KR20010086407A - Potassium channel interactors and uses therefor - Google Patents

Abstract

The present invention relates to an isolated nucleic acid molecule designated PCIP encoding a protein that binds to a potassium channel and modulates potassium channel mediated activity. The present invention also provides an antisense nucleic acid molecule, a recombinant expression vector containing a PCIP nucleic acid molecule, a host cell into which the expression vector is introduced, and a transplanted animal other than a human into which the PCIP gene has been introduced or degraded. The present invention further provides PCIP proteins, fusion proteins, antigenic peptides and anti-PCIP antibodies. Diagnostic methods using the compositions of the present invention are also provided.

Description

≪ Desc / Clms Page number 1 > POTASSIUM CHANNEL INTERACTORS AND USES THEREFOR < RTI ID =

Mammalian cell membranes are important for the maintenance and activity of many cells and tissues. Of particular interest is the study of trans-membranes and ion channels that act directly in the regulation of various pharmacological, physiological, and cellular processes. Many ion channels have been identified, including calcium, sodium and potassium channels, each of which has been investigated to determine its role in vertebrate and insect cells.

Since they are involved in maintaining the homeostasis of normal cells, much attention has been given to potassium channels. A significant number of these potassium channels open in response to changes in the cell membrane potential. Many voltage switch potassium channels have been identified and are characterized by their electrophysiological and pharmacological properties. Potassium flow is more varied than sodium and calcium flow and is more involved in determining cellular responses to external stimuli. The diversity of potassium channels and their important physiological role highlight their potential as targets for developing therapeutics for a variety of diseases.

One of the most distinctive classes of potassium channels is the voltage-gated potassium channel. The circular portion of this class is a protein encoded by the Drosophila Shaker gene. Shal or Kv4 proteins are types of voltage-gated potassium channels on which negative A-type currents written from different first cells are based. Kv4 channels play a major role in repolarization of cardiac action potentials. In neurons, Kv4 channels and their A-type currents play an important role in modulating excitability, activating potential initiation, and regulating the response of dendrites to synaptic inputs.

The basic function of a neuron is to accept, transmit and transmit signals. Despite signals of various purposes conveyed by different classes of neurons, the shape of the signal is always the same and consists of a change in the potential across the plasma membrane of the neuron. The plasma membrane of a neuron contains a voltage-gated cation channel, which is responsible for traversing the plasma membrane and thereby propagating potential (also called action potential or nerve impulse).

The Kv channels are, above all, (1) delayed rectifier potassium channels that re-excite the cells by repolarizing the membrane after each action potential, and (2) cells that are highly active and excitable at subthreshold voltages (A-type) potassium channel which acts to reduce the rate at which the excitation threshold is reached. In addition to being important for action potential conduction, Kv channels also play a role in depolarization, e.g., regulating the response to synaptic input and releasing neurotransmitters. As a result of this action, voltage-gated potassium channels are the main mediators of neurotic excitation (Hille B., Ionic Channels of Excitable Membranes, Second Edition, Sunderland, MA: Sinauer, (1992)].

There are many structural and functional varieties within the Kv potassium channel upper family. This diversity is caused by both the presence of multiple genes and alternate splicing of RNA transcripts produced from the same gene. Nevertheless, the amino acid sequence of the known Kv potassium channel is very similar. All are believed to consist of four pore forming a-subunits, some of which are known to have four cytoplasmic ([beta] -subunit) polypeptides. [Reference: Jan L. Y. et al. (1990) Trends Neurosci 13: 415-419, and Pongs, O. et al. (1995) Sem Neurosci. 7: 137-146). Known Kv channels (a-subunits) are classified into four sub-families due to homology to the initially isolated channel from Drosophila: Kv1, or a shaker-related subfamily; Kv2, or a shav related subfamily; Kv3, or show related subfamily; And Kv4, or shell-related subfamilies.

Kv4.2 and Kv4.3 are examples of Kv channels (a-subunits) of the shell-related subfamily. Kv4.3 has a unique neuro-anatomic distribution in that its mRNA is highly expressed in the glomerular monoclinic and prefrontal cholinergic neurons, where it participates in the release of the neurotransmitters dopamine, norepinephrine, serotonin and acetylcholine .

In addition, these channels are highly expressed in pyramidal cells of the cortex and in the middle neurons (see Serdio P. et al. (1996) J. Neurophys 75: 2174-2179]. Interestingly, Kv4.3 polypeptides are highly expressed in neurons representing the corresponding mRNA. It is believed that the Kv4.3 polypeptide is expressed in the small cell bodies of these cells and contributes to rapid inactivation of K ⁺ conduction therein. Kv4.2 mRNA is widely expressed in the brain and the corresponding polypeptides also appear to be concentrated within the cell bodies and contribute to rapid deactivation of K ⁺ conduction therein [ref. Sheng et al. (1992) Neuron 9: 271-284]. These cellular A-type Kv channels, like Kv4.2 and Kv4.3, seem to be involved in the processes underlying learning and memory, such as the maintenance of divisional jaw synaptic responses and conduction of backpropagation activity potentials [Hoffman DA et al. (1997) Nature 387: 869-875).

Thus, a protein that modulates a potassium channel protein, for example, interacting with the action of a potassium channel having a Kv4.2 or Kv4.3 subunit, may be nerve or cardiac excitatory within the cell expressing such channel, Provides novel molecular targets that regulate conduction, cellular excitability, and neurotransmitter release. In addition, the detection of genetic lesions in genes encoding these proteins may be useful in the treatment of central nervous system disorders such as epilepsy, spinal cord cerebral ataxia, depression, aging memory loss, migraine, obesity, Parkinson's disease or Alzheimer's disease; Or cardiovascular diseases, such as heart failure, hypertension, atrial fibrillation, dilated cardiomyopathy, idiopathic cardiomyopathy, or angina.

Contents

A. SUMMARY OF THE INVENTION 4-

B. Brief Description of the Drawings -12-

C. DETAILED DESCRIPTION OF THE INVENTION -18-

Ⅰ. The isolated nucleic acid molecule -33-

Ⅱ. The isolated PCIP protein and anti-PCIP antibody -54-

Ⅲ. Recombinant expression vector and host cell -68-

IV. Pharmaceutical compositions-78-

Ⅴ. Uses and Methods of the Invention-86-

A. Screening test -88-

B. Detection test-97-

1. Chromosome Mapping-97-

2. Determination of organization type -100-

3. Use of partial PCIP sequences in autopsy biology -101-

C. Predictive Medicine-102-

1. Diagnostic Test -103-

2. Prognosis Verification -105-

3. Monitoring effects during clinical trials -111-

D. Treatment Methods -113-

1. Prevention Methods -113-

2. Treatment methods -114-

3. pharmacogenomics -115-

D. Example-119-

SUMMARY OF THE INVENTION

The present invention is based, at least in part, on the discovery of novel nucleic acid molecules that encode gene products that interact with potassium channel proteins and which have homology to the gene products of the invention that interact with potassium channel proteins (paralogs). The potassium channel protein is, for example, a potassium channel having Kv4.2 or Kv4.3. The nucleic acid molecules of the invention and their gene products are referred to herein as "potassium channel interacting protein", "PCIP", or "KChIP" nucleic acid and protein molecules. The PCIP protein of the present invention can be used, for example, to interact with a binding to a potassium channel protein, to modulate the action of a potassium channel protein, and / or to modulate the activity of a potassium channel in the cell, It controls the action. The PCIP molecules of the present invention are useful as modulators to control various cell processes, i.e., neural or cardiac cell processes. Thus, in one aspect, the present invention provides nucleic acid fragments suitable as primers or hybrid probes for detection of PCIP encoding nucleic acids as well as isolated nucleic acid molecules encoding their PCIP proteins or their biologically active sites.

In one embodiment, the PCIP nucleic acid molecule of the present invention comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: SEQ ID NO: 13, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: (For example, the full-length nucleotide sequence) shown in SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937 , 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 55%, 60%, 65%, 70% or more of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with the ATCC as the nucleotide sequence of SEQ ID NO: 98950, 98951, 98991, 98993 or 98994 %, 75%, 80%, 85%, 90%, 95%, 98% It is the same phase.

In another preferred embodiment, the isolated nucleic acid molecule is a nucleic acid molecule having the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: , SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: The nucleotide sequence shown in SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, . In another preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: , SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: The nucleotide sequence of the nucleotide sequence of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71, At least 300, 350, 400, 426, or 583 nucleotide fragments.

In another embodiment, the PCIP nucleic acid molecule is a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: , SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: : 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991 , 98993 or 98994, which encodes a protein having an amino acid sequence sufficiently identical to the amino acid sequence encoded by the DNA insertion sequence of the plasmid deposited with the ATCC. In a preferred embodiment, the PCIP nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, or SEQ ID NO: 72 or accession numbers 98936, 98937, 98938, 98939, 98940 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 90% of the amino acid sequence encoded by the DNA insert sequence of the plasmid deposited with the ATCC, %, 95% or more identical to the amino acid sequence Which comprises a nucleotide sequence.

In another preferred embodiment, the isolated nucleic acid molecule encodes 1v, 9q, p19, W28559, KChIP4a, KChIP4b, 33b07, 1p, and the rat 7s protein. In another preferred embodiment, the nucleic acid molecule is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: : 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: , SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: The amino acid sequence of SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, or SEQ ID NO: 72, or accession numbers 98936, 98937, 98938, 98939 , 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, which contains a nucleotide sequence encoding a protein having an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC. In another embodiment, the nucleic acid molecule encodes a protein having a length of 426, 471, or 583 nucleotides or greater and having PCIP activity (as described herein).

Another aspect of the invention features PCIP nucleic acid molecules that specifically detect PCIP nucleic acid molecules for nucleic acid molecules that encode nucleic acid molecules, preferably non-PCIP proteins. For example, in one embodiment, such nucleic acid molecules are at least 426, 400-450, 471, 450-500, 500-550, 583, 550-600, 600-650, 650-700, 700 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: SEQ ID NO: 13, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: Nucleotide sequences of SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939 , 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, the DNA shovel of a plasmid deposited with the ATCC It is hybridized to the sequence, or a nucleic acid molecule comprising a complementary sequence thereof. In a preferred embodiment, the nucleic acid molecule is at least 15 nucleotides in length (e. G., Consecutively) and under stringent conditions, the nucleotide sequence of SEQ ID NO: 7 is at least about 93-126, 360-462, 732-825, 1028-1054, 1534 < / RTI > nucleotides. In another preferred embodiment, the nucleic acid molecule comprises nucleotides 93-126, 360-462, 732-825, 1028-1054, or 1517-1534 of SEQ ID NO: 7.

In another preferred embodiment, the nucleic acid molecule is at least 15 nucleotides in length (e. G., Consecutively), and under stringent conditions, 1-14, 49-116, 137-311, 345-410, 430- 482, 503-518, 662-693, 1406-1421, 1441-1457, 1478-1494, or 1882-1959 nucleotides. In another preferred embodiment, the nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of 1-14, 49-116, 137-311, 345-410, 430-482, 503-518, 662-693, 1406-1421, 1441-1457, 1478-1494, or 1882-1959 nucleotides.

In a preferred embodiment, the nucleic acid molecule is at least 15 nucleotides in length (e. G., Consecutively) and, under stringent conditions, at positions 932-1527, 1548-1765, 1786-1871, 1908-2091, 2259-2265 , Or 2630-2654 nucleotides. In another preferred embodiment, the nucleic acid molecule comprises nucleotides 932-1527, 1548-1765, 1786-1871, 1908-2091, 2259-2265, or 2630-2654 nucleotides of SEQ ID NO: 35.

In another preferred embodiment, the nucleic acid molecule is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, or SEQ ID NO: 72 or accession numbers 98936, 98937, 98938, 98939, 98940 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, encoding a natural allele of a polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC, wherein the nucleic acid molecule encodes a polypeptide having the amino acid sequence SEQ ID N 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 46, SEQ ID NO: : 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 71.

Another aspect of the invention provides isolated nucleic acid molecules that are antisense to the coding strand of PCIP nucleic acid molecules, e. G. PCIP nucleic acid molecules.

Another aspect of the invention provides a vector comprising a PCIP nucleic acid molecule. In certain embodiments, the vector is a recombinant expression vector. In another aspect, the invention provides a host cell comprising a vector of the invention. The present invention also provides a method for producing a protein, preferably a PCIP protein, by culturing a host cell of a mammal such as a host cell, preferably an exogenous mammalian cell, in a suitable medium.

Yet another aspect of the invention features isolated or recombinant PCIP proteins and polypeptides. In one embodiment, the isolated protein, preferably the PCIP protein, comprises at least one calcium binding domain. In a preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: The amino acid sequence of SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or accession Nos. 98936, 98937 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, At least 50%, 55%, 60%, 65%, 70% or 70% of the amino acid sequence encoded by the DNA insertion sequence of the plasmid deposited with the ATCC as the nucleic acid sequence of SEQ ID NO: 98950, 98951, 98991, 98993 or 98994 %, 75%, 80%, 85%, 90%, 9 5% or more. In another preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and modulates potassium channel mediated activity. Also, in another preferred embodiment, the protein, preferably the PCIP protein, comprises at least one calcium binding domain and is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: SEQ ID NO: 7, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: NO: 69, SEQ ID NO: 71. The nucleotide sequence of the nucleotide sequence of SEQ ID NO:

In another aspect, the invention provides a polynucleotide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: : 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, , SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72, wherein the fragment is a fragment of a protein having the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: , SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: : 70, or the amino acid sequence of SEQ ID NO: 72 or accession numbers 98936, 98937, 98938 , 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, (E. G., Consecutive amino acids) of the amino acid sequence encoded by the DNA insert sequence of a plasmid deposited with the ATCC, as described in WO 98/98951, 98991, 98993 or 98994. In another embodiment, the protein, preferably the PCIP protein, is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: : 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: , SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, SEQ ID NO: 72.

In another aspect, the invention provides a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 31, SEQ ID NO: 31, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: At least 50%, 55%, 60%, 50%, 50%, or 50%, at least 50%, at least 50%, at least 50%, at least 50% Characterized by a nucleic acid molecule encoded by a nucleic acid molecule having at least 65%, 70%, 75%, 80%, 85%, 90%, 95% or more identical nucleotide sequences and complementary sequences thereof, do.

The proteins of the invention and their biologically active sites may be conservatively linked to non-PCIP polypeptides (e. G., Heterologous amino acid sequences) to form fusion proteins. The invention further features an antibody such as a monoclonal or polyclonal antibody, which specifically binds to a protein of the invention, preferably a PCIP protein. In addition, the PCIP protein or biologically active site thereof may be incorporated into a pharmaceutical composition, which may optionally comprise a pharmaceutically acceptable carrier.

In another aspect, the present invention relates to a method for detecting a PCIP nucleic acid molecule, protein or polypeptide in a biological sample, wherein the presence of the PCIP nucleic acid molecule, protein or polypeptide is detected in a biological sample by contacting the biological sample with a reagent capable of detecting the PCIP nucleic acid molecule, , A method for detecting the presence of a protein or polypeptide.

In another aspect, the invention provides a method of contacting a biological sample with a reagent capable of detecting an indicator of PCIP activity to detect the presence of PCIP activity in a biological sample that causes the presence of PCIP activity to be detected in the biological sample .

In another aspect, the invention provides a method of modulating PCIP activity comprising contacting a cell capable of expressing PCIP with a reagent that modulates PCIP activity, wherein the activity of PCIP in the cell is modulated. In one embodiment, the reagent inhibits PCIP activity. In another embodiment, the reagent promotes PCIP activity. In one embodiment, the reagent is an antibody that specifically binds the PCIP protein. In another embodiment, the reagent modulates the expression of PCIP by modulating the transcription of the PCIP gene or the transcription of PCIP mRNA. In yet another embodiment, the reagent is a nucleic acid molecule having a nucleotide sequence that is antisense to the coding strand of the PCIP mRNA or PCIP gene.

In one embodiment, the methods of the invention are used to treat a patient having a disorder characterized by the expression or activity of an abnormal PCIP protein or nucleic acid by administering to the patient a reagent that is a PCIP modulator. In one embodiment, the PCIP regulator is a PCIP protein. In another embodiment, the PCIP regulator is a PCIP nucleic acid molecule. In yet another embodiment, the PCIP modulator is a peptide, peptidomotor, or other small molecule. In a preferred embodiment, the disorder characterized by abnormal PCIP protein or nucleic acid expression is a CNS disease or a cardiovascular disease.

In addition, the present invention provides diagnostic assays confirming the presence or absence of genetic modification characterized by one or more of the following causes: (i) abnormal transformation or mutation of the gene encoding the PCIP protein, (ii) abnormality of the PCIP protein Post-translational modification, wherein the wild-type gene encodes a protein having PCIP activity.

In another aspect, the present invention provides an indicator composition comprising a PCIP protein having PCIP activity, contacting the indicator composition with a test compound, measuring the effect of the test compound on PCIP activity in the indicator composition, A method of identifying a compound that binds to and modulates the activity of a PCIP protein that identifies a compound that modulates activity.

Other features and advantages of the present invention will become apparent from the following detailed description and claims.

Brief Description of Drawings

Figure 1 shows the cDNA sequence and predicted amino acid sequence of human lv. The nucleotide sequence corresponds to the 1-1463 nucleic acid of SEQ ID NO: 1. The amino acid sequence corresponds to amino acids 1-216 of SEQ ID NO: 2.

Figure 2 shows the cDNA sequence and predicted amino acid sequence of rat 1v. The nucleotide sequence corresponds to the 1-1856 nucleic acid of SEQ ID NO: 3. The amino acid sequence corresponds to 1-245 amino acids of SEQ ID NO: 4.

Figure 3 shows the cDNA sequence and predicted amino acid sequence of mouse 1v. The nucleotide sequence corresponds to 1-1907 nucleic acid of SEQ ID NO: 5. The amino acid sequence corresponds to amino acids 1-216 of SEQ ID NO: 6.

Figure 4 shows the cDNA sequence and predicted amino acid sequence of rat 1vl. The nucleotide sequence corresponds to the 1-1534 nucleic acid of SEQ ID NO: 7. The amino acid sequence corresponds to the 1-227 amino acids of SEQ ID NO: 8.

Figure 5 shows the cDNA sequence and predicted amino acid sequence of mouse 1 vl. The nucleotide sequence corresponds to the 1-1540 nucleic acid of SEQ ID NO: 9. The amino acid sequence corresponds to amino acid 1-227 of SEQ ID NO: 10.

Figure 6 shows the cDNA sequence and predicted amino acid sequence of rat 1vn. The nucleotide sequence corresponds to the 1-955 nucleic acid of SEQ ID NO: 11. The amino acid sequence corresponds to the 1-203 amino acids of SEQ ID NO: 12.

Figure 7 shows the cDNA sequence and predicted amino acid sequence of human 9ql. The nucleotide sequence corresponds to the 1-2009 nucleic acid of SEQ ID NO: 13. The amino acid sequence corresponds to 1-270 amino acids of SEQ ID NO: 14.

Figure 8 shows the cDNA sequence and predicted amino acid sequence of rat 9ql. The nucleotide sequence corresponds to the 1-1247 nucleic acid of SEQ ID NO: 15. The amino acid sequence corresponds to 1-257 amino acids of SEQ ID NO: 16.

Figure 9 shows the cDNA sequence and predicted amino acid sequence of mouse 9ql. The nucleotide sequence corresponds to the 1-2343 nucleic acid of SEQ ID NO: 17. The amino acid sequence corresponds to 1-270 amino acids of SEQ ID NO: 18.

Figure 10 shows the cDNA sequence and predicted amino acid sequence of human 9qm. The nucleotide sequence corresponds to 1-1955 nucleic acid of SEQ ID NO: 19. The amino acid sequence corresponds to amino acids 1-252 of SEQ ID NO: 20.

Figure 11 shows the cDNA sequence and predicted amino acid sequence of rat 9qm. The nucleotide sequence corresponds to 1-2300 nucleic acids of SEQ ID NO: 21. The amino acid sequence corresponds to amino acids 1-252 of SEQ ID NO: 22.

Figure 12 shows the cDNA sequence and the predicted amino acid sequence of human 9qs. The nucleotide sequence corresponds to the 1-1859 nucleic acid of SEQ ID NO: 23. The amino acid sequence corresponds to the 1-220 amino acids of SEQ ID NO: 24.

Figure 13 shows the cDNA sequence and the predicted amino acid sequence of monkey 9qs. The nucleotide sequence corresponds to the 1-2191 nucleic acid of SEQ ID NO: 25. The amino acid sequence corresponds to amino acid 1-220 of SEQ ID NO: 26.

Figure 14 shows the cDNA sequence and predicted amino acid sequence of rat 9qc. The nucleotide sequence corresponds to the 1-2057 nucleic acid of SEQ ID NO: 27. The amino acid sequence corresponds to amino acids 1-252 of SEQ ID NO: 28.

Figure 15 shows the cDNA sequence and predicted amino acid sequence of rat 8t. The nucleotide sequence corresponds to the 1-1904 nucleic acid of SEQ ID NO: 29. The amino acid sequence corresponds to the 1-225 amino acids of SEQ ID NO: 30.

Figure 16 shows the cDNA sequence and predicted amino acid sequence of human p19. The nucleotide sequence corresponds to the 1-619 nucleic acid of SEQ ID NO: 31. The amino acid sequence corresponds to 1-200 amino acids of SEQ ID NO: 32.

Figure 17 shows the cDNA sequence and predicted amino acid sequence of rat p19. The nucleotide sequence corresponds to the 1-442 nucleic acid of SEQ ID NO: 33. The amino acid sequence corresponds to 1-109 amino acids of SEQ ID NO: 34.

Figure 18 shows the cDNA sequence and predicted amino acid sequence of mouse p19. The nucleotide sequence corresponds to the 1-2644 nucleic acid of SEQ ID NO: 35. The amino acid sequence corresponds to amino acid 1-256 of SEQ ID NO: 36.

Figure 19 shows the cDNA sequence and predicted amino acid sequence of human W28559. The nucleotide sequence corresponds to the 1-380 nucleic acid of SEQ ID NO: 37. The amino acid sequence corresponds to amino acid 1-126 of SEQ ID NO: 38.

Figure 20 shows the cDNA sequence and predicted amino acid sequence of human P193. The nucleotide sequence corresponds to the 1-2176 nucleic acid of SEQ ID NO: 39. The amino acid sequence corresponds to amino acids 1-41 of SEQ ID NO: 40.

Figure 21 is a schematic representation of the rat 1v, rat 9qm and mouse P19 proteins and is arranged to represent the conserved regions within these proteins.

22 shows the gene DNA sequence of human 9q. Figure 22A shows exon 1 and its lateral intron sequence (SEQ ID NO: 46). Figure 22B shows exons 2-11 and its lateral intron sequence (SEQ ID NO: 47).

23 shows the cDNA sequence and the predicted amino acid sequence of the monkey KChIP4a. The nucleotide sequence corresponds to 1-2413 nucleic acids of SEQ ID NO: 48. The amino acid sequence corresponds to amino acid 1-233 of SEQ ID NO: 49.

24 shows the cDNA sequence and the predicted amino acid sequence of the monkey KChIP4b. The nucleotide sequence corresponds to the 1-1591 nucleic acid of SEQ ID NO: 50. The amino acid sequence corresponds to amino acid 1-233 of SEQ ID NO: 51.

Figure 25 shows an array of KChIP4a, KChIP4b, 9q1, 1v, p19, and related human paradigm (hsncspara) W28559. The same amino acid in the consensus is black, and the conserved amino acid is gray.

Figure 26 shows the cDNA sequence and predicted amino acid sequence of rat 33b07. The nucleotide sequence corresponds to the 1-2051 nucleic acid of SEQ ID NO: 52. The amino acid sequence corresponds to amino acid 1-407 of SEQ ID NO: 53.

Figure 27 shows the cDNA sequence and predicted amino acid sequence of human 33b07. The nucleotide sequence corresponds to the 1-4148 nucleic acid of SEQ ID NO: 54. The amino acid sequence corresponds to 1-414 amino acids of SEQ ID NO: 55.

Figure 28 shows the cDNA sequence and predicted amino acid sequence of rat 1p. The nucleotide sequence corresponds to the 1-2643 nucleic acid of SEQ ID NO: 56. The amino acid sequence corresponds to amino acid 1-267 of SEQ ID NO: 57.

Figure 29 shows the cDNA sequence and predicted amino acid sequence of rat 7s. The nucleotide sequence corresponds to the 1-2929 nucleic acid of SEQ ID NO: 58. The amino acid sequence corresponds to 1-270 amino acids of SEQ ID NO: 59.

Figure 30 shows the cDNA sequence and predicted amino acid sequence of rat 29x. The nucleotide sequence corresponds to the 1-1489 nucleic acid of SEQ ID NO: 60. The amino acid sequence corresponds to amino acid 1-351 of SEQ ID NO: 61.

31 shows the cDNA sequence of rat 25r. The nucleotide sequence corresponds to the 1-1194 nucleic acid of SEQ ID NO: 62.

Figure 32 shows the cDNA sequence and predicted amino acid sequence of rat 5p. The nucleotide sequence corresponds to the 1-600 nucleic acid of SEQ ID NO: 63. The amino acid sequence corresponds to the 1-95 amino acids of SEQ ID NO: 64.

Figure 33 shows the cDNA sequence and predicted amino acid sequence of rat 7q. The nucleotide sequence corresponds to the 1-639 nucleic acid of SEQ ID NO: 65. The amino acid sequence corresponds to amino acid 1-212 of SEQ ID NO: 66.

Figure 34 shows the cDNA sequence and predicted amino acid sequence of rat 19r. The nucleotide sequence corresponds to the 1-816 nucleic acid of SEQ ID NO: 67. The amino acid sequence corresponds to amino acid 1-271 of SEQ ID NO: 68.

Figure 35 shows the cDNA sequence and the predicted amino acid sequence of the monkey KChIP4c. The nucleotide sequence corresponds to the 1-2263 nucleic acid of SEQ ID NO: 69. The amino acid sequence corresponds to amino acid 1-229 of SEQ ID NO: 70.

Figure 36 shows the cDNA sequence and the predicted amino acid sequence of the monkey KChIP4d. The nucleotide sequence corresponds to the 1-2259 nucleic acid of SEQ ID NO: 71. The amino acid sequence corresponds to 1-250 amino acids of SEQ ID NO: 72.

37 shows the arrangement of KChIP4a, KChIP4b, KChIP4c, and KChIP4d.

Figure 38 shows a graph showing current record from CHO cells expressing Kv4.2 with or without KChIP2 (9ql). Peak current amplitudes at various test voltages are shown on the right panel. Figure 38 additionally shows a table showing the amplitude and motion effects of KChIP2 (9ql) on Kv4.2. KchIP2 expression alters peak current amplitude, inactivation and recovery from inactivation time constants, and activation V1 _{/ 2} .

Figure 39 shows a graph showing current record from CHO cells expressing Kv4.2 with or without KChIP3 (p19). Cells are fixed at -80 mV and increased from -60 mV to +50 mV during 200 ms. Peak current amplitudes at various test voltages are shown on the right panel. Figure 39 additionally shows a table showing the amplitude and kinetic effects of KChIP3 (p19) on Kv4.2. KchIP3 alters the inactivation and recovery from peak current and inactivity time constants.

Figure 40 shows the results of electrophysiological experiments demonstrating that the simultaneous expression of KchIP1 dramatically alters the current density and movement of Kv4.2 channels expressed in CHO cells.

Figure 40A shows the current record from CHO cells in which Kv4.2 cells were infected. The current is regenerated by depoling the test potential from -60 to 50 mV while holding the cell at a potential of substantially -80 mv. Current recording can be removed with a short circuit using the p / 5 protocol. The current axis was shown to be the same size as in (b) to emphasize the change in current amplitude. Inflow at 50 mV with the expanded current axis - a single current write indicates the current activation and deactivation movement.

Figure 40B shows the current record as in (a), but the same amounts of Kv4.2 and KChIP1 DNA were obtained from cells infected with the cells.

Figure 40C shows peak current amplitudes at all voltages obtained from cells infected with Kv4.2 (n = 11) alone or cells simultaneously infected with KChIP1 (n = 9).

Figures 40D and 40E show recovery from deactivation using two pulse protocols. Simultaneous expression (E) of Kv4.2 alone (D) or KChIP1 is driven in an inactive state using a first pulse at 50 mV, and then a second pulse at 50 mV is applied at various times after the first pulse. The potential before and after all pulses is fixed at -80 mV.

Figure 40F summarizes the percentage recovery of peak current between the cells for Kv4.2 (n = 8) and for the cells infected with Kv4.2 and KChIP1 (n = 5). The time constant of recovery from deactivation matches a single exponent.

Figure 41 shows an array of human KChIP family members with members of the healing flow of closely related Ca ²⁺ -containing proteins. (HIP: human hippocalcin, NCS1: rat nerve calcium sensor 1). The array was performed using the MegAlign program for macintosh (version 4.00 of DNASTAR) using the Clustal method with the PAM250 residual weight table and default parameters and was blackened using the BOXSHADES Shaded. The same residue as the consensus was shaded black and the conservative substituent was shaded gray. X, Y, Z and -X, -Y, and -Z designate the positions of the moieties responsible for bonding to calcium by the EP hand.

42 shows a physical map of the IOSCA area.

Figure 43 shows the location of h9q and associated maps showing known markers associated with IOSCA and epilepsy.

The present invention is based on the discovery of novel nucleic acid molecules comprising a substantial homologue to the gene product of the present invention that at least partially encodes a gene product interacting with a potassium channel protein or interacts with a potassium channel protein (paralog) do. The potassium channel protein is, for example, a potassium channel with Kv 4.2 or Kv 4.3 units. Nucleic acid molecules and their gene products of the invention herein are referred to as "Potassium Channel Interacting Proteins", "PCIP" or "KChIP" nucleic acid and protein molecules. Preferably, the PCIP protein of the present invention interacts with, for example binds, and modulates the activity of a potassium channel protein and / or modulates the activity of a potassium channel in a cell, e.g., a neural or cardiac cell, Adjust.

As used herein, the term " PCIP family " refers to two or more proteins or nucleic acid molecules having " PCIP " activity, as defined herein, when referring to proteins and nucleic acid molecules of the invention. These PCIP family members can be natural or non-natural and can be from the same or different species. For example, the PCIP family may contain a first protein of human origin and others, or alternatively, another protein of human origin may contain a homolog of non-human origin.

The terms " PCIP activity ", " biological activity of PCIP, " or " functional activity of PCIP, " as used herein interchangeably refer to the activity of PCIP-reactive cells or PCIP protein substrates PCIP protein, polypeptide, or nucleic acid molecule. In one embodiment, the PCIP activity is a direct activity, such as binding to a PCIP-target molecule. As used herein, the term " target molecule " or " binding partner " is a molecule to which the PCIP protein naturally binds or interacts, such that a PCIP mediated function is achieved. The PCIP target molecule may be a non-PCIP molecule or a PCIP protein or polypeptide of the present invention. In an exemplary embodiment, the PCIP target molecule is a PCIP ligand. Alternatively, PCIP activity is an indirect activity, such as cell signaling activity mediated by the interaction of PCIP protein with PCIP ligand. The biological activity of PCIP is described herein.

For example, a PCIP protein of the invention may exhibit one or more of the following activities: (1) the PCIP protein may interact (e.g., bind) with a potassium channel protein or a portion thereof; (2) the PCIP protein can modulate the phosphorylation state of a potassium channel protein or a portion thereof; (3) The PCIP protein can associate (e.g., bind) to calcium and act as a calcium dependent kinase, for example, phosphorylate a potassium channel or G protein coupled receptor in a calcium dependent manner; (4) The PCIP protein can be associated (e.g., linked) to calcium, for example acting in a calcium dependent manner in cellular processes, for example acting as a calcium dependent transcription factor; (5) the PCIP protein may beneficially affect cells by modulating potassium channel mediated activity in cells (such as neurons or cardiac cells such as sensory neurons or motor neurons); (6) PCIP protein is able to regulate chromatin formation in cells, such as neurons or cardiac cells; (7) PCIP proteins can modulate vesicle exchange and protein transport in cells, for example, neurons or cardiac cells; (8) PCIP protein can modulate cytokine signaling in cells, e.g., neurons or cardiac cells; (9) The PCIP protein can modulate the potassium channel protein or a portion thereof and its relationship to cell structure; (10) PCIP protein can regulate cell proliferation; (11) The PCIP protein can regulate the release of neurotransmitters; (12) PCIP protein can modulate membrane irritation; (13) PCIP protein can affect the residual potential of the membrane; (14) The PCIP protein can modulate the waveform and frequency of action potentials; (15) The PCIP protein can regulate the limits of stimulation.

