CZ20031154A3 - Agents interacting with potassium channel and their use - Google Patents

Abstract

The invention provides isolated nucleic acids molecules, designated PCIP nucleic acid molecules, which encode proteins that bind potassium channels and modulate potassium channel mediated activities. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing PCIP nucleic acid molecules, host cells into which the expression vectors have been introduced, and nonhuman transgenic animals in which a PCIP gene has been introduced or disrupted. The invention still further provides isolated PCIP proteins, fusion proteins, antigenic peptides and anti-PCIP antibodies. Diagnostic methods utilizing compositions of the invention are also provided.

Description

Mammalian cell membranes are important for the structural integrity and activity of many cells and tissues. Of particular importance for membrane physiology is the study of transmembrane ion channels that directly control various pharmacological, physiological and cellular processes. Many ion channels, including calcium, sodium and potassium channels, have been identified that have been investigated to determine their roles in vertebrate and insect cells.

Due to its involvement in the maintenance of normal cellular homeostasis, much attention is paid to potassium channels. Many of these potassium channels open in response to cell membrane potential changes. Many voltage-dependent potassium channels have been identified and their electrophysiological and pharmacological properties have been characterized. Potassium currents are more diverse than sodium and calcium currents and are involved in cell responses to external stimuli. The diversity of potassium channels and their important physiological role suggest their potential as targets for the development of therapeutic agents for the treatment of various diseases.

One of the best characterized classes of potassium channels is voltage-opened potassium channels. The prototype of this class is the protein encoded by the Shaker gene in Drosophila melanogaster. The Shal or Kv4 family proteins are a type of voltage-opened potassium channels that are responsible for the various natural A-type currents that have been observed with different cell types. Kv4 channels play a major role in repolarizing cardiac action potentials. In neurons, Kv4 channels and A currents play an important role in modulating the rate of activation, action potential, and controlling dendritic response to synaptic activation.

The basic function of neurons is to receive, conduct and transmit signals. Despite the different purposes of signals transmitted by different classes of neurons, the form of the signal is essentially the same and consists in changing the electrical potential along the plasma membrane of the neuron. The plasma membrane of a neuron contains voltage-opening cation channels that are responsible for propagating this electrical potential (also referred to as action potential or nerve impulse) across and along the plasma membrane.

The Kv family of channels includes, but is not limited to: (1) delayed repolarization potassium channels that repolarize the membrane • · · 9 9 9

9,999,999 9 ··· · 9,999 9 9 9

9999999 99,999 9 9 • 9,999,999

9999 9 99 99 99 99 after each action potential for preparing the cell for further activation; and (2) rapid inactivation potassium channels (Atyp), which are primarily active at sub-threshold voltages and which reduce the rate at which excitable cells reach the activation threshold. In addition to being critical to the action potential, Kv channels also control the response to depolarizing, eg, synaptic, activation and have an effect on the release of neurotransmitters. As a result of these activities, potassium channels are voltage-opened by key regulators of neuron excitability (Hille B., Ionic Channels of Excitable Membranes, Second Edition, Sunderland, MA: Sinauer, (1992)).

Structural and functional diversity is significant in the Kv family of potassium channels. This diversity is generated both by the existence of many genes and by alternative splicing of RNA transcripts of the same gene. However, the amino acid sequences of known Kv potassium channels show considerable similarity. All are composed of four α-subunits forming pore and some have four cytoplasmic (β subunit) polypeptides (Jan LY et al. (1990) Trends Neurosci 13: 415-419, and Pongs, O. et al. (1995) Sem Neurosci. 7: 137-146. The known Kv channel (α-subunits fall into four subfamilies labeled according to their homology with the channels first isolated from Drosophila: Kv1, or Shaker-related subfamily; Kv2, or Shah-related subfamily; Kv3, or Shaw related subfamily; and Kv4, or Shal- related subfamily.

Kv4.2 and Kv4.3 are examples of the Kv channel (α-subunits of the Shal-related subfamily). Kv4.3 has a unique neuroanatomic distribution in that its mRNA is highly expressed in monoaminergic brain stem and cholinergic forebrain neurons where it is involved in the release of dopamine, norepinephrine, serotonin, and acetylcholine neurotransmitters.

This channel is also highly expressed in cortical pyramidal cells and interneurons. (Serdio P et al. (1996) J. Neurophys 75: 2174-2179). Interestingly, the Kv4.3 polypeptide is highly expressed in neurons that express the respective mRNA. The Kv4.3 polypeptide is expressed in the somatodendritic membranes of these cells, where it is believed to contribute to the rapid inactivation of K + conductivity.

Kv4.2 mRNA is widely expressed in the brain, and the relevant polypeptide also appears to be concentrated in somatodendritic membranes where it contributes to rapid inactivation of K ⁺ conductivity (Sheng et al. (1992) Neuron 9: 271-84). These A-type somatodendritic Kv channels, as well as Kv4.2 and Kv4.3, are likely to be involved in learning and memory-based processes such as the integration of subliminal synaptic responses and the guidance of back-propagating action potentials (Hoffman DA et al. (1997) Nature 387: 869-875).

Thus, proteins that interact with and modulate the activity of potassium channel proteins, e.g., potassium channels having a Kv4.2 or Kv4.3 subunit, are novel molecular targets for modulating neuronal or cardiac excitability, e.g., action potential conduction, somatodendritic excitability, and neurotransmitter release, in cells expressing these channels. Further, the detection of genetic lesions in the gene encoding these proteins can be used to diagnose and treat diseases of the central nervous system such as epilepsy, spinocerebellar ataxia, anxiety, depression, age-related memory loss, migraine, obesity, Parkinson's disease or Alzheimer's disease; or cardiovascular diseases, such as heart failure, hypertension, atrial fibrillation, dilated cardiomyopathy, • 9 9 9 9

9 · 9 9 · 999 999 ••••• 99 99 999 9 9 • 9 9999 9999 • 99 9 9 99 99 99 99 idiopathic cardiomyopathy or angina pectoris.

SUMMARY OF THE INVENTION

The present invention is based, at least in part, on the discovery of novel nucleic acid molecules that encode gene products that interact with potassium channel proteins or that have significant homology to the gene products of the present invention that interact with potassium channel proteins (paralogs). Potassium channel proteins are, for example, potassium channels containing the Kv4.2 or Kv4.3 subunit. The nucleic acid molecules of the present invention and their gene products are referred to herein as potassium channel interacting proteins, PCIP, or KChIP nucleic acids and proteins. The PCIP proteins of the present invention interact with, e.g., bind to a potassium channel protein, modulate potassium channel protein activity, and / or modulate potassium channel activity in cells, eg, neurons or cardiomyocytes. The PCIP molecules of the present invention are useful as modulating agents for regulating various cellular processes, e.g., processes occurring in neurons or cardiac cells. Therefore, in one aspect, the invention provides an isolated nucleic acid molecule encoding PCIP proteins or biologically active portions thereof, as well as nucleic acid fragments useful as primers or hybridization probes for detecting PCIP-encoding nucleic acids.

In one embodiment, the PCIP nucleic acid molecule of the present invention is at least 50%, 55%, 60%, 65%,

70%, 75%, 80%, 85%, 90%, 95%, 98% or more identical to the nucleotide sequence (eg, full-length nucleotide

SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ

SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO

0 0 0 0 0 0 0 0 0 0 0 0 0

NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID

NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, or with its complementary sequence.

In another preferred embodiment, the isolated nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ.

ID NO: 11, SEQ ID NOi 13, SEQ ID NOr 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 4 6 SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 7 4 SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or

SEQ ID NO: 102, or a sequence complementary to that sequence.

In another preferred embodiment, the nucleic acid molecule comprises a fragment of at least 300, 350, 400, 426, 471, or 583 nucleotides of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ.

7 4 «4 « 4 4 «« »4 4 4 4 4 4 444 4 14 4 4 4 4 4 4 4 4 «« 3 4 4 4 444 44 4444 4 4 4 • 4 · 4 4 4 4 4 4 · 4 · 44 4 4 4 · 44 * 4 · 4 4 ID NO :! 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96,

SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or sequences complementary to said sequences.

In another embodiment, the PCIP nucleic acid molecule comprises a nucleotide sequence encoding a protein having an amino acid sequence sufficiently identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14,

SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103 i, or SEQ ID

NO: 109, or with the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994. In a preferred embodiment, the PCIP nucleic acid molecule comprises a nucleotide sequence encoding a protein having an amino acid sequence of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% , 95% or more identical to

99 9 amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14,

SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 7 8 SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103, or SEQ ID

NO: 109, or with the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994.

In another preferred embodiment, the isolated nucleic acid molecule encodes the amino acid sequence of 1v, 9q, p19, W28559, KChIP4a, KChIP4b, 33b07, 1p, and rat 7s protein. In yet another preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14,

SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 7 6 SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 8 9 SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103 or SEQ ID

NO: 109, or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession number 98936, · * · y »·

98942, 98943, 98944, 98945, 98951, 98991, 98993 or ·· · 44 · ·

98937, 98938, 98939, 98940, 98941,

98946, 98947, 98948, 98949, 98950,

In yet another preferred embodiment, the nucleic acid molecule is at least 426, 471, or 583 nucleotides in length and encodes a protein with PCIP activity (as described herein).

Another embodiment of the present invention relates to nucleic acid molecules, preferably PCIP nucleic acid molecules, which specifically detect PCIP nucleic acid molecules related to nucleic acid molecules encoding non-PCIP proteins. For example, in one embodiment, such nucleic acid molecules are at least 426, 400-450, 471, 450-500, 500-550, 583, 550-600, 600-650, 650-700, 700-750, 750-800 or more nucleotides long and hybridize under stringent conditions to nucleic acid molecules containing nucleotide sequences

shown in SEQ ID NO: 1, SEQ ID NO: 3 SEQ ID NO: 5, SEQ ID ' NO: 7 r SEQ ID NO: 9, i SEQ ID ' NO: 11, SEQ ID NO: 13, SEQ ID ' NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 2 9 SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID

NO: 100, or SEQ ID NO: 102, the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession number 98936,

98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, or sequences complementary to said sequences. In preferred embodiments, the nucleic acid molecules are at least 15 (e.g., contiguous) nucleotides long and hybridize under stringent conditions to nucleotides 93-126, 360-462, 732-825. · · · · · · · · · · · ·

W * ·································

1028-1054 or 1517-1534 of SEQ ID NO: 7. In another preferred embodiment, the nucleic acid molecules comprise nucleotides 93126, 360-462, 732-825, 1028-1054, or 1517-1534 of SEQ ID NO: 7.

In other preferred embodiments, the nucleic acid molecules are at least 15 (e.g., contiguous) nucleotides in length and hybridize under stringent conditions to nucleotides 1-14, 49-116, 137-311, 345-410, 430-482, 503-518, 662- 693, 1406-1421, 14411457, 1478-1494, or 1882-1959 of SEQ ID NO: 13. In another preferred embodiment, the nucleic acid molecules comprise nucleotides 1-14, 49-116, 137-311, 345-410, 430-482, 503-518, 662-693, 14061421, 1441-1457, 1478-1494, or 1882- 1959 SEQ ID NO: 13.

In preferred embodiments, the nucleic acid molecules are at least 15 (e.g., contiguous) nucleotides in length and hybridize under stringent conditions to nucleotides 932-1527, 1548-1765, 17861871, 1908-2091, 2259-2265, or 2630-2654 of SEQ ID NO: 35. In another preferred embodiment, the nucleic acid molecules comprise nucleotides 932-1527, 1548-1765, 1786-1871, 1908-2091, 22592265, or 2630-2654 of SEQ ID NO: 35.

In another preferred embodiment, the nucleic acid molecule encodes a naturally occurring allelic variant of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO.

NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ

999 ·

ID NO: 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17,

SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 8 0 SEQ ID NO: 82, SEQ ID NO: 8 4 SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID

NO: 100, or SEQ ID NO: 102 under stringent conditions.

Another embodiment of the present invention provides an isolated nucleic acid molecule that is antisense to a PCIP nucleic acid molecule, eg, a coding strand of a PCIP nucleic acid molecule.

Another aspect of the present invention provides a vector comprising a PCIP nucleic acid molecule. In some embodiments, the vector is a recombinant expression vector. In another embodiment, the invention provides a host cell comprising a vector of the present invention. The invention also provides a method for producing a protein, preferably a PCIP protein, by culturing a host cell, eg, a mammalian host cell, such as a non-human mammalian cell, of the present invention comprising a recombinant expression vector, in a suitable medium to produce such a protein.

• IQ ································

14 / · · ········

Another aspect of the present invention relates to isolated or recombinant PCIP proteins and polypeptides. In one embodiment, the isolated protein, preferably the PCIP protein, comprises at least one calcium binding domain. In a preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and has an amino acid sequence of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more percent identical to amino acid sequence SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 ,

SEQ ID NO: 16 SEQ ID NO: 18, SEQ ID NO: 20 SEQ NO NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103 :, or SEQ ID

NO: 109, or with the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994. In another preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and modulates potassium channel mediated activities.

In yet another preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and is encoded by a nucleic acid molecule having a nucleotide sequence that hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO. SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO.

• · • • • · * • · · · • · • · ··· · • · · 13 • ···· · · • · · · • · · • · · • · · • · • · · · • · · · NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 2 3 SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 7 9 SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or i SEQ ID NO: 102.

In another embodiment, the invention relates to fragments of proteins having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO.

NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 7 8 SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103 i, or

SEQ ID NO: 109, wherein the fragment comprises at least 15 amino acids (e.g., contiguous amino acids) of the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 ,

SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID

NO: 101, SEQ ID NQ: 103, or SEQ ID NO: 109, or the amino acid sequences encoded by the DNA insert of the plasmid deposited with the ATCC under accession numbers 98936, 98937, 98938,

98939, 98948, 98940, 98949, 98941, 98950, 98942, 98951, 98943, 98991, 98944, 98993, 98946, 98946, 98947, or 98994. In another embodiment has protein, preferably PCIP protein, amino acid SEQ ID NO: 2 SEQ ID NO: 4 SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16; NO: 18, SEQ ID NO-.20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID SEQ ID NO: 51 SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID SEQ ID NO: 99, SEQ ID NO: 101 SEQ ID NO: 103 or SEQ ID NO: 109.

In another embodiment, the invention relates to an isolated protein, preferably a PCIP protein that is encoded by a nucleic acid molecule having a nucleotide sequence of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90 %, 95%, 98% or more percent identical to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO.

NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID

NO: 102, or a sequence complementary to said sequences.

· · · · · · · · · · · · · · · · · · · · · · · · ·

The proteins of the present invention, or biologically active portions thereof, can be operably linked to a nonPCIP polypeptide (eg, a heterologous amino acid sequence) to form fusion proteins. The invention further relates to antibodies, such as monoclonal or polyclonal antibodies, that specifically bind to the proteins of the present invention, preferably PCIP proteins. Further, PCIP proteins or biologically active portions thereof may be incorporated into pharmaceutical compositions that optimally contain pharmaceutically acceptable carriers.

In another aspect, the present invention provides a method for detecting the presence of a PCIP nucleic acid, protein or polypeptide in a biological sample by contacting the biological sample with an agent capable of detecting a PCIP nucleic acid molecule, protein or polypeptide to detect the presence of a PCIP molecule. a nucleic acid, protein or polypeptide in a biological sample.

In another aspect, the present invention provides a method for detecting the presence of PCIP activity in a biological sample by contacting the biological sample with an agent capable of detecting a PCIP activity indicator such that the presence of PCIP activity in the biological sample is detected.

In another aspect, the invention provides a method for modulating PCIP activity comprising contacting cells capable of expressing PCIP with an agent that modulates PCIP activity so as to modulate PCIP activity in the cells. In one embodiment, the agent inhibits PCIP activity. In another embodiment, the agent stimulates PCIP activity. In one embodiment, the agent is an antibody that specifically binds to a PCIP protein. In another embodiment, the agent modulates PCIP expression by modulating PCI expression by modulating PCIP expression by modulating PCIP expression by modulating PCIP expression by modulating PCIP expression by modulating PCIP expression. transcription of PCIP gene or translation of PCIP mRNA. In yet another embodiment, the agent is a nucleic acid molecule having a nucleotide sequence that is antisense to the coding strand of the PCIP mRNA or PCIP gene.

In one embodiment, the methods of the present invention are used to treat a subject with a disease characterized by aberrant expression or activity of a PCIP protein or nucleic acid by administering an agent that is a PCIP modulator to an individual. In one embodiment, the PCIP modulator is a PCIP protein. In another embodiment, the PCIP modulator is a PCIP nucleic acid molecule. In yet another embodiment, the PCIP modulator is a peptide, peptidomimetics, or other small molecule. In another preferred embodiment, the aberrant PCIP protein disease or aberrant nucleic acid expression is a CNS disease or a cardiovascular disease.

The present invention also provides a diagnostic test for identifying the presence or absence of a genetic alteration characterized by at least one of the following characteristics:

(i) aberrant modification or mutation of a gene encoding a PCIP? protein; (ii) misregulation of the gene; and (iii) aberrant post-translational modification of the PCIP protein, wherein the natural form of the gene encodes a protein with PCIP activity.

In another aspect, the invention provides a method for identifying compounds that bind to or modulate PCIP protein activity, said method comprising providing an indicator composition comprising a PCIP protein with PCIP activity, contacting the indicator composition with a test compound, and determining the effect of the test compound on PCIP activity in an indicator means to identify a compound that modulates the activity of the PCIP protein.

• ·· 9

• 9 9999

Π 9 9999 9 9 · · 9 9 · ·

9999 9 ·· ··

Other features and advantages of the present invention will be apparent from the following detailed description and the appended claims.

Description of the figures in the attached drawings

Giant. 1 depicts the cDNA sequence and predicted amino acid sequence of human lv. The nucleotide sequence corresponds to nucleic acids 1 to 1463 of SEQ ID NO: 1.

The amino acid sequence corresponds to amino acids 1 to 216 of SEQ ID NO: 2.

Giant. 2 depicts the cDNA sequence and predicted amino acid sequence of rat 1v. The nucleotide sequence corresponds to nucleic acids 1 to 1856 of SEQ ID NO: 3. The amino acid sequence corresponds to amino acids 1 to 245 of SEQ ID NO: 4.

Giant. 3 depicts the cDNA sequence and predicted amino acid sequence of murine lv. The nucleotide sequence corresponds to nucleic acids 1 to 1907 of SEQ ID NO: 5. The amino acid sequence corresponds to amino acids 1 to 216 of SEQ ID NO: 6.

Giant. 4 depicts the cDNA sequence and predicted amino acid sequence of rat lvi. The nucleotide sequence corresponds to nucleic acids 1 to 1534 of SEQ ID NO: 7.

The amino acid sequence corresponds to amino acids 1 to 227 of SEQ ID NO: 8.

Giant. 5 shows the cDNA sequence and predicted amino acid sequence of murine lions. Nucleotide sequence

4 4 43 4

4 4 * * 4 4 4 4 4

444444 4

4 4 4

4444

44 to 44 corresponds to nucleic acids 1 to 1540 of SEQ ID NO: 9.

The amino acid sequence corresponds to amino acids 1 to 227 of SEQ ID NO: 10.

Giant. 6 depicts the cDNA sequence and predicted amino acid sequence of a partial rat lvn.

The nucleotide sequence corresponds to nucleic acids 1 to 955 of SEQ ID NO: 11. The amino acid sequence corresponds to amino acids 1 to 203 of SEQ ID NO: 12. (complete rat lvn sequences are shown here in Fig. 63, see below).

Giant. 7 depicts the cDNA sequence and predicted amino acid sequence of human 9q1. The nucleotide sequence corresponds to nucleic acids 1 to 2009 of SEQ ID NO: 13.

The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 14.

Giant. 8 depicts the cDNA sequence and predicted amino acid sequence of rat 9q1. The nucleotide sequence corresponds to nucleic acids 1 to 1247 of SEQ ID NO: 15. The amino acid sequence corresponds to amino acids 1 to 257 of SEQ ID NO: 16.

Giant. 9 depicts the cDNA sequence and predicted amino acid sequence of murine 9q1. The nucleotide sequence corresponds to nucleic acids 1 to 2343 of SEQ ID NO: 17. The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 18.

Giant. 10 depicts the cDNA sequence and predicted amino acid sequence of human 9qm. The nucleotide sequence corresponds to nucleic acids 1 to 1955 of SEQ ID NO: 19.

The amino acid sequence corresponds to amino acids 1 to 252 of SEQ

· «··· ·

ID NO: 20.

Giant. 11 depicts the cDNA sequence and predicted amino acid sequence of rat 9qm. The nucleotide sequence corresponds to nucleic acids 1 to 2300 of SEQ ID NO: 21. The amino acid sequence corresponds to amino acids 1 to 252 of SEQ ID NO: 22.

Giant. 12 depicts the cDNA sequence and predicted amino acid sequence of human 9qs. The nucleotide sequence corresponds to nucleic acids 1 to 1859 of SEQ ID NO: 23.

The amino acid sequence corresponds to amino acids 1 to 220 of SEQ ID NO: 24.

Giant. 13 depicts the cDNA sequence and predicted amino acid sequence of simian 9qs. The nucleotide sequence corresponds to nucleic acids 1 to 2191 of SEQ ID NO: 25. The amino acid sequence corresponds to amino acids 1 to 220 of SEQ ID NO: 26.

Giant. 14 depicts the cDNA sequence and predicted amino acid sequence of rat 9qc. The nucleotide sequence corresponds to nucleic acids 1 to 2057 of SEQ ID NO: 27.

The amino acid sequence corresponds to amino acids 1 to 252 of SEQ ID NO: 28.

Giant. 15 depicts the cDNA sequence and predicted amino acid sequence of rat 8t. The nucleotide sequence corresponds to nucleic acids 1 to 1904 of SEQ ID NO: 29. The amino acid sequence corresponds to amino acids 1 to 225 of SEQ ID NO: 30.

Giant. 16 depicts the cDNA sequence and predicted amino acid sequence of human p19. The nucleotide sequence corresponds to nucleic acids 1 to 619 of SEQ ID NO: 31. The amino acid sequence corresponds to amino acids 1 to 200 of SEQ ID NO: 32.

Giant. 17 depicts the cDNA sequence and predicted amino acid sequence of rat p19. The nucleotide sequence corresponds to nucleic acids 1 to 442 of SEQ ID NO: 33.

The amino acid sequence corresponds to amino acids 1 to 109 of SEQ ID NO: 34.

Giant. 18 shows the cDNA sequence and predicted amino acid sequence of murine p19. The nucleotide sequence corresponds to nucleic acids 1 to 2644 of SEQ ID NO: 35. The amino acid sequence corresponds to amino acids 1 to 256 of SEQ ID NO: 36.

Giant. 19 depicts the cDNA sequence and predicted amino acid sequence of human W28559. The nucleotide sequence corresponds to nucleic acids 1 to 380 of SEQ ID NO: 37. The amino acid sequence corresponds to amino acids 1 to 126 of SEQ ID NO: 38.

Giant. 20 depicts the cDNA sequence and predicted amino acid sequence of human P193. The nucleotide sequence corresponds to nucleic acids 1 to 2176 of SEQ ID NO: 39.

The amino acid sequence corresponds to amino acids 1 to 41 of SEQ ID NO: 40.

Giant. 21 is a schematic representation of rat 1v, rat 9qm, and murine P19 protein, which are aligned to reveal conserved domains between these proteins.

· · · «· · · • * * * * * * * * * * * * * * * * * * * * · · · · 4 · ». 4 4« 4 4 «« 4 · 4 4 4 4 4 4 4 4 4

£ ί * · · · 4 4 4444 * ··· 4 44 44 44 44

Giant. 22 depicts the genomic DNA sequence of human 9q.

Giant. 22A depicts exon 1 and its adjacent intron sequence (SEQ ID NO: 46). Giant. 22B depicts exons 2-11 and adjacent sequences thereof (SEQ ID NO: 47).

Giant. 23 depicts the cDNA sequence and predicted amino acid sequence of simian KChIP4a. The nucleotide sequence corresponds to nucleic acids 1 to 2413 of SEQ ID NO: 48. The amino acid sequence corresponds to amino acids 1 to 233 of SEQ ID NO: 49.

Giant. 24 depicts the cDNA sequence and predicted amino acid sequence of simian KChIP4b. The nucleotide sequence corresponds to nucleic acids 1 to 1591 of SEQ ID NO: 50. The amino acid sequence corresponds to amino acids 1 to 233 of SEQ ID NO: 51.

Giant. 25 depicts the alignment of KChIP4a, KChIP4b, 9q1, 1v, p19, and the related human paralog (hsncspara) W28559. Amino acids identical to the conventional sequence are highlighted in black and conserved amino acids are highlighted in gray.

Giant. 26 depicts the cDNA sequence and predicted amino acid sequence of rat 33b07. The nucleotide sequence corresponds to nucleic acids 1 to 2051 of SEQ ID NO: 52.

The amino acid sequence corresponds to amino acids 1 to 407 of SEQ ID NO: 53.

Giant. 27 depicts the cDNA sequence and predicted amino acid sequence of human 33b07. The nucleotide sequence corresponds to nucleic acids 1 to 4148 of SEQ ID NO: 54. The amino acid sequence corresponds to amino acids 1 to 414 of SEQ ID NO: 55.

• 9 · předpoklád «předpoklád and predicted. Nucleotide sequence

Giant. 28 depicts the cDNA sequence of the rat 1p amino acid sequence corresponding to nucleic acids 1 to 2643 of SEQ ID NO: 56. The amino acid sequence corresponds to amino acids 1 to 267 of SEQ ID NO: 57.

Giant. 29 depicts the cDNA sequence and predicted amino acid sequence of rat 7s. The nucleotide sequence corresponds to nucleic acids 1 to 2929 of SEQ ID NO: 58. The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 59.

Giant. 30 depicts the rat 29x cDNA sequence and predicted amino acid sequence. The nucleotide sequence corresponds to nucleic acids 1 to 1489 of SEQ ID NO: 60. The amino acid sequence corresponds to amino acids 1 to 351 of SEQ ID NO: 61.

Giant. 31 depicts the rat 25r cDNA sequence.

The nucleotide sequence corresponds to nucleic acids 1 to 1194 of SEQ ID NO: 62.

Giant. 32 depicts the cDNA sequence and predicted amino acid sequence of rat 5p. The nucleotide sequence corresponds to nucleic acids 1 to 600 of SEQ ID NO: 63. The amino acid sequence corresponds to amino acids 1 to 95 of SEQ ID NO: 64.

Giant. 33 depicts the cDNA sequence and predicted amino acid sequence of rat 7q. The nucleotide sequence corresponds to nucleic acids 1 to 639 of SEQ ID NO: 65. The amino acid sequence corresponds to amino acids 1 to 212 of SEQ

4 · ···

• «« · »···

ID ΝΟ: 66.

Giant. 34 depicts the rat 19r cDNA sequence and predicted amino acid sequence. The nucleotide sequence corresponds to nucleic acids 1 to 816 of SEQ ID NO: 67.

The amino acid sequence corresponds to amino acids 1 to 271 of SEQ ID NO: 68.

Giant. 35 depicts the cDNA sequence and predicted amino acid sequence of monkey KChIP4c. The nucleotide sequence corresponds to nucleic acids 1 to 2263 of SEQ ID NO: 69. The amino acid sequence corresponds to amino acids 1 to 229 of SEQ ID NO: 70.

Giant. 36 depicts the cDNA sequence and predicted amino acid sequence of monkey KChIP4d. The nucleotide sequence corresponds to nucleic acids 1 to 2259 of SEQ ID NO: 71. The amino acid sequence corresponds to amino acids 1 to 250 of SEQ ID NO: 72.

Giant. 37 shows the alignment of KChIP4a, KChIP4b, KChIP4c and KChIP4d.

Giant. 38 is a graph depicting current records from CHO cells that express Kv4.2 with or without KChIP2 (9q1). Cells are connected to a -80 mV voltage and the voltage gradually changes from -60 mV to +50 mV over 200 ms. The maximum current amplitudes at the different voltages tested are shown in the right panel. Giant. 38 further depicts a table showing the amplitude of the kinetic effects of KChIP2 (9ql) on Kv4.2. KChIP2 expression alters maximum current amplitudes, inactivation constant and recovery time from inactivation, and V1 / 2 activation.

• ···

Giant. 39 is a graph depicting current records from CHO cells that express Kv4.2 with or without KchIP3 (p19). Cells are connected to a -80 mV voltage and the voltage gradually changes from -60 mV to +50 mV over 200 ms. The maximum current amplitudes at the different voltages tested are shown in the right panel. Giant. 39 further depicts a table showing the amplitude of KchIP3 (p19) kinetic effects on Kv4.2. KchIP3 expression alters the maximum current amplitudes, inactivation constant and recovery time from inactivation, and V1 / 2 activation.

Giant. 40 depicts results from electrophysiological experiments demonstrating that co-expression of KChIP1 dramatically alters current density and kinetics of Kv4.2 channels expressed in CHO cells.

Giant. 40A shows currents in Kv4.2 transfected CHO cells. Currents were evoked by sequential depolarization of cells from a -80 mV maintenance potential to -60 to 50 mV test potentials. The currents are read using the p / 5 protocol. The current axis is shown at the same magnification as in Fig. (B) to emphasize changes in current amplitudes. The input-one-shot current at 50mV shown on the extended current axis shows the kinetics of the activation and inactivation current.

Giant. 40B shows current records as in FIG. (A), but from cells transfected with the same amount of DNA for Kv4.2 and KChIP1.

Giant. 40C depicts peak current amplitude at all voltages in cells transfected with Kv4.2 alone (n = 11) or co-transfected with KChIP1 (n = 9).

Giant. 40D and 40E show recovery from inactivation using • · • ·· ·

two-pulse protocol. Kv4.2 alone (D) or co-expressed with KChIP1 (E) is brought to the inactivated state using a first pulse at 50 mV and then a second pulse at 50 mV is applied, at different times after the first pulse. The holding potential is -80 mV before and after all pulses.

Giant. 40F shows the sum of percent recovery of peak current between pulses for Kv4.2 (n = 8) and Kv4.2 plus KChIP1 (n = 5) transfected cells. The inactivation recovery time constant is adjusted for one exponential.

Giant. 41 depicts a comparison of human KChIP family members with closely related members of the recoverin family of Ca 2+ -sensitive proteins. (HIP: human hippocalcine; NCS1: rat neuronal calcium sensor 1). Comparison was performed using the MegAlign program for Macintosh (version 4.00 from DNASTAR) using the Clustal method with a PAM250 weight parameter residue table, and shading was performed using BOXSHADES. Residues identical to the conventional sequence are highlighted in black, conservative substitutions are highlighted in gray. X, Y, Z and -X, -Y, -Z designate the positions of the residues that are responsible for calcium ion binding in the EF arm.

Giant. 42 shows a physical map of the IOSCA region.

Giant. 43 depicts a binding map showing the location of h9q and known markers associated with IOSCA and epilepsy.

Giant. 44 depicts the cDNA sequence and predicted amino acid sequence of human lions (KChIP11).

The nucleotide sequence corresponds to nucleic acids 1 to 1477 of SEQ ID NO: 79. Lowercase and uppercase letters indicate individual exons. The KChIP11 (KChIP11ong) specific exon is the second exon

in said sequence. The amino acid sequence corresponds to amino acids 1 to 227 of SEQ ID NO: 109.

Giant. 45 depicts the cDNA sequence and predicted amino acid sequence of the human KChIP1N variant with non-terminal splicing. The nucleotide sequence corresponds to nucleic acids 1 to 1639 of SEQ ID NO: 80. The amino acid sequence corresponds to amino acids 1 to 232 of SEQ ID NO: 81.

Giant. 46 depicts a comparison of the N-terminal domains of rat and human KChIP1N, showing that this N-terminal domain is conserved between the two sequences.

Giant. 47 depicts the genomic DNA sequence of human KChIP2 (including KChIP2 1, m, s, and N). The nucleotide sequence corresponds to nucleic acids 1 to 17803 of SEQ ID NO: 74. Uppercase letters show exons and lowercase letters indicate introns.

Giant. 48 depicts the cDNA sequence and predicted amino acid sequence of rat KChIP2L. The nucleotide sequence corresponds to nucleic acids 1 to 1285 of SEQ ID NO: 75. The amino acid sequence corresponds to amino acids 1 to 270 of SEQ ID NO: 76.

Giant. 49 shows the cDNA sequence and predicted human 8t amino acid sequence (KChIP2N). The nucleotide sequence corresponds to nucleic acids 1 to 2076 of SEQ ID NO: 77. The amino acid sequence corresponds to amino acids 1 to 225 of SEQ ID NO: 78.

Giant. 50 depicts a comparison of the N-terminal domains of rat and human KChIP2N (8t) protein, showing that these proteins have 96.5% identity.

«· · · · · · · · · · · · · · ·

Giant. 51 depicts the cDNA sequence and predicted amino acid sequence of full length human KChIP3. The nucleotide sequence corresponds to nucleic acids 1 to 2835 of SEQ ID NO: 82. The amino acid sequence corresponds to amino acids 1 to 256 of SEQ ID NO: 83. Changes from uppercase to lowercase show individual exons.

Giant. 52 depicts the cDNA sequence and predicted amino acid sequence of rat KChIP3. The nucleotide sequence corresponds to nucleic acids 1 to 2414 of SEQ ID NO: 84. The amino acid sequence corresponds to amino acids 1 to 178 of SEQ ID NO: 85. Uppercase letters indicate the coding region and lowercase letters indicate the 3 'UTR.

Giant. 53 depicts the cDNA sequence and predicted amino acid sequence of simian KChIP4XC (KChIP4b). The nucleotide sequence corresponds to nucleic acids 1 to 1005 of SEQ ID NO: 86. The amino acid sequence corresponds to amino acids 1 to 127 of SEQ ID NO: 87.

Giant. 54 depicts the cDNA sequence and predicted amino acid sequence of murine KChIP4N2 (KChIP4c). The nucleotide sequence corresponds to nucleic acids 1 to 2181 of SEQ ID NO: 88. The amino acid sequence corresponds to amino acids 1 to 229 of SEQ ID NO: 89.

Giant. 55 depicts the cDNA sequence and predicted amino acid sequence of rat KChIP4. The nucleotide sequence corresponds to nucleic acids 1 to 2022 of SEQ ID NO: 90. The amino acid sequence corresponds to amino acids 1 to 198 of SEQ

NO NO: 91.

·· 4

4

4

4 4 4 · · 444 444 • •• 4 4 44 44 44 44

Giant. 56 depicts the cDNA sequence and predicted amino acid sequence of human KChIP4α (KChIP4N1S) and a shorter variant with alternative splicing of KChIP4N1.

The nucleotide sequence corresponds to nucleic acids 1 to 2366 of SEQ ID NO: 92. The amino acid sequence corresponds to amino acids 1 to 188 of SEQ ID NO: 93.

Giant. 57 depicts the cDNA sequence and predicted amino acid sequence of human KChIP4a (KChIP4N1). The nucleotide sequence corresponds to nucleic acids 1 to 2431 of SEQ ID NO: 94. The amino acid sequence corresponds to amino acids 1 to 233 of SEQ ID NO: 95.

Giant. 58 depicts the cDNA sequence and predicted amino acid sequence of human KChIP4c (KChIPN2).

The nucleotide sequence corresponds to nucleic acids 1 to 2261 of SEQ ID NO: 96. The amino acid sequence corresponds to amino acids 1 to 229 of SEQ ID NO: 97.

Giant. 59 depicts the cDNA sequence and predicted amino acid sequence of human KChIP4d (KChIP4N3).

The nucleotide sequence corresponds to nucleic acids 1 to 2299 of SEQ ID NO: 98. The amino acid sequence corresponds to amino acids 1 to 250 of SEQ ID NO: 99.

Giant. 60 depicts the cDNA sequence and predicted amino acid sequence of rat KChIP4N1x, an alternative splice variant of KChIP4N1. The nucleotide sequence corresponds to nucleic acids 1 to 2246 of SEQ ID NO: 100. The amino acid sequence corresponds to amino acids 1 to 272 of SEQ ID NO: 101.

Giant. 61 is a set of graphs showing competitive modulation • 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · 9 · Kv4.3 inactivation time constants by KChIP4N2 and KChIP1. The cRNA types administered are listed in the cRNA section, where 4.3 denotes Kv4.3, 1 denotes KChIP1, and 4 denotes KChIP4. The numbers in parentheses indicate the dilution factors of cRNA with 1x = stock solution. The triangles above the bar graphs illustrate a combination of fixed doses of KChIP4N2 or KChIP1 and increasing doses of KChIP1 or KChIP4N2, respectively.

Giant. 62 depicts a protein comparison showing that the non-terminal domains of human KChIP1N and simian KChIP4N2 are homologous and that the N-terminal domains of human / rat KChIP1 and simian KChIP4N2 are divergent.

Giant. 63 depicts the cDNA sequence and predicted amino acid sequence of rat KChIPIN (lvn). The nucleotide sequence corresponds to nucleic acids 1 to 1856 of SEQ ID NO: 102. The amino acid sequence corresponds to amino acids 1 to 232 of SEQ ID NO: 103.

Giant. 64 is a graph depicting concentration-dependent modulation of Kv4.3 and Kv4.3 / KChIP1 currents in Xenopus oocytes by arachidonic acid. Depolarization pulses from a holding potential of -80 mV to +40 mV (duration = 500 ms). Arachidonic acid at a concentration of 1-10 μΜ inhibited peak amplitudes (A) and decreased inactivation time constants (Ti _per ct) (B) in oocytes injected with Kv4.3 cRNA alone (solid line) and injected simultaneously with Kv4.3 and KChIP1 cRNA (dashed line). n = 5 oocytes for each point.

Giant. 65 is a graph showing that modulation of Kv4.3 and Kv4.3 / KChIP1 streams by arachidonic acid is reversible.

Currents in Xenopus oocytes were evoked every 7 seconds by depolarizing pulses to +40 mV (duration = 500 ms) from • · • 9

• · holding potential -80 mV. Effects on peak amplitude (A) and inactivation time constants (T _inact ) (B) are shown as dashed bars showing the application of 10 μid arachidonic acid and empty bars showing ND96 elution with medium supplemented with 0.5 mg / ml BSA (n = 5 for each point).

Giant. 66 is a graph showing modulation of Kv4.3 and Kv4.3 / KChIP1 fatty acids. (A) Percentage blockade of Kv4 (open bars) and Kv4.3 / KChIP (hatched bars) peak amplitudes of 10 μΜ linoleic acid (n = 9, 8, Kv4.3,

Kv4.3 / KChIP1, respectively, γ-linolenic acid (n = 9, 8), ETI (n = 4, 6), ETYA (n = 4, 6), and arachidonic acid (n = 8, 9) ) in Xenopus oocytes. All values except for Ioleoleic acid / Kv4.3 alone are statistically significant compared to controls without fatty acids. Differences of all values between Kv4.3 and

Kv4.3 + KChIP1 for all fatty acids was statistically insignificant. (B) Percentage inhibition of Tinact currents in panel A under the same conditions. Values are given as mean ± SEM. All values for Kv4.3 alone were not statistically significant compared to controls without fatty acids. All values for

Kv4.3 + KChIP1 with the exception of linolelaidic acid was statistically significant compared to controls without fatty acids. The differences in values between Kv4.3 and Kv4.3 + KChIP1 in each fatty acid treatment were significant.

Giant. 67 is a graph showing that arachidonic acid does not interfere with the association between KChIP1 and the N-terminal Kv4.3 domain. (A) The overlapped sensograms indicate that neither the association phase nor the dissociation phase of the interaction between the intracellular Kv4.3 intracellular domain and KChIP1 was qualitatively altered by 10 μΜ of arachidonic acid in the Biosensor assay. (B) Growth · 4 · <4

dependent on the interaction of the N-terminal domain of Kv4.3 and KChIP1 in the selective SC-WLH medium was not altered by 10 μΜ ETYA. A non-selective SC-WL medium that allows strain growth independent of the interaction between the N-terminal domain of Kv4.3 and KChIP1 was used to control non-specific effects of ETYA on strain growth. Values are presented as mean ± SEM. n = 4 for each point.

Giant. 68 is a graph depicting results from Taqman analysis of rat KChIP1N tissue expression.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is based, at least in part, on the discovery of novel nucleic acid molecules that encode gene products that interact with potassium channel proteins or that have significant homology to the gene products of the present invention that interact with potassium channel proteins (paralogs). Potassium channel proteins are, for example, potassium channels containing the Kv4.2 or Kv4.3 subunit. The nucleic acid molecules of the present invention and their gene products are referred to herein as potassium channel interacting proteins, PCIPs, or KChlP nucleic acid molecules and proteins. Preferably, the PCIP proteins of the present invention interact with, eg, bind to a potassium channel protein, modulate potassium channel protein activities, and / or modulate potassium channel mediated activities in a cell, eg, and a neuron or cardiac cell.

The term PCIP family, as used herein to denote proteins and nucleic acid molecules of the present invention, refers to one or more proteins or nucleic acid molecules with PCIP activity as defined herein.

4 4 4 4

Such members of the PCIP family may be natural or artificial and may be of the same species or of different species. For example, the PCIP family may comprise a first protein of human origin, as well as others, other proteins of human origin, or alternatively may include homologues of non-human origin.

The terms PCIP activity, PCIP biological activity, or functional PCIP activity that are interchangeable refer to PCIP protein, polypeptide, or nucleic acid molecule activities on PCIP responsive cells or on a PCIP protein substrate, as determined in vivo or in vitro, using standard techniques. . In one embodiment, the PCIP activity is a direct activity, such as association with a PCIP-target molecule. The term "target molecule or binding partner" refers to a molecule with which a PCIP protein binds or interacts under normal circumstances to achieve PCIP-mediated function. The target molecule for PCIP may be a nonPCIP molecule or a PCIP protein or polypeptide of the present invention. In an exemplary embodiment, the target molecule is a PCIP ligand. Alternatively, PCIP activity is an indirect activity, such as cellular signaling mediated by the interaction of PCIP protein with a PCIP ligand. The biological activities of PCIP are described herein.

