulfat lysiert, mit Proteinase K behandelt, dann mit Phenol und Phenol/Chloroform ausgeschüttelt, mit RNase inkubiert, nochmals mit Phenol und Phenol/Chloroform ausgeschüttelt und schließlich die DNA mit Äthanol gefällt. Aus 109FLK-Zellen wurden etwa 2,5 mg DNA erhaltenFrom a permanently BLV-infected fetal lamb kidney cell line (FLK, from the Maaten cell line) containing three BLV proviruses per hapioid genome and continuously producing BLV, high molecular weight DNA became BHn and Stafford (Nucleic Acids Research 3,2303 [1976]) Prepared with an average chain length of «80-100 kb. For this, the FLK cells were lysed with sodium dodecyl sulfate, treated with proteinase K, then shaken out with phenol and phenol / chloroform, incubated with RNase, shaken out again with phenol and phenol / chloroform and finally the DNA was precipitated with ethanol. From 10 9 FLK cells, about 2.5 mg of DNA were obtained
Southern-Hybridisationsanalyse: Southern hybridization analysis:
Die hochmolekulare FLK-DNA wur ie mit der Restriktionsendonuklease Eco Rl (Boehringer, Mannheim GmbH) vollständig gespalten. Mit einem Aliquot wurde eine Elektrophorese in 0,5 %igerAgarose durchgeführt. Anschließend erfolgte ein Southern-Transfer und eine Hybridisation mit 32P-BLV-DNA. BLV-DNA konnte im Bereich von ca. 8 bis 12 kb (3 Banden) nachgewiesen werden.The high molecular DNA FLK-WUR ie with the restriction endonuclease Eco RI (Boehringer, Mannheim GmbH) completely digested. An aliquot was electrophoresed in 0.5% agarose. This was followed by Southern transfer and hybridization with 32 P-BLV DNA. BLV DNA could be detected in the range of about 8 to 12 kb (3 bands).
Isolation der BLV-DNA-haltigen Eco Rl-FragmenteIsolation of the BLV DNA-containing Eco RI fragments
Mit der vollständig Eco Rl-gespaltenen FLK-DNA wurde eine präparative Elektrophorese in 0,5%iger niedrigschmelzender Agarose (Miles Labroatories, Stoke Poges) durchgeführt. Die Fraktion von 8 bis 12 kb wurde herausgeschnitten, bei 650C geschmolzen, mit Puffer verdünnt und die DNA-Fragmente mit Äthanol gefällt. Aus 110^g EcoRI-gespaltener DNA konnten 2^g BLV-DNA-haltige DNA-Fragmente isoliert werdenPreparative electrophoresis in 0.5% low melting agarose (Miles Labroatories, Stoke Poges) was performed on the fully Eco RI-digested FLK DNA. The 8-12 kb fraction was excised, melted at 65 ° C., diluted with buffer and the DNA fragments precipitated with ethanol. From 110 ^ g EcoRI-digested DNA 2 ^ g BLV DNA-containing DNA fragments were isolated
Vektor: Vector:
Für die KSonierung wurde der lambda-spiTSelektionsvektor 2 558 benutzt (von Kam und Brenner konstruiert, unpubliziert). Der Vektor wurde in E. coli Q 358 vermehrt (2.1O10 pfu/ml), gereinigt, die DNA isoliert und mit Eco Rl gespalten.For the KSonierung the lambda SPiTSelektionsvektor 2 558 was used (constructed by Kam and Brenner, unpubliziert). The vector was propagated in E. coli Q 358 (2.1O 10 pfu / ml), purified, the DNA isolated and digested with Eco RI.
-3- 704 63-3- 704 63
Ligation:Ligation:
Die BLV-DNA-haltigen Eco Rl-Fragmente wurden mit der Eco Rl-gespaltenen Vektor-DNA im Verhältnis 1:4 gemischt und mittels T4-DNA-Ligase (Boehringer, Mannheim GmbH) verknüpft.The BLV DNA-containing Eco RI fragments were mixed with the Eco RI-digested vector DNA in a ratio of 1: 4 and linked by means of T4 DNA ligase (Boehringer, Mannheim GmbH).
in vitro-„Verpackung"in vitro "packaging"
Mittels der in vitro-„Verpackungs"-Reaktion wird lambda-DNA mit Phagenhüllen versehen und es entstehen infektiöse Partikel.By means of the in vitro "packaging" reaction, lambda DNA is provided with phage sheaths and infectious particles are formed.
