CZ20023518A3 - Medicament for inhibition of growth of non-solid tumor cells - Google Patents

Abstract

A method of inhibiting the growth of non-solid tumor cells that are stimulated by a ligand of vascular endothelial growth factor in human patients, comprising treating the human patients with an effective amount of a vascular endothelial growth factor receptor antagonist.

Description

Technical field

The invention relates to a medicament for inhibiting the growth of cells of non-solid tumors which are stimulated in a mammal by a ligand of the vascular endothelial growth factor receptor (VEGFR).

BACKGROUND OF THE INVENTION

Cancer is the second most common cause of death after heart attacks. Significant progress has been made in developing new therapies for the treatment of these devastating diseases. Most of this progress is due to a better understanding of cell proliferation in both normal and tumor cells.

Normal cells proliferate by highly controlled activation of growth factor receptors by their corresponding ligands. Examples of such receptors are tyrosine kinase receptors for growth factors.

Tumor cells also proliferate by activating growth factor receptors, but lose proper control of normal proliferation. Loss of control can be due to numerous factors, such as overexpression of growth factors and / or receptors, and autonomous activation of biochemical pathways regulated by growth factors.

Some examples of receptors that play a role in tumorigenesis are receptors for vascular endothelial growth factor (VEGFR), platelet-derived growth factor (PDGFR), insulin. ·· ·· similar growth factor (IGFR), nerve growth factor (NGFR), and fibroblast growth factor (FGF).

During embryonic development, hematopoietic and early endothelial cells (angioblasts) develop from a common precursor cell known as hemangioblast. Because of this common origin, several signaling pathways are shared by both hematopoietic and vascular cells. One such pathway is the VEGFR signaling pathway. VEGF receptors (VEGFR) include FLT-1 sequenced by Shibuya Met al., Oncogene 5, 519524 (1990) (VEGFR-1); KDR described in PCT / US92 / 01300, registered February 20, 1992 and described by Terman et al., Oncogene 6: 1677-1683 (1991); and FLK-1 sequenced by Mathews W. et al., Proc. Nati. Acad. Sci. USA, 88: 9026-9030 (1991) (KDR and FLK-1 are collectively called VEGFR-2).

Unless otherwise stated or otherwise derived from the context, this specification follows the conventional literature nomenclature of VEGF receptors. DRC refers to the human form of VEGFR-2. FLK-1 refers to the murine homologue of VEGFR2. FLT-1 is different but related to the KDR / FLK-1 receptor.

VEGFR binds to several soluble factors including vascular endothelial growth factor (VEGF), which exhibits proliferative and migratory effects on the endothelium. VEGFR-2 was thought to be exclusively expressed by edothelial cells. However, it has recently been shown that VGFR is present on a subset of multipotent hematopoietic stem cells (1). Some studies have shown that some leukemia cells also express VEGFR-2 (2).

VEGFR-2 and VEGFR-1 are two primary signaling tyrosine kinase receptors that mediate various biological effects of VEGF. Although the binding affinity of VEGFR-1 to VEGF is very high with Kd values of 10-70 pM (5), most studies have shown that VEGFR-2 is a critical receptor for the transmission of cellular signals for endothelial cell proliferation and differentiation (6). VEGFR-1 appears to be more important for vascular remodeling. The relative importance of VEGF receptors for the regulation of vasculogenesis and angiogenesis has been demonstrated in studies in which genes for VEGFR-2 and VEGFR-1 in mouse embryonic stem cells were disrupted by homologous recombination. VEGFR-2 deficient mice had drastic defects in vasculogenesis, angiogenesis, and hematopoiesis (7). In contrast, VEGFR-1 knockout mice developed abnormal channels, suggesting the role of this receptor in regulating cell-cell or cell-matrix interactions (8).

Inhibition of angiogenesis by disruption of VRGFR-2 ' signaling results in inhibition of growth and metastasis of solid tumors. For example, the monoclonal antibody (MoAb) neutralizing mouse VEGFR-2 inhibited tumor growth and metastasis in mouse models (9, 10). In addition, glioblastoma growth was inhibited in VEGFR-2 dominant negative mice (11). Such inhibition of tumor growth is attributed to inhibition of angiogenesis effectively limiting tumor blood supply.

Leukemias arise from hematopoietic stem cells having self-renewing capacity, while some less aggressive leukemias, such as chronic leukemias, appear to arise from more mature, determined hematopoietic progenitor cells.

In any event, leukemia cells do not require independent blood supply. Therefore, leukemia and other non-solid tumors are not susceptible to the treatments described above.

Some studies have shown that VEGF. it is almost always expressed by all established leukemia cell lines as well as freshly isolated human leukemias, including the well-studied leukemia cell line HL-60 (2,3). Using RT-PCR, several studies have shown that VEGFR-2 and 'VEGFR-1 are only expressed by certain human leukemias (2,3). However, none of these studies has shown that VEGF expression is associated with any parallel expression of surface VEGFR2 / VEGFR-1 or a functional response.

Current cancer treatments traditionally include chemotherapy or radiation. However, this treatment is not always effective, especially for a long time.

Therefore, there is a need for new treatments for non-solid tumors. It is an object of the present invention to provide such methods.

Description of the invention

This and other objectives, as will be apparent to those of ordinary skill in the art, have been achieved by providing a method of inhibiting the growth of non-consolidated tumors that are stimulated by a VEGFR ligand in mammals. The method comprises treating a mammal with an effective amount of a VEGR antagonist.

In another embodiment, the method of the present invention comprises treating human patients with a combination of an effective amount of a VEGFR antagonist and a chemotherapeutic agent.

In yet another embodiment, the method of the present invention comprises treating a human patient by combining an effective amount of a VEGFR antagonist and radiation.

• · · · · · · · · · · · · ·

FLT-1 / VEGFR-1 and stained with Control

Brief description of the pictures

Figure 1. Human chloromas express

KDR / VEGFR-2. Sections of human chloromas by immunohistochemistry as described in Methodology. A IgG staining only non-specifically (magnification: 400x); B: Factor VIII staining, showing specific blood vessel staining (magnification: 100x); C: Staining of KDR / VEGFR-2 on leukemia cell areas (magnification: 400x); D: FLT-1 / VEGFR-1 expression, also detected on a subset of leukemic cells (magnification: 400x). E and F: VEGF 'expression showing specific leukemia cell (E) and positive control, pericyt staining (white arrow, F) (magnification: 400x). These results represent 4 different samples.

Figure 2A: Expression of VEGFR-2 by leukemia cell lines. The HL-60 and HEL cell lines (as well as 5 primary leukemias) expressed KDR / VEGFR-2 as detected by RT-PCR. K562 cells were KDR negative, β-actin was used as internal control.

Figure 2B: VEGF ₁₆₅ induced dose-dependent VEGFR-2 phosphorylation on VEGFR-2 positive leukemia cell lines. Total cell lysates from HL-60 and HEL cells were immunoprecipitated with an antiphosphotyrosine antibody and subsequently analyzed by Western blot using antibodies against VEGFR-1 (FLT-1) or VEGFR-2 (KDR) as described in the Methodology. Fibroblasts were used as negative controls and showed no signs of VEGFR-1 or VEGFR-2 phosphorylation. The results presented represent 3 separate experiments.

Figure 3. VEGF induced proliferation at ₆ 5 subgroups leukemia mediated effect of KDR / VEGFR-second VEGFies induced a significant (*, p less than 0.003) increase in proliferation of all KDR / VEGFR-2 + 999 leukemias (2 cell lines and 2 primary) leukemia). This effect can be blocked by neutralizing MoAbs directed against KDR / VEGFR-2 (**, p less 0.04) as described in the Methodology. The results presented represent 3 separate experiments.

Figure 4. High affinity tyrosine kinase inhibitor KDR / VEGFR-2 blocked VEGF ₁₆₅ -induced leukemia cell proliferation. The tyrosine kinase inhibitor AG1433 significantly blocked leukemia cell proliferation (*, p less than 0.05), confirming that on leukemic cells mitogenic effects are mediated through. KDR / VEGFR-2. These results represent 2 separate experiments.

Figure 5. VEGF ₆ with induces MMP secretion by leukemic cells. A: Zymographic analysis of leukemia cell supernatants, with or without VEGF165 stimulation for 24 hours. B: Quantification of gelatinolytic activity detected in culture supernatants. Incubation of leukemic cells with VEGF165 for 24 hours significantly influenced (p less than 0.05) the level of MMP released into the supernatant as detected by zymography. The results presented represent 3 separate experiments.

Figure 6. VEGF165 induces in a dose-dependent manner (50-200 ng / ml) leukemia cell migration in matrigel coated wells, a process mediated by KDR / VEGFR-2 and FLT1 / VEGFR-1. Migration of HL-60 cells and 4 primary leukemias in matrigel-coated wells based on 200 ng / ml VEGF _{65 is shown} . This process requires MMP activity as demonstrated by the effects of synthetic MMPi. A monoclonal antibody to KDR / VEGFR-2 partially blocked leukemic cell migration, but incubating cells with both FLT-1 / VEGFR-1 and KDR / VEGFR-2 was more effective than using either antibody alone (**, p less than 0.05) ). These results represent 3 independent experiments.

Figure 7. Migration of HL-60 cells induced with VEGF ₆ is blocked by AG1433. A synthetic protein kinase inhibitor AG1433 (concentration 10 µM used) blocked VEGF ₆₅ -induced migration of HL-60 cells (*, p less than 0.04). These results represent 2 different experiments and each experiment was performed in a triplet.

Figure 8. Injection of HL-60 NOD-SCID cells into mice induces high concentrations of human but not murine VEGF in mouse plasma. Mice were injected with 1x10 ⁶ HL-60 cells (iv) and plasma levels of human (A) and mouse (B) VEGF were measured by ELISA at various time intervals after injection. The results represent 2 separate experiments. B. Survival of mice (%) after injection of HL-60 cells (iv). Mice were injected with 1x10 ⁶ HL-60 cells (iv) and 3 days after injection of leukemia cells (n = 5) ip with 400 µg IMC-1C11 (neutralizing MoAb to human VEGFR2 / KDR) or PBS / BSA (n = 8) three times a week. One mouse was sacrificed for histological analysis. The results presented represent 2 separate experiments.

Figure 9. Histology of liver (A, B) and spleen (C, D) of mice after injection of HL-60 cells. Untreated (control) mice showed signs of metastatic liver disease (white and red arrows, B) and spleen (D). In contrast, no leukemia cells in the liver (A) and in the spleen were detected in IMC-1C11-treated mice. There were signs of apoptosis (blue arrows, C), but a normal histological picture. · · · Φ φ φ φ byly byly byly byly byly

Figure 10. In VEGFR-2 positive leukemias, VEGF can promote leukemia cell growth through paracrine (increased bone marrow and endothelial cell mass) and autocrine mechanisms. Antibodies against human VEGFR-2 (arrow) can block the autocrine loop induced by VEGF-derived leukemia.

Figure 11. Nucleotide and amino acid sequences of pIC11.

Detailed description of the invention

The present invention provides an improved method of treating non-solid tumors, especially non-solid malignant tumors, in human patients.

Non-solid tumor cells

Non-solid tumor cells include tumors that affect hematopoietic structures including components of the immune system. Some examples of non-solid tumor cells include leukemias, multiple myelomas and lymphomas. These tumor cells generally appear in bone marrow and peripheral circulation.

The types of non-solids that can be treated in accordance with the invention are any non-solid tumors that are stimulated by a VEGFR ligand. The VEGFR family of receptors includes 9999

9 999 99 99

9 9 9 999 • 99 99 9 9 99 9 9 99 99 99 9 9999

9999 99 99 999 9 for example VEGFR-2 (KDR, flk-1) and VEGFR-1 (flt-1). Some examples of ligands that stimulate VEGFR include VEGF.