The term " potassium channel " as used herein includes proteins or polypeptides that are involved in the reception, induction and delivery of signals in stimulatory cells. Potassium channels are commonly expressed in electrically stimulatable cells, such as neurons, heart, skeletal muscle, smooth muscle, kidney, endocrine gland and oocyte, and can form heteromultiplexing structures composed of for example pore formation and cytoplasmic subunits have. Examples of potassium channels include (1) voltage gated potassium channels, (2) ligand gated potassium channels, and (3) mechanically gated potassium channels. For a detailed description of potassium channels, reference is made to the following references, cited as references in the present application: Kandel E.R. et al., Principles of Neural Science, second edition, (Elsevier Science Publishing Co., Inc., N. Y. (1985)). The PCIP protein of the present invention appears to interact with, for example, Kv4.3 subunit or potassium with Kv4.2 subunit.

As used herein, the term " potassium channel mediated activity " refers to a potassium channel associated with receiving, inducing and delivering signals in the potassium channel, e.g., the nervous system or cardiac system, for example potassium Channel < / RTI > activity. Potassium channel mediated activity is the release of neurotransmitters such as dopamine or norepinephrine from cells, such as nerve or cardiac cells; Regulation of membrane potential, waveform and frequency of action potentials, and stimulation threshold maintenance; And the integration of conductive and secondary limiting synaptic responses that in turn propagate the action potentials in, for example, neurons or cardiac cells.

As the PCIP protein of the present invention modulates potassium channel-mediated activity, this protein may be useful as a novel diagnostic and therapeutic agent for diseases associated with potassium channels and / or diseases related to the nervous system. In addition, the PCIP protein of the present invention has a Kv4 potassium channel, for example a Kv4.2 or Kv4.3 subunit, based on voltage gated K + current (known as I ₁₀ (transient external current)) at the mammalian heart (Kaab S. et al. (1998) Circulation 98 (14): 1383-93; Dixon, JE et al., (1996) Circulation Research 79 (4): 659-68; Nerbonne JM (1998) Journal of Neurobiology 37 (1): 37-59; Barry DM et al. (1998) Circulation Research 83 (5): 560-7; Barry DM et al. (1996) Annual Review of Physiology 58: 363-94. The current is based on rapid re-polarization of myocardial cells during action potentials. This current is also involved in the inter-bit spacing by regulating the rate at which the myocardial cells reach their limit to produce the action potentials that accompany them.

This current is also known to modulate cardiac hypertrophy in a patient, thereby prolonging the cardiac action potential. In these patients, prolongation of action potential is thought to contribute to the progression of heart disease leading from hypertrophy to heart failure, resulting in changes in calcium load and calcium treatment within the myocardium (Wickenden et al., (1998) Cardiovascular Research 37: 312]. Surprisingly, several PCIPs of the present invention (e.g., 9ql, 9qm, 9qs as shown in SEQ ID NOs: 13, 15, 17, 19, 21, 23 and 25) contain Kv4.2 or Kv4.3 subunits Binds to the potassium channel, coordinates this potassium channel, and contains the calcium-binding EF hand domain. Due to mutations in these PCIP genes, defects in the expression of these calcium-binding PCIP proteins themselves or deficiencies in their interaction with the Kv4.2 or Kv4.3 channels may result in Kv4.3 or Kv4.3 I _m ) current, and a therapeutic agent that alters PCIP expression or modulates the interaction between PCIP and Kv4.2 or Kv4.3 channels slows the progression of the disease from hypertrophy to heart failure It can be a very important treatment to suppress.

As used herein, " potassium channel related disorder " includes diseases, diseases or conditions characterized by aberrant modulation of potassium channel mediated activity. Potassium channel related diseases include the transmission of sensory impulses from the periphery to the brain and / or the induction of motion impulses from the brain to the periphery; Integration of reflexes; Analysis of sensory impulse; And can have a negative effect on emotions, intellectual (eg, learning and memory), or exercise processes. Potassium channel related diseases can also have a negative impact on the electrical impulses that stimulate the cardiac muscle fibers to contact. Examples of potassium channel related diseases include neurological diseases and cardiovascular diseases.

As used herein, the term " neurological disease " includes diseases, disorders or conditions affecting the nervous system. Examples of potassium channel related diseases and diseases related to the nervous system include cognitive diseases such as memory and learning disorders such as memory loss, motor neuropathy, cognitive impairment, aphasia of benign neoplasms, loss of sensory spatiality, Kluver -Bucy syndrome, Alzheimer-related memory loss (Eglen RM (1996) Pharmacol. And Toxicol 78 (2): 59-68; Perry EK (1995) Brain and Cognition 28 (3) 240-58) and learning impairment; Delirium associated with diseases affecting consciousness, such as visual acuity, perceptual disorder, or lewy body dementia; (1997) J. Clin. Psychiatry 58 (suppl. 10): 28-31). In addition, it has been reported that the number of patients with schizophrenia is significantly higher than that of patients with schizophrenia (Dean B. (1996) Mol. Psychiatry 1 Yeomans JS (1995) Neuropharmacol. 12 (1): 3-16; Reimann D. (1994) J. Psychiatric Res. 28 (3): 195-210), depression (primary or secondary); Sensory sensitivity disorders (Janowsky DS (1994) Am. J. Med. Genetics 54 (4): 335-44); Sleep disorders (Kimura F. (1997) J. Neurophysiol. 77 (2): 709-16), for example, REM sleep disorders in patients suffering from depression (Rieman D. (1994) J. Psychosomatic Res. Bourgin P. (1995) Neuroreport 6 (3): 532-6), paralytic water surface abnormality (Sakai K. (1997) Eur. J. Neuroscience 9 (3): 415-23) (1995) Am. J. Physiol. 269 (2 Pt 2): R308-17; Mallick BN (1997) Brain Res. 750 (1-2): 311- 7). Other examples of nervous system related disorders include diseases affecting pain mechanisms such as pain associated with irritable bowel syndrome (Mitch CH (1997) J. Med. Chem. 40 (4): 538-46; Shannon HE 1997) J. Pharmac. And Exp. Therapeutics 281 (2): 884-94; Bouaziz H. (1995) Anesthesia and Analgesia 80 (6): 1140-4 or Guimaraes AP (1994) Brain Res 647 (2) : 220-30) or chest pain; (1997) Pharmacol. Biochem & Behavior 56 (2): 273 (1997) Physiol. ≪ RTI ID = 0.0 &-9); (1997) J. Endocrinol. Invest. 20 (1): 8-12; Premawardhana LD (1994) Clin. Endocrinol. 40 (5): 617-21 ); Drinking disorders such as diabetes mellitus (Murzi E. (1997) Brain Res. 752 (1-2): 184-8; Yang X. (1994) Pharmacol. Biochem & Behavior 49 (1): 1-6; Neurodegenerative diseases such as Alzheimer's disease, dementia associated with Alzheimer's disease (e.g., Pick disease), Parkinson's and other Louis Diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, a progressive supranuclear palsy, epilepsy, spinal cord cerebellar degeneration, And Creutzfeldt-Jakob disease; psychosis such as depression, schizophrenia, Korsakoff's disease, mania, anxiety, bipolar affective disorders or phobias, neurological disorders such as migraine, spinal cord injury, seizures and head trauma.

The term " epilepsy " as used herein includes general neurological disorders caused by disorders of the normal electrical function of the brain. In normal brain function, many small electric charges pass from nerve cells in the brain to all parts of the body. In patients with epilepsy, this normal pattern is interrupted by a sudden and unusual strong seizure of electrical energy, which in brief can affect a person's perception, body movement or sensation. This physical change is termed an epileptic seizure. There are two categories of seizures: partial seizures in one domain of the brain, and integrated seizures affecting neurons throughout the brain. Epilepsy may be caused by brain damage before, during, or after birth; Head trauma; Malnutrition; Some infectious diseases; Brain tumor; And some dangers. However, in many cases its cause is unknown. The invention of epilepsy can be caused by a feeling of anxiety or emotional discomfort, a precursor to the onset of seizures. The signal of various impending epileptic seizures from patient to patient may include visual symptoms such as unstable light or " intense sunshine ". Recently, genetic linkage to epilepsy was found on chromosome 10q, a neighboring marker D10S192: 10q22-q24 (Ottman et al. (1995) Nature Genetics 10: 56-60]. Various forms of epilepsy include epileptic seizures, Jackson-type, pro-migratory familial types, socalled, Lennox-Gasstaut syndrome, febrile seizures, psychomotor and temporary lobes. The ones described herein are particularly useful for developing treatments for partial afflictions.

As used herein, the term " ataxia " is a common neurological disease caused by a disorder of normal electrical function of the brain. Spinal cord cerebral ataxia type 1 (SCA 1) is an autosomal dominant genetic disorder that is genetically linked to the short arm of chromosome 6 based on binding to the human major histocompatibility complex (H. Yakura et al . (1974) N. Engl. J. Med., 291, 154-155; and J.F. Jackson et al. (1997) N. Engl. J. Med 296, 1138-1141]. SCA1 appears to be tightly bound to the short arm marker D6S89 on chromosome 6 to HLA (L. P. W. Ranum et al., Am. J. Hum. Genet., 49, 31-41 (1991); and H. Y. Zoghbi et al., Am. J. Hum. Genet., 49, 23-30 (1991)]. The ones described herein are particularly useful in developing treatments for infantile onset spinocerebellar ataxia (IOSCA).

The term " cardiovascular disease " as used herein includes diseases affecting the cardiovascular system, e. G., The heart. Examples of cardiovascular diseases include, but are not limited to, atherosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, acute ventricular pacing, coronary microemboli, cardiac hypertrophy, bradycardia, pressure overload, Atrial fibrillation, atrial fibrillation, atrial fibrillation, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary aortic aneurysm, myocardial infarction, myocardial infarction, Disease, coronary aortic spasm, or arrhythmia. In a preferred embodiment, the cardiovascular disease is associated with an abnormal I ₁₀ current.

As defined herein, some components of the PCIP family may also have common structural features, such as a common structural domain or motif, or a sufficient amino acid or nucleotide sequence-like body. These PCIP family members can be natural or non-natural and can contain the same or different species. For example, the PCIP family may contain a first protein of human origin and others, or alternatively, another protein of human origin may contain a homolog of non-human origin.

For example, members of the PCIP family with common structural features may include one or more " calcium binding domains ". As used herein, the term " calcium binding domain " includes amino acid domains involved in calcium binding, such as the EF hand (Baimbridge KG et al. (1992) TINS 15 (8): 303-308). Preferably, the calcium binding domain has a sequence substantially identical to the consensus sequence:

EO ‥ OO ‥ O D KDGD G · O ... E F O O (SEQ ID NO: 41)

O is I, L, V, or M, and " · " represents a position that has no strongly preferred residues. Each residue recorded is present in excess of 25% of the sequence and the underlined residues are present in excess of 80% of the sequence. Amino acid residues 126-154 and 174-202 of human lv protein, amino acid residues 126-154 and 174-202 of rat lv protein, amino acid residues 137-165 and 185-213 of rat 1vl protein, amino acid residues 142-142 of rat 1vn protein, 170, amino acid residues 126-154 and 174-202 of mouse 1v protein, amino acid residues 137-165 and 185-213 of mouse 1vl protein, amino acid residues 144-172, 180-208 and 228-256 of human 9ql protein, human 9qm The amino acid residues 126-154, 162-190 and 210-238 of the protein, the amino acid residues 94-122, 130-158 and 178-206 of the human 9qs protein, the amino acid residues 126-154, 162-190 and 210- 238, amino acid residues 131-159, 167-195 and 215-243 of the rat 9ql protein, amino acid residues 126-154, 162-190 and 210-238 of the rat 9qc protein, amino acid residues 99-127 of the rat 8t protein, 163 and 183-211, the amino acid residues 144-172, 180-208 and 228-256 of the mouse 9ql protein, the monkey 9qs protein Amino acid residues 94-122, 130-158 and 178-206, amino acid residues 94-122, 130-158 and 178-206 of human p19 protein, amino acid residues 19-47 and 67-95 of rat p19 protein, Amino acid residues 130-158, 166-194 and 214-242 include the calcium binding domain (EF Hand) (see FIG. 1). Amino acid residues 116-127 and 152-163 of the monkey KChIP4a and KChIP4b proteins comprise the calcium binding domain.

In another embodiment, the isolated PCIP protein of the invention comprises an amino acid sequence of about 100-200 amino acid residues long, preferably 150-200 amino acid sequence length, more preferably 185 amino acid residue sequence length, and three Lt; RTI ID = 0.0 > EF < / RTI > The PCIP protein of the present invention can be used in combination with at least about 70%, 71%, 74%, 75%, 76%, 80% or more identical carboxyl terminal domains to the carboxyl terminal 185 amino acid residues of rat 1v, rat 9q or mouse p19 (See Figs. 21, 25 and 41).

The members of the PCIP family with common structural features are also described in Table I and described below. The present invention provides full length human, murine rat 1v cDNA clones, 1v splicing variant 1vl full length mouse and rat cDNA clones, partial rat cDNA clones of 1v splicing variant 1vn, and proteins encoded by these cDNAs . The present invention further provides full-length human and mouse and partial rat 9ql cDNA clones, full-length human and rat cDNA clones of 9ql splicing variant 9qm, full-length human and monkey cDNA clones of 9ql splicing variant 9qs, 9ql splicing variant 9qc Full-length rat cDNA clones, 9ql splicing variants 8t partial rat cDNA clones, and proteins encoded by these cDNAs. The present invention also provides full-length mouse and human and partial rat p19 cDNA clones and proteins encoded by these cDNAs. A full-length human cDNA clone of p19 is provided, and a partial clone p193 represents the 3 ' end of human p19 cDNA. Additionally, the invention provides a partial human W28559 cDNA clone, in which the protein is encoded. The present invention further provides a full-length monkey clone, KChIP4a and the corresponding full-length splicing variant KChIP4b, wherein the protein is encoded by these cDNAs.

Other components of the PCIP family that do not have common structural features, such as the members of the PCIP family, are described in Table II and described below. The present invention provides full length human and partial length rat 33b07 clones, in which proteins are encoded by these cDNAs. The present invention further provides a partial length rat 1p clone in which the protein is encoded. In addition, the present invention provides a partial length rat 7s clone in which the protein is encoded.

The present invention further provides PCIP family members representing previously identified cDNAs (29x, 25r, 5p, 7q and 19r). These previously identified cDNAs are identified as members of the PCIP family member, i. E., Molecules having PCIP activity, as described herein. Thus, the present invention provides methods of using these previously identified cDNAs, such as screening assays, diagnostic assays, methods of using these cDNAs in prognostic assays, and methods of treatment described herein.

The PCIP molecule of the present invention is based on its ability to interact with the amino terminal 180 amino acids of the rat Kv4.3 subunit, as determined using the yeast two-hybrid assay (described in detail in Example 1) It is confirmed early. Additional binding studies using other potassium subunits were performed to demonstrate the specificity of PCIP for Kv4.3 and Kv4.2. The in situ localization, immunohistochemistry methods, co-immunoprecipitation and patch clamping methods are then used to interact with and control the activity of the PCIP of the present invention, including potassium channels, particularly 4.3 or 4.2 subunits .

Several new human, mouse, monkey and rat PCIP family members were identified here as 1v, 9q, p19, W28559, KChIP4, 33b07, 1p and rat 7s proteins and nucleic acid molecules. The human, rat and mouse cDNA encoding the 1v polypeptide is represented by SEQ ID NOs: 1, 3 and 5, and is shown in Figures 1,2 and 3, respectively. In the brain, 1v mRNA is highly expressed among the neocortical and hippocampal middle neurons, among the hypothalamic nucleus and medial reins, among the forebrain and progenitor cholinergic neurons, among the upper hypersensitivity, and cerebellar granule cells. The 1v polypeptide is highly expressed in axon and axon terminals, dendrites and body weight of cells expressing 1v mRNA. Splice variants of the 1v gene are identified in rats and mice and are represented by SEQ ID NOs: 7, 9 and 11, and are shown in Figures 4, 5 and 6, respectively. The 1v polypeptide interacts with a potassium channel that contains the Kv4.3 or kv4.2 subunit and not the Kv1.1 subunit. As determined by Northern blots, the 1v transcript (mRNA) is predominantly expressed in the brain.

8t cDNA (SEQ ID NO: 29) encodes a polypeptide having a molecular weight of about 26 kD corresponding to SEQ ID NO: 30 (see Fig. 15). The 8t polypeptide reacts with a potassium channel that contains a Kv4.3 or Kv4.2 subunit, but not a Kv1.1 subunit. As evidenced by Northern blot and field data, 8t mRNA is predominantly expressed in the heart and brain. The 8t cDNA is a splicing variant of 9q.

Human, rat, monkey and mouse 9q cDNAs are also isolated. 9), human 9qm (SEQ ID NO: 19; Figure 10), rat 9qm (SEQ ID NO: 21; Figure 11), human 9qs (SEQ ID NO: 23; Figure 12), monkey 9qs (SEQ ID NO: 25; Figure 13), and rat 9qc (SEQ ID NO: 27; The genomic DNA sequence of 9q was also determined. Exon 1 and its flanking intron sequence (SEQ ID NO: 46) are shown in Figure 22A. Exons 2-11 and its flanking intron sequence (SEQ ID NO: 47) are shown in Figure 22B. The 9q polypeptide comprises a Kv4.3 or Kv4.2 subunit but reacts with a potassium channel that does not contain a Kv1.1 subunit. As evidenced by Northern blot and in situ data, the 9q protein is predominantly expressed in the heart and brain. In the brain, 9q mRNA is highly expressed in the salivary gland, hippocampal formation, neocortical pyramidal cells and internuclei, thalamus, upper jugular and cerebellum.

Human, rat and mouse P19 cDNAs are also isolated. Human < RTI ID = 0.0 > P19 < / RTI > And SEQ ID NO: 39 and FIG. 20 (3 'sequence). Rat P19 is shown in SEQ ID NO: 33 and FIG. 17, and mouse P19 is shown in SEQ ID NO: 35 and FIG. The P19 polypeptide comprises a Kv4.3 or Kv4.2 subunit, but reacts with a potassium channel that does not contain a Kv1.1 subunit. As evidenced by Northern blot and in situ data, the P19 transcript (mRNA) is predominantly expressed in the brain.

A partial human paralogue of the PCIP molecule has also been identified. Such paralogue is referred to as W28559, and is shown in SEQ ID NO: 37 and FIG.

Monkey KChIP4a and its splicing variants KChIP4b, KChIP4c and KChIP4d were also identified. Monkey KChIP4a is shown in SEQ ID NO: 48 and FIG. Monkey KChIP4b is shown in SEQ ID NO: 50 and in Fig. Monkey KChIP4c is shown in SEQ ID NO: 69 and FIG. Monkey KChIP4d is shown in SEQ ID NO: 71 and in Fig.

The nucleotide sequence of the full length rat 33b07 cDNA and the amino acid sequence of the rat 33b07 polypeptide are shown in Figure 26 and SEQ ID NOs: 52 and 53, respectively. The rat 33b07 cDNA encodes a protein having a molecular weight of about 44.7 kD and a length of 407 amino acid residues. Rat 33b07 binds rKv4.3N and rKv4.2N and is slightly superior to rKv4.2N in the yeast 2-hybrid assay.

The nucleotide sequence of the full length human 33b07 cDNA and the predicted amino acid sequence of the human 33b07 polypeptide are shown in Figure 27 and SEQ ID NOs 54 and 55, respectively.

The nucleotide sequence of the partially-length rat lp cDNA and the predicted amino acid sequence of the rat lp polypeptide are shown in Figure 28 and SEQ ID NO 56 and 57, respectively. The rat lp cDNA encodes a protein with a molecular weight of about 28.6 kD and a length of 267 amino acid residues. Rat 1p binds rKv4.3N and rKv4.2N and is slightly superior to rKv4.3N in the yeast 2-hybrid assay.

The nucleotide sequence of the partially-length rat 7s cDNA and the predicted amino acid sequence of the rat 7s polypeptide are shown in Figure 29 and SEQ ID NOs 58 and 59, respectively. The rat 7s cDNA encodes a protein with a molecular weight of about 28.6 kD and a length of 270 amino acid residues. Rat 7s binds rKv4.3N and rKv4.2N and is slightly superior to rKv4.3N in the yeast two-hybrid assay.

The sequences of the present invention are summarized in Tables I and II below.

Table I

The novel polynucleotides and polypeptides of the present invention (whole field except as indicated)

PCIP Nucleic acid molecule type Source SEQ ID NO: DNA SEQ ID NO: Protein ATCC 1v or KChIP1 1v People (225-875) ^* One 2 98994 1v The rat (210-860) 3 4 98946 1v The mouse (477-1127) 5 6 98945 1vl Rats (31-714) 7 8 98942 1vl Mouse (77-760) 9 10 98943 1vn (partial) Rats (345-955) 11 12 98944 9q or KChIP2 Genomic DNA sequences (exon 1 and flanking intron sequences) Person 46 Genomic DNA sequences (exons 2-11 and flanking intron sequences) Person 47 9ql People (207-1019) 13 14 9899398991 9ql (partial) Rat (2-775) 15 16 98948 9ql Mouse (181-993) 17 18 98937 9qm People (207-965) 19 20 9899398991 9qm Rats (214-972) 21 22 98941 9qs People (207-869) 23 24 98951 9qs Monkey (133-795) 25 26 98950 9qc Rats (208-966) 27 28 98947 8t (partial) Rats (1-678) 29 30 98939 p19 or KChIP3 p19 People (1-771) 31 32 PTA-316 p19 (partial) Rats (1-330) 33 34 98936 p19 Mouse (49-819) 35 36 98940 p193 (partial) People (2-127) 39 40 98949 W28559 W28559 (partial) People (1-339) 37 38 KChIP4 KChIP4a Monkeys (265-966) 48 49 KChIP4b C-terminal splicing variant Monkeys (265-966) 50 51 KChIP4c splicing variant Monkey (122-811) 69 70 KChIP4d splicing variant Monkeys (64-816) 71 72 * The coordinates of the coding sequence are shown in parentheses. The first column shows the identified PCIP and the second column shows the various nucleic acid types identified for each PCIP.

Table II

The polynucleotides and polypeptides of the present invention (entire field except as indicated)

PCIP Nucleic acid molecule type Source SEQ ID NO: DNA SEQ ID NO: Protein ATCC 33b07 new 33b07 People (88-1332) 52 53 PTA-316 33b07 Rats (85-1308) 54 55 1p New 1p (partial) Rats (1-804) 56 57 7s New 7s (partial) Rats (1-813) 58 59 29x 29x Rats (433-1071) 60 61 Splice variant of 25r29x Rats (130-768) 62 5p 5p Rats (52-339) 63 64 7q 7q Rats (1-639) 65 66 19r 19r Rats (1-816) 67 68 * The coordinates of the coding sequence are shown in parentheses. The first column represents the four families of identified PCIPs, and Column 2 represents the various nucleic acid types identified for each family. In addition, novel molecules are presented.

Plasmids containing nucleotide sequences encoding human, rat and monkey PCIP were deposited on November 17, 1998 in the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209 And was designated as the accession number described above. These deposits will be maintained under the Budapest Treaty, an international treaty on microbial deposit for patent process purposes. These deposits are merely intended to be convenient for those of skill in the art, and have been deposited at 35 U.S.C. It is not a required license under §112.

A clone containing a cDNA molecule encoding human p19 (clone EphP19) and human 33b07 (clone Eph33b07) was deposited on July 8, 1998 as Accession Number PTA-316 in the American Type Culture Collection (Manassa, VA) , A recombinant plasmid containing each particular cDNA clone as part of a complex deposit representing a mixture of the two strains (the ATCC strain designation for a mixture of hP19 and h33b07 is EphP19h33b07mix).

To isolate and isolate a strain containing a specific cDNA clone, a portion of the mixture was streaked to form a single colony on an LB plate supplemented with 100 ug / ml ampicillin to grow a single colony, minipreparation). Next, a sample of DNA mini-preparation can be enzymatically digested with NotI, and the resulting product is resolved on 0.8% agarose gel using standard DNA electrophoresis conditions. Enzyme degradation provides the following band patterns: EphP19: 7 kb 9 (single band), Eph33b07: 5.8 kb (single band).

Various aspects of the invention are described in detail in the following paragraphs:

I. Isolated nucleic acid molecules

One aspect of the invention is a nucleic acid fragment and a nucleic acid fragment sufficient to be used as a hybridization probe to identify a PCIP protein or a biologically active portion thereof, a PCIP encoding nucleic acid molecule (e. G., PCIP mRNA) To an isolated nucleic acid molecule encoding a fragment for use as a PCR primer for amplification. The term " nucleic acid molecule " as used herein includes DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of DNA or RNA produced using nucleotide analogs. The nucleic acid molecule may be single or double stranded, preferably double stranded DNA.

An " isolated " nucleic acid molecule is isolated from other nucleic acid molecules present in the natural source of the nucleic acid. Preferably, the " isolated " nucleic acid does not contain sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived (i. E., Sequences located at the 5 ' and 3 ' ends of the nucleic acid). For example, in various embodiments, the isolated PCIP nucleic acid molecule is selected from the group consisting of nucleotides of about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb May contain less than 0.1 kb. In addition, " isolated " nucleic acid molecules, e. G., CDNA molecules, may be substantially free of the culture medium or other cellular material when produced by recombinant techniques, or may contain chemical precursors or other chemicals when chemically synthesized I can not.

The nucleic acid molecules of the invention, such as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: : 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: , The nucleotide sequence of SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 Nucleic acid molecules having a nucleotide sequence of a DNA insertion sequence of a plasmid deposited with the ATCC as part of ATCC No. 98994 or a part thereof can be separated using standard molecular biology techniques and the sequence information provided herein. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: Nucleotide sequences of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 , 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, The PCIP nucleic acid molecule as a hybridization probe can be isolated using standard hybridization and cloning techniques using part or all of the nucleic acid molecule having the nucleotide sequence of the DNA insertion sequence of the plasmid deposited on the host (E. G., Sambrook, J., Fritsh E. F., and Maniatis, T. Molecular Cloning:...... A Laboratory Manual 2nd, ed, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press Cold Spring Harbor NY 1989).

SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: , SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: Nucleotide sequences of ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 A nucleic acid molecule comprising a portion or all of the nucleotide sequence of the DNA insertion sequence of the deposited plasmid is a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, or SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 71, nucleotide sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946 , 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, which are designed based on the nucleotide sequence of the DNA insert sequence of the plasmid deposited with the ATCC Can be isolated by polymerase chain reaction (PCR) using synthetic oligonucleotide primers.

The nucleic acid of the present invention can be amplified using cDNA, mRNA as a template or alternatively genomic DNA and a suitable oligonucleotide primer according to standard PCR amplification techniques. The amplified nucleic acid can then be cloned into a suitable vector and characterized by DNA sequencing. Oligonucleotides corresponding to PCIP nucleic acid sequences can also be prepared by standard synthetic techniques using, for example, automated DNA synthesizers.

In a preferred embodiment, the isolated nucleic acid molecule of the present invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: : 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: , The nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 as nucleotide sequences of the DNA insertion sequences of the plasmids deposited with the ATCC or parts of any of these sequences.

5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 29, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951 98991, 98993 or 98994, or a complementary sequence of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with the ATCC, or a part of any of these sequences. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: Nucleotide sequences of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 , 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 7, SEQ ID NO: : Nucleotide sequence of 9 or accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: , SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: : SEQ ID NO: 48, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316 to a nucleotide sequence of a DNA insertion sequence of a plasmid deposited with the ATCC to form a stable duplex.

In another preferred embodiment, the isolated nucleic acid molecule of the invention comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: , SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: The nucleotide sequence of the nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 55%, 60% or more of the full length of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with the ATCC as the nucleotide sequence of SEQ ID NO: 98951, 98991, 98993 or 98994, or a part of any of these nucleotide sequences, , 65%, 70 %, 75%, 80%, 85%, 90%, 95% or more identical nucleotide sequences.

Also, a nucleic acid molecule of the present invention may comprise one or more nucleotides selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 31, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, A fragment that can be used as a fragment, a primer or a probe that encodes only a part of the nucleotide sequence of the DNA insert sequence of the plasmid deposited with the ATCC as 98993 or 98994, such as a biologically active portion of the PCIP protein It can be included. The nucleotide sequence determined from the cloning of the PICP gene enables generation of probes and primers designed for use in identifying and / or cloning other PCIP family members as well as PCIP analogs from other species.

The probe / primer typically comprises substantially purified oligonucleotides. Oligonucleotides are typically selected under stringent conditions as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 31, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 7 or SEQ ID NO: 98993 or the DNA sequence of the DNA insert of the plasmid deposited at ATCC, : 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: Nucleotide sequences of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 , 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 2, SEQ ID NO: , SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, , Nucleotide sequences of SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession No. 98936 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, About 12 or 15 or more of natural allelic variants or mutants of the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with the ATCC as the nucleic acid sequences of the nucleotide sequence of SEQ ID NOs: 98949, 98950, 98951, 98991, 98993 or 98994 , Preferably about 20 to 25, more preferably about 30, 35, 40, 45, 50, 55, 60, 65 or 75 consecutive nucleotides. In an exemplary embodiment, the nucleic acid molecule of the present invention is selected from the group consisting of 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800- SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 5, or SEQ ID NO: 5 under stringent hybridization conditions, including nucleotide sequences of SEQ ID NO: 850, 850-900, 949, 950-1000 or longer nucleotides. : 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: , SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: A nucleotide sequence of SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: No. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 It is hybridized to a nucleic acid molecule of the nucleotide sequence of the inserted DNA sequence of the plasmid deposited with ATCC 98 994 as the call.

Probes based on the PCIP nucleotide sequence can be used to detect transcripts or genomic sequences encoding the same or a homologous protein. In a preferred embodiment, the probe further comprises an attached label group, for example the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme carrier. Such probes can be used to detect whether a PCIP gene can be mutated or deleted, or to measure the level of a PCIP encoding nucleic acid in a cell sample from an individual to detect a cell or tissue that misexpresses the PCIP protein, such as detecting a PCIP mRNA level Can be used as part of a diagnostic test kit for identification.

A nucleic acid fragment encoding a " biologically active portion of a PCIP protein " is a nucleic acid fragment that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 29, SEQ ID NO: 29, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: The nucleotide sequence of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994, which can be prepared by isolating a portion of the nucleotide sequence of the DNA insert sequence of the plasmid deposited with the ATCC, expressing the encoded portion of the PCIP protein While by the expression) measuring the activity of the encoded portion of the PCIP protein PICP biological activity of the biological activity (PCIP protein encoding a polypeptide with are described herein).

The present invention provides a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: , SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: : Nucleotide sequences of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 7, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 1, SEQ ID NO: 9, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: : 69 or the nucleotide sequence of SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 nucleotides of the DNA insertion sequence of the plasmid deposited with the ATCC Encoding the same PCIP protein encoded by the sequence. In another embodiment, the isolated nucleic acid molecule of the invention comprises a nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: : 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: , A nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72.

SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: Nucleotide sequences of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, Nos. 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 deposited at ATCC It will be appreciated by those skilled in the art that, in addition to the nucleotide sequence of the DNA insertion sequence of the plasmid in question, a DNA sequence polymorphism that results in a change in the amino acid sequence of the PCIP protein can be present in the population. Within the PCIP gene, these genetic polymorphisms can exist individually within a population due to natural similar variations. As used herein, the terms " gene " and " recombinant gene " include an open reading frame that encodes a PCIP protein, preferably a mammalian PCIP protein and may additionally comprise a noncoding regulatory sequence and an intron ≪ / RTI >

Allelic variants of human PCIP include both functional and non-functional PCIP proteins. A functional allelic variant is a naturally occurring amino acid sequence variant of a human PCIP protein having the ability to bind a PCIP ligand and / or to modulate any of the PCIP activities described herein. The functional allelic variant typically comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: : 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, , Conservative substitutions of one or more amino acids of SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72, substitution, deletion or insertion of non-critical residues in non- .