For example, the PCIP proteins of the present invention may have one or more of the following activities: (1) may interact with (e.g., bind to) a potassium channel protein or portions thereof; (2) can regulate the phosphorylation state of a potassium channel protein or portion thereof; (3) may associate with (e.g., bind to) calcium and may, for example, act as calcium-dependent kinases, e.g., phosphorylate a potassium channel or a G-protein coupled receptor in a calcium-dependent manner; (4) may associate with (eg bind) ·· · • 9 9 9 9 ► 999 ·

9

999 999

9 · 9 · 9 9

9) 9 9 9 9 • 9 9 · 99 99 na) calcium, and can - for example - act in a calcium-dependent manner in cellular processes, eg act as calcium-dependent transcription factors; (5) can modulate potassium channel mediated activities in cells (eg, neurons such as sensory neurons or motor neurons, or heart cells), for example, to favor the cells; (6) can modulate chromatin production in cells, eg, neurons or heart cells; (7) can modulate vesicle transfer and protein transport in cells, eg, neurons or heart cells; (8) can modulate cytokine signaling in cells, eg, neurons or heart cells; (9) can regulate the association of a potassium channel protein or portion thereof with a cellular cytoskeleton; (10) can modulate cell proliferation; (11) can modulate the release of neurotransmitters; (12) can modulate membrane excitability; (13) may affect the resting potential of membranes; (14) can modulate waveforms and action potential frequencies; and (15) can modulate excitation thresholds.

The term potassium channel refers to a protein or polypeptide that is involved in acquiring, conducting, and transmitting signals in excitable cells. Potassium channels are typically expressed in electrically excitable cells, eg, neurons, heart, skeleton and smooth muscle, kidney, endocrine and egg cells, and may form heteromultimeric structures, eg, composed of cytoplasmic and pore-forming subunits. Examples of potassium channels are: (1) voltage-controlled potassium channels, (2) ligand-controlled potassium channels, and (3) mechanically-controlled potassium channels. For a detailed description of potassium channels, see Kandel E.R. et al., Principles of Neural Science, 2nd Edition, (Elsevier Science Publishing Co., Inc., N.Y. (1985)), the disclosure of which is incorporated herein by reference.

9 9 9 9

9 9 9 9 999

999999 99

9

9900 9 99 99

9 9 99 ·

9 9

19 Dec

9 9

9 9 9

99 link. The PCIP proteins of the present invention have been shown to interact, for example, with potassium channels containing a Kv4.3 subunit or a Kv4.2 subunit.

The term potassium channel mediated activity refers to activities that involve the participation of a potassium channel, eg, and a potassium channel, in neurons or heart cells associated with the acquisition, conduction, and transmission of signals in, for example, the nervous system or heart. Potassium channel mediated activities include the release of neurotransmitters, such as dopamine or norepinephrine, from cells, such as neurons or heart cells; modulation of membrane resting potential, waveform and action potential frequencies, excitation thresholds; modulation of processes such as the integration of subliminal synaptic responses and the conduction of back-propagating action potentials in, for example, neurons or heart cells.

Since the PCIP proteins of the present invention modulate potassium channel mediated activities, they may be useful as novel diagnostic and therapeutic agents for the treatment of potassium channel associated diseases and / or nervous system diseases. In addition, PCIP proteins of the present invention modulate Kv4 potassium channels, e.g., potassium channels with a Kv4.2 or Kv4.3 subunit, which are the basis for a voltage driven K + current known as I _t0 (temporary outward current) in the heart of mammals (Kaab S). et al (1998) Circulation 98 (14): 1383-93, Dixon JE et al (1996)

Circulation Research 79 (4): 659 - 68; Nerbonne JM (1998) Journal of Neurobiology 37 (1): 37-59. Barry D.M. et al. (1998) Circulation Research 83 (5): 560-7. Barry D.M. et al. (1996) Annual Review of Physiology 58: 363-94. This current is the cause of rapid repolarization of cardiomyocytes during action potential. Also involved in heart rate by controlling • 9 Μ ·· ·· · ·· · *

9 9 9 9 9

9 9 · * ··· · · ·

9999 9 9 9 9 9 9 9 · · · ··· «* ·· * .the rate at which cardiomyocytes reach the threshold for further action potential burst.

It is also known that this current is inhibited in patients with cardiac hypertrophy, leading to prolonged cardiac action potential. In these patients, prolongation of action potential is thought to cause changes and concentration and metabolism of myocardial calcium, contributing to the progression of heart disease from hypertrophy to heart failure (Wickenden et al. (1998)

Cardiovascular Research 37: 312). Interestingly, several PCIPs of the present invention (eg, 9q1, 9qm, 9qs, shown in SEQ ID NOs: 13, 15, 17, 19, 21, 23 and 25) bind to and modulate Kv4-containing potassium channels. 2 or Kv4.3 subunit, and these contain the calcium-binding EF-domains.

As a result of mutations in these PCIP genes, defects in the expression of these PCIP proteins binding calcium alone, or defects in the interaction between these PCIP and Kv4.2 or Kv4.3 channels, may result in a decrease in KV4.3 or Kv4.3 (I _m ) currents in the myocardium. Therapeutic agents that alter PCIP expression or modulate the interaction between these PCIP and Kv4.2 or Kv4.3 may be extremely valuable agents to slow or prevent the progression of heart disease from hypertrophy to heart failure.

The term potassium channel associated disease refers to a disease, disorder or condition that is characterized by mis-regulation of potassium channel mediated activity. A potassium channel disorder can adversely affect the transmission of sensory pulses from the periphery to the brain and / or the transmission of motor pulses from the brain to the periphery; integration of reflexes; interpretation of sensory impulses; emotional, intellectual (eg learning and memory) or motor processes. The potassium channel associated disease can further harm electrical impulses that ····

stimulate cardiac muscle fibers to contractions. Examples of potassium channel associated disorders include diseases of the nervous system as well as cardiovascular diseases.

The term nervous system disease includes a disorder, disease or condition that affects the nervous system.

Examples of potassium channel-associated disorders and nervous system disorders are cognitive disorders such as memory and learning disorders such as amnesia, apraxia, agnosia, amnestic dysnomia, amnestic spatial disorientation, Kluver-Bucy syndrome, Alzheimer's memory loss (Eglen RM (1996)) Pharmacol and Toxicol 78 (2): 59-68, Perry EK (1995) Brain and Cognition 28 (3): 240-58) and learning disability; disorders affecting consciousness, eg, visual hallucinations, perception disorders, or delirium associated with dementia associated with Lewy bodies; schizo-effective disorders (Dean B. (1996) Mol. Psychiatry 1 (1): 54-8), schizophrenia with mood change (Bymaster FP (1997) J. Clin. Psychiatry 58 (suppl.10): 28-36; Yeomans JS (1995) Neuropharmacol 12 (1): 3-16 Reimann D. (1994) J. Psychiatry Res. 28 (3): 195-210), depressive disease (primary or secondary); affective disorders (Janowsky D.S. (1994) Am. J. Med. Genetics 54 (4): 335-44); sleep disorders (Kimura F. (1997) J. Neurophysiol. 77 (2): 709-16), eg, REM sleep abnormalities in depressed patients (Riemann D. (1994) J. Psychosomatic Res. 38 Suppl. 1: 15-25; Bourgin P. (1995) Neuroreport 6 (3): 532-6), paradoxical sleep abnormalities (Sakar K. (1997) Eur. J. Neuroscience 9 (3): 415-23), insomnia, physical abnormalities temperature or respiratory depression during sleep (Slidsky SL (1995) By J. Physiol. 269 (2 Pt 2): R308-17; Mallick BN (1997) Brain Res. 750 (1-2): 311-7). Other examples of diseases of the nervous system are disorders of pain-generating mechanisms, such as pain in irritable bowel syndrome (Mitch C. H. (1997) J. Med. Chem. 40 (4): 538-46;

4 4 · 4 • ··· 9 9 ·

4 4 4 4 4 8

9 · 9 4 9

99 99

9 • 4 4 • 94 4 44 · 9 • 9

4 4 4 4

Shannon H.E. (1997) J. Pharmac. and Exp. Therapeutics

281 (2): 884-94; Bouaziz H. (1995) Anesthesia and Analgesia 80 (6): 1140-4; or Guimaraes A.P. (1994) Brain Res. 647 (2): 220-30) or chest pain; locomotor disorders (Monassi CR (1997) Physiol. and Behav. 62 (1): 53-9), eg, locomotor disorders in Parkinson's disease (Finn M. (1997) Pharmacol. Biochem. & Behavior 57 (1-2): Mayorga AJ (1997) Pharmacol. Biochem. & Behavior 56 (2): 273-9), eating disorders such as obesity associated with insulin hypersecretion (Maccario M. (1997) J. Endocrinol. Invest. 20 (1): 8-12, Premawardhana LD (1994) Clin. Endocrinol. 40 (5): 617-21); fluid intake disorders such as diabetic polydipsia (Murzi E. (1997) Brain Res. 752 (1-2): 184-8; Yang X. (1994) Pharmacol. Biochem. & Behavior 49 (1): 1-6 ), - neurodegenerative diseases such as Alzheimer's disease, dementias associated with Alzheimer's disease (such as Pick's disease), Parkinson's disease and other Lewy-diffuse corpuscular diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive, elevated palsy, epilepsy, spinocerebelebellar , epileptic syndromes, Jakob-Creutzfield's disease; psychiatric disorders, eg, depression, schizophrenic disorders, Korsakoff's psychosis, mania, anxiety disorders, bipolar affective disorders, or phobic disorders; neurological disorders such as migraine; spinal cord injury; stroke and head trauma.

The term epilepsy as used herein refers to neurological diseases caused by disorders of the normal electrical functions of the brain. In a normally functioning brain, millions of subtle electrical impulses are transmitted from neurons to the entire body. In patients with epilepsy, this normal state is interrupted by random and unusual intense impulses of electrical energy, which may affect individual consciousness, individual mobility, or individual perception. These physical changes

9

9,999 9 9 9

9

9999

9999 are referred to as epileptic seizures. There are two categories of seizures: partial seizures that occur in one area of the brain, and generalized seizures that affect nerve cells throughout the brain. Epilepsy may result from brain injury before, during and after delivery; head injury; poor nutrition; certain infectious diseases; brain tumors; and some poisons. However, in many cases the cause is unknown. Epilepsy attacks may be preceded by unusual feelings, called aura, indicating the onset of a seizure. Symptoms of impending epileptic seizure, which may vary between patients, may include visual phenomena such as flashes of light. Recently, genetic binding for epilepsy has been discovered on chromosome 10q, near the marker D10S192: 10q22-q24 (Ottman et al. (1995) Nature Genetics 10: 56-60). Various forms of epilepsy include: grand mal, Jackson seizures, myoclonal progressive familial epilepsy, petit mal, LennoxGastaut syndrome, febrile seizures, psycho-motor epilepsy and temporal epilepsy. The disclosed findings are particularly important for the development of new therapies for partial epilepsy.

The term ataxia refers to common neurological disorders caused by disorders in the normal electrical functions of the brain. Type 1 spinocerebellar ataxia (SCA1) is an autosomal dominant disease that is genetically linked to the short arm of chromosome 6 by binding to the human major histocompatibility complex (HLA). See, for example, H. Yakura et al. (1974) N. Engl. J. Med., 291,154-155; and J. F. Jackson et al. (1977) N. Engl. J. Med. 296, 1138-1141. SCA1 has been shown to be tightly bound to marker D6S89 on the short arm of chromosome 6, telomerically to HLA. See, for example, L. P. W. Ranum et al. , Am. J. Huni. Genet., 49: 31-41 (1991); and Η. Y. Zoghbi et al., Am. J. Hum. Genet., 49, 23-30 (1991). The disclosed discoveries are particularly important for the development of new therapies for:

9999 9 9 9 9 9 9 9 9 · • · · · 9 · 9 9 9 9

9999 9 99 99 99 99 spinocerebellar ataxia with onset in childhood (IOSCA).

The term cardiovascular disease includes diseases affecting the cardiovascular system, e.g., the heart. Examples of cardiovascular diseases are arteriosclerosis, ischemic reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular rhythm, coronary microembolism, tachycardia, bradycardia, hypertension, aneurysm, aortic coronary artery, coronary artery disease, coronary artery ligation long QT, congestive heart failure, sinus node dysfunction, angina pectoris, heart failure, hypertension, atrial fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, ischemic heart disease, coronary artery spasm or arrhythmia. In a preferred embodiment, the cardiovascular disease associated with an abnormal current I _a.

Some members of the PCIP family may have common structural characteristics, such as a common structural domain or motif, or and sufficient amino acid or nucleotide sequence homology as defined herein. Such members of the PCIP family may be natural or artificial and may be of the same or of different kinds. For example, the PCIP family may comprise a first protein of human origin, as well as other, different proteins of human origin, or alternatively may include homologues of non-human origin.

For example, PCIP family members having common structural characteristics may include at least one calcium binding domain. The term calcium binding domain refers to an amino acid domain, e.g., the EF arm (Baimbridge K.G. et al. (1992) TINS 15 (8): 303-308), which

4444 * 4

4 4

4444 4

4 4 • 4,444

4. 4 44 4

4 4 4

4 4 4

44 participates in calcium binding. Preferably, the calcium binding domain has a sequence that is significantly identical to the conventional sequence:

EO ·· 00 · K ODKDGDGAO ·· · EF ·· ΟΟ. (SEQ ID NO: 41) wherein O may be I, L, V or M, and · show positions without a strongly preferred residue. Each said residue is present in more than 25% of the sequences, and the underlined residues are present in more than 80% of the sequences. Amino acid residues 126-154 and 174-202 of the human lv protein, amino acid residues 126-154 and 174-202 of rat lv protein, amino acid residues 137-165 and 185-213 of rat lv protein, amino acid residues 142-170 of rat lvn protein, amino acid residues 126-154 and 174-202 of the murine lv protein, amino acid residues 137-165 and 185-213 of the murine lion protein, amino acid residues 144-172, 180-208, and 228256 of the human 9ql protein, amino acid residues 126-154, 162-190, and 210-238 of human 9qm protein, amino acid residues 94-122, 130-158 and 178-206 of human 9qm protein, amino acid residues 126-154, 162-190 and 210-238 of rat 9qm protein, amino acid residues 131-159, 167-195 , and 215-243 rat 9q1 protein, amino acid residues 126-154, 162-190 and 210-238 rat 9qc protein, amino acid residues 99-127, 135-163 and 183-211 of rat 8t protein, amino acid residues 144-172, 180 -208 and 228-256 mouse 9q1 protein, amino acid residues 94-122 , 130-158 and 178-206 of the monkey 9qs protein, amino acid residues 94-122, 130-158 and 178-206 of the human p19 protein, amino acid residues 19-47 and 67-95 of rat p19 protein, and amino acid residues 130-158, 166194 and 214-242 mouse p19 protein contain calcium binding domains (EF arms) (see Figs. 21). The amino acid residues 116127 and 152-163 of the simian KChIP4a and KChIP4b protein contain calcium binding domains.

• · ·

· A a a a a a a a a a a a a a a a a a

In another embodiment, isolated PCIP proteins of the present invention are identified according to the presence of at least one conserved carboxy-terminal domain that comprises an amino acid sequence of about 100-200 amino acid residues, preferably 150-200 amino acid residues, and more preferably 185 amino acid residues, and which comprises three EF arms. The PCIP proteins of the present invention preferably comprise a carboxy-terminal domain that is at least 70%, 71%, 74%, 75%, 76%, 80%, or more identical to the carboxy-terminal 185 amino acid residues of rat 1v, rat 9q , or mouse p19 (see Figures 21, 25 and 41).

PCIP family members having common structural characteristics are listed in Table I. Other PCIP family members, eg, PCIP family members that do not have common structural characteristics, are listed in Table II and are described below. The present invention provides a complete human and and partial rat 33b07 clone and proteins encoded by these cDNAs. The present invention further provides a partial rat 1p clone and a protein encoded by this cDNA. Further, the present invention provides a partial rat 7s clone and protein encoded by this cDNA.

The present invention further provides PCIP family members that represent previously identified cDNAs (29x, 25r, 5p, 7q, and 19r). These previously identified cDNAs are identified herein as members of the PCIP family, i.e., as molecules having PCIP activities as described herein. Accordingly, the present invention provides methods for using these previously identified cDNAs, eg, methods for using these cDNAs in screening assays, diagnostic assays, prognostic assays and treatment methods of the present invention.

4 * 4 ·· • 4 44 444 44 · 4 4 4 444 4 ·

444445 44 444 4

4 444444

4444 44 44 44 44 of the invention.

The PCIP molecules of the present invention were first identified by their ability, which was determined using the yeast two-hybrid assay (described in detail in Example 1), to interact with the amino-terminal 180 amino acids of the rat Kv4.3 subunit. Additional binding experiments with other potassium channel subunits were performed to demonstrate PCIP specificity for Kv4.3 and Kv4.2. In situ localization, immunohistochemical methods, co-immunoprecipitation, and sticky clamps were then used to clearly demonstrate that the PCIPs of the present invention interact with and modulate potassium channel activities, particularly those containing the 4.3 or 4.2 subunit.

Several new human, murine, monkey and rat PCIP family members have been identified and referred to herein as 1v, 9g, p19, W28559, KChIP4, 33b07, 1p and rat 7s proteins and nucleic acid molecules. The human, rat and mouse cDNAs encoding the lv polypeptide are set forth in SEQ ID NOs: 1, 3 and 5, and are shown in Figures 1, 2 and 3, respectively.

In the brain, lv mRNA is highly expressed in neocortical and hippocampal interneurons, in the thalamic reticular nucleus and medial habenule, in the basal forebrain and striatal cholinergic neurons, in the superior colliculus and cerebellar granular cells, the lv polypeptide is highly expressed in the body, dendon and axonal endings of cells that express lv mRNA. Alternative splice gene variants 1v have been identified in rats and mice and are shown in SEQ ID NOs: 7, 9 and 11 and in Figures 4, 5, and 6, respectively, the 1v polypeptide interacts with potassium channels containing Kv4.3 or kv4.2 subunits, but not with Kv1.1 subunits. According to Northern hybridization, lv transcripts (mRNA) are mainly expressed in the brain.

The 8t cDNA (SEQ ID NO: 29) encodes a polypeptide with a molecular weight of approximately 26 kD corresponding to SEQ ID NO: 30 (see FIG.

15). The 8t polypeptide interacts with a potassium channel containing Kv4.3 or Kv4.2 subunits, but not with Kv1.1 subunits. According to Northern transmission and in-situ data, 8t mRNA is expressed primarily in the heart and brain. The 8t cDNA is a variant splice 9q.

Human, rat, monkey and mouse 9q cDNAs were also isolated.

Alternative splicing variants include human 9ql (SEQ ID NO: 13; Figure 7), rat 9ql (SEQ ID NO: 15; Figure 8), mouse 9ql (SEQ ID NO: 17; Figure 9), human 9qm (SEQ ID NO: 19; Figure 10), rat 9qm (SEQ ID NO: 21; Figure 11), human 9qs (SEQ ID NO: 23; Figure 12), monkey 9qs (SEQ ID NO: 25; 13) and rat 9qc (SEQ ID NO: 27; FIG. 14). The genomic DNA sequence of 9q was also determined.

Exon 1 and its adjacent intron sequences (SEQ ID NO: 46) are shown in Figure 22A. Exons 2-11 and adjacent intron sequences (SEQ ID NO: 47) are shown in Figure 22B. The 9q polypeptides interact with potassium channels containing Kv4.3 or Kv4.2 subunits, but not with Kv1.1 subunits. According to Northern blot and in-situ assays, 9q proteins are expressed primarily in the heart and brain. In the brain, 9q mRNA is highly expressed in neostriatum, hippocampus, neocortical pyramidal cells and interneurons, and in the thalamus, superior colliculus and cerebellum.

Human, rat and mouse P19 cDNAs were also isolated. Human P19 is shown in SEQ ID NO: 31 and Figure 16; and in SEQ ID NO: 39 and Fig. 20 (3 'sequence). Rat P19 is shown in SEQ ID NO: 33 and Fig. 17, and mouse P19 is shown in SEQ ID NO: 35 and Figs.

18. P19 polypeptides interact with potassium channels containing Kv4.3 or Kv4.2 subunits but not with Kv1.1 • 4,444

4 44 44 • 4 4 4 · · ·· ·

4 · 4 · · · · τ τ 4 · 4 · 4 4 6 6

44 * 4 4 »4 4 4 4 4 4 subunits. According to Northern blotting, P19 transcripts (mRNA) are mainly expressed in the brain.

A partial human paralog of PCIP molecules has also been identified. This paralog is referred to herein as W28559 and is shown in SEQ ID NO: 37 and Figure 19.

Monkey KChIP4a and its variants with alternative splicing KChIP4b, KChIP4c and KChIP4d were also identified. Monkey KChIP4a is shown in SEQ ID NO: 48 and Fig. 23. Monkey KChIP4b is shown in SEQ ID NO: 50 and Fig. 24. Monkey KChIP4c is shown in SEQ ID NO: 69 and Fig. 35. Monkey KChIP4d is shown in SEQ ID NO: 71 and FIG. 36.

The nucleotide sequence of the complete rat 33b07 cDNA and the predicted amino acid sequence of the rat 33b07 polypeptides are shown in Figure 26 and in SEQ ID NOs: 52 and 53, respectively. The rat 33b07 cDNA encodes a protein having a molecular weight of about 44.7 kD, having a length of 407 amino acid residues. Rat 33b07 binds to rKv4.3N and rKv4.2N with a slight preference for rKv4.2N in the yeast 2-hybrid assay.

The nucleotide sequence of the complete human 33b07 cDNA and the predicted amino acid sequence of the human 33b07 polypeptides are shown in Fig. 27 and in SEQ ID NOs: 54 and 55, respectively.

The nucleotide sequence of a portion of the rat 1p cDNA and the putative amino acid sequence of the rat 1p polypeptide are shown in Figure 28 and in SEQ ID NOs: 56 and 57, respectively. The rat 1p cDNA encodes a protein with a molecular weight of about 28.6 kD and a length of 267 amino acid residues. Rat lp binds to ···················· · · · RKv4.3N and rKv4.2N with mild preference for rKv4.3N in the yeast two-hybrid test.

The nucleotide sequences of a portion of the rat 7s cDNA and the putative amino acid sequence of the rat 7s polypeptides are shown in Figure 29 and in SEQ ID NOs: 58 and 59, respectively. Rat 7s cDNA encodes a protein with a molecular weight of approximately 28.6 kD and a length of 270 amino acid residues. Rat 7s binds to rKv4.3N and rKv4.2N with preference for rKv4.3N in the yeast 2-hybrid assay.

The sequences of the present invention are summarized in Tables I and II below.

Table I

Novel polynucleotides and polypeptides of the present invention (complete unless otherwise stated)

PCIP Form molecules nuclear acid Source SEQ ID NO: DNA SEQ ID NO: PROTEIN ATCC lv or KChIPl lv human (225-875) * 1 2 98994 KChIPlN (lvN) N- variants terminal alternative montage human (353-461) 80 81 lv rat (210-860) 3 4 98946

• 9 • ·

lv mouse (477- 1127) 5 6 98945 lions human 79 109 lions rat (31-714) 7 8 98942 lions mouse (77-760) 9 10 98943 lvn rat (345-955) 11 (partial) 12 (partial) 98944 (339-1037) 102 (complete) 103 (complete) 9q or KChIP2 Genomic DNA sequence human 74 Genomic DNA sequence (Exon 1 and neighboring intronic sequence) human 46 Genomic DNA sequence (Exons 2-11 and neighboring intronic sequence) human 47 9ql human (207-1019) 13 14 98993 98991

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ··

9ql rat (2- 775) 15 Dec (partial) 16 (partial) 98948 (1-813) 75 (complete) 76 (complete) 9ql mouse (181 -993) 17 18 98937 9qm human (207-965) 19 Dec 20 May 98993 98991 9qm rat (214-972) 21 22nd 98941 9qs human (207-869) 23 24 98951 9qs monkey (133- 795) 25 26 98950 9qc rat (208-966) 27 Mar: 28 98947 8t human (1-678) 77 (partial) 78 (partial) rat (1- 678) 29 (partial) 30 (partial) 98939 pl9 steed KChIP3 KChIP3 (complete) human (16-786) 82 83 pl9 human (1-771) 31 32 PTA- 316 pl9 rat (1- 330) 33 (partial) 34 (partial) 98936 (1-579) 84 (partial) 85 (partial)

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·······················

pl9 mouse (49-819) 35 36 98940 pl93 (partial) human (2-127) 39 40 98949 W28559 W28559 (partial) human (1-339) 37 38 KChIP4 KChIP4a (KCMP4N1) human (248-949) 94 95 KChIP4aS (KChIP4NlS) shorter variants with an alternative montage KChIP4Nl human (319-885) 92 93 KChIP4c (KCMP4N2) human (90-779) 96 97 KChIP4d (KChIP4N3) human (65-817) 98 99 KChIP4a (KCMP4N1) monkey (265-966) 48 49 KChIP4b variants with C- terminal alternative montage monkey (265-966) 50 (partial) 51 (partial) KChIP4b (KChIP4XC) monkey (1-385) 86 (partial) 87 (partial) KChIP4c (KChIP4N2) variants s alternative montage monkey (122-811) 69 70

• · · · ·

KChIP4d (KChIP4N3) variants s alternative montage monkey (64-816) 71 72 KChIP4c (KChIP4N2) mouse (56-745) 88 89 KChIP4 rat (1- 597) 90 (partial) 91 (partial) KChIP4aX (KChIP4Nlx) variants s alternative montage KChIP4Nl rat (1- 821) 100 ALIGN! (partial) 101 (partial)

* Coordinates of the coding sequence are indicated in parentheses. The first column shows the PCIPs that have been identified and column 2 shows the different forms of nucleic acid identified for each PCIP.

Table II

Polynucleotides and Polypeptides of the Present Invention (Complete unless otherwise noted)

PCIP Form molecules nuclear acid Source SEQ ID NO: DNA SEQ ID NO: PROTEIN ATCC 33b07 new 33b07 human (88-1332) 52 53 PTA- 316 33b07 rat (85-1308) 54 55

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

99 ·· 9 9 9 9 9 9 9 9 9

lp new ip (partial) rat (1-804) 56 57 7s new 7s (partial) rat (1-813) 58 59 29x 29x rat (433-1071) 60 61 25r variants s alternative sestřihem 29x rat (130-768) 62 5p 5p rat (52-339) 63 64 7q 7q rat (1-639) 65 66 19r 19r rat (1-816) 67 68

★ Coordinates of the coding sequence are indicated in brackets. The first column shows the four PCIP families that have been identified, and column 2 shows the different forms of nucleic acid identified for each family. New molecules are also indicated.

Plasmids containing nucleotide sequences encoding human, rat, and monkey PCIP were deposited with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209, November 17, 1998, under the accession numbers listed above. These depositions were carried out under the Budapest Treaty on the Deposit of Microorganisms for the Purposes of Patent Procedures. These mountings were made only for the needs of those skilled in the art, and there is no reason for the mountings to be in accordance with 35 U.S.C. §112.

Clones containing cDNA molecules encoding human p19 (clone EphP19) and human 33b07 (clone Eph33b07) were deposited with the American Type Culture Collection (Manassas, VA) on July 8, 1998 under accession number PTA-316 as part of a composite deposit representing a mixture of two strains. each carrying one recombinant plasmid with a particular cDNA clone. (The ATCC strain designation for the mixture of hP19 and h33b07 is EphP19h33b07mix).

To differentiate strains and isolate a strain carrying a particular cDNA clone, a portion of the mixture can be cultured to obtain individual colonies on LB plates supplemented with 100 µg / ml ampicillin, individual colonies can be cultured, and then plasmid DNA can be extracted using standard miniprep procedure. Then, a sample of this DNA preparation can be digested with NotI and the products obtained can be resolved on a 0.8% agarose gel using standard electrophoretic conditions for DNA. Digestion yields the following bands: EphP19: 7 kb 9 (single band), Eph33b07: 5.8 kb (single band).

Various aspects of the present invention are described in more detail in the following sections:

I. Isolated nucleic acid molecules

One aspect of the present invention pertains to isolated nucleic acid molecules that encode PCIP proteins or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify PCIP-encoding nucleic acid molecules (eg, PCIP mRNA) and fragments for use. as PCR primers for amplification or mutation of PCIP nucleic acid molecules. The term nucleic acid molecule refers to DNA as a DNA molecule.

-7Z. Φ molecules (eg, cDNA or genomic DNA) and RNA molecules (eg, mRNA) and DNA or RNA analogs generated using nucleotide analogs. The nucleic acid molecule may be single stranded or double stranded, but is preferably double stranded DNA.

An isolated nucleic acid molecule is a molecule that is separated from other nucleic acid molecules that are present in a natural source of nucleic acid. Preferably, the isolated nucleic acid does not contain sequences that naturally adjacent to the nucleic acid (i.e., sequences located at the 5 'and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated PCIP nucleic acid molecule may comprise less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb nucleotide sequence that naturally adjacent to the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived. Further, an isolated nucleic acid molecule, such as a cDNA molecule, may be significantly free of other cellular material or culture medium when produced by recombinant techniques, or may be significantly free of chemical precursors or other chemical agents when synthesized chemically.

The nucleic acid molecule of the present invention, e.g., a nucleic acid molecule having the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7,

SEQ ID NO: 9; SEQ ID NO: 11; SEQ ID 1 NO: 13; SEQ ID NO: 15; SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74,

• 4 4

444 444 * 4 4 • 4 4 4 4 444 4 4

CO 4444 44 44 444 4 4

JJ 4 4444 4444

4444 44 44 44 44 44

SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO

NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90,

SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO

NO: 100, or SEQ ID NO: 102, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944,

98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, or parts thereof, can be isolated using standard molecular biology techniques and sequence information provided herein. Using all or part of the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO.

NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NQ: 100 or í SEQ ID NO: 102, or

the nucleotide sequences of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940,

98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, as hybridization probes, the PCIP nucleic acid molecule can be isolated using standard hybridization and cloning techniques (such as See, e.g., Sambrook, J., Fritsh, EF, and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

Further, a nucleic acid molecule comprising all or 0 0

0

0000

000000 00 000 0 0 ^ 7 “0 0 00 ··

0000 00 00 00 00 00

Part of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO

NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17,

SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO. 50, SEQ ID NO NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86 SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or a nucleotide sequence DNA

a plasmid insert deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994 can be isolated polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed according to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ. ID NO: 13

SEQ ID NO: 15, SEQ ID NO: 17 SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35 SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56 SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 8 0 SEQ NO NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ NQ ID: 100 or I SEQ ID NO: 102, or by

the nucleotide sequences of the DNA insert of the plasmid deposited with the ATCC under accession numbers 989.36, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994.

The nucleic acid of the present invention may be 9 ** 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9

SS · 9999 99 99 999 9 9 + φ 9999 9999 • 999 9 99 99 99 99 amplified using cDNA, mRNA or, alternatively, genomic DNA as a template and appropriate oligonucleotide primers using standard PCR amplification techniques. The nucleic acid thus amplified can be cloned into a suitable vector and can be characterized by DNA sequence analysis. Further, oligonucleotides corresponding to a PCIP nucleotide sequence can be prepared by standard synthesis techniques, e.g., using an automated DNA synthesizer.

In a preferred embodiment, the isolated nucleic acid molecule of the present invention comprises the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 SEQ ID NO: 13; SEQ ID NO

NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO NO: 29, SEQ ID NO: 31, SEQ ID NO NO: 33, SEQ ID NO: 35, SEQ ID NO: 37 SEQ ID NO: 39, SEQ ID NO: 46 SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO NO: 50, SEQ ID NO. 52, SEQ ID NO NO: 54, SEQ ID NO: 56, SEQ ID NO: 58 SEQ ID NO: 69, SEQ ID NO: 71 SEQ ID NO: 74, SEQ ID NO. 75, SEQ ID NO NO: 77, SEQ ID NO: 79, SEQ ID NO NO: 80, SEQ ID NO: 82, SEQ ID NO: 84 SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO. 92, SEQ ID NO NO: 94, SEQ ID NO: 96, SEQ ID NO NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or nucleotide

the DNA sequence of the plasmid insert deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, or a portion of any of these nucleotide sequences.

In another preferred embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleic acid molecule that is complementary to the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO. : 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 1, 1, 4, 4, 4, 4 9 • ···· 44 44 444 4 5

4,444 444 «

4444 44 44 44 44 44

NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 8 4 SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NQ: 100 or; SEQ ID NO: 102, or k nucleotide

the DNA sequence of the plasmid insert deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, or to a portion of any of these nucleotide sequences. A nucleic acid molecule that is complementary to the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9,

SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NQ: 100 or

SEQ ID NO: 102, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession number 98936,

98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, is a molecule that is sufficiently complementary to the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3,

SEQ ID NO: 4, SEQ ID NO: 7, SEQ ID NO: 9, or to the nucleotide sequence of the ATCC plasmid insert DNA deposited in the ATCC. ·· · ·

O z · · ········ ···· · · · ··· under accession number 98936, 98937, 98938, 98939, 98940,

98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948,

98950, 98951, 98991, 98993, or 98994, such that: can hybridize to the nucleotide sequence set forth above in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO NO: 27, SEQ ID NO NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37 SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO NO: 48, SEQ ID NO NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58 SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO NO. 75, SEQ ID NO NO: 77, SEQ ID NO: 79, SEQ ID SEQ ID NO: 82 SEQ ID NO: 84 SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90; NO. 92, SEQ ID NO NO: 94, SEQ ID NO: 96, SEQ ID SEQ ID NO: 100 , or SEQ ID

NO: 102, or to the nucleotide sequence of the ATCC insert plasmid DNA under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991 , 98993, or 98994, to form a stable duplex.

In yet another preferred embodiment, the isolated nucleic acid molecule of the present invention comprises a nucleotide sequence that is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% , 98% or more percent identical to the entire nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ.

SEQ ID NO: 11, SEQ SEQ ID NO: 13, SEQ SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 7 9 SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID

• · · · · · · · · · · · · · · · · ·

NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92,

SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or

SEQ ID NO: 102, or the entire nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession number 98936,

98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, or portions of any of these nucleotide sequences.

Further, the nucleic acid molecule of the present invention may comprise only a portion of the nucleic acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO

NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or i SEQ ID NO: 102, or nucleotide sequence] DNA

a plasmid insert deposited with the ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944,

98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, for example, a fragment that can be used as a probe or primer or a fragment encoding a biologically active portion of a PCIP protein. The nucleotide sequence determined from the cloning of the PCIP gene allows the generation of probes and primers for use in identifying and / or cloning other members of the PCIP family, as well as PCIP homologs from other species.

The probe / primer typically comprises significantly purified oligonucleotides. Oligonucleotides typically contain a region region of the region. A nucleotide sequence that hybridizes under stringent conditions to at least about 12 or 15, preferably about 20 or 25, more preferably about 30, 35, 40, 45, 50, 55, 60, 65, or 75 consecutive nucleotides of the coding sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ.

SEQ ID NO: 13, SEQ SEQ ID NO: 17, SEQ SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 3 9 SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 7 9 SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102,

or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939,

98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, antisense sequences to SEQ ID NO: 1, SEQ ID NO: 3 SEQ ID NO: 5 SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO.

NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25 SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or i SEQ ID NO: 102, or k nucleotide; DNA sequence

a plasmid insert deposited with the ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or natural alleles a variant or mutant of SEQ.

SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9,

SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 7 9 SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or

SEQ ID NO: 102, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994.

In an exemplary embodiment, the nucleic acid molecule of the present invention comprises a nucleotide sequence having a length of 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750- 800, 800-850, 850-900, 949, 950-1000, or more nucleotides and hybridizes under stringent hybridization conditions to the nucleic acid molecule of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ

SEQ ID NO: 13, SEQ SEQ ID NO: 15, SEQ SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 7 4 SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 8 0 SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102,

or to the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession number 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 9 948 · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

98949, 98950, 98951, 98991, 98993, or 98994.

Probes designed according to the PCIP nucleotide sequence can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In a preferred embodiment, the probe further comprises a tagging group attached thereto, e.g., a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor. Such probes can be used as part of a diagnostic test baptism to identify cells or tissues that incorrectly express a PCIP protein, for example, by measuring the concentration of PCIP-encoding nucleic acids in a sample of cells from an individual, e.g., detecting PCIP mRNA concentrations or determining PCIP gene mutated or deleted.

A nucleic acid fragment encoding a biologically active portion of a PCIP protein can be prepared by isolating a portion of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5,

SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO

NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37 SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58 SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO. 75, SEQ ID NO NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84 SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO. 92, SEQ ID NO NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NQ: 100 or SEQ ID NO: 102, or nucleotide

DNA sequence of plasmid insert deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994 encodes a polypeptide with PCIP biological activity (the biological activities of the PCIP proteins are described below), expressing the encoded portion of the PCIP protein (eg, by recombinant expression in vitro) and evaluating the activity of the encoded portion of the PCIP protein.

· · · · · · · · · · · · · · · · · · · · · · · ·

The invention further encompasses nucleic acid molecules that differ from the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ

ID NO :: 13, SEQ ID NOh 15, SEQ ID NOh 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 2 9 SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102

or from the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, due to the degeneracy of the genetic code and encode the same PCIP proteins as those encoded by the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO

NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102 or a nucleotide sequence Plasmid insert DNA

stored in ATCC under accession number 98936, 98937, 98938 • · φφ φφφφφφφφφφφφφφφφφφφφφφφφφφφφφφφ · · · · · · · · ·φφφφφφφφφφφ

98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994. In another embodiment, an isolated nucleic acid molecule of the present invention has a nucleotide sequence encoding a protein having an amino acid the sequence shown in SEQ ID NO: 2, SEQ

ID NO: 4 , SEQ: NO NO: 6, SEQ ID NO: 8 SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 5 9 SEQ ID NO: 7 0 SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 8 9 SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID

NO: 103, or SEQ ID NO: 109.

In addition to the PCIP nucleotide sequence set forth in SEQ ID NO: 1,

SEQ ID SEQ ID NO: 5 SEQ ID NO: 7, SEQ SEQ ID NO: 9; NO: 11, SEQ ID NO: 13, SEQ SEQ ID NO: 15; NO: 17, SEQ ID NO: 19, SEQ ID SEQ ID NO: 21 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO NO: 29, SEQ ID NO: 31, SEQ SEQ ID NO: 33; NO: 35, SEQ ID NO: 37, SEQ ID SEQ ID NO: 39 46, SEQ ID NO: 47. SEQ ID NO: 48; NO: 50, SEQ ID NO: 52, SEQ SEQ ID NO: 54; NO: 56, SEQ ID NO: 58, SEQ ID SEQ ID NO: 69 71, SEQ ID NO: 74. SEQ ID NO: 75, SEQ ID NO NO: 77, SEQ ID NO: 79; SEQ ID NO: 80; NO: 82, SEQ ID NO: 84, SEQ ID SEQ ID NO: 86 88, SEQ ID NO: 90. SEQ ID NO: 92, SEQ ID NO NO: 94, SEQ ID NO: 96, SEQ SEQ ID NO: 98; NO: 100, or SEQ ID

NO: 102, or the nucleotide sequences of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, it will be apparent to those skilled in the art that there may be DNA sequence polymorphisms in a population (eg, a human population) that • 4 4

4 4 4 4 ·· · 4 • 44 44 44 * · _Λ 444 44 444 444

Ad 4 4444 4 4 44 444 4 4

VT 4 4444 4444

4444 4 44 44 44 44 can lead to changes in the amino acid sequence of PCIP proteins. Such genetic polymorphisms in PCIP genes may exist among individuals in a population due to natural allelic variations. The terms gene and recombinant gene refer to nucleic acid molecules that comprise an open reading frame encoding a PCIP protein, preferably a mammalian PCIP protein, and may further comprise non-coding regulatory sequences and introns.

Allelic variants of human PCIP include both functional and non-functional PCIP proteins. Functional allelic are natural variants of the amino acid sequence of a human PCIP protein that retain the ability to bind to a PCIP ligand and / or modulate any of the PCIP activities described herein. Functional allelic variants usually contain only conservative substitutions of one or more amino acids of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12,

SEQ ID NO: 14 SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 20 SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 8 9 SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID

NO: 103, or SEQ ID NO: 109 or the substitution, deletion, or insertion of non-critical residues in the non-critical regions of the protein.

Non-functional allelic variants are natural amino acid sequence variants that do not retain the ability to bind to a PCIP ligand and / or modulate any of the PCIP activities described herein. Non-functional allelic variants usually include non-conservative substitutions, deletions or insertions, or premature truncations of the amino acid sequence of SEQ ID NO: 2, SEQ.

65 ΦΦ Φ • φ Φ φ φ Φ ΦΦ • • Φ · Φ ΦΦ ·· Φ φ Φ * • φ φ Φ · φ φ φ φ Φ φ φ φ Φ φφ Φ Φ φφφφ Φ ♦ • Φ φ Φ φ φ Φ Φ ·· Φ Φ φφφφ ΦΦΦΦ Φ Φ SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14; SEQ ID NO: 16 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32; SEQ ID NO: 34 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57; SEQ ID NO: 59 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 8 5 SEQ ID NO: 87; SEQ ID NO: 89 91, SEQ ID NO: 93, SEQ ID SEQ ID NO: 95, SEQ ID NO: 99; ID NO: 101, SEQ ID

103: 103, or SEQ ID NO: 109 or substitution, insertion or deletion in critical residues or critical regions.

The present invention further provides non-human orthologs of the human PCIP protein. Human PCIP protein orthologs are proteins that are isolated from a non-human organism and that have the same binding to PCIP ligand and / or modulation of potassium channel activities as human PCIP protein. Human PCIP protein orthologs can be readily identified by containing an amino acid sequence that is substantially identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 SEQ ID NO: 12

SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 7 6 SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 8 9 SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID

NO: 103, or SEQ ID NO: 109.