Some examples of non-solid tumors include leukemias, multiple myelomas and lymphomas. Some examples of leukemias include acute myelocytic leukemia (AML), chronic myelocytic leukemia (CML), acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), erythrocytic leukemia or monocytic leukemia. Some examples of lymphomas include lymphomas within Hodgkin's and Non-Hodgkin's disease.

Non-solid tumors may express VEGFR at normal concentrations, or may overexpress VEGFR at concentrations that are at least 10, 100 or 1000 times higher than normal concentrations.

VEGFR antagonists

The non-solid tumors of the present invention are treated with a VEGFR antagonist. For purposes of this specification, a VEGFR antagonist is any molecule that inhibits VEGFR ligand stimulation. Such inhibition of stimulation inhibits the growth of cells that express VEGFR.

The mechanism of inhibition is not explained in the present invention. However, VEGFR tyrosine kinases are generally activated through phosphorylation reactions. Therefore, antagonists of the invention generally inhibit phosphorylation of VEGFR. Therefore, the determination of phosphorylation is useful for predicting whether these antagonists will be useful in the present invention.

· ♦ ♦ · · · • • • • · ·

The growth of non-solid tumors is sufficiently inhibited in the patient to prevent the progression of cancer (i.e., growth, invasiveness, metastasis, and / or recurrence of non-solid tumors). The VEGFR antagonist of the present invention may be cytostatic, i.e., inhibit the growth of a non-solid tumor. The ERGR antagonist is preferably cytolytic, i.e., destroys the tumor.

VEGFR antagonists include biological molecules or small molecules. Biological molecules include all lipids and polymers of monosaccharides, amino acids, and nucleotides having more than 450. Thus, the biological molecules oligosaccharides and molecular weight greater include, for example, oligopeptides, polypeptides, oligonucleotide peptides and polynucleotides.

polysaccharides, proteins, and

Oligonucleotides polynucleotides include, for example, DNA and RNA.

Biological molecules further include derivatives of any of the molecules described above. Derivatives of biological molecules include, for example, lipid and glycosylation derivatives of oligopeptides, polypeptides, peptides and proteins.

Derivatives of biological molecules further include lipid derivatives of oligosaccharides and polysaccharides, for example lipopolysaccharides.

Biological molecules are most typically antibodies or functional equivalents of antibodies. Functional equivalents of antibodies have binding characteristics comparable to antibodies and inhibit the growth of cells that express VEGFR. Such functional equivalents «9 ·· • 9« 999 • 9 999 999

9999 9999 9 • 99 99 · 9999

9999 99 to 9 999 99 99 include, for example, chimerized, humanized and single chain antibodies, as well as fragments thereof.

Preferably, the functional equivalent of an antibody is a chimerized or humanized antibody. The chimerized antibody comprises a non-human antibody variable region and a human antibody constant region. The humanized antibody comprises a non-human hypervariable region (CDR). The variable region other than the hypervariable region, for example, the framework variable region, and the constant region of a humanized antibody are from a human antibody.

For purposes of this application, suitable variable and hypervariable regions of non-human antibodies can be derived from antibodies produced by any non-human mammal that can produce monoclonal antibodies. Suitable examples of non-human mammals include, for example, rabbits, rats, mice, horses, goats, or primates. Mice are preferred.

Functional equivalents further include antibody fragments having binding characteristics that are the same as or comparable to the binding characteristics of the whole antibody. Suitable antibody fragments include any fragment that contains a sufficient portion of the hypervariable (i.e., complementarity determining) region for specific binding and with sufficient affinity for VEGFR to inhibit the growth of cells that express such receptors.

♦ 0 · ♦♦ · 00 0 0 0 0 ··· 00 000 0 0 0 0 0

000 000 0 0000 0000 0 · 0 · · 0 0000 0000 00 00 000 00 00

Such fragments may contain, for example, one or both Fab fragments or F (ab ') 2 fragments. Preferably, antibody fragments comprise all six complementarity determining regions of the whole antibody, although functional fragments containing less than all such regions, such as three, four or five CDRs, are also included.

Preferred fragments are single chain antibodies or Fv fragments. Single chain antibodies are polypeptides that comprise at least an antibody heavy chain variable region linked to a light chain variable region with or without an interface member. Thus, the Fv fragment comprises the entire antibody combining site. These chains can be produced in bacteria or in eukaryotic cells.

The antibodies and functional equivalents may be representatives of any class of immunoglobulins, such as IgG, IgM, IgA, IgD or IgE, or subclasses thereof. Preferred antibodies are those of the IgG1 subclass. Functional equivalents may be equivalents of combinations of any of the above classes and subclasses.

Antibodies can be generated from the desired receptor by methods well known in the art. Receptors are either commercially available or can be isolated by well known methods. Methods for isolating and purifying KDR are known, for example, in PCT / US92 / 01300. Methods for isolating and purifying flk-1 can be found in the journal in Proc Natl Sci 88: 9026-30 (1991). Methods for isolating and purifying flt-1 can be found in Oncogene 5: 519-24.

«444

4 · • 4 φ * • <4 «t 4 4 4 4 •» · »4444 · 4 ··

4444 «4« • 4 4 »44« 4

4 4 4 4

44 44

Methods for producing monoclonal antibodies include the immunological method described by Kohler and Milstein in Nature 256, 495-497 (1975) and by Campbell in Monoclonal Antibody Technology, The Production and Characterization of Rodent and Human Hybridomas in Burdon et al, Eds, Laboratory Techniques in Biochemistry and Molecular Biology, Volume 13, Elsevier Science Publishers, Amsterdam (1985). The recombinant DNA method described by Huse et al. in Science 246, 1275-1281 (1989) is also suitable.

Briefly, in order to produce monoclonal antibodies, a host mammal is inoculated with a receptor or receptor fragment as described above and then optionally re-inoculated. For a receptor fragment to be useful, it must contain sufficient amino acid residues to define the epitope of the molecule to be detected. If the fragment is too short to be immunogenic, it can be conjugated to a carrier molecule. Some suitable carrier molecules include hemocyanin labels and bovine serum albumin. Conjugation may be accomplished by methods known in the art. One such method combines the cysteine residue of the fragment with the cysteine residue of the carrier molecule.

Spleens are harvested from inoculated mammals a few days after final inoculation. Spleen cell suspensions are fused to a tumor cell. The resulting hybridoma cells that express antibodies are isolated, cultured, and maintained in culture.

• · · ·

• · · ······

Antibodies that are substantially of human origin can be produced in transgenic mammals, especially transgenic mice that are genetically modified to express human antibodies. Methods for generating chimeric and humanized antibodies are well known in the art. Methods for generating chimeric antibodies include, for example, those described in US patents Boss (Celltech) and Cabill (Genetech). See U.S. Patent Nos. 4,816,397 and 4,816,567, respectively. Methods of making humanized antibodies are described, for example, in US Patent Winter, No. 5,225,539.

A preferred method of humanizing antibodies is called CDRgrafting. In this method, murine antibody regions that are directly involved in antigen binding, i.e., complementarity determining regions or CDRs, are grafted onto human variable regions to form reshaped human variable regions. The fully humanized variable regions are then joined to human constant regions to produce fully fully humanized antibodies.

In order to generate fully humanized antibodies that bind well to the antigen, it is advantageous to design the reshaped human variable regions with caution. The human variable regions into which the CDRs will be grafted should be carefully selected, and it is usually necessary to make several amino acid changes at critical positions within the framework regions (FRs) of the human variable regions.

For example, the reshaped human variable regions may comprise up to ten amino acid changes in the FR of the selected human light chain variable region and twelve amino acid changes in the FR of the selected human heavy chain variable region. DNA sequences encoding these reshaped human heavy and light chain variable region genes are linked to DNA sequences encoding human heavy and light chain constant region genes, preferably γΐ and κ. The reshaped humanized antibody is then expressed in mammalian cells and its affinity for its target is compared to that of the corresponding murine antibody and chimeric antibody.

Methods for selecting residues of the humanized antibody to be substituted and for making substitutions are well known in the art. See, for example, Co et al., Nature 351, 501-502 (1992); Queen et al., Proc. Nati. Acad. Sci. 86, 100029-1003 (1989) and Rodrigues et al., Int. J. Cancer, Supplement 7: 45-50 (1992). A method of humanizing and reshaping 225 anti-EGFR monoclonal antibodies is described by Goldstein et al. in PCT application WO 96/40210. This method can be adapted to generate humanized and reshaped antibodies against other receptor tyrosine kinase growth factors.

Methods for generating single chain antibodies are also well known in the art. Some suitable examples include, for example, European Patent Application Wels et al, No. 502,812 and Int. J. Cancer 60: 137-144 (1995). Single chain antibodies can also be prepared by phage library screening. See below.

Other methods of generating functional equivalents described above are disclosed in PCT Application WO 93/21319, European Patent Application 239 400, PCT Application WO 89/09622, European.

U.S. Patent 338,745, U.S. Patent 5,658,570, U.S. Patent 5,693,780 and European Patent Application EP 332,424.

Preferred VEGFR antibodies are chimerized, humanized, and single chain antibodies derived from a murine antibody for which the amino acid and nucleotide sequences of the heavy and light chain hypervariable regions are listed below. The chimerized antibody and single chain antibodies may be performed in accordance with standard methods, such as those described below. The humanized antibody can be prepared in accordance with the method described in example IV of PCT application WO ^96/40210,: which is hereby incorporated by reference.

The sequences of the hypervariable (CDR) regions of the light and heavy chains are reproduced below. The nucleotide sequence is shown below the amino acid sequence.

································

Heavy chain hypervariable regions (VH):

CDR1

SEQ ID NO: 1

Gly Pne Asn Ile Asp Phe Tyr Met His

SEQ ID NO: 9 ggcttcaaca ttaaagactt ctatatgcac

CDR2

SEQ ID NO: 2

Trp Ile Asp Glu Asn Gly Asp Ser Asp Tyr Ala Lys Phe Gin Gly

SEQ ID NO: 10 tgattgatc ctgagaatgg tgattctgat tatgccccga agttccaggg c

CDR3

SEQ ID NO: 3

Tyr Tyr Gly Asp

SEQ ID NO: 11 actacgaagg ctac

Hypervariable light chain (VL) regions:

CDR1

9 9 9 9 9 9

9 ·

9999 99

9 ·

SEQ ID NO: 4

Ser Ala Ser Ser Ser Val Ser Tyr Met His ···· · · ·

9 9

9 9

9 9 9

99

SEQ ID NO: 12 agtgccagct caagtgtaag ttacatgcac

CDR2

SEQ ID NO: 5

Ser Thr Ser Asn Leu Ala Ser

SEQ ID NO: 13 agcacatcca acctggcttc t

CDR3

SEQ ID NO: 6

Gin Gin Arg

SEQ ID NO: 14 cagcaaagga gtagttaccc attcacg

The entire light and heavy chain sequences are listed below. Nucleotide. the sequence is shown below the amino acid sequence.