A non-functional allelic variant is a naturally occurring amino acid sequence variant of a human PCIP protein that binds to and / or is incapable of modulating any of the PCIP activities described herein. The non-functional allelic variant comprises a nucleotide sequence that is at least 70% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: Deletion or insertion or premature cleavage of an amino acid sequence of SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72, or substitution, insertion or deletion in a critical residue or critical region, Lt; / RTI >

The present invention further provides non-human orthologues of the human PCIP protein. Orthollog of the human PCIP protein is a protein isolated from non-human organisms and has the same control of the potassium channel mediated activity of the human PCIP protein and / or the same PCIP ligand binding. The orthologs of the human PCIP protein are SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72.

SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 31, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940 , 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, Nucleic acid molecules having a nucleotide sequence of a DNA insertion sequence of a plasmid deposited at ATCC No. 98993 or 98994 are intended to be within the scope of the present invention. For example, other PCIP cDNAs can be identified based on the nucleotide sequence of human PCIP. Further, it is contemplated that a polypeptide comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: The nucleotide sequence of SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991 Nucleic acid molecules having a nucleotide sequence that is different from the nucleotide sequence of the DNA insertion sequence of a plasmid deposited with the ATCC, Nos. 98993 or 98994 are also contemplated within the scope of the present invention. For example, the mouse PCIP cDNA can be identified based on the nucleotide sequence of human PCIP.

Naturally occurring allelic variants and nucleic acid molecules corresponding to analogs of the PCIP cDNAs of the present invention can be prepared using the cDNAs disclosed herein or a portion thereof as hybridization probes according to standard hybridization techniques under stringent hybridization conditions, And < / RTI >

Thus, in another embodiment, the isolated nucleic acid molecule of the present invention is a nucleotide 15 or more, 20, 25, 30 or more in length, and is a nucleotide having a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: SEQ ID NO: 7, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: The nucleotide sequence of SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: , Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947 Nucleic acid molecules comprising a nucleotide sequence of a DNA insertion sequence of a plasmid deposited with the ATCC, under the stringent conditions described in U.S. Patent Nos. 98948, 98949, 98950, 98951, 98991, 98993 or 98994, And hybridized. In other embodiments, the nucleic acid is at least 30, 50, 100, 150, 200, 250, 300, 307, 350, 400, 450, 500, 550, 600, 650, 700, 800, 850, 900, 949, or 950 nucleotides. As used herein, the term " hybridization under stringent conditions " is intended to describe conditions for hybridization and rinsing under conditions in which at least 60% identical nucleotide sequences to each other are typically hybridized. Preferably, due to this condition, sequences that are each about 70% or more, more preferably about 80% or more, and most preferably about 85% or more or 90% identical to each other are typically hybridized to each other. Such stringent conditions are known to those skilled in the art and are described in Current Protocols in Molecular Biology, John Wiley & Sons. N. Y. (1989), 6.3.1-6.3.6]. A preferred, non-limiting example of stringent hybridization conditions is hybridization at 6Ox sodium chloride / sodium citrate (SSC) at about 45 ° C followed by hybridization at 50 ° C, preferably 55 ° C, more preferably 60 ° C or 65 ° C In 0.2x SSC, 0.1% SDS. Preferably, the isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO: 1 corresponds to a naturally occurring nucleic acid molecule. As described herein, a "naturally occurring" nucleic acid molecule refers to an RNA or DNA molecule having a naturally occurring nucleotide sequence (encoding a native protein).

In addition to natural allelic variants of the PCIP sequence that may be present in a population, those skilled in the art will further appreciate that SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: A nucleotide sequence of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950 , 98951, 98991, 98993 or 98994, the nucleotide sequence of the DNA insert sequence of a plasmid deposited with the ATCC, Will alter the amino acid sequence of the encoded PCIP protein without altering the functional ability of the protein. For example, a nucleotide substitution resulting in an amino acid substitution in an "unnecessary" amino acid residue can be made by the nucleotide substitutions shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: : 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: , The nucleotide sequence of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98949 Nucleic Acid Sequence of the DNA Insert Sequence of Plasmids deposited at ATCC, Nos. 98951, 98991, 98993 or 98994. (E. G., SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: : 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: , SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72) , &Quot; essential " amino acid residues are essential for biological activity. For example, the amino acid residues retained between the PCIP proteins of the invention are predicted to be particularly modified and modified. Furthermore, additional amino acid residues conserved between the PCIP protein of the present invention and other members of the PCIP family protein will not be modified and modified.

Thus, another aspect of the invention relates to a nucleic acid molecule containing a PCIP protein that contains a change in an amino acid residue that is not essential for activity. Such a PCIP protein may also comprise at least one amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 32, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: , SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 and still retains biological activity. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: , SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 55, 60, or 60% identity to SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: %, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the amino acid sequence.

SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 22, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: An isolated nucleic acid encoding a PCIP protein similar to the protein of SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: SEQ ID NO: 7, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: The nucleotide sequence of SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: , Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 9894 2, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 One or more amino acid substitutions, additions or deletions are introduced into the encoded protein, as it can be produced by substitution, addition or deletion of one or more nucleotides into the nucleotide sequence of the DNA insertion sequence of the plasmid deposited with the ATCC. SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: Nucleotide sequences of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 , 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 ATCC Mutations can be introduced by standard techniques such as inducing specific site abrupt displacement with the nucleotide sequence of the DNA insertion sequence of the deposited plasmid and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made in one or more predicted nonessential amino acid residues. A " conservative amino acid substitution " is a substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are defined in the art. Such families include, but are not limited to, basic side chains such as lysine, arginine, histidine, acidic side chains such as aspartic acid, glutamic acid, uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, (Such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . Thus, the nonessential amino acid residues predicted in the PCIP protein are preferably substituted with other amino acid residues from the same side chain family. Also, in other embodiments, mutations may be introduced randomly along some or all of the PCIP coding sequence by inducing saturation mutations, and the resulting mutants may be screened for PCIP biological activity to identify mutations that retain activity . SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: Nucleotide sequences of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 , 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 or 98994 ATCC Following the mutagenesis of the nucleotide sequence of the DNA insertion sequence of the deposited plasmid, the encoded protein can be recombinantly expressed and the activity of the protein can be measured.

In a preferred embodiment, the mutant PCIP protein interacts (e.g., binds) with (1) the potassium channel protein or a portion thereof, (2) regulates the phosphorylation state of the potassium channel protein or a portion thereof, and (3) For example, act as a calcium dependent kinase, for example phosphorylating the potassium channel in a calcium dependent manner, (4) being involved in calcium binding, for example acting as a calcium dependent transcription factor, (5) (6) modulate the release of neurotransmitters, (7) regulate membrane excitability, (8) regulate the membrane potential of the membrane, (9) regulate the frequency of the waveform and action potential, and (10) regulate the threshold of excitement.

In addition to nucleic acid molecules encoding the PCIP proteins described above, another aspect of the invention relates to isolated nucleic acid molecules that are antisense. Antisense " nucleic acid molecule includes a complementary sequence to a " sense " nucleic acid encoding a protein, such as a complementary sequence to a coding strand of a double-stranded cDNA molecule or a complementary sequence to an mRNA sequence. The antisense nucleic acid molecule may be a complementary sequence to a complete PCIP coding strand, or only a portion thereof. In one embodiment, the antisense nucleic acid molecule encodes a coding strand of a nucleotide sequence encoding a PCIP The term " coding region " refers to the region of the nucleotide sequence that comprises the codon translated into an amino acid residue. In another embodiment, the antisense nucleic acid molecule encodes a nucleotide sequence encoding a PCIP Quot; non-coding region " of the coding strand. The term " non-coding region " And are referred to as 5 and 3 'sequences on the side of the coding region (referred to as 5' and 3 'untranslated regions).

When the coding sequence is a coding strand encoding the PCIP disclosed herein, the antisense nucleic acid of the present invention can be designed according to the Watson and Crick base pair rule. The antisense nucleic acid molecule may be a complementary sequence to the complete coding region of the PCIP mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or noncoding region of the PCIP mRNA. For example, the antisense oligonucleotide may be a complementary sequence to a region comprising the translation initiation site of the PCIP mRNA. Antisense oligonucleotides can be about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. The antisense nucleic acid of the present invention can be produced using chemical synthesis and enzyme linkage reaction using procedures known in the art. For example, antisense nucleic acids (such as antisense oligonucleotides) use naturally occurring nucleotides or various modified nucleotides designed to increase the biological stability of the molecule or to improve the physical stability of the duplex formed between the antisense and sense nucleic acids For example, a phosphorothioate derivative and an acridine-substituted nucleotide can be used. Examples of modified nucleotides that can be used to generate antisense nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, (Carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D- galactosylquinosine, inosine, N6-isopentenyl adenine Methylguanidine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methyl Aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylquinoxine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyl Adenine, uracil-5-oxyacetic acid (v), ibutoxosine, water uracil, quiosine, 2- thiocytosine, 5-methyl- 5-oxyacetic acid, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-thiouracil, -Amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine. In addition, the antisense nucleic acid can be prepared by biologically using an expression vector in which the nucleic acid is subcloned in an antisense orientation (i. E., The RNA transcribed from the inserted nucleic acid will be antisense oriented towards the important target nucleic acid as further described in the following paragraphs ).

The antisense nucleic acid molecules of the present invention are typically generated in situ or are typically administered to individuals, which hybridize or bind to the genomic DNA and / or cellular mRNA encoding the PCIP protein and inhibit transcription and / Lt; / RTI > Hybridization forms a stable duplex in the case of antisense nucleic acid molecules that bind to the DNA duplex through specific interactions in the main groove of the double helix by normal nucleotide complementarity. Examples of routes of administration of the antisense nucleic acid molecules of the invention include direct injection at the tissue site. In addition, the antisense nucleic acid molecule can be modified and administered systemically to target selected cells. For example, in systemic administration, antisense molecules can be modified to bind antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens so that they bind to receptors or antigens expressed on specifically selected cell surfaces. In addition, antisense nucleic acid molecules can be delivered to cells using the vectors disclosed herein. To achieve a sufficient intracellular concentration of the antisense molecule, a vector construct in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter is preferred.

In yet another embodiment, the antisense nucleic acid molecule of the present invention is an alpha -anomer nucleic acid molecule is an alpha -anomer nucleic acid molecule. α-anomeric nucleic acid molecules form hybrids of specific double strands with complementary RNAs in which the strands are parallel to each other, as opposed to the usual β-units (Gaultier et al. (1987) Nucleic Acids Res. 15: 6625- 6641). In addition, the antisense nucleic acid molecule can also be used as a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215 (1987) Nucleic Acids Res. 15: 6131-6148) : 327-330).

In another embodiment, the antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity that can cleave single-stranded nucleic acids such as mRNAs with complementary domains. Thus, ribozymes (e.g., as described in Haselhoff and Gerlach (1988) Nature 334: 585-591)) can be used to catalyze the PCIP mRNA transcripts to inhibit the translation of PCIP mRNA have. A ribozyme having specificity for a PCIP encoding nucleic acid can be prepared from the PCIP cDNA disclosed herein (i.e., SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: : 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: , The nucleotide sequence of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98949 Nucleic acid sequence of the DNA insertion sequence of a plasmid deposited with the Korean Society of Biotechnology, 98951, 98991, 98993 or 98994, ATCC). For example, derivatives of Tetrahymena L-19 IVS RNA can be made complementary to nucleotide sequences in which the nucleotides of the active site have been cleaved in PCIP-encoding mRNA. See Cech et al. U.S. Patent No. 4,987,071; And Cech et al. U. S. Patent No. 5,116, 742). In addition, PCIP mRNA can be used to select catalytic RNA having specific ribonuclease activity from the pool of RNA molecules. Barter. D. and Szostak, J.W. (1993) Science 261: 1411-1481.

In addition, PCIP gene expression can be inhibited by targeting a complementary nucleotide sequence to the regulatory region of PCIP, forming a triple helix structure that prevents transcription of the PCIP gene in the target cell. Helene, C. (1991) Anticancer Drug Des. 6 (6): 569-84; Helene, C. et al. (1992) Ann. N.Y. Acad. Sci. 660-27-36; and Maher, L.J. (1992) Bioassays 14 (2): 807-15).

In another embodiment, the PCIP nucleic acid molecules of the present invention may be modified at the base moiety, sugar moiety, phosphate backbone, for example, to improve stability, hybridization or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecule can be modified to generate peptide nucleic acids (see Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4 (1): 5-23). As used herein, the term " peptide nucleic acid " or " PNA " backbone refers to nucleic acid mimics such as DNA mimics, wherein the deoxyribose phosphate skeleton is substituted by a pseudopeptide backbone and only four natural nucleobases maintain. The central backbone of the PNA appears to allow specific hybridization with DNA and RNA under conditions of low ionic strength. PNA oligomers are described in Hyrup B. et al. (1996) supra; Perry-O'Keefe et al. Proc. Natl. Acad. Sci. 93: 14670-675. ≪ / RTI >

PNAs of PCIP nucleic acid molecules can be used in therapeutic and diagnostic applications. For example, PNA can be used as an antisense or anti-gene agent for sequence-specific regulation of gene expression, for example, by inducing transcription or translation arrest or by inhibiting replication. The PNA of the PCIP nucleic acid molecule can also be used to analyze single base pair mutations in one gene (e.g., by PNA-induced PCR clamping), other enzymes (e.g., S1 nuclease [Hyrup B. Quot;) ") as an " artificial restriction enzyme " Or as probes or primers for DNA sequencing or hybridization (reference: Hyrup B. et al . (1996) supra; Perry-O'Keefe quoted above] can be used.

In yet another embodiment, the PNA of PCIP can be modified (e.g., by attaching a lipophilic or other helper group to the PNA, forming a PNA-DNA chimera, or using liposomes or other drug delivery techniques known in the art For example, their stability or increased cell uptake). For example, a PNA-DNA chimera of the PCIP nucleic acid molecule can be generated that can combine the advantageous properties of PNA and DNA. Such chimeras will allow DNA recognition enzymes (e.g. RNAse H and DNA polymerase) to react with the DNA moiety, while the PNA moiety will provide high binding affinity and specificity. The PNA-DNA chimeras can be combined using linkers of appropriate lengths selected by base stacking, number of bonds between the Nuclease bases, and orientation (Hyrup B. (1996) supra). The synthesis of PNA-DNA chimeras is described in Hyrup B. (1996) supra and Finn PJ et al . (1996) Nucleic Acids Res . (24) (17): 3357-63. For example, the DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and can be prepared by reacting a modified nucleoside analog, e. G., 5 '-( 4-methoxytrityl) amino -5'-deoxy-thymidine phosphoramidite can be used between the PNA and the 5 'end of DNA (see Mag, M. et al . (1989) Nucleic Acid Res . 17: 5973-88. Next, the PNA monomer is coupled stepwise with the 5'PNA fragment and the 3'DNA fragment to generate the molecule. (Reference: Finn PJ et al . (1996) quoted above]. Alternatively, chimeric molecules can be synthesized with 5 ' DNA fragments and 3 ' PNA fragments [Peterser, KH et al . (1975) Bioorganic Med. Chem. Lett . 5: 1119-11124].

In other embodiments, oligonucleotides can be conjugated to other subgroups, such as peptides (e. G., To target in vivo host cell receptors), or agents that facilitate transport across cell membranes (see e.g., Letsinger et al . (1989) Proc. Natl. Acad. Sci. US . 86: 6553-6556; Lemaitre et al . (1987) Proc. Natl. Acad. Sci. USA 84: 648-652; PCT Publication WO88 / 09810] or blood-brain barrier [Reference: PCT Publication No. WO89 / 10134]. Oligonucleotides can also be prepared by dividing the hybridization-initiated fragment (Krol et al . (1988) Bio-Techniques 6: 958-976] or intercalating agents [Reference: Zon (1988) Pharm. Res . 5: 539-549. For this purpose, oligonucleotides can be conjugated to another molecule (e.g., a peptide, a hybridization initiator, a transfer agent, or a hybridization initiated cleavage agent).

II. The isolated PCIP protein and anti-PCIP antibody

One aspect of the invention is directed to polypeptide fragments suitable for use as isolated PCIP proteins and biologically active portions thereof and as immunogens for culturing anti-PCIP antibodies. In one embodiment, the native PCIP protein can be isolated from the cell or tissue source by a suitable purification method using standard protein purification techniques. In another embodiment, the PCIP protein is produced by recombinant DNA technology. As an alternative to recombinant expression, PCIP proteins or polypeptides can be chemically synthesized using standard peptide synthesis techniques.

&Quot; Isolated " or " purified " protein, or a biologically active portion thereof, does not substantially contain cytoplasmic or other contaminating proteins from the cell or tissue from which the PCIP protein is derived or is chemically synthesized, It does not contain any chemicals. As used herein, the expressions " substantially free of cytoplasmic material " of the above-mentioned proteins, or biologically active portions thereof, include preparations of the PCIP protein in which the protein is isolated from the cytoplasmic component of the cell isolated or recombinantly produced. In one embodiment, the expressions "substantially free of cytoplasmic material" of the above-mentioned proteins or biologically active portions thereof are less than about 30% (based on dry weight) of non-PCIP proteins (also referred to as "contaminating proteins" More preferably less than about 20% non-PCIP protein, even more preferably less than about 10% non-PCIP protein, most preferably less than about 5% non-PCIP protein ≪ / RTI > It is also preferred that when the PCIP protein or a biologically active portion thereof is recombinantly produced, it is substantially free of the culture medium, i.e. the culture medium contains less than about 20%, more preferably less than about 10% And most preferably less than about 5%.

The phrase " substantially free of chemical precursors or other chemicals " refers to the above-mentioned proteins or biologically active portions thereof, including the manufacture of PCIP proteins in which proteins are separated from chemical precursors or other chemicals involved in the synthesis of the protein do. In one embodiment, the expression " substantially free of chemical precursors or other chemicals " of the aforementioned proteins or biologically active portions thereof is less than about 30% (based on dry weight) of chemical precursors or non- More preferably less than about 20% chemical precursors or non-PCIP chemicals, even more preferably less than about 10% chemical precursors or non-PCIP chemicals, most preferably less than about 5% chemical Precursors or preparations of PCIP proteins with non-PCIP chemicals.

As used herein, the term " biologically active portion " of a PCIP protein comprises a fragment of a PCIP protein that participates in the interaction between a PCIP molecule and a non-PCIP molecule. The biologically active portion of the PCIP protein comprises a peptide comprising an amino acid sequence substantially identical to or derived from the amino acid sequence of the PCIP protein and comprising a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: : 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, , SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, The amino acid sequence comprises fewer amino acids than the full length PCIP protein and represents at least one active portion of the PCIP protein. Typically, the biologically active portion comprises a domain or motif with one or more sites of the active site of the PCIP protein, e. G., A site associated with a potassium channel subunit. The biologically active portion of the PCIP protein may be, for example, a polypeptide having an amino acid length of 10, 25, 50, 100, 200 or more. The biologically active portion of the PCIP protein can be used as a target to develop agents that modulate potassium channel mediated activity.

In one embodiment, the biologically active portion of the PCIP protein comprises at least one calcium binding domain.

It is to be understood that the preferred biologically active portion of the PCIP protein of the present invention may contain at least one of the identified structural domains. A more preferred biologically active portion of the PCIP protein may contain at least two of the identified structural domains. Moreover, other biologically active moieties in which other regions of the protein are deleted can be produced by recombinant techniques and can be evaluated for one or more functional activities of the native PCIP protein.

In a preferred embodiment, the PCIP protein comprises the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72. In another embodiment, the PCIP protein comprises a sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 70, or SEQ ID NO: ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: : 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, , SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 Lt; RTI ID = 0.0 > I, < / RTI > As described, is different from the amino acid sequence due to natural allelic mutation or mutagenesis. Thus, in another embodiment, the PCIP protein comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: : 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, , SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: At least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% identity with SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: %, 95% or more of the amino acid sequence of SEQ ID NO.

The isolated protein, preferably 1v, 9q, p19, W28559, KChIP4a, KChIP4b, 33b07, 1p or 7s protein of the present invention has the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: , SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: The amino acid sequence of SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: A polypeptide having a sufficiently identical amino acid sequence or having an amino acid sequence that is substantially identical to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 31, SEQ ID NO: 31, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71. The term " substantially identical " amino acid sequence or nucleotide sequence as used herein refers to a nucleotide sequence that is sufficient or sufficient for a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences share a common structural domain or motif and / Refers to a first amino acid or nucleotide sequence that contains at least the same or equivalent amino acid residues or nucleotides (e. G., Amino acid residues having similar side chains). For example, an amino acid or nucleotide sequence that shares a common structural domain may have at least 30%, 40%, or 50% sequence identity, preferably 60% sequence identity, more preferably 70% 80% sequence identity, even more preferably 90-95% sequence identity, and contain one or more, preferably two or more, structural domains or motifs, which are defined herein as sufficiently equivalent. Furthermore, amino acid or nucleotide sequences that share at least 30%, 40% or 50%, preferably 60%, more preferably 70-80% or 90-95% sequence identity share a common functional activity, Herein, it is defined as sufficiently the same.

A preferred protein is a PCIP protein having at least one calcium binding domain and preferably PCIP activity. Other preferred proteins have one or more calcium binding domains and are preferably selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: Lt; / RTI > is a PCIP protein encoded by a nucleic acid sequence having a nucleotide sequence that hybridizes to a nucleic acid sequence comprising a nucleotide sequence of SEQ ID NO:

To determine the% identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., one or both of the first and second amino acids or nucleic acid sequences for optimal alignment Gaps can be introduced in the sequence and non-synonymous sequences can be ignored for comparison purposes). In a preferred embodiment, the length of the reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 30% (SEQ ID NO: 2), SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 5 with 177 amino acid residues) 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: The second sequence is aligned in the PCIP amino acid sequence of SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: , Preferably not less than 80, more preferably not less than 120, still more preferably not less than 140, even more preferably not more than 1 50, 160 or more than 170 amino acid residues are aligned). The amino acid residue or nucleotide is then compared at the corresponding amino acid position or nucleotide position. When the position of the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position of the second sequence, the molecule is the same at this position (amino acid or nucleic acid used herein " identity " Surname "). The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences.

Determination of% identity between two sequences and comparison of sequences can be accomplished using mathematical algorithms. In a preferred embodiment, the percent identity between the two amino acid sequences is determined using a Blosum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6 or 4 and 1, 2, 3, Needleman and Wunsch [ J. MoI., Supra) incorporated into the GAP program in the GCG software package (available from http://www.gcg.com) using a length weight of 6 . Biol . (48): 444-453 (1970)]. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70 or 80 and a length weight of 1, 2, 3, 4, 5 or 6 is determined using the GAP program in the GCG software package (available from http://www.gcg.com). In another embodiment, the percent identity between two amino acid or two nucleic acid sequences is calculated using the PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4, which are incorporated into the ALIGN program (version 2.0). E. Meyers et al. It is determined using the algorithm of W. Miller [CABIOS, 4: 11-17 (1989)].

The nucleic acid and protein sequences of the present invention can be further used as a " query sequence " for examining published databases and identifying, for example, other family members or related sequences. This investigation [Altschul, et al . (1990) J. Mol. Biol . 215: 403-10) using the NBLAST and XBLAST programs (version 2.0). BLAST nucleotide probes for obtaining the same nucleotide sequence as the PCIP nucleic acid molecule of the present invention can be performed with an NBLAST program (score = 100, wordlength = 12). BLAST protein detection for obtaining the same amino acid sequence as the PCIP protein molecule of the present invention can be performed with the XBLAST program (score = 50, word length = 3). In order to achieve a gap-formed alignment of the comparative application, capped BLAST is described in Altschul et al . (1997) Nucleic Acids Res. 25 (17): 3389-3402). When using BLAST and gap-formed BLAST programs, the default parameters of each program can be used (see: http://www.ncbi.nlm.nih.gov).

The present invention also provides a PCIP chimera or fusion protein. As used herein, the term PCIP " chimeric protein " or " fusion protein " includes PCIP polypeptides that are operably linked to a non-PCIP polypeptide. "PCIP polypeptide" refers to a polypeptide having an amino acid sequence corresponding to PCIP, whereas "non-PCIP polypeptide" is different from a protein that is not substantially identical to the PCIP protein, eg, a PCIP protein Refers to a polypeptide having an amino acid sequence corresponding to a protein derived from the same or a different organism. Within the PCIP fusion protein, the PCIP polypeptide may correspond to all or part of the PCIP protein. In a preferred embodiment, the PCIP fusion protein comprises at least a portion of a biologically active portion of the PCIP protein. In another preferred embodiment, the PCIP fusion protein comprises at least two of the biologically active portions of the PCIP protein. Within the fusion protein, the term " operably linked " is intended to indicate that the PCIP polypeptide and the non-PCIP polypeptide are fused in-frame to each other. A non-PCIP polypeptide is fused to the N-terminus or C-terminus of the PCIP polypeptide.

For example, in one embodiment, the fusion protein is a GST-PCIP fusion protein in which the PCIP sequence is fused to the C-terminus of the GST sequence. Such fusion proteins can facilitate the purification of recombinant PCIP.

In another embodiment, the fusion protein is a PCIP protein containing a heterologous signal sequence at its N-terminus. In certain host cells (e. G., Mammalian host cells), the expression and / or secretion of PCIP can be increased by using heterologous signal sequences.

The PCIP fusion protein of the present invention can be incorporated into a pharmaceutical composition and administered into a subject's body. The PCIP fusion protein can be used to influence the biocompatibility of the PCIP substrate. The use of a PCIP fusion protein may be useful for the treatment of a variety of disorders associated with potassium channel related diseases such as CNS disorders, such as Alzheimer's disease, dementia associated with Alzheimer's disease (e.g., Pick's disease), Parkinson's disease and other Rui spreading somatic diseases, , Amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, spinal cord cerebral ataxia, and Creutzfeldt-Jakob disease; Psychiatric disorders such as depression, schizophreniform disorders, Korsakov's mental illness, mania, anxiety disorder or panic disorder; Learning or memory impairment, for example, amnesia or age-related memory loss; And neurological disorders, e. G., Migraine. The use of a PCIP fusion protein may also be useful for the treatment of potassium channel related disorders such as cardiovascular disorders such as atherosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall opening, ventricular opening, May be useful for therapeutic purposes for the treatment of coronary microembolism, tachycardia, bradycardia, pressure overload, aortic arch, coronary artery ligation, vascular heart disease, atrial fibrilation or congestive heart failure.

Furthermore, the PCIP fusion protein of the present invention can be used as an immunogen to produce an anti-PCIP antibody to a subject, can be used to purify the PCIP ligand, and can be screened to identify molecules that inhibit the interaction of PCIP substrate and PCIP Lt; / RTI >

Preferably, the PCIP chimera or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, a DNA fragment encoding a different polypeptide sequence may be prepared according to conventional techniques, for example, at the end of a smooth end or stagger end for splicing, restriction enzyme digestion to provide suitable ends, An intragastric end filling, an alkaline phosphatase to avoid unwanted binding, and enzyme binding. In another embodiment, the fusion gene can be synthesized by conventional techniques, including automated DNA synthesizers. Alternatively, PCR amplification of the gene fragment can be performed using an anchor primer that generates complementary overhangs between two consecutive gene fragments that can subsequently be annealed and reamplified to generate a chimeric gene sequence (See, for example, Current Protocols in Molecular Biology , eds. Ausubel et al . John Wiley & Sons: 1992]. Moreover, many expression vectors pre-coding for fusion sites (e. G., GST polypeptides) are available. The PCIP encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety can be linked frame-wise to the PCIP protein.

The invention also relates to mutants of PCIP proteins that function as PCIP agonists (analogs) or PCIP antagonists. Mutants of the PCIP protein can be generated by mutagenesis of the PCIP protein, e. G., Splice point mutation or truncation. The agonist of the PCIP protein may have substantially the same or a subset of the biological activity of the native PCIP protein. Antagonists of the PCIP protein can inhibit one or more activities of the native PCIP protein by competitively controlling, for example, the potassium channel mediated activity of the PCIP protein. As such, certain biological effects can be induced by treatment with a mutant of limited function. In one embodiment, the treatment of a subject with a mutant having a subset of the biological activities of said natural form of said protein results in less side effects to the subject than treatment with native PCIP protein.

In one embodiment, a mutant of the PCIP protein that functions as a PCIP agonist (analog) or PCIP antagonist can be obtained by selecting a combination library of mutants of the PCIP protein for PCIP protein agonist or antagonist activity, e. G., Truncation mutants Can be identified. In one embodiment, the mutated library of PCIP mutants is generated by a combination mutagenesis at the nucleic acid level and is encoded by a mutagenized gene library. A mutated library of PCIP mutants can be prepared by enzymatically binding a mixture of synthetic oligonucleotides to a gene sequence, for example, such that a set of axial sets of potential PCIP sequences is used as an individual polypeptide, or alternatively, a set of PCIP sequences For example, a subset of the larger fusion proteins contained therein (e.g., for phage display). There are a variety of methods that can be used to generate libraries of potential PCIP mutants from foster oligonucleotide sequences. The chemical synthesis of the full-length gene sequence can be performed in an automated DNA tim screener, after which the synthetic gene is ligated into an appropriate expression vector. The use of a fused set of genes allows all of the sequence encoding the desired set of potential PCIP sequences to be provided in one mixture. Methods for synthesizing fullerene oligonucleotides are known in the art (see, for example, Narang, SA (1983) Tetrahedron 39: 3; Itakura et al . (1984) Annu. Rev. Biochem . 53: 323; Itakura et al . (1984) Science 198: 1056; Ike et al . (1983) Nucleic Acid Res . 11: 477].

In addition, a library of fragments of the PCIP protein coding sequence can be used to generate a mutated population of PCIP fragments for selection and subsequent selection of mutants of the PCIP protein. In one embodiment, the library of coding sequence fragments is obtained by treating double-stranded PCR fragments of the PCIP coding sequence with nuclease under the condition that the cleavage occurs only about once per molecule, denaturing the double-stranded DNA, To produce double stranded DNA which may contain sense / antisense pairs from different truncated products, to remove single stranded portions from the reconstructed double structure by treatment with S1 nuclease, and to generate the resulting fragment library into an expression vector And the like. By this method, expression libraries can be derived that code for N-terminal, C-terminal and internal fragments of PCIP proteins of various sizes.

Several techniques are known in the art for screening gene products of combinatorial libraries made by split point mutations or truncations and for selecting cDNA libraries for gene products with selected characteristics. This technique may be suitable for rapid screening of gene libraries generated by the combined mutagenesis of PCIP proteins. The most widely used techniques for screening large genomic libraries that can be analyzed at high throughput include cloning the gene library into a replicable expression vector, transforming the appropriate cells with the resulting vector library, and detecting the desired activity And expressing the combination gene under conditions that facilitate isolation of the vector encoding the gene in which the product of the gene is detected. Recombinant ensemble mutagenesis (REM), a novel technique for increasing the frequency of functional mutants in the library, can be used in conjunction with screening assays to identify PCIP mutants (see Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 89: 7811-7815; Delgrave et al . (1993) Protein Engineering 6 (3): 327-331].

In one embodiment, cell-based assays can be used to analyze mutated PCIP libraries. For example, a library of expression vectors can be transfected into a cell line that usually has potassium channel-mediated activity. The effect of PCIP mutants on potassium channel mediated activity can then be determined, for example, by any of a number of enzyme assays or by detecting the release of neurotransmitters. Plasmid DNA can then be recovered from the cells that are scored for potassium channel mediated activity, and further inhibition of, or alternatively, potentiation of, individualized, individualized clones.

Isolated PCIP proteins, or portions or fragments thereof, can be used as immunogens to generate antibodies that bind to PCIP using standard techniques for producing polyclonal and monoclonal antibody preparations. A full-length PCIP protein may be used, or, alternatively, the invention provides an antigenic peptide fragment of PCIP for use as an immunogen. The antigenic peptide fragment of PCIP has the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: : 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, , At least eight amino acid residues in the amino acid sequence shown in SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 77, wherein the antibody raised against the peptide is specific for PCIP RTI ID = 0.0 > PCIP < / RTI > to form an immune complex. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, most preferably at least 30 amino acid residues.

Preferred epitopes encompassed by antigenic peptides are those regions of the PCIP that are located on the surface of the protein, for example, hydrophilic regions, and highly antigenic regions.