Furthermore, nucleic acid molecules encoding other members of the PCIP family and therefore having a nucleotide sequence that is different from the PCIP sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ. SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13,

SEQ ID NO: 15, SEQ ID NO: 17 SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO NO: 27, SEQ ID NO NO: 29, SEQ ID NO NO: 31, SEQ ID NO: 33, SEQ ID NO: 35 SEQ ID NO: 37 SEQ ID NO: 39 SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO NO: 48, SEQ ID NO NO. 50, SEQ ID NO NO: 52, SEQ ID NO: 54, SEQ ID NO: 56 SEQ ID NO: 58 SEQ ID NO: 69 SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO NO. 75, SEQ ID NO NO: 77, SEQ ID NO NO: 79, SEQ ID NO: 80, SEQ NO NO: 82, SEQ ID NO: 84 SEQ ID NO: 86 SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO NO. 92, SEQ ID NO NO: 94, SEQ ID NO NO: 96, SEQ ID NO: 98, SEQ ID NO: 100 or SEQ ID NO: 102, or from

nucleotide sequences of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, are within the scope of the present invention. For example, other PCIP cDNAs can be identified by the nucleotide sequence of human PCIP.

Furthermore, nucleic acid molecules encoding PCIP proteins from different species having a nucleotide sequence that is different from the PCIP sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO. 9, SEQ ID NO: 11, SEQ ID NO: 13,

SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NQ: 100 or; SEQ ID NO: 102, or from

nucleotide sequences of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949,

v / · · · · · · · · · · · · · · ·

98950, 98951, 98991, 98993, or 98994 are within the scope of the present invention. For example, murine PCIP cDNA can be identified by the nucleotide sequence of human PCIP.

Nucleic acid molecules corresponding to the natural allelic variants and homologs of the PCIP cDNAs of the present invention can be isolated according to their homology to the PCIP nucleic acid of the present invention using the cDNA described herein, or a portion thereof, as hybridization probes using standard hybridization techniques and stringent hybridization conditions. .

Accordingly, in another embodiment, an isolated nucleic acid molecule of the present invention is at least 15, 20, 25, 30 or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 1, SEQ ID NO. 3 SEQ

SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 SEQ ID NO: 11, SEQ ID NO: 13 SEQ ID NO: 15; NO: 17, SEQ ID NO NO: 19, SEQ ID NO: 21, SEQ ID NO NO: 23, SEQ ID NO: 25, SEQ ID NO: 27 SEQ ID NO: 29, SEQ ID NO: 31 SEQ ID NO: 33; NO: 35, SEQ ID NO NO: 37, SEQ ID NO. 39, SEQ ID NO NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 SEQ ID NO: 50, SEQ ID NO: 52 SEQ ID NO: 54, SEQ ID NO NO: 56, SEQ ID NO NO: 58, SEQ ID NO. 69, SEQ ID NO SEQ ID NO: 71, SEQ ID NO: 75 SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80; NO: 82, SEQ ID NO NO: 84, SEQ ID NO: 86, SEQ ID NO SEQ ID NO: 90, SEQ ID NO: 92 SEQ ID NO: 94, SEQ ID NO: 96

SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994. In another embodiment, the nucleic acid has a length of at least 30, 50, 100, 150, 200, 250, 300, 307, 350, 400, 450, 500 , 550, 600, 650, 700, 750, 800, 9, 9, 9 and 99 9 9

9

4 «« 9

99

9 9

9 999

9 9 9

9 9 9

99

9 9

9 9

9 9 9

9 9 «♦ · ·

850, 900, 949, or 950 nucleotides. The term hybridizes under stringent conditions, as used herein, refers to hybridization and wash conditions under which nucleotide sequences of at least 60% identical remain bound to each other. Preferably, the conditions are such that the sequences at least about 70%, more preferably at least about 80%, more preferably at least about 85% or 90% identical, hybridize to each other.

Such stringent conditions are known to those skilled in the art and are disclosed in Current Protocols in Molecular Biology, Ausubel et al., Eds., John Wiley & Sons, Inc. (1995), sections 2, 4 and 6. Further stringent conditions may be found in Molecular Cloning: A Laboratory Manual, Sambrook et al., Cold Spring Harbor Press, Cold Spring Harbor, NY (1989), Chapters 7, 9 and 11. A preferred example of stringent hybridization conditions is hybridization in 4X sodium chloride / sodium citrate (SSC) at about 65-70 ° C (or alternatively hybridization in 4X SSC plus 50% formamide at about 42-50 ° C) followed by one or more washes in 1X SSC, at about 65-70 ° C. A preferred example of stringent hybridization conditions is hybridization in IX SSC, at about 65-70 ° C (or alternatively hybridization in IX SSC plus 50% formamide at about 42-50 ° C) followed by one or more washes in 0.3X SSC, at about 65-70 ° C. A preferred example of reduced stringency hybridization conditions is 4X SSC hybridization at about 50-60 ° C (or alternatively hybridization in 6X SSC plus 50% formamide at about 40-45 ° C) followed by one or more 2X SSC washes, at about 50-60 ° C. Values within the stated limits eg 65-70 ° C or at 42-50 ° C also fall within the scope of the present invention. SSPE (1xSSPE is 0.15 M NaCl, 10 mM NaH ₂ PO ₄ , and 1.25 mM EDTA, pH 7.4) can be used instead of SSC (1X SSC is 0.15 M NaCl and 15 mM sodium citrate) in hybridization and wash buffers; washes are performed for 15 minutes after completion of each 6

· • * · · · · · · · · · · ·

4 · · <

hybrídizace. The hybridization temperature for hybrids with an expected length of less than 50 pairs of baffles should be 5-10 ° C below the melting temperature (T _m ) of the hybrid, where T _m is determined according to the following equation. For hybrids smaller than 18 pairs, T _m (° C) = 2 (# A +)

T bases) + 4 (# G + C bases). For hybrids of lengths 18 and 49, T _m (° C) = 81.5 + 16.6 (log ₁₀ [Na ⁺ ]) + 0.41 (% G + C) - (600 / N), where N is the number of bases in the hybrid and [Na ⁺ ] is the concentration of sodium ions in the hybridization buffer ([Na ⁺ ] for 1X SSC = 0.165 M). It is also known to those skilled in the art that additional agents may be added to the hybridization and / or wash buffers to reduce non-specific hybridization of nucleic acid molecules to membranes, e.g., nitrocellulose or nylon membranes, including, for example, blocking agents DNA), detergents (eg, SDS), chelating agents (eg, EDTA), Ficoll, PVP and the like. When using nylon membranes, an example of stringent hybridization conditions is hybridization in 0.25-0.5 M NaH ₂ PO ₄ , 7%

SDS at about 65 ° C followed by one or more washes with 0.02 M NaH ₂ PO ₄ , 1% SDS at 65 ° C (see, eg, Church and Gilbert (1984) Proc. Natl. Acad. Sci. USA 81: 1991-1995), or alternatively 0.2X SSC, 1% SDS.

Preferably, the isolated nucleic acid molecules of the present invention that hybridize under stringent conditions to SEQ ID NO: 1 correspond to a natural nucleic acid molecule. The term natural nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in the natural state (e.g., encodes a natural protein).

In addition to the natural allelic variant of the PCIP sequence that may exist in the population, it will be understood by those skilled in the art that within the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, · · · · · · · · · · · · · · · · · · · · · · · ·

SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO

NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO NO: 31, SEQ ID NO NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 SEQ ID NO: 46 SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO. 50, SEQ ID NO NO. 52, SEQ ID NO NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 SEQ ID NO: 71 SEQ ID NO: 74, SEQ ID NO: 7 5 SEQ ID NO: 77, SEQ ID NO NO: 79, SEQ ID NO NO: 8 0 SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86 SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO NO: 96, SEQ ID NO NO: 98, SEQ ID NO: 100, or 1 SEQ ID NO: 102, or nucleotide sequence

the DNA sequences of the plasmid insert deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994 may be mutated to introduce changes that cause changes in the amino acid sequence of the encoded PCIP proteins without impairing the functional ability of the PCIP proteins. For example, they may be in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ.

SEQ ID NO: 13, SEQ SEQ ID NO: 15, SEQ SEQ ID NO: 17, SEQ SEQ ID NO: 19; NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 7 9 SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102,

or in the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939,

98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, nucleotide substitutions resulting in amino acid substitutions at non-essential amino acid residues were made. Non-essential · · · · · · · · · An amino acid residue is a residue that can be altered in the native PCIP sequence (e.g., SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NQ: 10 SEQ ID NO: 12

SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID

NO: 103, or SEQ ID NO: 109) without altering biological activities, while an essential amino acid residue is required for biological activity. For example, amino acid residues that are conserved among the PCIP proteins of the present invention are particularly unsuitable for alteration. Furthermore, other amino acid residues that are conserved between the PCIP proteins of the present invention and other members of the PCIP protein family are also not suitable for alteration.

Therefore, another aspect of the present invention pertains to nucleic acid molecules encoding PCIP proteins that contain changes in amino acid residues that are not essential for activity. Such PCIP proteins differ in amino acid sequence from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 SEQ ID NO: 16

SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

99: 99, SEQ ID ΝΟ: 101, SEQ ID ΝΟ: 103, or SEQ ID ΝΟ: 109, and still retain biological activity. In one embodiment, an isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more percent identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO.

NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 102 1, or SEQ ID NO: 109.

An isolated nucleic acid molecule encoding a PCIP protein homologous to a protein of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO.

NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ NO NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 8 9 SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 102 1, or

SEQ ID NO: 109 can be generated by inserting one or more nucleotide substitutions, additions, or deletions into the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO

NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25

73 ·· · • · · * · • · · • • · · · • • · · • • • · · · • · · • · · · · • 1 · 1 • · · · • · · · • · • · • · • · · • · • · • · · · • • • · • · SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO NO. 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO NO. 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO NO. 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO NO. 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or nucleotide sequence: DNA

a plasmid insert deposited with the ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, such that one or more amino acid substitutions, additions, or deletions are inserted into the encoded protein. The mutations can be inserted into SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13,

SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or: SEQ ID NO: 102, or to

nucleotide sequences of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, using standard techniques such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more non-essential amino acid residues. A conservative amino acid substitution is one in which there is a substitution in which the term &quot; The amino acid residue has been replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families are amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), polar uncharged side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (eg alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, phenylalanine , tryptophan, histidine). Thus, the putative nonessential amino acid residue in the PCIP protein is preferably replaced by another amino acid residue from the same side chain group. Alternatively, in another embodiment, mutations can be inserted randomly into all or part of a PCIP coding sequence, for example, by saturation mutagenesis, and the resulting mutants can be assayed for PCIP biological activity to identify mutants that retain activity. After mutagenesis of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ. ID

NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID

NO: 100, or SEQ ID NO: 102, or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession number • 9

98 9 • · · · »·

9 · · 99

9999 99 99 999

9 9 9 9 9

99 99

98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, the encoded protein can be expressed recombinantly and activity determined protein.

In a preferred embodiment, the mutant PCIP protein can be tested for the ability to (1) interact with (e.g., bind to) a potassium channel protein or a portion thereof; (2) regulate the phosphorylation state of a potassium channel protein or portion thereof; (3) associate with (e.g., bind to) calcium and act as calcium-dependent kinases, e.g., phosphorylate the potassium channel in a calcium-dependent manner; (4) associate with (e.g., bind to) calcium, and act as calcium-dependent transcription factors; (5) modulate potassium channel mediated activities in cells (eg, neurons or heart cells), for example, to favor the cells; (6) modulate the release of neurotransmitters; (7) modulate membrane excitability; (8) affect the resting potential of the membranes; (9) modulate waveforms and action potential frequencies; and (10) modulate the excitation thresholds.

In addition to the nucleic acid molecules encoding the PCIP proteins described above, another aspect of the present invention relates to isolated nucleic acid molecules that are antisense to these molecules. The antisense nucleic acid comprises a nucleotide sequence that is complementary to the coding nucleic acid encoding the protein, eg, complementary to the coding strand of the double-stranded cDNA molecule or complementary to the mRNA sequence. Thus, the antisense nucleic acid can be bound by a hydrogen bond to the encoding nucleic acid. The antisense nucleic acid may be complementary to all or part of the PCIP coding strand. In one embodiment, the antisense molecule is 9 tons. 9 tons. · · 9 / O 9 9 9 99 9 9 99 9

The antisense nucleic acid is the coding region of the coding strand of the nucleotide sequence encoding PCIP. The term coding region refers to a region of a nucleotide sequence comprising codons that are translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense to the non-coding region of the coding strand of the nucleotide sequence encoding PCIP. The term non-coding region refers to 5 'and 3' sequences adjacent to the coding region that are not translated into amino acids (i.e., sequences also referred to as 5 'and 3' untranslated regions).

According to the coding strand of the PCIP coding sequence described herein, the antisense nucleic acid of the present invention can be designed according to Watson and Crick pairing rules. The antisense nucleic acid molecule may be complementary to the entire coding region of the PCIP mRNA, but is preferably an oligonucleotide that is antisense to only a portion of the coding or non-coding region of the PCIP mRNA. For example, the antisense oligonucleotide may be complementary to a region adjacent to a PCIP mRNA translation start site. Antisense oligonucleotides may be, for example, about 5, 10, 15, 20, 25, 30,

35, 40, 45 or 50 nucleotides. The antisense nucleic acid of the present invention can be prepared using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (eg, an antisense oligonucleotide) may be chemically synthesized using natural nucleotides or variously modified nucleotides designed to enhance the biological ability of the molecules or to enhance the physical ability of a duplex formed between the antisense and coding nucleic acid, e.g. · · · ··· · 4 · ·

4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 . Examples of modified nucleotides that can be used to generate antisense nucleic acid are 5-fluorouracil, 5-bromuracil, 5-chloruracil, 5-ioduracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thi thiomethyl-2-thi 5-carboxymethylaminomethyluracil, dihydrouracil, beta-Dgalactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, 7-methylcytosine, 7-methylcytosine, methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, 5-quiosine, 2-thiosine, 2-thiosine, 2-methyl -thiouracil, 2-thiouracil, 4thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using expression of a vector into which the nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid to a cell in an antisense orientation to a target nucleic acid, as described in more detail in the next section).

The antisense nucleic acid molecules of the present invention are usually administered to individuals or generated in situ by hybridizing to or binding to cellular mRNA and / or genomic DNA encoding a PCIP protein and thereby inhibiting protein expression, e.g., by inhibiting transcription and / or translation. Hybridization may be conventional nucleotide complementarity, resulting in stable duplex formation, or 78%. For example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, it may be a hybridization caused by specific interactions in the main groove. Double helix. An example of a method of administering the antisense nucleic acid molecules of the present invention is by direct injection into the tissue. Alternatively, the antisense nucleic acid molecule may be modified for targeted administration to selected cells and then administered systemically. For example, for systemic administration, the antisense molecule may be modified to specifically bind to receptors or antigens expressed on the surface of selected cells, eg, by binding antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of the strong pol II or pol III promoter are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the present invention is an α-anomeric nucleic acid molecule. The aanomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNAs in which, in contrast to conventional β-subunits, the strands are parallel to one another (Gaultier et al. (1987) Nucleic Acids Res. 15: 6625-6641). The antisense nucleic acid molecule may also comprise a 2'-o-methylribonucleotide (Inoue et al. (1987)

Nucleic Acids Res. 15: 6131-6148) or a chimeric RNA-DNA analog (Inoue et al. (1987) FEBS Lett. 215: 327-330).

In yet another embodiment, the antisense nucleic acid of the present invention is a ribozyme. Ribozymes are * 9 · 9 · 9 9

9999 9 9 99

9

Catalytic RNA molecules with ribonuclease activity capable of cleaving single stranded nucleic acids, such as mRNA, to which they contain a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334: 585-591)) can be used to catalytically cleave PCIP mRNA transcripts and thereby inhibit the translation of PCIP mRNA. A ribozyme with specificity for PCIP-encoding nucleic acids can be designed according to the nucleotide sequence of the PCIP cDNA described herein (i.e., SEQ ID NO: 1, SEQ ID NO: 3 SEQ.

SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 SEQ ID NO: 11 SEQ ID NO: 13 SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 4 6 SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96,

SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or according to the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994). For example, a Tetrahymena L-19 IVS RNA derivative may be prepared in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in the PCIP-encoding mRNA. See, eg, Cech et al. U.S. Pat. U.S. Patent No. 4,987,071; and Cech et al. U.S. Pat. U.S. Patent No. 5,116,742. Alternatively, PCIP mRNA can be used to select catalytic RNA having specific ribonuclease activity from the group of RNA molecules. See, e.g., Bartel, D. and Szostak, J.W. (1993) Science 261: 1411-1418.

Alternatively, expression of the PCIP gene may be inhibited by the targeted

9 9 9 9 99 9 9 99 99 9

9999 99 99 9 9 · * 9 • 9 9 9 · 9 99 9 9 • 999 99 99 99 ·· 9 9 by affecting a nucleotide sequence complementary to the regulatory region of the PCIP (eg, PCIP promoter and / or enhancer) to form a triple helix that prevents transcription of the PCIP gene in target cells. See Helene, C. (1991) Anticancer Drug Des. 6 (6): 569-84; Helene, C. et al. (1992) Ann. N.Y.

Acad. Sci. 660: 27-36; and Maher, L.J. (1992) Bioassays 14 (12): 807-15.

In yet another embodiment, the PCIP nucleic acid molecules of the present invention can be modified in the base, carbohydrate moiety or phosphate backbone to improve the ability, hybridization, or solubility of the molecule. For example, the deoxyribosophosphate backbone of a nucleic acid molecule can be modified to yield a peptide nucleic acid (see Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4 (1): 5-23). The terms peptide nucleic acid or PNA refer to nucleic acid mimic compounds, eg DNA, in which the deoxyribosophosphate backbone is replaced by a pseudopeptide backbone and only four conventional nucleobases are retained. The neutral PNA backbone has been shown to allow specific hybridization to DNA and RNA under low ion conditions. PNA oligomer synthesis may be performed using standard solid phase peptide synthesis protocols as described in Hyrup B. et al. (1996) supra; Perry O'Keefe et al. Why. Nati. Acad. Sci. 93: 14670-675.

PNA PCIP nucleic acid molecules can be used in therapeutic and diagnostic applications. For example, PNAs may be used as antisense or antigenic agents for sequence-specific modulation of gene expression, for example, by inducing transcriptional or translational arrest or inhibiting replication. PNA PCIP nucleic acid molecules can also be used in single base pair mutation analysis

* 99 · 99 · 99 99

9 9

In a gene (eg, PNA-directed PCR clamping); as 'artificial restriction enzymes' when used in combination with other enzymes, (eg, S1 nucleases (Hyrup B. (1996) supra)); or as probes or primers for DNA sequencing or hybridization (Hyrup B. et al. (1996) supra; Perry-O'Keefe, supra).

In another embodiment, PNAs of PCIPs may be modified (eg, to enhance their stability or uptake in cells) by binding lipophilic or other helper groups to PNAs, forming PNA-DNA chimeras, or using liposomes or other drug delivery techniques known in the art. For example, PNA-DNA chimeras of PCIP nucleic acid molecules that can combine the beneficial properties of PNA and DNA may be prepared. Such chimeras allow DNA recognition enzymes (eg, RNAse H and DNA polymerase) to interact with a moiety, while the PNA moiety confers high binding affinity and specificity. PNA-DNA chimeras can be coupled using linkers of appropriate length, selected by base size, number of nucleobase linkages, and orientation (Hyrup B. (1996), supra). Synthesis of PNA-DNA chimeras can be performed as described in Hyrup B. (1996), supra and Finn P.J. et al. (1996) Nucleic Acids Res. 24 (17): 3357-63. For example, the DNA strand may be synthesized on a solid support using standard phosphoramidite coupling reagents and modified nucleoside analogs, e.g., 5 '- (4-methoxytrityl) amino-5'-deoxy-thymidine-phosphoramidite may be used between the PNA and the 5' end of the DNA ( Mag, M. et al (1989) Nucleic

Acid Res. 17: 5973-88). PNA monomers are then sequentially linked to give a chimeric molecule with a 5 'PNA segment and a 3' DNA segment (Finn P.J. et al. (1996), supra).

Alternatively, chimeric molecules can be synthesized with a 5 'DNA segment and a 3' PNA segment (Peterser, K. H. et al. (1975)

Bioorganic Med. Chem. Lett. 5: 1119-11124).

• 44

• 4 · ·· 4

4445 · 4 • ·

In another embodiment, the oligonucleotide may contain additional linked moieties, such as peptides (eg, to target a host cell receptor in vivo), or agents facilitating transport across cell membranes (see, eg, Letsinger et al. (1989) Proc. Natl. Acad. Sci., US 86: 6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. USA 84: 648-652; PCT Application No. WO88 / 09810) or the blood-brain barrier (see, e.g., PCT Application No. WO89 / 10134). In addition, oligonucleotides may be modified by hybridization with activated cleavage agents (see, eg, Krol et al. (1988) Bio-Technik 6: 958-976) or intercalating agents. (See, eg, Zon (1988) Pharm. Res. 5: 539-549). Thus, the oligonucleotide may be conjugated to another molecule (eg, a peptide, a hybridization-activated crosslinker, a transport agent, or a hybridization-activated cleavage agent).

II. Isolated PCIP proteins and anti-PCIP antibodies

One aspect of the present invention relates to isolated PCIP proteins and biologically active portions thereof, as well as polypeptide fragments suitable for use as immunogens for inducing anti-PCIP antibodies. In one embodiment, native PCIP proteins can be isolated from cells or tissues by a suitable purification scheme using standard protein purification techniques. In another embodiment, the PCIP proteins are produced by a recombinant DNA technique. Alternatively to recombinant expression, the PCIP protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques.

An isolated or purified protein or biologically active portion thereof is substantially free of cellular material or • · · · · ·· ·· ·· • · · · · · ··· _Λ * · ··· · · · «· ca * Β other contaminating proteins from cells or tissues of which the PCIP protein is a β β β β β β IP β IP β IP IP IP β obtained or significantly free of chemical precursors or other chemical agents when synthesized chemically. Significantly cellular-free refers to PCIP protein preparations in which the protein is separated from the cellular components from which it is isolated or recombinantly produced. In one embodiment, the term substantially free of cellular material refers to PCIP protein preparations comprising less than about 30% (by dry weight) of a non-PCIP protein (also referred to herein as a contaminating protein), preferably less than about 20% of a non-PCIP protein, even more preferably less than about 10% of the non-PCIP protein, and most preferably less than about 5% of the non-PCIP protein. When the PCIP protein or biologically active portion thereof is recombinantly produced, it is also preferably significantly free of the culture medium, ie, the culture medium constitutes less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the protein preparation.

Significantly free of chemical precursors or other chemical reagents refers to PCIP protein preparations in which the protein is separated from chemical precursors or other chemical reagents used in protein synthesis. In one embodiment, a term substantially free of chemical precursors or other chemical agents refers to PCIP protein preparations comprising less than about 30% (by dry weight) of chemical precursors or non-PCIP chemical agents, more preferably less than about 20% chemical precursors or non-PCIP chemical agents even more preferably, less than about 10% of chemical precursors or non-PCIP chemicals, and most preferably less than about 5% of chemical precursors or non-PCIP chemicals.

9 · • 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9

9 9 9 9 9

9 9 · · ·

99 99

The term biologically active portion of a PCIP protein refers to a fragment of a PCIP protein that is involved in the interaction between a PCIP molecule and a non-PCIP molecule. Biologically active portions of a PCIP protein include peptides comprising an amino acid sequence sufficiently identical to or derived from the PCIP protein amino acid sequence, eg, the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 ,

SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103, or SEQ ID NO: 109, which

it contains less amino acids than complete PCIP proteins, and exhibits at least one PCIP protein activity. Typically, biologically active portions comprise a domain or motif with at least one PCIP protein activity, eg, by binding to a potassium channel subunit. The biologically active portion of the PCIP protein may be a polypeptide having, for example, a length of 10, 25, 50, 100, 200 or more amino acids. The biologically active portions of PCIP proteins can be used as target molecules in the development of agents that modulate potassium channel mediated activities.

In one embodiment, the biologically active portion of the PCIP protein comprises at least one calcium binding domain.

It will be appreciated that preferred biologically active portions of the PCIP protein of the present invention comprise at least one of the aforementioned structural domain. Biologically more advantageous · · · · · · «« «« «« «« «« «« The active portions of the PCIP protein comprise at least two of the above structural domains. Further, other biologically active portions in which additional regions of the protein are deleted can be prepared by recombinant techniques and can be tested for one or more functional activities of the native PCIP protein.

In a preferred embodiment, the PCIP protein has the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO

NO: 16, SEQ ID NO: 18 SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 SEQ ID NO: 26, SEQ ID NO NO: 28, SEQ ID NO: 30, SEQ ID NO NO: 32, SEQ ID NO NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40 SEQ NO ID: 49, SEQ ID NO. 51, SEQ ID NO NO: 53, SEQ ID NO: 55, SEQ ID NO NO: 57, SEQ ID NO NO: 59, SEQ ID NO: 70 SEQ ID NO: 72, SEQ ID NO: 76, SEQ NO NO: 78, SEQ ID NO: 81, SEQ ID NO NO: 83, SEQ ID NO: 85, SEQ ID NO NO: 87, SEQ ID NO NO: 89, SEQ ID NO: 91 SEQ ID NO: 93, SEQ ID NO: 95, SEQ NO NO: 97, SEQ ID NO: 99, SEQ ID NO NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109. In other embodiments is a PCIP protein significantly homologous with SEQ SEQ ID NO: 1, SEQ: ED NO: 3, SEQ ID NO: 6; NO: 8, SEQ ID NO NO: 10, SEQ ID NO: 12 SEQ ID NO: 14, SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 20, SEQ ID NO NO: 22, SEQ ID NO: 24, SEQ ID NO NO: 26, SEQ ID NO NO: 28, SEQ ID NO: 30 SEQ ID NO: 32, SEQ ID NO: 34 SEQ ID NO: 36 SEQ ID NO. 38, SEQ ID NO NO: 40, SEQ ID NO: 49, SEQ ID NO NO: 51, SEQ ID NO NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 SEQ ID NO: 72, SEQ ID NO NO: 76, SEQ ID NO. 78, SEQ ID NO NO: 81, SEQ ID NO NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89 SEQ NO ID: 91, SEQ ID NO: 93, SEQ ID NO NO: 95, SEQ ID NO: 97, SEQ ID NO NO: 99, SEQ ID NO NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109, and retains

functional activities of the protein of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, ··· ·

SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 7 8 SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103 i, or SEQ ID

NO: 109, although different in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in Section I, supra. Accordingly, in another embodiment, the PCIP protein comprises at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% amino acid sequence, 98% or more identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO.

NO: 12, SEQ ID NO: 14, SEQ ID NO: 16 SEQ ID NO: 18, SEQ ID NO: 20 SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO NO: 26, SEQ ID NO: 28, SEQ ID NO NO: 30, SEQ ID NO: 32, SEQ ID NO: 34 SEQ ID NO: 36, SEQ ID NO: 38 SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO NO: 51, SEQ ID NO: 53, SEQ ID NO NO: 55, SEQ ID NO: 57, SEQ NO NO: 59, SEQ ID NO: 70, SEQ ID NO: 72 SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO NO: 81, SEQ ID NO: 83, SEQ ID NO NO: 85, SEQ ID NO: 87, SEQ NO ID: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO NO: 99, SEQ ID NO. 101, SEQ ID NOŮ 103, or SEQ: NO NO: 109.

The isolated proteins of the present invention, preferably the 1v, 9q, p19, W28559, KChIP4a, KChIP4b, 33b07, 1p, or 7s proteins, have an amino acid sequence sufficiently identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO

NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78,

• «4 5 6 7 8 9 9 9 9 9

9 9 9 99 9 9 9

9999 9 9 99 9 9 9 9

9 9 9 9 9

SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO

NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97,

SEQ NO NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ NO NO: 109 or are encoded by the nucleotide sequence sufficiently identical se SEQ ID NO: 1, SEQ ID NO: 3 SEQ ID NO: 5, SEQ ID NO: 7 SEQ ID NO: 9, SEQ ID 1 NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17 SEQ ID NO: 19 SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO NO: 27, SEQ ID NO NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35 SEQ ID NO: 37 SEQ ID NO: 39, SEQ ID NO: 46; 47, SEQ ID NO NO: 48, SEQ ID NO NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56 SEQ ID NO: 58 SEQ ID NO: 69, SEQ ID NO: 71; 74, SEQ ID NO NO: 75, SEQ ID NO NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ NO NO: 82, SEQ NO ID: 84, SEQ ID NO: 86, SEQ ID NO: 88; 90, SEQ ID NO NO: 92, SEQ ID NO NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ NQ ID: 100

or SEQ ID NO: 102. The term sufficiently identical as used herein refers to a first amino acid or nucleotide sequence that comprises a sufficient or minimum number of identical or equivalent (e.g., amino acid residues with similar side chains) amino acid residues or nucleotides as compared to the second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences share common structural domains or motifs and / or the same functional activities. For example, amino acid or nucleotide sequences that share common structural domains have at least 30%, 40%, or 50% identity, preferably 60% identity, more preferably 70% -80%, and even more preferably 90-95% identity in the amino acid sequence of domains and containing at least one and preferably two structural domains or motifs are considered to be sufficiently identical herein. Further, amino acid or nucleotide sequences having at least 30%, 40%, or 50%, preferably 60%, more preferably 70-80%, or 90-95% identity and having common functional activities are considered herein to be sufficiently identical.

9 9

9 9 9 ·· «« «· •

9999 8 • * · · **

* 999 9 9 9

9 9 9 9 9

9 9 9 9 9

99 99

Preferred proteins are PCIP proteins having at least one calcium binding domain and preferably PCIP activity. Other preferred proteins are PCIP proteins having at least one calcium binding domain, and are preferably encoded by a nucleic acid molecule having a nucleotide sequence that hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3 SEQ SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11,

SEQ ID NO: 13 SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO NO: 23, SEQ ID NO: 25, SEQ ID NO NO: 27, SEQ ID NO NO: 29, SEQ ID NO: 31 SEQ ID NO: 33, SEQ ID NO: 35 SEQ ID NO: 37 SEQ ID NO. 39, SEQ ID NO NO: 4 6 SEQ ID NO: 47, SEQ ID NO NO: 48, SEQ ID NO NO: 50, SEQ ID NO: 52 SEQ ID NO: 54, SEQ ID NO: 56 SEQ ID NO: 58 SEQ ID NO. 69, SEQ ID NO NO: 71, SEQ ID NO. 74, SEQ ID NO NO. 75, SEQ ID NO NO: 77, SEQ ID NO-79, SEQ ID NO: 80, SEQ ID NO: 82 SEQ ID NO: 84 SEQ ID NO: 86, SEQ ID NO NO: 8 8 SEQ ID NO: 90, SEQ ID NO NO. 92, SEQ ID NO NO: 94, SEQ ID NO: 96 SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102.

To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal alignment (e.g., gaps for optimal alignment can be inserted into one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences can be eliminated for comparison purposes). In a preferred embodiment, the length of the reference sequence assigned in the comparison is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and most preferably at least 70%, 80%, or 90% of the length of the reference sequence (e.g. we compare the second sequence with the PCIP amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14,

SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO.

89 • * 9 • · · t 9 9 · • · • 9 • · • · 99 · « « · «« • · • · • 9 • ·· ♦ • • · 9 9 9 9 · NO: 24, SEQ ID NO: 26, SEQ ID NO NO: 28, SEQ ID NO: 30 SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO. 38, SEQ ID NO NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO NO: 101, SEQ ID NO: 103 >, or SEQ ID

NO: 109 having 177 amino acid residues, thus assigning at least 80, preferably at least 100, more preferably at least 120, even more preferably at least 140, and most preferably at least 150, 160 or 170 amino acid residues). The amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the position at the corresponding location in the second sequence, the molecules at that position are identical (the term "amino acid or nucleic acid identity is equivalent to the homology" of amino acids or nucleic acids). The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap required to optimally assign the two sequences.

Sequence comparison and percent identity determination between two sequences can be performed using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch algorithm (J. Mol. Biol. (48): 444-453 (1970)), which is used in the GAP program in GCG software (which is available from at http://www.gcg.com), using either Blosum 62 matrix, or PAM250 matrix, and weight gaps 16, 14, 12, 10, 8, 6, or 4, and scales for length 1, 2, 3 , 4, 5, or 6. In yet another preferred embodiment, the percent identity between the two is one of the following: GCG program by nucleotide sequences determined using GAP software (which is available at http://www.gcg.com), using NWSgapdna.CMP matrix and weight gaps 40, 50, 60, 70, or 80 aa scales for lengths of 1, 2, 3, 4, 5, or 6. V in another embodiment, the percent identity between two amino acid or nucleus determined using the E. Meyer and W. Miller algorithm (CABIOS, 4: 11-17 (1989)), which is used in the ALIGN program (version 2.0 or 2.0U), using a PAM120 residue weight table, a penalty gap length 12 and gap penalty 4.

Further, the nucleic acid and protein sequences of the present invention may be used as a requirement sequence for performing public database searches, for example, to identify other family members or related sequences. Such searches may be performed using NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215: 403-10. BLAST nucleotide searches can be performed with the NBLAST program, score =

100, wordlength = 12, to obtain a nucleotide sequence homologous to the PCIP nucleic acid molecule of the present invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3, to obtain an amino acid sequence homologous to the PCIP protein molecules of the present invention. Gapped BLAST, as described in Altschul et al., (1997) Nucleic Acids Res. 25 (17): 3389-3402. When using BLAST and Gapped BLAST programs, the error parameters of the respective programs (eg XBLAST and NBLAST) can be used. See http: //www.ncbi.nlm.nih. gov.

The invention also provides PCIP chimeric or fusion proteins. The term PCIP chimeric protein or fusion protein refers to a PCIP polypeptide operably linked to a nonPCIP polypeptide. PCIP polypeptide refers to a polypeptide having an amino acid sequence corresponding to PCIP, while non-PCIP polypeptide refers to a polypeptide having an amino acid sequence corresponding to a protein that is not significantly homologous to a PCIP protein, e.g., a protein that is different from the PCIP protein and obtained from the same or another organism . In a PCIP fusion protein, the PCIP polypeptide may correspond to all or part of the PCIP protein. In a preferred embodiment, the PCIP fusion protein comprises at least one biologically active portion of the PCIP protein. In another preferred embodiment, the PCIP fusion protein comprises at least two biologically active portions of the PCIP protein.

In a fusion protein, the term operably linked indicates that the PCIP polypeptide and the non-PCIP polypeptide are fused in frame to each other. The non-PCIP polypeptide may be fused to the N-terminus or C-terminus of the PCIP polypeptide.

For example, in one embodiment, the GST-PCIP fusion protein is a fusion protein in which the PCIP sequence is fused to the C-terminus of the GST sequence. Such fusion proteins may facilitate the purification of recombinant PCIPs.

In another embodiment, the fusion protein is a PCIP protein comprising a heterologous signal sequence at its N-terminus. In some host cells (eg, mammalian host cells), the expression and / or secretion of PCIP can be increased using a heterologous signal sequence.

The PCIP fusion proteins of the present invention can be incorporated into pharmaceutical compositions and can be administered to individuals in vivo. PCIP fusion proteins can be used to affect the bioavailability of a PCIP substrate. Using PCIP

fusion proteins may be useful therapeutically for the treatment of potassium channel associated disorders such as CNS diseases, e.g., neurodegenerative diseases such as Alzheimer's disease, Alzheimer's disease-related dementias (such as Pick's disease), Parkinson's and other diffuse Lewy-related diseases corpuscles, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, spinocerebellar ataxia, and Jakob-Creutzfield's disease; psychiatric disorders such as depression, schizophrenic disorders, Korsakoff's psychosis, mania, anxiety disorders or phobias; learning or memory disorders, eg amnesia or age-related memory loss; and neurological diseases; eg migraine. The use of PCIP fusion proteins may also be useful for the treatment of potassium channel-associated disorders such as cardiovascular diseases, e.g. , bradycardia, hypertension, aortic aneurysm, coronary artery ligation, coronary artery disease, atrial fibrillation and congestive heart failure.

Further, the PCIP-fusion proteins of the present invention can be used as immunogens for the production of anti-PCIP antibodies in an individual, for purification of PCIP ligand, and in screening assays to identify molecules that inhibit the interaction of PCIP with a PCIP substrate.

Preferably, the PCIP chimeric or fusion protein of the present invention is produced by a standard recombinant DNA technique. For example, DNA fragments encoding different polypeptide sequences are ligated together in a reading frame using conventional techniques, for example, using sticky or blunt techniques.

QT · ···· ·· ·· ··· ·.

Ends for ligation, digest with restriction enzymes to obtain suitable ends, add sticky ends as needed, alkaline phosphatase treatment to prevent unwanted coupling and enzymatic ligation is performed. In another embodiment, the fusion gene can be synthesized using conventional techniques, including automated DNA synthesis. Alternatively, PCR amplification of gene fragments can be performed using anchoring primers that generate complementary overlaps between two adjacent gene fragments, which can then be heat treated and reamplified to yield a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds.

Ausubel et al. John Wiley & Sons: 1992). Further, there are many commercially available expression vectors that already encode a fusion moiety (eg, a GST polypeptide). PCIP-encoding nucleic acids can be cloned into such expression vectors such that the fusion is read-bound to the PCIP protein.

The present invention also relates to variants of PCIP proteins that act as PCIP agonists (mimetics) or as PCIP antagonists. Variants of PCIP proteins may be prepared by mutagenesis, eg, by discrete point mutation or truncation of the PCIP protein. PCIP protein agonists may retain substantially the same - or a portion - of the biological activities of the natural form of PCIP protein. A PCIP protein antagonist may inhibit one or more activities of the wild-type form of PCIP protein, for example, by competitively modulating activities mediated by the potassium channel of the PCIP protein. Thus, specific biological effects can be achieved by administering a variant with reduced function. In one embodiment, treatment of a single variant with limited biological activity of the native protein has fewer side effects in the individual than treatment with the native form of PCIP protein.

• ··· • ·

In one embodiment, PCIP protein variants that act as PCIP agonists (mimetics) or PCIP antagonists can be identified by screening combinatorial libraries of mutants, for example, truncated mutants, PCIP protein for agonist or antagonist activity with respect to PCIP protein. In one embodiment, a large library of PCIP variants is generated by combinatorial mutagenesis at the nucleic acid level, and the library is encoded by a large gene library. An extensive library of PCIP variants can be produced, for example, by enzymatic ligation of a mixture of synthetic oligonucleotides into a gene sequence such that a degenerate set of potential PCIP sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (eg for phage display) containing a set of PCIP sequences . There are various methods that can be used to produce libraries of potential PCIP variants from a degenerate oligonucleotide sequence. Chemical synthesis of the degenerate gene sequence may be performed on an automated DNA synthesizer, and the synthetic gene may then be ligated into a suitable expression vector. The use of a degenerate set of genes makes it possible to obtain in one mixture all the sequences encoding the desired set of potential PCIP sequences. Methods for the synthesis of degenerate oligonucleotides are known in the art (see, eg, Narang, S.A. (1983)

Tetrahedron 39: 3; Itakura et al. (1984) Annu. Roar. Biochem. 53: 323; Itakura et al. (1984) Science 198: 1056; Ike et al.

(1983) Nucleic Acid Res. 11: 477.

Further, libraries of PCIP protein fragment coding sequences can be used to prepare a diverse population of PCIP fragments for screening and subsequent selection of PCIP protein variants. In one embodiment, a library of coding sequence fragments can be prepared by a double-stranded PCR reaction.

QS fragment of PCIP coding sequence with nuclease under conditions where nicking occurs only about once per molecule by denaturating double stranded DNA, by renaturating the DNA to form double stranded DNA, which may contain coding / antisense pairs from various nicked products, removing the single stranded portion from the reformed duplexes by reaction with S1 nuclease, and ligating the obtained library fragments into an expression vector. In this way, an expression library that encodes the non-terminal, C-terminal, and internal fragments of various sizes from the PCIP protein can be obtained.

Several techniques are known in the art for screening gene products of combinatorial libraries produced by point mutations or truncations, and for screening cDNA libraries for gene products with a selected property. Such techniques can be adapted to rapidly screen gene libraries generated by combinatorial mutagenesis of PCIP proteins. The most commonly used techniques that are suitable for highly efficient analysis, for screening large gene libraries, typically include cloning the gene library into replicable expression vectors, transforming suitable cells with the vector library, and expressing combinatorial genes under conditions where detection of desired activity facilitates vector isolation encoding a gene whose product was detected. Recrusive ensemble mutagenesis (REM) _of a new technique which enhances the frequency of functional mutants in the libraries, can be used in • combination with the screening assays to identify PCIP variants (Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 89: 78117815, Delgrave et al (1993) Protein Engineering 6 (3): 327331).

In one embodiment, cell assays can be used to analyze a large PCIP library. For example, a library of expression vectors may be transfected into a cell line that exhibits potassium channel mediated activities. The effect of the PCIP mutant on potassium channel mediated activity can be detected, e.g., by any of the enzymatic assays or by detecting neurotransmitter release. The plasmid DNA may then be obtained from cells that exhibit inhibition, or alternatively potentiation, of potassium channel mediated activity, and individual clones may be further characterized.

The isolated PCIP protein, or a portion or fragment thereof, can be used as an immunogen to induce antibodies that bind to PCIP using standard techniques for making polyclonal and monoclonal antibodies. A complete PCIP protein may be used, or alternatively, the invention provides antigenic peptide fragments of PCIP for use as immunogens. The PCIP antigen peptide comprises at least 8 amino acid residues of the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12,

SEQ ID NO: 14 SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 20 SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 8 9 SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID

NO: 103, or SEQ ID NO: 109 and includes such an epitope of PCIP that the antibody directed against the peptide forms a specific immune complex with PCIP. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.

• · · ·

»9 · · · ····

Preferred epitopes contained in antigenic peptides are PCIP regions that are located on the surface of the protein, eg, hydrophilic regions, as well as regions with high antigenicity.

A PCIP immunogen is typically used to prepare an antibody by immunizing a suitable individual (eg, rabbit, goat, mouse or other mammal) with an immunogen. A suitable immunogenic composition may comprise, for example, recombinantly expressed PCIP protein or chemically synthesized PCIP polypeptide. The composition may further comprise an adjuvant, such as Freund's complete or incomplete adjuvant, or a similar immunostimulatory agent. Immunization of a suitable individual with an immunogenic PCIP preparation induces the generation of polyclonal anti-PCIP antibodies.