Heavy chain

SEQ ID NO: 7

Gin Val Lys Glu Gin Ser Gly Ala Glu Glu Ser Gly Ser Gly Ala Ser Lys Leu Ser Cys Thr Thr Ser Gly Phe Asn Ile Asp Phe Tyr Met His Trp Val Lys Gin Arg Pro Glu Gly Leu Glu Trp Ile Gly Trp Ile Asp Pro Glu Asn Gly Asp Ser Asp Tyr Ala Pro Lys Phe Gin Gly Lys Ala Thr Met Thr Met Thr Tkla Asp Ser Ser Asn Thr Ala Tyr Leu Gin Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Tyr Tyr Gly Thr Thr Thr Thr Thr Val Thr Thr Val Ser Ser

SEQ ID NO: 15

caggtcaagc tgcagcagtc tggggcagag cttgtggggt caggggcctr agtcaaattg 60 tcctgcacaa cttctggctt caacattaaa gacttctata tgcactgggt gaagcagagg 120 cctgaacagg gcctggagtg gattggatgg attgatcctg agaatggtga ttctgattat 180 gccccgaagt tccagggcaa ggccaccatg actgcagact catcctccaa cacagcctac 240 ctgcagctca gcagcctgac atctgaggac actgccgtct attactgtaa tgcatactat 300 ggtgactacg aaggctactg gggccaaggg accacggtca ccgtctcctc a 351

The light chain of SEQ ID NO: 8

Asp Ile Glu Leu Thr Gin SerPro Ala Ile Met Ser Ala Ser For Gly Glu Lys Val Thr Ile Thr Cys Ser Ala Ser Ser Ser Wall Ser Tyr Met His Trp Pne Gin Gin Lys Pro Gly Thr Pro Ser Lys Leu Trp Tle Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gin Gin Arg Ser Ser Tyr For Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys

····················

SEQ ID NO: 16 gacatcgagc tcactcagtc tccagcaatc atgtctgcat ctccagggga gaaggtcacc 60 ataacctgca gtgccagctc aagtgtaagt ggttccagca gaagccaggc 120 acttctccca aactctggat ttatagcaca cttctggagt ccctgctcgc 180 ttcagtggca gtggatctgg gacctcttac tcagccgaat ggaggctgaa 240 gatgctgcca cttattadtg ccagcaaaggagtagttacc cattcacgtt cggctcgggg 300 accaagctgg aaataaaa tacatgcact tccaacctgg tctctcacaa • • ··· ·· · 99

• 9 ····

Other examples of biological molecules that are useful as antagonists include soluble receptors. (Exp. Cell Res. 241: 1, 161-170; Proc. Natl. Acad. Sci. 92:23, 10457-61)

In addition to the biological molecules discussed above, small molecules may also be useful as antagonists in the present invention. Any molecule that is not a biological molecule is considered a small molecule in this specification. Some examples of small molecules include organic compounds, organometallic organometallic compounds, organic salts and compounds, carbohydrates, amino acids, and nucleotides. Small molecules further include molecules that would otherwise be considered biological molecules if their molecular weight is not greater than 450. Thus, the small molecules may be lipids, oligosaccharides, oligopeptides and oligonucleotides and derivatives thereof having a molecular weight of 450 or less.

It is emphasized that small molecules can have any molecular weight. They are called small molecules because they typically have a molecular weight of less than 450. Small molecules include compounds that are found in nature as well as synthetic compounds. Preferably, small molecules inhibit the growth of non-solid tumor cells that express VEGFR tyrosine kinase.

Some examples of small molecules that are 'useful' as VEGFR molecules include the quinazolines, quinolines and cinolins described by Hennequin et al. in J. Med. Chem. 42, 5369-5389 (1999). See also Annie et al., Journal of Aquired Immune Deficiency Syndromes and Human Retrovirology 17, A41 (1998).

9 9 9 9 9 9 9 ♦ 9 99 · 9 9 9 9 9 9 9 9 9 9

9 · 999 99 99

Administration of VEGFR antagonists

The present invention includes administering to a human patient an effective amount of a VEGFR antagonist. Administration of the VEGFR antagonist can be accomplished by a variety of routes including systemic administration by parenteral and enteral routes. The VEGFR antagonist of the present invention can be readily administered intravenously (e.g., by intravenous injection), which is the preferred route of administration. Intravenous administration can be accomplished by contacting VEGFR antagonists with a suitable pharmaceutical carrier (vehicle) or excipient by a person skilled in the art.

The VEGFR antagonists of the present invention significantly inhibit the growth of non-solid tumor cells when administered to an human patient in an effective amount. As used herein, an effective amount is an amount effective to achieve the specified result of inhibiting the growth of non-solid tumors.

Optimal dosages of VEGFR antagonists may be determined by the physician depending on a variety of parameters including age, sex, weight, severity of the disease to be treated, the type of antagonist to be administered, and the route of administration. Generally, a serum concentration of the antagonist that permits saturation of the target receptor is desirable. For example, in the case of polypeptides and antibodies, a concentration of about 0.1 nM is normally sufficient. For example, an antibody dose of 100 mg / m ² provides a serum concentration of about 20 nM for eight days.

• · ·

As a rough guide, doses of 10-300 mg / m ^{2 of} antibody per week can be administered. Equivalent doses of antibody fragments should be used at more frequent intervals to maintain serum levels at a concentration that permits receptor saturation.

Combination therapy

In one preferred embodiment, the non-solid tumor can be treated with an effective amount of a combination of a VEGFR antagonist as described above and chemotherapeutic agents, radiation, or combinations thereof.

Examples of chemotherapeutic agents include alkylating agents such as nitrogen mustard, ethyleneimine compounds and alkyl sulfonates; antimetabolites such as folic acid or pyrimidine antagonists; mitosis inhibitors such as vinca alkaloids and podophyllotoxin derivatives; cytotoxic antibiotics; compounds that damage or interfere with DNA expression.

Specific examples of chemotherapeutic agents or chemotherapy include cisplatin, dacarbazine (DTIC), dactinomycin, mechloretamine, (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), doxorubicin (adriamycin), daunorubicin, munorubicin, daunorubicin etoposide, methotrexate, 5-fluorouracil, vinblastine, vincristine, bleomycin, paclitaxel (taxol), docetaxel (taxotere), aldesleukin, asparaginase, busulfan, carboplatin, cladribine, floxuridine, fludarabine, megoproline, alphaoproline, alphaoproline, ifoproline, ifoproline, ifopurol, mitotane, pegaspargase, pentostatin, pipobroman, dacarbazine, plicamycin interferon, plicamycin, tamoxifen, teniposide, testolactone, thioguanine, thiotepa, tartaric mustrad, vinorelbine, chlorambucil, taxol and their.

Administration of chemotherapeutic agents may be accomplished by a variety of routes including systemic administration by parenteral and eneteral routes as described above.

In yet another embodiment, the non-solid tumor can be treated with an effective amount of a VEGFR antagonist in combination with radiation. The source may be either external or internal to the patient to be treated. If the source is external, treatment is known as external beam radiation therapy (EBRT). If the source of radiation is internal, the treatment is called brachytherapy (BT).

The irradiation is applied in accordance with well known standard techniques with standard equipment made for this purpose, such as AECL Theratron and Varian Clinac. The dose of radiation depends on a number of factors, as is well known in the art. Such factors include the type of organ to be treated, healthy organs in the radiation pathway that may be inadvertently or undesirably affected, the patient's tolerance to radiation treatment, and the body area to be treated. The dosage will typically be between 1 and 100 Gy and more particularly between 2 and 80 Gy. Some doses that have been described include 35 Gy per spinal cord, 15 Gy per kidney, 20 Gy per liver and 65-80 Gy per prostate. However, it should be emphasized that the invention is not limited to. no specific dose. The dose will be determined by the attending physician in accordance with the particular factors in the situation, including those mentioned above.

The distance between the patient's external radiation source may be any distance, an acceptable balance between killing by minimizing side effects. A source typically between 70 and 100 cm from the point of entry into and the point of entry into which represents the target cells and the external radiation is the patient.

Brachytherapy is generally performed by locating the source of radiation in the patient. The radiation source is typically approximately 0-3 cm from the tissue to be treated. Known techniques include interstitial, intercavitary and superficial brachytherapy. Radioactive grains can be implanted permanently or temporarily. Some typical radioactive atoms that are used in permanent implants include iodine 125 and radon. Some typical radioactive atoms that are used as temporary implants include radium, cesium 137 and iridium 192. Some other radioactive atoms that are used in brachytherapy include americium 241 and gold 198.

The radiation dose for brachytherapy may be the same as those mentioned above for external beam radiation treatment. In addition to the factors mentioned above for determining the dose for external beam radiation therapy, the nature of the radioactive atom is also taken into account for determining the dose of brachytherapy.

In a preferred embodiment, there is synergy in the treatment of non-solid tumors in chemotherapeutic combinations. In other human patients with a VEGFR antagonist and substances or radiation, or in their words, inhibition of tumor growth by a VEGFR antagonist is enhanced when combined with chemotherapeutic agents.

Substances or radiation or combinations thereof. Synergy may be demonstrated, for example, by greater inhibition of non-solid tumor growth by combination therapy than would be expected with either VEGFR antagonist, a chemotherapeutic agent, or radiation alone. Synergy is preferably demonstrated by cancer remission, where remission is not expected from treatment with a VEGFR antagonist, a chemotherapeutic agent alone, or radiation alone.

The VEGFR antagonist is administered before, during, or after initiation of chemotherapeutic agent or radiation therapy, as well as a combination of such administration, ie, before and during, before and after, during and after, or before, during and after initiation of chemotherapeutic agent treatment and / or radiation therapy. For example, if the VEGFR antagonist is an antibody, it is typically administered between day 1 and day 30, preferably between day 3 and day 20, more preferably between day 5 and day 12, before starting treatment with radiation and / or chemotherapeutic agents.

The examples below demonstrate that certain subgroups of leukemias not only produce VEGF but also express functional VEGFR-2 in vivo and in vitro, resulting in an autocrine loop that enhances leukemia cell proliferation and migration. Approximately 50% of freshly isolated acute myeloblastic leukemias (AML) examined express mRNA and protein for VEGFR-2. VEGF165 induced VEGFR-2 phosphorylation and increased leukemia cell proliferation. ₆ 5 VEGF also induces the expression of metalloproteinase-9 (MMP-9) leukemic cells and promote their migration through reconstituted basement membranes.

· Cell synthesis of cells

Neutralizing MoAb to VEGFR-2 and a specific VEGFR-2 inhibitor blocked VEGF- _6- mediated leukemia proliferation and VEGF-induced leukemia migration. Xenotransplantation of human leukemias by immunocompromised NOD-SCID mice resulted in a significant increase in human but not murine VEGF in plasma and death of inoculated mice within two weeks. Injection of human specific neutralizing monoclonal antibody, which selectively blocks signaling by human VEGF-2, inhibited proliferation of xenotransplanted human leukemias and increased mouse survival during the experiment.

All chemicals were obtained from Sigma unless otherwise noted.

DETAILED DESCRIPTION OF THE INVENTION

Example 1. Inhibition of VEGFR

Sampling of primary AML and isolation of mononuclear cells by Ficoll gradient

Peripheral blood samples from patients with leukemias (diagnosed with acute leukemia) were collected by phlebotomy, diluted in half with Hank buffer (Gibco BRL) and overlaid with 5 ml of Lymhoprep (Ficoll, Accurate Chemical and Scientific Corporation, NY). Each sample was centrifuged at 4000 rpm for 30 minutes and the mononuclear cells in the interphase were collected in a fresh tube and washed twice with Hank buffer for 5 minutes at 2500 rpm. The resulting cell pellet was finally resuspended in RPMI / 10% FCS.

Cell culture

The three AML cell lines used in this study, HL-60 (promyelomonocytic), HEL (megakaryocytic) and K562 (erythroid), were cultured in RPMI with 10% FCS, penicillin. Fcfc (100 U / ml), streptomycin (100 µg / ml) and fungizone (0.25 µg / ml). Prior to incubation with VEGF and / or antibodies / protein inhibitor kinases, cells were cultured for 16 hours through night only in RPMI alone.

After collection and isolation of mononuclear cells from peripheral blood, primary leukemic cells were cultured overnight in RPMI / 10% FCS to eliminate possible contamination with monocytes / macrophages that adhere more readily to tissue culture flasks. The cells remaining in suspension are mainly leukemic blasts. These leukemic cells were subsequently transferred to another vessel and before adding VEGF and / or anti-VEGFR antibodies, the cells were cultured serum-free for 16 hours overnight in RPMI alone.