PCIP immunogens are typically used to prepare antibodies by immunizing an appropriate subject (e.g., rabbit, goat, mouse or other mammal) with an immunogen. A suitable immunogenic preparation may, for example, contain a recombinantly expressed PCIP protein or a chemically synthesized PCIP polypeptide. Such a product may further comprise a reinforcing agent, such as Freund's complete or incomplete adjuvant, or a similar immunostimulant. Immunization of a suitable subject by an immunogenic PCIP preparation results in a polyclonal anti-PCIP antibody response.

Accordingly, another aspect of the present invention relates to an anti-PCIP antibody. As used herein, the term " antibody " refers to an immunoglobulin molecule, ie, an immunoglobulin molecule immunoglobulin molecule that specifically binds to an antigen (causing an immune response specifically to an antigen), such as PCIP Quot; active " Examples of immunologically active portions of immunoglobulin molecules include F (ab) and F (ab ') ₂ , which can be generated by treating the antibody with an enzyme such as pepsin. The present invention provides polyclonal and monoclonal antibodies that are coupled to PCIP. As used herein, the term " polyclonal antibody " or " monoclonal antibody composition " refers to a population of antibody molecules that contain only one type of antigen binding site capable of immunoreacting with a particular epitope of PCIP. The monoclonal antibody composition thus exhibits a single binding affinity for a particular PCIP protein that causes an immune response.

A polyclonal anti-PCIP antibody can be prepared as described above by immunizing a subject suitable for PCIP immunogen. The anti-PCIP antibody potency of the immunized subject can be monitored over time by standard techniques such as enzyme-linked immunosorbent assay (ELISA) using immunized PCIP. If desired, antibody molecules derived for PCIP can be derived from mammals (e. G., From blood) and further purified by well-known techniques, such as protein A chromatography, to obtain IgG fractions have. At the appropriate time after immunization, for example, when the anti-PCIP antibody titer is highest, antibody-producing cells can be obtained from the subject and are described first in Kohler and Milstein (1975) Nature 256: 495-497 Standard techniques such as hybridoma technology [see for example Brown et al . (1981) J. Immunol. 127: 539-46; Brown et al . (1980) J. Biol. Chem . 255: 4980-83; Yeh et al . (1976) Proc. Natl. Acad. Sci. USA 76: 2927-31; and Yeh et al . (1982) Int. J. Cancer 29: 269-75], more recent human B cell hybridoma technology (reference: Kozbor et al . (1983) Immunol Today 4:72], EBV-hybridoma technique [Cole et al . (1985) Monoclonal Antibodies and Cancer Therapy , Alan R. Liss, Inc., pp. 76-96] or by the trioma technique to produce monoclonal antibodies. Techniques for generating monoclonal antibody hybridomas are well known [General Reference: RH Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyzes , Plenum Publishing Corp. New York. New York (1980); EA Lerner (1981) Yale J. Biol. Med . 54: 387-402; ML Gefter et al . (1977) Somatic Cell Genet . 3: 231-36]. Briefly, an infinite proliferating cell line (typically a myeloma cell line) is fused to a lymphocyte (typically a spleen cell) from a mammal immunized with a PCIP immunogen as described above, and the culture supernatant of the resulting hybridoma cell is cultured in PCIP Is selected to identify a hybridoma that produces a monoclonal antibody to be bound.

All of the many known protocols used to fuse lymphocytes and infinite proliferative cell lines can be applied for the purpose of generating anti-PCIP monoclonal antibodies (see, e.g., G. Galfre et al . (1977) Nature 266: 55052; Gefter et al. Somatic Cell Genet. , Cited above; Lerner, Yale J. Biol. Med ., Cited above; Kenneth, Monoclonal Antibodies, cited above]. Moreover, those skilled in the art will recognize that many variations of this method may also be usefully employed. Typically, infinite proliferative cell lines (e. G., Myeloma cell lines) are derived from the same mammalian species such as lymphocytes. For example, murine hybridomas can be generated by infusing infinitely proliferating mouse cell lines with lymphocytes from mice immunized with an immunogenic preparation of the invention. A preferred infinite proliferating cell line is a mouse myeloma cell line sensitive to a culture medium (" HAT medium ") containing hypoxanthine, an amino protein and thymidine. All multiple myeloma cell lines can be used as fusion partners according to standard techniques, e.g., P3-NS1 / 1-Ag4-1, P3-x63-Ag8.653 or Sp2 / O-Ag14 myeloma cell lines. These myeloma cell lines are available from the ATCC. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (" PEG "). The hybridoma cells generated from the fusion are then selected by screening for myeloma cells fused non-productively with unfused myeloma cells using HAT medium (since these cells are not transformed, a few days later, unfused spleen cells Lethal). Hybridoma cells producing the monoclonal antibodies of the invention are detected, for example, by screening hybridoma culture supernatants for antibodies bound to PCIP using standard ELISA assays.

As an alternative to producing monoclonal antibody-specific hybridomas, monoclonal anti-PCIP antibodies can be identified and isolated by screening for a combinatorial recombinant immunoglobulin library (e. G., Antibody phage display library) by PCIP, The bound immunoglobulin library can be isolated. Kits for generating and screening phage display libraries are available [the Pharmacia Recombinant Phage Antibody System . Catalog No. 27-9400-01; And the Stratagene SurfZAP (TM) Phage Display Kit . Catalog No. 240612]. Also, examples of methods and reagents particularly suitable for use in generating and screening antibody display libraries are described, for example, in US Patent No. 5,223, 409 to Ladner et al .; PCT International Publication No. WO 92/18619 to Kang et al; PCT International Publication No. WO 91/17271 to Dower et al .; PCT International Publication No. WO 92/20791 by Winter et al .; PCT International Publication No. WO 92/15679 to Markland et al .; PCT International Publication No. WO 93/01288 by Breitling et al .; PCT International Publication No. WO 92/01047 by McCafferty et al; PCT International Publication No. WO 92/09690 to Garrard et al .; PCT International Publication No. WO 90/02809 to Radner et al .; And Fuchs et al . (1991) Bio / Technology 9: 1370-1372; Hay et al. (1992) Hum. Antibody. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; Griffiths et al . (1993) EMBO J 12: 725-734; Hawkins etal . (1992) J. Mol. Biol . 226: 889-896; Clarkson et al. (1991) Nature 352: 624-628; Gram et al. (1992) Proc. Natl. Acad. Sci. USA 89: 3576-3580; Garrad et al . (1991) Bio / Technology 9: 1373-1377; Hoogenboom et al. (1991) Nuc. Acid Res . 19: 4133-4137; Barbas et al . (1991) Proc. Natl. Acad. Sci. USA 88: 7978-7982; and McCafferty et al. Nature (1990) 348: 552-554.

In addition, recombinant anti-PCIP antibodies such as chimeric and humanized monoclonal antibodies, including both human and non-human parts, that can be generated using standard recombinant DNA technology are within the scope of the present invention . Such chimeric and phosphorylated monoclonal antibodies may be produced using recombinant DNA techniques known in the art, such as those described in international application PCT / US86 / 02269, such as Robinson et al .; European Patent Application No. 184,187 to Akira et al .; European Patent Application No. 171,496 of Taniguch, M.; European Patent Application No. 173,494 to Morrison et al; PCT International Publication No. WO 86/01533 to Neuberger et al .; U.S. Patent No. 4,816,567 to Cabilly et al; European Patent Application No. 125,023, Kabli et al; And Better et al. (1988) Science 240: 1041-1043; Liu et al . (1987) Proc. Natl. Acad. Sci. USA 84: 3439-3443; Liu et al . (1987) J. Immunol. 139: 3521-3526; Sun et al . (1987) Proc. Natl. Acad. Sci. USA 84: 214-218; Nishimura et al . (1987) Canc. Res . 47: 999-1005; Wood et al . (1985) Nature 314: 446-449; and Shaw et al . (1988) J. Natl. Cancer Inst . 80: 1553-1559; Morrison. SL (1985) Science 229: 1202-1207; Oi et al. (1986) BioTechniques 4: 214; Winter US Patent 5,225,539; Jones et al . (1986) Nature 321: 552-525; Verhoeyan et al. (1988) Science 239: 1534; and Beidler et al . (1988) J. Immunol . 141: 4053-4060. ≪ / RTI >

Anti-PCIP antibodies (e. G., Monoclonal antibodies) can be used to isolate PCIP by standard techniques such as affinity chromatography or immunoprecipitation. Anti-PCIP antibodies can facilitate purification of native PCIP from cells and recombinantly produced PCIP expressed in host cells. Moreover, anti-PCIP antibodies can be used to detect PCIP proteins (eg in cell lysates or cellular supernatants) to assess the pattern and abundance of expression of PCIP proteins. Anti-PCIP antibodies can be used diagnostically to determine the efficacy of a given therapeutic regimen by monitoring protein levels in tissues as part of the clinical trial process. Detection may be facilitated by coupling (i. E., Physical binding) the antibody to a detectable moiety. Examples of detectable components include various enzymes, subgroups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, alkaline galactosidase or acetylcholinesterase; Examples of suitable subgroup complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent substances include: umbelliferone, fluorescein, fluorescein isothiothianate, rhodamine, dichlorotriazinylamine fluorescein, dysyl chloride or picoheryline; Examples of luminescent materials include luminol; Examples of bioluminescent materials include luciferase, luciferin and aequorin; Examples of suitable radioactive materials include ¹²⁵ I, ¹³¹ I, ³⁵ S or ³ H.

III. Recombinant expression vectors and host cells

Another aspect of the invention relates to an expression vector containing a nucleic acid encoding a vector, preferably a PCIP protein (or portion thereof). The term " vector " as used herein refers to a nucleic acid molecule that is linked to another nucleic acid and is capable of transporting another nucleic acid. One type of vector is a " plasmid " that refers to a circular double stranded DNA to which additional DNA segments can be ligated. Other types of vectors are viral vectors in which additional DNA segments can be linked to the viral genome. Certain vectors have autonomous replication capacity in host cells into which they are introduced (e. G., Bacterial vectors and episomal mammalian vectors with bacterial origin of replication). Other vectors (e. G. Non-episomal mammalian vectors) are replicated along with the host genome by integration into the genome of the host cell upon introduction into the host cell. In addition, certain vectors may direct expression of the genes to which they are operatively linked. Such vectors are referred to herein as " expression vectors ". Generally, expression vectors useful in recombinant DNA technology are often present in the form of plasmids. As used herein, the terms " plasmid " and " vector " may be used interchangeably because the plasmid is the most commonly used form of vector. However, the present invention is meant to include such other forms of expression vectors, such as homologous viral vectors (e. G., Replication defective retroviruses, adenoviruses, and adeno-associated viruses).

The recombinant expression vector of the present invention includes a nucleic acid of the present invention in a form suitable for the expression of a nucleic acid in a host cell, wherein the recombinant expression vector is selected on the basis of the host cell to be used for expression, ≪ RTI ID = 0.0 > and / or < / RTI > Within a recombinant expression vector, " operably linked " means that the nucleotide sequence of interest is linked to a regulatory sequence in a manner that permits expression of the nucleotide sequence (e. G., An in vitro transcription / translation system or In the host cell when the vector is introduced into the host cell). The term " regulatory sequence " is intended to include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Acadmic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of nucleotide sequences in many types of host cells and those that direct expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences). Those skilled in the art will recognize that the design of the expression vector may depend on factors such as the choice of host cell to be transformed, the level of expression of the desired protein, and the like. The expression vector of the present invention may be introduced into a host cell to produce a protein or peptide comprising the fusion protein or peptide encoded by the nucleic acid described herein (e.g., a PCIP protein, a mutant form of the PCIP protein, a fusion protein Etc).

The recombinant expression proteins of the present invention can be designed for the expression of PCIP proteins in prokaryotic or eukaryotic cells. For example, the PCIP protein can be expressed in bacterial cells such as E. coli, insect cells (using a baculovirus expression vector), yeast cells or mammalian cells. Suitable host cells are also discussed in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Acadmic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro using, for example, the T7 promoter regulatory sequence and T7 polymerase.

Protein expression in prokaryotes is most frequently carried out in E. coli using vectors containing constitutive or inducible promoters directing the expression of fused or non-fused adducts. The fusion vector adds many amino acids to the encoded protein, typically the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) increased expression of the recombinant protein; 2) increased solubility of the recombinant protein; And 3) aiding the purification of the recombinant protein by acting as a ligand in an affinity purification. Often, in a fusion expression vector, a proteolytic cleavage site is introduced at the junction of the fusion site and the recombinant protein so that the recombinant protein can be separated from the fusion site after purification of the fusion protein. These enzymes, and their cognate recognition sequences, include Xa factor, thrombin, and enterokinase. Exemplary fusion expression vectors include glutathione S-transferase (GST), maltose E binding protein, or pGEX (Pharmacia Biotech, Inc., Smith DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England BioLabs, Beverly, MA) and pRIT5 (Pharmacia, Peace Away, NJ).

The purified fusion protein may be used to test for PCIP activity (e. G., Direct assays or competitive assays as described in detail below), e. G. To generate antibodies specific for PCIP proteins. In one preferred embodiment, the PCIP fusion protein expressed in the retroviral expression vector of the invention can be used to infuse bone marrow cells that are subsequently transplanted into the irradiated host. After sufficient time has elapsed (eg, 6 weeks), the recipient pathologic examination is performed.

Examples of suitable inductive non-fused E. coli vectors include pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego , California (1990) 60-89). Target gene expression from the pTrc vector depends on host RNA polymerase transfer from the hybrid trp-lac promoter. Target gene expression from the pET 11d vector depends on the transcription from the T7 gn10-lac fusion promoter mediated by the cotransfected viral RNA polymerase (T7 gn1). These viral polymerases are provided by the host strain BL21 (DE3) or HMS174 (DE3) from the resident protease, which encodes the T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.

One way to maximize recombinant protein expression in E. coli is to express the protein in host bacteria that are defective in proteolytic cleavage of the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press , San Diego, California (1990) 119-128]. Another method is to change the nucleic acid sequence of the nucleic acid to be inserted into the expression vector so that the individual codons for each amino acid are those that are selectively used in E. coli (Wada et al., (1992) Nucleic Acids Res. 20: 2111-2118]. Such changes in the nucleic acid sequences of the present invention can be performed by standard DNA synthesis techniques.

In another embodiment, the PCIP expression vector is a yeast expression vector. Examples of expression vectors in yeast S. cervisae include pYepSec1 [Baldari et al., (1987) Embo J. 6: 229-234], pMFa (Kurjan and Herskowitz (1982) Cell 30: 933- PYES2 [Invitrogen Corporation, San Diego, CA], and picZ (InVitrogen Corp. San Diego, Calif.).

Alternatively, the PCIP protein can be expressed in insect cells using a baculovirus expression vector. Baculovirus vectors that can be used to express proteins in cultured insect cells (e.g., Sf 9 cells) include the pAC family [Smith et al., (1983) Mol. Cell Biol. 3: 2156-2156] and the pVL family [Lucklow and Summers (1989) Virology 170: 31-39].

In another embodiment, the nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 [Seed, B. (1987) Nature 329: 840] and pMT2PC [Kaufman et al., (1987) EMBO J. 6: 187-195]. When used in mammalian cells, the regulatory function of the expression vector is often provided by a viral regulatory element. For example, commonly used promoters are obtained from poliomas, adenovirus 2, cytomegalovirus and simian virus 40 (Simian Virus 40). For other expression systems suitable for both prokaryotic and eukaryotic cells see Sambrook, J. Fritsh, EF, and Maniatis, T. Molecular Cloning: A Laboratory Manual 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY 1989, Chapter 16 and 17].

In other embodiments, the recombinant mammalian expression vector is capable of selectively directing the expression of the nucleic acid in a particular cell type (e. G., A tissue specific regulatory element is used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver specific: Pinkert et al. (1987) Genes Dev. 1: 268-277), the lymph-specific promoter (Calame and Eaton (1988) Adv. Immunol. 43: 235-275), particularly promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8: 729-733) and immunoglobulins (Banerji et al. (1983) Cell 33: 729-740; (1983) Cell 33: 741-748), neuron-specific promoters (for example, nerve fiber promoters Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86: 5473-5477), pancreas- (Edlund et al., (1985) Science 230: 912-916) and milk gland specific promoters (e.g., whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166). In addition, embryonic regulated promoters such as the murine hox promoter (Kessel and Gruss (1990) Science 249: 374-379) and the alpha-fetal protein promoter (Campes andTilghman (1989) Genes Dev. 3: 537 -546).

The present invention also provides a recombinant expression vector comprising a DNA molecule of the invention cloned into an expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to the regulatory sequence in a manner that allows the expression (by transcription of the DNA molecule) of the RNA molecule to be antisense to the PCIP mRNA. Regulatory sequences operably linked to the nucleic acid cloned in the antisense orientation may be selected, for example, as viral promoters and / or amplifiers, which direct the continuous expression of the antisense RNA molecule in various cell types, Tissue-specific, or cell-type specific expression of the < RTI ID = 0.0 > RNA. ≪ / RTI > The antisense expression vector may be in the form of a recombinant plasmid, phagemid or weakened virus in which the antisense nucleic acid is produced under the control of a highly efficient regulatory region whose activity can be determined by the cell type into which the vector is introduced . For a discussion of the regulation of gene expression using antisense genes, see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews-Trends in Genetics, Vol. 1 (1) 1986].

Another aspect of the present invention relates to a host cell into which the recombinant expression vector of the present invention has been introduced. The terms " host cell " and " recombinant host cell " are used interchangeably herein. It is understood that these terms refer not only to the particular test cell but also to the progeny or potential progeny of such a cell. These progeny may not, in fact, be identical to parental cells, but are included within the scope of the term as used herein, as certain modifications may occur in subsequent generations due to mutations or environmental influences.

The host cell may be any prokaryotic or eukaryotic cell. For example, the PCIP protein can be expressed in bacterial cells such as E. coli, yeast or mammalian cells (e.g., Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

Vector DNA can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to a variety of known techniques for introducing an external nucleic acid (eg, DNA) into a host cell, including calcium phosphate or calcium chloride co- DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in the following references and other experimental manuals (Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY 1989].

For stable transfection of mammalian cells, it is known that only a small fraction of the cells can integrate external DNA into the genome, depending on the expression vector and transfection technique used. In order to identify and select these components, it is common to introduce a gene encoding a selectable marker (e. G., Resistant to antibiotics) into a host cell with the gene of interest. Preferred selectable markers include those that confer resistance to drugs such as G418, hygromycin and methotrexate. The nucleic acid encoding the selectable marker may be introduced into the host cell on the same vector as encoding the PCIP protein, or may be introduced on a separate vector. Cells that are stably transfected with the introduced nucleic acid can be identified by drug selection (e. G., Cells in which the selectable marker gene is introduced survive, but other cells die).

Host cells of the invention, e. G. Prokaryotic or eukaryotic host cells in culture, can be used to produce (i. E. Express) PCIP protein. Accordingly, the present invention further provides a method for producing PCIP protein using the host cell of the present invention. In one embodiment, the method comprises culturing the host cell of the invention (wherein a recombinant expression vector encoding the PCIP protein is introduced) in a suitable medium to produce a PCIP protein. In another embodiment, the method further comprises separating the PCIP protein from the medium or host cell.

The host cells of the invention may also be used to produce non-human transgenic animals. For example, in one embodiment, a host cell of the invention is a modified oocyte or embryonic stem cell into which a PCIP coding sequence is introduced. Such host cells can be used to create non-human transgenic animals into which the exogenous PCIP sequence has been introduced into the genome or to create homologous recombinant animals in which the endogenous PCIP sequence has been modified. Such animals are useful for studying the function and / or activity of PCIP and for identifying and / or evaluating modulators of PCIP activity. As used herein, a " transgenic animal " is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, wherein at least one of the animal cells comprises a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like. The transgene is an exogenous DNA integrated into the genome of the cell from which the transgenic animal develops and remains in the genome of the mature animal to direct the expression of the encoded gene product in one or more cell types or tissues of the transgenic animal do. As used herein, a " homologous recombinant animal " is a non-human animal, preferably a mammal, more preferably a mouse, and prior to development of the animal, an endogenous PCIP gene is introduced into the endogenous gene and to the animal's cells, Is modified by homologous recombination between introduced foreign DNA molecules.

The transgenic animal of the present invention can be obtained by introducing the PCIP encoding nucleic acid into the male precursor of the fertilized oocyte, for example, by microinjection, retroviral infection, and developing oocytes in a female foster animal . SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: The PCIP cDNA sequence of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71 can be introduced into the genome of a non-human animal as a transgene. Alternatively, the PCIP gene of a non-human animal, e. G. Mouse or rat, of the human PCIP gene can be used as a transplantation gene. Alternatively, a PCIP genomic animal, such as a member with another PCIP, may comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: The PCIP cDNA sequence of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71 or accession numbers 98936, 98937, 98938 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, or 98994, which can be used as a transplantation gene, based on the hybridization with the DNA insert sequence of the plasmid deposited at the ATCC (described in subsection I above). Intron sequences and polyadenylation signals may be included in the transgene to increase the expression efficiency of the transgene. Tissue-specific regulatory sequences may be operatively linked to the PCIP-grafted gene to direct expression of the PCIP protein on a particular cell. Methods of producing transgenic animals, particularly animals such as mice, by embryo manipulation and microinjection are conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 and 4,870,009 to Leder et al, Are described in Wagner et al., U.S. Patent No. 4,873,191 and Hogan B. Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, NY 1986) Are used in the production of other transplanted animals The base transgenic animal can be identified based on the presence of the PCIP transgene in the genome and / or the expression of PCIP mRNA in the tissues or cells of an animal. Animals can be used to breed additional animals carrying the transgene. In addition, the transgenic animal carrying the transgene encoding the PCIP protein Other genes that hold the graft can be crossed with transgenic animals and add.

In order to make a homologous recombinant animal, a vector containing part or all of the PCIP gene is prepared, and deletion, insertion or substitution is introduced into the PCIP gene, thereby changing the PCIP gene, for example, functionally. The PCIP gene may be a human gene (e. G., The cDNA of SEQ ID NO: 1), more preferably a non-human animal of the human PCIP gene (e. For example, the mouse PCIP gene can be used to construct a homologous recombination vector suitable for altering the endogenous PCIP gene in the mouse genome. In one preferred embodiment, the vector is designed such that upon homologous recombination, the endogenous PCIP gene is functionally disrupted (i. E., It no longer encodes a functional protein; also referred to as a " knock out " vector). Alternatively, the vector may be designed to encode functional proteins (for example, the upstream regulatory region may be altered to alter the expression of the endogenous PCIP protein) although the endogenous PCIP gene is mutated or modified at homologous recombination . In homologous recombination vectors, the modified portion of the PCIP gene is flanked at the 5 ' and 3 ' ends by additional nucleic acid sequences of the PCIP gene such that homologous recombination between the exogenous PCIP gene retained in the vector and the endogenous PCIP gene of the embryonic stem cells occurs do. Typically, several kilobases of flanking DNA (both 5 'and 3' ends) are contained within the vector (see Thomas K. R. et al. For a description of homologous recombination vectors. and Capecchi, M.R. (1987) Cell 51: 503]. The vector is introduced into the embryonic stem cell line (e. G., By electroporation), and the cell in which the introduced PCIP gene is homologously recombined with the endogenous PCIP gene is selected (Li E. et al. (1992) 69: 915]. Selected cells are injected into blastocysts of animals (e.g., mice) to form aggregated chimeras (Bradley A. Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, ed. (IRL, Oxford, 1987) pp .113-152). The chimeric embryos were transplanted into appropriate gymnosperm animals and the embryos were developed until birth. A progeny that lays homologously recombined DNA in germ cells can be used to cross all cells of an animal with an animal that contains homologously recombined DNA by wire transfer of the transgene. Methods of constructing homologous recombinant vectors and homologous recombinant animals are further described in the following references (Bradley A. (1991) Current Opinion in Biotechnology 2: 823-829, PCT International Publication No. WO 90/11354 (Le Mouellec et al., WO 91/01140 (Smithies et al), WO 92/0968 (Zijlstra et al.), and WO 93/04169 (Berns et al.).

In other embodiments, transgenic non-human animals can be produced that include a selected system that allows for controlled expression of the transgene. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. For a description of the cre / loxP recombinase system, see the following article: Lakso et al. (1992) Proc. Natl. Acad. Sci. USA 89: 6232-6236). Another example of a recombinase system is the FLP recombinase system of Saccharomyces cervisae (O'Gorman et al. (1991) Science 251: 1351-1355). When the cre / loxP recombinase system is used to regulate the expression of a transgene, an animal containing a trans recombinant gene encoding both Cre recombinase and the selected protein is required. These animals may be transplanted with two transgenic animals containing a transgene encoding a "double" gene transplant animal, eg, one encoding the selected protein and the other transgene encoding the recombinase .

Clones of non-human transgenic animals described herein may also be produced according to the methods described in the following references (Wilmut I. et al. (1997) Nature 385: 810-813, PCT International Publication Nos. WO 97/07668 and WO 97/07669]. Briefly, cells from a transplanted animal, for example, somatic cells, can be isolated to induce growth cycles to enter the G ₀ phase. The stasis cell can then be fused, for example, using an electric pulse, to the oocyte from which the stasis cell has been removed from the nucleus of an animal of the same species as the isolated cell. Cultured oocytes are cultured and developed into embryonic or blastocyst cells, and then transferred to fertile newborn sheep. The offspring that were born in these wool animals would be clones of cells, for example, animals whose somatic cells were isolated.

IV. Pharmaceutical composition

PCIP nucleic acid molecules, fragments of the PCIP protein, and anti-PCIP antibodies (referred to herein as " active compounds ") of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise a nucleic acid molecule, a protein, or an antibody and a pharmaceutically acceptable carrier. The term " pharmaceutically acceptable carrier " as used herein includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents suitable for pharmaceutical administration, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. As long as any conventional media or agent is not compounded with the active compound, its use in the composition is expected. Supplementary active compounds may also be incorporated into the compositions.

The pharmaceutical composition of the present invention is formulated to be suitable for the route to be administered. Examples of routes of administration include parenteral, for example, intravenous, intradermal, subcutaneous, oral (e.g., inhaled), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous administration may include the following components: sterile diluents such as water for injection, saline, non-volatile oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; Antimicrobial agents such as benzyl alcohol or methyl paraben; Antioxidants such as ascorbic acid or sodium sulfite; Chelating agents such as ethylenediaminetetraacetic acid; Buffering agents such as acetate, citrate or phosphate, and isotonic agents such as sodium chloride or glucose. The pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral formulations may be packaged in ampoules, disposable syringes, or multi-dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use may include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, the suitable carrier comprises a saline solution, jeonggyunsu, Crescent blanket (Cremophor) EL ^TM (BASF, Parr when Companion, NJ) or phosphate buffered saline (PBS). In all cases, the composition should be sterile and fluid to the extent that it can be easily injected. It must be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or a dispersion medium comprising, for example, water, ethanol, a polyol (e.g., carboxy, propylene glycol, and liquid polyethylene glycol, etc.), and mixtures thereof. Proper fluidity can be maintained, for example, by the use of coatings such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. The inhibition of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, tiermarosal, and the like. In many cases, it will be desirable to include isotonic agents, for example, polyalcohols such as sugars, mannitol, sorbitol, sodium chloride in the composition. Delayed absorption of the injectable compositions can be brought about by the inclusion of agents which delay absorption in the composition, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in the required amount (e.g., a fragment of the PCIP protein or an anti-PCIP antibody) into an appropriate solvent with one or a combination of the ingredients listed above followed by sterile filtration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other necessary ingredients listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred method of manufacture is lyophilization and vacuum drying, in which powders of the active ingredient and any further desired ingredient are obtained from previously sterile-filtered solutions.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For oral therapeutic administration purposes, the active compounds may be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a fountain aid, and the compound in the fluid carrier is orally applied, cleaned, spit or swallowed. Pharmaceutically compatible binding agents and / or auxiliary substances may be included as part of the composition. Tablets, pills, capsules, troches and the like may contain any of the following ingredients or compounds of a similar nature: binders such as microcrystalline cellulose, tragacanth rubber or gelatin; Excipients such as starch or lactose, disintegrants such as alginic acid, Primogel, or corn starch; Sweeteners such as sucrose or saccharin; Or a flavoring such as peppermint, methyl salicylate, or orange flavor.

For inhalation administration, the compound is administered in the form of an aerosol spray, or nebulizer, from a pressurized container or dispenser containing a suitable propellant, for example, a gas such as carbon dioxide.

Systemic administration may be by light mucosal or percutaneous means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished by the use of a nasal spray or suppository. For transdermal administration, the active compound is formulated into ointments, lozenges, gels, or creams generally known in the art.

The compounds may also be formulated in the form of suppositories (containing, for example, conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal administration.

In one embodiment, the active compound is formulated with a carrier that prevents it from being rapidly removed from the body, such as, for example, a controlled release formulation compound comprising an implant and a microencapsulated delivery system. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Methods of making such formulations will be apparent to those skilled in the art. The raw materials are commercially available from Alzah Corporation and Nova Pharmaceutical Industries Incorporated. Liposomal suspensions (including liposomes targeted to cells infected with monoclonal antibodies to viral antigens) may also be used as pharmaceutically acceptable carriers. These can be prepared according to the methods described in, for example, U.S. Patent No. 4,522,811, which are known to those skilled in the art.

It is particularly advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suitable as unitary dosages for the subject being treated; Each unit containing a predetermined amount of the active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifications for the dosage unit form of the invention are specified by the inherent properties of the active compound and the particular therapeutic effect to be achieved and the inherent limitations in the art of compounding such an active compound for the treatment of an individual, .

The toxicity and therapeutic efficacy of such compounds is determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, by determining LD50 (50% lethal dose of the population) and ED50 (therapeutically effective dose in 50% of the population) . The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the LD50 / ED50 ratio. Compounds that exhibit a large therapeutic index are preferred. Compounds that exhibit toxic side effects can be used but can be engineered to reduce side effects by minimizing possible damage to unincorporated cells by designing a delivery system that targets such compounds to sites of diseased tissue.

Data obtained from cell culture assays and animal studies can be used to formulate dosages ranging from those used in humans. The dosage of such compounds is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration employed. For any compound used in the methods of the invention, the therapeutically effective dose can be estimated from cell culture assays first. Capacity can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 determined in cell culture (the concentration of the test compound that inhibits a maximum of half the symptoms). This information can be used to more accurately determine useful doses in humans. Plasma concentrations can be measured, for example, by high performance liquid chromatography.

A therapeutically effective amount of a protein or polypeptide as defined herein is in the range of about 0.001 to 30 mg per kg of body weight, preferably about 0.01 to 25 mg per kg of body weight, more preferably about 0.1 to 20 mg per kg of body weight, About 1 to 10 mg, 2 to 9 mg, 3 to 8 mg, 4 to 7 mg, or 5 to 6 mg per kg of body weight. Those skilled in the art will recognize that certain factors may affect the dosage required to effectively treat a patient, including, but not limited to, the severity of the disease or disorder, previous treatment experience, general health status and / or age of the patient, But are not so limited. In addition, treating a patient with a therapeutically effective amount of a protein, polypeptide, or antibody may comprise a single treatment, or preferably, may comprise continuous treatment.

In one preferred embodiment, the patient is treated with antibody, protein, or polypeptide at about 0.1 to 20 mg per kg body weight once per week for about 1 to 10 weeks, preferably for 2 to 8 weeks, more preferably about For 3 to 7 weeks, and even more preferably for about 4.5 or 6 weeks. It will be appreciated that the effective dose of the antibody, protein, or polypeptide used in therapy may be increased or decreased for a particular treatment period. Changes in dosage can occur and are evident from the results of diagnostic assays as defined herein.

The present invention includes agents that modulate expression or activity. For example, the agent may be a small molecule. For example, such small molecules may be selected from the group consisting of peptides, peptides, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds having a molecular weight less than about 10,000 g Organic or inorganic compounds having a molecular weight of less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight of less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight of less than about 500 grams per mole, Esters, and other pharmaceutically acceptable forms of such compounds.

The appropriate dosage of the small molecule drug is, of course, dependent on a number of factors that a physician, veterinarian or researcher with ordinary skill can understand. The capacity of a small molecule can be determined, for example, by the nature, size, and condition of the subject or sample being treated, as well as the route through which the composition is to be administered, Will vary depending on the expected effect.