Accordingly, another aspect of the present invention relates to anti-PCIP antibodies. The term antibody as used herein refers to an immunoglobulin molecule and an immunologically active portion thereof, i.e., molecules that retain an antigen binding site that specifically binds to (immunoreacts with) an antigen, such as PCIP. Examples of immunologically active portions of immunoglobulin molecules are F (ab) and F (ab ') 2 fragments, which can be generated by treating the antibody with an enzyme such as pepsin. The invention provides polyclonal and monoclonal antibodies that bind to PCIP. The term monoclonal antibody or monoclonal antibody preparation as used herein refers to a population of antibody molecules that contain only one type of antigen binding site capable of immunoreacting with a particular epitope of PCIP. Thus, a monoclonal antibody preparation typically has a single binding affinity for a particular PCIP protein with which it immunoreacts.

· · · · · · * * * · * * * * * * * * * * * • * *

Polyclonal anti-PCIP antibodies can be prepared as described above by immunizing a suitable individual with a PCIP immunogen. The anti-PCIP antibody titer in an immunized individual can be monitored over time using standard techniques such as enzyme-linked immunosorbent assay (ELISA) using immobilized PCIP. If desired, anti-PCIP antibody molecules can be isolated from a mammal (eg, blood) and can be further purified using well known techniques such as protein A chromatography to obtain an IgG fraction. At an appropriate time after immunization, eg, when anti-PCIP antibody titers are highest, antibody producing cells can be obtained from an individual and can be used to prepare a monoclonal antibody using standard techniques such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256: 495-497) (see also, Brown et al. (1981) J. Immunol. 127: 539-46; Brown et al. (1980) J. Biol. Chem. 255: 4980-83; Yeh et al (1976) Proc Natl Acad Sci.

USA 76: 2927-31; and Yeh et al. (1982) Int. J. Cancer 29: 269-75), a newer human B cell hybridoma technique (Kozbor et al. (1983) Immunol. Today 4:72), an EBV-hybridoma technique (Cole et al. (1985), Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, Inc., Pp. 77-96) or the trioma technique. The technology for producing hybridomas for monoclonal antibodies is well known (generally see H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyzes, Plenum Publishing Corp., New York, New York (1980); EA Lerner (1981) Yale J. Biol Med, 54: 387-402, ML Gefter et al (1977) Somatic Cell Genet.

3: 231-36). Briefly, an immortalized cell line (usually myeloma) is fused to lymphocytes (usually splenocytes) from mammals immunized with a PCIP immunogen as described above, and the supernatants of the obtained hybridoma cells are screened to identify hybridomas.

Any of the many known protocols used to fuse lymphocytes and immortalized cell lines can be used to generate an anti-PCIP monoclonal antibody (see, eg, G. Galfre et al. (1977) Nature 256: 55052; Gefter et al.

Somatic Cell Genet., Cited above; Lerner, Yale, J. Biol.

Med., Cited above; Kenneth, Monoclonal ANtibodies, cited above). In addition, it will be apparent to those skilled in the art that various variations of the methods may be employed. Typically, an immortalized cell line (eg, a myeloma cell line) is obtained from the same mammalian species as the lymphocytes. For example, mouse hybridomas can be prepared by fusing lymphocytes from mice immunized with the immunogenic composition of the present invention with an immortalized mouse cell line. A preferred immortalized cell line is a mouse myeloma cell line that is sensitive to culture medium containing hypoxanthine, aminopterin and thymidine (HAT medium). Any of many myeloma cell lines can be used as a fusion partner using standard techniques, e.g., P3-NS1 /. 1-Ag41, P3-x63-Ag8.653 or Sp2 / O-Ag14 myeloma line. These myeloma lines are available in the ATCC. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (PEG). The fusion hybridoma cells are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). The monoclonal antibody-producing hybridoma cells of the present invention are detected by screening hybridoma culture supernatants for antibodies that bind to PCIP, e.g., using standard ELISA assays.

As an alternative to the preparation of hybridomas secreting • · • ·

100 9 9 9

9999 99 99,999 · ·

9 9 9 9 9

Monoclonal antibodies may be monoclonal anti-PCIP antibodies identified and isolated by screening a recombinant combinatorial immunoglobulin library (eg, an antibody phage display library) using PCIP to isolate immunoglobulin library members that bind to PCIP . Kits for generating and screening phage display libraries are commercially available (eg, Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and Stratagene SurfZAP ™ Phage Display Kit, Catalog No. 240612). Further, examples of methods and reagents suitable for use in generating and screening antibody display libraries are given, for example, in Ladner et al. U.S. Pat. U.S. Patent No. 5,223,409; Kang et al. PCT International Application No. WO 92/18619; Dower et al. PCT International Application No. WO 91/17271; Winter et al. PCT International Application WO 92/20791; Markland et al. PCT International Application No. WO 92/15679; Breitling et al. PCT International Application WO 93/01288; McCafferty et al. PCT International Application No. WO 92/01047; Garrard et al. PCT International Application No. WO 92/09690; Ladner et al. PCT International Application No. WO 90/02809; Fuchs et al. (1991) Bio / Technology 9: 1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; Griffiths et al. (1993) EMBO J12: 725-734; Hawkins et al.

(1992) J. Mol. Biol. 226: 889-896; Clarkson et al. (1991)

Nature 352: 624-628; Gram et al. (1992) Proc. Nati. Acad. Sci. USA 89: 3576-3580; Garrad et al. (1991) Bio / Technology 9: 13731377; Hoogenboom et al. (1991) Nuc. Acid Res. 19: 4133-4137; Barbas et al. (1991) Proc. Nati. Acad. Sci. USA 88: 7978-7982; and McCafferty et al. Nature (1990) 348: 552-554.

Further, recombinant anti-PCIP antibodies, such as chimeric and humanized monoclonal antibodies, containing both human and non-human moieties, which can be prepared.

101 · Using · Using · Using · · · · · · · · · · · · · · · · · · · standard recombinant DNA techniques are within the scope of the present invention. Such chimeric and humanized monoclonal antibodies may be prepared by recombinant DNA techniques known in the art, for example using the methods described in Robinson et al., International Application No. PCT / US86 / 02269; Akira, et al., European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al., European Patent Application 173,494; Neuberger et al., PCT International Application No. WO 86/01533; Cabilly et al. U.S. Pat. U.S. Patent No. 4,816,567; Cabilly et al., European Patent Application 125,023; Better et al.

(1988) Science 240: 1041-1043; Liu et al. (1987) Proc. Nati. Acad. Sci. USA 84: 3439-3443; Liu et al. (1987) J. Immunol. 139: 3521-3526; Sun et al. (1987) Proc. Nati. Acad. Sci. USA 84: 214-218; Nishimura et al. (1987) Canc. Res. 47: 999-1005;

Wood et al. (1985) Nature 314: 446-449; and Shaw et al. (1988) J.

Nati. Cancer Inst. 80: 1553-1559); Morrison, S.L. (1985) Science 229: 1202-1207; Oi et al. (1986) BioTechnik 4: 214; Winter, U.S. Pat. U.S. Patent 5,225,539; Jones et al. (1986) Nature

321: 552-525. Verhoeyan et al. (1988) Science 239: 1534; and Beidler et al. (1988) J. Immunol. 141: 4053-4060.

An anti-PCIP antibody (eg, a monoclonal antibody) can be used to isolate PCIP using standard techniques such as affinity chromatography or immunoprecipitation. An antiPCIP antibody can facilitate the purification of native PCIP from cells or recombinantly produced PCIP expressed in host cells. Further, an anti-PCIP antibody can be used to detect PCIP protein (eg, in a cell lysate or cell supernatant) to assess the level and pattern of PCIP protein expression. The anti-PCIP antibody can be used diagnostically to monitor the protein concentration in tissues in clinical testing, e.g.

· · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

1Π9 ·········· «·· · · ·········· · · · · ···

Detection may be facilitated by binding (ie, physical binding) of the antibody to a detectable substance. Examples of detectable substances are various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes are horseradish peroxidase, alkaline phosphatase, -galactosidase or acetylcholinesterase; examples of suitable prosthetic groups are streptavidin / biotin and avidin / biotin complexes; examples of suitable fluorescent materials are umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material is luminol; an example of a bioluminescent material is luciferase, luciferin and aequorin, and an example of a suitable radioactive material is ¹²⁵ L, ¹³¹ L, ³⁵ S or ³ H.

III. Recombinant expression vectors and host cells

Another aspect of the present invention relates to vectors, preferably expression vectors, containing nucleic acids encoding a PCIP protein (or portions thereof). The term vector as used herein refers to a nucleic acid molecule capable of transporting other nucleic acids bound thereto. One type of vector is a plasmid, which is a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Some vectors are capable of autonomous replication in the host cell into which they are introduced (eg, bacterial vectors comprising a bacterial origin of replication and episomal mammalian vectors). Other vectors (eg, non-episomal mammalian vectors) are integrated into the genome of the host cell upon insertion into the host cell and are therefore replicated • 4 4 4 4 ······ · · 4 4 4 «« 4 • 44 4444 4 4 4

1Λ0 4444444444444 4

J · Vw / φ φ 4444 4444 • 444 4 44 «4 44 44 together with the host cell genome. Furthermore, some vectors may direct the expression of genes to which they are operably linked. Such vectors are referred to herein as expression vectors. In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids. In the present invention, the terms plasmid and vector are interchangeable since plasmid is the most commonly used form of vector. However, other forms of expression vectors, such as viral vectors (eg, replication of defective retroviruses, adenoviruses, and adeno-associated viruses) that have equivalent functions, are also contemplated by the invention.

The recombinant expression vectors of the present invention comprise the nucleic acids of the present invention in a form suitable for expressing the nucleic acid in a host cell, meaning that the recombinant expression vectors comprise one or more regulatory cell sequences selected for the host cell used for expression that are operably linked to the nucleic acid sequence to be expressed. In a recombinant expression vector, the term operably linked means that a given nucleotide sequence is linked to a regulatory sequence in a manner that allows expression of the nucleotide sequence (eg, in an in vitro transcription / translation system or in a host cell when the vector is inserted into a host cell). The term regulatory sequence refers to promoters, enhancers, and expression elements thereof (e.g., polyadenylation signals).

Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185

Academic Press, San Diego, CA (1990). Regulatory sequences include those that control the constitutive expression of the nucleotide sequence in many types of host cells, and those that control the expression of the nucleotide sequence only in certain types of host cells (eg, tissue-specific).

ΦΦΦ · φφφφ · · ·

Φ Φ Φ · Φ Φ • · φ Φ

ΦΦΦΦ Φ ΦΦ · · • · φφφφ

104 regulatory sequence). It will be understood by those skilled in the art that the composition of the expression vector may depend on factors such as the choice of host cell to be transformed, the desired level of protein expression, and the like. Expression vectors of the present invention may be introduced into a host cell for the production of proteins or peptides, including fusion proteins or peptides encoded by a nucleic acid as described herein (eg, PCIP proteins, mutant forms of PCIP proteins, fusion proteins, and the like).

The recombinant expression vectors of the present invention can be designed to express PCIP proteins in prokaryotic or eukaryotic cells. For example, PCIP proteins can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast, or mammalian cells. Suitable host cells are described in more detail in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using the T7 promoter regulatory sequence and T7 polymerase.

Protein expression in prokaryotes is most commonly performed in E. coli using vectors containing constitutive or inducible promoters directing the expression of fusion or nonfusion proteins. Fusion vectors add a number of amino acids to the encoded protein, usually at the amino terminus of the recombinant protein. Such fusion vectors usually serve three purposes: 1) increasing expression of the recombinant protein; 2) increasing the solubility of the recombinant protein; and 3) to facilitate purification of the recombinant protein by acting as a ligand in affinity purification. It is often in fusion

· · Expres expres φ expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres expres a proteolytic cleavage site that facilitates separation of the recombinant protein from the fusion group after purification of the fusion protein. Such enzymes, and their respective recognition sequences, include Factor Xa, thrombin, and enterokinase. Typical fusion expression vectors are pGEX (Pharmacia Biotech Inc; Smith, DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), which fusion glutathione Stransferase (GST), a maltose E binding protein or protein A, respectively, to a target recombinant protein.

The purified fusion proteins can be used in assays for PCIP activity (e.g., direct assays or competitive assays described in more detail below), or to generate antibodies specific for PCIP proteins. In a preferred embodiment, the PCIP fusion protein expressed in the retroviral expression vector of the present invention is used to infect bone marrow cells, which are then transplanted to irradiated recipients. After a sufficient period of time, the pathology of the recipient is then examined (for example, after six weeks).

Examples of suitable inducible non-fusion E. coli expression vectors are pTrc (Amann et al., (1988) Gene 69: 301-315) and pET lid (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89). The expression of the target gene from the pTrc vector depends on the transcription of the RNA polymerase in the host from the hybrid trp-lac fusion promoter. The expression of the target gene from the pET lid vector depends on transcription from the T7 gn10-lac fusion promoter mediated by the co-expressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied by the host strain BL21 (DE3) or HMS174 (DE3) from a resident strain.

106 prophages carrying the T7 gnl gene under transcriptional control of the lacUV promoter.

One strategy to maximize expression of recombinant protein in E. coli is to express the protein in a host bacterium with impaired capacity for proteolytic cleavage of the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990)). 119-128). Another strategy is to alter the nucleic acid sequence to be inserted into the expression vector so that the individual codons for each amino acid are those codons that are preferably used in E. coli (Wada et al., (1992) Nucleic Acids Res. 20: 21112118). Such nucleic acid sequence alterations of the present invention can be made using standard DNA synthesis techniques.

In another embodiment, the PCIP expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisae are pYepSecl (Baldari, et al., (1987) Embo J.).

6: 229-234), pMFα (Kurjan and Herskowitz, (1982) Cell 30: 933943), pJRY88 (Schultz et al., (1987) Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, CA) , and picZ (InVitrogen Corp, San Diego, CA).

Alternatively, PCIP proteins can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors suitable for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al. (1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39.

In yet another embodiment, the nucleic acids of the present invention are expressed in mammalian cells beyond

107 · · · · · · · ♦ · «• 107 Use of mammalian expression vectors. Examples of mammalian expression vectors are pCDM8 (Seed, B. (1987) Nature 329: 840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6: 187-195). When used in mammalian cells, control functions for the expression vector are often delivered by viral regulatory elements. For example, commonly used promoters are derived from polyomavirus, Adenovirus 2, cytomegalovirus, and Simian Virus 40. For a description of other suitable expression systems for prokaryotic and eukaryotic cells, see Chapters 16 and 17 in Sambrook, J.

Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

In another embodiment, the recombinant mammalian expression vector is capable of directing nucleic acid expression preferably in certain cell types (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Examples of tissue-specific promoters are the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1: 268-277), lymphoid tissue-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43: 235-275 ), specifically T cell receptor promoters (Winoto and Baltimore (1989) EMBO J. 8: 729-733) and immunoglobulins (Banerji et al. (1983) Cell

33: 729-740; Queen and Baltimore (1983) Cell 33: 741-748), neuronspecific promoters (e.g., neurofilamental promoter; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86: 5473-5477), pancreatic-specific promoters. (Edlund et al. (1985))

Science 230: 912-916), and mammary gland specific promoters (e.g., whey promoter; U.S. Patent No. 4,873,316 and

European Patent Application No. 264,166). The invention also encompasses the use of developmentally regulated promoters, such as murine hox promoters (Kessel and Gruss (1990) Science 249: 374108) * 9 999 9 9 9

9 9 9 · 9 9 9 9 9 9 9 9

9 9 9 9 9

379) and the α-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3: 537-546).

The invention further provides a recombinant expression vector comprising a DNA molecule of the present invention cloned into an expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in a manner that allows expression (by transcription of the DNA molecule) of an RNA molecule that is antisense to PCIP mRNA. A regulatory sequence operably linked to a nucleic acid cloned in an antisense orientation may be selected to direct the continuous expression of the antisense RNA molecule in different cell types, such as viral promoters and / or enhancers, or the regulatory sequence may be selected such that direct constitutive, tissue-specific or cell-specific expression of antisense RNA. The antisense expression vector may be in the form of a recombinant plasmid, phagemid or attenuated virus in which the antisense nucleic acid is produced under the control of a highly efficient regulatory region whose activity can be determined by the type of cells into which the vector is inserted. For a description of regulation of gene expression using antisense genes, see Weintraub, H. et al., Antisense RNA as and a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 2 (1)

1986.

Another aspect of the present invention pertains to a host cell into which a recombinant expression vector of the present invention is introduced. The terms host cell and recombinant host cell are interchangeable. It should be understood that these terms refer not only to certain particular cells but also to the progeny or potential progeny of these cells. Modifications that may occur in • · 4 44 4 4 • 4 · 444 4 4 ·

444 4,444 4 4 4

44 * 4 44 44

4 4444 4444

4444 4 44 «44 44« 4

44 4

109 subsequent generations due to mutations or environmental influences, such progeny may not be identical to the original cells, but are within the scope of the invention.

The host cell may be any prokaryotic or eukaryotic cell. For example, the PCIP protein may be expressed in bacterial cells such as E. coli, insect cells, yeast, or mammalian cells (such as Chinese hamster ovary (CHO) cells or COS cells). Other suitable host cells are known to those skilled in the art.

The vector DNA may be inserted into a prokaryotic or eukaryotic cell by conventional transformation or transfection techniques. Transformation and transfection terms refer to various techniques known in the art for introducing foreign nucleic acid (eg, DNA) into a host cell, including calcium phosphate or calcium chloride coprecipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting a host cell are disclosed in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and in other laboratory manuals.

Stable transfection of mammalian cells is known that, depending on the expression vector and transfection technique, only a small fraction of the cells can integrate foreign DNA into their genome. To identify and select these integrants, usually a gene encoding a selectable marker (eg, an antibiotic resistance gene) is inserted into the host cell along with the gene of interest. Preferred selectable markers include drug resistance genes, such as G418, such as G418.

I Λ ♦ li li li li li li li liU · · U U U U U U U U U U U

hygromycin and methotrexate. The nucleic acid encoding the selectable marker may be inserted into the host cell on the same vector as the vector encoding the PCIP protein, or it may be inserted on a separate vector. Cells stably transfected with the inserted nucleic acid can be identified by drug selection (eg, cells that have incorporated a selectable marker will survive while other cells will not).

Host cells of the present invention, such as prokaryotic or eukaryotic host cells in culture, can be used to produce (i.e., express) a PCIP protein. Accordingly, the invention further provides methods for producing a PCIP protein using the host cell of the present invention. In one embodiment, the method comprises culturing a host cell of the present invention (into which a recombinant expression vector encoding a PCIP protein has been inserted) in a suitable medium such that a PCIP protein is produced. In another embodiment, the method further comprises isolating the PCIP protein from the medium or the host cell.

The host cells of the present invention can also be used to produce non-human transgenic animals. For example, in one embodiment, the host cell of the present invention is a fertilized oocyte or embryonic stem cell into which a PCIP-encoding sequence has been inserted. Such host cells can then be used to generate non-human transgenic animals into whose genome an exogenous PCIP sequence is inserted, or homologous recombinant animals in which the endogenous PCIP sequence has been altered. Such animals are useful for studying the function and / or activity of PCIP and for identifying and / or evaluating modulators of PCIP activity. The term transgenic animal refers to a non-human animal.

9 9 9 9

999 99,999 9 9 9

111 9 9999 9 9 9 9 9 9

1 X 9 9 9 99 9 9 99 9

9 9 9 9 9 99 9 9 9 9 of an animal, preferably a mammal, most preferably a rodent such as a rat or mouse, wherein one or more cells of the animal comprise a transgene. Other examples of transgenic animals are primates, sheep, dogs, cows, goats, chickens, amphibians and the like. A transgene is an exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of an adult animal, directs the expression of the encoded gene product in one or more cell or tissue types of the transgenic animal. The term homologous recombinant animal refers to a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous PCIP gene has been altered by homologous recombination between an endogenous gene and an exogenous DNA molecule inserted into an animal cell, for example an animal embryonic cell.

The transgenic animal of the present invention can be made by introducing a PCIP-encoding nucleic acid into a male pronucleus of a fertilized oocyte, eg, by microinjection, a retroviral infection, and developing the oocyte in a pseudogravid female. The PCIP cDNA sequence of SEQ ID NO: 1, SEQ ID NO: 3 of SEQ ID

NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13,

SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID N0: 100 or: SEQ ID NO: 102 can be

inserted as a transgene into the genome of a non-human animal.

Alternatively, a non-human homolog of a human PCIP gene, such as a mouse or rat PCIP gene, may be used as the transgene.

Alternatively, the homolog may be a PCIP gene, such as another member

PCIP family, isolated by hybridization to a PCIP cDNA sequence

SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO

NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17,

SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO. NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO. NO: 96, SEQ ID NO: 98, SEQ ID NO

NO: 100, or SEQ ID NO: 102 or the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939,

98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994 (as described in U.S. Pat

in section I above) and can be used as a transgene. Intron sequences and polyadenylation signals may also be included in the transgene to increase the efficiency of transgene expression. Tissue-specific regulatory sequences can be operably linked to a PCIP transgene to direct expression of PCIP protein in certain cells. Methods for preparing transgenic animals by embryo manipulation and microinjection, particularly in animals such as mice, are common in the art and are described, for example, in U.S. Pat. Nos. 4736866 and 4870009 to Leder et al. No. 4,873,191 to Wagner et al. and in Hogan, B., Manipulating Embryo Mouse, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used to produce other transgenic animals. Transgenic progeny may be identified by the presence of the PCIP transgene and its genome and / or expression of PCIP mRNA in the tissues or cells of the animal. The transgenic progeny may then be used to cross with other animals carrying the transgene. Furthermore, transgenic animals

• 9

9 9 «9 9999

113 • 9 9 9 • 9 9

carrying a transgene encoding a PCIP protein can be further crossed with other transgenic animals carrying other transgenes.

For preparing a homologous recombinant animal, a vector is prepared that comprises at least a portion of the PCIP gene into which deletions, additions, or substitutions have been introduced to alter, e.g., disrupt, the PCIP gene. The PCIP gene may be a human gene (eg, a cDNA of SEQ ID NO: 1), but more preferably is a non-human homolog of a human PCIP gene (eg, a cDNA of SEQ ID NO: 3 or 5). For example, a mouse PCIP gene can be used to construct a homologous recombinant vector suitable for altering the endogenous PCIP gene in the mouse genome. In a preferred embodiment, the vector is designed such that upon homologous recombination, the endogenous PCIP gene is functionally disrupted (i.e., no longer encodes a functional protein; this is also referred to as a knock out vector). Alternatively, the vector may be designed to mutate or otherwise alter the endogenous PCIP gene upon homologous recombination, but still to encode a functional protein (e.g., the preceding regulatory region may be altered such that the expression of the endogenous PCIP protein is altered). In a homogeneous recombinant vector, the altered portion of the PCIP gene is flanked by the 5 'and 3' ends of another nucleic acid sequence of the PCIP gene, thereby allowing homologous recombination between the exogenous PCIP gene on the vector and the endogenous PCIP gene in the embryonic stem cell. Another adjacent PCIP nucleic acid sequence is long enough for successful homologous recombination with an endogenous gene. Typically, several kilobases of contiguous DNA (at both the 5 'and 3' ends) are contained in the vector (see, eg, Thomas, KR and Capecchi, MR (1987) Cell 51: 503 for a description of vectors for homologous recombination) . The vector is inserted into an embryonic stem cell line (e.g.

electroporation) and cells in which the inserted PCIP gene homologously recombined with the endogenous PCIP gene are selected (see e.g.

* • · • a ····

114

4 4 4

Li, E. et al. (1992) Cell 69: 915]. The selected cells are then injected into animal blastocysts (e.g., mice) to obtain an aggregation chimera (see, eg, Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1987) p. 113-152). The chimeric embryo can then be implanted into a suitable pseudogravid female and the embryo can be delivered. Progeny carrying homologously recombined DNA in their germ cells can be used to cross with animals whose all cells contain homologously recombined DNA due to germline transgene transfer. Methods for constructing homologously recombined animals are further described in Bradley, A. (1991) Proud Opinion in Biotechnology 2: 823-829 and in PCT International Application Nos .: WO 90/11354, Le Mouellec et al .; WO 91/01140 to Smithies et al .; WO 92/0968 to Zijlstra et al .; and WO 93/04169 to Berns et al.

In another embodiment, non-human transgenic animals can be produced that contain systems allowing the regulated expression of the transgene. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. For a description of the cre / loxP recombinase system, see, e.g., Lakso et al. (1992) Proc. Nati. Acad. Sci. USA 89: 6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science

251: 1351-1355. When the cre / loxP recombinase system is used to regulate transgene expression, animals containing transgenes encoding both Cre recombinase and the selected protein are required. Such animals can be obtained by constructing double transgenic animals, eg, by mating two transgenic animals, wherein one comprises a transgene encoding a selected protein and the other comprises a transgene encoding a recombinase.

115 • ·· 00 04 · 4 · 0 »0 0 0 0 0 0 00 0 0 00 000 000 00000 00 00 000 0 0 0 0000 0000 0 00 00 00 00

Clones of non-human transgenic animals of the present invention can also be produced by the method described by Wilmut, I. et al. (1997) Nature 385: 810-813 and PCT International Application Nos. WO 97/07668 and WO 97/07669. Briefly, a cell, eg, a somatic cell, from a transgenic animal can be isolated and induced to exit from the growth phase and enter into the Go phase. The resting cell may then be fused, eg, by electric pulses, with enucleated oocytes from an animal of the same species as the animal from which the resting cell was isolated. The reconstructed oocyte is then cultured by developing a morula or blastocyst, which is then transferred to a suitable pseudogravid female. The progeny of the female will be a clone of the animal from which the cell, e.g., the somatic cell, has been isolated.

IV. Pharmaceutical preparations

PCIP nucleic acid molecules, fragments of PCIP proteins, and anti-PCIP antibodies (also referred to herein as active compounds) of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise a nucleic acid molecule, a protein, or an antibody, and a pharmaceutically acceptable carrier. The term pharmaceutically acceptable carrier refers to any solvent, dispersion medium, coating, antibacterial or antifungal agent, isotonicity adjusting or delaying absorption agent, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art.

Unless any conventional agent or medium is incompatible with the active compound, its possible use in the compositions is contemplated. The compositions may also contain additional active compounds.

• to • to • ii6. · ··;

• • to to • to • to • to • to • to • to this *

The pharmaceutical compositions of the present invention are formulated to be compatible with the selected route of administration. Examples of routes of administration are parenteral, eg, intravenous, intradermal, subcutaneous, oral (eg, inhalation), transdermal (topical), transmucosal, and rectal. Solutions or suspensions for parenteral, intradermal or subcutaneous administration may contain the following components: sterile diluents, such as water for injection, saline, non-volatile oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates, and tonicity adjusting agents such as sodium chloride or dextrose. The pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral formulations may be contained in ampoules, syringes or multi-dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL ™ (BASF, Parsippany, NJ) or phosphate buffered saline. In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be protected from contamination

4

4 4 4

4444

4

4444 4

444 «

117 · 4 · 4 4 4 4 4 4 4 4 4 4

44 44 44 microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, by the maintenance of a suitable particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved using various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to use isotonic agents, for example, carbohydrates, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of injectables can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound (eg, a fragment of a PCIP protein or an anti-PCIP antibody) in an appropriate amount into a suitable solvent, together with one or more of the reagents listed above, and then filter sterilizing. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the desired other ingredients set forth above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying, resulting in a powder consisting of the active compound and other ingredients obtained from the sterile filtered solution described above.

Oral compositions typically include an inert diluent and an edible carrier. Can be enclosed in gelatin capsules

Or compressed into tablets. For oral therapeutic administration, the active compound may be admixed with excipients and used in the form of tablets, lozenges or capsules. Oral compositions can also be prepared using a liquid carrier in the form of a mouthwash, wherein in such a composition the compound in the liquid carrier is orally applied and spitified or expectorated or swallowed. Pharmaceutically compatible binding agents, and / or adjuvant materials may also be included in the composition. Tablets, pills, capsules, lozenges, and the like may contain any of the following compounds or compounds of a similar nature: binders such as microcrystalline cellulose, tragacanth or gelatin; additives such as starch or lactose, disintegrants such as alginic acid, Primogel, or corn starch; glidants such as magnesium stearate or Sterotes; lubricants such as colloidal silica; sweetening agents such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

For administration by inhalation, the compounds are administered in the form of aerosol sprays from a pressurized container containing a suitable propellant such as carbon dioxide or a nebulizer.

Systemic administration may be transgucosal or transdermal. For mucosal or transdermal administration, mucosal or skin penetration enhancers are used in the compositions. Such agents are generally known in the art, and include, for example, for mucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration may be by nasal spray or suppository. For transdermal administration, the active compounds are formulated in the form of ointments, lotions, gels or creams as known in the art.

··· ·

119

The compounds may also be prepared in the form of suppositories (e.g.

using suitable suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal administration.

In one embodiment, the active compounds are formulated with carriers that protect the compound from rapid elimination from the body, to provide controlled release compositions, such as implants and microencapsulated systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid can be used. Methods for preparing such compositions are known to those skilled in the art. Such materials can also be purchased from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells using a monoclonal antibody to viral antigens) can also be used as pharmaceutically acceptable carriers. These carriers can be prepared using methods known in the art, for example, as described in U.S. Pat. No. 4522811.

It is particularly preferred to formulate oral or parenteral compositions in dosage unit form with ease of administration and uniformity of dosage. Dosage unit refers to a physically discrete unit suitable for administration as a single dose to the subject being treated, each such unit containing a predetermined amount of active compound calculated to produce the desired therapeutic effect together with the required pharmaceutical carrier. The characteristics of the dosage unit of the present invention are determined and are directly dependent on the unique characteristics of the active compound to the desired therapeutic effect, and the limitations imposed by the possibilities of processing such active compound into a composition.

120

The toxicity and therapeutic efficacy of such a compound can be determined using standard pharmaceutical procedures on cell cultures or experimental animals, eg, to determine LD50 (doses lethal to 50% of the population) and ED50 (doses therapeutically effective in 50% of the population). The ratio between toxic and therapeutic effects is referred to as the therapeutic index and is expressed as the ratio LD50 / ED50. Compounds that exhibit high therapeutic indices are preferred. Compounds with toxic side effects may also be used, but there is a need for a delivery system that targets such compounds to the affected tissue so as to minimize potential damage to uninfected cells and thus reduce adverse effects.

Data obtained from cell culture and animal assays can be used to determine human doses. Dosages of such compounds are preferably in the range of such circulating concentrations that include the ED 50 with little or no toxicity. Dosages within this range may vary depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the present invention, the therapeutically effective dose can first be estimated from cell culture assays. In animal models, a dose that is sufficient to achieve a plasma concentration including an IC 50 (i.e., the concentration of a test compound that is sufficient to achieve half maximal inhibition of symptoms) as determined in cell culture can be determined. Such information can be used to more accurately determine a human dose. Plasma concentrations can be measured, for example, by high performance liquid chromatography.

As defined herein, a therapeutically effective amount is a ·

121 of a protein or polypeptide (ie, an effective dose) in the range of about 0.001 to 30 mg / kg body weight, preferably about 0.01 to 25 mg / kg body weight, more preferably about 0.1 to 20 mg / kg body weight, and even more preferably about 1 to 10 mg / kg, 2 to 9 mg / kg, 3 to 8 mg / kg, 4 to 7 mg / kg, or 5 to 6 mg / kg of body weight. Those skilled in the art will be aware of other factors that may affect the dosage required for effective treatment of the subject, including the severity of the disease or disorder, prior treatment, general health and / or age of the subject, and other concomitant diseases. Further, treating an individual with a therapeutically effective amount of a protein, polypeptide, or antibody may be a single dose treatment, but is more preferably a series of dose treatment.

In a preferred embodiment, the subject is treated with the antibody, protein or polypeptide at a dose in the range of about 0.1 to 20 mg / kg body weight, once per week for about 1 to 10 weeks, preferably 2 to 8 weeks, more preferably about 3 to 7 weeks. , and more preferably about 4, 5, or 6 weeks. It will also be appreciated that the effective dose of the antibody, protein, or polypeptide used for treatment may increase or decrease during treatment. Dosage changes are made according to diagnostic test results as described herein.

The present invention includes agents that modulate expression or activity. For example, the agents may be small molecules. Small molecules include, for example, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (ie including heteroorganic and organometallic compounds) having a molecular weight of less than about 10,000 grams per mole, organic or inorganic compounds having a molecular

122

weight of less than about 5000 grams per mole, organic or inorganic compounds having a molecular weight of less than about 1000 grams per mole, organic or inorganic compounds having a molecular weight of less than about 500 grams per mole, and salts, esters and other pharmaceutically acceptable forms of such compounds .

It will be appreciated that appropriate dosages of small molecule agents depend on many factors known to physicians, veterinarians or researchers. The dosage of the small molecule will vary, for example, according to the identity, size and condition of the individual or sample, the manner in which the composition is administered, and the effect required on the nucleic acid or polypeptides of the present invention.

Exemplary dosages are a mg or µg dose of small molecule per kilogram of individual or sample weight (eg, about 1 µg per kilogram to about 500 mg per kilogram, about 100 µg per kilogram to about 5 mg per kilogram, or about 1 µg per kilogram to about It will further be appreciated that suitable doses of the small molecule depend on the efficacy of the small molecule with respect to the expression or activity to be modulated, such suitable doses may be determined using the assays described above. of small molecules administered to an individual (eg, a human) to modulate the expression or activity of the polypeptides or nucleic acid of the present invention, the physician, veterinarian or researcher may then prescribe a relatively low dose and then increase the dose until a satisfactory effect is achieved. realize that a specific dose for a particular is dince depends on various factors, including the activity of the specific compound used, age, body weight, general health, gender, dietary habits • · · ·

123

4 4 4444 4 4 4

4 ··· 44 · 44 444

4 4444 4444

444 44 44 44 44 individual, time of administration, route of administration, elimination rate, any combination of drugs, and the degree of expression or activity to be modulated.

Further, the antibody (or fragment thereof) may be conjugated to a therapeutic moiety such as a cytotoxin, a therapeutic agent, or a radioactive metal. A cytotoxin or cytotoxic agent is an agent that is detrimental to cells. Examples are taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracindione, mitoxantrone, mithramycin, actinomine, actinomine, actinomine, actinomine, actinomine, actinomine, and puromycin and analogs or homologues thereof. Therapeutic agents include, for example, antimetabolites (eg, methotrexate, 6-mercaptopurine, 6thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (eg, mechlorethamine, thioep, chlorambucil, melphalan, carmustine (CCNU) and lomustine (CC)) , cyclophosphamide, busulfan, dibromomanitol, streptozotocin, mitomycin C and cisdichlorodiamine-platinum (II) (DDP) cisplatin), anthracyclines (e.g. daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g. dactinomycin, mithinomycin, mithinomycin) and anthramycin (AMC)), and anti-mitotic agents (eg, vincristine and vinblastine).

The conjugates of the present invention can be used to modify a given biological response and the therapeutic moiety is not limited to classical chemical therapeutic agents. For example, the therapeutic moiety may be a protein or polypeptide having the desired biological activity. Such proteins include, for example, toxins such as abrin, ricin A, pseudomonad exotoxin or diphtheria toxin; proteins, φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ · · ·

124 such as tumor necrosis factor, α-interferon, β-interferon, nerve growth factor, thrombocyte growth factor, tissue plasminogen activator; or a biological response modifying agent such as lymphokines, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), or other growth factors.

Techniques for conjugating such therapeutic moieties to antibodies are well known, see, eg, Arnon et al., Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985);

Hellstrom et al., Antibodies For Drug Delivery, in Controlled Drug Delivery (2nd edition), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, Antibodies Carriers of Cytotoxic Agents In Cancer Therapy: A Review, in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); Analysis, Results, and Future Prospective Of The Therapeutic Use Of Radiolabeled Antibodies In Cancer Therapy, in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), p. 30316 (Academic Press 1985), and Thorpe et al., Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates,

Imunol. Rev., 62: 119-58 (1982). Alternatively, the antibody may be conjugated to a second antibody to obtain an antibody heteroconjugate as described in Segal, U.S. Pat. No. 4,676,980.

The nucleic acid molecules of the present invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors may be administered

125

0 0 0 0 · · 000000

0 0 004 · 0 0

004 0 0000 0 0 0

0000000 «0 000 0 0 • 0 0000 0000 0 4 0 0 0 ·· 00 00 00 individuals, for example by intravenous injection, topical administration (see

U.S. Patent 5,328,470) or by stereotactic injection (see e.g.

Chen et al. (1994) Proc. Nati. Acad. Sci. USA 91: 3054-3057.

The gene therapy vector pharmaceutical composition may comprise the vector in an acceptable diluent, or may contain a slow release matrix into which the gene delivery vehicle is incorporated. Alternatively, when a complete gene transfer vector independent of recombinant cells, eg, a retroviral vector, can be produced, the pharmaceutical composition may comprise one or more cells that produce the gene delivery system.

The pharmaceutical compositions may be contained in a container, package or dispenser along with instructions for administration.

V. Use and methods of the present invention

The nucleic acid molecules, proteins, protein homologs, and antibodies of the present invention can be used in one or more of the following methods: a) screening assays; (b) predictive medicine (eg, diagnostic tests, prognostic tests, monitoring of clinical studies and pharmacogenetics); and c) methods of treatment (eg, therapeutic and prophylactic). The PCIP proteins of the present invention have one or more of the following activities: (1) they can interact with (eg, bind to) a potassium channel protein or portion thereof; (2) can regulate the phosphorylation state of a potassium channel protein or portion thereof; (3) may associate with (e.g., bind to) calcium and may, for example, act as calcium-dependent kinases, e.g., phosphorylate a potassium channel or a G-protein coupled receptor in a calcium-dependent manner; (4) may associate with (e.g., bind to) calcium, and may - for example

999 «

126 • * · V · 4 4 · 9 ·

9 9 9 · · 9 9

9 9 9 act in a calcium-dependent manner in cellular processes, eg act as calcium-dependent transcription factors; (5) can modulate potassium channel mediated activities in cells (eg, neurons such as sensory neurons or motor neurons, or heart cells), for example, to favor the cell; (6) can modulate chromatin production in cells, eg, neurons or heart cells; (7) can modulate vesicle transfer and protein transport in cells, eg, neurons or heart cells; (8) can modulate cytokine signaling in cells, eg, neurons or heart cells; (9) can regulate the association of a potassium channel protein or portion thereof with a cellular cytoskeleton; (10) can modulate cell proliferation; (11) can modulate the release of neurotransmitters; (12) can modulate membrane excitability; (13) may affect the resting potential of membranes; (14) can modulate waveforms and action potential frequencies; and (15) can modulate excitation thresholds; and therefore may be used to, for example, (1) modulate the activity of a potassium channel protein or a portion thereof; (2) modulating the phosphorylation state of a potassium channel protein or a portion thereof; (3) modulating the phosphorylation state of the potassium channel or G-protein coupled receptor in a calcium-dependent manner; (4) associating with (eg, binding to) calcium, and may, for example, - act in a calcium dependent manner; (5) can modulate potassium channel mediated activities in cells (eg, neurons such as sensory neurons or motor neurons, or heart cells), for example, to favor the cells; (6) can modulate chromatin production in cells, eg, neurons or heart cells; (7) can modulate vesicle transfer and protein transport in cells, eg, neurons or heart cells; (8) can modulate cytokine signaling in cells, eg, neurons or heart cells; (9) can regulate protein association

4 4 • 4 ·

127

4

4 4

• 44

4 4

4 · 4

4 «* 4 ···« * · 4

A potassium channel or a portion thereof with a cell cytoskeleton; (10) can modulate cell proliferation; (11) can modulate the release of neurotransmitters; (12) can modulate membrane excitability; (13) may affect the resting potential of membranes; (14) can modulate waveforms and action potential frequencies; and (15) can modulate excitation thresholds;

An isolated nucleic acid molecule of the present invention can be used, for example, to express a PCIP protein (eg, using a recombinant expression vector in a host cell in gene therapy), to detect PCIP mRNA (eg, in a biological sample) or genetic alterations in the PCIP gene. , and for modulating PCIP activity as described below. PCIP proteins can be used to treat diseases characterized by insufficient or overproduction of PCIP substrate or production of PCIP inhibitors. Further, PCIP proteins may be used to screen for natural PCIP substrates, to search for drugs or compounds that modulate PCIP activity, as well as to treat diseases characterized by insufficient or overproduction of PCIP protein or production of forms of PCIP protein having reduced or aberrant activity compared to natural PCIP protein (eg, CNS diseases such as neurodegenerative diseases, eg Alzheimer's disease, dementia associated with Alzheimer's disease (such as Pick's disease), Parkinson's disease and other dementia associated with Lewy diffuse bodies, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, spinocerebellar ataxia and Jakob-Creutzfield disease, psychiatric disorders such as depression, schizophrenic disorders, Korsakoff's psychosis, mania, anxiety disorders, bipolar affective disorders or phobic disorders; learning or memory disorders, eg amnesia or age-related memory loss; Neurological • · · · · · · · ·······

128 diseases such as migraine; painful diseases, eg, hyperalgesia or pain associated with musculoskeletal disorders; spinal cord injury; stroke; head trauma; or cardiovascular diseases such as sinus node dysfunction, angina, heart failure, hypertension, atrial fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, 1 myocardial infarction, coronary artery disease, coronary artery spasm or arrhythmia). Further, the anti-PCIP antibodies of the present invention can be used to detect and isolate PCIP proteins, regulate the bioavailability of PCIP proteins, and modulate PCIP activity.

A. Screening tests:

The invention provides a method (also referred to herein as a screening assay) for identifying modulators, ie, candidate or test compounds or agents (eg, peptides, peptidomimetics, small molecules or other drugs) that bind to PCIP proteins, have stimulatory or inhibitory effect on, for example, PCIP expression or PCIP activity, or have a stimulatory or inhibitory effect on, for example, PCIP substrate expression or activity.