For proliferation experiments, cells were cultured in 6-well plates (Corning), at a cell density of 1x10 ⁵ cells / well in serum-free RPMI. Cells were treated (10-50 ng / ml VEGF) or untreated (medium alone) and cultured in the presence or absence of 500 ng to 1 µg / ml immunoneutralizing MoAb to KDR / VEGFR-2, IMC-1C11 (12), or MoAb to FLT-1 / VEGFR-1, clone 6.12 (both from ImClone Systems Incorporated). A synthetic protein kinase inhibitor with high affinity for VEGFR-2 (AG1433, IC ₅₀ : 9.3 µM, Calbiochem, La Jolla, CA) was also used to confirm the mitogenic effects of VEGF on VEGFR-2-mediated leukemia cell lines. at a concentration of 10 µM as recommended by the manufacturer. After 24, 48 and 96 hours, live cells (as determined by trypan blue exclusion) were counted in a triplet using a haemocytometer. Each experiment was performed in a triplet and experiments with leukemia cell lines were repeated three times.

• fc

4444 ··

P «· 4 · 4 4 · ·

4 * · ·

4444 ·· ·· ·· 4 * 44

4 4 44 44 4 4 4 4 4 44 44

RNA extraction, cDNA synthesis and RT-PCR

Total RNA was extracted using TRI reagent following manufacturer's instructions. The cDNA was subsequently synthesized from total RNA using a Ready-To-go Kit (Amersham Pharmacia Biotech, Piscataway, NJ) and PCR was performed using a PCR thermocycler (MWG Biotech, High Point, NC). The amplification PCR program used to amplify KDR, FLT-1 and β-actin consisted of a pre-cycle of 5 minutes at 94 ° C, 45 seconds at 60 ° C and 45 seconds at 72 ° C. After the initial cycle, the reaction was continued for 35 cycles of 1 minute at 94 ° C, 45 seconds at 65 ° C and 2 minutes at 72 ° C, and the reaction was terminated for 7 minutes at 72 ° C. The primer sequences were as follows: β-actin forward primer: tcatgtttgagaccttcaa (SEQ ID NO: 17); β-actin reverse primer: gtctttgcggatgtccacg (SEQ ID NO: 18) (β-actin PCR product: 513 bp); VEGFR-2 forward primer: gtgaccaacatggagtcgtg (SEQ ID NO:

19); VEGFR-2 reverse primer: ccagagattccatgccactt (SEQ ID NO:

20) (VEGFR-2 PCR product: 660 bp); VEGFR-1 forward primer: atttgtgattttggccttgc (SEQ ID NO: 21); VEGFR-1 reverse primer: caggctcatgaacttgaaagc (SEQ ID NO: 22) (VEGFR-1 PCR product: 550 bp). Endothelial cell cDNA was used as a positive control for all 3 sets of primers.

Protein extraction and western blotting

Phosphorylated VEGF receptors (VEGFR-1 and VEGFR-2) were detected by Western blot after incubation of cells with 20 ng / ml VEGF166 (RD Systems ·, MN) for 10 minutes at 37 ° C. After this brief stimulation, total protein extracts from primary leukemic cells and cell lines were obtained by lysing the cells in cold RIPA buffer (50 mM Tris, 5 mM EDTA, 1% Triton X-114, 0.4% sodium cacodylate and 150 mM NaCl) in presence of protease inhibitors (1 mg / ml aprotinin, 10 mg / ml leupeptin, 1 mM β-glycerol phosphate, 1 mM sodium orthovanadate and 1 mM PMSF). Embryonic fibroblasts (MRC5 cell line) were used as a negative control. After centrifugation, which was used to remove cell debris, supernatants (minimum total protein 500 ng) were immunoprecipitated overnight at 4 ° C with protein-G agarose beads and antiphosphotyrosine antibody (Santa Cruz Biotechnology, CA) to precipitate phosphorylated proteins . These proteins were resuspended in sample buffer and subjected to SDS-PAGE-acrylamide gel electrophoresis (7.5%) gels) under reducing conditions (in the presence of β-mercaptoethanol). Proteins were blotted onto nitrocellulose membrane according to conventional protocols. The blots were finally blocked with 1% BSA / PBS-1% Tween-20 for 1 hour at room temperature (RT) followed by incubation with primary and secondary antibodies. Rabbit polyclonal anti-VEGFR-2 antibody (Santa Cruz Biotechnology, CA) and goat monoclonal anti-VEGFR-1 antibody (RD Systems, MN) were used at a concentration of 1 µg / ml, and a secondary anti-rabbit IgG-HRP antibody (for VEGFR-2) or anti-rabbit IgG-HRP antibody (for VEGFR-1) was used at a concentration of 1: 6000. ECL chemiluminescence detection system and ECL film (Amersham Pharmacia Biotech, Piscataway, NJ) were used to visualize the presence of proteins on nitrocellulose blots.

Gelatinolytic zymography

Supernatants from leukemic cell lines and primary cell cultures were withdrawn after incubation overnight in serum free, with or without VEGFiesr medium, and their metalloproteinase activity was measured by gelatinolytic zymography as previously described (13). Briefly, cell culture supernatants were incubated with gelatin-agarose beads to concentrate gelatinases, and subjected to SDS-PAGE acrylamide electrophoresis containing 1% gelatin. The gels were then incubated in 2.5% Triton X-100 for 1 hour at RT, washed with 0% 0 00 0000, and washed with 0% 0 00 0000. in distilled water (DW) and placed in low salt buffer and collagenase (50 nM Tris, pH 7.6, 0.2 M NaCl, 5 mM CaCl 2 and 0.2% v / v Brij-35) at 37 ° C for 18 hours.

The beads with gelatinolytic activity were visualized after staining the gels with 10 ml 0.2% Coomasie blue solution and 190 ml bleach solution (distilled water, methanol and glacial acetic acid, 6: 3: 1) for 30-60 minutes at RT. For each experiment, 1 x 10 ⁶ cells were plated in each well and the experiments were performed in a triplet. Adobe Photoshop 4.0 and the Umax Astra scanner were used to scan the gels, and the intensity of the gelatinolytic strips was evaluated using NIH Image 1.58.

Migration experiments

Freshly isolated leukemia cells and cell lines were resuspended in serum free RPMI and a sample of 10 ⁶ cells / ml was prepared. A modified version of the previously described well migration technique was used (14). Briefly, LC aliquots (100 µl) were added to 8 µm pore inserts, coated with 25 µg of Matrigel without growth factor (Beckton and Dickinson, San Jose, CA) and placed in wells of a 24-well plate. The lower compartment contained serum free RPMI with or without 200 ng / ml VEGFies (RD Systems, MN). For the purpose of blocking migration, each condition was prepared in a separate aliquot and incubated with 1 µg / ml IMC-1C11, anti-VEGFR-1 (clone 6.12) MoAb neutralizing, 10 µM AG1433 (Calbiochem, CA) or wide range MMP inhibitor. 5,10-phenanthroline (1 µM). The antibodies and tyrosine kinase inhibitor used in these studies have been shown to block VEGF-induced endothelial cell proliferation and receptor phosphorylation (12,15,16). Migration was performed at 37 ° C and 5% CO 2 for 14-18 hours. Migrated cells were harvested from the lower compartment, centrifuged at 8000 rpm and counted on a hemocytometer. Only viable cells were used for quantification as determined by trypan exclusion. 4444 · 4 · 4 · 4 4 4 4

4 4 · 4 4> 45 4

4 · 44 4,444 ·

4444 44 44 444 44 44 blue. The experiments were performed in a triplet and the results are shown as the number of cells migrated in response to VEGF.

Immunohistochemical detection of KDR / VEGFR-2, FLT-1 / VEGFR-1 and VEGF for ectopically implanted leukemias (chloromas).

Chlorine paraffin sections were immunohistochemically stained for VEGFR-1 and VEGFR-2 using conventional protocols. The protocols used were: mouse MoAb to VEGFR-2, clone 6.64 (ImClone-Systems Incorporated) used at a concentration of 300 ng / ml; rabbit polyclonal antibody to VEGFR-1 (RD Systems) used at 200 ng / ml; vWF polyclonal antibody used at a concentration of 200 ng / ml; VEGF polyclonal antibody (BioGenex, Ab No. 360 p) used at a concentration of 200 ng / ml. Peroxidase-labeled secondary antibodies (against mouse and rabbit immunoglobulins) were used at a 1/6000 dilution. Sections were stained with Hematoxylin / Eosin and observed under a light microscope.

In vivo experiments with HL-60 cells

Non-obese diabetic paired by age experiments. Cells (NON-SCID) in all injected immunocompromised mice and sex were used HL-60 (1x10 ⁶ / mouse) were intravenously (iv) to 10 NON-SCID mice and 3 days post-injection, mice were divided into 2 groups of 5 mice each. One group was treated intraperitoneally with 400 µg IMC-1C11 (12) three times a week, while the control group was injected with PBS / 1% BSA control for antibody) for the duration of the experiment.

diluent

Quantification of VEGF levels in mouse plasma

Two ELISA kits (both from RD systems) specific for human and murine VEGF, respectively, were used to determine plasma levels of VEGF in the plasma of mice injected with HL-60 cells. Plasma samples were taken at different time points after injection of leukemia cells and samples were used without further dilution.

································· · ··· ·· ··

Each sample was analyzed in a triplet and determinations were performed in two separate experiments. Both analyzes had a sensitivity limit of 7.5 pg / ml and were performed according to the manufacturer's instructions.

Human chloromas express VEGF, VEGFR-2 and VEGFR-1

Human leukemias are not only localized to the bone marrow and peripheral circulation, but can also metastasize to tissues and form solids called chloromas.

Immunohistochemical staining of human chloromas with VEGFR-1 and VEGFR-2-specific antibiotics revealed that in addition to staining of endothelial lining, blood vessels, these receptors were also expressed on a subset of leukemic cells (Fig. 1C and D). Cell membrane localized staining and positive cells appeared scattered in sections (Fig. 1C and D). Overall, the areas in the sections analyzed were more VEGFR ^X 2 positive than VEGFR-1 positive. These receptors were primarily detected in different regions of the tumor, suggesting that staining for VEGFR-1 and VEGFR-2 may identify different cell populations. Furthermore, leukemic cells were stained for VRGF in the sections analyzed (Fig. 1, E and F), suggesting that autocrine loop between VEGF and its receptors may contribute to the formation of chloromas.

Primary leukemia and leukemia cell lines produce VEGF and express VEGFR-2

To generate VEGF and express VEGFR-2, three leukemic cell lines and 10 primary acute leukemias (isolated from peripheral blood samples) were analyzed by ELISA and RT-PCR.

Of the analyzed leukemic cell lines, HL-60 and HEL cells expressed VEGFR-2 at the mRNA level, whereas K532 cells were

negative (Fig. 2A). RT-PCR analysis of primary leukemia samples showed that 5 out of 10 primary AML samples (50% total) expressed VEGFR-2. VEGFR-1 was also detected by RT-PCR on VEGFR-2 positive leukemias. Furthermore, all VEGFR-2 positive leukemia cell lines produced VEGF in vitro. Thus, the presence of functional receptors on VEGF-producing leukemic cells can create an autocrine loop promoting cell growth and survival.

VEGFies induce phosphorylation of VEGFR-1 and VEGFR-2 on leukemic cells

VEGFies induced a dose-dependent increase in VEGFR-1 and VEGFR-2 phosphorylation on leukemic cell lines and primary leukemias, but not on fibroblasts or VEGFR negative leukemic cells' (Fig. 2B) ... In the absence of VEGF, leukemic cells have basal phosphorylation of VEGFR- 1 and VRGFR-2 (Fig. 2B), which may be due to VEGF production and expression of its receptors by the same cells.