Typical doses include mg or pg of a small molecule per kg of subject or sample body (e.g., about 1 μg / kg to 500 mg / kg, about 100 μg / kg to about 5 mg / kg, or about 1 Mu] g / kg to about 50 [mu] g / kg). The appropriate dosage of the small molecule will, of course, depend on the potency of the small molecule in relation to the expression or activity to be regulated. Such suitable doses may be determined using the assays described herein. When one or more of these small molecules are administered to an animal (e.g., a human) to modulate expression or activity of the polypeptide or nucleic acid of the present invention, the physician, veterinarian, or researcher may, for example, initially prescribe a relatively low dose , And then the capacity can be increased until a suitable reaction is obtained. Also, the specific dose level for a particular animal subject will depend upon a variety of factors including the nature of the particular compound employed, the age, weight, general health, sex and diet of the subject, time of administration, route of administration, rate of excretion, But will depend on various factors including the degree of expression or activity.

In addition, the antibody (a fragment thereof) can be conjugated with a therapeutic moiety such as a cytotoxin, a therapeutic agent, or a radioactive metal ion. A cytotoxin or cytotoxic agent includes any agent that damages the cell. For example, taxol, cytochalasin B, gramicidine D, ethidium bromide, emetine, mitomycin, ethofoside, tenofoside, vincristine, vinblastine, colchicine, doxorubicin, Dehydroestine, glucocorticoid, procaine, tetracaine, lidocaine, propranolol, and puromycin, and analogs thereof, such as, for example, dexamethasone, doxorubicin, dihydroxyanthracyclodione, Or homologs. Therapeutic agents may be selected from the group consisting of metabolic antagonists (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, decarbazine), alkylating agents (e. G., Mechlorethamine, (II) (") " ((II)), < / RTI > DDP) cisplatin), anthracyclines (e.g., donorubicin (doctomycin) and doxorubicin), antibiotics (such as dactinomycin (all actinomycin), bleomycin, mitramycin, and anthramycin AMC), anti-mitotic agents (e. G., Vincristine and vinblastine).

The conjugates of the present invention can be used to modify a given biological response. That is, the drug component is not construed as being limited to conventional chemotherapeutic agents. For example, the drug component may be a protein or polypeptide having the desired biological activity. Such proteins include, for example, toxins such as abrin, lysine A, Pseudomonas exotoxin, or diphtheria toxin; Proteins such as tumor necrosis factor, alpha interferon, beta interferon, nerve growth factor, platelet-derived growth factor, tissue plasminogen activator; (&Quot; IL-2 "), interleukin-6 (" IL-6 "), granulocyte macrophage colony stimulating (&Quot; GM-CSF "), granulocyte colony stimulating factor (" G-CSF "), or other growth factors.

Methods of binding such therapeutic moieties to antibodies are known (Arnon et al., &Quot; Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy ", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al., (Eds. , " Antibodies For Drug Delivery ", in Controlled Drug Delivery (2nd Ed.), Robinson et al., (eds.), pp. 633 -53 (Marcel Dekker, Inc. 1987); Tporpe, " Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review ", in Monoclonal Antibodies '84: Biological And Clinical Applications, pnchera et al., (Eds. Baldwin et al., (Eds.), Pp. 303-16 (Academic Press 1985), and Thorpe et al. (1985); " Analysis, Results, and Future prospective of the Therapeutic UseOf Radiolabeled Antibody In Cancer Therapy, 62: 119-58 (1982). Alternatively, one antibody may be conjugated to a second antibody and an antibody heteromeric conjugate (See Segal in U.S. Patent No. 4,676,980).

The nucleic acid molecule of the present invention can be inserted into a vector and used as a gene therapy vector. Gene therapy vectors may be delivered to a patient by, for example, topical administration by intravenous injection (see U.S. Patent No. 5,328,470), systemic injection (Chen et al., (1994) Proc. Natl. Acad Sci. USA 91: 3054-3057). The pharmaceutical preparation of the gene therapy vector may comprise a gene therapy vector as an acceptable diluent or may comprise a slow release matrix incorporating a gene delivery vehicle. Alternatively, if the complete gene transfer vector can be obtained from the recombinant cell, e. G., A retroviral vector in intact form, the pharmaceutical preparation can comprise one or more cells producing a gene delivery system.

The pharmaceutical composition may be included in a container, pack, or dispenser with instructions for administration.

V. Uses and Methods of the Invention

The nucleic acid molecules, proteins, protein homologs, and antibodies described herein can be used in one or more of the following ways: a) screening assays; b) Predictive agents (eg, diagnostic analysis, precursor analysis, monitoring of clinical trials, and pharmacogenetics); And c) methods of treatment (e. G., Treatment and prevention). As described herein, the PCIP protein of the present invention has one or more of the following activities: (1) interaction (e.g., binding) with potassium channel protein or a portion thereof; (2) modulation of the phosphorylation state of the potassium channel protein or a portion thereof; (3) its action as a calcium dependent (e.g., binding) and, for example, as a calcium dependent kinase, for example phosphorylation of the potassium channel or phosphorylation of the G-protein coupled to the receptor in a calcium dependent manner; (4) function as a calcium-related (e.g., binding) and, for example, a calcium dependent transcription factor; (5) activate potassium channel mediated activity in cells (e.g., neurons or cardiac cells) ; (6) regulation of chromatin formation in cells, for example, neurons or cardiac cells; (7) Cells For example, regulation of vesicular transport and protein delivery in neuronal or cardiac cells; (8) Cells For example, modulation of cytokines in neurons or cardiac cells; (9) regulation of the association of the cytoskeleton with the potassium channel protein or a portion thereof; (10) regulation of cell proliferation; (11) regulation of neurotransmitters; (12) regulation of membrane excitability; (13) Effect on membrane potential; (14) Control of wavelength shape and frequency of active potential; And (15) regulation of excitation. Thus, the PCIP protein of the present invention can be used, for example, in: (1) modulating the activity of a potassium channel protein or a portion thereof; (2) modulation of the phosphorylation state of the potassium channel protein or a portion thereof; (3) modulation of phosphorylation status of G-proteins coupled with receptors in a potassium channel or calcium dependent manner; (4) related to calcium (e.g., binding) and, for example, to calcium dependent transcription factors; (5) regulate potassium channel mediated activity in cells (e. G., Neuronal or cardiac cells) to, for example, favorably affect cells; (6) regulation of chromatin formation in cells, for example, neurons or cardiac cells; (7) Regulation of bovine transport and protein delivery in cells, for example, neurons or cardiac cells; (8) Regulation of cytokine signaling in cells, for example, neurons or cardiac cells; (9) regulation of the association of the cytoskeleton with the potassium channel protein or a portion thereof; (10) regulation of cell proliferation; (11) regulation of neurotransmitter release; (12) regulation of membrane excitability; (13) Effect on membrane potential; (14) Control of wavelength shape and frequency of active potential; And (15) regulation of excitation.

The isolated nucleic acid molecule of the present invention can be used to detect, for example, expression of the PCIP protein (e. G., Through recombinant expression vectors in host cells in gene therapy applications), detection of PCIP mRNA or detection of genetic alterations of the PCIP gene And may be used to regulate PCIP activity as follows. The PCIP protein can be used in the treatment of diseases characterized by insufficient or excessive production of PCIP substrates or PCIP inhibitors. In addition, the PCIP protein is characterized by screening of native PCIP substrates, screening of drugs or compounds that modulate PCIP activity, and insufficient or excessive production of PCIP protein forms that are degraded or have abnormal activity compared to PCIP protein or PCIP wild- (E.g., Parkinson's disease and other rheumatoid diffuse diseases, multiple sclerosis, amyotrophic lateral sclerosis, bipolar disorder) associated with CNS disorders such as Alzheimer's disease, Alzheimer's disease, Psychotic disorders such as depression, schizophrenia, psychosis of Korsakov, mania, anxiety, bipolar disorder, or panic disorder; learning disorder, progressive supranuclear palsy, epilepsy, spinal cord cerebral ataxia, and Jakob-Creutzfeldt disease; For example, amnesia or senile memory loss; neurological disorders such as migraine: pain Such as pain associated with hyperalgesia or musculoskeletal disorders, spinal cord injury, stroke, and head trauma; or cardiovascular diseases such as, for example, frozen section disorders, angina pectoris, heart failure, hypertension, atrial fibrillation, atrial flutter, , Idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary spasm, or arrhythmia). In addition, the anti-PCIP antibodies of the present invention can be used for the detection and isolation of PCIP proteins, for controlling the bioactivity of PCIP proteins and for controlling PCIP activity.

A. Screening analysis

The present invention also provides methods for modulating or inhibiting the expression or activity of a PCIP substrate, such as a candidate or test compound or agent (e. G., Peptide < RTI ID = 0.0 > , Peptidomas, small molecules, or other drugs).

In one embodiment, the invention provides assays for screening candidate compounds or test compounds that are substrates of a PCIP protein or polypeptide or a biologically active portion thereof. In another embodiment, the invention provides an assay for screening candidate compounds or test compounds that bind to or control activity of a PCIP protein or polypeptide or biologically active portion thereof. The test compounds of the present invention can be obtained by combining any of several of the combined libraries known in the art including: biological libraries; Spatially addressable parallel solid-phase or solution-phase libraries; Disassembly requirements compositional library method; &Quot; 1-Bead 1-compound " library method; And affinity chromatography selections. While the biological library approach is limited to peptide libraries, four other approaches are available for peptides, non-peptide oligomers, or small molecule compound libraries (Lam, K. S. (1997) Anicancer Drug Des.

Examples of molecular library synthesis methods can be found in the art (see, for example, Dewitt et al., (1993) Proc. Natl. Acad. Sci. USA 90: 6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91: 11422; Zukermann et al., 91994) j. Med Chem. 37: 2678; Cho et al., (1993) Science 261: 1303; Carrell et al., (1994) Angew. chem. Int. Ed. Engl. 33: 2059; Carell et al., 91994) Angew: Chem. Int. Ed. Engl. 33: 2061; and Gallop et al., (1994) J. Med. Chem. 37: 1233).

Compound libraries can be presented in solution (see, for example, Houghten (1992) Biotechniques 13: 412-421) or beads (Lam (1991) Nature 354; 82-84), chips (Fodor (Lander USP 5,223,409), spores (Lander USP 409), plasmids (Cull et al., (1992) Proc Natl Acad Sci USA 89: 1865-1869) )) Science 249: 386-390): (Devlin (1990) Science 249: 404-406); (Cwirla et al. (1990) Proc Natl Acad Sci 87: 6378-6382) (Felici (1991) J. Mol. Biol. (Landner, supra).

In one embodiment, the assay is a cell-based assay wherein a cell expressing a PCIP protein or a biologically active portion thereof is contacted with a test compound and the test compound is contacted with a PCIP activity, e. The ability to regulate binding is measured. The ability of a test compound to modulate PCIP activity can be accomplished, for example, by monitoring the release of a neurotransmitter, e.g., dopamine, from a PCIP expressing cell, such as a black neuron or a cardiac cell. In addition, the ability of a test compound to modulate PCIP activity can be performed, for example, by monitoring the release of neurotransmitters from I _to current or PCIP expressing cells, such as cardiac cells. An intracellular current, for example, an I _to current, can be measured using the method described in the reference (Hamill et al., 1981, Pfluegers Arch, 391: 85-100) as described in the Examples. The cell may be of mammalian origin, for example. Measurements of the ability of a test compound to modulate the binding of PCIP to a substrate can be made, for example, by measuring the binding of a PCIP substrate and a radioactive isotope such that the binding of the PCIP substrate to the PCIP can be measured by detecting a labeled PCIP substrate in the complex & Or by conjugating an enzymatic label. For example, a compound (e.g., a PCIP substrate) may be labeled directly or indirectly with ¹²⁵ I, ³⁵ S, or ³ H, and the radioisotope may be measured by a direct or systillery coefficient of radiation release . Alternatively, the compound may be enzymatically labeled, for example, using horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label may be used to determine the conversion of the appropriate substrate to the product .

It is also within the scope of the present invention that the ability of a compound (e.g., a PCIP substrate) to bind to PCIP is measured without labeling any of the interacting agents. For example, a microphysiometer can be used to detect the interaction of a compound with PCIP without labeling the compound or PCIP (McConell, HM. Et al., (1992) Science 257: 1906-1912 ). As used herein, a "microphysiometer" (eg, a cytosensor) is an analytical device that uses a light-tracing potential difference sensor (LAPS) to measure the rate at which a cell acidifies its environment. A change in the rate of acidification can be used as an indicator of the interaction between the compound and the PCIP.

In another embodiment, the assay comprises contacting a cell expressing a PCIP target molecule (e. G., Potassium channel or fragment thereof) with a test compound as a cell-based assay and determining whether the test compound modulates the activity of the PCIP target molecule For example, stimulation or inhibition). The ability of a test compound to modulate the activity of a PCIP target molecule can be performed, for example, by determining the ability of PCIP to bind or interact with a PCIP target molecule, e.g., a potassium channel or a fragment thereof.

The ability of the PCIP protein or biologically active fragment thereof to measure binding or interaction with a PCIP target molecule can be performed by one of the methods described above for measuring direct binding. In a preferred embodiment, measuring the ability of a PCIP protein to bind or interact with a PCIP target molecule can be performed by measuring the activity of the target molecule. For example, the activity of the target molecule may be determined by detecting the induction of a second cellular messenger of the target (e.g., intracellular Ca ²⁺ , diacylglycerol, IP _3, etc.), catalytic / enzymatic activity of the target Detection of the induction of a reporter gene (including a detectable marker, e. G., A target-responsive regulatory element operatively linked to a nucleic acid encoding luciferase), or a targeted regulated cellular response such as neurotransmission Can be measured by detection of the release of the substance.

In another embodiment, the assay of the invention is a cell-free assay wherein the PCIP protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to bind to the PCIP protein or a biologically active portion thereof is measured. The preferred biologically active portion of the PCIP protein used in the assay of the present invention is involved in the interaction with a non-PCIP molecule, e.g., a potassium channel or a fragment thereof, or a fragment with a high surface hit probability. The binding of the test compound to the PCIP protein can be measured directly or indirectly as described above. In a preferred embodiment, the assay comprises contacting the PCIP protein or biologically active portion thereof with a PCIP to contact with a known compound that forms an assay mixture, contacting the assay mixture with the test compound, and determining the interaction of the test compound with the PCIP protein Wherein the measurement of the ability of the test compound to interact with the PCIP protein comprises a determination of the ability of the test compound to bind to PCIP or its biologically active portion in an affinity comparable to known compounds .

In another embodiment, the assay is a cell-free assay, wherein the PCIP protein or a biologically active portion thereof is contacted with a test compound, and the test compound modulates (e. G., Stimulates or stimulates the activity of the PCIP protein or a biologically active portion thereof Inhibition) is measured. Measurement of the ability of the test compound to modulate the activity of the PCIP protein can be performed, for example, by measuring the ability of the PCIP protein to bind to the PCIP target molecule by any of the methods for measuring the direct binding. Measurement of the ability of a PCIP protein to bind to a PCIP target molecule can also be performed using, for example, real-time biomolecular interaction analysis (BIA) (Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63: 2338-2345 and Szabo et al. (1995) Curr Opin. Struct Biol. 5: 699-705). As used herein, " BIA " is a technique for studying a biospecific response in real time without labeling an interacting agent (e.g., BIAcore). Changes in the optical surface plasmon resonance (SPR) phenomenon indicate a real-time response between biomolecules.

In an alternative embodiment, a determination of the ability of a test compound to modulate the activity of a PCIP protein can be performed by determining the ability of the PCIP protein to further modulate the activity of the effector downstream of the PCIP target molecule. For example, the activity of an effector molecule on an appropriate target can be measured, or the binding of an effector to a suitable target can be measured as described above.

In another embodiment, the cell-free assay comprises contacting the PCIP protein or biologically active portion thereof with a PCIP protein to contact a known compound that forms an assay mixture, contacting the assay mixture with a test compound, Wherein the ability of the test compound to interact with the PCIP protein is determined by measuring the ability of the PCIP protein to bind to the PCIP target molecule or to modulate the activity of the PCIP target molecule .

Cell-independent assays of the invention can be used for both the soluble and / or membrane bound forms of the isolated protein. If the membrane-bound form of the isolated cell is used in a cell-independent assay (e.g., potassium channel), it may be desirable to have the membrane-bound form of the isolated cells retained in solution using a solubilizer. Examples of such solubilizers include nonionic detergents such as n-octyl glucoside, n-dodecyl maltoside, octanoyl-N-methyl glucamide, decanoyl-N-methyl glucamide, Triton Trade name) X-100, Triton (registered trademark) X-114, Thesit (registered trademark), isotridecipoly (ethylene glycol ether)_n, 3 - [(3-cholamidopropyl) dimethylaminio] -1-propane sulfonate (CHAPS) Sulfonate (CHAPSO), or N-dodecyl-N, N-dimethyl-3-ammonio-1-propanesulfonate.

In one or more of the above analytical methods of the invention, it is preferred to immobilize the PCIP or its target molecule to separate the uncomplexed form from the complexed form of one or both of the proteins, and for the automation of the assay . The binding of the test compound to the PCIP protein in the presence or absence of the candidate compound, or the interaction of the PCIP protein with the target molecule, can be performed in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein may be provided that adds a domain that allows one or both of the proteins to bind to the matrix. For example, glutathione-S-transferase / PCIP fusion protein or glutathione-S-transferase / target fusion protein is adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione- And the test compound or the non-adsorbed target protein or PCIP protein, and the mixture may be combined with the test compound or the non-adsorbed target protein or PCIP protein under conditions (for example, physiological conditions for salt and pH) Lt; / RTI > After incubation, the beads or microtiter plate wells are washed to remove unbound components, the matrix is fixed to the case of beads, and the complex is measured, for example, directly or indirectly as described above. Alternatively, the complex may be separated from the matrix and the PCIP binding level or activity may be measured by standard methods.

Other methods for immobilizing proteins can also be used in the screening assays of the present invention. For example, a PCIP protein or PCIP target molecule can be immobilized using the condensation of biotin and streptavidin. Biotinylated PCIP proteins or target molecules can be synthesized from biotin-NHS (N-hydroxy-succinimide) using techniques known in the art (e.g., biotinylation kits, Pierce Chemicals, Rockford, IL) And may be immobilized in streptavidin-coated 96-well plates (Pierce Chemicals). Alternatively, an antibody that is reactive with the PCIP protein or target molecule or that does not interfere with the binding of the PCIP protein to its target molecule can be induced in the wells of the plate, and the unbound target or PCIP protein can be introduced into the well It can be confined by condensation. In addition to the GST-immobilized complexes described above, the method of measuring this complex relies on the detection of the immunity of the complex using an antibody reactive with the PCIP protein or the target molecule, and detection of the enzymatic activity associated with the PCIP protein or the target molecule Lt; / RTI > binding assay.

In a preferred embodiment, the candidate or test compound or agent is capable of their ability to inhibit or stimulate the ability of the PCIP molecule to modulate vesicle transport and protein delivery in cells (e. G. Neurons or cardiac cells) (1999) Genes Dev. 13 (11); 1475-85, and Roth MG et al. (1999) Chem. Phys. Lipids. 98 (1-2); 141-52).

In another preferred embodiment, the candidate or test compound or agent is capable of their ability to inhibit or stimulate the ability of the PCIP molecule to modulate the phosphorylation status of a potassium channel protein or a portion thereof, for example, in vitro kinase Can be measured using the analysis. Briefly, the PCIP target molecule, for example, an immunoprecipitated potassium channel from a cell line expressing such a molecule, can be coupled to the PCIP protein and radiolabeled ATP, e.g., [? ^-32 P] ATP with MgCl ₂ and MnCl ₂ example, may be incubated in a buffer containing 10mM MgCl ₂ and 5mM MnCl _2. After incubation, the immunoprecipitated PCIP target molecules, e. G., Potassium channels, are separated by SDS-polyacrylamide gel electrophoresis under reducing conditions, transferred to a membrane, e. G., A PVDF membrane, and autoradiated. The presence of the detection band on the automated radiograph indicates that the PCIP substrate, for example the potassium channel, is phosphorylated. Phosphoamino acid analysis of the phosphorylated substrate can also be used to determine which residues on the PCIP substrate are phosphorylated. In summary, the radiolabeled protein bands are cleaved from the SDS gel and applied to partial acid hydrolysis. The following products are separated by one-dimensional electrophoresis and analyzed, for example, on a phosphoimager, and compared to ninhydrin stained phosphoamino acid standards. The assay described on the reference incorporated herein by reference (Tamaskovic R. et al., (1999) Biol. Chem. 380 (5): 569-78) may also be used.

In another preferred embodiment, the candidate or test compound or agent is used for their ability to inhibit or stimulate the ability of the PCIP molecule to be associated with calcium, for example, Liu L. et al., Incorporated herein by reference. (1999) Cell Signal. 11 (5): 317-24 and Kawai T. et al., (1999) Oncogene 18 (23): 3471-80).

In another preferred embodiment, the candidate or test compound or agent is capable of their ability to inhibit or stimulate the ability of the PCIP molecule to modulate chromatin formation in a cell, for example, a reference incorporated herein by reference (1999) J. Mol. Biol. 290 (2): 547-557). In addition, Can be tested using the assay described in < RTI ID = 0.0 >

In other preferred embodiments, the candidate or test compound or agent is capable of their ability to inhibit or stimulate the ability of the PCIP molecule to modulate cell proliferation, for example, as described in BAker FL (1995) CellProlif. 28 (1): 1-15, Cheviron N et al., (1996) Cell Prolif. 29 (8): 437-46, Hu ZW et al. 290 (1): 28-37 and Elliott K. et al. (1999) Oncogene 18 (24): 3564-73).

In another preferred embodiment, the candidate or test compound or agent is capable of their ability to inhibit or stimulate the ability of the PCIP molecule to modulate the association of the potassium channel protein or a portion thereof with the cytoskeleton of the cell, (1998) Cell Res, 244 (1) (1998) Cell Mol. Biol. 44 (7): 1117-27 and Chia CP et al. : 340-8). ≪ / RTI >

In another preferred embodiment, the candidate or test compound or agent is capable of determining the ability of these molecules to inhibit or stimulate the ability of the PCIP molecule to modulate membrane excitability, as described, for example, in Bar- (1985) J. Biol. Chem. 260 (8): 4740-4 and Baker JL et al. (1984) Neurosci. Lett. 47 (3): 313-8) .

In another preferred embodiment, the candidate or test compound or agent is capable of their ability to inhibit or stimulate the ability of the PCIP molecule to modulate cytokine signaling in a cell, e.g., a neuronal or cardiac cell, (Nakashima Y. et al., (1999) J. Bone Joint Surg. Am. 81 (5): 603-15) incorporated herein by reference.

In another preferred embodiment, the modulator of PCIP expression is identified in a method wherein the cell is contacted with a candidate compound and the expression of PCIP mRNA or protein is measured in the cell. The level of expression of PCIP mRNA or protein in the presence of the candidate compound is compared to the level of expression of PCIP mRNA or protein in the absence of the candidate compound. The candidate compounds can then be identified as modulators of PCIP expression based on these comparisons. For example, if the expression of PCIP mRNA or protein is greater at a statistically significant level than in the absence of the candidate compound, the candidate compound is identified as a stimulator of PCIP mRNA or protein expression. On the other hand, if the expression of the PCIP mRNA or protein is less than at a statistically significant level in the absence of the candidate compound, the candidate compound is identified as an inhibitor of PCIP mRNA or protein expression. Expression levels of PCIP mRNA or protein in a cell can be measured by the methods described herein for the measurement of PCIP mRNA or protein.

In another aspect of the invention, the PCIP protein is another protein ("PCIP binding protein" or "PCIP-bp") that binds or interacts with PCIP and is a 2-hybrid assay (1993) Cell 72: 223-232; Madura et al., (1993) J. Biol. Chem. 268: 12046-12054; Bartel et < RTI ID = 0.0 & may be used as a " bait protein " in Iwabuchi et al. (1993) Oncogene 8: 1693-1696; and Brent WO94 / 10300). Such a PCIP binding protein may also be involved, for example, in the delivery of a signal by a PCIP protein or PCIP target as a downstream element of the PCIP mediated signaling pathway. Alternatively, such a PCIP binding protein can be a PCIP inhibitor.

Two-dimensional hybrid systems are based on the molecular properties of most transcription factors consisting of cleavable DNA-binding and activation domains. In summary, the assay uses two different DNA constructs. In one construct, the gene encoding the PCIP protein is fused with a gene encoding DNA that binds to the binding domain of a known transcription factor (e. G., GAL-4). In other constructs, a DNA sequence from a DNA sequence library encoding an unidentified protein ("prey" or sample ") is fused with a gene encoding the activation domain of a known transcription factor. If a" bait " And " prey " proteins interact in vivo to form a PCIP-dependent complex, the DNA binding and activation domains of the transcription factor become very close together. This proximity is a function of the reporter ' The expression of the reporter gene can be measured, cell colonies containing the functional transcription factor can be isolated, and the cloned gene encoding a protein that interacts with the PCIP protein Lt; / RTI >

The present invention also relates to a novel agent identified by said screening assay. Accordingly, it is also within the scope of the present invention to use the identified agents in suitable animal models herein. For example, the efficacy, toxicity (eg, proliferative effect) of an identified agent (eg, a PCIP modulating agent, an antisense PCIP nucleic acid molecule, a PCIP-specific antibody, or a PCIP binding partner) , Or for measuring side effects. In addition, the identified agents described herein can be used to measure the mechanism of action of such agents in animal models. The present invention also relates to the use of the novel agents for the treatment of diseases such as CNA diseases or cardiovascular diseases identified by the above screening analysis.

B. Measurement Analysis

A portion or fragment of the cDNA sequence (and corresponding complete gene sequence) identified herein can be used in a variety of ways as a polynucleotide reagent. For example, these sequences include (i) mapping of each of these genes on the chromosome; And thereby tracking gene regions associated with genetic disorders; (Ii) identification of individuals from small amounts of biological samples (tissue typing); And (iii) forensic identification of biological samples. These applications are described below.

1. Chromosome Mapping

Once the sequence (or portion of the sequence) of the gene is isolated, such a sequence can be used to map the location of the gene on the chromosome. This method is called chromosomal mapping. Thus, as described above, a portion or fragment of the PCIP nucleotide sequence may be used for mapping the position of the PCIP gene on the chromosome. The mapping of PCIP sequences to chromosomes is an important first step in relating these sequences to genes associated with the disease.

Briefly, the PCIP gene can be mapped to a chromosome by preparing a PCR primer (preferably 15-25 bp in length) from the PCIP nucleotide sequence. Computer analysis of the PCIP sequence can be used to predict primers that do not ligate more than one exon in the genomic DNA, complicating the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual chromosomes. Only hybrids containing the PCIP sequence and the corresponding human gene will produce amplified fragments.

Somatic hybrids are prepared by fusing somatic cells from other mammals (e. G., Human and mouse cells). As human and mouse hybrids grow and divide, the human chromosome gradually disappears randomly, but the mouse chromosome is retained. Mouse cells can not grow due to lack of a specific enzyme in a mouse cell. However, human cells can maintain a human chromosome containing a gene encoding the necessary enzyme by using a growth medium. By using various media, a panel of hybrid cell lines can be established. Each cell line in the panel contains a single human chromosome or a small number of human chromosomes, and a complete set of mouse chromosomes, allowing for easy mapping of the individual genes to specific human chromosomes (see D'Eustachio P. et al. (1983) Science 220; 9190924). Somatic cell hybrids containing only a single fragment of a human chromosome can also be produced by using dislocated and deleted human chromosomes.

PCR mapping of somatic cell hybrids is a rapid process for assigning specific sequences to specific chromosomes. Three or more sequences per day may be assigned using a single thermocycler. A sub-arrangement can be achieved using a panel of fragments from a specific chromosome, while using the PCIP nucleotide sequence for the design of oligonucleotide primers. Other mapping methods that can similarly map PCIP sequences to chromosomes include hybridization at that location (see Fan, Y et al., (1990) Proc. Natl. Acad. Sci. USA, 87: 6223 -27), preliminary screening with labeled flow-sorting chromosomes, and hybridization to a chromosome-specific cDNA library.

Fluorescence in situ hybridization (FISH) of the DNA sequence for metaphase chromosome expansion at that location can be used to provide precise chromosomal location in one step. Chromosomal development can be accomplished using cells whose cell division has been blocked in the mid-stage by chemicals, such as colcemids that interfere with mitotic spindle. The chromosomes are briefly treated with trypsin and then stained with Gimsa. A bright and dark band pattern is developed on the chromosome, and chromosomes can be identified, respectively. The FISH method can use a short DNA sequence of 500 or 600 bases. However, clones larger than 1,000 bases are more likely to bind at specific chromosomal sites, with sufficient signal intensity for simple detection. Preferably, 1,000 bases, and even more preferably 2,000 bases, are sufficient to obtain good results at reasonable times. Such methods are described in references (Verma et al, Human Chromosomes: A manual of Basic Techniques (Pergamon Press, New York 1988).

Reagents for chromosomal mapping can be used to mark single sites on a single chromosome or chromosome. In fact, regions that do not encode genes are desirable for mapping purposes. The coding sequence may be more conservative than in the gene sequence, thereby increasing the likelihood of crosshybridization during chromosomal mapping.

Once the sequence is mapped to a precise chromosomal location, the physical location of the sequence on the chromosome may be related to the gene map data. Such data can be found, for example, in references (V. McKusick, Mendelian Inheritance in Man, available on-line through Johns Hopkins University Welch Medical Library). Next, the relationship between genes and diseases mapped to the same chromosomal region can be identified through linkage analysis (coinheritance of physically adjacent genes) (Egland, J. et al., (1987) Nature , 325: 783-787).

In addition, differences in DNA sequences between individuals infected with the disease associated with the PCIP gene and those not infected can be measured. If mutations are observed in some or all of the infected individuals, but not in infected individuals, mutations may be pathogens of a particular disease. Comparisons of infected and uninfected individuals generally involve primarily looking for structural deletions or chromosomes of chromosomes, such as deletions or dislocations of genes that can be detected through chromosome expansion or that can be detected by PCR based on DNA sequences do. Ultimately, the completion of sequences from several individuals can be performed to identify the presence of mutations from the polymorphism and to distinguish mutations.

2. Organizational Typing

The PCR sequence of the present invention can also be used to identify an individual from a small amount of biological sample. For example, US forces are considering using restriction fragment polymorphism (RELP) for human identification. In this method, the genomic DNA of an individual is broken down into one or more restriction enzymes and probed in a Southern blot to generate a unique band for identification. This approach eliminates the limitations of "Dog tags" that can be lost, switched or stolen, making it difficult to identify positively. The sequences of the present invention are useful as additional DNA markers for RFLP (see U.S. Patent No. 5,272,057).

In addition, the sequences of the present invention can be used to provide an alternative method of determining the actual base-to-base of a selected portion of a particular genome. As such, the PCIP nucleotide sequences described herein can be used to prepare two PCR primers from the 5 ' end and the 3 ' end of the sequence. These primers can then be used to amplify the individual DNA and subsequently sequenced.

A panel of corresponding DNA sequences from an individual produced in this manner can provide unique individual identification as each individual has a unique set of DNA sequences due to conflicting differences. The sequences of the present invention can be used to obtain such identification sequences from individuals and tissues. The PCIP nucleotide sequences of the present invention can uniquely represent parts of the human genome. Allelic variability occurs somewhat in the coding regions of these sequences and occurs more often in the noncoding regions. It is estimated that the change in allelic traits between individuals occurs at about one frequency every 500 bases. Each of the sequences described herein can be used as a standard from which DNA from an individual can be compared for purposes of identification. Since a greater number of polymorphisms occur in the noncoding region, fewer sequences are needed to distinguish individuals. Noncoding sequences can provide a satisfactory positive individual identity with a panel of about 10 to 1,000 primers yielding a 100 base noncoding amplification sequence each. When the predicted coding sequence is used, the more suitable primers for positive individuals will be 500-2000.

When a panel of reagents from the PCIP nucleotide sequence described herein is used to generate a unique identification database for an individual, the same reagent may subsequently be used to identify the tissue from the individual. Using a unique identification database, positive identification, survival or death of an individual can be performed from a small sample of tissue.