In one embodiment, the invention provides assays for screening for potential compounds that are substrates of a PCIP protein or polypeptide, or a biologically active portion thereof. In another embodiment, the invention provides assays for screening compounds that bind to or modulate the activities of a PCIP protein or polypeptide, or a biologically active portion thereof. Test compounds of the present invention can be obtained using any of a variety of combinatorial library approaches known in the art, including:

biological libraries; spatially distinguishable parallel • · • · · ·

Solid or solution libraries; synthetic libraries requiring deconvolution; 'one bead - one compound' libraries; and synthetic libraries using affinity chromatography selection. The method using biological libraries is limited to peptide libraries, while the other four methods are useful for peptide, non-peptide oligomer or small molecule libraries (Lam, K.S. (1997) Anticancer Drug Des. 12: 145).

Examples of methods for synthesizing a molecular library are given, for example, in: DeWitt et al. (1993) Proc. Nati. Acad. Sci. U.S.A. 90: 6909; Erb et al. (1994) Proc. Nati. Acad. Sci. USA 91: 11422; Zuckermann et al. (1994). J. Med. Chem.

37: 2678; Cho et al. (1993) Science 261: 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2061; and in Gallop et al (1994) J. Med . Chem. 37: 1233.

Compound libraries may be present in solution (eg, Houghten (1992) Biotechniques 13: 412-421), or on beads (Lam (1991) Nature 354: 82-84), chips (Fodor (1993) Nature 364: 555-556 ), bacteria (Ladner USP 5,223,409), spores (Ladner USP '409), plasmids (Culi et al. (1992) Proc Natl Acad Sci USA 89: 1865-1869) or phage (Scott and Smith (1990) Science 249: 386-390); (Devlin (1990) Science 249: 404-406); (Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87: 6378-6382); (Felici (1991) J. Mol. Biol. 222: 301-310); (Ladner, supra).

In one embodiment, the assay is a cellular assay in which a cell that expresses a PCIP protein or biologically active portion thereof is contacted with a test compound, and the ability of the test compound to modulate PCIP activity, e.g., potassium channel binding or a portion thereof is determined. Determination • 9

1ΟΛ ······· «·« * ·· 9

The ability of a test compound to modulate PCIP activity can be accomplished, for example, by monitoring the release of neurotransmitters, e.g., dopamine, from cells that express PCIP, such as are neurons, such as substantia nigra neurons, or heart cells. Further, determining the ability of a test compound to modulate PCIP activity can be accomplished, for example, by monitoring the Ito current or releasing neurotransmitters from cells that express PCIP, such as heart cells. Cell currents, e.g., Ito current, can be measured using contact electrode techniques as described in the examples and using techniques described, for example, in Hamill et al. 1981. Pfluegers Arch. 391: 85-100). For example, the cell may be a mammalian cell. Determining the ability of a test compound to modulate the ability of a PCIP to bind to a substrate can be performed, for example, by binding the PCIP substrate to a radioisotope or enzymatic label such that the binding of the PCIP substrate to the PCIP can be determined by detecting the labeled PCIP substrate in complex. For example, compounds (eg, PCIP substrates) can be labeled with 35g, 14g _of or 1 H, either directly or indirectly, and the radioisotope can be detected by direct radioemission reading or scintillation counting. Alternatively, the compounds may be enzymatically labeled using, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic marker may be detected by determining the conversion of a suitable substrate to the product.

The invention also provides a method for determining the ability of a compound (eg, a PCIP substrate) to interact with PCIP without labeling any of the interacting components. For example, a microphysiometer can be used to detect the interaction of a compound with PCIP without labeling the compound or PCIP.

McConnell, Η. M. et al. (1992) Science 257: 1906-1912. The term microphysiometer (eg, Cytosensor) refers to an analytical microscope.

ΙΟΙ ·········· ♦ ·· «

A device that measures the rate at which cells acidify their environment using a light potentiometric sensor (LAPS). Changes in acidification rate can be used as an indicator of the interactions between compounds and PCIP.

In another embodiment, the assay is a cell assay comprising contacting cells expressing a PCIP target molecule (eg, a potassium channel or fragment thereof) with a test compound and determining the ability of the test compound to modulate (eg, stimulate or inhibit) the activity of the PCIP target molecule. Determining the ability of a test compound to modulate the activity of a PCIP target molecule can be performed, for example, by determining the ability of a PCIP protein to bind or interact with a PCIP target molecule, e.g., a potassium channel or fragment thereof.

The determination of the ability of a PCIP protein or a biologically active fragment thereof to bind to or interact with a PCIP target molecule can be performed by one of the methods described above for determining direct binding. In a preferred embodiment, the determination of the ability of a PCIP protein to bind to or interact with a target molecule for PCIP can be performed by determining the activity of the target molecule. For example, the activity of the target molecule can be determined by detecting induction of second messenger molecules in the target cells (i.e. intracellular Ca ^ ^4-, diacylglycerol, IP3 etc.), detecting catalytic / enzymatic activity of the target molecule on an appropriate substrate, detecting the induction of a reporter gene (comprising a target a molecule corresponding to a regulatory element operably linked to a nucleic acid encoding a detectable marker (eg, luciferase), or by detecting a target molecule of a regulated cellular response, such as neurotransmitter release.

132

In yet another embodiment, the assay of the present invention is a cell-free assay wherein the PCIP protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to bind to the PCIP protein or biologically active portion thereof is determined. Preferred biologically active portions of PCIP proteins for use in the assays of the present invention are fragments that are involved in interactions with non-PCIP molecules, e.g.

potassium channels or fragments thereof, or fragments with high surface probability scores. Binding of the test compound to the PCIP protein can be determined either directly or indirectly as described above. In a preferred embodiment, the assay comprises contacting the PCIP protein or biologically active portion thereof with a known compound that binds to PCIP to form a test mixture, contacting the test mixture with the test compound, and determining the ability of the test compound to interact with the PCIP protein. with a PCIP protein comprises determining the ability of a test compound to preferentially bind to PCIP or a biologically active portion thereof as compared to a known compound.

In another embodiment, the assay is a cell-free assay wherein the PCIP protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to modulate (eg, stimulate or inhibit) the activity of the PCIP protein or biologically active portion thereof is determined. Determination of the ability of a test compound to modulate PCIP protein activity can be performed, for example, by determining the ability of the PCIP protein to bind to a PCIP target molecule by one of the methods described above for determining direct binding. Determination of the ability of PCIP protein to bind to

The target PCIP molecule can also be performed using technologies such as real-time biomolecular interaction analysis (BIA). Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63: 2338-2345 and Szabo et al. (1995) Curr. Opin. Struct. Biol. 5: 699-705. The term BIA refers to a technology for studying real-time biospecific interactions without labeling any of the interacting agents (eg, BIAcore). Changes in the surface phenomenon of surface plasmon resonance (SPR) can be used as an indicator of real-time reactions between biological molecules.

Alternatively, the determination of the ability of a test compound to modulate the activity of a PCIP protein can be performed by determining the ability of the PCIP protein to further modulate the activities of downstream effectors of the target molecule for PCIP. For example, the activity of an effector molecule on a suitable target molecule or the binding of effectors to a suitable target may be monitored as described above.

In yet another embodiment, the cell-free assay comprises contacting the PCIP protein or biologically active portion thereof with a known compound that binds to the PCIP protein to form a test mixture, contacting the test mixture with the test compound, and determining the ability of the test compound to interact with the PCIP protein. the test compound to interact with the PCIP protein comprises determining the ability of the PCIP protein to preferentially bind to or modulate the activity of the target molecule for PCIP.

The cell-free assays of the present invention are suitable for use in both soluble and membrane-bound forms of isolated proteins. In cell-free tests in which the membrane-bound form of the isolated is used

134

99

9

9 98 9 9 9 ·

9 9 9 9 9

It may be desirable to use a solubilizing agent to keep the isolated membrane bound protein in solution. Examples of such solubilizing agents are nonionic detergents such as n-octylglucoside, ndodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton® X-100, Triton® X-114,

Thesit®, isotridecypoly (ethylene glycol ether) nz 3 - [(3-cholamidopropyl) dimethylamminio] -1-propanesulfonate (CHAPS), 3 [(3-cholamidopropyl) dimethylamminio] -2-hydroxy-1-propanesulfonate (CHAPSO), or N-dodecyl = N, N-dimethyl-3-ammonio-1-propanesulfonate.

In more than one embodiment of the assay methods of the present invention, it may be desirable to immobilize either PCIP or its target molecule to facilitate separation of complexed forms from uncomplexed forms of one or both proteins, as well as to modify assay automation.

Binding of the test compound to the PCIP protein, or the interaction of the PCIP protein with the target molecule in the presence and absence of the test compound, can be performed in any vessel containing suitable reagents. Examples of such vessels are microtiter plates, test tubes and microcentrifuge tubes. In one embodiment, a fusion protein may be provided that adds a domain that allows binding of one or both proteins to the matrix. For example, glutathione transferase / PCIP fusion proteins or glutathione transferase / target fusion proteins can be adsorbed onto glutathione-sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione-derivatized microtiter plates, which are then combined with the test compound or test compound. and unadsorbed target protein or PCIP protein, and the mixture is incubated under conditions suitable for complexing (e.g. under physiological conditions)

135 this to it to it to it to it to it to it to it «4» » Salts and pH). After incubation, the beads or wells of the microtiter plate are washed to remove any unbound components and the complexes are determined either directly or indirectly, for example as described above. Alternatively, the complexes can be dissociated from the matrix and the level of PCIP binding or activity can be determined using standard techniques.

Another technique for immobilizing proteins on matrices can also be used in the screening assays of the present invention. For example, a PCIP protein or PCIP target molecule can be immobilized using biotin-streptavidin conjugation. Biotinylated PCIP protein or target molecules can be prepared from biotin-NHS (N-hydroxysuccinimide) using techniques known in the art (e.g.

biotinylation kit, Pierce Chemicals, Rockford, IL), and can be mobilized on wells of streptavidin-coated 96-well plates (Pierce Chemical). Alternatively, antibodies reactive with PCIP protein or target molecules but which do not interfere with binding of PCIP protein to the target molecule can be derivatized into the wells of the plate, and unbound target group or PCIP protein can be captured in the wells by conjugation with the antibody. Methods for detecting such complexes, in addition to those described above for GST-immobilized complexes, include immunodetection of complexes using an antibody reactive with a PCIP protein or target molecule, as well as enzyme assays that involve detection of enzymatic activity associated with a PCIP protein or target molecule.

In a preferred embodiment, potential or test compounds or agents are tested for their ability to inhibit or stimulate the ability of a PCIP molecule to modulate vesicle movement and protein transport in cells, eg, neurons or heart cells, using the assays described, for example, in Komada.

4 · 44 ·· • · 4 4

4 4 4 4444 4 · 4 nr · 4444 44 44 4 · 4 · ·

130 «· 4444 4444

4444 44 44 44 44 44

M.s et al. (1999) Genes Dev. 13 (11): 1475-85, and Roth M.G. et al. (1999) Chem. Phys. Lipids. 98 (1-2): 141-52, the contents of which are incorporated herein by reference.

In another preferred embodiment, potential or test compounds or agents are tested for their ability to inhibit or stimulate the ability of a PCIP molecule to regulate the phosphorylation state of a potassium channel protein or portion thereof, using, for example, an in vitro kinase assay. Briefly, a PCIP target molecule, eg, an immunoprecipitated potassium channel from a cell line expressing such a molecule, can be incubated with PCIP protein and radioactive ATP, eg, [γ- ³² Ρ] ATP, in a buffer containing MgCl ₂ and MnCl ₂ , eg. 10 mM MgCl ₂ and 5 mM MnCl ₂ . Following incubation, the immunoprecipitated PCIP target molecule, e.g., the potassium channel, can be separated by SDS polyacrylamide gel electrophoresis under reducing conditions, transferred to a membrane, e.g., a PVDF membrane, and evaluated by autoradiography. The appearance of detectable bands on the autoradiograph indicates that the PCIP substrate, e.g., the potassium channel, has been phosphorylated. A phosphoamino acid analysis of a phosphorylated substrate may also be performed to determine which residues on the PCIP substrate are phosphorylated. Briefly, a radiophosphorylated protein band can be excised from an SDS gel and subjected to partial acid hydrolysis. The products can then be separated by one-dimensional electrophoresis and can be analyzed, for example, on a phosphoimager and can be compared to ninhydrin-stained phosphoamino acid standards. Assays such as those described, for example, in Tamaskovic R. et al. (1999) Biol. Chem.

380 (5): 569-78, which is incorporated herein by reference.

In another preferred embodiment, the test compounds or compounds are 99 9 9 9 9 9 9

999 9 9999 9 9 9 <♦ ···· · · 9 9 999 9 9 »·· 9 9 ·· ·· ·· ·· reagents tested for their ability to inhibit or stimulate the ability of a PCIP molecule to associate (eg, bind) with calcium, using for example the tests described in Liu L.

(1999) Cell Signal. 11 (5): 317-24 and Kawai T. et al. (1999)

Oncogene 18 (23): 3471-80, the contents of which are incorporated herein by reference.

·· ····

In another preferred embodiment, candidate or test compounds or agents are tested for their ability to inhibit or stimulate the ability of a PCIP molecule to modulate chromatin production in a cell using, for example, the assays described in Okuwaki M. et al. (1998) J. Biol. Chem. 273 (51): 34511-8; and Miyaji-Yamaguchi M. (1999) J. Mol. Biol. 290 (2): 547-557, the contents of which are incorporated herein by reference.

In yet another preferred embodiment, candidate or test compounds or agents are tested for their ability to inhibit or stimulate the ability of a PCIP molecule to modulate cell proliferation, using, for example, the assays described in Baker F.L. et al. (1995) Cell Prolif. 28 (1): 1-15. Cheviron N. et al. (1996) Cell Prolif. 29 (8): 437-46; Hu Z.W. et al. (1999) J. Pharmacol. Exp. Ther. 290 (1): 28-37; and Elliott K. et al. (1999) Oncogene 18 (24): 3564-73, the contents of which are incorporated herein by reference.

In a preferred embodiment, candidate or test compounds or agents are tested for their ability to inhibit or stimulate the ability of a PCIP molecule to regulate the association of a potassium channel protein or portion thereof with a cellular cytoskeleton, using, for example, the assays described in Gonzalez C. et al. (1998) Cell Mol. Biol. 44 (7): 1117-27

Chia C.P. et al. (1998) Exp. Cell Res. 244 (1): 34 0-8, where content ·

9 · 9 9 ♦ · · · · · 9

138 • 9 99 9 • 99 9 9 9

9 9 9 9 9 9

9 9 9 9 9 9 · · · ··· 9 9 9 · 9 * · · · · · · These publications are hereby incorporated by reference.

In another preferred embodiment, candidate or test compounds or agents are tested for their ability to inhibit or stimulate the ability of a PCIP molecule to modulate membrane excitability, using, for example, the assays described in Bar-Sagi D. et al. (1985) J. Biol. Chem. 260 (8): 4740-4

Barker J.L. et al. (1984) Neurosci. Lett. 47 (3): 313-8, the contents of which are incorporated herein by reference.

In another preferred embodiment, candidate or test compounds or agents are tested for their ability to inhibit or stimulate the ability of a PCIP molecule to modulate cytokine signaling in a cell, eg, neurons or heart cells, using the assays described in Nakashima Y. et al. (1999)

J. Bone Joint Surg. Am. 81 (5): 603-15, the contents of which are incorporated herein by reference.

In another embodiment, PCIP expression modulators are identified by a method where the cell is contacted with a test compound and the expression of PCIP mRNA or protein in the cell is determined. The level of PCIP mRNA or protein expression in the presence of a test compound is compared to the level of PCIP mRNA or protein expression in the absence of a test compound. Test compounds can then be identified as modulators of PCIP expression based on this comparison.

For example, when PCIP mRNA or protein expression is higher (statistically significantly higher) in the presence of a test compound than in its absence, then the test compound is identified as a stimulator of PCIP mRNA or protein expression. Alternatively, when PCIP mRNA or protein expression is lower (statistically significantly lower) in the presence of a test compound than in its absence, the PCIP mRNA or protein is lower (statistically significantly lower). ·

Thus, the test compound is identified as an inhibitor of PCIP expression, and the test compound is identified as an inhibitor of PCIP expression. mRNA or protein. The level of expression of PCIP mRNA or protein in cells can be determined by the methods described herein for detecting PCIP mRNA or protein.

In yet another aspect of the present invention, PCIP proteins can be used as capture proteins in a 2-hybrid assay or a 3-hybrid assay (see, eg, US Patent No. 5,283,317; Zervos et al. (1993) Cell 72: 223-232; Madura et al. (1993) J. Biol Chem 268: 12046-12054, Bartel et al.

(1993) Biotechniques 14: 920-924; Iwabuchi et al. (1993)

Oncogene 8: 1693-1696; and Brent WO94 / 10300), to identify additional proteins that bind to or interact with PCIP (PCIP-binding proteins or PCIP-bp) and which are involved in PCIP activity (as described in more detail in the Examples). Such PCIP-binding proteins are also likely to be involved in propagating signals from PCIP proteins or PCIP target molecules, for example, through the following elements of the PCIP-signaling pathway. Alternatively, such PCIP-binding proteins are likely to be PCIP inhibitors.

The 2-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA binding domains and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, a gene that encodes a PCIP protein is fused to a gene encoding a DNA binding domain of a known transcription factor (eg, GAL-4). In another construct, a DNA sequence from a library of DNA sequences that encodes an unidentified protein (sample) is fused to a gene that encodes the activation domain of a known transcription factor. If the captured and captured proteins are able to interact in vivo to produce PCIP.

999 ·

140 • 99,999 99 ·

999 9999 99 9

9999 9 9 99 999 9 9

9 9 9 9 9

Thus, the DNA-binding and activation domains of the transcription factor are in close proximity. This proximity allows transcription of a reporter gene (eg, LacZ) that is operably linked to a transcriptional regulatory site reactive to the transcription factor. Reporter gene expression can be detected and cell colonies containing a functional transcription factor can be isolated and used to obtain a cloned gene that encodes a protein that interacts with a PCIP protein.

The present invention further relates to novel reagents identified by the above screening assays. Therefore, the present invention further encompasses the use of agents identified by the above methods in a suitable animal model. For example, an agent identified in the above manner (eg, a PCIP modulating agent, an antisense PCIP nucleic acid molecule, a PCIP-specific antibody, or a PCIP-binding partner) can be used in an animal model to determine efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, the agents identified by the above methods can be used in an animal model to determine the mechanism of action of such agents. Furthermore, the present invention relates to the use of the novel agents identified by the above screening methods for treatment, for example, for the treatment of CNS or cardiovascular disease as described herein.

B. Detection tests

Portions or fragments of the cDNA sequence identified in the present invention (and corresponding complete gene sequences) can be used in many ways as polynucleotide agents. For example, these sequences can be used to: (i)

141

9 99 99

9 9 9 9 9

999 99,999 9 9 9

9999 99 99 999 9 9 • 9 9 9 9 9

99 9 9 99 99 99 99 ··· · mapping of relevant genes to chromosome; thereby localizing the gene regions associated with the genetic disease; (ii) identifying individuals from a small biological sample (tissue typing); and (iii) forensically identifying the biological sample.

These applications are described in the following sections.

1. Chromosomal mapping

Once the sequence (or part of the sequence) of the gene has been isolated, the sequence can be used to map the gene to the chromosome. This process is called chromosomal mapping. Thus, portions or fragments of the PCIP nucleotide sequence described in the present invention can be used to localize PCIP genes on the chromosome. Mapping a PCIP sequence to chromosomes is an important first step in correlating these sequences with disease-associated genes.

Briefly, PCIP genes can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp in length) from the PCIP nucleotide sequence. Computer analysis of the PCIP sequence can be used to design primers that do not span more than one exon in genomic DNA, which would complicate the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids that contain the human gene corresponding to the PCIP sequence will yield amplified fragments.

Somatic cell hybrids are prepared by fusing somatic cells from a variety of mammals (e.g., human and mouse cells). As human and mouse cell hybrids grow and divide, they gradually lose human chromosomes at random, but retain mouse chromosomes. When using a medium in which mouse cells cannot • · myší buňky buňky buňky buňky buňky buňky buňky buňky buňky buňky buňky buňky buňky

JO ♦ · ♦ · ♦ · · ······ «ΐ * τΖ. Growth because they do not have a certain enzyme, but human cells can, will preserve the human chromosome that contains the gene encoding the needed enzyme. Using different media, a panel of hybrid cell lines can be obtained. Each cell line in the panel contains either a single human chromosome or a small number of human chromosomes, and a complete set of mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes. (D'Eustachio, P. et al. (1983) Science

220: 919-924. Somatic cell hybrids containing only fragments of human chromosomes can also be prepared using human chromosomes with translocations and deletions.

PCR mapping of somatic cell hybrids is a quick way to assign a particular sequence to a particular chromosome. Using one thermal cycler, it is possible to assign three or more sequences per day. Using the PCIP nucleotide sequence for the preparation of oligonucleotide primers, sublocalization can be performed using panels of fragments from specific chromosomes. Other mapping strategies that can also be used to map a PCIP sequence to a chromosome include in situ hybridization (described in Fan, Y. et al. (1990) Proc. Natl.

Acad. Sci. USA, 87: 6223-27), pre-screening with labeled sorted chromosomes, and pre-selection by hybridization to a chromosomal specific cDNA library.

Fluorescence in situ hybridization (FISH) DNA sequence for chromosome metaphase coating can be further used to obtain accurate chromosomal location in one step.

The chromosomal coating may be made using cells whose division has been blocked in the metaphase by a chemical agent such as a colcemid that damages the mitotic spindle. Chromosomes can be trypsin treated and then stained according to

Giemsy. A sample of light and dark strips is formed on each ·· · * · · »· ·» · ··· ·

143 ♦ · · ♦ · · · ·

on the chromosome and each chromosome can be identified. The FISH technique can be used with DNA sequences of 500 or 600 bases in length. However, clones longer than 1000 bases are more likely to bind to a unique chromosome site with sufficient signal intensity for simple detection.

Preferably, 1000 bases, and more preferably 2000 bases, is a sufficient number of bases to obtain good results in a reasonable time. For a review of this technique, see Verma et al., Human Chromosomes: A Manual of Basic Techniques (Pergamon Press, New York 1988).

The chromosomal mapping reagents may be used individually to designate a single chromosome or a single site on that chromosome, or reagent panels may be used to designate multiple sites and / or multiple chromosomes. Reagents corresponding to non-coding gene regions are preferred for mapping. The coding sequences are more likely to be conserved in gene families, which increases the chance of cross-hybridization during chromosomal mapping.

Once the sequence has been accurately located on the chromosome, the physical position of the sequence can be correlated with the genetic map (such data are provided in, for example, V. McKusick, Mendelian Inheritance in Man, available online via Johns Hopkins University Welch Medical Library). Relationships between a gene and a disease mapped to the same chromosomal region can be identified by linkage analysis (concomitant inheritance of physically contiguous genes), as described, for example, in Egeland, J. et al. (1987) Nature, 325: 783-787.

Further, differences in DNA sequence between individuals affected and unaffected by the disease associated with the PCIP gene can be determined. If a mutation is observed in some or all of the affected individuals, but not in any of them

9

9 9 · 9

9999

9

9999 9

144

9 9 9 • 9 9

9 99 9

9

9 9 ·

100 ·· ** · ·

9 · 9 9

9 9 ·

9 9 9

99, the mutation is probably a causal cause of the disease. Comparison of affected and unaffected individuals usually involves first looking for structural alterations in the chromosomes, such as deletions or translocations, that are visible on the chromosomal smear or detectable using PCR according to this DNA sequence. Finally, gene sequencing from several individuals can be performed to confirm the presence of mutations and to differentiate mutations from polymorphisms.

2. Tissue typing

The PCIP sequences of the present invention can also be used to identify individuals from small biological samples. For example, the United States Army is considering using restriction fragment length polymorphisms (RFLPs) to identify its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes, and probing and Southern blots result in unique bands useful for identification. This method does not have the disadvantages of Dog Tags, which can be lost, switched or removed, which would make positive identification difficult. The sequences of the present invention are useful as additional DNA markers for RFLP (as described in U.S. Patent 5272057).

Further, the sequence of the present invention can be used to provide an alternative technique that determines the actual DNA sequence of selected portions of an individual's genome. Thus, the PCIP nucleotide sequences of the present invention can be used to prepare two PCR primers from the 5 'and 3' ends of the sequence. These primers can then be used to amplify the individual's DNA and sequenced.

145 • *

99

· ♦ · • · •

9 999

9 9 9 • 9 9

9999

Panels of appropriate DNA sequences from an individual prepared in this manner can provide unique identification of the individual, since each individual has a unique set of such DNA due to allelic variations. The sequences of the present invention can be used to obtain such an identification sequence from individuals and tissues. The PCIP nucleotide sequences of the present invention represent unique portions of the human genome. Allelic variations occur to some extent in the coding regions of these sequences, and to a greater extent in the non-coding regions. Allelic variations between individuals are believed to occur at a frequency of approximately once every 500 bases. Each described sequence can, to some extent, be used as a standard with which DNA from an individual can be compared for identification. Since a greater number of polymorphisms occur in non-coding regions, less sequence is required to discriminate individuals. Non-coding sequences can provide positive identification of an individual using a panel of approximately 10 to 1000 primers, each resulting in a non-coding amplified 100 base sequence. When the putative coding sequences are used, the number of primers for the positive identification of an individual of 500-2000 is more appropriate.

When a panel of reagents from a PCIP nucleotide sequence is used to prepare an identification database for an individual, the same reagents can then be used to identify tissues from the individual. Using a unique identification database, positive identification of an individual - living or dead - can be performed from an extremely small tissue sample.

3. Use of partial PCIP sequences in forensic biology

DNA-based identification techniques can also be used • 9 99 · «

146

8 «·«

• in forensic biology. Forensic biology is a scientific discipline that uses genetic typing in biological evidence found in criminal acts as a means of positive identification, for example, offenders.

To perform such identification, PCR technology can be used to amplify the DNA sequence obtained from very small biological samples, such as tissues, for example, hair or skin, or body fluids, for example blood, saliva, seminal fluid, found at the crime scene. The amplified sequence can then be compared to standards to allow identification of the origin of the biological sample.

The sequences of the present invention can be used to provide polynucleotide reagents, e.g.

PCR primers targeted to a specific locus in the human genome, where such agents can increase the reliability of forensic DNA-based identification by, for example, providing a different identification marker (i.e., another DNA sequence that is unique to a particular individual). As mentioned above, the actual sequence of the bases can be used for identification and is an accurate alternative to the analysis of fragments generated by restriction enzymes. Sequences targeted to non-coding regions are particularly suitable for this use, since a greater number of polymorphisms occur in the non-coding regions, making it easier to distinguish individuals using this technique. Examples of polynucleotide reagents include PCIP nucleotide sequences or portions thereof having a length of at least 20 bases, preferably at least 30 bases.

The PCIP nucleotide sequences of the present invention can further be used to provide polynucleotide reagents, eg, labeled or unlabeled probes, which can be used, for example, in-situ hybridization, to identify specific tissue, eg, brain tissue. This can be very useful in cases where a forensic pathologist evaluates tissue of unknown origin. Panels of such PCIP probes can be used to identify tissues by organ type and / or type.

147

9 99 99

9 9 9 9 9

9 9 9 999 9 9 9

9999 9 f

9 9 9 9 9

999 9 9 99 99 99 99 ·· · »··

Similarly, such reagents, eg, PCIP primers or probes, can be used to examine tissue cultures for contamination (i.e., test for the presence of a mixture of different cell types in culture).

C. Predictive Medicine:

The present invention also relates to the field of predictive medicine in which diagnostic tests, prognostic tests, and clinical trial monitoring are used for prognostic (predictive) purposes to determine whether an individual is to be prophylactically treated. Accordingly, one aspect of the present invention pertains to diagnostic assays for determining expression of PCIP protein and / or nucleic acid as well as PCIP activity in a biological sample (eg, blood, serum, cells, tissues) to determine whether an individual is an individual. affected by the disease or disorder, or whether there is a risk of developing a disease associated with aberrant PCIP expression or activity. The invention also provides prognostic (or predictive) assays to determine whether an individual is at risk for developing a disorder associated with PCIP protein expression, nucleic acid, or PCIP activity. For example, mutations in the PCIP gene can be tested in a biological sample. Such assays may be used for prognostic or predictive purposes for the prophylactic treatment of an individual prior to the development of a disease characterized or associated with PCIP protein, nucleic acid expression, or activity.

148 · · * <<<<<<9 9 9 t t t t t t 9 9

9 9 9 9 9

999 9 9 9 · 9 99 99

Another aspect of the present invention pertains to monitoring the effect of an agent (e.g., drugs, compounds) on expression or activity

PCIP in clinical trials.

These and other reagents are described in detail in the following sections.

1. Diagnostic tests

An exemplary method for detecting the presence or absence of a PCIP protein or nucleic acid in a biological sample comprises obtaining a biological sample from the test subject and contacting the biological sample with a compound or reagent capable of detecting PCIP protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes a PCIP protein. such that the presence of the PCIP protein or nucleic acid in the biological sample is detected. A preferred reagent for detecting PCIP mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to PCIP mRNA or genomic DNA. For example, the nucleic acid probe may be a complete PCIP nucleic acid, such as nucleic acid SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ. SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17,

SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 2 9 SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID

NO: 100, or SEQ ID NO: 102, or the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939,

149 * · · · · · · · · · · ·

98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948,

98949, 98950, 98951, 98991, 98993, or 98994, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100,

250 or 500 nucleotides sufficient for specific hybridization under stringent conditions to PCIP mRNA or genomic DNA. Other suitable probes for use in the diagnostic assays of the present invention are described herein.

A preferred agent for detecting a PCIP protein is an antibody capable of binding to a PCIP protein, preferably an antibody with a detectable marker. The antibody may be polyclonal or, more preferably, monoclonal. An intact antibody or fragment thereof (eg, Fab or F (ab ') 2) may be used.

The term labeled in connection with a probe or antibody includes direct labeling of the probe or antibody by binding (i.e., physical binding) of the detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody with reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of the primary antibody using a fluorescently labeled secondary antibody and terminal labeling of the DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term biological sample refers to tissues, cells, and biological fluids isolated from an individual, as well as tissues, cells, and fluids present in an individual. That is, the detection method of the present invention can be used to detect PCIP mRNA, protein or genomic DNA in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detecting PCIP mRNA include Northern hybridization and in-situ hybridization. In vitro techniques for the detection of PCIP protein include enzyme-linked immunosorbent assays (ELISA), Western hybridization, immunoprecipitation and immunofluorescence assays. In vitro techniques for detecting PCIP genomic DNA include Southern

150 ····························· protein marker.

• 4 hybridization. Further, in vivo techniques for detecting PCIP include administering a labeled anti-PCIP antibody to a subject For example, the antibody may be radiolabeled, the presence and location of which in the subject may be determined using standard imaging techniques.

In one embodiment, the biological sample comprises a protein molecule from a test subject. Alternatively, the biological sample may comprise mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a serum or cerebrospinal fluid sample isolated from a subject by conventional means.

In another embodiment, the methods further comprise obtaining a control biological sample from the control individual, contacting the control sample with a compound or agent capable of detecting PCIP protein, mRNA, or genomic DNA such that the presence of PCIP protein, mRNA, or genomic DNA is detected in the biological sample, and comparing the presence of PCIP protein, mRNA or genomic DNA in the control with the presence of PCIP protein, mRNA or genomic DNA in the test sample.

The invention also provides kits for detecting the presence of PCIP in a biological sample. For example, the kit may comprise a labeled compound or agent capable of detecting PCIP protein or mRNA in a biological sample; a device for determining the amount of PCIP in the sample; and a device for comparing the amount of PCIP in the sample to a standard. The compound or agent may be packaged in a suitable container. The kit may further comprise instructions for using a kit for detecting a PCIP protein or nucleic acid.

.

Prognostic tests

151 9 9 99 999 9 9 9 9 99 999 9 9 9 9 9 99 999 9 9

The described diagnostic methods can further be used to identify individuals at risk of developing a disease or disorder associated with aberrant PCIP expression or activity. For example, the described assays, such as previous diagnostic assays or the following assays, can be used to identify individuals at risk of developing a disorder associated with a mis-regulation of PCIP protein activity or nucleic acid expression such as neurodegenerative disorders such as Alzheimer's disease, Alzheimer's-related dementias. diseases (such as Pick's disease), Parkinson's disease and other diffuse Lewy bodies associated diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, spinocerebellar ataxia, JakobCreutzfield's disease; psychiatric disorders such as depression, schizophrenic disorders, Korsakoff's psychosis, mania, anxiety disorders, bipolar affective disorders or phobias; and memory or learning disorders such as amnesia or age-related memory loss; and neurological diseases such as migraine; and painful diseases such as hyperalgesia or pain associated with musculoskeletal diseases; spinal cord injury; stroke; head trauma; or cardiovascular diseases such as sinus node dysfunction, angina pectoris, heart failure, hypertension, atrial fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm or arrhythmia.

Alternatively, the prognostic assays can be used to identify an individual having or at risk for developing a disease associated with a mis-regulation of PCIP protein activity or nucleic acid expression, such as a potassium channel associated disease. Thus, the present invention provides a method for identifying a disease or

152 disorders associated with aberrant PCIP expression or activity, wherein the test sample is obtained from an individual and a PCIP protein or nucleic acid (eg, mRNA or genomic DNA) is detected, wherein the presence of the PCIP protein or nucleic acid is diagnostic for the existence or risk of disease or disorders associated with aberrant expression or PCIP activity in an individual. The term test sample refers to a biological sample obtained from an individual to be examined. For example, the test sample may be a biological fluid (eg, serum), a cell sample, or a tissue.

Further, the disclosed prognostic assays may be used to determine whether an agent (eg, agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other potential drug) can be administered to an individual to treat aberrant-associated disease or disorder. by PCIP expression or activity. For example, such methods can be used to determine whether an individual can be effectively treated with a CNS or cardiovascular disease agent. Thus, the present invention provides a method for determining whether an individual can be effectively treated with an agent for disorders associated with aberrant PCIP expression or activity in which a test sample is obtained and the expression or activity of a PCIP protein or nucleic acid is detected (e.g. thus, overexpression or activity of a PCIP protein or nucleic acid of a diagnostic individual may be treated with an agent to treat a disorder associated with aberrant PCIP expression or activity).

The methods of the present invention can also be used to detect genetic alterations in the PCIP gene, thereby determining whether an individual with an altered gene is at risk for a disorder characterized by erroneous regulation of activity

153 · · · · · · · · · · · · · · · · · · ·

PCIP protein or nucleic acid expression such as CNS disease or cardiovascular disease. In a preferred embodiment, the methods comprise detecting - in a cell sample from an individual - the presence or absence of a genetic alteration characterized by at least one alteration affecting the integrity of the gene encoding PCIP-protein, or mis-expression of PCIP geiMf. For example, such genetic alterations may be detected by detecting the existence of 1) a deletion of one or more nucleotides from the PCIP gene; 2) addition of one or more nucleotides to the PCIP gene; 3) substitution of one or more nucleotides of the PCIP gene; 4) chromosomal rearrangement of the PCIP gene; 5) alteration at messenger RNA level of PCIP gene transcript, 6) aberrant modification of PCIP gene, such as genomic DNA methylation pattern, 7) presence of unnatural splicing of messenger RNA transcript of PCIP gene, 8) unnatural level of PCIP protein transcription, 9) allelic loss of PCIP and 10) inappropriate post-translational modifications of the PCIP protein. There are many assays in the art that can be used to detect alterations in the PCIP gene. A preferred biological sample is tissue or serum isolated from an individual in a conventional manner.

In some embodiments, detection of alteration involves the use of a probe / primer in a polymerase chain reaction (PCR) (see, eg, US Patent Nos. 4683195 and 4683202), such as anchoring PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) ( see, eg, Landegran et al (1988) Science 241: 10771080 and Nakazawa et al (1994) Proc. Natl. Acad. Sci. USA 91: 360-364), wherein the latter is useful for detecting point mutations. in the PCIP gene (see Abravaya et al. (1995)

Nucleic Acids Res., 23: 675-682). The method comprises the step of collecting a sample of cells from an individual, isolating the nucleic acid (eg, genomic, mRNA, or both) from the cell in the sample, contacting the nucleic acid with one or more primers,

154 • · ·

4 which specifically hybridize to the PCIP gene under conditions in which hybridization and amplification of the PCIP gene (if present) and detection of the presence thereof occur or the absence of an amplification product, or detecting the size of the amplification product and comparing its length to a control sample.

It is contemplated that PCR and / or LCR may be used as a first amplification step together with any other techniques used to detect mutations.

Alternative amplification methods include: slowed sequence replication (Guatelli, JC et al., (1990) Proc. Natl. Acad. Sci. USA 87: 1874-1878), transcriptional amplification system (Kwoh, DY et al., (1989) Proc. Natl. Acad. Sci. USA 86: 11731177), Q-Beta Replicase (Lizardi, PM et al. (1988) BioTechnology 6: 1197), or any other nucleic acid amplification technique followed by detection of amplified molecules after using techniques well known in the art. These detection schemes are particularly useful for detecting nucleic acid molecules when such molecules are present in very small numbers.

In an alternative embodiment, mutations in the PCIP gene from a cell sample may be identified by alterations in the restriction enzyme digestion pattern. For example, a control DNA sample is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment lengths are determined by gel electrophoresis and compared. The differences in fragment length between sample and control DNA indicate mutations in the DNA tested. Further, sequence-specific ribozymes (see, for example, U.S. Patent No. 5,498,531) can be used to test for the presence of specific mutations according to whether or not a ribozyme specific cleavage site has been created or lost.

• • •

155

In another embodiment, genetic mutations in PCIP can be identified by hybridizing a test and control nucleic acid, eg, DNA or RNA, to a dense array containing hundreds or thousands of oligonucleotide probes (Cronin, MT et al. (1996) Human Mutation 7: 244-255 Kozal, MJ et al.

(1996) Nature Medicine 2: 753-759). Genetic mutations in PCIP can be identified on two-dimensional arrays containing light-generated DNA probes as described in Cronin, M.T. et al., supra. Briefly, a first hybridization probe assembly can be used to search long DNA strands in a sample and control to identify baseline differences between sequences using linear sets of sequentially overlapping probes. This step allows identification of point mutations. This step is followed by the use of a second hybridization kit that allows the characterization of specific mutations using a smaller, specialized probe assembly complementary to all detected variants or mutations. Each set of probes is composed of a parallel set of probes, one complementary to the natural gene and the other to the mutant gene.

In yet another embodiment, any of the sequencing reactions can be used for direct sequencing of the PCIP gene and detecting mutations by comparing the sequence of the test PCIP gene to the corresponding normal (control) sequence. Examples of sequencing techniques are those developed by Maxam and Gilbert ((1977) Proc. Natl. Acad. Sci. USA 74: 560) or Sanger ((1977) Proc. Natl. Acad. Sci. USA 74: 5463). It is also contemplated that any of a variety of automated sequencing techniques ((1995) Biotechniques 19: 448) can be used in performing diagnostic assays, including sequencing by mass spectrometry (see, eg, PCT International Application No. WO 94/16101; Cohen et al. (1996) Adv Chromatogr 36: 127-162 and Griffin et al (1993) Appl Biochem Biotechnol.

• ·

156

38: 147-159.

Other methods for detecting mutations in the PCIP gene are methods in which protection from cleavage agents is used to detect mismatched bases in RNA / RNA or RNA / DNA heteroduplexes (Myers et al. (1985) Science 230: 1242).

Generally, the mismatch cleavage technique begins with obtaining heteroduplexes formed by hybridizing (labeled) RNA or DNA containing a native PCIP sequence to a potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes are treated with an agent that cleaves the single-stranded regions of the duplex, such as those resulting from mismatches between the control and test chains. RNA / DNA duplexes can be processed by RNase and DNA / DNA hybrids can be treated by Sl nuclease for enzymatic digestion of mismatched regions. In another embodiment, DNA / DNA or RNA / DNA duplexes can be treated with hydroxylamine or osmium tetroxide and piperidine to digest mismatched regions. After digestion of the mismatched regions, the material obtained is separated by size on a denaturing polyacrylamide gel to determine the site of mutation. See, for example, Cotton et al. (1988) Proc. Natl Acad Sci USA

85: 4397; Saleeba et al. (1992) Methods Enzymol. 217: 286-295.

In a preferred embodiment, the control DNA or RNA may be labeled for detection.

In yet another embodiment, the mismatched baseline cleavage reaction utilizes one or more proteins that recognize mismatched bases in double stranded DNA (so-called DNA mismatch repair enzymes) in defined systems for detecting and mapping point mutations in PCIP cDNAs obtained from a cell sample. For example, the mutY enzyme of E. coli cleaves A in G / A mismatches, and the thymidine-DNA glycosylase of HeLa cells cleaves T • · · ·· ·

157 in G / T mismatch pairs (Hsu et al. (1994) Carcinogenesis

15: 1657-1662). In an exemplary embodiment, a probe based on a PCIP sequence, e.g., a native PCIP sequence, is hybridized to a cDNA or other DNA product from the test cells. The duplex is treated with a DNA mismatch repair enzyme and the cleavage product, if any, can be detected by electrophoresis or the like. See, for example, U.S. Pat. No. 5459039.

In another embodiment, alterations in electrophoretic mobility are used to identify mutations in PCIP genes. For example, single chain conformation polymorphism (SSCP) can be used to detect differences in electrophoretic mobility between mutant and natural nucleic acid (Orita et al. (1989) Proc Natl. Acad. Sci USA: 86: 2766, see also Cotton (1993)).

Mutat. Res. 285: 125-144; and Hayashi (1992) Genet. Anal. Tech. Appl. 9: 73-79). Single-stranded DNA fragments of test and control PCIP nucleic acids are denatured and allowed to renaturate. The secondary structure of a single-stranded nucleic acid is sequence-dependent, resulting in alterations in electrophoretic mobility that allow detection of individual changes in the bases. DNA fragments can be labeled or can be detected with labeled probes. The sensitivity of the assay can be increased by using RNA (instead of DNA) in which the secondary structure is more sensitive to changes in sequence. In a preferred embodiment, the method of the present invention utilizes heteroduplex analysis to separate double-stranded heteroduplex molecules according to changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7: 5).