The observation that VEGF ₆ s induced phosphorylation of its receptors on a subset of leukemias suggests that it can also induce phenotypic changes on these cells. Therefore, the effect of VEGF165 was further investigated by observing phenotypic changes such as increased proliferation, matrix metalloproteinase (MMP) formation and migration across the reconstituted basement membrane. To investigate whether VEGFies induces its effects on leukemic cells via VEGFR-2, anti-VEGFR MoAbs and the specific protein kinase inhibitor AG1433 were used.

VEGF induces leukemia cell proliferation, an effect mediated via VEGFR-2

VEGF165 induced dose-enhancement and leukemia cell lines in a manner dependent on proliferation of VEGFR-2 positive leukemias (Fig. 3). This effect could be blocked 9 9 9 9 9 9 9 9 9

9 9 4 9 4 9 9 9 9 9 9 9 9 by incubating the cells with IMC-1C11, used at a concentration of 1 µg / ml (Fig. 3, *, p less than 0.05). Mitogenic effects of VEGF165 leukemia cells seem to be mainly mediated through its receptor because MoAb neutralizing VEGFR-1 had no effect on leukemic cell proliferation induced by VEGF ₁₆ 5Důležité is that on leukemia cells, which did not respond to VEGFies, such as the cell line K562 and primary samples 6, 7, 8, 9 and 10, incubation with IMC-1C11 had no effect on VEGF-induced cell proliferation (Fig. 3).

Experiments using the protein kinase inhibitor AG1433 confirmed that VEGF ₆₅ induced leukemia cell proliferation mainly via VEGFR-2 (Fig. 4) _; . AG1433 significantly blocked the growth of VEGF-induced leukemia cells for ₁₆ s at 72 hours. (**, p less than 0.05, Fig. 4) · As with neutralizing MoAbs, incubation of K562 cells, VEGFR-2 negative leukemias or fibroblasts (not shown) with AG1433 in the presence or absence of VEGF165 had no effect on cell proliferation induced VEGF (Fig. 4).

These results showed that VRGF165 induced. cell 'proliferation' on a subset of cell lines and primary leukemias. This effect can be blocked by MoAb to VEGFR-2 and a synthetic protein kinase inhibitor with high affinity for this receptor. This suggests that on leukemic cells, as has been shown on endothelial cells, VEGF1 ₆₅ transmits its mitogenic effects via VEGFR-2.

VEGF induces MMP secretion / production by leukemic cells VEGFies induces smooth muscle MMP production, an effect that is usually correlated with obtaining a more invasive phenotype (17). We have investigated whether VEGF _16S can induce a similar effect on leukemia cells.

• 4 ·· «*« · β ·· ····

4 »4 · 4 · 4 · 4 · 4 · 4 · 444 444 444

Without stimulation under serum-free conditions, the MMP levels released into the supernatant by each sample were variable (Fig. 5). It is suggested that MMP production by leukemic cells may identify a leukemic subtype or sub-population with a more invasive phenotype. The primary leukemias and / or cell lines under investigation have been shown to show that myelomonocyte subtypes (shown in Figure 5: HL-60 cells, samples 2 and 3) have consistently higher basal production and MMP release. For MMP-producing leukemias, incubation with VEGFies significantly increased MMP-9 secretion by leukemic cells (Figs. 5A and B) over an 18 hour period, as determined by densitometry. In primary leukemias, MMP-9 was the major MMP released into the cell supernatant where MMP-2 was not present in most cases (Fig. 5). The levels of TIMP-1 produced by leukemic cells showed only slight variations upon stimulation with VEGF165 as shown by Western blot.

VEGF induces migration of leukemic cells by matrigel coated wells, an effect mediated by VEGFR-1 and VEGFR-2. We investigated whether VEGFi ₆ s was induced. an increase in MMP production by leukemic cells reflects the acquisition of a more invasive phenotype. This has been demonstrated using a migration system in which the well inserts are coated with a thin layer of matrigel, which serves as a model of invasion across the basement membrane. VEGFiss induced HL-60 leukemia cell and VEGFR-2 + primary leukemia migration in a dose-dependent manner (Fig. 6). This process requires the formation and activation of MMP since VEGF-induced cell migration was blocked using a synthetic MMP inhibitor, 5,10-phenanthroline (Fig. 6) and recombinant human TIMP-1.

The remaining cell lines and VEGFR-2 negative primary leukemias did not migrate, depending on VEGF, even through the bare (uncoated) wells. This correlated with reduced ability

of these cells secrete MMPs, but may also be caused by a decreased level of VEGFR expression on these cells, particularly VEGFR-1.

As mentioned above, the mitogenic effects of VEGF1 ₆₅ on leukemia cells were mediated via VEGFR-2. However, in the migration system used in our studies, incubation of HL-60 cells with IMC-1C11 (at a concentration of 1 µg / ml) could only partially (40%) block VEGF165-induced matigel migration (Fig. 6). On the other hand, MoAb to VEGFR-1 used at the same concentration significantly blocked (60-70% migration of HL60 cells (Fig. 6 *, p less than 0.05), suggesting that on these cells VEGF165 may induce MMP activation and migration To confirm this possibility, incubation of HL-60 cells with a combination of VEGFR-1 and VEGFR-2 MoAb resulted in a more effective blockade of VEGF _i6 5 induced migration (70-80%) than either antibody alone (Fig. 6). However, the incubation of HL-60 cells with the VEGFR-2 specific tyrosine kinase inhibitor AG1433 significantly blocked the migration induced by VEGF ₆₅ (70%) (Fig. 7, *, p less than 0.05). on HL-60 cells, the interaction of VEGF ₆ ss VEGFR-1 and VEGFR-2 may be necessary to induce cell migration and invasion, but the exact contribution of each receptor in this process requires further investigation.

In primary leukemias, both anti-VEGFR-1 and VEGFR-2 MoAbs showed overall comparable migration-blocking effects (Fig. 6). However, as for the HL-60 cells leukemia were primary incubation with a combination of anti-VEGFR-1 and VEGFR-2 MoAbs more effective than either antibody alone, with the blockade of VEGF-induced migration by 80 ₆ 5% (Fig. 6). Finally, the migration of leukemic cells in response to VEGF16S could not be blocked by anti-MMP-2 antibodies in any of the cells tested, but was significantly reduced when the cells were incubated with MMP-2 neutralizing antibodies,

9 9 9

This indicates that MMP-9 may be a major proteinase involved in the migration process.

As mentioned above, the migration assay used in our studies requires secretion and activation of active MMP, as well as cellular chemotaxis in response to VEGF ₁₆ 5. Furthermore, studies with antibodies and protein kinase inhibitors indicate that VEGF- ₆₅ induced signaling via VEGFR-1 and VEGFR-2 may be necessary for cells to migrate and invade through the basement membrane. This is not surprising since VEGFR-1 has been shown to mediate monocyte migration (18) as well as MMP production by smooth muscle cells (17).

Taken together, these results suggest that VEGF165 induces a more invasive phenotype on the subset of leukemic cells as determined by increased proliferation, MMP formation and migration through VEGFR-2, although signaling via VEGFR-1 may also be necessary, particularly for migration and MMP production.

HL-60 cells release VEGF in vivo

It is now well established that HL-60 cells release VEGF in picogram amounts in vitro. Using NOD-SCID mice, we examined whether these cells also release VEGF in vivo. As shown in Figure 8A, human VEGF plasma levels increased significantly following leukemic cell injection, which correlated with an increase in circulating leukemic cells and a corresponding decrease in mouse survival (Fig. 8B). Importantly, the plasma levels of mouse VEGF remained very low (at or below the detection level, Fig. 8A) throughout the experiment. These results support the autocrine role of VEGF in the growth and survival of leukemia cells.

Anti-human VEGFR-2 / KDR moAb (IMC-1C11) blocks leukemic growth in vivo · 4 · φ · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · • ··· ♦ · 9 · · · ··· * 39 ........... “··

In the absence of any treatment, injected 1 x 10 ⁶ HL-60 (iv) cells survived for only 14-18 days (n = 8), emphasizing the aggressive nature of these leukemic cells. Using IMC-1C11, we investigated whether VEGF derived from leukemic cells promotes leukemic cell growth by autocrine interaction with VEGFR-2. As shown in Figure 8B, mice treated with IMC-1C11 survived for the duration of the experiment (more than 80 days, Fig. 8B, p less than 0.005). Importantly, it has recently been confirmed that the antibody used in these studies is specific for human VEGFR-2 (KDR) and does not cross-react with mice. flk-1 (Lu et al., published). Also, as mentioned above, human VEGF plasma levels increased in control (untreated) mice, which correlated with a decrease in overall mouse survival (Figs. 8A and B).

These in vivo results confirm the role of VEGF, and VEGFR-2 in the regulation of leukemia cell growth, and suggest that antibodies to VEGF receptors may represent a new therapeutic approach for the treatment of a subset of leukemias.

MoAb against human VEGFR-2 / KDR blocks the formation of liver and spleen metastases

Histological analysis of the liver and spleen of mice after injection of HL60 cells and treated with PBS 14 days after initiation of treatment revealed the presence of leukemic infiltrates (chloromas) in both organs (Fig. 9B and D). Liver sections had several regions invaded by leukemia cells with signs of active cell proliferation (Fig. 9B).

Furthermore, the spleen red pulp region of these mice was largely replaced by leukemic cells (Fig. 9D). On the other hand, mice treated with neutralizing MoAb IMC-1C11 had normal liver and spleen histology (Fig. 9A and C). In treated mice there was no evidence of leukemia infiltrates in the liver (Fig. 9A) and the spleen appeared normal with signs of apoptosis (Fig. 9A).

φ φ φ φ φ φ φ φ φ · · · · · · · · · · · ·

9C). These results indicate that moAbs to human VEGFR-2 block the proliferation and invasiveness of HL-60 cells in inoculated mice.

Interpretation of the Example 1

To define a role of VEGF / human VEGFR-2 autocrine loop in the regulation of leukemic cells in vivo, we used a _r a well-established model of xenotransplantation, where a human leukemia cell line HL-60 transplanted into immunodeficient mice (19-21). Injection of 1 million HL-60 NON-SCID cells into mice results in engraftment and leukemic chloroma formation in bone marrow, spleen, liver, and peripheral circulation. We demonstrate that HL-60 cells produce human VEGF, which can be detected in the plasma of mice with HL-60 xenografted cells at high concentrations as determined by the human specific ELISA (Figure 8A). Increasing levels of human VEGF were detected in plasma samples and increased over time as HL-60 cells proliferated in NON-SCID mice. In contrast, the plasma levels of VEGF produced were insignificant and did not increase during HL-60 cell proliferation (Figure 8A).

In the absence of any NON-SCID intervention, mice xenografted with HL-60 cells are subject to metastatic chloroma proliferation within 14 days of inoculation. However, injection of MoAb specific for the VEGF binding domain of human VEGFR-2 resulted in inhibition of HL-60 human leukemia proliferation in NON-SCID mice and their long-term survival during the experimental period (over 80 days, Figure 8B). Histological examination of the liver and spleen showed that treatment of MoAb against VEGFR-2 effectively inhibited the proliferation of leukemia infiltrates and chloromas in the liver and spleen (Figure 9). These data strongly suggest that endogenously produced human VEGF by HL-60 cells promotes the growth of these leukemic cells through interaction with human VEGFR-2 forming an autocrine loop and confirming in vitro data. Taken together, these data illustrate the plasticity of VEGFR signaling in

vascular and hematopoietic lineages and their potential to promote proliferation of certain subgroups of VEGFR-2 + acute leukemias.