3. Uses of Partial PCIP Sequences in Forensic Biology

DNA-based identification methods can also be used in the field of legal biology. Forensic biology, for example, is a scientific field that uses genetic typing of biological evidence found in crime scenes as a means for positive identification of suspects of crime. For this identification, PCR methods can be used to amplify DNA sequences from very small quantities of biological samples found in crime scenes, such as tissue, e.g., hair or skin, or body fluids such as saliva, blood, or semen . The amplified sequence is then compared to a standard, thereby identifying the origin of the biological sample.

The sequences of the present invention can be used to provide polynucleotide reagents, e.g., PCR primers, targeted at specific positions of the human genome, including, for example, other "identification markers" Lt; RTI ID = 0.0 > DNA). ≪ / RTI > As described above, the actual nucleotide sequence information can be used for identification as an accurate alternative to the pattern formed by the fragment produced by the restriction enzyme. Sequences targeted to non-coding regions are particularly suitable for such uses because they generate a greater number of polymorphisms than in non-coding regions, which makes it easier to identify an entity in this way. Examples of polynucleotide reagents include those having 20 or more bases, preferably 30 bases or longer, as the PCIP nucleotide sequence or part thereof.

The PCIP nucleotides described herein can also be used to provide polynucleotide reagents, for example, labeled or labeled probes that can be used in in situ hybridization techniques to identify specific tissues, such as brain tissue . This may be useful when a forensic pathologist provides an organization of unknown origin. The panels of such PCIP probes can be used to identify tissues by species and / or organ type.

In a similar fashion, these reagents, e. G. PCIP primers or probes, can be used to screen tissue cultures for contaminants (screening for the presence of different types of cell mixtures in culture).

C. Preventive Medicine:

The present invention also relates to the field of preventive medicine in which diagnostic assays, predictive assays, and clinical laboratory monitoring are used for diagnostic (predictive) purposes to proactively treat individuals. Accordingly, one aspect of the present invention provides a method of detecting PCIP protein and / or nucleic acid expression as well as PCIP activity based on biological samples (e.g., blood, serum, cells, tissues) Or a risk of developing a disease associated with abnormal PCIP expression or activity. The present invention also provides a diagnostic (or predictive) assay for determining whether an individual is at risk of developing a disease associated with PCIP protein, nucleic acid expression or activity. For example, mutations in the PCIP gene can be verified in a biological sample. Such assays may be used for diagnostic or prophylactic purposes to prevent or treat individuals prior to the onset of a disease characterized by, or associated with, PCIP protein, nucleic acid expression or activity.

Another aspect of the invention relates to monitoring the effect of agents (e.g., drugs, compounds) on the expression or activity of PCIP in clinical trials.

These and other items will be described in more detail below.

1. Diagnostic test

An exemplary method for assaying for the presence or absence of a PCIP protein or nucleic acid in a biological sample comprises obtaining a biological sample from a test subject and contacting the biological sample with a PCIP protein or nucleic acid encoding the PCIP protein (e.g., mRNA, Genomic DNA) to detect the presence of a PCIP protein or nucleic acid in a biological sample. A preferred agent for detecting PCIP mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing PCIP mRNA or genomic DNA. Nucleic acid probes may comprise, for example, a full length PCIP nucleic acid, such as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, , SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: The nucleic acid of SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69, SEQ ID NO: 98936, 98937, 989388, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948 Or at least a portion thereof, such as at least 15, 30, 50, 100, or 100% in length, of a DNA insert sequence deposited with the ATCC at the Korean Society for Biotechnology, 98949, 98950, 98951, 98991, 98993 or 98994 , Oligonucleotides of 250 or 500 nucleotides O lactide may be, it is sufficient to hybridize specifically under stringent conditions to PCIP mRNA or genomic DNA. Other suitable probes for use in the diagnostic assays of the present invention are described herein.

A preferred agent for detecting the PCIP protein is an antibody capable of binding to the PCIP protein, preferably an antibody having a detectable label. The antibody may be polyclonal, or more preferably, monoclonal. An uninjured antibody, or a fragment thereof (e.g., Fab or F (ab ') ₂ ), may be used. The term " labeled " in relation to a probe or antibody refers to a probe or a probe by reactivity with another directly labeled reagent, as well as direct labeling by a coupling (i.e., physical binding) It is intended to include indirect labeling of the antibody. Examples of indirect labeling include detecting a first antibody using a fluorescently labeled second antibody and biotinylated labeling of the DNA probe so that it can be detected with fluorescence labeled streptavidin. The term " biological sample " is intended to include tissue, cells and biological fluids isolated from the subject as well as tissues, cells and fluids present in the subject. That is, the detection method of the present invention can be used to detect PCIP mRNA, protein, or genomic DNA in an in vitro biological sample as well as in vitro. For example, in vitro techniques for detection of PCIP mRNA include Northern hybridization and in situ hybridization. In vitro techniques for the detection of PCIP proteins include enzyme-linked immunosorbent assays (ELISA), Western blot, immunoprecipitation and immunofluorescence. In vitro techniques for detection of PCIP genomic DNA include Southern hybridization. In addition, in vivo techniques for the detection of PCIP proteins include the introduction of anti-PCIP antibodies labeled with the subject. For example, such an antibody may be labeled with a radioactive marker whose presence and location on the subject can be detected by standard imaging techniques.

In one embodiment, the biological sample comprises protein molecules from the test subject. Alternatively, the biological sample may comprise mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a serum sample or cerebrospinal fluid isolated from the subject by conventional means.

In another embodiment, the method comprises obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting a PCIP protein, mRNA, or genomic DNA to produce a PCIP protein, mRNA or genomic DNA The presence of a PCIP protein, mRNA or genomic DNA in a control sample and the presence of a PCIP protein, mRNA or genomic DNA in a test sample.

The invention also includes a kit for detecting the presence of PCIP in a biological sample. For example, the kit may comprise a labeled compound or agent capable of detecting a PCIP protein or mRNA in a biological sample; Means for measuring the amount of PCIP in the sample; And means for comparing the amount of PCIP in the sample to a standard. The compound or agent may be packaged in a suitable container. The kit may further include a guide for using the kit to detect PCIP protein or nucleic acid.

2. Diagnostic test

The diagnostic methods described herein can also be used to identify subjects at risk for having or having a disease or disorder associated with abnormal PCIP expression or activity. For example, assays described herein, such as a prior diagnostic test or a follow-up test, may be used to treat neurodegenerative diseases such as Alzheimer's disease, dementia associated with Alzheimer's disease (such as peak illness), Parkinson's disease and other Lewy diffuse body disease, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, spinal cerebellar ataxia and Creutzfeldt Jakob disease; Psychiatric disorders such as depression, schizophrenia, Korsakov's psychosis, mania, anxiety, bipolar disorder or phobias; Learning or memory impairment, for example amnesia or age-related memory loss; Neurological disorders such as migraine; Pain disorders such as hyperalgesia or pain associated with musculoskeletal disorders; Spinal cord injury; heart attack; And head trauma; Or PCIP protein activity such as cardiovascular disease such as freeze insufficiency, angina pectoris, heart attack, hypertension, cardiac arrhythmia, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm or arrhythmia Or may be used to identify subjects at risk for or having a disease associated with a control error in nucleic acid expression.

Alternatively, the diagnostic assays can be used to identify subjects at risk for, or at risk for, diseases associated with PCIP protein activity, such as potassium channel related disease, or control errors in nucleic acid expression. Thus, the present invention provides a method for detecting a PCIP protein or nucleic acid, comprising obtaining a test sample from a subject and detecting the PCIP protein or nucleic acid (e.g., mRNA or genomic DNA) to determine whether the presence of the PCIP protein or nucleic acid is indicative of a disease or condition associated with abnormal PCIP expression or activity A method of identifying a disease or disorder associated with abnormal PCIP expression or activity, which diagnoses a subject at risk of developing. As used herein, " test sample " refers to a biological sample obtained from a subject. For example, the test sample can be a biological fluid (e. G., Serum), a cell sample, or a tissue.

In addition, the diagnostic assays described herein can be used to treat disorders or diseases associated with abnormal PCIP expression or activity by administering to a subject (e.g., an agent, an antagonist, a peptidomimetic, a protein, a peptide, a nucleic acid, a small molecule, Or other drug candidates) can be administered. For example, such methods can be used to determine if a subject can be effectively treated for CNS disease or cardiovascular disease. Thus, the present invention provides a method for detecting a PCIP protein or nucleic acid expression or activity (e. G., Determining the presence or extent of a PCIP protein, or nucleic acid expression or activity associated with abnormal PCIP expression or activity, To determine if the subject can be effectively treated for a disease associated with abnormal PCIP expression or activity.

The method of the present invention can also detect genetic alterations in the PCIP gene to determine whether a subject with the altered gene is at risk for a disease characterized by a PCNP protein activity such as a CNS disease or cardiovascular disease, Can be used for measurement. In a preferred embodiment, the methods of the invention detect, in a sample of cells from a subject, the presence or absence of a genetic modification characterized by one or more alterations affecting the integrity of the gene encoding the PCIP-protein or the misrepresentation of the PCIP gene . For example, such genetic modifications include 1) deletion of one or more nucleotides from the PCIP gene; 2) addition of one or more nucleotides to the PCIP gene; 3) substitution of one or more nucleotides of the PCIP gene; 4) Chromosomal rearrangement of the PCIP gene; 5) modification of the PCIP gene at the mRNA level; 6) abnormal transformation of PCIP gene such as DNA methylation pattern of DNA, 7) presence of non-wild type slicing pattern of mRNA transcription of PCIP gene, 8) non-wild type level of PCIP-protein, 9) allele loss of PCIP gene, 10) can be detected by confirming the presence of one or more of the translational modifications after non-conformity of the PCIP protein. As is described herein, the known methods of assaying that can be used to detect deformation in the PCIP gene are the majority. A preferred biological sample is a tissue or serum sample isolated from the subject by conventional means.

In certain embodiments, the detection of the deformation is accomplished by polymerase chain reaction (PCR) such as anchor PCR or RACE PCR (see, for example, U.S. Patent Nos. 4,683,195 and 4,683,202) or alternatively, Ligation Reference examples include the use of probes / primers in Landegran et al. (1988) Science 241: 1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91: 360-364) May be particularly useful in detecting point mutations in the PCIP gene (Abravaya et al. (1995) Nucleic Acids Res. 23: 675-682. The method comprises the steps of collecting a cell sample from a subject, separating the nucleic acid (e. G., Genomic, mRNA, or both) from the sample cell, hybridizing and amplifying the PCIP gene (if present) Contacting said nucleic acid sample with at least one primer that specifically hybridizes to the PCIP gene and detecting the presence or absence of the amplification product, detecting the size of the amplification product, and comparing the length against the control sample . It is envisioned that PCR and / or LCR would preferably be used as the pre-amplification step with the techniques used to detect the mutations described herein.

Still another amplification method is self-supporting sequence replication (Guatelli, JC et al, ( 199) Proc Natl Acad Sci USA 87:..... 1874-1878)., Transcription amplification system (Kwoh, DY et al, ( 1989) Proc ... Natl Acad Sci USA 86 :. 1173-1177), Q- Beta replica claim (Replicase) (Lizardi, PM et al (1988.) Bio-Technology 6: 1197), or other nucleic acid amplification method include And then amplified molecules are detected using techniques well known to those skilled in the art. Such detection methods are particularly useful for detecting nucleic acid molecules when such molecules are present in very small numbers.

In another embodiment, the mutation in the PCIP gene from the sample cell can be confirmed by a modification in the restriction enzyme cleavage pattern. For example, sample and control DNA are isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes measured and compared by gel electrophoresis. The difference in fragment length size between the sample and the control DNA indicates the variation in the sample DNA. In addition, the use of sequence specific ribozymes (see, e.g., US Patent No. 5,498, 531) can be used to record the presence of specific mutations due to the development or loss of the ribozyme degradation site.

In another embodiment, the gene mutation in PCIP can be identified by hybridizing the sample and control nucleic acid, e. G., DNA or RNA, to a high density array containing hundreds or thousands of oligonucleotide probes (cronin, MT et al., (1996) Human Mutation 7: 244-255; Kozal, MJ et al. (1996) Nature Medicine 2: 753-759]. For example, gene mutations in PCIP can be detected using the above cronin, M. < RTI ID = 0.0 > tea. Dimensional array containing a photo-generated DNA probe as described in the literature such as < RTI ID = 0.0 > In summary, a first hybridization array of probes can be used to scan across a long stretch of DNA in the sample and control to create a linear array of sequential redundant probes to confirm the base change in sequence. This step enables identification of point mutations. After this step, a second hybridization arrangement is made that allows the characterization of specific mutations by using smaller, more specific probes complementary to all variants or mutants detected. Each mutation sequence consists of a set of parallel probes, one complementary to the wild type gene and the other complementary to the mutated gene.

In yet another embodiment, the various known sequence analysis reactions can be used to directly sequence the PCIP gene and to detect the mutation by comparing the sequence of the sample PCIP with the corresponding wild-type (control) sequence. Examples of sequencing reactions include Maxam and Gilbert (1997) Proc. Natl. Acad. Sci. USA 74: 560) or Sanger ((1997) Proc. Natl. Acad. 74: 5463). In addition, many automated sequencing procedures by mass spectrometry (see, for example: PCT International Application WO 94/16101; Cohen et al (1996 ) Adv Chromatogr 36:..... 127-162; and Griffin et al (1993) Appl Biochem . including by sequencing by 147-159) diagnostic assays ((1995) Biotechniques 19:: Biotechnol 38. are contemplated that may be used in the case of performing 448).

Another method for detecting mutations in the PCIP gene is that the protection from the degrading agent is used to detect mismatch bases in RNA / RNA or RNA / DNA heteroduplex (see Myers et al (1985) Science 230: 1242]. In general, the art of "mismatch degradation" is disclosed by providing a heteroduplex formed by hybridizing (labeled) RNA or DNA containing a wild-type PCIP sequence to a potential mutant RNA or DNA obtained from a tissue sample. Double-stranded duplexes are treated to disrupt single-stranded regions of the two flexes that would otherwise be due to base pair mismatches between the control and sample strands. For example, an RNA / DNA duplex can be treated with an S1 nuclease treated RNase and a DNA / DNA hybrid that enzymatically degrade the mismatched region. In other embodiments, the DNA / DNA or RNA / DNA duplex can be treated with hydroxylamine or osmium tetroxide and with piperidine to decompose the mature match region. After degradation of the mitch match region, the resulting material is then degraded to size for polyacrylamide gel degeneration to determine the site of variation (see, e.g., Cotton et al. (1988) Proc. Natl Acad Sci USA 85: 4397; Saleeba et al. (1992) Methods Enzymol . 217: 286-295). In a preferred embodiment, the control DNA or RNA may be labeled for detection.

In yet another embodiment, the MTC degradation reaction is performed in double-stranded DNA (so-called " DNA mismatch repair " enzymes) in a system defined for detecting and mapping point mutations in PCIP cDNA obtained from a sample of cells One or more proteins that recognize match base pairs are used. For example, the mutY enzyme of E. coli degrades A in G / A mismatches and thymidine DNA glycosylase from HeLa cells degrades T in G / T mismatches (Hsu et al. (1994) Carcinogenesis 15: 1657-1662]. According to an illustrative embodiment, a probe based on a PCIP sequence, e. G., A wild-type PCIP sequence, is hybridized with cDNA or other DNA products from a test cell. This duplex is treated with a DNA mismatch repair enzyme and, if present, degradation products can be detected from electrophoresis protocols and the like (see, for example, U.S. Patent No. 5,459,039).

In another embodiment, alterations in electrophoretic mobility can be used to identify mutations in the PCIP gene. For example, single strand conformation polymorphism (SSCP) can be used to detect differences in electrophoretic mobility between mutant and wild-type nucleic acids (Orita et al.91989) . Proc Natl. Acad. Sci USA: 86: 2766; Cotton (1993) Mutat. Res . 285: 125-144; and Hayashi (1992) Genet. Anal. Tech. Appl. 9: 73-79). Single stranded DNA fragments of the sample and control PCIP nucleic acid will be denatured and denatured. The second structure of the single-stranded nucleic acid varies according to the sequence, and consequently, deformation in the electrophoretic mobility enables detection of even a single base change. The DNA fragment can be labeled or detected with a labeled probe. The sensitivity of assays can be enhanced by using RNA (rather than DNA), where the second structure is more sensitive to sequence variation. In a preferred embodiment, the method separates double-stranded heteroduplex molecules based on changes in electrophoretic mobility using heteroduplex analysis (Keen et al. (1991) Trends Genet 7: 5).

In another embodiment, the migration of the mutant or wild-type fragment in a polyacrylamide gel containing a gradient of the modified product is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313 : 495]. When DGGE is used as an analytical method, the DNA will be modified to ensure that it is not fully denatured, for example, by adding a GC clamp of about 40 bp of highly molten GC-floating DNA by PCR. In another embodiment, a temperature gradient is used in place of the denaturing gradient to confirm the difference in mobility of the sample DNA with the control (Rosenbaum and Reissner (1987) Biophys Chem 265: 12753).

Other examples of techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers can be prepared by centering known mutations and then hybridizing to the target DNA under conditions that permit hybridization only when complete matches are found (see Saiki et al. (1986 ) Nature 324: 163; Saiki et al. (1989) Proc. Natl Acad. Sci USA 86: 6230]. Such allele-specific oligonucleotides are hybridized to the PCR amplified target DNA or a number of different mutants when the oligonucleotide is attached to the hybridizing membrane and hybridized with the labeled target DNA.

Alternatively, allele-specific amplification techniques that rely on selective PCR amplification can be used with the present invention. Oligonucleotides used as primers for specific amplification can be introduced at the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17: 2437-2448) (Prossne (1993) Tibtech 11: 238) of primers that can prevent or reduce polymerase extensions. It may also be desirable to introduce a new restriction site in the mutation region to create a detection based on degradation (Gasparini et al. (1992) Mol. Cell Probes 6: 1]. In certain embodiments, it is expected that amplification can be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88: 189]. In this case, only if there is a complete match at the 3 ' end of the 5 ' sequence, the linkage will occur and the presence or absence of amplification will be sought to enable detection of the presence of a known mutation at the specific site.

The methods described herein include, for example, one or more of the probe nucleic acids or antibody reagents described herein that can be conveniently used in clinical settings for diagnosing a patient exhibiting symptoms or family history of a disease or condition associated with the PCIP gene Can be carried out by using a diagnostic kit packed before sale.

Furthermore, cell types or tissues in which PCIP is expressed can be used in the diagnostic assays described herein.

3. Monitoring of effects during imitation experiments

Monitoring the effects of agents (e.g., drugs) on the expression or activity of PCIP proteins (e.g., modulation of membrane excitability or resting potential) can be applied in clinical trials as well as basic drug screening have. For example, the efficacy of the agent determined by screening assays as described herein to increase PCIP gene expression, protein levels, or upregulate PCIP activity may be enhanced by reduced PCIP gene expression, protein level or downregulated PCIP activity May be monitored in clinical trials of subjects exhibiting < RTI ID = 0.0 > Alternatively, the efficacy of the agent determined by screening assays to decrease PCIP gene expression, protein levels, or down-regulate PCIP activity may be assessed by comparing the efficacy of PCIP gene expression, protein level or up-regulated PCIP activity Can be monitored in the test. In such clinical trials, the expression or activity of the PCIP gene and preferably other genes involved in, for example, potassium channel related diseases may be used as phenotypic markers or " read out " of the particular cell.

(E.g., a compound, drug, or small molecule) that modulates PCIP activity (e.g., as identified in screening assays as described herein), including, but not limited to, The regulated genes in the cells can be identified. Thus, for example, in order to study the effects of agents on potassium channel-related diseases in clinical trials, cells can be isolated, RNA prepared, and analyzed for expression levels of other genes involved in PCIP and potassium channel related diseases, respectively have. The level of gene expression (e. G., Gene expression pattern) may be determined by Northern blot analysis or RT-PCR as described herein, or alternatively by measuring the amount of protein produced, , Or by measuring the activity levels of PCIP or other genes. In this way, the gene expression pattern can act as a marker for the physiological response of the cell to the agent. Thus, this response state can be measured at various points before and during treatment of the individual.

In a preferred embodiment, the present invention provides a method of treating a subject, comprising: (i) obtaining a pre-dose sample from a subject prior to administering the agent; (ii) detecting the level of expression of the PCIP protein, mRNA, or genomic DNA in the sample before administration; (iii) obtaining a sample after one or more doses from the subject; (iv) detecting the expression or activity level of the PCIP protein, mRNA or genomic DNA from the sample after administration; (v) comparing the level of expression or activity of the PCIP protein, mRNA or genomic DNA of the sample before administration with the PCIP protein, mRNA or genomic DNA of the sample or sample after administration; And (vi) administering the agent to a subject, such as an agent, an antagonist, a peptidomerocyte, a protein, a peptide, a nucleic acid, a small molecule or a screening assay described herein, ≪ RTI ID = 0.0 > and / or < / RTI > other drug candidates identified by the drug). For example, administration of an increased agent is desirable to increase the expression or activity of PCIP above the level detected, i.e., to increase the efficacy of the agent. Alternatively, administration of the reduced agent is desirable to reduce the expression or activity of PCIP to a level that is less than that detected, i. E., To reduce the efficacy of the agent. According to this embodiment, PCIP expression or activity may be used as an indicator of efficacy in the absence of observable phenotypic responses.

D. Treatment

The present invention provides prophylactic and therapeutic methods of treating subjects with or susceptible to (susceptible to) diseases associated with abnormal PCIP expression or activity. With respect to prophylactic and therapeutic treatment methods, such treatments can be specifically tailored or modified based on knowledge gained from the field of " pharmacogenomics ". As used herein, " pharmacogenetics " refers to the application of genomic techniques such as gene sequence analysis, statistical genetics and clinical development and gene expression analysis for drugs in the market. More specifically, the term is intended to study how a gene of a patient determines a response to a drug (e.g., a "drug response phenotype" or "drug response genotype" of a patient.) Thus, The present invention provides a method for tailoring prophylactic or therapeutic treatment of an individual with the PCIP molecule or PCIP modulator of the present invention, depending on the individual drug response genotype. Pharmacogenetics can be used by a clinician or physician to treat a patient, And to prevent patients with adverse drug-related side effects from being treated.

1. Prevention Methods

In one aspect, the invention provides a method of inhibiting a condition or disease associated with abnormal PCIP expression or activity from a subject by administering to the subject an agent or PCIP modulating PCIP expression or one or more PCIP activity. Subjects at risk for, or at risk for, abnormal PCIP expression or activity can be identified, for example, by one or a combination of the diagnostic or prophylactic assays described herein. Administration of the prophylactic agent may be effected before symptoms indicative of a characteristic above PCIP are expressed, such that the disease or disorder is prevented or otherwise delayed. Depending on the type of PCIP or more, for example, PCIP, PCIP agonists or PCIP antagonists may be used to treat the subject. Suitable i can be measured based on the screening assays described herein.

2. Treatment

Another aspect of the invention relates to a method of modulating PCIP expression or activity for therapeutic purposes. Thus, in an exemplary embodiment, the modulating method of the invention comprises contacting the cell with an agent or PCIP modulating at least one activity of the PCIP protein activity associated with the cell. Agents that modulate PCIP protein activity include nucleic acid or protein, natural target molecules of PCIP protein (e.g., PCIP substrate), PCIP antibodies, PCIP agonists or antagonists, PCIP agonists or antagonists, peptidomes or other small molecules, May be the same as described herein. In one embodiment, the agent stimulates one or more PCIP activities. Examples of such irritants include nucleic acid molecules encoding the PCIP introduced into cells and active PCIP proteins. In yet another embodiment, the agent inhibits one or more PCIP activities. Examples of such inhibitors include antisense PCIP nucleic acid molecules, anti-PCIP antibodies and PCIP inhibitors. Such modulation may be performed in vitro (e.g., by incubating the cells) or, alternatively, in vivo (e.g., by administering the agent to the subject). Thus, the present invention provides a method of treating an individual suffering from a disease or disorder characterized by abnormal expression or activity of a PCIP protein or nucleic acid molecule. Examples of such diseases include, but are not limited to, CNS disorders such as neurodegenerative diseases such as Alzheimer's disease, dementia associated with Alzheimer's disease (such as peak disease), Parkinson's disease and other diseases such as Louvre's Disease, Progressive supranuclear palsy, epilepsy, spinal cerebellar ataxia and Creutzfeldt Jakob disease; Psychiatric disorders such as depression, schizophrenia, Korsakov's psychosis, mania, anxiety, bipolar disorder or phobias; Learning or memory impairment, for example amnesia or age-related memory loss; Neurological disorders such as migraine; Pain disorders such as hyperalgesia or pain associated with musculoskeletal disorders; Spinal cord injury; heart attack; And head trauma; Or cardiovascular diseases such as atherosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, deep seated formation, rapid heart rate tachycardia, coronary microemboliemia, vomiting, bradycardia, pressure overload, aortic bending, coronary artery disease Myocardial infarction, myocardial infarction, coronary artery disease, coronary heart disease, myocardial infarction, atrial fibrillation, atrial fibrillation, intestinal QT syndrome, congestive heart failure, frozen heart failure, angina pectoris, heart attack, hypertension, Arterial spasm or arrhythmia. In one embodiment, the invention contemplates administering a combination of agents that modulate (e.g., upregulate or downregulate) PCIP expression or activity (e. G., As identified by the screening assays described herein) . In another embodiment, the invention includes administering a PCIP protein or nucleic acid molecule as a therapeutic agent to compensate for reduced or abnormal PCIP expression or activity.

In a preferred embodiment of the invention, the invention comprises a method of treating a PCIP-related disease or condition, comprising administering to the subject a therapeutically effective amount of an antibody. As defined herein, a therapeutically effective amount (i. E., An effective dosage) of the antibody is from 0.001 to 30 mg, preferably from about 0.01 to 25 mg, more preferably from about 0.1 to 20 mg, 10 mg, 2 to 9 mg, 3 to 8 mg, 4 to 7 mg, or 5 to 6 mg. Those skilled in the art will appreciate that certain factors, including, but not limited to, the severity of the disease or disorder, previous treatment, the overall health status and / or age of the subject, and other conditions may affect the dosage required to effectively treat the subject Will be aware of the possibility. In addition, treating a subject with a therapeutically effective amount of an antibody may comprise a single treatment or, preferably, may include concurrent treatment. In a preferred embodiment, the subject is administered once per week for about 1 to 10 weeks, preferably for 2 to 8 weeks, more preferably for about 3 to 7 weeks, more preferably for about 4, 5 or 6 weeks, 20 mg / kg body weight. It should also be appreciated that the effective dose of the antibody used in therapy may increase or decrease over the course of a particular treatment. Changes in dosage can result from the results of the diagnostic assays described herein.

Stimulation of PCIP activity is desirable in situations where PCIP is abnormally down-regulated and / or increased PCIP activity would have a beneficial effect. For example, stimulation of PCIP activity is desirable in situations where PCIP is down-regulated and / or where increased PCIP activity would have beneficial effects. Similarly, inhibition of PCIP activity is desirable in situations where PCIP is likely to have an advantageous effect of abnormally upregulated and / or increased PCIP activity.

3. Pharmacogenetics

The agent or agent having an enhancing or inhibitory effect on the PCIP molecule of the present invention as well as the PCIP activity (e. G., PCIP gene expression) identified by the screening assays described herein may be administered to the individual to determine whether a potassium channel Related diseases (e. G., CNS disorders such as neurodegenerative diseases such as Alzheimer ' s disease, dementia associated with Alzheimer ' s disease (such as Peak Disease), Parkinson ' s disease and other diseases such as Louvre's Disease, multiple sclerosis, For example schizophrenia, psychosis, Korsakoff psychosis, mania, anxiety, bipolar disorder or phobias; learning or memory impairment, for example, schizophrenia, schizophrenia, , Memory loss or age-related memory loss, neurological disorders such as migraine, pain disorders such as musculoskeletal disorders Such as atherosclerosis, ischemic reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, vascular formation, rapid heart rate, and / or cardiovascular disease, Atrial fibrillation, Atrial fibrillation, Atrial fibrillation, Chronic QT syndrome, Congestive heart failure, Frozen section depression, Angina pectoris, Heart attack, Hypertension, Cardiac arrhythmia, Atrial fibrillation, Coronary artery hypertrophy, Coronary artery hypertrophy , Dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary spasm or arrhythmia) (either prophylactically or therapeutically). With this treatment, pharmacogenetics (a study of the relationship between an individual's genotype and an individual's response to an exogenous compound or drug) can be considered. Differences in metabolism of the therapeutic agent can lead to severe toxicity or treatment failure by altering the relationship between the dose of the pharmacologically active agent and the blood concentration. Thus, the knowledge obtained from relevant pharmacogenetic studies in adjusting therapeutic regimens and / or dosages of treatment using PCIP molecules or PCIP modulators, as well as decisions on whether to administer PCIP molecules or PCIP modulators, Can be considered.

Pharmacogenetics deals with clinically important genetic alterations in response to drugs due to altered drug placement and anomalous behavior in diseased persons (see for example Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol . 23 (10-11): 983-985 and Linder, MW et al. (1997) Clin. Chem. 43 (2): 254-266). Generally, two types of pharmacogenetic states can be distinguished. A genetic state that is inherited as a single factor that modifies the way the drug acts on the body (modified drug action), or a genetic state that is inherited as a single factor that alters the way the body acts on the drug (modified drug metabolism) . Such a drug-genetic condition can occur either as a naturally occurring polymorphism or as a rare genetic defect. For example, glucose-6-phosphate dehydrogeoxygenase deficiency (G6PD) is associated with a major clinical complication following ingestion of oxidative drugs (anti-malaria, sulfonamide, analgesic and nitrofuran) and consumption of fava beans It is a common genetic enzyme disease which is hemolysis afterwards.

One of the pharmacogenetics methods to identify genes that predict drug reactions known as " genome-wide association " is the use of known gene related markers (e. G., Two mutants each having two mutants Biallelic " gene marker map consisting of 60,000 to 100,000 polymorphic or variable regions on the genome of the genome. Such high resolution genetic maps identify markers associated with a particular observed drug response or side effect This high resolution map can be compared to the combination of tens of thousands of known single nucleotide polymorphisms (SNPs) of the human genome, As used herein, " SNP " refers to a single nucleotide in a DNA stretch For example, SNPs can occur once every 1000 bases of DNA, although SNPs can be involved in disease processes, but the vast majority may be disease-free. Given a genetic map of the genome, individuals can be grouped into genetic categories that depend on a particular pattern of SNPs in an individual's genome. In this way, considering characteristics that may be common among genetically similar individuals, It can be adjusted to an entirely similar group of individuals.

Alternatively, a " candidate gene approach " can be used to identify genes that predict drug response. According to this method, when a gene encoding a drug target is known (e.g., the PCIP protein of the present invention), all common mutants of this gene can be identified fairly easily in the population, It can be measured whether a certain type of gene has a specific drug reaction.

As an illustrative example, the activity of a drug metabolizing enzyme is a major determinant of both the strength and duration of drug activity. The discovery of the genetic polymorphisms of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2) and the cytochrome P450 enzymes CYP2D6 and CYP2C19) suggests that some patients do not achieve the expected drug effect, After dosing, explanations were given for the reasons for excessive drug response and severe toxicity. These polymorphisms are expressed in two phenotypes in the population, including metastatic (EM) and low-metabolism (PM) patients. The prevalence of PM is different among different populations. For example, gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM, all of which lead to the absence of functional CYP2D6. Low-dose patients with CYP2D6 and CYP2C19 exhibit over-frequent drug reactions and side effects when administered at standard doses. If the metabolite is the active therapeutic moiety, PM does not show a therapeutic response, which is evidenced by the CYP2D6-formed metabolite morphine-mediated strand effect of codeine. The other extremes are super-fast metabolites that do not respond to so-called standard doses. Recently, the molecular basic structure of hyperbaric metabolism has been confirmed by CYP2D6 gene amplification.

Alternatively, a method called " profiling gene expression " can be used to identify genes that predict drug response. For example, gene expression in an animal to which a drug (e. G., A PCIP molecule or PCIP modulator of the invention) has been administered may indicate whether the gene pathway associated with toxicity has been turned on.