In yet another embodiment, the movement of mutant or natural fragments in polyacrylamide gels containing a denaturing agent gradient is tested using a denaturing gradient gel electrophoresis (DGGE) (Myers et al.

• 1 • 1 • 1

158 (1985) Nature 313: 495). When DGGE is used as a method of analysis, the DNA is modified to ensure that it is not completely denatured, for example by adding a GCn-clamp of approximately 40 bp in length formed by high-melting CG-rich DNA by PCR. In another embodiment, the temperature gradient is used instead of a denaturing gradient to identify differences in control and test DNA mobility (Rosenbaum and Reissner (1987) Biophys Chem 265: 12753).

Examples of other techniques for detecting point mutations are, for example, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers can be prepared in which a known mutation is inserted at the center and then hybridize to the target DNA under conditions that allow hybridization only when perfect match is present (Saiki et al. (1986) Nature 324: 163). ; Saiki et al. (1989) Proc. Nati

Acad. Sci USA 86: 6230). Such allele-specific oligonucleotides hybridize to the PCR-amplified target DNA or to a variety of different mutations when the oligonucleotides are bound to the hybridization membrane and hybridize to the labeled target DNA.

Alternatively, allelic-specific amplification technology, which consists in selective PCR amplification, may be used in the present invention. Oligonucleotides used as primers for specific amplification can carry the desired mutations at the center of the molecule (so amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17: 2437-2448) or at the 3 'end of the primer where pairing, under appropriate conditions, prevent or reduce polymerase elongation (Prossner (1993) Tibtech 11: 238). In addition, it may be desirable to insert a new restriction site in the region.

159 ··· · · · · · · · · · · · · • • • • • • • • • • • • • • • • • Mutations to enable detection based on cleavage (Gasparini et al. (1992) Mol. Cell Probes 6: 1). It is contemplated that in some embodiments, amplification can also be performed using a Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88: 189). In such cases, ligation occurs only when there is a perfect match at the 3 'end of the 5' sequence that allows the detection of known mutations at a specific site by searching for the presence or absence of amplification.

The methods of the present invention can be performed, for example, using pre-made diagnostic kits comprising at least one nucleic acid probe or antibody of the present invention, wherein the kits can be used, for example, in a clinic to diagnose patients with symptoms or family history of PCIP gene related disease. .

Further, any type of cells or tissues in which PCIP is expressed can be used in the prognostic assays of the present invention.

3. Effect monitoring during clinical trials

Monitoring the effect of an agent (eg, drug) on PCIP protein expression or activity (eg, by modulating membrane excitability or resting potential) can be used not only in basic drug screening, but also in clinical trials. The efficacy of an agent discovered in a screening assay, as described herein, in increasing PCIP gene expression, protein concentration, or increasing PCIP activity can be monitored in clinical trials in subjects exhibiting reduced PCIP gene expression, protein concentration, or reduced PCIP activity.

• 9

9

9 9

9

9

160 • 9 9 • 9 9 • 9 9 9 9 • 9 9

9 9 • ·· ·

Alternatively, the efficacy of an agent discovered in a screening assay, as described herein, in decreasing PCIP gene expression, protein concentration, or increasing PCIP activity may be monitored in clinical trials in subjects exhibiting increased PCIP gene expression, protein concentration, or increased PCIP activity. In such clinical trials, the expression or activity of the PCIP gene, preferably other genes believed to be associated with potassium channel associated disorders, can be used as a marker of the phenotype of certain cells.

For example, genes, including PCIPs, can be identified that are modulated in cells by an agent (eg, compound, drug, or small molecule) that modulates PCIP activities (eg, identified in screening assays as described herein above). Thus, to study the effect of an agent on potassium channel associated disorders in clinical trials, a cell can be isolated and RNA prepared from the cell, which can be analyzed for expression level of PCIP and other genes that may be involved in potassium channel associated diseases. The level of gene expression (eg, gene expression pattern) can be quantified by Northern hybridization or RT-PCR as described herein, or alternatively by measuring the amount of protein produced, using one of the methods described, or by measuring the activity of PCIP or other genes. In this method, the gene expression pattern can serve as a marker indicating the physiological response of cells to the agent. Thus, this reaction state may be determined before and during treatment of the subject with an agent.

In a preferred embodiment, the present invention provides a method for monitoring the effectiveness of treatment of an individual with an agent (e.g.

agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other.

161 9 9 9

9 9 9 9999

9999 99 99 999

9 9 9 9 9

9999 9 99 99 99 99 potential drug identified by the screening assay of the present invention), comprising the steps of (i) obtaining a sample from an individual prior to administration of the agent; (ii) detecting the level of expression of the PCIP protein, mRNA or genomic DNA in the sample obtained prior to administration; (iii) obtaining one or more samples from the individual after administration of the agent; (iv) detecting the level of expression or activity of the PCIP protein, mRNA or genomic DNA in the samples obtained after administration; (v) comparing the level of expression or activity of the PCIP protein, mRNA or genomic DNA in the sample before administration with the expression or activity of the PCIP protein, mRNA or genomic DNA in the sample after administration of the agent; and (vi) accordingly altering the administration of the agent to the subject. For example, increasing the administration of the agent may be desirable to increase the expression or activity of PCIP to higher levels than detected levels, i.e., to increase the efficiency of the agent. Alternatively, reducing the administration of the agent may be desirable to reduce the expression or activity of PCIP to levels below the levels detected, i.e., to reduce the efficacy of the agent. In such an embodiment, PCIP expression or activity can be used as an indicator of the efficacy of the agent, even in the absence of an observable phenotypic reaction.

D. Methods of treatment:

The present invention provides both prophylactic and therapeutic methods for treating an individual at risk (or susceptible to) a disorder or having a disease associated with aberrant PCIP expression or activity. Prophylactic and therapeutic treatments may be specifically tailored or modified according to the knowledge of the art of pharmacogenomics. The term pharmacogenomics, as used herein, refers to the use of genomic technologies, such as gene sequencing, statistical genetics, and gene expression analysis, for clinically developed and marketed drugs. More specifically, this term refers to ·· ♦ • · ·

• ·· • · • '

Research into how the patient's genes determine the patient's response to the drug (eg, the patient's drug response phenotype or the patient's drug response genotype). Thus, in another aspect, the present invention provides methods for individually modifying prophylactic or therapeutic treatment with PCIP molecules of the present invention or PCIP modulators according to the patient's genotype of drug response. Pharmacogenomics allows physicians to specifically deliver prophylactic or therapeutic treatments to patients who will most benefit from such treatment and prevent treatment in patients who would have toxic treatment-related adverse reactions.

1. Prophylactic methods

In one aspect, the invention provides a method for preventing a disease or condition associated with aberrant PCIP expression or activity in an individual, wherein the individual is administered PCIP or a PCIP expression modulating agent, or at least one PCIP activity. Individuals at risk for a disease caused or affected by aberrant PCIP expression or activity may be identified, for example, by one or a combination of diagnostic or prognostic assays of the present invention. The administration of the prophylactic agent may be performed prior to the manifestation of the symptoms characteristic of the disorder in PCIP, so that the disease is prevented or, alternatively, its progression is slowed. Depending on the type of PCIP aberration, a PCIP, PCIP agonist, or PCIP antagonist may be used to treat an individual. A suitable reagent may be selected using the assays of the present invention.

2. Therapeutic methods

Another aspect of the present invention relates to methods 9 9 9 999 9 99 9 999 9 9 9 9 9 9 9 9 9 9

9 9 9 9 9 9 9 K 9 9

163 modulating PCIP expression or activity for therapeutic purposes.

Accordingly, in an exemplary embodiment, the modulation method of the present invention comprises contacting a cell with a PCIP or agent that modulates one or more PCIP protein activities associated with the cells. The agent that modulates PCIP protein activities may be an agent described herein, such as a nucleic acid or protein, a natural PCIP protein target molecule (eg, a PCIP substrate), a PCIP antibody, a PCIP agonist or antagonist, a PCIP agonist or antagonist peptidomimetic, or other small molecule. In one embodiment, the agent stimulates one or more PCIP activities. Examples of such stimulating agents are the active PCIP protein and the nucleic acid molecule encoding PCIP that has been introduced into the cell. In another embodiment, the agent inhibits one or more PCIP activities. Examples of such inhibitory agents are antisense PCIP nucleic acid molecules, anti-PCIP antibodies, and PCIP inhibitors.

These modulation methods may be performed in vitro (eg, by culturing cells with the agent) or alternatively in vivo (eg, by administering the agent to an individual). Thus, the present invention provides methods of treating an individual suffering from a disease or disorder characterized by aberrant expression or activity of a PCIP protein or nucleic acid molecule. Examples of such disorders are CNS disorders such as neurodegenerative disorders such as Alzheimer's disease, dementia associated with Alzheimer's disease (such as Pick's disease), Parkinson's disease and other diffuse Lewy bodies associated diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy , epilepsy, spinocerebellar ataxia and Jakob-Creutzfieldt's disease; psychiatric disorders such as depression, schizophrenic disorders, Korsakoff's psychosis, mania, anxiety disorders or phobias; learning or memory disorders, eg, age-related amnesia or memory loss; and neurological diseases; e.g..

· ♦ · · ·

164 ·· ·

A · · A · · · · ··· # · · · ·

Migraine, painful diseases such as hyperalgesia or musculoskeletal related pain diseases; spinal cord injury; stroke; and head trauma; or cardiovascular diseases, e.g., arteriosclerosis, ischemic reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular rhythm, coronary microembolism, tachycardia, bradycardia, hypertension, aneurysm, aortic coronary artery, coronary artery ligation, coronary artery disease atrial failure, long QT syndrome, congestive heart failure, sinus node dysfunction, tonsillitis, hypertension, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery spasm or arrhythmia. In one embodiment, the method comprises administering an agent (eg, an agent identified by the screening assay of the present invention), or a combination of agents that modulate (eg, increase or decrease) PCIP expression or activity. In another embodiment, the method comprises administering a PCIP protein or nucleic acid molecule to compensate for reduced or aberrant PCIP expression or activity.

A preferred embodiment of the present invention is a method for treating a disease or disorder associated with PCIP, comprising administering to the subject a therapeutically effective amount of a PCIP antibody. As defined herein, the therapeutically effective amount of the antibody (ie, the effective dose) is in the range of about 0.001 to 30 mg / kg body weight, preferably about 0.01 to 25 mg / kg body weight, more preferably about 0.1 to 20 mg / kg body weight, and even more preferably about 1 to 10 mg / kg, 2 to 9 mg / kg, 3 to 8 mg / kg, 4 to 7 mg / kg, or 5 to 6 mg / kg body weight. It will be appreciated by those skilled in the art that some factors may affect the dose required for effective treatment of the individual, for example, the severity of the disease or disorder,

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · , the general health of the individual and / or the age of the individual, and the presence of other diseases. Further, treatment of an individual with a therapeutically effective amount of an antibody may comprise a single dose, or may indicate repeated administration. In a preferred example, the subject is treated with the antibody at a dose of about 0.1 to 20 mg / kg body weight, once a week, for about 1 to 10 weeks, preferably 2 to 8 weeks, more preferably about 3 to 7 weeks, and even more preferably about 4, 5 or 6 weeks. It will also be appreciated that the effective dose of antibody used for treatment may increase or decrease over a single treatment period. Dosage changes may result from diagnostic test results as described herein.

Stimulation of PCIP activity is desirable in situations where PCI is abnormally downregulated and / or when increased PCIP activity is likely to have a positive effect. For example, stimulation of PCIP activity is desirable in situations in which PCIP is downregulated and / or when increased PCIP activity is likely to have a positive effect. Similarly, inhibition of PCIP activity is desirable in situations where PCI is abnormally upregulated and / or when a decrease in PCIP activity is likely to have a positive effect.

3. Pharmacogenomics

The PCIP molecules of the present invention, as well as agents or modulators having a stimulatory or inhibitory effect on PCIP activity (eg, PCIP gene expression) identified by the screening assays of the present invention, can be administered to individuals for treating (prophylactic or therapeutic) disorders associated with potassium channel associated with aberrant PCIP activity (such as diseases

CNS, eg neurodegenerative disorders, eg Alzheimer's

166 disease, dementia associated with Alzheimer's disease (such as Pick's disease), Parkinson's disease and other diseases associated with diffuse Lewy bodies, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, spinocerebellar ataxia and Jakob-Creutzfieldt's disease; psychiatric disorders such as depression, schizophrenic disorders, Korsakoff's psychosis, mania, anxiety disorders or phobias; learning or memory disorders, eg amnesia or age-related memory loss; and neurological diseases; eg, migraine, painful diseases such as hyperalgesia or pain associated with musculoskeletal diseases; spinal cord injury; stroke; and head trauma; or cardiovascular diseases, e.g., arteriosclerosis, ischemic reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular rhythm, coronary microembolism, tachycardia, bradycardia, hypertension, aneurysm, aortic coronary artery, coronary artery ligation, coronary artery disease atrial, long QT syndrome, congestive heart failure, sinus node dysfunction, tonsillitis, hypertension, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery spasm or arrhythmia). Pharmacogenomics (i.e., research into the relationship between an individual's genotype and its response to foreign compounds or drugs) may be used in such treatment. Differences in the metabolism of therapeutic agents may lead to severe toxicity or therapeutic failure due to altered blood-drug dose-concentration relationships. Thus, a physician can use the knowledge gained in relevant pharmacogemic studies to determine whether to administer a PCIP molecule or a PCIP modulator, as well as to adjust the dose and / or therapeutic regimen of the PCIP molecule or PCIP modulator.

167 • 4 4 * 44 • 44 444 44 ·

444 4,444 4 4 4

4444444 44 444 4 4 4444 4444

4444 4,444 44 · 4444

Pharmacogemics is concerned with clinically significant hereditary variations in response to the drug caused by the different metabolisms of the drug and its abnormal effects in affected persons. See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol.

23 (10-11): 983-985; and Linder, M.W. et al. (1997) Clin. Chem.

43 (2): 254-266. In general, two types of pharmacogenomic conditions can be distinguished. Genetic dispositions affecting drug action on the body (altered drug effect) or genetic dispositions affecting body action on drug (altered drug metabolism). These pharmacogenomic dispositions may occur either due to rare genetic defects or due to natural polymorphisms. For example, glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common hereditary enzymopathy in which haemolysis is a major clinical complication after ingestion of oxidative drugs (antimalarics, sulfonamide, analgesics, nitrofurans) and ingestion of beans.

One pharmacogenomic approach for identifying drug response genes, known as natural genome association, consists primarily in high-precision mapping of the human genome using known gene-associated markers (eg, a bi-allelic gene marker map that consists of 60 genes). 000 to 100 000 polymorphic or variable sites on the human genome, each having two variants). Such a high-resolution genetic map can be compared to a genome map of each of a statistically significant number of patients enrolled in Phase II / III clinical studies to identify markers associated with the observed drug effect or side effect. Alternatively, such a high resolution map may be prepared by combining some 10 million known single nucleotide polymorphisms (SNPs) in the human genome. SNP refers to common alterations that occur in a single nucleotide base in the DNA strand. For example, SNPs can be "91 *"

9 1 4 4 * »· * _1year 9 9 999« ··

168 ···· · · ♦ 1 9 9 9 9 9 «· · 9 9 9 9 9 9 9 9

9999 9 ·· 99 Λ 9 99 occur once every 1000 bases of DNA. SNP may be involved in the disease, but it is not usually related to the disease. Knowing the genetic map based on the occurrence of such SNPs, individuals can be categorized into individual genetic categories according to the particular nature of the SNPs in their genome. In this way, treatment regimens may be tailored to certain groups of genetically similar individuals, taking into account features that may be common to such genetically similar individuals.

Alternatively, a method known as a candidate gene technique may be used to identify genes that determine drug response. If a gene encoding a drug target is known in this method (e.g., a PCIP protein of the present invention), all variants of the gene in the population can be easily identified and it can be determined whether one version of the gene is associated with a particular response to medicine.

In an illustrative embodiment, the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action. The discovery of the genetic polymorphism of drug metabolizing enzymes (eg, N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes CYP2D6 and CYP2C19) provided an explanation of why drug effects are not apparent in some patients or excessive and severe toxicity following administration standard and safe doses of the drug. These polymorphisms are expressed in the population in two phenotypes, fast metabolisers (EM) and slow metabolisers (PM). The prevalence of PM varies across populations. For example, the gene encoding CYP2D6 is highly polymorphic and several mutations have been identified in PM that all lead to the absence of functional CYP2D6. Slow metabolisers of CYP2D6 and CYP2C19 quite often have an excessive drug reaction and serious side effects

·· ·

After administration of standard doses. If the metabolite is an active therapeutic group, PM does not show any therapeutic response, as demonstrated for the analgesic effect of codeine mediated by the CYP2D6-formed metabolite morphine. Another extreme is the so-called ultra-fast metabolisers who do not respond to standard doses. Recently, the molecular cause of ultrafast metabolism, which is the amplification of the CYP2D6 gene, has been identified.

Alternatively, a method referred to as gene expression profiling can be used to identify genes that determine response to a drug. For example, gene expression in an animal that has been administered a drug (eg, a PCIP molecule or a PCIP modulator of the present invention) can show which gene pathways leading to a toxic response have been triggered.

The information obtained from one or more of the above-mentioned pharmacogemic procedures can be used to determine the appropriate dose of the therapeutic regimen for the prophylactic or therapeutic treatment of the individual. This knowledge, when used for dose determination or drug selection, can prevent side effects or therapeutic failure and thus can enhance therapeutic or prophylactic efficacy in treating an individual with a PCIP molecule or a PCIP modulator, such as a modulator identified using one of the screening assays of the present invention.

4. Use of PCIP molecules as complementary markers

The PCIP molecules of the present invention are also useful as disease or disorder markers, as precursor markers for disease, as markers for predisposing to disease, as markers for drug activity, or as markers

170

• The pharmacogenetic profile of an individual. Using the methods of the present invention, the presence, absence and / or quantity of PCIP molecules of the present invention can be detected, and can be correlated with one or more biological states in vivo. For example, PCIP molecules of the present invention can serve as complementary markers for one or more disorders or diseases or conditions leading to diseases.

The term complementary marker refers to an objective biochemical marker that correlates with the absence or presence of a disease or disorder, or with the progression of a disease or disorder (eg, the presence or absence of a tumor). The presence or quantity of such markers is independent of the cause of the disease. Therefore, these markers can serve to indicate whether a particular treatment is effective in terms of disease or disorder. Additional markers are used especially when the extent or presence of the disease or disorder is difficult to evaluate using standard methods (e.g., early stages of tumors) or when assessing disease progression is desirable before a potentially dangerous clinical outcome is achieved (e.g. cardiovascular disease assessment can be performed using cholesterol concentration as a companion marker, and HIV infection analysis can be performed using HIV RNA concentrations as companion marker, well indicative of the clinical risk of myocardial infarction or fully developed AIDS). Examples of use of flanking markers are given in: Koomen et al. (2000) J. Mass. Spectrom. 35: 258-264; and James (1994) AIDS Treatment News Archive 209.

The PCIP molecules of the present invention are also useful as pharmacodynamic markers. The term pharmacodynamic marker, as used herein, refers to

an objective biochemical marker that specifically correlates with drug effects. The presence or quantity of the pharmacodynamic marker is not related to the disease or disorder for which the drug is administered; therefore, the presence or quantity of a marker is indicative of the presence or activity of a drug in an individual.

For example, a pharmacodynamic marker may indicate the concentration of drug in biological tissue in the sense that the marker is either expressed or transcribed, or unexpressed or not transcribed in a given tissue depending on the concentration of the drug. In this way, the distribution or uptake of the drug can be monitored by a pharmacodynamic marker. Similarly, the presence or quantity of the pharmacodynamic marker may be dependent on the presence or quantity of the metabolic product of the drug, so that the presence or quantity of the marker indicates the relative rate of degradation of the drug in vivo. Pharmacodynamic markers are particularly suitable for use in increasing the sensitivity of detecting drug effects, especially when the drug is administered at low doses. Since even a small amount of drug may be sufficient to activate repeated rounds of transcription or expression of a marker (eg, a PCIP marker), the amplified marker may be present in a quantity that is more readily detectable than the drug itself. The marker may also be more easily detectable due to the nature of the marker itself; for example, using the methods of the present invention, anti-PCIP antibodies can be used in an immune detection system for a PCIP protein marker, or PCIP-specific radiolabeled probes can be used to detect a PCIP mRNA marker. Furthermore, the use of a pharmacodynamic marker may provide further prediction of the risk of treatment at higher doses. Examples of the use of pharmacodynamic markers are given in: Matsuda et al. US 6033862; Hattis et al. (1991) Env. Health Perspect.

90: 229-238; Schentag (1999) Am. J. Health-Syst. Pharm. 56

Suppl. 3: S21-S24; and Nicolau (1999) Am. J. Health-Syst. Pharm.

• ·· «« · · · ♦ to

172

Suppl. 3: S16-S20.

The PCIP molecules of the present invention are also useful as pharmacogenoma markers. The term pharmacogenoma marker refers to an objective biochemical marker that correlates with a specific clinical drug response or individual sensitivity (see, eg, McLeod et al.

(1999) Eur. J. Cancer 35 (12): 1650-1652. The presence or quantity of the pharmacogenoma marker is related to the predicted response of the individual to a specific drug or class of drugs prior to drug administration. By assessing the presence or quantity of one or more pharmacogenomic markers in an individual, it is possible to determine the drug that is most suitable for the treatment of the individual, or the drug that is expected to have the greatest success. For example, depending on the presence or quantity of RNA or protein (eg, PCIP protein or RNA) for specific tumor markers in an individual, optimal treatment of the individual with the specific tumor present in the individual may be selected. Similarly, the presence or absence of a specific mutation in PCIP DNA may correlate with the response to PCIP. Thus, the use of pharmacogenomic markers allows the selection of the most appropriate treatment for an individual without the need for treatment.

The present invention is further illustrated by the following non-limiting examples. The contents of all citations, patents and published patent applications are hereby incorporated by reference in their entirety

DETAILED DESCRIPTION OF THE INVENTION

The following materials and methods were used in the examples.

Strains, plasmids, capture cDNA and general microbiological

φ «• φφφ

173 φ • φ φ techniky techniky techniky techniky techniky techniky techniky

The basic yeast strains (HF7c, Y187,), the capture (pGBT9) and the captured (pACT2) plasmids used in the examples were purchased from Clontech (Palo Alto, CA). cDNAs encoding rat Kv4.3, Kv4.2, and Kv1.1 were obtained from Wyeth-Ayerst Research (865 Ridge Rd., Monmouth Junction, NJ 08852). Standard yeast medium, including synthetic complete medium without L-leucine, L-tryptophan, and L-histidine, was prepared by a known method of yeast genetic manipulation by a known method (Sherman (1991) Meth. Enzymol. 194: 3-21). Yeast transformations were performed using standard protocols (Gietz et al. (1992) Nucleic Acids Res. 20: 1425; Ito et al (1983) J. Bacteriol. 153: 163-168). Plasmid DNAs were isolated from yeast strains using standard methods (Hoffman and Winston (1987) Gene 57: 267-272).

Construction of capture and quasirt strain

The first 180 amino acids of rKv4.3 (as described in Serdio P. et al. (1996) J. Neurophys 75: 2174-2179) were amplified by PCR and cloned in frame into pGBT9 to obtain plasmids pFWA2, (a capture plasmid). This capture plasmid was transformed into a 2-hybrid screening strain HF7c and tested for expression and self-activation. The capture plasmid was verified for expression using Western hybridization. The rKv4.3 capture plasmid did not activate itself in the presence of 10 mM 3-amino-1,2,3-triazole (3-AT).

Library construction

Rat middle brain tissue was obtained from Wyeth-Ayerst

Research (Monmouth Junction, N.J.). The total cellular RNA was 4

· «··· <

174 extracted from tissues using standard techniques (Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular.

Cloning: A Laboratory Manual. 2nd edition, Cold Spring Harbor

Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1989)). mRNA was prepared using the Poly-A Spin mRNA Isolation Kit from New England Biolabs (Beverly, MA). cDNA from the mRNA sample was synthesized using the Stratagene Synthesis Kit cDNA (La Jolla, CA) and ligated to pACT2's EcoRI and XhoI sites, to yield a 2-hybrid library.

2-hybrid screening

The 2-hybrid screen was performed essentially as described in Bartel, P. et al. (1993) Using the Two-hybrid

System to Detect Polypeptide-Polypeptide Interactions in Cellular Interactions in Development: A Practical Approach, Hartley, D.A. ed. Oxford University Press, Oxford, p. 153179, with pair of capture agent-rkv4.3 capture agent-rat midbrain library. The beta-galactosidase (beta-gal) assay on the filter disc was performed essentially as described above (Brill et al. (1994) Mol. Biol. Cell.

5: 297-312). Clones that were positive for the activity of both reporter genes (His and beta-galactosidase) were scored and selected plasmids isolated from yeast, transformed into E. coli strain KC8, DNA plasmids purified, and the plasmids obtained were sequenced by conventional methods (Sanger F et al.

(1977) PNAS 74: 5463-67.

Specificity test

Positively interacting clones were tested in a binding specificity assay where they were exposed to a panel of related and unrelated capture agents using previously.

175 · · · · · · · · · · · · · · · · · · · · · · · · · · The pairing scheme described (Finley RL Jr. et al. (1994))

PNAS, 91 (26): 12980-12984). Briefly, positive fish plasmids were transformed into Y187 and the capture reagent panel transformed into HF7c. Transformed fish and capture cells were coated as strips on selective medium plates, paired on YPAD plates, and assayed for reporter gene activity.

Analysis

PCIP nucleotides were analyzed for corresponding nucleotides using the BLASTN 1.4.8MP program (Altschul et al. (1990) Basic

Local Alignment Search Tool. J. Mol. Biol. 215: 403-410).

PCIP proteins were analyzed for the corresponding polypeptides using the BLASTP 1.4.9MP program.

Electrophysiological methods

Mammalian in vitro studies

HEK 293 and CHO cells were used for the experiment 1-3 days after transient transfection. Whole cell currents were scanned from cells expressing GFP identified by green fluorescence. Electrodes pushed out of fibrous borosilicate glass (Sutter Instrument Co., Novato, CA) had an initial resistance of 3-5 MOhm. After Gigaseal and the configuration of ruptured whole cells the resistance was less than 10 MOhms. Whole cell solutions were made from 10X Hank balanced saline (GibcoBRL) at the following concentrations (in mM): 138 NaCl, 5.4 KCl, 1.3 MgCl ₂ , 1.3 CaCl ₂ , 5.5 Dglucose and 10 HEPES pH 7.4. The intracellular electrode solution consisted of (in mM) 140 KCl, 10 HEPES, 10 EGTA, 0.5 MgCl ₂ , pH 7.3. All chemical reagents were from Sigma (St. Louis, MO).

9 9 9

9999 8 9

176

999 9 or Fisher Scientific (Houston, TX). Membrane currents were recorded using an EPC9 contact terminal amplifier (HEKÁ, Germany). Data was analyzed using Matlab (Natick, Ma), and was read if necessary. All experiments were carried out at room temperature.

Experiments on Xenopus oocytes

More than two surgical procedures were performed on frogs and procedures were performed using conventional techniques. Frogs were anesthetized with ice. Total cRNA (1-10 ng) was injected into stage IV Xenopus oocytes collected the previous day. Xenopus oocytes were incubated in ND96 containing (in mM) 96 NaCl, 2 KCl, 1.8 CaCl ₂ , 1 MgCl ₂ , 5 HEPES, pH 7.6, plus (Gentamycin 50 µg / ml) at 18 ° C. Xenopus oocytes were studied 3-7 days after injection. Voltage recordings from two electrodes were made in ND96 solution using a TURBO TEC 03 Clamp Amplifier (ALA Scientific Instruments, Westbury, NY). Both electrodes were filled with 3 M KCl and had resistances ranging from 0.2-1 MOhm. Current signals were filtered at 1000 Hz before being transferred to a PC (Gateway, CA) using PULSE software (HEKÁ, Germany).

Example 1: Identification of rat PCIP cDNA

The Kv4.3 gene coding sequence (encoding the first 180 amino acids) was amplified by PCR and cloned into pGBT9 to generate the GAL4 DNA-binding domain-Kv4.3 (1-180) gene fusion (plasmid pFWA2). HF7c was transformed with this construct. The strain obtained was grown on synthetic complete medium without Ltryptophan but not on synthetic complete medium without Ltryptophan and L-histidine in the presence of 10mM 3-AT, which

177 ··· ··· · 9 9 999 9 9 9 • 9999 9 9 99 999 9 «* · ············ shows that the {GAL4 DNA-binding domain} - {vKv4.3 (1-180)} gene fusion has no intrinsic activity to activate transcription higher than the threshold allowed by 10 mM 3-AT.

In this example, a yeast 2-hybrid assay was performed in which a plasmid containing the {GAL4 DNA-binding domain} {rKv4.3 (1-180)} fusion gene was inserted into the yeast 2-hybrid screening strain HF7c as described above. HF7c was then transformed with a rat 2-hybrid midbrain library.

Approximately six million transformants were obtained and placed on selection medium. Colonies that grew on selection medium and expressed the beta-galactosidase reporter gene were further characterized and subjected to retransformation and specificity assays. Retransformation and specificity assays yielded three PCIP clones (Rat 1v, 8t, and 9qm) that were able to bind to the Kv4.3 polypeptide.

The complete sequences for the rat lv gene and partial sequences for the 8t and 9q genes were identified as follows. Partial rat PCIP sequences were used to prepare probes, which were then used to screen, for example, the rat middrain cDNA library. Positive clones were identified, amplified and sequenced using standard techniques to obtain the complete sequence. Further, rapid amplification of the existing ends of rat PCIP cDNA (using, for example, 5 'RACE, Gibco, BRL) was used to complete the 5' end of the transcripts.

Example 2: Identification of human lv cDNA

To obtain a human lv nucleic acid molecule, a cDNA library prepared from a human hippocampus (Clontech, Palo

Alto, CA) investigated the following under very strict conditions

178 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Method: prehybridization for 4 hours at 42 ° C in Clontech Express Hyb solution, then overnight hybridization at 42 ° C.

The probe used was a PCR-generated fragment, including nucleotides 49-711 of the rat sequence, labeled with 32p dCTP. The filters were washed 6 times in 2XSSC / 0.1% SDS at 55 ° C. The same conditions were used for secondary screening of positive isolates. The clones so obtained were sequenced using an ABI automated DNA sequencing system, and the sequences were compared to the rat sequence shown in SEQ ID NO: 3 as well as known sequences from the GenBank database. The largest clone from the library was then subcloned into pBS-KS + (Stratagene, La Jolla, CA) for sequence verification. A 515 base pair clone was determined to represent the human homologue of the lv gene, containing 211 base pair of 5 'UTR and 304 base pair of large coding region. A 3 'RACE according to the manufacturer's instructions (Clontech Advantage PCR kit) was used to prepare complete cDNA.

Example 3: Isolation and characterization of alternative splicing variants lv

The murine lv sequence shown in SEQ ID NO: 5 and the rat lvi alternative splice variant shown in SEQ ID NO: 7 were isolated using the 2-hybrid assay as described in Example 1. The murine lvi alternative splice variant shown in SEQ ID NO: 7 was isolated. NO: 7 was isolated by screening the mouse brain cDNA library, and the rat alternative splice variant of lvn shown in SEQ ID NO: 11 was isolated by BLAST screening.

Example 4: Isolation and identification of 9Q and other PCIPs

Rat 9q1 (SEQ ID NO: 15) was isolated from the rat database

9qm (SEQ ID NO: 21) was isolated by a 2-hybrid test and a rat

9qc (SEQ ID NO: 27) was identified from the database. Human 9ql

179 • 9 ·

9 9 9 (SEQ ID NO: 13) and human 9qs (SEQ ID NO: 23) were identified as described in Example 2. Mouse 9q1 (SEQ ID NO: 17), monkey 9qs (SEQ ID NO: 25), human p183 (SEQ ID NO: 39), rat p19 (SEQ ID NO: 33) and mouse p19 (SEQ ID NO: 35) were identified from the database. Rat 8t (SEQ ID NO: 29) was identified using a 2-hybrid assay. The sequence W28559 (SEQ ID NO: 37) was identified from the database and sequenced by the identified EST with Genbank accession number AI352454. The protein sequence was found to contain a 41 amino acid region with strong homology to 1v, 9q1 and p19 (see alignment in Figure 25). However, beyond this homogeneous region, the sequence differs from that of the PCIP family. This sequence may represent a gene having a 41 amino acid domain with homology to a similar domain occurring in members of the PCIP family.

Human genomic 9q sequences (SEQ ID NOs: 46 and 47) were isolated by screening a BAC genomic DNA library (Reasearch Genetics) using primers designed according to the sequence of human 9qm cDNA. Two positive clones (44802 and 721117) were identified and sequenced.

Example 5: Expression of IV, 8T, and 9Q mRNA in rat tissues

Rat and mouse Northern membranes containing various tissues (Clontech) were probed with a [32p] -labeled cDNA probe directed to the 5'-untranslated and 5'-coding region of the rat 1v sequence (nucleotides 35-124; SEQ ID NO: 3) (this probe) is specific for rat lv and rat lvi), the 5 'coding region of the 8t sequence (nucleotides 1-88; SEQ ID NO: 29) (this probe is specific for the 8t), or the 5' end of the rat 9qm sequence (nucleotides 1-195; (SEQ ID NO: 21) (this probe is specific for all 9q isoforms except 8t). Membranes were hybridized using standard

180

• ·· · technician. Northern membranes hybridized with the rat lv probe showed a single band at 2.3 kb only in a pathway containing brain RNA, suggesting that lv expression is brain-specific. Northern membranes probed with a rat 8t probe showed a major band at 2.4 kb. The rat 8t band was most intense in the pathway containing cardiac RNA and a weaker band in the pathway containing brain RNA was also present. Northern membranes hybridized with a 9q cDNA probe showed a major band at 2.5 kb and a minor band larger than 4 kb with predominant expression in brain and heart. The smaller band may represent incomplete spliced or processed 9q mRNA. The results from northern hybridizations further show that p19 is expressed primarily in the heart.

Example 6: Expression of IV, 8T, and 9Q in the brain

Expression of rat 1v and 8t / 9q genes in the brain was screened by Sequencing Hybridization Histochemistry (ISHH) using [?] S labeled cRNA probes and a hybridization procedure identical to that described in Rhodes et al. (1996) J. Neuros.,

16: 4846-4860. Templates for the preparation of cRNA probes were prepared by standard PCR methods. Briefly, oligonucleotide primers were designed to amplify a fragment of the 3 'or 5' untranslated region of the target cDNA and further to add a promoter-recognition sequence for T7 and T3 polymerase. Thus, we used the following primers to prepare a probe of 300 nucleotides directed to the 3'-untranslated region of lv mRNA:

5-TAATACGACTCACTATAGGGACTGGCCATCCTGCTCTCAG-3 (T7, coding; SEQ ID NO: 42)

5-ATTAACCCTCACTAAAGGGACACTACTGTTTAAGCTCAAG-3 (T3, reverse, antisense; SEQ ID NO: 43). The underlined bases correspond to the T7 and T3 promoter sequences. To prepare a 325 bp probe • · · ·

181 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · The region of the 3'-untranslated sequence of the common 8t and 9q mRNA was used as follows:

5-TAATACGACTCACTATAGGGCACCTCCCCTCCGGCTGTTC-3 (T7, coding;

SEQ ID NO: 44)

5-ATTAACCCTCACT AAAGGGAGAGCAGCAGCATGGCAGGGT-3 (T3, reverse, antisense; SEQ ID NO: 45).

Rat brain tissue autoradiograms processed for ISHH localization of lv or 8t / 9q mRNA expression showed that lv mRNA is expressed strongly in the brain with an expression pattern consistent with neuronal labeling, unlike glial or endothelial cells, lv mRNA is strongly expressed in cortical, hippocampal and striatal interneurons, thalamic reticulum nucleus, medial habenule, and in cerebellar granular cells, lv mRNA is expressed moderately in the midbrain nuclei, including substantia nigra and superior colliculus, in several other thalamic nuclei and in the medial septal and diagonal nucleus of the basal anterior brain.

Because the probes used to analyze the expression of 8t and 9q hybridize to a region of the 3-untranslated region that is identical in the 8t and 9q mRNA, this probe creates a composite image showing that the 8t / 9q mRNA is extensively expressed in the brain in a way that partially overlaps expression of lv as described above. However, 8t / 9q mRNA is strongly expressed in the striatum, hippocampus, cerebellar granular cells and neocortex. 8t / 9q mRNA is moderately expressed in the middle brain, thalamus and brainstem. In many of these regions, 8t / 9q mRNA appears to be concentrated in interneurons except the major cells, and in all regions, 8t / 9q expression appears to be concentrated in neurons instead of glial cells.

182 · ♦ · · 182 «« «« «« · * * * * · · · · · · ·

Single and double labeled immunohistochemical assays have shown that PCIP and Kv4 polypeptides are precisely colocalized in many cell types and brain regions where PCIP and Kv4 mRNA are co-expressed. For example, 9qm localizes concurrently with Kv4.2 in the bodies and dendrites of hippocampal granular and pyramidal cells, neurons in the medial habenular nucleus and in cerebellar basket cells, while lv localizes concurrently with Kv4.3 in neurons II of the posterior cingulatory cortex layer, hippocampal interneurons and in a subset of cerebellar granular cells. Immunoprecipitation showed that lv and 9qm are co-associated with Kv4 α-subunits in rat brain membranes.

Example 7: Co-association of PCIP and Kv4 channels in COS and CHO cells

COSI and CHO cells were transiently transfected with individual PCIPs (KChIP1, KChIP2, KChIP3) alone or together with Kv4.2 or Kv4.3, using a lipofectamine-plus procedure, essentially as described by the manufacturer (Boehringer Mannheim). 48 hours after transfection, cells were washed, fixed, and processed for immunofluorescent visualization as previously described (Bekele-Arcuri et al. (1996) Neuropharmacology, 35: 851-865).

Affinity-purified rabbit polyclonal or murine monoclonal antibodies to the Kv4 channel or PCIP protein were used for immunofluorescence detection of target proteins.

When expressed alone, PCIPs were diffused in the cytoplasm of COS-1 and CHO cells as expected for cytoplasmic proteins. Conversely, when expressed alone, Kv4.2 and Kv4.3 polypeptides were concentrated in the perinuclear ER and Golgi compartments, with some immunoreactivity concentrated at the outer edges of the cells.

183

• 4 4 4 44

When PCIPs were expressed concurrently with the Kv4 α-subunits, the characteristic diffuse distribution of PCIPs changed dramatically so that the PCIPs co-localized with the Kv4 α-subunits.

This PCIP redistribution did not occur when pCIPs were expressed concurrently with the Kv1.4 α-subunits, indicating that the altered localization of PCIP is not due to overexpression and that these PCIPs associate specifically with the Kv4-α-subunit family.

To verify that PCIP and Kv4 polypeptides are tightly associated and not only co-located with co-transfected cells, reciprocal immunoprecipitation analyzes were performed using PCIP and channel-specific antibodies described above. All three PCIP polypeptides were associated with Kv4 α-subunits in co-transfected cells, as evidenced by the ability of antiKv4.2 and anti-Kv4.3 antibodies to immunoprecipitate KChIP1,

KChIP2, and KChIP3 proteins from lysates prepared from co-transfected cells, and the ability of anti-PCIP antibodies to immunoprecipitate Kv4.2 and Kv4.3 α-subunits from the same lysates. Cells were lysed in buffer containing detergent and protease inhibitors, and prepared for the immunoprecipitation reaction as described previously (Nakahira et al. (1996) J. Biol. Chem., 271: 7084-7089). Immunoprecipitation was performed as described by Nakahira et al. (1996) J. Biol. Chem., 271: 7084-7089 and in Harlow, E. and Lane, D., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, cl988. The products obtained from immunoprecipitation were fractionated by size SDS-PAGE and transferred to nitrocellulose filters using standard procedures.

To confirm that the cytoplasmic N-terminus of the Kv4 channel is sufficient to interact with PCIP, KChIP1 or KChIP2 was co-expressed with a Kv4.3 mutant (Kv4.3 C) lacking • ·· ·

184 whole 219 amino acid cytoplasmic C 184 C amino acid cytoplasmic C -terminal ending. In transiently transfected COS-1 cells was

Kv4.3? C mutant significantly uptake in the perinuclear ER and Golgi apparatus: little or no staining was observed at the outer edges of the cells. However, KChIP1 and KChIP2 localized concurrently with Kv4.3? C in co-transfected cells, and further Kv4.3? C effectively immunoprecipitated simultaneously with PCIP antibody, indicating that the interaction of these PCIPs with the Kv4 α-subunit does not require a cytoplasmic C-terminus. channel.

Example 8: Concurrent association of PCIP and Kv4 channels in natural tissues

To determine whether PCIPs localize concurrently with and associate with Kv4 subunits in natural tissues, Kv4- and PCIP-specific antibodies were used for single and double labeled immunohistochemical assays and for reciprocal co-immunoprecipitation analysis of rat brain membranes. Immunohistochemical staining of rat brain sections showed that KChIP1 and KChIP2 localize concurrently with Kv4.2 and Kv4.3 in a region- and type-specific manner. For example, KChIP1 localized concurrently with Kv4.3 in hippocampal interneurons, cerebellar granular cells and cerebellar glomeruli, specialized synaptic clusters between cerebellar basket and golgi dendrites, and moss fiber termination. KChIP2 localizes concurrently with Kv4.3 and Kv4.2 in dendrites of granular cells in the dentate gyrus, in the apical and basal dendrites of the hippocampal and neocortical pyramidal cells, and in several subcortical structures, including the striatum and superior colliculus. Co-immunoprecipitation analyzes performed using synaptic membranes prepared from whole rat brain showed that PCIPs (KChIPs 1, 2 and 3) are closely associated with

00 0

0000 • 0

185

0 ···

0 000

0 0 0 • 0 0 0

00

Kv4.2 and Kv4.3 in K + channel brain complexes. Anti-PCIP antibodies immunoprecipitated Kv4.2 and Kv4.3 from brain membranes, and anti-Kv4.2 and Kv4.3 antibodies immunoprecipitated PCIP. None of the PCIP polypeptides immunoprecipitated with the antiKv2.1 antibody, suggesting that the association of these PCIPs to brain Kv channels may be specific for Kv4 α-subunits. Taken together, these anatomical and biochemical analyzes have shown that these PCIPs are integral components of natural Kv4 channel complexes.