Das dazu nötige Frier- und Tau-Lysat wurde aus induzierten E.coli BHB2671-Zellen und das Ultraschall-Lysat aus induzierten E.coli BHB2673-Zellen präpariert. Die Verpackungsreaktion erfolgte in einem speziellen ATP-haltigen Puffer nach Zugabe der ligierten Vektor-DNA, des Frier- und Tau-Lysates und des Ultraschall-Lysates. Die entstandenen Rekombinantenphagen werden mittels einer Cäsiumchlorid-Gradientenzentrifugation gereinigt und konzentriert. Aus 1 μg ligierter Vektor-DNA werden etwa 5.The necessary freeze and thaw lysate was prepared from induced E. coli BHB2671 cells and the ultrasound lysate from induced E. coli BHB2673 cells. The packaging reaction was carried out in a special ATP-containing buffer after addition of the ligated vector DNA, the freeze and thaw lysate and the ultrasound lysate. The resulting recombinant phage are purified by cesium chloride gradient centrifugation and concentrated. From 1 μg of ligated vector DNA, about 5.
10svermehrungsfähige Rekombinantenphagen erhalten.10 s reproducible recombinant phage obtained.
Screening:screening:
Die Rekombinanten werden auf dem Selektionsstamm E.coli Q359 ausplattiert und die entstandenen Phagenplaques mittels Filterhybridisation getestet. Die Zellulosenitrat-Filter (SM 11306, Sartorius GmbH, Göttingen) werden in wäßriger Lösung für 15 Std. bei 650C mit32P-BLV-DNA hybridisiert (spez. Aktivität 1 · 108 cpm/jug DNA). Röntgenfilm (HS 11, ORWO Wolfen) wurde unter Verwendung von Intensivierungsfolie (Perlux Extra rapid, VEB Kalichemie Berlin) mit den Zellulosenitratfiltern drei bis fünf Tage bei -7O0C exponiert. Die durch Filmschwärzung lokalisierten BLV-positiven Phagenklone wurden durch wiederholtes ausplattieren und darauffolgender Filterhybridisation angereichert und gereinigt. Es wurden etwa 500000 Rekombinatenklone geprüft und vier BLV-positive Klone isoliert.The recombinants are plated out on the selection strain E. coli Q359 and the resulting phage plaques are tested by means of filter hybridization. The cellulose nitrate filters (SM 11306, Sartorius GmbH, Göttingen) are hybridized in aqueous solution for 15 hours at 65 0 C with 32 P-BLV DNA (specific activity 1 x 10 8 cpm / jug DNA). X-ray film (HS 11, ORWO Wolfen) was (Perlux extra rapid, VEB Berlin Kalichemie) using intensifying film with the nitrocellulose filters three to five days at -7O 0 C exposed. The film blackened BLV positive phage clones were enriched and purified by repeated plating and subsequent filter hybridization. Approximately 500,000 recombinant clones were tested and four BLV positive clones were isolated.
Restriktionsanalyse des lambda-BLV-Klons HU-1:Restriction analysis of the lambda BLV clone HU-1:
Einer der vier positiven Klone wurde in E.coli Q359 vermehrt, die DNA isoliert und eine Restriktionsanalyse durchgeführt.One of the four positive clones was propagated in E. coli Q359, the DNA isolated and a restriction analysis performed.
Die Spaltung mit Eco Rl zeigt, daß das klonierte Insert etwa 10,5 kb lang ist. Bei der Spaltung mit weiteren fünf Restriktionsendonukleasen (Sacl, Sail, Bam Hl, Xhol, Hind IM) entstanden die in Tab. 1 aufgelisteten Fragmente. Durch Vergleich mit den Daten der Restriktionsanalyse des Monierten nichtintegrierten BLV (Kashmiri et al., J. Virol. 43,583 (1984) ergibt sich, daß der Klon lamdba-BLV HU-1 8,1 kb (90%) des BLV-Provirus sowie 2,4 kb 5'-flankierende zelluläre Sequenzen enthält.Cleavage with Eco RI shows that the cloned insert is about 10.5 kb long. Upon cleavage with another five restriction endonucleases (Sacl, Sail, Bam HI, Xhol, Hind III), the fragments listed in Table 1 were generated. By comparison with the data of the restriction analysis of the cloned unintegrated BLV (Kashmiri et al., J. Virol. 43, 583 (1984), it is apparent that the clone lamdba BLV HU-1 contains 8.1 kb (90%) of the BLV provirus, as well 2.4 kb 5 'flanking cellular sequences.
Partielle Sequenzanalyse:Partial sequence analysis:
Von einem Teil des Klons HU-1 wurde die DNA-Sequenz bestimmt (Abb. 1 a-1 c).Part of clone HU-1 was used to determine the DNA sequence (Figure 1 a-1 c).