Information generated from one or more of the pharmacogenomics methods may be used to determine suitable dosages and treatment regimens for prophylactic or therapeutic treatment of the subject. This knowledge is useful when treating a subject with a PCIP molecule or PCIP modulator, such as a modulator identified by one of the typical screening assays described herein, by preventing adverse reactions or treatment failures when applied to administration or drug selection, And the prevention effect can be improved.

The invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application, as well as drawings and sequence listings, are incorporated herein by reference.

The following materials and methods were used in the examples.

Strains, plasmids, bait cDNAs and general microbiological techniques

The basic yeast strains (HF7c, Y187), bait (pGBT9) and fish (pACT2) plasmids used in this experiment were purchased from Clontech (Palo Alto, Calif.). CDNA encoding the rat Kv4.3, Kv4.2 and Kv1.1 was obtained from Wyeth-Ayerst Research (865 Ridge Rd., Monmouth Junction, NJ 08852). Standard yeast media containing synthetic complete medium lacking L-leucine, L-tryptophan and L-histidine were prepared and yeast genetic manipulation was performed as known (Sherman (1991) Meth. Enzymol. 194: 21). Yeast transfections were performed using standard protocols (Gietz et al. (1992) Nucleic Acids Res. 20: 1425; Ito et al (1983) J. Bacteriol. 153: 163-168). Plasmid DNA was isolated from yeast strains by standard methods (Hoffman and Winston (1987) Gene 57: 267-272).

Composition of bait and yeast strains

The first 180 amino acids of rKv4.3 (Serdio P. et al. (1996) J. Neurophys 75: 2174-2179) were amplified by PCR and cloned into pGBT9 framewise to obtain plasmid pFWA2 &Quot;). This bait was transformed into the 2-hybrid screening strain HF7c and tested for expression and self-activation. The bait was confirmed for expression by Western blotting. rKv4.3 bait was not self-activated in the presence of 10 mM 3-amino-1,2,3-triazole (3-AT).

Configuring the Library

Rat midbrain tissue was obtained from Wats-Ehlestrist (Monmouth Junction, NJ 08852). Whole cell RNA was extracted from tissues using standard techniques (Sambrook, J., Fritsh, EF, and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press , Cold Spring Harbor, NY, (1989)). mRNA was prepared using the Poly-A Spin mRNA Isolation Kit from New England Biolabs (Beverly, Mass.). cDNA from the mRNA sample was synthesized using a cDNA synthesis kit from Stratagene (La Jolla, Calif.) and ligated into the EcoRI and XhoI sites of pACT2 to generate a 2-hybrid library.

2-Hybrid Screening

Hybrid screens were prepared essentially as described in Bartel, P., et al. (1993) "Using the Two-Hybrid System to Detect Polypeptide using the bait-library pair of the rkv4.3 bait- -Polypeptide Interactions " in Cellular Interactions in Development: A Practical Approach, Hartley, DA ed. Oxford University Press, Oxford, pp. 153-179. ≪ / RTI > Filter disk beta-galactosidase (beta-gal) assays were performed essentially as known (Brill et al. (1994) Mol. Biol. Cell. 5: 297-312). Scoring a positive clone for both reporter gene activity (His and beta-galactosidase), isolating the fish plasmid from the yeast, transforming into E. coli strain KC8, purifying the DNA plasmid, generating (Sanger F. et al. (1977) PNAS, 74: 5463-67).

Specificity test

Positive interaction material clones were applied to binding specificity tests where these clones were exposed to a panel of baits not related to the relevant bait by a known mating scheme (Finley RL Jr. et al. (1994) PNAS, 91 (26): 12980-12984). Briefly, the positive fish plasmid was transformed into Y187 and the panel of bait was transformed into HF7c. Transfected fish and bait cells were streaked as streaks on selected embryos, mated on YPAD plates and tested for reporter gene activity.

analysis

PCIP nucleotides were analyzed for nucleic acid hits by the BLASTIN 1.4.8 MP program (Altschul et al. (1990) Basic Local Alignment Search Tool, J. Mol. Biol. 215: 403-410). PCIP proteins were analyzed for polypeptide hits by the BLASTP 1.4.9MP program.

Example 1: Identification of rat PCIP cDNA

The Kv4.3 gene coding sequence (initially encoding 180 amino acids) was amplified by PCR and cloned into pGBT9 to generate the GAL4 DNA binding domain-Kv4.3 (1-180) gene fusion (plasmid pFWA2). HF7c was transformed into this construct. The resulting strain was grown in the presence of L-tryptophan and L-histidine in the presence of 10 mM 3-AT on a synthetic complete medium lacking L-tryptophan, which is not a synthetic complete medium, which contains {GAL4 DNA-binding domain} - {vKv4 .3 (1-180)} gene fusants do not have an endogenous transcription activation activity higher than the threshold allowed by 10 mM 3-AT.

In this example, a yeast two-hybrid assay was performed in which a plasmid containing the {GAL4 DNA-binding domain} - {rKv4.3 (1-180)} gene fusions was transfected with the yeast 2-hybrid screening strain 0.0 > HF7c. ≪ / RTI > Thereafter, HF7c was transformed into a rat midbrain 2-hybrid library. Approximately 6 million transformants were obtained and plated in selective media. Colonies that grew on selective media and expressed beta-galactosidase reporter gene were further characterized and applied for retransformation and specificity assays. The retransformation and specificity tests resulted in three PCIP clones (rats 1v, 8t and 9qm) that are capable of binding to Kv4.3 polypeptides.

The full-length sequence for the rat 1v gene and the partial sequence for the 8t and 9q genes were derived as follows. Probes were prepared using partial rat PCIP sequences and used to screen, for example, the rat midbrain cDNA library. Positive clones were identified, amplified and sequenced using standard techniques to obtain full length sequences. In addition, the 5'end of the transcript was completed using the rapid amplification of the existing rat PCIP cDNA ends (using, for example, 5'RACE (Gibco, BRL)).

Example 2: Identification of human 1v cDNA

To obtain human lv nucleic acid molecules, cDNA libraries generated from human hippocampus (Clontech, Palo Alto, Calif.) Were screened under low stringency conditions as follows: Clontech Express Hyb solution Hour and then hybridized overnight at < RTI ID = 0.0 > 42 C. < / RTI > The probe used was a PCR generated fragment containing nucleotides 49-711 of the rat sequence labeled with ³² P dCTP. The filters were washed 6 times in 2XSSC / 0.1% SDS at 55 < 0 > C. The same conditions were used for the secondary screening of the positive isolates. The clones thus obtained were sequenced using an ABI automated DNA sequencing system and compared to the known sequences from the GenBank database as well as the rat sequences shown in SEQ ID NO: 3. The maximum clone from the library screen was subcloned into pBS-KS + (Stratagene, La Jolla, Calif.) To confirm the sequence. A 515 base pair clone containing 211 base pairs of the 5 'UTR and 304 base pair coding regions was determined to represent the human homolog of the 1 v gene. To generate full-length cDNA, 3'RACE was used according to manufacturer's instructions (Clontech Advantage PCR kit).

Example 3: Isolation and characterization of 1v splicing variants

The mouse 1v shown in SEQ ID NO: 5 and the rat 1vl splicing variant shown in SEQ ID NO: 7 were isolated using a 2-hybrid assay as described in Example 1. The mouse 1vl splicing variant shown in SEQ ID NO: 7 was isolated by screening a mouse brain cDNA library and the rat 1vn splicing variant shown in SEQ ID NO: 11 was isolated by BLAST search.

Example 4: Isolation and identification of 9q and other PCIPs

Rat 9qc (SEQ ID NO: 15) was isolated by database mining and rat 9qm (SEQ ID NO: 21) was isolated by 2-hybrid assay and rat 9qc (SEQ ID NO: . Human 9ql (SEQ ID NO: 13) and human 9qs (SEQ ID NO: 23) were identified as described in Example 2. Mouse 9ql (SEQ ID NO: 17), monkey 9qs (SEQ ID NO: 25), human p193 (SEQ ID NO: 39), rat p19 (SEQ ID NO: 33) and mouse p19 I was identified by database mining. Rat 8t (SEQ ID NO: 29) was identified using a 2-hybrid assay. The sequence of W28559 (SEQ ID NO: 37) was identified by sequencing of the identified EST with database mining and GeneBank accession number AI352454. The protein sequence was found to contain 41 amino acid regions with strong homology to 1v, 9ql and pl9 (see alignment shown in Figure 25). However, downstream of this homology region, the sequence differs from the sequence of the PCIP family. Such a sequence may represent a gene having a 41 amino acid domain that is homologous to a similar domain found in PCIP family members.

The human genome 9q sequences (SEQ ID NOs: 46 and 47) were isolated by screening the BAC genomic DNA library (Reasearch Genetics) using primers designed based on the sequence of human 9qm cDNA. Two positive clones were identified (448O2 and 721I17) and sequenced.

Example 5: Expression of 1v, 8t and 9q mRNA in rat tissues

(Clontech) in rat and mouse were immunoprecipitated with 5'-untranslated region and 5'-coding region of rat 1v sequence (Nucleotide 35-124; SEQ ID NO: 3) (Nucleotide 1-88; SEQ ID NO: 29) (this probe is specific for 8t), or the 5 'end of the rat 9qm sequence (nucleotides 1-195; Probed with a [ ³² P] labeled cDNA probe derived from SEQ ID NO: 21 (this probe is specific for all 9q isoforms other than 8t). The blots were hybridized using standard techniques. The Northern blot hybridized with the rat 1v probe showed a single band at 2.3kb only in lanes containing brain RNA, suggesting that 1v expression is brain specific. The Northern blot probed with a rat 8t probe showed a major band at 2.4kb. The rat 8t band was strongest in lanes containing heart RNA, while lanes containing brain RNA also had weak bands. The Northern blot hybridized with 9q cDNA showed a major band at 2.5 kb and a small band beyond 4 kb indicating that it was mainly expressed in the brain and heart. Small bands can exhibit incompletely spliced or processed 9q mRNA. The results from the Northern blot further indicated that p19 was mainly expressed in the heart.

Example 6 Expression of 1v, 8t and 9q in the Brain

Expression of the rat 1v and 8t / 9q genes in the brain was compared with that of the [ ³⁵ S] labeled cRNA probe and the procedure described in Rhodes et al. (1996) J. Neurosci., 16: 4846-4860 Hybridization process was used to investigate by in situ Hybridization Histochemistry (ISHH). Templates for producing cRNA probes were generated by standard PCR methods. In summary, oligonucleotide probes were designed to amplify fragments of the 3'- or 5'-untranslated region of the target cDNA and to add promoter recognition sequences for T7 and T3 polymerases. Thus, to generate 300 nucleotide probes derived from the 3'-untranslated region of 1v mRNA, we used the following primers:

5- TAATACGACTCACTATAGGG ACTGGCCATCCTGCTCTCAG-3 ( T7 , forward, sense; SEQ ID NO: 42)

5- ATTAACCCTCACTAAAGGGA CACTACTGTTTAAGCTCAAG-3 ( T3 , reverse, antisense; SEQ ID NO: 43). The underlined bases correspond to the T7 and T3 promoter sequences. To generate probes derived in the 325 bp region of the 3'-untranslated sequence shared by 8t and 9q mRNA, the following primers were used:

5- TAATACGACTCACTATAGGG CACCTCCCCTCCGGCTGTTC-3 ( T7 , forward, sense; SEQ ID NO: 44)

5- ATTAACCCTCACTAAAGGGA GAGCAGCAGCATGGCAGGGT-3 ( T3 , reverse, antisense; SEQ ID NO: 45).

Automatic radiographs of rat brain tissue sections treated for ISHH localization of 1v or 8t / 9q mRNA expression showed that 1v mRNA is widely expressed in the brain in a pattern consistent with neuron labeling as opposed to glial or endothelial cells. 1v mRNA is highly expressed in the cortex, hippocampus and striatum middle neurons, thalamic nuclei, medial habenula, and cerebellar granule cells. 1v mRNA is expressed at intermediate levels in the midbrain nucleus, including the substantia nigra and the superior colliculus, some other aphakia, and the inner septum and diagonal filamentous ganglia of the basal forebrain.

Since the probe used to analyze the expression of 8t and 9q is hybridized to a region of the same 3-nontranslational region as in 8t and 9q mRNA, the probe can not detect 8t / 9q mRNA at 1v And generates a complex image that indicates that it is widely expressed in the brain as a pattern partially overlapped with the pattern of the brain. However, 8t / 9q mRNA is highly expressed in striatum, hippocampal structure, cerebellar granule cells, and neocortex. 8t / 9q mRNA is expressed at intermediate levels in the midbrain, thalamus and brainstem. In many of these regions, 8t / 9q mRNA is thought to be concentrated not only in the middle neurons but also in the main cells, and in all regions, 8t / 9q expression is thought to be concentrated in neurons as opposed to glial cells.

Single-label and double-label immunohistochemistry showed that PCIP and Kv4 polypeptides were correctly co-localized to multiple cell types and brain regions coexpressed with PCIP and Kv4 mRNA. For example, 9qm is co-localized with Kv4.2 in somata and dendrites of hippocampal granule cells and pyramidal cells, neurons in the inner reich nucleus, and cerebellum cells, whereas 1v is posterior cingulate cortex), and Kv4.3 in a subset of cerebellar granule cells. Immunoprecipitation assays showed that 1 v and 9 qm co-covalently bind to the Kv4 a-subunit in rat brain membranes.

Example 7: Co-binding of PCIP and Kv4 channels in COS and CHO cells

COS1 and CHO cells were transiently transfected with individual PCIP (KChIP1, KChIP2, KChIP3) alone or with Kv4.2 or Kv4.3 using lipofectamine and essentially the procedures described by the manufacturer (Boehringer Mannheim) . At 48 hours after transfection, cells were washed, fixed, and processed for immunofluorescence visualization as known (Bekele-Arcuri et al. (1996) Neuropharmacology, 35: 851-865). Affinity purified Kv4 channel or PCIP protein Rabbit polyclonal antibody or mouse monoclonal antibody was used for immunofluorescence detection of the target protein.

When expressed alone, PCIP was diffusely distributed throughout the cytoplasm of COS-1 and CHO cells as expected for cytoplasmic proteins. In contrast, when expressed alone, Kv4.2 and Kv4.3 polypeptides are concentrated within the perinuclear ER and Golgi compartment, with some immunoreactivity concentrated at the outer edge of the cell. When PCIP was coexpressed with Kv4 [alpha] -subunit, the characteristic broad PCIP distribution significantly changed so that PCIP was correctly co-localized with Kv4 [alpha] -subunit. This redistribution of PCIP did not occur when they were coexpressed with the Kv1.4 [alpha] -subunit, indicating that the altered PCIP localization is not the result of overexpression and that this PCIP is specifically bound to the Kv4- family [alpha] -subunit .

To demonstrate that PCIP and Kv4 polypeptides are intimately bound and not simply co-localized to co-transfected cells, mutual immunoprecipitation assays were performed using the PCIP and channel-specific antibodies described above . The ability of anti-Kv4.2 and anti-Kv4.3 antibodies capable of immunoprecipitating KChIP1, KChIP2 and KChIP3 proteins from prepared lysates from co-transfected cells and the ability of Kv4.2 and Kv4.3 < RTI ID = 0.0 & As evidenced by the ability of anti-PCIP antibodies to immunoprecipitate subunits, all three PCIP polypeptides were covalently bound to Kv4 [alpha] -subunit in co-transfected cells. Cells were lysed in buffers containing detergents and protease inhibitors and prepared for immunoprecipitation reactions essentially as known (Nakahira et al. (1996) J. Biol. Chem., 271: 7084-7089). Immunoprecipitation is described by Nakahira et al. (1996) J. Biol. Chem., 271: 7084-7089) and Harlow E. and Lane, D. in Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, c1988 Respectively. The product resulting from immunoprecipitation was size fractionated by SDS-PAGE and transferred to a nitrocellulose filter using standard procedures.

To confirm if the cytoplasmic N-terminus of the Kv4 channel is sufficient for interaction, the PCIP, KChIP1 or KChIP2, was cloned into the Kv4.3 mutant (Kv4.3ΔC) lacking a total of 219 amino acid cytoplasmic C-terminal tail Lt; / RTI > In transiently transfected COS-1 cells, Kv4.3 [Delta] [Delta] C mutants were trapped extensively in ER and Golgi around the nucleus: little or no staining at the outer edge of the cell It was not. Nevertheless, KChIP1 and KChIP2 were co-localized correctly with Kv4.3ΔC in co-transfected cells, and furthermore, Kv4.3ΔC was effectively co-immunoprecipitated by PCIP antibody, indicating that this PCIP and Kv4 α- Indicating that the unit does not require the cytoplasmic C-terminus of the channel.

Example 8: Co-binding of PCIP and Kv4 channels in native tissue

To determine whether PCIP is co-localized and co-conjugated with Kv4 in natural tissues, Kv4- and PCIP-specific antibodies were analyzed by single-label and double-label immunohistochemistry and cross-co- immunoprecipitation assays of rat brain membranes Respectively. Immunohistochemical staining of rat brain slices showed that KChIP1 and KChIP2 were co-localized with Kv4.2 and Kv4.3 in a region and cell type specific manner. For example, KChIP1 was co-localized with Kv4.3 in hippocampal mid-neurons, cerebellar granule cells, and glomeruli, a special synaptic arrangement between the dendritic cells of the cerebellum basket and the Golgi cells, and the moss fiber end. KChIP2 was co-localized with Kv4.3 and Kv4.2 in several subcortical structures including dendritic cells of dendritic cells, apical and basal dendrites of hippocampus and neocortical pyramidal cells, and striatum and mantle. As a result of the co-immunoprecipitation analysis performed using the prepared synaptic membrane from the rat whole brain, PCIP (KChIP 1, 2 and 3) were found to be tightly linked to Kv4.2 and Kv4.3 in the brain K ⁺ channel complex. Anti-PCIP antibodies immunoprecipitated Kv4.2 and Kv4.3 from the meniscus, and anti-Kv4.2 and Kv4.3 antibodies immunoprecipitated PCIP. None of the PCIP polypeptides were immunoprecipitated by anti-Kv2.1, indicating that the binding of this PCIP to the brain Kv channel may be specific for the Kv4 [alpha] -subunit. Taken together, these anatomical and biochemical analyzes indicate that this PCIP is a component of the natural Kv4 channel complex.

Example 9: Calcium binding protein PCIP

To determine if KChIP 1, 2 and 3 bind Ca ²⁺ , a GST fusion protein was generated for each PCIP and the recombinant PCIP polypeptide enzymatically cleaved from GST as well as the GST-PCIP protein was incubated with ⁴⁵ Ca ²⁺ The ability to bind was investigated using a filter overlay assay (see Kobayashi et al. (1993) Biochem. Biophys. Res. Commun. 189 (1): 511-7). All three PCIP polypeptides that are not all three unrelated GST fusion proteins exhibit potent ⁴⁵ Ca ²⁺ binding in this assay. Moreover, all three PCIP polypeptides exhibit Ca ²⁺ -dependent displacement on SDS-PAGE, indicating that KChIP 1, 2 and 3 are indeed Ca ²⁺ -binding proteins, as are other members of this family (Kobuyashi et al (1993) supra; Buxbaum et al., Nef (1996) Neuron-specific calcium sensors (the NCS-1 subfamily) , pp94-98; Buxbaum JD, et al. (1998) Nature Med. 4 (10): 1177-81).

Example 10 Electrophysiological Characterization of PCIP

Another important problem is that PCIP such as KChIP1 (1v), KChIP2 (9ql), and KChIP3 (p19) are co-localized and co-coupled with the Kv4? -Subunit in the brain. It was to decide to change. To address this problem, Kv4.2 and Kv4.3 were expressed alone and in combination with individual PCIP. CHO cells were transiently transfected with cDNA using the DOTAP lipofection method described by the manufacturer (Boehringer Mannheim, Inc.). The transfected cells were identified by co-lranulation of the enhanced GFP with the gene of interest followed by determining whether the cells contained green GFP fluorescence. Currents in CHO cells were measured using a patch-clamp technique (Hamill et al. 1981. Pfluegers Arch. 391: 85-100).

Transient transfection of the rat Kv4.2 [alpha] -subunit in CHO cells produced expression of a typical A-type K + conductivity. The co-expression of Kv4.2 and KChIP1 showed some significant effects of KChIP1 on the channel (Figure 41 and Table 1). First, the magnitude of the Kv4.2 current increased about 7.5 times in the presence of KChIP1 (Kv4.2 alone = 0.60 +/- 0.096 nA / cell; Kv4.2 + KChIP1 = 4.5 +/- 0.55 nA / cell ). The Kv4.2 current density increased by 12 fold with KVIP1 coexpression (Kv4.2 alone = 25.5 +/- 3.2 pA / pF when converted to current density by correcting for cell capacity as a measure of cell surface membrane area) ; Kv4.2 + KChIP1 = 306.9 +/- 57.9 pA / pF), indicating that KChIP promotes and / or stabilizes Kv4.2 surface expression. With this increase in current density, a significant leftward displacement of the threshold for Kv4.2 current activation was observed in cells expressing Kv4.2 and KChIP1 (activation V1 / 2 = 20.8 + - 7.0mV, Kv4.2 + KChIP1 = -12.1 +/- 1.4mV). Finally, the kinetics of Kv4.2 inactivation is markedly slowed when Kv4.2 is coexpressed with KChIP1 (Kv4.2 alone inactivation time constant = 28.2 +/- 2.6 ms; Kv4.2 + KChIP1 = 104.1 + (Recovery tau = 53.6 +/- 7.6 ms) compared to cells expressing Kv4.2 alone (recovery tau = 272.2 +/- 26.1 ms) compared with cells expressing both Kv4.2 and KChIP1 And recovered from inactivity much earlier.

KChIPs 1, 2 and 3 have unique N-termini but share significant amino acid identity within the C-terminal " core " domain. Despite this unique N-terminal, the effects of KChIP2 and KChIP3 on Kv4.2 current density and kinetics were remarkably similar to those produced by KChIP1 (Table 1). Thus, to confirm that the conserved C-terminal core domain containing all three EF-hands was sufficient to regulate Kv4 current density and kinetics, N-terminal truncation mutants of KChIPl and KChIP2 were prepared . The KChIP1ΔN2-31 and KChIPΔN2-67 mutants are KChIP1 and KChIP2, respectively, cut for the C-terminal 185 amino acid core sequence. Joint expression of KChIP1ΔN2-31 or KChIP2ΔN2-67 and kv4.2 in CHO cells produced a change in Kv4.2 current density and kinetics that is indistinguishable from the effects produced by the full-length KChIP1 or KChIP2 (Table 1).

To investigate whether this modulating effect of KChIP is specific to the Kv4 channel, KChIP1 was coexpressed with Kv1.4 and Kv2.1 in Xenopus oocytes. Genopus oocytes were injected with 1 to 3 ng of cRNA per oocyte prepared using a standard in vitro transcription technique (Sambrook et al., 1989. Molecular Cloning: a laboratory manual, Cold Spring Harbor Press). The current in the oocyte was measured by a 2-electrode voltage clamp. KChIP1 was considered to have no effect on Kv1.4 or Kv2.1 currents (Table 2), indicating that this functional effect may be specific for Kv4 channels. The kinetic analysis was repeated after expressing Kv4.3 and KChIP mRNA in Genopus oocytes as a final control for KChIP effect and to demonstrate that the effect of KChIP on Kv4 current is independent of the expression system. The effect of KChIP1 on Kv4.3 in the oocyte system was remarkably similar to the effect on Kv4.2 in CHO cells (Table 1).

Because this KChIP binds Ca2 +, another important issue is to determine if the effect of KChIP1 on Kv4.2 current is Ca2 + dependent. This problem was solved indirectly by introducing a point mutation in the EF-hand domain of each KChIP: one mutant had a point mutation in the first two EF hands (D ₁₉₉ → A, G ₁₀₄ → A, D ₁₃₅ → A and G ₁₄₀ → A) and the other one has point mutations in all three EF hands (D ₁₉₉ → A, G ₁₀₄ → A, D ₁₃₅ → A, G ₁₄₀ → A, D ₁₈₃ → A and G ₁₈₈ ? A). These mutations displaced the two most highly conserved amino acids in the EF-hand consensus with alanine (Fig. 25: Linse, S and Forsen, S. (1995) Determinants that govern high-affinity Calcium binding. (Ed.) Advances in second messenger and phosphoprotein research. New York, Ravens Press., 30: 89-150). Co-expression of these KChIP1 triple EF-hand mutants with Kv4.2 or Kv4.3 in COS cells indicates that these mutants co-localized and efficiently immunoprecipitated with Kv4 [alpha] -subunit in COS-1 cells . However, this EF-hand point mutation completely eliminated the effect of KChIP1 on Kv4.2 kinetics (Table 1). Taken together, these results indicate that the binding interaction between KChIP1 and Kv4.2 is Ca2 + independent, while the regulation of Kv4.2 kinetics by KChIP1 is Ca2 + -dependent or structural changes induced by point mutations in the EF-hand domain .

Table 1

Functional Effects of KchIP on Kv4 Channel

Current parameter rKv4.2 + vector rKv4.2 + KchIP1 rKv4.2 + KchIP1? N2-31 rKv4.2 + KchIP2 rKv4.2 + KchIP2? N2-67 rKv4.2 + KchIP3 rKv4.3 rKv4.3 + KchIP1 Peak current (nA / cell at 50 MV) 0.60 ^* 0.096 4.5 ^* 0.055 6.0 ^* 1.1 3.3 ^* 0.45 5.8 ^* 1.1 3.5 ^* ± 0.99 7.7 μA ± 2.6 18.1 占^*占 .3.8 Peak current density (pA / pF at 50 mV) 25.5 ± 3.2 306.9 ^* + - 57.9 407.2 ^* + - 104.8 196.6 ^* + - 26.6 202.6 ^* +/- 27.5 161.7 ^* ± 21.8 ... ... Deactivation time constant (ms, at 50 mV) 28.2 ± 2.6 104.1 ± 10.4 129.2 ± 14.2 95.1 ^* 8.3 109.5 ^* + - 9.6 67.2 ^* 14.1 56.3 ± 6.6 135.0 + - 15.1 Recovery time from inactivity time constant 272.2 53.6 ^* 98.1 ^* 49.5 ^* 36.1 ^* 126.1 ^* 327.0 34.5 ^* * Significantly different from control

Table 2

Functional Effects of KChIP on Other Kv Channels

Oocyte Oocyte Current parameter HKv1.4 hKv1.4 + 1v HKv2.1 HKv2.1 + 1v Peak current 8.3 6.5 3.7 2.9 (/ / Cell at 50 MV) ± 2.0 ± 0.64 ± 0.48 ± 0.37 Deactivation time constant 53.2 58.2 1.9s 1.7s (ms, at 50 mV) ± 2.8 6.6 ± ± 0.079 0.078 Recovery time from inactivity time constant (sec, at -80 mV) 1.9 1.6 7.6 7.7 Activation V _1/2 (mV) -21.0 -20.9 12.0 12.4 Steady state deactivation V1 / 2 (mV) -48.1 -47.5 -25.3 -23.9

Example 11 Effect of KChIP1 on Surface Expression of Kv4-? Subunit in COS-1 Cells

To investigate the ability of KChIP1 to enhance surface expression of Kv4 channels, the ability of KChIP1 to promote the formation of co-clusters of Kv4 channels and PSD-95 was monitored. PSD-95 is used to facilitate visualization of the complex.

To facilitate the interaction between Kv4.3 and PSD-95, a chimeric Kv4.3 subunit (Kv4.3ch) was generated in which 10 C-terminal amino acids from rKv1.4 (SNAKAVETDV, SEQ ID NO: 73) was added to the C-terminus of Kv4.3. Ten C-terminal amino acids from rKv1.4 were used, which binds to PSD-95 and binds to the Kv4.3 protein with the ability to bind PSD-95 when fused to the Kv4.3 C-terminus . Expression of Kv4.3ch in COS-1 has minimal detectable Kv4.3ch immunoreactivity at the outer edge of the cells, indicating that the Kv4.3ch polypeptide is trapped in the cytoplasm of the nucleus. When Kv4.3ch was coexpressed with PSD-95, PSD-95 was trapped in perinuclear cytoplasm and co-localized with Kv4.3ch. However, when KChIP1 was coexpressed with Kv4.3ch and PSD-95, a large plaque-like surface co-cluster of Kv4.3ch, KChIP1 and PSD-95 was observed. Triple-labeled immunofluorescence confirmed that these surface clusters contain all three polypeptides, and mutual co-immunoprecipitation assays showed that the three polypeptides were covalently bound in these surface clusters. Control experiments showed that KChIP1 did not interact with PSD-95 alone and was not co-localized with Kv1.4 and PSD-95 in surface clusters. Taken together, this data indicates that KChIP1 can facilitate transport of the Kv4.3 subunit to the cell surface.

Example 12: Characterization of PCIP protein

In this example, the amino acid sequence of the PCIP protein was compared to the amino acid sequence of a known protein and various motifs were identified.

The 1v polypeptide whose amino acid sequence is shown in SEQ ID NO: 3 is a novel polypeptide comprising 216 amino acid residues. (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited by Means, AR, Raven Press, Ltd.). , New York) were identified by sequence alignment (see FIG. 21).

The 8t polypeptide whose amino acid sequence is shown in SEQ ID NO: 30 is a novel polypeptide comprising 225 amino acid residues. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited by Means, AR, RavenPress, Ltd., New York) was identified by sequence alignment (see FIG. 21).

9q polypeptide is a calcium binding domain that is presumed to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited by Means, Raven Press, Ltd., New York) (see FIG. 21).

The p19 polypeptide is a calcium binding domain that is presumed to be involved in calcium binding (Linse, S. and Forsen, S. (1995) Advances in Second Messenger and Phosphoprotein Research 30, Chapter 3, p89-151, edited by Means, Raven Press, Ltd., New York) (see FIG. 21).

A BLASTN 2.0.7 search for the nucleotide sequence of rat 1v1 (Altschul et al. (1990) J. Mol. Biol. 215: 403) showed that rat 1vl is similar to the rat cDNA clone RMUAH89 (Accession No. AA849706). The rat 1 vl nucleic acid molecule is 98% identical to the rat cDNA clone RMUAH89 (Accession No. AA849706) across nucleotides 1063-1488.

A BLASTN 2.0.7 search of the nucleotide sequence of human 9ql (Altschul et al. (1990) J. Mol. Biol. 215: 403) showed that human 9ql is similar to human cDNA clone 1309405 (Accession No. AA757119). The human 9ql nucleic acid molecule is 98% identical to the human cDNA clone 1309405 (Accession No. AA757119) over nucleotides 937-1405.

BLASTN 2.0.7 search for the nucleotide sequence of mouse P19 (Altschul et al. (1990) J. Mol. Biol. 215: 403) showed that mouse P19 is similar to Mus muscle cDNA clone MNCb-7005 (Accession No. AU035979) . The mouse P19 nucleic acid molecule is 98% identical to Mus muscle cDNA clone MNCb-7005 (Accession No. AU035979) over nucleotides 1 to 583.

Example 13 Expression of Recombinant PCIP Protein in Bacterial Cells

In this example, PCIP is expressed as a recombinant glutathione-S-transferase (GST) fusion polypeptide in E. coli, and the fusion polypeptide is isolated and characterized. Specifically, PCIP is fused to GST and this fusion polypeptide is expressed in E. coli, e.g., strain BI21. Expression of the GST-PCIP fusion protein in BI21 was induced using IPTG. The recombinant fusion protein was purified by affinity chromatography on glutathione beads from the crude bacterial lysate of the induced strain BI21. Polyacrylamide gel electrophoresis analysis of purified polypeptides from bacterial lysates was used to determine the molecular weight of the resulting fusion polypeptides.

Rat 1v and 9ql were cloned into pGEX-6p-2 (Pharmacia). The resulting recombinant fusion protein was expressed in E. coli and purified by performing methods known in the art (see Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992). The identity of the purified protein was confirmed by Western blot analysis using antibodies generated against the peptide epitopes of rats 1v and 9ql.