In humans, acute leukemias are classified according to the type of progenitor cell and the differentiation state of the stem cell from which they originate (M1 to M7. Most leukemias are caused by malignant transformation of myeloid-h progenitors (M1, M2, M3, M4, M5) they are mostly localized in the bone marrow and peripheral circulation.-Leukemic cells, however, occasionally gain the capacity to invade various tissues creating niches for the formation of large tumor masses called chloromas, depending on our in vivo results, the majority of VEGFR-2 tested chloromas tested to date and VEGFR-1 Assuming that chlorine formation, like vascular formation, requires sequential invasion, proliferation and stabilization of leukemic cells, it is not surprising that leukemic cells with a chlorine-forming potential also express VEGFR, for example, HL60 cells represent a single leukemic model with a capacity. metastasize and form a solid, vas Therefore, leukemias intended for the formation of chloromas can utilize VEGFR to increase regulation of MMP expression and facilitate invasion of tissues. Expression of VEGFR-2 may subsequently promote leukemia cell proliferation. In the absence of anti-regulatory factors, leukemias can continue to proliferate.

Based on our in vivo results, HL-60 cell growth was inhibited, suggesting that leukemia cell proliferation is mediated by VEGF / VEGFR-2 generated autocrine loops in addition to paracrine loops (Figure 10).

Example II. Production of single chain antibodies

Cell lines and proteins ·· ···· ♦ · · • 9 ·

9 9 • 9 9 9 ·

Primary cultured HUVEC cells were maintained in EBM medium at 37 ° C, 5% CO 2. Cells were used for all analyzes between passages 2-5. VEGF protein ₆ 5 was expressed in baculovirus and purified. The cDNA encoding the extracellular domain of KDR was isolated by RT-PCR from human fetal kidney mRNA and subcloned into the Bgl II and BspE1 sites of the AP-Tag vector. In this plasmid, the KDR 'extracellular domain cDNA is fused to a human placental AP cDNA. The plasmid was electroporated into NIH 3T3 cells along with the neomycin expression vector pSV-Neo and stable cell clones. were selected by G418. The soluble KDR-ΑΡ fusion protein was purified from cell culture supernatant by affinity chromatography using immobilized anti-AP monoclonal antibodies.

Mouse immunization and construction of a single chain antibody phage library

Female BALB / C mice received two intraperitoneal (ip) injections of 10 µg KDR-ΡΡ in 200 µl RIBI adjuvant system over a two month period followed by a single ip injection without RIBI adjuvant. Mice were also injected subcutaneously (sc) with 10 µg KDR-Ρ in 200 µl RIBI at the time of first immunization. Three days before euthanasia, mice were challenged with challenge i.p. injection of KDR-ΑΡ. Donor spleens were removed and cells were harvested. RNA was extracted and mRNA was purified from total RNA of splenocytes. The scFv phage library was constructed using mRNA that was exposed on the surface of filamentous phage M13.

When exposed to scFvs on the surface of filamentous phage, the V _H and V _L domains of the antibody are linked together by a 15 amino acid long binding element (GGGGS) ³ (SEQ ID NO 23) and fused to the non-terminal phage protein III. The 15 amino acid long E tag, which is followed by the Amber Codon (TAG), was 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9

9 9 9 9 9 9 9 9 9 99 between the C-terminal part of V _L and protein III for detection and other analytical purposes. The amber codon located between the E tag protein III allows the construct to form a format with exposure to scFv on the surface after transformation in a suppressor host (such as TGI cells) and scFv in a soluble form upon transformation into a non-suppressor host (such as HB2151 cells).

The assembled scFv DNA was ligated into the pCANTAB 5E vector. Transformed TGI cells were plated in 2YTAG plates and incubated. Colonies were picked into 10 ml 2YT medium, mixed with 5 ml 50% glycerol and stored at -70 ° C as a sample library. >

Biopanorámování

The library sample was cultured to log phase, rescued with M13K07 helper phage, and amplified overnight in 2YTAK medium (2YT containing 100 µg / ml ampicillin and 50 µg / ml kanamycin) at 30 ° C. The phage preparation was precipitated in 4% PEG / 0.5 M NaCl, resuspended in 3% fat-free milk / PBS containing 500 µg / ml AP protein and incubated at 37 ° C for 1 hour to capture the phage with anti-AP scFv k blocking other non-specific binding.

KDR-AE coated Maxisorp Star tubes (10 µg / ml) (Nunc Denmark) were first blocked with 3% milk / PBS at 37 ° C for 1 hour and then incubated with the phage preparation at room temperature for 1 hour. The tubes were washed 10 times with PBST followed by 10 times with PBS (PBS containing 0.1% Tween 20). Bound phage were eluted at room temperature for 10 minutes with 1 ml freshly prepared 100 mM triethylamine solution. The eluted phage were incubated with 10 ml with medium log phase TGI cells at 37 ° C for 30 minutes stationary and 30 minutes with shaking. The infected TGI cells were then plated on 2YTAG plates and incubated overnight at 30 ° C.

•

99% (185/186) of the clones examined after the 3rd round of panning were found to specifically bind DRC. However, only 15 (8%) of these binding agents could block KDR binding to immobilized VEGF. DNA BstN I fingerprinting of these 15 clones showed the presence of 2 different cleaved forms, while 21 randomly removed non-VEGF blocking clones resulted in 4 different forms. All digested forms were also evident in the clones identified after the 2nd round of panning. Representative clones of each digested form? were collected from clones obtained after round 2 panning and subjected to DNA sequencing. Of the 15 sequenced clones, 2 unique VEGF blocking clones and 3 non-VEGF blocking clones were identified. One scFv, p2A7, which did not bind KDR or block VEGF binding to KDR was selected as a negative control for all studies.

ELISA phage

Individual TG1 clones were cultured at 37 ° C in 96-well plates and rescued with M13K07 helper phage as described above. The amplified phage preparation was blocked with 1/6 volume of 18% milk / PBS at room temperature for 1 hour and added to 96-well Maxisorp (Nunc) plates coated with KDR-ΑΡ or AP (1 µg / ml x 100 µl). After incubation at room temperature, plates were washed 3 times 10 times with PBST and incubated with rabbit anti-M13 phage AbHRP conjugate. Plates were washed 5 times, peroxidase substrate was added, optical density was read at 450 nm using a microplate reader, and csFv antibodies were identified and sequenced.

Preparation of soluble scFv

Phones of individual clones were used to infect the non-suppressor host E.coli HB2151 and the infectious agent was 9 9 9 9 9 9 9 9 9 9 9 99

9 9 9 9 9

9999 99 · 9 999 99 99 selected on 2YTAG-N plates. ScFv expression. in HB2 151 cells was induced by culturing the cells in 2YTA medium containing 1 mM isopropyl-1-thio-β-D-galktopyranoside at 30 ° C. Periplasmic cell extract was prepared by resuspending the cell pellet in 25 mM Tris (pH 7.5) containing 20% (w / v) sucrose, 200 mM NaCl, 1 mM EDTA, and 0.1 mM PMSF followed by incubation at 4 ° C with gentle by stirring for 1 hour. After centrifugation at 15,000 rpm, soluble scFv was purified from the supernatant by affinity chromatography using the RPAS Purification Module (Pharmacia Bioteeh).

Example III. Analyzes

Quantitative KDR binding analysis

Two assays were used to examine the quantitative binding of purified soluble scFv to KDR.

Four different clones, including two VEGF blocking clones, pIC11 and plF12, one non-blocking clone, the dominant clone p2A6 and the non-binding clone p2A7. were expressed in shake flasks using non-suppressor E. coli HB2151 host cells. The heavy chain and light chain sequences of PlC11 are shown in Figure 11. The soluble scFv was purified from the periplasmic extracts of E. coli anti E <tag affinity chromatography. The yield of purified scFv of these clones was in the range of 100-400 µg / liter culture.

In direct binding analysis, various amounts of soluble scFv were added to. KDR-coated 96-well Maxisorp microtiter plates and incubated at room temperature for 1 hour, after which the plates were washed 3 times with PBST. Plates were then incubated at room temperature for 1 hour with 100 µl mouse anti E tag antibody followed by incubation with 100 µl rabbit anti-mouse antibody-HRP conjugate.

• · ····

9 9

9 9 9

9 9 9

99

Plates were washed and developed according to the procedure described above for phage ELISA.

In another assay, i.e., competitive VEGF blocking assay, various amounts of scFv were mixed with a fixed amount of KDR-AP (50 ng) and incubated at room temperature for 1 hour. The mixture was then transferred to 96-well plates coated with VEGF ₆₅ (20 ng / well) and incubated at room temperature for a further 2 hours, after which the plates were washed 5 times and substrate for AP was added to quantify bound KDR-AP molecules. Then, the IC 50 value, i.e. the concentration of scFv required for 50% inhibition of KDR binding to VEGF, was calculated.

Clone pIL11 and pIL12 but not p2A6 also block binding to immobilized VEGF. The clC11 clone, the dominant clone after each panning round, showed the highest KDR binding capacity and the highest potential to block VEGF binding to KDR (Table 1). The antibody concentrations of the clC11 clone required for 50% maximal KDR binding and for 50% inhibition of KDR binding to VEGF were 0.2 nM and 3 nM, respectively (see Table 1). FACS analysis demonstrated that clC11, plF12 and p2A6 clones were also able to bind to the expressed cell surface receptor, HUVEC cells.

BIAcore analysis of soluble scFv

ScFv binding kinetics to KDR were measured using BIAcore biosensors (Pharmacia Biosensor). The KDR-AP fusion protein was immobilized on a sensor chip and soluble scFvs were injected at concentrations ranging from 62.56 nM to 1000 nM. Sensograms were obtained at each concentration and evaluated using the BIA Evaluation 2.0 program to determine the rate constant k on and k off. The Kd value was calculated from the ratio of koff / kon constants.

* · · ♦ # · ·· · ·· ···· * * ♦ · · ♦ · • · f · f · f · f · f · f · c · · · · ···· ..........

Table 1 shows the results of surface plasmon resonance on a BIAcore device. VEGF blocks scFv, plC11 and plF12, bound to immobilized KDR with approximately 6 times weaker affinity (Kd,

11.2 nM) than the best binding clone pIC11, mainly due to much higher dissociation. As expected, clone p2A7 did not bind to immobilized KDR on a BIAcore device.

Phosphorylation analysis

Phosphorylation analyzes were performed by early passage of HUVEC cells followed by the protocol described previously. Briefly, HUVEC cells were incubated in serum-free EBM-2 basal medium supplemented with 0.5% bovine serum albumin at room temperature for 10 minutes in the presence or absence of scFv antibodies at a concentration of 5 µg / ml followed by stimulation with 20 ng / ml VEGFi ₆₅ at. 15 minutes at room temperature. Cells were lysed and KDR receptor was immunoprecipitated from cell lysate using Protein A Sepharose beads bound to rabbit anti-KDR polyclonal antibody (ImClone Systems Incorporated). The beads were washed and mixed with SDS sample buffer and the supernatant was subjected to Western blot analysis.

To detect KDR phosphorylation, blots were exposed to antiphosphotyrosine Mab, 4G10. To determine MAP kinase activity, cell lysates were resolved by SDS-PAGE followed by Western blot analysis using a phospho specific anti-MAP kinase antibody. All signals were detected using ECL.

The results showed that VEGF blocking scFv pIC1 but not non-blocking scFv p-2A6 were able to inhibit VEGF-stimulated KDR receptor phosphorylation. Furthermore, pIC11 also effectively inhibited VEGF-stimulated activation of MAP kinases p44 / p42. In contrast, neither plCll. neither IMC-2A6 inhibited VEGF-stimulated MAP kinase p44 / p42 activation.

9999

9999

Anti-mitogenic analysis

HUVEC cells (5 x 10 3 cells / well) were plated in 96-well tissue culture plates (Wallach, Inc., Gaithersburg, MD) in 200 µl EBM-2 medium without VEGF, bFGF or EGF and incubated at 37 ° C for 72 hours. hours. Different amounts of antibodies were added to the wells in duplicate, which were preincubated at 37 ° C for 1 hour, after which VEGFies were added to a final concentration of 16 ng / ml. After 18 hours of incubation, 0.25 µCi (3H) -TdR (Amersham) was added to each well and incubated for an additional 4 hours. Cells were placed on ice, washed twice with serum-containing medium followed by incubation for 10 minutes at 4 ° C with 10% TCA. The cells were then washed once with water and solubilized in 25 µl of 2% SDS. Scintillation fluid (150 µl / well) was added and radioactivity incorporated into DNA was determined on a scintillation counter (Wallach, Model 1450 Microbeta Scintillation Counter).