Claims (2)
Leu-Leu-Abb. 1cFXG-10-4-5'von 1 bis 291 : Teilsequenz x-RegionGGA TCC TTT TAT GTC AAT CAT CAG ATT TTA TTC CTG CAT CTT AAA CAA Gly-Ser-Phe-Tyr-Val-Asn-His-Gln-lle-Leu-Phe-Leu-His-teu-Lys-Gln-TCT CAT GGA ATT TTC ACT CTA ACC TGG GAG ATA TGG GGA TAT GAT CCC Cys His Gly Ile Phe Thr Leu Thr Trp Glu Ile Trp Gly Tyr Asp Pro CTG ATC ACC TTT TCT TTA CAT AAG ATC CCT GAT CCC GCT CAA CCC GAC Leu Ile-Thr-Phe-Ser-Leu-His-Lys-Ile-Pro-Asp-Pro-Pro-Gln-Pro-Asp-TTT CCC CAG TTG AAC AGT GAC TGG GTT CCC TCT GTC AGA TCA TGG GCC Phe-Pro Gln Leu Asn Ser Asp Trp Val Pro Ser Val Ars Ser Trp Als CTG CTT
Leu-Leu-fig. 1cFXG-10-4-5'from 1 to 291: partial sequence x region
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DD27046384A DD232510A1 (en) | 1984-12-07 | 1984-12-07 | METHOD FOR PRODUCING LAMBDA BLV RECOMBINANT CLONES |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DD27046384A DD232510A1 (en) | 1984-12-07 | 1984-12-07 | METHOD FOR PRODUCING LAMBDA BLV RECOMBINANT CLONES |
Publications (1)
Publication Number | Publication Date |
---|---|
DD232510A1 true DD232510A1 (en) | 1986-01-29 |
Family
ID=5563047
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DD27046384A DD232510A1 (en) | 1984-12-07 | 1984-12-07 | METHOD FOR PRODUCING LAMBDA BLV RECOMBINANT CLONES |
Country Status (1)
Country | Link |
---|---|
DD (1) | DD232510A1 (en) |
-
1984
- 1984-12-07 DD DD27046384A patent/DD232510A1/en not_active IP Right Cessation
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DE3588253T2 (en) | Recombinant proteins of viruses associated with lymphadenopathy syndrome and / or acquired immunodeficiency syndrome | |
US4601978A (en) | Mammalian metallothionein promoter system | |
DE3043981C2 (en) | ||
EP0099084A2 (en) | Process for the preparation of interferon and expression vehicles therefor | |
EP0886679B1 (en) | Parapoxviruses containing foreign dna, their production and their use in vaccines | |
EP0100521B1 (en) | Process for the production of a herpes antigen, appropriate means therefor and a process for its production, and the use of this antigen | |
EP1025253B1 (en) | Positive-negative selection for homologous recombination | |
EP0507179B1 (en) | Equine herpes viruses (EHV) containing foreign DNA, process for their preparation and their use as vaccines | |
Geisselsoder et al. | In vivo transcription patterns of temperate coliphage P2 | |
DE69936867T2 (en) | DNS SEQUENCE, METHOD FOR DETECTION AND MANUFACTURE AND USE | |
EP0564532B1 (en) | Polypeptides derived from proteins of the hepatitis c virus | |
EP0284791B1 (en) | DNA and RNA molecules of the western-subtype TBE virus, polypeptides coded by these molecules and their use | |
DD232510A1 (en) | METHOD FOR PRODUCING LAMBDA BLV RECOMBINANT CLONES | |
EP0354440A1 (en) | Human Papilloma virus type 57, its DNA and proteins encoded thereby | |
Tam et al. | Multiple cellular factors bind to cis-regulatory elements found inboard of the 5'palindrome of Minute Virus of Mice | |
DE3103714A1 (en) | Recombinant DNA method for the preparation of a protein similar to human interferon | |
DE3640550C2 (en) | ||
DE10055545A1 (en) | HPV 16-L1 and HPV 16-L2 encoding DNA sequences optimized for expression in eukaryotes | |
DE3331860C2 (en) | ||
DE60124984T2 (en) | METHOD FOR CHECKING THE QUALITY OF A WEAKENED VARICELLA PHASE VACCINE | |
EP0276730A2 (en) | Cassette vector system for the expression of open reading frames in eukaryotic cells | |
DE3203537C2 (en) | ||
DE3724482C2 (en) | Method for expanding the cell specificity of eukaryotic expression vectors | |
DE69531523T2 (en) | Expression vector with regulatory region of the ADP ribosylation factor | |
WO1999025837A2 (en) | Method for producing virus-like particles on the basis of polyoma viruses |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
ENJ | Ceased due to non-payment of renewal fee |