Example 14 Expression of Recombinant PCIP Protein in COS Cells

To express the PCIP gene in COS cells, pcDNA / Amp vector (Invitrogen Corporation, San Diego, Calif.) Was used. This vector contains in sequence the SV40 origin of replication, the ampicillin resistance gene, the E. coli replication origin, the CMV promoter, the polylinker region, and the SV40 intron and polyadenylation site. By cloning the DNA fragment encoding the complete PCIP protein and the HA tag (Wilson et al. (1984) Cell 37: 767) frame-fused to the 3 'end of the fragment or the FLAG tag into the polylinker region of the vector, Lt; RTI ID = 0.0 > CMV < / RTI > promoter.

To construct the plasmid, the PCIP DNA sequence was amplified by PCR using two primers. The 5 'primer contains about 20 nucleotides of the PCIP sequence starting from the initiation codon followed by the restriction site of interest; The 3 ' terminal sequence contains the final 20 nucleotides of the complementary sequence, termination codon, HA tag or FLAG tag and PCIP coding sequence for other restriction sites of interest. The PCR amplified fragment and the pCDNA / Amp vector were digested with the appropriate restriction enzymes and the vector was dephosphorylated using CIAP enzyme (New England Biolabs, Beverly, Mass.). Preferably, the two restriction sites selected were different so that the PCIP gene was inserted in the correct orientation. The coupling mixture is transformed into E. coli cells (strains HB101, DH5a, SURE available from Stratagene Cloning Systems, La Jolla, Calif. Can be used) and the transformed cultures are plated on ampicillin plate plates Plating and resistant colony were selected. Plasmid DNA was isolated from the transformants and examined for the presence of the correct fragments by restriction analysis.

COS cells were then transfected with PCIP-pcDNA / Amp plasmid DNA using calcium phosphate or calcium chloride co-infusion, DEAE-dextran-mediated transfection, lipofection or electroporation. Other suitable methods for transfecting host cells are described in < RTI ID = 0.0 > Sambrook, J. < / RTI > (Sambrook, J.), Freeze, Lee. Fritsh (EF) and Mania Teis, Tee. Can be found in Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Expression of the PCIP polypeptide can be measured by immunoprecipitation using a radiolabeled marker ( ³⁵ S-methionine or ³⁵ S-cysteine available from NEN (Boston, MA) may be used) and HA-specific monoclonal antibody (Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988). In summary, the cells were labeled for ³⁵ 8 hours S- methionine (or ³⁵ cysteine S-). The medium was then harvested and the cells were lysed using a detergent (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). Both the cell lysate and the medium were precipitated with HA-specific monoclonal antibodies. The precipitated polypeptides were then analyzed by SDS-PAGE.

Alternatively, DNA containing the PCIP coding sequence was cloned directly into the polylinker of the pCDNA / Amp vector using the appropriate restriction sites. The resulting plasmids were transfected into COS cells in the manner described above and the expression of PCIP polypeptides was detected by immunoprecipitation using a radioactive label and a PCIP specific monoclonal antibody.

Rat 1v was cloned into the mammalian expression vector pRBG4. Transfection into COS cells was performed using LipofectAmine Plus (Gibco BRL) according to the manufacturer's instructions. The expressed 1v protein was detected by immunocytochemistry and / or western blot analysis using antibodies generated against 1v in rabbit or mouse.

Example 15: Identification and characterization of human full-length p19

Human full-length p19 sequences were identified using RACE PCR. The sequence of p19 (also called KChIP3) is shown in Fig. The amino acid sequence of human p19 was 92% identical to the mouse p19 gene (SEQ ID NO: 35).

In a TBLASTN search using the protein sequence of human p19, human p19 has two sequences, Calsenilin (1998) Nature Medicine 4: 1177-1181, and DREAM [ ²⁺ -dependent regulatory substance (Carrion et al. (1999) Nature 398: 80-84). Human p19 is 100% identical to calenicillin at the nucleotide level (but 3 'is extended for the published sequence) and is 99% identical to DREAM at the nucleotide level.

The ability of p19 (as well as other PCIP family members), which co-locates with prysgenylin to act as a transcription factor, is tested in Northern blots, in situ hybridization, β-gal assays, DNA transfer assays (Carrion et al. (1999) Nature 398: 80) and DNA transfer super shift assay using antibodies specific for KchIP.

Other assays suitable for assessing the association of PCIP family members with prisonylin include co-immunoprecipitation (Buxbaum et al. (1998) Nature Medicine 4: 1177).

Example 16 Identification and Characterization of Monkey KChIP4

In this embodiment, the identification and characterization of the genes encoding the monkey KChIP4a (jlkbd352e01t1) and alternatively the spliced monkeys KChIP4b (jlkbb231c04t1), KChIP4c (jlkxa053c02) and KChIP4d (jlkx015b10) are described. Four clones jlkbb231c04t1, jlkbd352e01t1, jlkxa053c02 and jlkx015b10 were identified through a TBLASTN search in the proprietary database using sequences of known PCIP family members. The four monkey clones were obtained and sequenced.

The sequences of the monkey monkey clones jlkbb231c04t1 and jlkbd352e01t1 have been found to correspond to alternatively spliced variants of the additional PCIP family members designated herein as KChIP4. The clone jlkbb231c04t1 contains a 822 bp deletion site (presumably due to splice removal of the exon) compared to jlkbd352e01t1, resulting in the loss of the last EF hand domain. In clone jlkbd352e01t1, the last EF hand domain is conserved and the C-terminus is highly homologous to the C-terminus of the PCIP family members 1v, 9ql and p19. The overall identity of the homologous C-terminus between KChIP4, 1v, 9ql and p19 ranged from 71% to 80% at the amino acid level (alignment was performed using CLUSTALW).

Monkeys KChIP4c and KChIP4d were found by searching BLASTN using monkey KChIP4a as a query language for searching an exclusive database.

The nucleotide sequence of the monkey KChIP4a cDNA and the predicted amino acid sequence of the KChIP4a polypeptide are shown in Figure 23 and SEQ ID NO: 48 and SEQ ID NO: 49, respectively.

The nucleotide sequence of the monkey KChIP4b cDNA and the predicted amino acid sequence of the KChIP4b polypeptide are shown in Figure 24 and SEQ ID NO: 50 and SEQ ID NO: 51, respectively.

The nucleotide sequence of the monkey KChIP4c cDNA and the predicted amino acid sequence of the KChIP4c polypeptide are shown in Figure 35 and SEQ ID NO: 69 and SEQ ID NO: 70, respectively.

The nucleotide sequence of the monkey KChIP4d cDNA and the predicted amino acid sequence of the KChIP4d polypeptide are shown in Figure 36 and SEQ ID NO: 71 and SEQ ID NO: 72, respectively.

37 shows the sequence of the protein sequences of KChIP4a, KChIP4b, KChIP4c and KChIP4d.

As shown by Northern blot experiments in which a Northern blot purchased from Clontech was probed using a DNA fragment from the 3'-untranslated region of rat KChIP4, rat KChIP4 was predominantly expressed in the brain and in the kidney It is weakly expressed but not in the heart, brain, spleen, lung, liver, skeletal muscle or testis.

Example 17: Identification and characterization of human and rat 33b07

In this example, the identification and characterization of genes encoding the rat and human 33b07 will be described. Partial rat 33b07 (clone name 9o) was isolated as a positive clone from the yeast two-hybrid screening described above using rKv4.3N as bait. The full-length rat 33b07 clone was identified by mining the proprietary database.

The nucleotide sequence of the full length rat 33b07 cDNA and the predicted amino acid sequence of the rat 33b07 polypebide are shown in Figure 26 and SEQ ID NO: 52 and SEQ ID NO: 53, respectively. The rat 33b07 cDNA encodes a protein with a molecular weight of about 44.7 kD, and the length of the protein is 407 amino acid residues.

Rat 33b07 binds to rKv4.3N and rKv4.2N with a weak preference for rKv4.2N in the yeast two-hybrid assay. In contrast, rat 33b07 does not bind to rKv1.1N, indicating that the rat 33b07-Kv4N interaction is specific.

Rat 33b07 is predominantly expressed in the brain as determined by Northern blot analysis.

It was also identified by mining a proprietary database of human 33b07 ortholog (clone 106d5). The nucleotide sequence of the full length human 33b07 cDNA and the predicted amino acid sequence of the human 33b07 polypeptide are shown in Figure 27 and SEQ ID NO: 54 and SEQ ID NO: 55, respectively. The human 33b07 cDNA encodes a protein with a molecular weight of about 45.1 kD, which is 414 amino acid residues in length.

Human 33b07 is 99% identical to human KIAA0721 (GenBank accession number: AB018264) at the amino acid level. However, GenBank accession number: AB018264 does not have a functional annotation. Human 33b07 is also homologous to testis-specific (Y-encoded) proteins (TSP (Y)), SET and nucleosomal augmented protein (NAP). Human 33b07 is 38% identical over human SET protein (GenBank Accession No. Q01105 = U51924) and amino acids 204-337 and is 46% identical over amino acids 334-387.

In addition, the human SET can be linked to HLA-DR related protein II (PHAPII) (Hoppe-Seyler (1994) Biol. Chem. 375: 113-126] and, in some cases, associated with acute undifferentiated leukemia (AUL) as a result of translocation events resulting in the formation of the SET-CAN fusion gene (Von Lindern M. et al. (1992) Mol. Cell. Biol. 12: 3346-3355. Alternatively, an alternatively spliced form of SET is referred to as template activity factor-I alpha (TAF). TAF has been found to be associated with myelogenous leukemia induction (Nagata K. et al. (1995) Proc. Natl. Acad. Sci. U.S.A. 92 (10), 4279-4283). The human SET is also a potent protein inhibitor of Phosphatase 2A (Adachi Y. et al. (1994) J. Biol. Chem. 269: 2258-2262]. NAP may be involved in the regulation of chromatin formation and may contribute to the regulation of cell proliferation (Simon H. U. et al. (1994) Biochem. J. 297, 389-397].

Thus, 33b07 can function as a protein inhibitor of the phosphatase, oncogene and / or chromatin modulator due to its homology to the identified proteins. The homology of 33b07 to the SET, a protein phosphatase inhibitor, is particularly interesting. Many channels, particularly Kv4 channels (33b07 associated), have been found to be regulated by phosphorylation by PKC and PKA (1998) J. Neuroscience 18 (10): 3521-3528; Am J Physiol 273: H1775-86 (1997)]. Thus, 33b07 can regulate Kv4 activity by regulating the phosphorylation state of the potassium channel.

Example 18 Identification and Characterization of Rat 1p

In this embodiment, identification and characterization of a gene encoding rat 1p will be described. Partial rat 1p was isolated as a positive clone from the yeast two-hybrid screening described above using rKv4.3N as bait.

The nucleotide sequence of the partial length rat lp cDNA and the predicted amino acid sequence of the rat lp polypeptide are shown in Figure 28 and SEQ ID NO: 56 and SEQ ID NO: 57, respectively. The rat lp cDNA encodes a protein with a molecular weight of about 28.6 kD, which is 267 amino acid residues in length.

Rat 1p binds to rKv4.3N and rKv4.2N with a weak preference for rKv4.3N in the yeast 2-hybrid assay. In contrast, 1p does not bind to rKv1.1N, indicating that the 1p-Kv4N interaction is specific.

Rat 1p is predominantly expressed in the brain as determined by Northern blot analysis.

100 scores of the amino acid sequence of rat 1p and 3 word length (see Altschul et al. (1990) J. Mol. Biol. (Restin, GenBank Accession No. P30622; also called cytoplasmic linker protein-170 alpha-2 (CLIP-170), M97501) by BLASTP 1.4 search . The rat lp protein is 58% identical to human leptin over amino acid residues 105-182 and is 55% identical to human leptin over amino acid residues 115-186 and is 22% identical to human leptin over amino acid residues 173-246, Is 22% identical to human leucine over residues 169-218 and is 58% identical to human leucine over amino acid residues 217-228.

Reestin is also named Reed-Sternberg intermediate product filament-related protein. Reed-Sternberg cells are tumor cells for the diagnosis of Hodgkin's disease. This suggests that restenosis overexpression may be a contributing factor in the progression of Hodgkin's disease (Bilbe G. et al. (1992) EMBO J. 11: 2103-13] and resten is an intermediate filament-related protein that links intracellular vesicles to microtubules (Pierre P, et al. (1992) Cell 70 (6), 887-900).

The cytoskeleton is activated by potassium channel activity (Honore E, et al. (1992) EMBO J. 11: 2465-2471 and Levin G, et al. (1996) J. Biol. Chem. 271: 29321-29328] as well as other channels such as the Ca ⁺⁺ channel (Johnson BD et al. (1993) Neuron 10: 797-804; Or Na ^< ⁺ > channels (Fukuda J. et al. (1981) Nature 294: 82-85].

Thus, based on its homology to the leptin protein, the rat 1p protein can bind to the cytoskeleton and regulate the activity of the potassium channel, e.g., Kv4, through its binding to the cytoskeleton.

Example 19: Identification and characterization of rat 7s

In this embodiment, identification and characterization of a gene encoding rat 7s will be described. Partial rats 7s were isolated as positive clones from the yeast two-hybrid screening described above using rKv4.3N as bait. Rats 7s are described, for example, in van Hille B. et al. (1993) J. Biol. Chem. ATPase catalytic subunit A (Accession Nos. P38606 and B46091) as described in US Pat. No. 6,268,108 (10), 7075-7080.

The nucleotide sequence of the partial length rat 7s cDNA and the predicted amino acid sequence of the rat 7s polypeptide are shown in Figure 29 and SEQ ID NO: 58 and SEQ ID NO: 59, respectively. The rat 7s cDNA is a protein with a molecular weight of about 28.6 kD and the length of this protein is 270 amino acid residues.

Rat 7s binds to rKv4.3N and rKv4.2N with preference for rKv4.3N in the yeast two-hybrid assay. In contrast, 7s does not bind to rKv1.1N, indicating that the 7s-Kv4N interaction is specific.

Rat 7s is expressed at a significantly higher level in the brain and kidney than in the lung, liver, heart, testis, and skeletal muscle, as determined by Northern blot analysis.

Example 20: Identification and Characterization of Rat 29x and 25r

In this embodiment, the identification and characterization of the gene encoding the rat 29x will be described. Rat 29x was isolated as a positive clone from the yeast two-hybrid screening described above using rKv4.3N as bait. The rat 25r is a 29x splice variant. Although these differ in the 5 'untranslated region, they are the same at the coding region and amino acid level.

The nucleotide sequence of the rat 29x cDNA and the predicted amino acid sequence of the rat 29x polypeptide are shown in Figure 30 and SEQ ID NO: 60 and SEQ ID NO: 61, respectively. The rat 29x cDNA encodes a protein with a molecular weight of about 40.4 kD and the length of the protein is 351 amino acid residues.

The nucleotide sequence of the rat 25r cDNA is shown in Figure 31 and SEQ ID NO: 62. The rat 25r cDNA encodes a protein with a molecular weight of about 40.4 kD, which is 351 amino acid residues in length.

Rat 29x is expressed in the spleen, lung, kidney, heart, brain, testis, skeletal muscle and liver, which is expressed at the highest level in the spleen and at the lowest level in the liver.

Rat 29x binds to rKv4.3N and rKv4.2N with a weak preference for rKv4.3N in the yeast two-hybrid assay. In contrast, 29x does not bind to rKv1.1N, indicating that the 29x-Kv4N interaction is specific.

Rat 29x is a rat SOCS-1 (a suppressor of cytokine signaling) at the amino acid level (see Starr R. et al. (1997) Nature 387: 917-921; JAB [Endo T.A. et al. (1997) Nature 387: 921-924; And SSI-1 (STAT-induced STAT inhibitor-1) (Naka T. et al. (1997) Nature 387: 924-928]. These proteins are characterized by having the SH2 domain and bind to and inhibit JAK kinase to regulate cytokine signaling.

As used herein, the term " SH2 domain " refers to the Src homology 2 domain and includes a protein domain of about 100 amino acids in length that is related to the binding of phosphotyrosine residues, such as phosphotyrosine residues of other proteins . The target site is called the SH2-binding site. The SH2 domain has a conserved 3D structure consisting of two alpha helices and six to seven beta-strands. The core of the SH2 domain is formed by a continuous Better-Meander consisting of two connected beta-sheets (Kuriyan J. et al. (1997) Curr. Opin. Struct. Biol. 3: 828-837. The SH2 domain functions as a modulator of the intracellular signaling cascade by interacting with the target peptide, which is sequence-specific and strictly phosphorylation-dependent, with a phosphotyrosine-containing target peptide (Pawson T. (1995) Nature 373 : 573-580]. Some proteins have multiple SH2 domains, which increase their affinity for binding to the phosphate protein or give them the ability to bind to different phosphate proteins. Rat 29x has the SH2 domain at amino acid residue 219-308 of SEQ ID NO: 61.

Tyrosine phosphorylation modulates potassium channel activity (see Prevarskaya N.B. et al. (1995) J. Biol. Chem. 270: 24292-24299. JAK kinase phosphorylates proteins in tyrosine and is involved in the regulation of channel activity (Prevarskaya N.B. et al. Supra). Thus, based on its homology to SOCS-1, JAB and SSI-1, rat 29x can modulate the activity of potassium channels, such as Kv4, by modulating JAK kinase activity.

Example 21 Identification and Characterization of Rat 5p

In this embodiment, the identification and characterization of the gene encoding the rat 5p will be described. Rat 5p was isolated as a positive clone from the yeast-2-hybrid screening described above using rKv4.3N as bait.

The nucleotide sequence of the rat 5p cDNA and the predicted amino acid sequence of the rat 5p polypeptide are shown in Figure 32 and SEQ ID NO: 63 and SEQ ID NO: 64, respectively. The rat 5p cDNA encodes a protein with a molecular weight of about 11.1 kD, and the length of this protein is 95 amino acid residues.

Rat 5p binds to rKv4.3N and rKv4.2N at similar strengths in the yeast two-hybrid assay. In contrast, 5p does not bind to rKv1.1N, indicating that the 5p-Kv4N interaction is specific.

Rat 5p is expressed in the spleen, lung, skeletal muscle, heart, kidney, brain, liver and testis as determined by Northern blot analysis.

Rat 5p is the same as rat Calpactin I light chain or P10 (Accession No. P05943). P10 binds to annexin II (p36) and induces its dimerization. P10 can function as a regulator of protein humanization when the p36 monomer is a preferential target of tyrosine-specific kinase (Masiakowski P. et al. (1998) Proc. Natl. Acad. Sci. U.S.A. 85 (4): 1277-1281].

Tyrosine phosphorylation modulates the activity of the potassium channel (see Prevarskaya N.B. et al. Supra). Thus, due to its identity to P10, rat 5p can modulate the activity of potassium channels, such as Kv4, by modulating the activity of tyrosine-specific kinases.

Example 22 Identification and Characterization of Rat 7q

In this embodiment, identification and characterization of a gene encoding rat 7q will be described. Rat 7q was isolated as a positive clone from yeast two-hybrid screening described below using rKv4.3N as bait. Whole-length rat 7q was obtained by RACE PCR.

The nucleotide sequence of the rat 7q cDNA and the predicted amino acid sequence of the rat 7q polypeptide are shown in Figure 33 and SEQ ID NO: 65 and SEQ ID NO: 66, respectively. The rat 7q cDNA encodes a protein with a molecular weight of about 23.5 kD, which is 212 amino acid residues in length.

Rat 7q binds to rKv4.3N and rKv4.2N at the same intensity in the yeast two-hybrid assay. In contrast, 7q does not bind to rKv1.1N, indicating that the 7q-Kv4N interaction is specific.

Rat 7q is expressed in the heart, brain, spleen, lung, liver, skeletal muscle, kidney and testis as determined by Northern blot analysis.

Rat 7q is identical to RAB2 (rat RAS-related protein, Accession No. P05712) at the amino acid level. RAB2 appears to be involved in vesicular transport and protein migration (see Touchot N. et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84 (23): 8210-8214). Thus, based on its homology to RAB2, rat 7q may be associated with a potassium channel, e.g., Kv4 transport.

Example 23 Identification and Characterization of Rat 19r

In this embodiment, the identification and characterization of the gene encoding the rat 19r will be described. Partial rat 19r was isolated as a positive clone from yeast two-hybrid screening described above using rKv4.3N as bait. Full length rat 19r was obtained by RACE PCR.

Nucleotide sequences of rat 19r cDNA and predicted amino acid sequences of rat 19r polypeptide are shown in Figure 34 and SEQ ID NO: 67 and SEQ ID NO: 68, respectively. The rat 19r cDNA encodes a protein with a molecular weight of about 31.9 kD, which is 271 amino acid residues in length.

Rat 19r is expressed in the heart, brain, spleen, lung, liver, skeletal muscle, kidney, and testes as determined by Northern blot analysis.

Rat 19r binds to rKv4.3N and rKv4.2N with a weak preference for rKv4.3N in the yeast two-hybrid assay. In contrast, 19r does not bind to rKv1.1N, indicating that the 19r-Kv4N interaction is specific.

Rat 19r is described in Dickeson S. K. et al. et al. (1989) J. Biol. Chem. (PTDINSTP, Accession No. M25758 or P16446), which is described in US Pat. PTDINSTP is associated with the enhancement of phospholipase C-beta (PLC-beta) signaling, phosphatidylinositol transfer protein (PtdIns-TP) synthesis, secretory vesicle formation and phosphatidylinositol 3-kinase (PtdIns 3-kinase) (Cf. Cunningham E. et al. (1995) Curr. Biol. 5 (7): 775-783; (1995) Nature 377 (6549): 544-547; and Panaretou C. et al. (1997) J. Biol. Chem. 272 (4): 2477-2485).

Thus, based on its homology with PTDINSTP, rat 19r can regulate potassium channels, such as Kv4 activity, via PLC-beta signaling and / or PtdIns 3-kinase signaling pathways. The rat p19r may also be associated with potassium channels, such as Kv4 transport.

Example 24: Chromosomal localization of human 9q

In this example, human PCIP 9q was chromosomally mapped using a radiated hybrid panel (panel GB4). h9q was mapped for the region of chromosome 10q previously described as having an association with partial epilepsy named D10S192: 10q22-q24 (Ottman et al. (1995) Nature Genetics 10: 56-60] (see FIG. 43). Based on the above observations, the present invention clearly demonstrates that the 9q family of proteins can serve as targets for the medical intervention of targets and epilepsy to develop anti-epileptic drugs.

In addition, h9q was mapped to the region of chromosome 10q previously described as having relevance to IOSCA designated D10S192 and D10S1265: 10q24 (Nikali, Genomics 39: 185-191 (1997)) (see Figures 42 and 43) ). Based on the above observations, the present invention clearly demonstrates that the 9q family of proteins can serve as targets for the development of anti-myelofixaclastic drugs and as a target for medical intervention of myelofibrosis.

Equivalent

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be included in the following claims.

Claims (53)

a) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 33, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a DNA insert sequence of a plasmid deposited with the ATCC as PTA-316, or a nucleic acid molecule comprising at least 60% identical nucleotide sequence to a complementary sequence thereof; b) an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 33, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a DNA insert sequence of a plasmid deposited at ATCC as PTA-316, or a complementary sequence thereof, nucleic acid molecule comprising a fragment of at least 583 nucleotides of nucleic acid; c) an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence that is about 60% or more identical to an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316; d) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70, or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a fragment of a polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316, wherein the fragment is selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12 , SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: : 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951 Or more than 15 contiguous amino acid residues of the amino acid sequence encoded by the DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316; And e) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: , Amino acid sequences of SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72, or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or nucleic acid molecule encoding a natural allelic variant of a polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316, wherein the nucleic acid molecule encodes the polypeptide of SEQ ID NO: 1, SEQ ID NO 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: , SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: : 69 or SEQ ID NO: 71, or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945 DNA insertions of plasmids deposited at the ATCC as PTA-316, or 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316 Wherein the nucleic acid molecule is hybridized to a nucleic acid molecule comprising a sequence. The method according to claim 1, a) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: SEQ ID NO: 33, SEQ ID NO: 33, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, or the nucleotide sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a DNA insert sequence of a plasmid deposited with the ATCC as PTA-316, or a complementary sequence thereof; And b) an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a nucleic acid molecule encoding a polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316. 2. The nucleic acid molecule of claim 1, further comprising a vector nucleic acid sequence. 2. The nucleic acid molecule of claim 1, further comprising a nucleic acid sequence encoding a heterologous polypeptide. A host cell containing the nucleic acid molecule of claim 1. 6. The host cell of claim 5, wherein the host cell is a mammalian host cell. A mammalian host cell other than a human containing the nucleic acid molecule of claim 1. a) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 35, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: , Amino acid sequences of SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or accession numbers 98936, 98937, 98938, 98939, 98940, 98941, 98942 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 6, SEQ ID NO: 6, SEQ ID NO: SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: : 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, , Amino acid sequences of SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or accession numbers 98936, 98937, 98939, 98940, 98941, 98942, 98943 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316 Comprising at least 15 consecutive amino acids of the amino acid sequence encoded by the DNA insertion sequence of the plasmid deposited with the ATCC); b) an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a natural allelic variant of a polypeptide comprising an amino acid sequence encoded by a DNA insert sequence of a plasmid deposited with the ATCC as PTA-316, wherein the polypeptide is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, S SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: SEQ ID NO: 27, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: , 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316, encoding nucleic acid molecules that hybridize to a nucleic acid molecule comprising a DNA insertion sequence of a plasmid deposited with the ATCC do); And c) an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: : 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, , A nucleotide sequence of SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: 71, or a nucleotide sequence of SEQ ID NO: 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a nucleic acid molecule comprising a nucleotide sequence comprising at least 60% identical nucleotide sequence to a nucleic acid comprising a DNA insertion sequence of a plasmid deposited with ATCC as PTA-316; And d) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a polypeptide comprising an amino acid sequence that is at least 60% identical to an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316. 9. The isolated polynucleotide of claim 8, wherein the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: The amino acid sequence of SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or the amino acid sequence of Accession Nos. 98936, 98937, 98938, 98939, 98940 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993 , 98994, or PTA-316. ≪ Desc / Clms Page number 12 > 9. The polypeptide of claim 8, further comprising a heterologous amino acid sequence. 10. An antibody that selectively binds to the polypeptide of claim 8. A method of producing a polypeptide selected from the group consisting of the following polypeptides, comprising culturing the host cell of claim 5 under conditions in which the nucleic acid molecule is expressed: a) SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316; b) an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or fragments of a polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316, wherein the fragment is a fragment of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: : 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, , SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941, 98942 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 or PTA-316 Containing at least 15 contiguous amino acids of the amino acid sequence encoded by the DNA insertion sequence of the plasmid deposited with the ATCC as a host; And c) an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 34, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 70 or SEQ ID NO: 72 or amino acid sequences of Accession Nos. 98936, 98937, 98938, 98939, 98940, 98941 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994 Or a natural allelic variant of a polypeptide comprising an amino acid sequence encoded by a DNA insertion sequence of a plasmid deposited with the ATCC as PTA-316, wherein the polypeptide is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SE Q ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: SEQ ID NO: 27, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 69 or SEQ ID NO: , 98937, 98938, 98939, 98940, 98941, 98942, 98943, 98944, 98945, 98946, 98947, 98948, 98949, 98950, 98951, 98991, 98993, 98994, or PTA-316, encoding nucleic acid molecules that hybridize to a nucleic acid molecule comprising a DNA insertion sequence of a plasmid deposited with the ATCC do). a) contacting a sample with a compound that selectively binds to the polypeptide; And b) detecting the presence of the polypeptide of claim 8 in the sample by determining whether the compound binds to the polypeptide in the sample. 14. The method of claim 13, wherein the compound that binds to the polypeptide is an antibody. 9. A kit comprising a compound that selectively binds to the polypeptide of claim 8 and instructions for use. a) contacting the sample with a nucleic acid probe or primer that is selectively hybridized to the nucleic acid molecule; And b) detecting the presence of the nucleic acid molecule of claim 1 in the sample by determining whether the nucleic acid probe or primer binds to the nucleic acid molecule in the sample, thereby detecting the presence of the nucleic acid molecule of claim 1 in the sample. 17. The method of claim 16, wherein the sample comprises mRNA molecules and is contacted with a nucleic acid probe. A kit comprising a compound that selectively hybridizes to the nucleic acid molecule of claim 1 and instructions for use. a) contacting a test compound with a cell expressing the polypeptide or polypeptide; And b) identifying a compound that binds to the polypeptide of claim 8, comprising determining whether the polypeptide binds to the test compound. 20. The method of claim 19, a) detection of binding by direct detection of test compound / polypeptide binding; b) detection of binding using competitive binding assays; And c) detecting the binding of the test compound to the polypeptide by a method selected from the group consisting of detection of binding using an assay for PCIP activity. A method of modulating the activity of a polypeptide of claim 8, comprising contacting the cell expressing the polypeptide or polypeptide with a compound that binds to the polypeptide at a concentration sufficient to modulate the activity of the polypeptide. a) contacting the test compound with the polypeptide of claim 8; And b) identifying a compound that modulates the activity of the polypeptide of claim 8, including identifying a compound that modulates the activity of the polypeptide by determining the effect of the test compound on the activity of the polypeptide. Identifying a compound capable of treating a disease characterized by abnormal PCIP nucleic acid expression or PCIP protein activity by assaying the ability of the compound or agent to modulate the expression of the PCIP nucleic acid molecule of claim 1 or the activity of the PCIP polypeptide of claim 8 Wherein the compound is capable of treating a disease characterized by abnormal PCIP nucleic acid expression or PCIP protein activity. 24. The method of claim 23, wherein the disease is a CNS disease. 25. The method of claim 24, wherein the disease is epilepsy. 25. The method of claim 24, wherein the disease is spinal cord cerebral ataxia. 24. The method of claim 23, wherein the disease is cardiovascular disease. 28. The method of claim 27, wherein the cardiovascular disease is associated with an abnormal I _to current. Genetic impairment in a cell sample from a subject wherein the genetic impairment is characterized by a change affecting the integrity of the gene encoding the PCIP polypeptide of claim 8 or by misexpression of the PCIP nucleic acid molecule of claim 1 ) Of the subject is at risk of developing a disorder characterized by abnormal or abnormal PCIP nucleic acid expression and / or PCIP protein activity. 30. The method of claim 29, wherein the disease is a CNS disease. 31. The method of claim 30, wherein the disease is epilepsy. 31. The method of claim 30, wherein the disease is spinal cord cerebral ataxia. 30. The method of claim 29, wherein the disease is cardiovascular disease. 34. The method of claim 33, wherein the cardiovascular disease is associated with an abnormal I _to current. Wherein the genetic impairment is characterized by a change affecting the integrity of the gene encoding the PCIP polypeptide of claim 8 or by the misrepresentation of the PCIP nucleic acid molecule of claim 1, Characterized by abnormal or abnormal PCIP nucleic acid expression and / or PCIP protein activity, including identifying a subject suffering from a disease characterized by abnormal or abnormal PCIP nucleic acid expression and / or PCIP protein activity by detecting the presence or absence of abnormal or abnormal PCIP nucleic acid expression and / How to identify an affected person with a disease. 37. The method of claim 35, wherein the disease is a CNS disease. 37. The method of claim 36, wherein the disease is epilepsy. 37. The method of claim 36, wherein the disease is spinal cord cerebral ataxia. 37. The method of claim 35, wherein the disease is cardiovascular disease. 40. The method of claim 39, wherein the cardiovascular disease is associated with an abnormal I _to current. A method of treating a subject suffering from a potassium channel-related disorder, comprising administering to the subject a therapeutically effective amount of the PCIP polypeptide of claim 8 or a portion thereof. 42. The method of claim 41, wherein the disease is a CNS disease. 43. The method of claim 42, wherein the disease is epilepsy. 43. The method of claim 42, wherein the disease is spinal cord cerebral ataxia. 42. The method of claim 41, wherein the disease is cardiovascular disease. 46. The method of claim 45, wherein the cardiovascular disease is associated with an abnormal I _to current. Comprising administering to a subject a therapeutically effective amount of a nucleic acid encoding a PCIP polypeptide of claim 8 or a portion thereof. 48. The method of claim 47, wherein the disease is a CNS disease. 49. The method of claim 48, wherein the disease is epilepsy. 49. The method of claim 48, wherein the disease is spinal cord cerebral ataxia. 48. The method of claim 47, wherein the disease is cardiovascular disease. 52. The method of claim 51, wherein the cardiovascular disease is associated with an abnormal I _to current. Use of a compound identified by the method of claim 23 for treating a potassium channel related disorder.