The ability of scFv antibodies to block VEGF-stimulated mitogenic activity on HUVEC cells is shown in FIG. 3. The VEGF-blocking scFv p1C11 strongly inhibited DNA-induced DNA synthesis in HUVECs with an EC ₅₀ value, i.e., an antibody concentration that inhibited 50% of VEGF-stimulated HUVEC mitogenesis of approximately 5 nM. Non-blocking scFv p2A6 showed no inhibitory effect on mitogenic activity of VEGF. Neither pIC11 nor p2A6 inhibited bFGF-induced HUVEC DNA synthesis,

Example IV. Generation of chimeric antibodies

Cell lines and proteins

Primarily cultured human umbilical vein endothelial cells (HUVEC) were maintained in EBM-2 medium at 37 ° C, 5% CO ₂ . Cells between passages 2-5 were used for all analyzes. VEGF165 and KDR-Alkaline Phosphatase Fusion Proteins (KDR-AP) were: 0000 0000 0 0 0 0 0 0 0 0 0000 0000 000000. , expressed in baculovirus and NIH 3T3 cells, respectively, and purified according to the procedures described above. Anti-KDR antibodies scFv and scFv p2A6 that bind to KDR but do not block the KDR-VEGF interaction were isolated from a phage library constructed from mice immunized with KDR as described above. C225 is a chimeric IgG1 antibody directed against the epidermal growth factor (EGF) receptor.

Cloning of scFv pIC11 variable domains

The variable domains of the light (V _L ) and heavy (V _H ) chains of pIC11 were cloned from the scFv expression vector by PCR using primers 1 and 2 and primers 3 and 4 respectively. The leader protein sequence for protein secretion in mammalian cells was then added to 5 'ends of V _L and V _H by PCR using primers 5 and 2 and primers 5 and 4, respectively.

Primer 1: 5 'CRA GTA GCA ACT GCA ACT GGA CAT

Primer 2: 5'TCG ATC TAG AAG GAT CCA ACT TTT TAT TTC CAG3 'BamHI

Primer 3: 5'CTA GTA ACT GCA ACT GGA GTA CAT TCA CAG GTC AAG CTG3 '

Primer 4: 5'TCG AAG GAT CCA ACC TGA GGA GAC GGT3 '

BamHI

Primer 5: 5 'GGT CAA AAG CTT ATG

Hind III

CTT TTT CTA GTA GCA ACT3 '·· 4 ··· • · ·· ·

·· ···· · 4 · 4 ·· · 4 ·· ·

Construction of expression vectors for chimeric pIC11 IgG.

Separate vectors for expression of chimeric IgG light and heavy chains were constructed. The cloned V _L gene was digested with Hind III and BamHI and ligated into the pKN100 vector containing the human κ light chain constant region (C _L ) to create an expression vector for the chimeric pIC11 light chain, IMC-1C11-L. The cloned V _H gene was digested with Hind III and BamHI and ligated into the pGID105 vector containing the human IgG1 (γ) heavy chain (C _H ) constant region to create an expression vector for the chimeric pIC11 heavy chain, IMC-1C11-H. Both constructs were examined by restriction enzyme digestion and verified by dideoxynucleotide sequencing.

As seen in Figure 4, both V _H and V _L domains are fused precisely at their 5 'ends to a segment of the gene encoding the leader peptide sequence as indicated. The V _H and V _L domains are ligated by Hind III / BamHI sites to the PG1D105 expression vector containing the human IgG1 (γ) heavy chain (C _H ) constant region, and pKN100 that contains the cDNA version of the human κ light chain (C) _L ). In both cases, expression is under the control of the HCMV 1 promoter and is terminated by an artificial termination sequence. The light and heavy chain region of the complementary determining regions (CDRs) defined according to the hypervariable sequence definition of Kabat et al. Are underlined and designated as CDR-H1 to H3 and CDR-L1 to L3.

IgG expression and purification.

COS cells were transfected with the same amount of plasmids IMC1C11-L and IMC 1C11-H for transient IgG expression. Subconfluent COS cells grown in DMEM / 10% FCS in 150 mm culture flasks were washed once with 20 ml DMEM containing 40 mM Tris (pH 7.4), followed by incubation at 37 ° C. ·

for 4.5 hours with 4 ml DMEM / DEAE-Dextran / DNA mixture (DMEM containing 40 nM Tris, 0.4 mg / ml DEAE-Dextran (Sigma) and 20 µg plasmid IMC-1C11-L and IMC-1C11- H). Cells were incubated at 37 ° C for 1 hour with 4 ml DMEM / 2% FCS containing 100 nM chloroquine (Sigma) followed by incubation with 1.5 ml 20% glycerol / PBS at room temperature for 1 minute. Cells were washed twice with DMEM / 5% FCS and incubated in 20 ml of the same medium overnight. Cell culture medium was changed to serum-free DMEM / HEPES after cells were washed twice with pure DMEM. Cell culture supernatant was withdrawn 48 hours and 120 hours after transfection. Chimeric IgG was purified from the pooled supernatant by affinity chromatography using a protein G column according to the protocol described by the manufacturer (Pharmacia Biotech). Fractions containing IgG were pooled, buffer exchanged into PBS and concentrated using a Centricon 10 concentration apparatus (Amicon Corp., Beverly, MA). IgG purity was analyzed by SDS-PAGE. The concentration of purified antibody was determined by ELISA analysis using a specific anti-human γ chain antibody as scavenger. The standard curve was calibrated using clinical grade human C225 antibody.

Following Protein G affinity purification, a single protein band of approximately 150 kD was detected on SDS-PAGE. Western blot analysis using HRP-conjugated specific human IgG1 Fc fragment confirmed the presence of human IgG Fc fragment in the purified protein.

The ELISA results indicate that IMC-1C11 binds more effectively to immobilized KDR than maternal scFv.

Example V. Determination and Analysis

FACS analysis.

Early passaged HUVECs were cultured overnight in EBM-2 without growth factor to induce KDR expression. Cells were harvested and washed three times with PBS, incubated with IMC-pIC11 IgG (5µg / ml) for 1 hour at 4 ° C followed by incubation with FITC-labeled rabbit antibody to human Fc fragment (Capper, Organon Teknika Corp., West Chester , PA) for an additional 60 minutes. Cells were washed and analyzed by flow cytometer (Model EPICS ^(R) , Coulter Corp., Edison, NJ). As previously seen for maternal scFv pIC11, IMC-1C11 specifically binds to KDR expressed on early passaged HUVEC cells.

Quantitative DRC binding study

Various amounts of antibodies were added to 96-well Maxi-sorp microtiter plates coated with KDR (Nunc. Denmark) and incubated at room temperature for 1 hour, after which the plates were washed 3 times with PBS containing 0.1% Tween-20. Plates were then incubated at room temperature for 1 hour with 100 µl mouse anti E tag antibody-HRP conjugate (Pharmacia Biotech) for scFv, or rabbit conjugate rabbit specific antibody to human IgG-HRP Fc fragment (Cappel, Organon Teknika Corp.) for chimeric IgG. Plates were washed 5 times, TMB peroxidase substrate (KPL, Gaithersburg, MD) was added and OD read at 450 nm using. a microplate reader (Molecular Device, Sunnyvale, CA). IMC-1C11 binds more effectively to immobilized KDR than maternal scFv.

Biacore analysis.

The binding kinetics of KDR antibodies were measured using BIAcore biosensors (Pharmacia Biosensor). The KDR-AP fusion protein was immobilized on a sensor chip and antibodies or VEGF were injected at concentrations ranging from 25 nM to 200 nM. Sensorgrams were obtained at each concentration and were evaluated using the BIA Evaluation 2.0 program to determine the rate constants kon and koff. The Kd value was calculated as the ratio of the rate constants koff / kon.

BIAcore analysis revealed that IMC-1C11 binds to KDR with higher affinity than maternal scFv (Table 2). The Kd of IMC1C11 is 0.82 nM compared to 2.1 nM for scFv. The increased affinity of IMC1C11 is mainly due to the lower dissociation rate (k off) of bivalent chimeric IgG. It is important to note that the affinity of IMC-1C11 for binding to KDR is similar to that of natural VEGF ligand for KDR binding, which is 0.93 nM as determined in our BIAcore analysis (Table 2).

Competitive VEGF Binding Analysis;

In the first analysis, different amounts of antibody were mixed with a mixed amount of KDR-Ρ (50ng) and incubated at room temperature for 1 hour. The mixtures were then transferred to VEGF _6- coated 96 well microtiter plates (200 ng / well) and incubated at room temperature for a further 2 hours, after which the plates were washed 5 times and the substrate for AP (p-nitrophenyl phosphate, Sigma) added. quantification of KDR-ΑΡ molecules. The EC50 value was then calculated. ie, the concentration of antibody required to inhibit 50% of KDR binding to VEGF.

IMC-1C11 blocks the KDR receptor from binding with immobilized VEGF in a dose-dependent manner. The chimeric antibody more effectively blocks the interaction of VEGF-KDR with an IC 50 (ie, the concentration of antibody required to 50% inhibit KDR binding to VEGF) of 0.8 nM compared to 2.0 nM for scFv. The control scFv also binds KDR, but does not block VEGF-KDR.

In the second analysis, different quantities of IMC-1C11 or unlabeled VEGF protein ₆ 5 mixed with a fixed amount of labeled VEGF ₆₅ 1251 is added to 96-well plates coated with KDR mikrotitračnlch receptor. Plates were incubated at room temperature for 2 hours, washed 5 times, and the amount of VEGF155r-labeled radionuclide that bound to the immobilized KDR receptor was calculated. The concentrations of IMC1C11 and unlabeled VEGF ₁₆₅ required to block 50% of the binding of VEGF-labeled radionuclide to the immobilized KDR receptor were determined.

IMC-1C11 effectively competes with 1251-labeled VEGF for binding to the immobilized KDR receptor in a dose-dependent manner. As expected, C225, a chimeric antibody directed against the EGF receptor, does not bind to the KDR receptor or block the VEGF-KDR interaction.

Phosphorylation analysis.

HUVEC subconfluent cells were cultured in ABM-2 without growth factor for 24 to 48 hours prior to the experiment. After pretreatment with 50 nM sodium orthovanadate for 30 minutes, cells were incubated in the presence or absence of antibodies for 30 minutes followed by stimulation with 20 ng / ml VEGF ₆₅ or 10 ng / ml FGF at room temperature for a further 15 minutes. The cells were then lysed in lysis buffer (50 nM Tris, 150 mM, 1% NP-40, 2 mM EDTA, 0.25% sodium deoxycholate, 1 mM PMSF, 1 µg / ml leupeptin, 1 µg / ml pepstatin, 10 µg / ml aprotinin, pH 7.5) and cell lysate were used for both KDR and MAP kinase phosphorylation analysis. The KDR receptor was immunoprecipitated from cell lysates by Protein A Sepharose beads (Santa Cruz Biotechnology, Inc., CA) bound to the anti-KDR antibody, Mab 4.13 (ImClone Systems). Proteins were resolved on SDS-PAGE and subjected to Western blot analysis. To detect KDR phosphorylation, blots were exposed to antiphosphotyrosine Mab, PY20 (ICN Biomedicals, Inc. Aurora, OH). For analysis of MAP kinase activity, cell lysates were resolved on SDS-PAGE followed by Western blot analysis using a phospho-specific anti-MAP kinase antibody. • · · · · · · · · · ·

........ * ......