Example 9: PCIPs are calcium binding proteins

To determine whether KChlP 1, 2 and 3 binds Ca ²⁺ , GST-fusion proteins were prepared for each PCIP and the ability of GSTPCIP proteins, as well as recombinant PCIP polypeptides 2+ enzymatically cleaved from GST to bind Ca, was evaluated using an assay. filter overlapping (as described, for example, in Kobayashi et al. (1993) Biochem. Biophys. Res. Commun.

189 (1): 511-7). All three PCIP polypeptides, but not unrelated GST-fusion protein, showed strong Ca ²⁺ binding in this assay. Furthermore, all three PCIP polypeptides showed a Ca ²⁺ dependent mobility shift on SDS-PAGE, indicating that, like other members of this family, KChIPs 1, 2 and 3 are actually Ca ²⁺ -binding proteins (Kobuyashi et al. (1993) Buxbaum et al., Nef (1996) Neuron-specific calcium sensors (the NCS-1 subfamily) In: Celio MR (ed) Guidebook on calcium-binding proteins Oxford University Press, New York, pp. 94- 98: Buxbaum JD, et al (1998) Nature Med 4 (10): 1177-81.

Example 10: Electrophysiological characterization of PCIP

Because PCIPs, such as KChIP1 (lv), KChIP2 (9ql), and KChIP3 (p19), are localized together by the Kv4 α-subunits in the brain, it is this to IP ·· ·· ··· • ·· ····································

Another important question is whether these PCIPs change the conductivity of Kv4 channels. To address this issue, Kv4.2 and Kv4.3 were expressed alone and in combination with individual PCIPs.

CHO cells were transiently transfected with cDNA using the DOTAP lipofection method as recommended by the manufacturer (Boehringer Mannheim, Inc). Transfected cells were identified by co-transfection of GFP with the genes of interest and then determined whether the cells contained GFP fluorescence. Currents in CHO cells were measured using a contact clamp technique (Hamill et al.

1981. Pfluegers Arch. 391: 85-100).

Transient transfection of rat Kv4.2 α-subunit in CHO cells resulted in expression of typical K + conductivity A type. Co-expression of Kv4.2 with KChIP1 showed several pronounced effects of KChIP1 on the channel (Fig. 41 and Table 1). First, the amplitude of the Kv4.2 current increased approximately 7.5-fold in the presence of KChIP1 (the amplitude of Kv4.2 alone = 0.60 +/- 0.096 nA / cell; Kv4.2 + KChIP1 = 4.5 +/- 0) , 55 nA / cell). When converted to current density by correcting for cell capacitance, measuring cell surface area, the Kv4.2 current density increased 12-fold while expressing KChIP1 (Kv4.2 alone = 25.5 +/- 3.2 pA / pF; Kv4) 2 + KChIP1 = 306.9 +/- 57.9 pA / pF), indicating that KChIP promotes and / or stabilizes Kv4.2 surface expression.

Along with this increase in current density, a dramatic shift of the Kv4.2 current activation threshold to the left was observed in cells expressing Kv4.2 and KChIP1 (activation of VL / 2 for Kv4.2 alone = 20.8 + / - 7.0mV, Kv4.2 + KChIP1 = -12.1 +/- 1.4 mV). Finally, the kinetics of Kv4.2 inactivation slowed significantly when Kv4.2 was expressed simultaneously with KChIP1 (Kv4.2 alone inactivation time constant = 28.2 +/- 2.6 ms; Kv4.2 +

KChIP1 = 104.1 +/- 10.4 ms), while channels recovered from inactivation much faster in cells expressing both Kv4.2 and KChIP1 (recovery tau = 53.6 +/- 7.6 ms) compared to cells • · · · * * * *

9999 ·

187 ·· ·· ·· ··· ·

9 9 9 9 9 9 9

9 9 9 9 9 9

99 99 99 expressing Kv4.2 alone (recovery tau = 272.2 +/- 26.1 ms).

KCh1P 1, 2 and 3 have different N-termini but have significant amino acid identity in the C-terminal base domain.

Despite different N-termini, the effects of KChIP2 and KChIP3 on Kv4.2 current density and kinetics are similar to KChIP1 (Table 1).

Thus, to confirm that the C-terminal base domain, which contains all three EF-arms, is sufficient to modulate Kv4 current density and kinetics, KChIP1 and KChIP2 mutations with N-terminal truncation were prepared. The KChIP1? N2-31 and KChIP2? N2-67 mutants are truncated relative to KChIP1 and KChIP2, respectively, to the C-terminal 185 amino acid backbone. Coexpression of KChIP1? N2-31 or KChIP2? N2-67 with Kv4.2 in CHO cells produced changes in Kv4.2 current density and kinetics that were indistinguishable from the effects produced by complete KChIP1 or KChIP2 (Table 1).

To investigate whether the modulation effects of these KCh1Ps are specific for Kv4 channels, KChIP1 was expressed concurrently with Kv1.4 and Kv2.1 in Xenopus oocytes. 1-3 ng of cRNA / oocyte were injected into the Xenopus oocyte, where cRNA was prepared using standard in vitro transcription techniques (Sambrook et al. 1989. Molecular Cloning: a laboratory manual, Cold Spring Harbor Press). Currents in Xenopus oocytes were measured using 2-electrode voltage terminals. KChIP1 showed no effect on Kv1.4 or Kv2.1 streams (Table 2), indicating that these functional effects may be Kv4 channel specific. As a final control of KChlP effects and to verify that the effects of KChlP on Kv4 streams are independent of the expression system, the above kinetics analyzes were repeated after expression of Kv4.3 and KChlP mRNA in Xenopus oocytes. The effects of KChIP1 on Kv4.3 in the Xenopus oocyte system were strongly similar to • • • 4

44

444 4

188 ♦ · 4 4 4 4 4 4 444 4 4 4 4 4 4 4 44 44 4 4

44 44 44 effects on Kv4.2 in CHO cells (Table 1).

2+ o

Since these KChlPs bind to Ca, it is another important task to determine whether the effects of KChIP1 on Kv4.2 currents are Ca ²⁺ dependent. This question was answered indirectly by inserting point mutations into each EF-arm of KChIP1: one mutant of a mile point mutation in the first two EF arms (D199 to A, Gum to A, D135 to A, and G140 to A) and another had point mutations in all three EF arms (D199 on A, Gum on A, D135 on A, G140 on A, D183 on A, and Gi88 on A). These mutations substituted alanine for the two most conserved amino acids in the EF-arm (Fig. 25; Linse, S. and Forsen, S. (1995) Determinants that govern high-affinity calcium binding. Vn Means, S. (Ed.) Advances in second messenger and phosphoprotein research (New York, Ravens Press,. 30: 89-150). Co-expression of this KChIP1 mutant with three mutations in the EF-arm with Kv4.2 or Kv4.3 in COS cells showed that this mutant is localized simultaneously and is effectively immunoprecipitated with Kv4 α-subunits in COS-1 cells. However, these point mutations in the EF-arm completely eliminated the effects of KChIP1 on Kv4.2 kinetics (Table 1). Taken together, these results indicate that the binding interaction between KChIP1 and Kv4.2 is Ca2 + independent, while the modulation of Kv4.2 KChIP1 kinetics is either Ca2 ⁺ -dependent or sensitive to structural changes introduced by point mutations into EF-arms.

189 · »» »» · «« «« «« «« «• • • • • · · · · * * * * * * * * * * *

Table 1: Functional effects of KChlP on Kv4 channels

Parameter current rKv4.2 Η ^- vector rKv4.2 + KChlP 1 rKv4.2 + KChIPl ÁN2-31 rKv4.2 + KChIP2 rKv4.2 + KChIP2 ÓN2-67 rKv4.2 + KChIP3 rKv4.3 rKv4.3 + KChIPl Top current 0.60 * 4.5 * 6.0 * 3.3 * 5.8 * 3.5 * 7.7μΑ 18.1μΑ * (nA / cell ± 0.096 ± 0.055 ± 1-1 ± 0.45 ± 1-1 ± 0.99 ± 2.6 ± 3.8 at 50 MV) Vrcholová density current 25.5 306.9 * 407.2 * 196.6 * 202.6 * 161.7 * - - (pA / pF at 50 mV) ± 3.2 ± 57.9 ± 104.8 ± 26.6 ± 27.5 ± 21.8 Inactivation 28.2 104.1 129.2 95.1 * 109.5 * 67.2 * 56.3 135.0 time constant (ms, at 50 mV) ± 2.6 ± 10.4 ± 14.2 ± 8.3 ± 9.6 ± 14.1 ± 6.6 ± 15.1 time 272.2 53.6 * 98.1 * 49.5 * 36.1 * 126.1 * 327.0 34.5 * constant recovery from inactivation AND

* Significantly different from control.

190 »· 190» «« »» »» »» »»

Table 2: Functional effects of KChlP on other Kv channels

Xenopus oocytes Xenopus oocytes Current parameters HKvl.4 hKvl.4 ± lv HKv2.1 HKv2.1 ± lv Peak current 8.3 6.5 3.7 2.9 (μΑ / cell at 50 MV) ± 2.0 ± 0.64 ± 0.48 ± 0.37 Inactivation time constant 53.2 58.2 1.9 s 1.7 s (ms, at 50 mV) ± 2.8 ± 6.6 ± 0.079 0.078 Constant of the time recovery from inactivation (s, at -80 mV) 1.9 1.6 7.6 7.7 Activation V1 / 2 (mV) -21.0 -20.9 12.0 12.4 Equilibrium inactivation V1 / 2 (mV) -48.1 -47.5 -25.3 -23.9

Example 11: Effects of KChIP1 on Surface Expression of KV4-α Subunits in COS-1 Cells

To assess the ability of KChIP1 to increase surface expression of Kv4 channels, the ability of KChIP1 to promote Kv4 channel formation in a cell surface assembly with PSD-95 was examined. PSD-95 was used to facilitate visualization of the complex.

To facilitate the interaction between Kv4.3 and PSD-95, a *

191 · · K K K K K K K K K K K K K K K K K K K K K K K K K ·· ···· «« * · · · * ₉ 9 Κν4.3 chimeric subunit (Kv4.3ch), which was 10 amino acids of Cterminálních rKvl.4 (SNAKAVETDV SEQ ID

NO: 73) connected to the C-terminus of Kv4.3. The C-terminal 10 amino acids of rKv1.4 were used because they associate with PSD-95 and cause the ability to associate PSD-95 with the Kv4.3 protein when fused to the C-terminus of Kv4.3. Expression of Kv4.3ch in COS-1 cells showed that Kv4.3ch polypeptide was captured in the perinuclear cytoplasm, with minimal detectable Kv4.3ch immunoreactivity at the outer edges of the cells. When Kv4.3ch was expressed concurrently with PSD-95, PSD-95 captured in the perinuclear cytoplasm and localized concurrently with Kv4.3ch. However, when KChIP1 was expressed concurrently with Kv4.3ch and PSD-95, large plaque-like pools of Kv4.3ch, KChIP1 and PSD-95 were observed. Triple-labeled immunofluorescence confirmed that these surface clusters contained all three polypeptides, and reciprocal co-immunoprecipitation analyzes showed that the three polypeptides are associated in these surface clusters. Control experiments showed that KChIP1 did not interact with PSD-95 alone, and did not localize concurrently with Kv1.4 and PSD-95 in surface clusters. Taken together, these data show that KChIP1 can support the temporary transfer of the Kv4.3 subunit to the cell surface.

Example 12: Characterization of PCIP proteins

In this example, the amino acid sequence of PCIP proteins was compared to the amino acid sequences of known proteins and different motifs were identified.

1v polypeptide having the amino acid sequence set forth in SEQ ID NO: 2

SEQ ID NO: 3 is a novel polypeptide that contains 216 amino acid residues. Domains that appear to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in

192 ·· · 4 4 ·· 4 · 4 4

· 4 · 4 · 4 · 4 · 4 · 4 · 4 · 4 · 4 · 4

Second Messenger and Phosphoprotein Research 30, chapter

3, pp. 89-151, ed. Means, AR., Raven Press, Ltd., New York), were identified by sequence comparison (see Figure 21).

An 8t polypeptide whose amino acid sequence is set forth in SEQ ID NO: 30 is a novel polypeptide that contains 225 amino acid residues. Calcium binding domains likely to be involved in calcium binding (Linse, S. and Forsen, S.

(1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter, pp. 89-151, ed. Means, AR., Raven Press, Ltd., New York), were identified by sequence comparison (see Figure 21).

The 9q polypeptide is a novel polypeptide that contains calcium binding domains that appear to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter, pp. 89-151, ed.

Means, AR., Raven Press, Ltd., New York).

The p19 polypeptide is a novel polypeptide that contains calcium binding domains that appear to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter, pp. 89-151, ed.

Means, AR., Raven Press, Ltd., New York)

BLASTN 2.0.7 screening (Altschul et al. (1990) J. Mol. Biol. 215: 403) of the rat lion nucleotide sequence showed that the rat lvi is similar to the rat cDNA clone RMUAH89 (accession number AA849706). The rat lvi nucleic acid molecule is 98% identical to the rat cDNA clone RMUAH89 (accession number AA849706) at nucleotides 1063 to 1488.

BLASTN 2.0.7 Scanning (Altschul et al. (1990) J. Mol.

193

Biol. 215: 403) of the nucleotide sequence of human 9q1 showed that human 9q1 is similar to human cDNA clone 1309405 (accession number AA757119). The human 9 ql nucleic acid molecule is 98% identical to the human cDNA clone 1309405 (accession number AA757119) at nucleotides 937-1405.

BLASTN 2.0.7 screening (Altschul et al. (1990) J. Mol. Biol. 215: 403) of the nucleotide sequence of mouse P19 showed that mouse P19 is similar to the Mus musculus cDNA clone MNCb-7005 (accession number AU035979). The murine P19 nucleic acid molecule is 98% identical to the Mus musculus cDNA clone MNCb7005 (accession number AU035979) at nucleotides 1-583.

Example 13: Expression of recombinant PCIP proteins in bacterial cells

In this example, PCIP was expressed as a recombinant glutathione-S-transferase (GST) fusion polypeptide in E. coli, and the fusion polypeptide was isolated and characterized. Specifically, PCIP was fused to GST and this fusion polypeptide was expressed in E.coli, e.g., strain BI21. Expression of the GST-PCIP fusion protein in BI21 was induced by IPTG. The recombinant fusion polypeptide was purified from crude bacterial lysates induced by the BI21 strain by affinity chromatography on glutathione beads.

The molecular weight of the obtained fusion polypeptide was determined by electrophoretic analysis of a polyacrylamide gel purified polypeptide from bacterial lysates.

Rat 1v and 9ql were cloned into pGEX-6p-2 (Pharmacia).

The obtained recombinant fusion proteins were expressed in E. coli cells and purified using methods known in the art (as described, for example, in Current Protocols in Molecular

Biology, ed. Ausubel et al. John Wiley & Sons: 1992).

·· ·

194 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

The identities of the purified proteins were verified by western blotting using antibodies directed against rat 1v and 9q1 peptide epitopes.

Example 14: Expression of recombinant PCIP proteins in COS cells

A pcDNA / Amp vector from Invitrogen Corporation (San Diego, CA) was used to express the PCIP gene in COS cells. This vector comprises an SV40 origin of replication, an ampicillin resistance gene, an E. coli origin of replication, and a CMV promoter followed by a polylinker region, and an SV40 intron and polyadenylation site. DNA fragment encoding whole PCIP protein and HA tail (Wilson et al. (1984)

Cell 37: 767) or the FLAG tail fused in-frame to the 3 'end of the fragment was cloned into the polylinker region of the vector, thereby placing expression of the recombinant protein after control of the CMV promoter.

To construct the plasmid, the PCIP DNA sequence was amplified by PCR using two primers. The 5 'primer contained a selected restriction site followed by approximately twenty nucleotides of the PCIP coding sequence from the initiation codon; The 3 'end of the sequence contained a complementary sequence to the next selected restriction site, a translation stop codon, a HA tail or FLAG tail, and the last 20 nucleotides of the PCIP coding sequence. The PCR amplified fragment of the pCDNA / Amp vector was digested with the appropriate restriction enzymes and the vector was dephosphorylated using the CIAP enzyme (New England Biolabs, Beverly, MA). Preferably, the two selected restriction sites are different such that the PCIP gene is inserted in the correct orientation. The ligation mixture was transformed into E. coli cells (e.g. strains HB101, DH5α, SURE, from Stratagene may be used)

195

Cloning Systems, La Jolla, CA), transformed culture was plated on ampicillin medium plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment.

COS cells were then transfected with PCIP-pcDNA / Amp plasmid DNA using a technique using calcium phosphate or calcium chloride precipitation, DEAEdextran-mediated transfection, lipofection, or electroporation. Other suitable methods for transfecting a host cell are disclosed in Sambrook, J., Fritsh, EF, and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Expression of PCIP polypeptides was detected by radiolabeling (35g-methionine or β-S-cysteine from NEN, Boston, MA) and immunoprecipitation ( Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988) using HA specific monoclonal antibody. Briefly, cells were labeled for 8 hours 35g_ methionine (or 55g_ _C y _S -J- _e j _NEM). The culture medium was then harvested and the cells lysed using detergents (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). Cell lysate and culture medium were precipitated with HA specific monoclonal antibody. The precipitated polypeptides were then analyzed by SDS-PAGE.

Alternatively, the DNA containing the PCIP coding sequence was cloned directly into the polylinker of the pCDNA / Amp vector using suitable restriction sites. The obtained plasmid was transfected into COS cells as described above and expression of PCIP polypeptides was detected by radiolabeling and immunoprecipitation with

9

9 · 9

antibodies.

pRBG4 expression vector.

196 use of PCIP specific monoclonal

Rat lv was cloned into mammalian

Transfection into COS cells was performed using LipofectAmine Plus (Gibco BRL) according to the manufacturer's instructions. Expressed lv protein was detected by immunocytochemistry and / or western blotting using antibodies directed against lv in rabbits or mice.

Example 15: Identification and Characterization of Complete Human P19

The complete sequence of human p19 was identified using RACE PCR. The sequence of p19 (also referred to as KChIP3) is shown in Figure 16. The amino acid sequence of human p19 is 92% identical to the mouse p19 gene (SEQ ID NO: 35).

TBLASTN search using the human p19 protein sequence showed that human p19 is homologous to two sequences, Calsenilin (as described in (1998) Nature Medicine 4: 1177-1181) and DREAM, and the Ca ²⁺ -dependent regulator of transcription of prodynorphine and c phos (as described in Carrion et al. (1999) Nature 398: 80-84). Human p19 is 100% identical at nucleotide level to Calsenilin (but exceeds the 3 'published sequence) and 99% identical at nucleotide level to DREAM.

The ability of p19 (like other members of the PCIP family) to co-locate with presenilin and act as transcription factors was determined using techniques known in the art such as northern hybridization, in situ hybridization, β-gal assays, DNA mobility assays (as described). , for example, in Carrion et al. (1999) Nature 398: 80) and suerposun assays.

197 DNA mobility, using antibodies specific for KChIP.

Another assay suitable for assessing association of PCIP family members with presenilins is co-immunoprecipitation (as described, for example, in Buxbaum et al. (1998) Nature Medicine 4: 1177).

Example 16: Identification and characterization of simian KChIP4

In this example, the identification and characterization of genes encoding monkey KChIP4a (jlkbd352e01t1) and alternatively spliced monkey KChIP4b (jlkbb231c04t1), KChIP4c (jlkxa053c02), and KChIP4d (jlkx015bl0) are described. TBLASTN search in a suitable database with the sequence of known PCIP family members led to the identification of four clones jlkbb231c04t1, jlkbd352e01t1, jlkxa053c02 and jlkx015bl0. These four monkey clones were obtained and sequenced.

The sequences of the monkey clones jlkbb231c04t1 and jlkbd352e01t1 were found to correspond to alternatively spliced variants of another PCIP family member referred to herein as KChIP4. Clone jlkbb231c04t1 contains an 822bp deletion relative to jlkbd352e01tl (presumably due to exon excision), resulting in loss of the EF domain. In clone jlkbd352e01t1, the final EF domain is retained and the C-terminus is highly homologous to the C-terminus of the PCIP family members lv, 9q1 and p19. The overall identity at the homologous C-terminal between KChIP4, 1v, 9q1 and p19 is in the range of 71% -80% at the amino acid level (alignment was performed using CLUSTALW).

Monkey KChIP4c and KChIP4d were discovered by BLASTN search using monkey KChIP4a as a search request in a suitable database.

198

The nucleotide sequence of the simian KChIP4a cDNA and the predicted amino acid sequence of the KChIP4a polypeptide are shown in Figure 23 and in SEQ ID NOs: 48 and 49, respectively.

The nucleotide sequence of the simian KChIP4b cDNA and the predicted amino acid sequence of the KChIP4b polypeptide are set forth in Figure 24 and in SEQ ID NOs: 50 and 51, respectively.

The nucleotide sequence of the simian KChIP4c cDNA and the predicted amino acid sequence of the KChIP4c polypeptide are shown in Figure 35 and in SEQ ID NOs: 69 and 70, respectively.

The nucleotide sequence of the simian KChIP4d cDNA and the predicted amino acid sequence of the KChIP4d polypeptide are shown in Figure 36 and in SEQ ID NOs: 71 and 72, respectively.

Giant. 37 depicts a protein sequence comparison of KChIP4a, KChIP4b, KChIP4c, and KChIP4d.

Rat KChIP4 is primarily expressed in the brain and weakly in the kidneys, but not in the heart, brain, spleen, lungs, liver, skeletal muscle or testes, as shown by northern hybridizations in which northern membranes purchased from Clontech were probed with a DNA fragment of 3'- untranslated region of rat KChIP4.

Example 17: Identification and characterization of human and rat 33b07

This example describes the identification and characterization of genes encoding rat and human 33b07. A partial rat 33b07 sequence (clone 90) was isolated as a positive clone from the yeast 2-hybrid assay described above, using rKv4.3N as capture reagent. A complete rat 33b07 clone was identified from a suitable database.

199 • ··· • · 4 • · 4

The nucleotide sequence of the complete rat 33b07 cDNA and the predicted amino acid sequence of the rat 33b07 polypeptide are shown in Figure 26 and in SEQ ID NOs: 52 and 53, respectively. The rat 33b07 cDNA encodes a protein having a molecular weight of about 44.7 kD and a length of 407 amino acids.

Rat 33b07 binds to rKv4.3N and rKv4.2N with mild prefrence for rKv4.2N in the yeast 2-hybrid assay. In contrast, rat 33b07 does not bind to rKv1.1N, indicating that rat 33bO7-Kv4N interaction is specific.

Rat 33b07 is mainly expressed in the brain as determined by Northern hybridization.

The human 33b07 ortholog (clone 106d5) was also identified by screening a suitable database. The nucleotide sequence of the complete human 33b07 cDNA and the predicted amino acid sequence of the human 33b07 polypeptide are set forth in Figure 27 and in SEQ ID NOs: 54 and 55, respectively. The human 33b07 cDNA encodes a protein having a molecular weight of about 45.1 kD and a length of 414 amino acids.

Human 33b07 is 99% identical to the human KIAA0721 protein (GenBank accession number: AB018264) at the amino acid level. However, GenBank accession number: AB018264 does not have a functional annotation. Human 33b07 is also homologous to testes-specific (Y-encoded) proteins (TSP (Y) s), SET, and nucleosome assembly-related proteins (NAP). Human 33b07 is 38% identical to human SET protein (GenBank)

• * · ·

200 · ··:

* 9) accession number Q01105 = U51924) in amino acids 204 to 337 and 46% identical in amino acids 334 to 387.

Human SET is also referred to as HLA-DR associated protein II (PHAPII) (Hoppe-Seyler (1994) Biol. Chem. 375: 113126) and in some cases is associated with acute undifferentiated leukemia (AUL) due to translocation leading to SET -CAN fusion gene (Von Lindern M. et al. (1992)

Mol. Cell. Biol. 12: 3346-3355). Alternatively, the spliced form of SET is also referred to as template activation factor-1 alpha (TAF). TAF is associated with myeloid leukemogenesis (Nagata K. et al. (1995) Proc. Natl. Acad. Sci. U.S.A. 92 (10), 42794283). Human SET is also a potent protein inhibitor of phosphatase 2A (Adachi Y. et al. (1994) J. Biol. Chem. 269: 22582262). NAPs may be involved in modulating chromatin formation and contribute to the regulation of cell proliferation (Simon H.U. et al. (1994) Biochem. J. 297, 389-397).

Therefore, due to its homology with the above-mentioned proteins, 33b07 can also act as a protein inhibitor of phosphatase, an oncogene and / or a chromatin modulator. The homology of 33b07 to SET, a protein inhibitor of phosphatase, is of considerable importance. Many channels, especially Kv4 channels (to which 33b07 is associated), are regulated by PKC and PKA phosphorylation ((1998) J. Neuroscience 18 (10): 3521-3528; Am J Physiol 273: H1775-86 (1997)). Thus, 33b07 can also modulate Kv4 activities by regulating the phosphorylation state of the potassium channel.

Example 18: Identification and Characterization of Rat Ip

This example describes the identification and characterization of the gene encoding rat Ip. Partial rat 1p was isolated as a positive clone from the yeast 2-hybrid assay described

• · · ·

201 above, using rKv4.3N as the scavenger.

The nucleotide sequence of the partial rat 1p cDNA and the predicted amino acid sequence of the rat 1p polypeptide are shown in Figure 28 and in SEQ ID NOs: 56 and 57, respectively. The rat 1p cDNA encodes a protein having a molecular weight of about 28.6 kD and a length of 267 amino acids.

Rat 1p binds to rKv4.3N and rKv4.2N with a slight preference for rKv4.3N in the yeast 2-hybrid assay. In contrast, lp does not bind to rKv1.1N, indicating that the lp-Kv4N interaction is specific.

In particular, rat 1p is expressed in the brain as determined by Northern hybridization.

BLASTP 1.4 search, using a score of 100 and a word length of 3 (Altschul et al. (1990) J. Mol. Biol. 215: 403), the amino acid sequence of rat 1p showed that rat 1p is similar to human Restin (GenBank accession number P30622; it is referred to as cytoplasmic linking protein-170 alpha-2 (CLIP-170), M97501)). Rat lp protein is 58% identical to human Restin at amino acids 105 to 182, 55% identical to human Restin at amino acids 115 to 186, 22% identical to human Restin at amino acids 173 to 246, 22% identical to human Restin at amino acids 169 to 218, and 58% identical to human Restin at amino acids 217 to 228.

Restin is also referred to as ReedSternberg-associated medium filament protein. Reed-Sternberg cells are cancer cells diagnostic of Hodgkin's disease. It is believed that overexpression of restin may contribute to progression

202

♦ ··· ·

9 9 9 9 • 100 9

Hodgkin's Disease (Bilbe G. et al. (1992) EMBO J. 11: 2103-13) and restin appears to be an intermediate filament-associated protein that binds endocytic vesicles to microtubules (Pierre P, et al. (1992) Cell 70 (6), 887-900).

The cytoskeleton regulates the activity of potassium channels (see, for example, Honor E, et al. (1992) EMBO J. 11: 2465-2471 and

Levin G, et al. (1996) J. Biol. Chem. 271: 29321-29328), as well as other channel activities, e.g., Ca ⁺⁺ channels (Johnson BD et al. (1993) Neuron 10: 797-804); or Na ⁺ channels (Fukuda J. et al. (1981) Nature 294: 82-85).

Therefore, based on its homology to restin, the rat lp protein can be associated with a cytoskeleton and can modulate potassium channel activities, eg Kv4, through its association with a cytoskeleton.

Example 19: Identification and Characterization of Rat 7s

This example describes the identification and characterization of the gene encoding rat 7s. A feline rat 7s was isolated as a positive clone from the yeast 2-hybrid assay described above, using rKv4.3N as capture reagent. Rat 7s is a rat ortholog of human vacuolar H (+) - ATPase catalytic subunit A (accession numbers P38606 and B46091), as described, for example, in van Hille B. et al. (1993) J. Biol.

Chem. 268 (10): 7075-7080.

The nucleotide sequence of the partial rat 7s cDNA and the predicted amino acid sequence of the rat 7s polypeptide are shown in Figure 29 and in SEQ ID NOs: 58 and 59, respectively. The rat 7s cDNA encodes a protein having a molecular weight of about 28.6 kD and a length of 270 amino acids.

• • 44 • • 4

4444 ··

203

Rat 7s binds to rKv4.3N and rKv4.2N with preference for rKv4.3N in the yeast 2-hybrid assay. In contrast, 7s do not bind to rKv1.1N, indicating that the 7s-Kv4N interaction is specific.

Rat 7s is expressed at significantly higher concentrations in the brain and kidneys than in the lungs, heart, liver, testes, and skeletal muscle, as determined by Northern analysis.

Example 20: Identification and Characterization of Rat 29x and 25r

This example describes the identification and characterization of the gene encoding rat 29x. Rat 29x was isolated as a positive clone from the yeast 2-hybrid assay described above, using rKv4.3N as capture reagent. Rat 25r is a variant of 29x with alternative splicing. They differ in the 5 'untranslated region, but are identical in the coding region and at the amino acid level.

The nucleotide sequence of the rat 29x cDNA and the predicted amino acid sequence of the rat 29x polypeptide are shown in Figure 30 and in SEQ ID NOs: 60 and 61, respectively. The rat 29x cDNA encodes a protein having a molecular weight of about 40.4 kD and a length of 351 amino acids.

The nucleotide sequence of the rat 25r cDNA is shown in Figure 31 and in SEQ ID NO: 62. The rat 25r cDNA encodes a protein having a molecular weight of about 40.4 kD and a length of 351 amino acids.

Rat 29x is expressed in the spleen, lungs, kidneys, heart, brain, testes, skeletal muscle and liver, with the highest to · · ··· «

204 • · ·· ··

9 9 9 This expresses this in the spleen and the lowest in the liver.

The rat 29x binds to rKv4.3N and rKv4.2N with a slight preference for rKv4.3N in the yeast 2-hybrid assay. In contrast, 29x does not bind to rKv1.1N, indicating that the 29x-Kv4N interaction is specific.

Rat 29x is identical at amino acid level to rat SOCS-1 (Suppressor Of Cytokine Signaling) as described in Starr R. et al. (1997) Nature 387: 917-921; with JAB as described in Endo T.A. et al. (1997) Nature 387: 921-924; and SSI1 (STAT-induced STAT inhibitor-1) as described in Naka T. et al. (1997) Nature 387: 924-928. These proteins are characterized by having the SH2 domain, binding to and inhibiting JAK kinase, thereby regulating cytokine signaling.

The term SH2 domain, also Src homologous 2 domain, refers to a protein domain of about 100 amino acids in length that is involved in the binding of phosphotyrosine residues, e.g.

phosphotyrosine residues in other proteins. Target sites are referred to as SH2-binding sites. The SH2 domain has a conserved 3D structure consisting of two alpha helices and six to seven beta-chains. The core of the SH2 domain is a continuous beta-meander composed of two linked beta-sheets (Kuriyan J. et al. (1997) Curr. Opin. Struct. Biol. 3: 828-837). SH2 domains act as regulatory modules of the intracellular signaling cascade by interacting with high affinity with phosphotyrosine-containing target peptides in a sequence-specific and phosphorylation-dependent manner (Pawson T.

(1995) Nature 373: 573-580). Some proteins contain multiple SH2 domains that increase their affinity for binding to different phosphoproteins or cause their ability to bind to different phosphoproteins. Rat 29x contains SH2 domain in ···· ·

205 ··· ·

amino acid residues 219-308 of SEQ ID NO: 61.

Tyrosine phosphorylation regulates potassium channel activity (Prevarskaya N.B. et al. (1995) J. Biol. Chem. 270: 2429224299). JAK kinase phosphorylates proteins on tyrosines and is believed to be involved in regulating channel activity (Prevarskaya N.B. et al., Supra). Thus, due to their homology to SOCS-1, JAB, and SSI-1, rats can modulate potassium channel activities, e.g., Kv4, 29x by modulating the activity of JAK kinase.

Example 21: Identification and Characterization of Rat 5p

This example describes the identification and characterization of the gene encoding rat 5p. Rat 5p was isolated as a positive clone from the yeast 2-hybrid assay described above, using rKv4.3N as capture reagent.

The nucleotide sequences of rat 5pc DNA and the predicted amino acid sequence of rat 5p polypeptides are shown in Figure 32 and in SEQ ID NOs: 63 and 64, respectively. The rat 5p cDNA encodes a protein having a molecular weight of about 11.1 kD and a length of 95 amino acids.

Rat 5p binds to rKv4.3N and rKv4.2N with the same potency in the yeast 2-hybrid assay. In contrast, 5β does not bind to rKv1.1N, indicating that the 5β-Kv4N interaction is specific.

Rat 5p is expressed in spleen, lung, skeletal muscle, heart, kidney, liver and testes as determined by Northern hybridization.

Rat 5p is identical to rat Calpactin light chain ··

99 9

206

9999 • 99 99 9

1 ---- - ----

9 9 9

I or P10 (accession number P05943). P10 binds to and induces dimerization of annexin II (p36). P10 can act as a regulator of protein phosphorylation in that the p36 monomer is a preferred target for tyrosine-specific kinase (Masiakowski P. et al. (1998) Proc. Natl. Acad. Sci. U.S.A. 85 (4): 1277-1281).

Tyrosine phosphorylation regulates potassium channel activities (Prevarskaya N.B. et al., Supra). Thus, due to its identity with P10, rat 5p can modulate potassium channel activities, eg, Kv4, by modulating tyrosine-specific kinase activity.

Example 22: Identification and Characterization of Rat 7q

This example describes the identification and characterization of the gene encoding rat 7q. Rat 7q was isolated as a positive clone from the yeast 2-hybrid assay described above, using rKv4.3N as capture reagent. Complete rat 7q was obtained by RACE PCR.

The nucleotide sequence of the rat 7q cDNA and the predicted amino acid sequence of the rat 7q polypeptide are shown in Figure 33 and in SEQ ID NOs: 65 and 66, respectively. The rat 7q cDNA encodes a protein having a molecular weight of about 23.5 kD and a length of 212 amino acids.

Rat 7q binds to rKv4.3N and rKv4.2N with the same potency in the yeast 2-hybrid assay. In contrast, 7q does not bind to rKv1.1N, indicating that the 7q-Kv4N interaction is specific.

Rat 7q is expressed in heart, brain, spleen, lung, liver, skeletal muscle, kidney and testes as determined by Northern analysis.

4 4 4 4

207 ·· 4 ·· 44

4 444 44 ·

444 · 4444

4444444 44 444 4 4 • 4 4 4 44 4 4 · 4 ·· * · ·

Rat 7q is identical to RAB2 (rat RAS-related protein, accession number P05712) at the amino acid level. RAB2 appears to be involved in vesicle and protein transport (Touchot N. et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84 (23): 8210-8214). Therefore, due to its homology with RAB2, rat 7q can participate in the transport of a potassium channel, eg Kv4.

Example 23: Identification and Characterization of Rat 19r

This example describes the identification and characterization of the gene encoding rat 19r. Partial rat 19r was isolated as a positive clone from the yeast 2-hybrid assay described above, using rKv4.3N as capture reagent. Complete rat 19r was obtained by RACE PCR.

The nucleotide sequence of the rat 19r cDNA and the predicted amino acid sequence of the rat 19r polypeptide are shown in Figure 34 and in SEQ ID NOS: 67 and 68, respectively. The rat 19r cDNA encodes a protein having a molecular weight of about 31.9 kD and a length of 271 amino acids.

Rat 19r is expressed in heart, brain, spleen, lung, liver, skeletal muscle, kidney and testes as determined by Northern analysis.

Rat 19r binds to rKv4.3N and rKv4.2N with a slight preference for rKv4.3N in the yeast 2-hybrid assay. In contrast, 19r does not bind to rKv1.1N, indicating that the 19r-Kv4N interaction is specific.

Rat 19r is identical to rat phosphatidylinositol (PTDINS) alpha transfer protein (PTDINSTP, incremental).

209 · «··· ·

No. M25758 or P16446) as described in Dickeson S.K. et al. (1989) J. Biol. Chem. 264: 16557-16564. PTDINSTP is believed to be involved in phospholipase C-beta signaling (PLCbeta), phosphatidylinositol transfer protein synthesis (Ptdlns-TP), secretory vesicle formation and enhancement of phosphatidylinositol-3-kinase activity (Ptdlns 3-kinase) (Cunningham E. et al. (1995) Curr Biol 5 (7): 775-783, (1995) Nature 377 (6549): 544-547, and Panaretou C. et al (1997) J. Biol.

272 (4): 2477-2485).

Therefore, due to its homology to PTDINSTP, rat 19r can modulate potassium channel activity, eg, Kv4, via the PLCbeta signaling pathway and / or the Ptdns 3-kinase signaling pathway. Rat p19r may also be involved in the transport of a potassium channel, e.g. Kv4.

Example 24: Chromosomal localization of human 9q

In this example, human PCIP 9q is chromosomally mapped using a panel of radioactive hybrids (Panel GB4). h9q localizes to the chromosome region 10q, which was previously found to contain binding to epilepsy, namely D10S192: 10q22-q24 (Ottman et al. (1995) Nature Genetics 10: 56-60) (see Fig. 43). According to this observation, the present invention clearly shows that the 9q protein family can serve as a target protein family for the development of antiepileptic drugs and targets for medical intervention in epilepsy.

Further, h9q has been located in the region of chromosome 10q, which was previously found to contain binding to IOSCA, namely D10S192 and D10S1265: 10q24-Nikali (Genomics 39: 185191 (1997)) (see Figures 42 and 43). According to this observation, the present invention clearly shows that the 9q protein family can • 0 · 0 · · 0

0000 0 0

0

0

0 ·

209

0000

serve as a target family of proteins for the development of drugs against spinocerebellar ataxia, and that this family can also serve as a target group for drug intervention in spinocerebellar ataxia.

Example 25: Arachidonic acid in modulation of KV4 / KChIP channels

Modulation of Kv4 current kinetics by arachidonic acid is KChlP dependent

Arachidonic acid (AA) has been shown to inhibit recombinant Kv4 current expressed in Xenopus oocytes (Villarroel, A. and Schwarz, T. L. (1996) J. Neuroscience 16: 2522-32). However, modulations were observed only for maximum current amplitudes, while current kinetics parameters were not affected by the presence of AA. In contrast, records from membrane contacts from hippocampal neurons showed that in addition to reducing the maximum amplitude, AA changes the A-current kinetics parameters in Kv4 channels (Keros, S. and McBain, C. J. (1997) J. Neuroscience 17: 3476-87). Importantly, the inactivation time constant was significantly reduced (note: the inactivation time constant is inversely proportional to the inactivation rate. Therefore, the inactivation was accelerated (Keros (1997), supra).

This example examined the hypothesis that KChlP lacks helper subunits, which is responsible for the above-mentioned differences in kinetics, by expressing Kv4 alone or together with KChlP in CHO cells and Xenopus oocytes, and measuring their inactivation time constants (using techniques known in the art). in the art as described, for example, in An et al. (2000) Nature

403: 553-6; Keros, S. and McBain, C.J. (1997) J. Neuroscience

17: 3476-87; and Villarroel, A. and Schwarz, T. L. (1996) J.

Neuroscience 16: 2522-32).

9 9

9 9

9 999

9 9 9 •

9

9 9

9 9

9999 9

9

999 9 9 ·

210

Modulation of Kv4 kinetics by arachidonic acid was KCh1P dependent (Table 3). When Kv4.2 was expressed alone in CHO cells, the inactivation time constant of the resulting current was unchanged in the absence or presence of 10 μΜ arachidonic acid (32 ± 3 vs. 32 ± 2 ms ± mean standard error (SEM)). In contrast, when co-expressed with KChIP1, the Kv4.2 current inactivation time constant was reduced from 88 ± 8 ms in the absence of arachidonic acid to 37 ± 3 ms in the presence of 10 μΜ arachidonic acid. Similar results were obtained with KChIP1 (Table 4) and KChIP2 in Xenopus oocytes. These results show that modulation of the arachidonic acid Kv4 current kinetics is dependent on the presence of KChlP. The change in the kinetics of Kv4 / KChIPs in the presence of arachidonic acid is consistent with the change described on neuronal membranes [Keros (1997), supra], supporting the assumption that KChlPs are endogenous Kv4 current subunits.

It should be noted that arachidonic acid also reduces the maximum amplitude of the Kv4 / KChlP current in both CHO cells and Xenopus oocytes (Tables 3 and 4). This shows that the modulation of the maximum amplitude of Kv4 current is independent of KCh1P.

Table 3. Modulation of Kv4 and Kv4 / KChIP1 currents in CHO cells by arachidonic acid.

Kv4.2 Kv4.2 KV4.2 / KChIP1 KV4.2 / KChlPl ΟμΜΑΑ ΙΟμΜΑΑ 0 μΜ AA 10 μΜ AA Inactivation time constant (ms ± SEM) 32 ± 3 32 ± 2 88 ± 8 37 ± 3 Maximum amplitude (pA ± SEM) 620 ± 80 336 ± 82 4539 ± 448 2827 ± 496

9 *

9 ** 9 9

211

9,999 «9 9

The effects of arachidonic acid on the A-stream have also been studied in the neuronal system (cultured primary cerebellar neurons) where both Kv4 and KChlP are present. TEA (10 mM) was applied to block the weak elongated outer component. The inactivation time constants A of the current in the absence and presence of 10 μΜ arachidonic acid were 44 ± 5 ms and 21 ± ms (mean ± SEM), respectively. The respective maximum amplitude was reduced from 2.0 ± 0.6 nA to 1.2 ± 0.4 nA. These results confirm that arachidonic acid modulates both the amplitude of the Kv4 A-current and its kinetics in natural cells.

Modulation of Kv4 / KChlP current by arachidonic acid is concentration-dependent and reversible

The effects of different concentrations of arachidonic acid on Kv4 / KChlP current were studied on Xenopus oocytes. Because physiological concentrations of arachidonic acid are often 10 μΜ (Needleman, et al., 1986 Annu Rev Biochem 55: 69-102; Anderson and Welsh, 1990, Proc Natl Acad Sci USA 87: 7334-8; Meves,

1994, Prog Neurobiol 43: 175-86), arachidonic acid was tested at concentrations of 1-10 μΜ. The concentration-dependent blockage of the maximum amplitude Kv4.3 of the current was independent of the presence of KChIP1 (see Fig. 64A). Furthermore, the tendency of the amplitude to decrease as the concentration increased was very similar with or without the presence of KClP. The maximum current blockage did not appear to be saturated above 10 μΜ. Villarroel and Schwarz, (1996) J. Neurosci 16: 2522-32 reported that the IC50 of arachidonic acid for Kv4 and subunits was about 8 μΜ in oocytes. The inactivation time constant in the absence of KChIP1 was unchanged at all arachidonic acid concentrations tested. However, in the presence of KChIP1, the inactivation time constant decreased depending on

212 · · · · · * * 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9

Φ 9 9 9 9 9 9 9 9

9999 «··« φ · «99 concentration (see Fig. 64Β).

The onset of KChIP-dependent inactivation acceleration and KCh1Pindependent Kv4.3 current blockade of 10 μΜ arachidonic acid was almost immediate (Fig. 65). At least a slight delay (14 seconds) is attributed to the transport of the solution from the reservoir to the measuring chamber. The amplitude blockade gradually developed over time (Fig. 65A). The presence of KChIP1 did not significantly change either the percent decrease or the rate of current blockage over time, nor did it change the rate of recovery of Kv4.3 current amplitude over time (Fig. 65A). In contrast to the gradual development of amplitude blockade, the KChlP1-dependent effect on Kv4 kinetics occurred much faster after perfusion of arachidonic acid, and tended to reach plateau rapidly (Fig. 65B). When arachidonic acid was eluted, Kv4.3 current amplitude and inactivation time constants were fully recovered at similar rates in the presence of KChIP1 (cf. Figs. 65A and 65B).

Two small decreases in the Kv4.3 graph alone on panel B were artifacts caused by buffer changes.

Modulation of Kv4 / KChIP stream by other fatty acids

It has previously been shown that some fatty acids mimic the effects of arachidonic acid on the Kv4 current in Xenopus oocytes when Kv4 is expressed alone (Villarroel and Schwarz, J Neurosci 16: 2522-32 (1996)). Therefore, the selectivity of fatty acids for the Kv4 stream in the presence of KchIP was investigated. Arachidonic acid is a 20-carbon fatty acid bearing four cis double bonds, with the first two binding to C5 (20: 4 c5). The following arachidonic acid analogues with different structural properties were tested: γ-linolenic acid (18: 3 c9) having three cis double bonds instead of four double bonds, linolelaidic acid (18: 2 t9) having ·· · · * ·· « · Ι ι ι ι ι · · · · · · · · · • • • • • • • • • • • ·· ·· ·· ·· ····

213 two double bonds instead of four cis double bonds, 5,8,11,14-eicosatetraynic acid (ETYA, 20: 4 n5) having four triple bonds instead of double bonds in arachidonic acid (n shows the position of the first triple bond), and acid 5 , 8,11-eicosatriyno (ETI, 20: 3 n5) having three triple bonds. Giant. 66A shows that the peak current amplitude Kv4.3 was significantly reduced compared to a control without fatty acid of 10 μΜ γlinolenic acid, ETI, ETYA and arachidonic acid, independent of the presence of KChIPl. The percent inhibition of Kv4 amplitude alone and Kv4 / KChIP was not significantly different for these fatty acids. A small, statistically significant Kv4 block of 10 µΜ current amplitude of linolelaic acid was observed in the presence of KChIPl, but not in the absence of KChIPl when the values were compared to the respective controls. However, no significant difference was observed when comparing Kv4.3 and Kv4.3 / KChIP KChIP1.

In the absence of KChIP1, none of the fatty acids showed a statistically significant effect on Kv4.3 inactivation time constant (Fig. 66B). Only those fatty acids that caused significant current blockade independent of KCh1P (γ-linolenic acid, ETI, ETYA and arachidonic acid) reduced the Kv4.3 inactivation time constant when expressed concurrently with KChIP1. Linolelaidic acid, which exhibited only a medium KChIP-dependent Kv4.3 current blockade, did not affect Kv4.3 inactivation time constant (Fig. 66B). Thus, some long chain fatty acids may mimic arachidonic acid in modulating the Kv4 current kinetics depending on KChlP. In general, there is a link between the ability of a given fatty acid to block maximum amplitude and modify the kinetics of the reconstituted Kv4 / KChIP stream.

Arachidonic acid does not interfere with Kv4 and KChlP association

214 · · · · · »* * · · 214 · · · · · ·· ·· ·· ··

The following tests were used in this example.

In vitro binding assay

The N-terminal domain of rat Kv4.3 was expressed as a GST fusion (GST-Kv4.3N) and purified from E.coli essentially following protocols provided by Amersham Pharmacia Biotech (Piscataway, New Jersey). The recombinant rat KChIP1 protein was first expressed and purified as a GST-fusion, then the GST group was cleaved using a PreScission protease (Amersham Pharmacia Biotech) to obtain free KCHIP1 protein. Both GST-Kv4.3N and KChlP proteins were > 95% pure as determined by staining Coomassie denaturing gels with dye. In vitro binding assays were performed using Biacore 3000 from Biacore AB in Uppsala, Sweden. Experiments were performed in phosphate buffered saline (PBS), pH 7.4, with 1 mM CaCl 2 and 0.05% polysorbate P-20. The anti-GST antibody (Biacore AB) was bound to 3 CM-5 chip flow cells (Biacore AB) at 2000 resonance units (RU) using an amine bond. The resulting flow cell was activated and blocked with ethanolamine, which was used as a reference control surface. The GST-Kv4.3N terminal domain was captured on two anti-GST flow cells and GST alone bound to a third anti-GST flow cell at a level of 150 RU. Purified KChIP1 at a concentration of 1 μΜ in the presence and absence of 10 μΜ arachidonic acid was then injected into all four flow cells. Arachidonic acid (10 μΜ) was also injected separately. Data are presented as sensograms with GST reference readings.

Yeast 2-Hybrid Strains and Growth Tests • · • ·

215 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Diploid strains containing capture agent (Kv4.3 non-terminal domain or pGBT9 empty vector) and fish (KChIP1) plasmids were obtained as described (An, et al., 2000). For synchronization, the strains were cultured to saturation before being inoculated at the same OD600 value in 5 ml of synthetic Complete-TrpLeuHis drop-out (SC-WLH) medium, which selected interaction-dependent growth, or in 5 ml of SC-WL medium, which is non-selective in the presence or absence of 10 μΜ ETYA. The medium contained 5 mM 3-AT (3-amino-1,2,4-triazole) to suppress weak self-activating activity from the Kv4.3 N-terminal capture domain. The cultures were cultured for 17 hours at 30 ° C and OD600 values were read by spectrophotometer.

To test the hypothesis that arachidonic acid works through interference with binding between Kv4 and KCh1P, surface plasmon resonance measurement (Biosensor) was first used to measure the association and dissociation phase of the Kv4-KChIP interaction in the presence and absence of arachidonic acid. The intracellular N-terminal domain of Kv4.3 was expressed as a GST fusion protein (GST-Kv4.3N) and immobilized on the surface of the Biosensor chip. The recombinant KChIP1 protein was passed through the chip surface in the presence and absence of 10 μΜ arachidonic acid. As shown in Fig. 67A, the KChIP1 protein was bound to the GST-Kv4.3N surface, but no qualitative differences were observed in either the on-phase or off-phase association of the KChIP1 and Kv4.3 N-terminal domains. The results from the Biosensor assay were further confirmed in a yeast 2-hybrid system where Kv4-KChIP interaction-dependent growth on selective SC-WLH medium was not affected by 10 μΜ ETYA (Fig. 67B). ETYA was used in these experiments instead of arachidonic acid because, although both ETYA and arachidonic acid affect the Kv4 current almost identically, ETYA is non-metabolizable and therefore more suitable for this experiment.

• · · · · · · · · · · · ·

Taken together, these results indicate that the fatty acids tested do not interfere with the association between Kv4 and KChIP.

216

Kv4 / KChIP is more sensitive to arachidonic acid modulation than Κνί.ΐ / Κνβΐ

Pore-forming alpha subunits of ion channels, including potassium channel subunits, often do not work alone. They associate with helper subunits and these helper subunits can significantly alter channel activity. Thus, it is more useful to study alpha subunits in combination with their helper subunits because physiologically relevant channels are alpha- and helper subunit complexes.

When recombinant Kv4 alpha subunits are expressed alone, they have been found to be more susceptible to arachidonic acid inhibition than alpha subunits of several other voltage-triggered potassium channels (eg, Kvl.1) (Villarroel (1996), supra). However, this study investigated arachidonic acid modulation only for alpha channel subunits. It was not known whether the Kv4 current was more sensitive to arachidonic acid modulation than other channel currents when the channels were tested in the presence of the respective subunits.

In this example, this was tested by measuring two complexes of alpha- and helper subunit: Kv4.3 / KChIP1 and Κνί.ΐ / Κνβΐ. (Κνβΐ, which is one classical beta subunit of the potassium channel, dramatically changes Kvl.l kinetics). Kv4.3 / KChIP1 and Κνί.ΐ / Κνβΐ were expressed, respectively, in Xenopus oocytes and their obtained currents were recorded in the presence or absence of 10 μΜ arachidonic acid. The results showed that the maximum amplitude Κνί.ΐ / Κνβΐ of the current was not significantly increased in the presence of 10 μΜ · · · ·

217 · 4 · 4 ··· · acids · acids · acids arachidone (11 ± 4 to 14 ± 1 μΑ), while the maximum amplitude of Kv4.3 / KChIP1 decreased significantly (44 ± 10 to 21 ± 4 μΑ, Table 4). KvKv4.3 / KChIP1 was more sensitive to arachidonic acid modulation than Κνί.ΐ / ννβ

4). Although 10 μΜ of arachidonic acid does not cause a statistically significant decrease in the inactivation time constant Κνί.ΐ / Κνβΐ (11 ± 1 to 9 ± 1 ms), the same concentration of arachidonic acid significantly reduces Kv4.3 / KChIPl inactivation time constant from 104 ± 7 to 55 ± 4 ms). These results show that arachidonic acid modulates the kinetics and amplitude of Kv4 / KChIPs of potassium current in normal neurons rather than kinetics and amplitude Κνί.ΐ / Κνβΐ.

Table 4. Arachidonic acid in modulation of Kv4, Kv4 / KChIP1, Kvl.1, Κνί.ΐ / ννβ currents in Xenopus oocytes.

Kv4.3 Kv4.3 KV4.3 / KChI PI KV4.3 / KCM PI Kvl.l Kvl.l Kvl.l / Kv βΐ Kvl.l / Kv βΐ 0 μΜ AA 10 μΜ AA ΟμΜΑΑ ΙΟμΜΑΑ ΟμΜ AA 10 μΜ AA ΟμΜΑΑ 10 μΜ AA Inactivation time constant (ms ± PULL) 75 ± 7 66 ± 6 104 ± 7 55 ± 4 ON. ON. 11 ± 1 9 ± 1 Maximal amplitude (μΑ ± PULL) 30 ± 7 13 ± 1 44 ± 10 21 ± 4 19 ± 2 21 ± 3 11 ± 4 14 ± 1

Example 26: K-channel interacting protein 2 (KChIP2), alternative splicing variants, chromosomal organization and localization

218

In this example, KChIP2 variants and their chromosomal organization were identified using standard techniques. The KChIP2 genes are highly conserved at the amino acid level between human, rat and mouse. Various human splice variants were identified by database search and cDNA library screening. Alternative splicing results in N-terminal domains of variable length, but the base C-terminal domain is sufficient to associate with and modulate Kv4. The human KChIP2 gene is in the range of approximately 18 kb in the q23 region of human chromosome 10 between WI-8488 and WI-6750. This region is syntenic with mouse chromosome 19 between D19Mit40 and D19Mit11. The rat variant discovered when searching the database has changed the last five amino acids and retains the ability to associate and modulate Kv4. Therefore, these various KChIP2 variants appear to function similarly in Kv4 modulation.

Example 27: Function and Expression of KChIPIL

RT-PCR was performed to assess tissue expression of rat KChIP11 (KChIP1 long) alternative splice variants.

PolyA + RNA from heart, brain, lung, spleen, liver, skeletal muscle, kidney and testes was purchased from Clontech. RT-PCR was performed using a Clontech One-step RT-PCR kit amplifying the 5 'primer GGTACCTTCTCGTCCCTGCAGACCAAACAAAG (SEQ ID NO: 104) and the 3' primer CGGTAAAGGACTTGCAGTTCTCTC (SEQ ID NO: 105) with PCR conditions modification: 50 ° C after for 1 hour;

94 ° C for 3 minutes; 50 cycles of 94 ° C for 30 seconds, 65 ° C for 30 seconds, and 68 ° C for 2 minutes. The 5 'primer is specific for KChIP1. Both KChIP1 and KChIP11 can be amplified using the same primer set, yielding two different sized PCR products that separate into two bands by electrophoresis.

• · _. _Λ ··· ·· ♦ ·· ·· ·

71Q · ····································

The KChIP11-specific band was observed only in the brain, indicating that it is specifically expressed in the brain. The same reaction also showed a strong KChIP1-specific signal in the brain and a weakly visible band in skeletal muscle. No KChIP11 or KChIP11 signals were observed in any other tissue tested. In conclusion, KChIP11 expression is brain-specific, with very weak expression in skeletal muscle.

The function of KChIP11 Xenopus oocytes has also been tested.

Kv4.3 cRNA was injected into Xenopus oocytes with or without KChIP11 cRNA. Similar to KChIP1, KChIP11 increased the maximum amplitude of Kv4.3 from 15 ± 4 ± to 55 ± 7 μΑ and increased the inactivation time constant from 56 ± 4 to 100 ± 8 ms (Table 5). These data show that KchiP11, like KChIP1, modulates the maximal amplitude and kinetics of Kv4 current in vitro.

Assuming that the common C-terminal 185 amino acids in KChIP1 and KChIP11 are responsible for binding to Kv4.3, it is likely that KChIP11 co-associates with Kv4 in the brain. Insertion of additional amino acids into the KChIP11 protein may be important for unknown functions, and the DNA sequence encoding these amino acids may be used as a specific gene marker for detecting cells and / or tissues with specific expression of this particular variant with alternative splicing.

DNA and protein sequences specific for alternative splicing variants of KchIII are identical between rat and human. Therefore, functional data obtained for KChIP11 molecules from one species can also be used for the other species.

Table 5. Kv4.3 modulation by KChIP11 and KChIP11.

220

Kv4.3 co-expressed with No KChIPll KChIPl KChIPlN Inactivation time constant (ms ± PULL) 56 ± 4 100 ± 8 112 ± 3 1778 ± 136 Maximum amplitude (μΑ ± SEM) 15 ± 4 55 ± 7 59 ± 5 18 ± 3

Example 28: Function and expression of KChIPIN

Rat KChIP11 expression was assessed using the Taqman technique with the GGCAAAGAAGCGCGATTTT probe (SEQ ID NO: 106), encoding primer TCCCGGGTAGGCAAGCA (SEQ ID NO: 107), and the reverse primer CCTGCTCAAGCCCAGCACTGCA (SEQ ID NO: 108). The probe is specific for KChIPIN. As shown in Fig. 68, KChIP1N is mainly expressed in the dorsal root ganglia (DRG), and weakly in the brain spinal cord.

The function of KChIPIN in Xenopus oocytes was also evaluated.

Kv4.3 cRNA was injected into Xenopus oocytes with or without KChIPIN cRNA. In contrast to KChIP1 and KChIP11, KChIP1N did not affect the maximal amplitude of Kv4.3 (15 ± 4 vs. 18 + 3 with or without KChIP1N, Table 5). Surprisingly, KChIP1N caused a much greater increase in Kv4.3 inactivation time constant than KChIP1 or KChIP11 (32-fold increase at KChIP1N vs. ~ 2-fold increase for KChIP1 or KChIP11; Table 5).

These data show that KchiPlN modulates the Kv4 stream in vitro in a manner different from KChIP1 or KChIP11. First, the increase in the inactivation time constant of KChIP1N was significantly higher compared to the increase caused by KChIP1 or KChIP11.

As a result, KChIPIN was able to change inactivation • 4 more rapidly

221

Kv4.3 current (almost completely inactivated within 200 ms) to almost non-inactivated for 500 ms seconds + 40 volt pulse. Second, KChIPIN, at the concentration tested, did not affect the maximal amplitude of Kv4. Since alternative splice KChIP1 variants have common C-terminal 196 amino acids, these data point to an important and different function of the unique 36-amino acid N-terminal domain of KChIP1N.

Example 29: Function of KChIP2 variant with alternative splicing

In this example, the function of the alternative splice KChIP2 variant, rat KChIP21, human KChIP2s, and rat KChIP2C was tested in Xenopus oocytes. The results of these experiments are summarized in the following table.

Table 6. Modulation of KV4 stream by KChIP2 with alternative splicing variant.

Kv4.3 co-expressed with KChIP21 KCMP2m KChIP2s KCWP2C none Maximum amplitude (pA ± SEM) 51 ± 4 40 ± 4 44 ± 3 44 ± 5 14 ± 3 Inactivation time constant (ms ± SEM) 87 ± 4 70 ± 2 90 ± 3 74 ± 4 55 ± 4

The data shows that these alternative splice KChIP2 variants modulate the Kv4 stream similarly to KChIP2m (Table 6). Because there is extremely high homology (> 95%) between rat and human KChIP2 at the amino acid level, it is expected that the results obtained using KChIP2 molecules from one species will be similar to the results for KChIP2 molecules from the other species.

Example 30: Function and Expression of KChIP4 • 9 * 9 9

999 99 99

9 9 9 9 9

9 9 9 9 9 9 9

Μ 9,999 9 9 9 9 9 9 9 9 9

LLL 9 9 9 9 9 9 9 9 9 9 · · · · ···

Northern hybridization was performed to determine tissue expression of KChIP4. The probe, obtained from the 3'UT region of rat KChIP4 (598-909) common to all N-terminal variants with alternative splicing of KChIP4, was used to probe rat Clontech MTN Northern membranes. Of the tissues present on the Northern membranes (heart, brain, lung, spleen, kidney and testes), a predominant band of approximately 2.4 kb was only observed in the brain. A weak band with slightly higher mobility was also present in the kidneys. Therefore, it is clear that the alternative splice N-terminal variants of KChIP4 are expressed primarily in the brain and less in the kidney.

The ability of KChIP4 to associate with Kv4 was also tested using the yeast 2-hybrid assay. The H domain of KChIP4 (Cterminal 185 amino acids), which is common to all N-terminal variants of alternative splice KChIP4 and homologous to other KChIPs, was expressed as fish, and the Kv4.3, Kv4.2 non-terminal domains were expressed as baits (Kv4.3N , Kv4.2N, respectively) using standard techniques. KChIP4H has been associated with Kv4.3N and Kv4.2N, but not with Kvl.IN or other control baits in both the growth assay and the β-galactosidase assay. These results show that KChIP4s specifically bind to Kv4 channels.

Example 31: Functional analysis of KChIP4N2

KChIP4N2, as opposed to KChIP1, kCHIP2 and KChIP3, exhibits dose-dependent effects on maximal amplitude Kv4.3 when co-injected into Xenopus oocytes (Table 7).

At high concentrations (eg 5x dilution), KChIP4N2 decreases the Kv4.3 current amplitude, while lower concentrations of KChIP4N2 or <#

0 0 · 0 · 0 0 04 0 0 0

0 »0 000 · 0

0 0 0 0 0

04 0 * 00 do not amplify or have any effect on the Kv4 current amplitude (Table 7).

223

KChIP4N2, as opposed to KChIP1, kCHIP2, and KChIP3, also exhibits dose-dependent kinetics of Kv4.3 inactivation kinetics when injected simultaneously into Xenopus oocytes (Table 7). At high concentrations, KChIP4 changes the rapidly inactivating Kv4.3 current to an almost non-inactivating current (eg, at 5x dilution, the current curve slows too slowly over time to obtain an inactivation time constant). When more diluted KChIP4N2 cRNA is applied, the inactivation time constants gradually decrease to the value obtained in the absence of KChIP4N2.

Table 7: Modulation of maximum amplitude and Kv4.3 current kinetics by different concentrations of KChIP4N2 in Xenopus oocytes.

Kv4.3 coexpressed with KCHP4N2 diluted factor (lx = stock solution) lx 5x 30x 120x 500x zero Inactivation time constant (ms ± SEM) 681 ± 28 193 ± 13 84 ± 5 56 ± 4 Maximum amplitude (μΑ ± PULL) 0 ± 0 4 ± 1 25 ± 2 16 ± 3 9 ± 4 15 ± 4

The N-terminal domain of KChIP4N2 is required for the observed effects of KChIP4N2. Deletion of the N-terminal domain substantially abolishes the effects of normal KChIP4N2 on maximal amplitude and inactivation time constant Kv4.3 (Table 8).

The effect of the N-terminal domain of KChIP4N2 appears to be dominant over other KCh1P molecules. We made a chimeric molecule, 4N-1H, where the N-terminal domain was KChIP4N2

224

4 • · 4

4 4 »444 • 4» 44 «* 4 • 44» 9

4 · 4 4

44 44 44 fused to the C-terminal 185 amino acid H domain of KChIP1 (KChIP1H, which is homologous to other KChIPs). When this molecule was expressed concurrently with Kv4, KChIP1H modulated the Kv4 current almost as much as KChIP1, and produced a modulation profile that was quite different from that of KChIP4N2 (An F. et al. (2000) Nature 403: 553-556). However, when co-expressed with Kv4.3, the 4N-1H produced a modulation profile almost indistinguishable from KChIP4N2 instead of KChIP1H or KChIP1 (Table 6). This shows that the N-terminal domain of KChIP4N2 can act as a module, and its modulating effect is dominant over the modulating effects of other KChIPs.

Table 8. The N-terminal domain of KChIP4N2 is required for the effects of KChIP4N2, and is dominant over KChIP1.

Kv4.3 co-expressed with KChIP4 (30xWire) KChIP4H 4N-1H Inactivation time constant (ms ± PULL) 681 ± 28 105 ± 4 680 ± 39 Maximum amplitude (μΑ ± SEM) 25 ± 2 19 ± 2 26 ± 3

Since KChIP4 and other KChlP associate with the Kv4 Non-terminal Domain (Kv4N), it is likely that these KChlP binds to the same site on Kv4N. If this is true, KChIP4N2 and KChIP1 should compete for modulation of the Kv4 stream when both are simultaneously expressed with Kv4. This hypothesis was tested and, as shown in Fig. 61, KChIP4N2 and KChIP1 compete for modulation of Kv4 current. Since the concentration of KChIP4 cRNA injected into Xenopus oocytes was constant while the concentration of KChIP1 cRNA gradually increased, the Kv4.3 current profile changed from the KChIP4 profile to a KChIP1-like profile. Conversely, when the concentration of KChIP1 cRNA was constant while the concentration of KChIP4 cRNA gradually increased, the current profile changed from the KChIP1 profile to a KChIP4-like profile.

225

These results indicate that KChIP1 and KChIP4 functionally compete with each other, probably due to competitive binding to the same site on Kv4.3N. The results also show that different combinations of KChIP4N2 and other KCh1Ps result in currents with hybrid profiles that are quantitatively and qualitatively similar or different from the original profiles. It is likely that KChIP4N2 and other KCh1P are co-expressed in some cell types in vivo (eg, in the brain). Therefore, depending on the in vivo concentrations and particular cell types, KChIP4N2 and other KCh1P can produce quite different currents, although the pore-forming alpha subunits are Kv4 molecules.

The implications of these findings for KChIP4N2 are far reaching. The data show that the N-terminal domain carries a dominant modulation function that can be separated from the H domain functions (binding to Kv4 and modulating Kv4 current amplitude and kinetics as described in An et al., Supra, but in a manner different from KChIP4N2 ^. N-terminal domains). Therefore, it is likely that the N-terminal domain of KChIP4N2 interacts with portions of the potassium channel that are other than the N-terminal domain of Kv4. These other Kv4 sites are likely to be important for controlling potassium ion channel movement, due to the dramatic effect of KChIP4N2 on inactivation kinetics. It is then possible to use the N-terminal domain of KChIP4N2 as a means of designing and performing protein / peptide / compound screening, using this different activity as the endpoint. Using these screening assays, it is possible to obtain proteins / peptides / compounds that modulate Kv4 activities in a KChIP-dependent or independent manner.

As mentioned above, KChIP1N and KChIP4N2 have similar Kv4 current modulation characteristics. Both can convert quickly inactivating Kv4 streams to almost non-inactivating streams.

226

Both may have no effect on the maximum amplitude of Kv4. This is different from the effects of KChIP1, KChIP2 and KChIP3. Interestingly, when the N-terminal domains of human KChIP1N and simian KChIP4N2 were compared (using Megalign, DNA Star), they showed significant homology (Fig. 62), indicating the existence of a protein motif that causes different modulation of KChIP1N and KChIP4N2. In contrast, the N-terminal domains of human / rat KChIP1 and simian KChIP4N2 were quite different (Fig. 62).

Example 32: Functional analysis of KChIP4N1 and KChIP4N3

KChIP4N1 and KChIP4N3 were co-injected with Kv4.3 cRNA into Xenopus oocytes. The modulation effects of these proteins on Kv4.3 are summarized in Table 9. Both increased the inactivation time constant of Kv4.3. KChIP4N3 increased the maximal amplitude of Kv4.3, while KChIP4N1 had no statistically significant (ns) effects on Kv4.3 amplitude.

Table 9. Modulation of Kv4 current of KChIP4N1 and KChIP4N3 in Xenopus oocytes.

Kv4.3 co-expressed with KChIP4Nl KChIP4N3 nothing Maximum amplitude (μΑ ± SEM) 6 ± 1 (ns) 43 ± 4 15 ± 4 Inactivation time constant (ms ± SEM) 112 ± 7 85 ± 4 56 ± 4

Equivalents: Various equivalents of specific embodiments of the present invention will be known to those skilled in the art - or will be able to ascertain using conventional experiments. Such equivalents fall within the scope of the appended claims.

Claims (53)

An isolated nucleic acid molecule selected from the group consisting of: (a) a nucleic acid molecule comprising a nucleotide sequence which is at least 60% identical to the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO. NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25 SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO NO: 31, SEQ ID NO NO: 33, SEQ ID NO NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 SEQ ID NO: 48 SEQ ID NO: 50 SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO NO: 56, SEQ ID NO NO: 58, SEQ ID NO NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75 SEQ ID NO: 77 SEQ ID NO: 7 9 SEQ ID NO: 80, SEQ ID NO NO: 82, SEQ ID NO NO: 84, SEQ ID NO NO: 86, SEQ ID NO: 88, SEQ ID NO: 90 SEQ ID NO: 92 SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO NO: 100, or SEQ ID NO: 102, DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA- 316, or sequences complementary to said sequences; (b) a nucleic acid molecule comprising a fragment of at least 583 nucleotides in length, comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 SEQ ID NO: 13; NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 8 8 SEQ ID NO: 90, SEQ ID NO: 92, Φ Φ φφφφ 228 φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ »φ φ φ φ φ φ φ φ φ φ φ φ SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, DNA insert of plasmids deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316, or sequences complementary to said sequences; c) a nucleic acid molecule that encodes a polypeptide comprising an amino acid sequence at least about 60% identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 SEQ ID NO: 12 SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of plasmids deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949 , 98950, 98951, 98991, 98993, 98994, or PTA-316; d) a nucleic acid molecule that encodes a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO. NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 2 6, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, * 4 1 · 1 * 9 9119 229 9 9 9 9 9 999 99 991 999 9,999 1 9,999 9 9 9 9 9 1 2 3 4 5 6 7 8 9 98 9 «·· · 9 9 9 9 9 SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession number 98936 , 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316, wherein the fragment contains at least 15 contiguous amino acid residues the amino acid sequences of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 8 9 SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103, or SEQ ID NO: 109 or amino acid sequences encoded by the DNA insert of the plasmid deposited with ATCC under accession number 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316; and e) a nucleic acid molecule that encodes a natural allelic variant of the polypeptides comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 7 6 SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, 230 ** * «<<<<<*« «« «« * * * * · · · · · · · · · · · · · »································ SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945 , 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 SEQ ID NO: 17, SEQ ID NO: 19 SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO NO: 25, SEQ ID NO NO: 27, SEQ ID NO NO: 29, SEQ ID NO NO: 31, SEQ NO ID: 33, SEQ ID NO: 35 SEQ ID NO: 37 SEQ ID NO: 39 SEQ ID NO: 48, SEQ ID NO NO. 50, SEQ ID NO NO: 52, SEQ ID NO NO: 54, SEQ ID NO NO: 56, SEQ ID NO: 58 SEQ ID NO: 69 SEQ ID NO: 71 SEQ NO NO: 74, SEQ ID NO: 75, SEQ ID NO NO: 77, SEQ ID NO NO: 79, SEQ ID NO NO: 80, SEQ ID NO NO: 82, SEQ NO ID: 84, SEQ ID NO: 86 SEQ NO NO: 88, SEQ NO NO: 90 SEQ ID NO: 92, SEQ ID NO NO: 94, SEQ ID NO NO: 96, SEQ ID NO NO: 98, SEQ ID NO NO: 100, or: SEQ ID NO: 102, or a plasmid DNA insert deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316, strict conditions. The isolated nucleic acid molecule of claim 1, which is selected from the group consisting of: (a) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 8 0 SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID • · · · 231 ·· 999 99 9 <99 9 9999 9 9 9 9999999 99,999 9 9 9 9 9999 NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94 SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID N0: 100 or SEQ ID NO: 102 or a DNA insert of the plasmid deposited in the ATCC below incremental number 98936, 98937, 98938, 98939, 98940, 98941; 98942; 98943 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991 98993, 98994, or PTA-316 or sequence complementary to said sequences; and b) a nucleic acid molecule that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO. NO: 14, SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 20 SEQ NO NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 102 l, or SEQ ID NO: 109 or amino acid sequence encoded by a DNA insert of a plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316. The nucleic acid molecule of claim 1 further comprising vector nucleic acid sequences. The nucleic acid molecule of claim 1, further comprising a nucleic acid sequence encoding a heterologous polypeptide. 5. A host cell comprising the nucleic acid molecule of claim 1. 232 · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · 6. The host cell of claim 5, wherein the host cell is a mammalian host cell. 7. A non-human mammalian host cell comprising the nucleic acid molecule of claim 1. An isolated polypeptide selected from the group consisting of: a) a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101 SEQ ID NO : 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID _ · 9 · 9 9 999 9 9 9 · ···· ....... · ♦ 9 9 9 9 9 9 9 9 9 99 9 9 9 9 9 9 9 NO: 93, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109, or amino acid sequences encoded by the ATCC insertion plasmid DNA under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316; b) natural allelic variants of the polypeptides comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 , SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20 SEQ NO NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO NO: 30, SEQ ID NO NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38 SEQ ID NO: 40 SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO NO: 55, SEQ ID NO NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72 SEQ NO NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO NO: 85, SEQ ID NO NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ NO ID: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession number 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316, wherein the polypeptide is encoded by a nucleic acid molecule that hybridizes to a nucleic acid molecule comprising SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO 15, SEQ ID NO NO: 17, SEQ ID NO: 19, SEQ ID NO: 21 SEQ ID NO: 23, SEQ ID NO: 25 SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO NO: 31, SEQ ID NO: 33, SEQ ID NO NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 SEQ ID NO: 48, SEQ ID NO: 50 SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO NO: 56, SEQ ID NO: 58, SEQ ID NO NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77 SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO NO: 82, SEQ ID NO: 84, SEQ ID NO NO: 86, SEQ ID NO: 88, SEQ ID NO: 90 SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO NO: 100, or SEQ ID NO: 102, • · • · -. ··· · · · · · · · · · 734 · ·········· · · 9 9 9 9 9 9 9 9 9 9 or DNA insert of plasmids deposited in ATCC under incremental number 98936, 98938, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98947, 98947, 98948, 98949, 98950 98951, 98991, 98993, 98994, or PTA-316 under strict conditions; and c) a polypeptide that is encoded by a nucleic acid molecule comprising a nucleotide sequence that is at least 60% identical to a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25 SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50 SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77 SEQ ID NO: 7 9 SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, or SEQ ID NO: 102, or plasmid DNA insert deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA -316; d) a polypeptide comprising an amino acid sequence that is at least 60% identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO. NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103 !, or SEQ ID NO: 109 or p The amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98943, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316. 235 • · · · · · · · · · · 9 9 9 99 999 999 9999999 99,999 9 9 9 9 9 9 9 9 9 9 · 9999 · 99 99 99 99 An isolated polypeptide according to claim 8 comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO : 102 i, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession number 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316. The polypeptide of claim 8, further comprising heterologous amino acid sequences. 11. An antibody characterized in that it selectively binds to the polypeptide of claim 8. A method for preparing polypeptides selected from the group consisting of: a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO. 236 «· • · • • • • · · · • · · • · · • · · · · · • · • · · • · • · • · · · · • · • · • • • · · • · · · • • • · • · ♦ • · • • • • • NO: 20, SEQ ID NO: 22, SEQ ID NO NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with the ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316; b) a fragment of polypeptides comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 SEQ ID NO: 12 SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO NO: 20, SEQ ID NO NO: 22, SEQ ID NO NO: 24, SEQ ID NO: 26, SEQ ID NO: 28 SEQ ID NO: 30 SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO NO: 38, SEQ ID NO NO. 40, SEQ ID NO NO: 49, SEQ ID NO: 51, SEQ NO NO: 53, SEQ ID NO: 55 SEQ ID NO: 57 SEQ ID NO: 5 9 SEQ ID NO: 70, SEQ ID NO NO: 72, SEQ ID NO NO: 76, SEQ ID NO NO: 78, SEQ ID NO: 81, SEQ NO ID: 83, SEQ NO ID: 85, SEQ ID NO: 87 SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO NO: 93, SEQ ID NO NO: 95, SEQ ID NO NO: 97, SEQ ID NO: 99, SEQ NO NO: 101 SEQ ID NO: 103 1, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 SEQ ID NO: 14, SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 3 6 SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, • · · · • · • · • • • · • • · • « • • • · · · · • · 237 • • • · · · • • « • 4 t · · r ·> • · • «» • «· · • · • · • «· · SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID YES: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103 ;, or SEQ ID NO: 109, or amino acid sequences encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316; and c) a natural allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, or SEQ ID NO: 109 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949 , 98950, 98951, 98991, 98993, 98994, or PTA-316, wherein the polypeptide is encoded by a nucleic acid molecule that hybridizes to a nucleic acid molecule comprising SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 5. NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID • · ~ · ₀₀ · 9999 9 9 9 9 ZJo · ··········· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO NO: 100, or SEQ ID NO: 102, or a DNA insert of the plasmid deposited with ATCC under accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950 , 98951, 98991, 98993, 98994, or PTA-316 under stringent conditions; characterized in that it comprises culturing the host cell according to claim 5 under conditions in which the nucleic acid molecule is expressed. 13. A method for detecting the presence of the polypeptides of claim 8 in a sample, comprising: a) contacting the sample with a compound that selectively binds to the polypeptide; and b) determining whether the compound binds to the polypeptide in the sample, thereby detecting the presence of the polypeptides of claim 8 in the sample. The method of claim 13, wherein the compound that binds to the polypeptide is an antibody. A kit comprising a compound that selectively binds to the polypeptide of claim 8 and instructions for use. 16. A method for detecting the presence of a nucleic acid molecule of claim 1 in a sample comprising: (a) contacting the sample with a nucleic acid probe; or 443 444 44 4 444 94 444 944 4,444 44,444 444 · 4 9 4 4944 99 ·· 4449 · 4 · 49 49 239 a primer that selectively hybridizes to a nucleic acid molecule; and b) determining whether the nucleic acid probe or primer binds to the nucleic acid molecule in the sample, thereby detecting the presence of the nucleic acid molecule of claim 1 in the sample. 17. The method of claim 16, wherein the sample comprises mRNA molecules and is contacted with a nucleic acid probe. A kit comprising a compound that selectively hybridizes to the nucleic acid molecule of claim 1 and instructions for use. 19. A method for identifying a compound that binds to a polypeptide of claim 8, comprising: a) contacting the polypeptide, or a cell expressing the polypeptide, with a test compound; and b) determining whether the polypeptide binds to the test compound. 20. The method of claim 19, wherein binding of the test compound to the polypeptide is detected by a method selected from the group consisting of: a) detecting binding by directly detecting binding of the test compound and polypeptide; b) detecting binding using a competitive binding assay; and c) detecting binding using a PCIP activity assay. 21. A method of modulating the activity of a polypeptide according to claim 8, comprising contacting the polypeptide. 24U polypeptide or cells expressing the polypeptide with a compound that binds to the polypeptide at a concentration sufficient to modulate the activity of the polypeptide. 22. A method for identifying a compound that modulates the activity of a polypeptide of claim 8, comprising: a) contacting the polypeptide of claim 8 with a test compound; and b) determining the effect of the test compound on the activity of the polypeptide, thereby identifying a compound that modulates the activity of the polypeptide. 23. A method for identifying a compound capable of treating a disease characterized by aberrant PCIP nucleic acid expression or PCIP protein activity, comprising testing the ability of the compound or agent to modulate the expression of a PCIP nucleic acid molecule of claim 1 or a PCIP polypeptide activity of claim 8, thereby identifying a compound capable of treating a disease characterized by aberrant PCIP nucleic acid expression or PCIP protein activity. 24. The method of claim 23, wherein the disease is a CNS disease. by 25. The method of claim 24, wherein the disease is epilepsy. 27. The method of claim 24, wherein the disease is spinocerebellar ataxia. by, by, 28. The method of claim 23, 241 • · 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 * 9 9 9 9 ♦ 9 9 9 9 9 9 9 9 that the disease is cardiovascular disease. 29. The method of claim 28, wherein the cardiovascular disease is associated with an abnormal current I _T0. 30. A method of determining whether an individual is at risk for a disease characterized by aberrant or abnormal PCIP nucleic acid expression and / or PCIP protein activity, comprising detecting the presence or absence of a genetic lesion in a cell sample from an individual, wherein the genetic lesion is characterized by alteration. affecting the integrity of the gene encoding the PCIP polypeptide of claim 8, or mis-expression of the PCIP nucleic acid molecule of claim 1. 31. The method of claim 30, wherein the disease is a CNS disease. 32. The method of claim 31, wherein the disease is epilepsy. 33. The method of claim 31, wherein the disease is spinocerebellar ataxia. 34. The method of claim 30, wherein the disease is cardiovascular disease. by 35. The method of claim 34 wherein said cardiovascular disorder is associated with abnormal current I _a. 36. Method of identifying an individual suffering from a disease • 44 4 242 44 4 4 »4 · 44 443 44 4 ·· 4 4 4 · ♦ ·· 4 4 44 4 · 4 4 Characterized by aberrant or abnormal PCIP nucleic acid expression and / or PCIP protein activity, characterized in that it comprises obtaining a biological sample from an individual and detecting the presence or absence of a genetic lesion in the sample, wherein the genetic lesion is characterized by an alteration affecting the integrity of the gene encoding the PCIP polypeptide of claim 8 or mis-expression of the PCIP nucleic acid molecule of claim 1, thereby identifying an individual suffering from a disease characterized by aberrant or abnormal PCIP nucleic acid expression and / or PCIP protein activity. 37. The method of claim 36, wherein the disease is a CNS disease. 38. The method of claim 37, wherein the disease is epilepsy. 39. The method of claim 37, wherein the disease is spinocerebellar ataxia. 40. The method of claim 36, wherein the disease is cardiovascular disease. 41. The method of claim 40, wherein the cardiovascular disease is associated with an abnormal current I _a. The method of claim 36, wherein the disease is a CNS disease. 38. The method of claim 37, wherein the disease is epilepsy. 0 · 00 00 0 0 0 0 0 0 0 0000 0 0 · 0 000 000 0 0 0 ♦ · 0 0 0 · 0 00 00 00 00 0 0 0 «00 0 243 39. The method of claim 37, wherein the disease is spinocerebellar ataxia. 40. The method of claim 36, wherein the disease is cardiovascular disease. 41. The method of claim 40, wherein the cardiovascular disorder is associated with abnormal current I _a. 42. A method of treating an individual with a potassium channel associated disease, comprising administering to the subject a PCIP polypeptide of claim 8, or a portion thereof, such that the treatment occurs. 43. The method of claim 42, wherein the disease is a CNS disease. 44. The method of claim 43, wherein the disease is epilepsy. 45. The method of claim 43, wherein the disease is spinocerebellar ataxia. 46. The method of claim 42, wherein the disease is cardiovascular disease. 47. The method of claim 46 wherein said cardiovascular disorder is associated with abnormal current I _T0. 48. A method of treating an individual with a disease associated with 244 • 9 9 9 9 999 9 9 9 9 9 * 9 9 9 99 9 9 99 9 9 comprising a potassium channel comprising administering to a subject a nucleic acid encoding a PCIP polypeptide of claim 8, or a portion thereof, for treatment. 49. The method of claim 48, wherein the disease is a CNS disease. 50. The method of claim 49, wherein the disease is epilepsy. so that 51. The method of claim 49, wherein the disease is spinocerebellar ataxia. 52. The method of claim 48, wherein the disease is cardiovascular disease. 53. The method of claim 52 wherein said cardiovascular disorder is associated with abnormal current I _a. Use of a compound identified by the method of claim 23 for the treatment of a potassium channel associated disease.