(New England Bio Labs, Beverly, MA). All signals were detected using ECL (Amersham, Arlington Heights, IL).

In both assays, the blots were re-exposed to a polyclonal anti-KDR antibody (ImClone Systems) to ensure that equal amounts of protein were loaded into each trace of SDS-PGA gels.

IMC-1C11 effectively inhibits VEGF KDR receptor-stimulated phosphorylation and activation of p44 / p42 MAP kinases. In contrast, C225 shows no inhibition of KEG receptor activation and VEGF-stimulated MAP kinases. Neither IMC-1C11 nor C225 alone had any effect on KDR receptor activity and p44 / p42 MAP kinases. As previously seen for scFv pIC11, IMC-1C11 does not inhibit FGF-stimulated activation of p44 / p42 MAP kinases. Furthermore, neither the scFv p2A6 nor the chimeric IgG form of p2A6 (c-p2A6) inhibits VEGF-stimulated KDR receptor and MAP kinase activation.

Antimitogenic analysis

The effect of anti-KDR antibodies on mitogenesis of human VEGF-stimulated endothelial cells was determined by ( ³ H) TdR DNA incorporation analysis using HUVEC cells. HUVEC cells (5x10 ³ cells / well) were plated in 96-well tissue plates. cultures in 200 µl VEGF, bFGF or EGF free EBM-2 medium and incubated at 37 ° C for 72 hours. Various amounts of antibodies were added to the wells in duplicate and preincubated at 37 ° C for 1 hour, after which VEGFies were added to a final concentration of 16 ng / ml). After 18 hours of incubation, 0.5 µCi ( ³ H) -TdR was added to each well and incubated for an additional 4 hours. The radioactivity incorporated into the DNA was determined by scintillation counting.

IMC-1C11 and scFv pIC11 effectively inhibit VEGF-stimulated HUVEC cell mitogenesis. IMC-1C11 is a potent inhibitor of HUVEC-induced VEGF-induced mitogenesis than maternal scFv. Concentration

9 9 99 9 9 9 • · · · · ·

• 9 9 9 9 9 9 9 9 9 • 9 · _r · ···· "·· · antibody required for 50% inhibition of EGF-induced mitogenesis of HUVEC are 0.8 nM for both IMC-1C11 and respectively 6 nM for the scFv. As expected, scFv p2A6 showed no inhibitory effect on the proliferation of VEGF-stimulated endothelial cells.

·· · * «· ·· ·· ··· ·

Reference

1. Ziegler, B.L., Valtieri, M., Porada, G.A., De Maria, R., Muller, R., Masella, B., Gabbianelli, M., Casella, L, Pelosi,

E., Bock, T., Zanjani, E. D., and Peschle, C. (1999) Science 285 (5433), 1553-8.

2. Fiedier, W., Graeven, U., Ergun, S., Verago, S., Kilic, N., Stockschlader, M., and Hossfeld, D. K. (1997) Blood 89 (6), 1870-5.

3. Bellamy, W.T., Richter, L., Frutiger, Y., and Grogan, T. M. (1999) Cancer Res 59 (3), 728-33.

4. Katoh, 0., Tauchi, H., Kawaishi, K., Kimura, A., and Satow, Y. (1995) Cancer Res 55 (23), 5687-92.

5. Klagsbrun, M., and D'Amore, P. A. (1996) Cytokine Growth Factor Rev 7 (3), 259-70.

Ortega, N., Jonca, F., Vincent, S., Favard, C., Ruchoux, M. M., and Plouet, J. (1991) Am J Pathol 151 (5), 1215-24.

7. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X. F., Breitman, M. L., and Schuh, A. C. (1995) Nature 376 (6535), 62-6.

8. Fong, G.H., Rossant, J., Gertsenstein, M., and Breitman, M. L. (1995) Nature 376 (6535), 66-70.

9. Skobe, M., Rockwell, P., Goldstein, K, Vosseler, S., and Fusenig, N.E. (1997) Nat Med 3 (11), 1222-7.

10. Prewett, M., Huber, J., Li, Y., Santiago, A., O'Connor, W., King, K., Overholser, J., Hooper, A., Pytowski, B., Witte , L., Bohlen, P., and Hicklin, DJ (1999) Cancer Res 59 (20), 5209-18

11. Millauer, B., Shawver, L.K., Plate, K.H., Risau, W., and Ullrich, A. (1994) Nature 367 (6463), 576-9.

12. Zim, Z., Lu, D., Kotanides, H., Santiago, A., Jimenez, X., Simcox, T., Hicklin, DJ, Bohlen, P., and Witte, L. (1999) Cancer Lett 136 (2), 203-13 9 9 * 99 ··· ·

9 9

9

9

9 9

9999 · 9

99 9 · 9 • 9 9 9

9

9 9 9 ··

999 98 9 *

13. Leber, Τ. And Balkwill, F. R. (1997) Anal Biochem 249 (1), 24-8

14. Hamada, T., Mohle, R., Hesselgesser, J., Hoxie, J., Nachman, R. L., Moore, M.A.S, and Rafii, S. (1998) J Exp Med 188, 539548

15. Strawn, L.M., McMahon, G., App, H., Schreck, R., Kuchler, W.R., Longhi, Μ. P., Hui, TH, Tang, C, Levitzki, A., Gazit, A, Chen, I., Bushes, G., Orfi, L., Risau, W., Flamme, I., Ullrich, A., Kirta KP, and Shawyer. L. K. (1996) Cancer Res 56 (15), 3540-5

16. Zhu, Z., Rockwell, P., Lu, D., Kotanides, H., Pytowski, B., Hicklin, DJ, Bohlen, P., and Witte, L. (1998) Cancer Res 58 (15). , 3209-14

17. Wang, H., and Keiser, J.A. (1998) Circ Res 83 (8), 832-40

18. Barleon, B., Sozzani, S., Zhou, D., Weich, H.A., Mantovani. A., and Marme, D. (1996) Blood 87 (8), 3336-43

19. Clutterbuck, R. D., Millar, B. C., Powles, R. L., Newman, A., Catovsky, D., Jarman, M., and Millar, J. L. (1998) Br J Haematol 102 (2), 522-7.

20. Terpstra, W., Prins, A., Visser, T., Wognum, B., Wagemaker,

G., Lowenberg, B., and Wielenga, J. (1995) Leukemia 9 (9), 1573-7

21. Machado, E.A., Gerard, D.A., Lozzio, C. B., Lozzio, Β. B., Mitchell, J. R., and Golde, D. W. (1984) Blood 63 (5), 1015-22

22. Soker, S., Takashima, S., iao Miao, H. Q., Neufeld, G., and Klagsbrun, M. (1998) Cell 92 (6), 735-45.

23. Salven, P., Manpaa, H., Orpana, A., Aliíalo, K., and Joensuu,

H. (1997) Clin Cancer Res. 3 (5), 647-51

24. Obermair, A., Tempfer, C., Hefler, L., Preyer, O., Kaider, A. Zeillinger, R., Leodolter, S., and Kainz, C. (1998) Br J Cancer 77 (11). ), 1870-4

25. Kranz, A., Mattfeldt, T., And Waltenberger, J. (1999) Int J Cancer 84 (3), 293-8 ** φφ φ · ** · ** ** · R r r r r r r r r r r r r

26. Abu-Jawdeh, G. Fa, Faix, JD, Niloff, J., Tognazzi, K., Manseau, E., Dvorak, HF, and Brown, LF (1996) Lab Invest 74 (6), 1105- 15 Dec

27. Ferrer, FA, Miller, LJ, Lindquist, R. ₃ Kowalczyk, P., Laudone, VP, Albertsen, PC, and Kreutzer, DL (1999) Urology 54 (3), 567-72.

28. Folkman, J. (1997) Exs 79, 1-8

29. Perez-Atayde, A.R., Sallan, S.E., Tedrow, U., Cormors, S., Allred, E., and Folkman, J. (1997) Am J. Patol 150 (3), 815-21.

30. Fielder, W., Graeveo, U., Ergun, S., Verago, S., Kilic, N., Stockschlader, M., and Hossfeld, D. K. (1997) Leukemia 11 (8), 1234-7.

········································

Table 1: KDR binding analysis of scFv antibodies against KDR

Clone scFv KDR binding ¹ (ED ₅₀ , nM) VEGF Block ² (IC ₅₀ , nM) Coupling kinetics ³ Kon (10¾ ^-1 sec ^-1 ) Koff (10¾ ^- ¾ ^-1 ) Kd (10 ^- fy) PICH Yes (0,3) Yes (3,0) 1.1 2, 3 2.1 P1F12 Yes (1,0) Yes (15) 0.24 1.4 5.9 P2A6 Yes (5,0) No (over 300) 4.1 46.1 11.2 P2A7 No (NA) No (over 300) ON ON ON

1. Determined by direct binding ELISA, the numbers in parentheses represent the scFv concentrations that give 50% of the maximum binding;

2. Determined by competitive VEGF blocking ELISA, the numbers in parentheses represent the scFv concentrations required for 50% inhibition of KDR binding to immobilized VEGF;

3. Determined by BIAcore analysis

NA = not applicable

Table 2. KDR receptor binding kinetics of pIC11 scFv and IMC-1C11 *

Antibody Kon (10¾ ^- ¾ ^-1 ) Koff (10 ^- ¾ ^-1) Kd (10 ^- ¾) PlC11 scFv 1.11 2.27 2.1 IMC-1C11 0, 63 0.52 0.82 VEGF 1.87 1.81 0.93

* All rates were determined by surface plasmon resonance using the BIAcore system and are the average of at least three separate determinations.

9 9 9 9 9

r ..... ........... ♦ ·· - - * - 9ί »· -. · .._ 9_ · * ^ '9 9 9 9 9 9 9 ..... 9 ..... V

-λ:

r 9 9 · 9 9 9

Claims (24)

PATENT CLAIMS Use of an effective amount of a VEGFR receptor antagonist for the manufacture of a medicament for inhibiting the growth of non-solid tumor cells that are stimulated in a mammal by a vascular endothelial growth factor receptor (VEGFR) ligand. The use of claim 1, wherein the VEGFR is KDR. The use of claim 1, wherein the VEGFR is flk-1. ► 99 9 9 999 . 9 9 9 4 9 9 The use of claim 1, wherein the VEGFR is fit-1. The use of claim 1, wherein the mammal is a human. The use of claim 1, wherein the antagonist is a biological molecule. The use of claim 6, wherein the biological molecule is a monoclonal antibody specific for VEGFR or a fragment that comprises a hypervariable region thereof. The use of claim 7, wherein the antibody comprises at least one variable heavy chain fragment comprising: CDRH1 having amino acid sequence mentioned in SEQ ID NO 1; CDRH2 NO 2; and possessing amino acid sequence mentioned in SEQ ID CDRH3 NO 3; having amino acid sequence mentioned in SEQ ID and at least one light chain variable fragment comprising: • · · - · · · f f f f .............. β • -β · ·> ....... · V V V V ... ... 9 · »· · · · ··· <· CDRL1 having the amino acid sequence shown in SEQ ID NO 4; CDRL2 having the amino acid sequence shown in SEQ ID NO 5; and CDRL3 having the amino acid sequence shown in SEQ ID NO 6. The use of claim 7, wherein the antibody comprises at least one variable heavy chain fragment having the amino acid sequence set forth in SEQ ID NO 7; and at least one light chain variable fragment having the amino acid sequence set forth in SEQ ID NO 8. The use of claim 7, wherein the monoclonal antibody is chimerized or humanized. The use of claim 1, wherein the antagonist is a small molecule. The use of claim 1, wherein the medicament is intended for administration in combination with treatment of non-solid tumor cells by radiation, chemotherapy, or combinations thereof. The use of claim 1, wherein the tumor cells are cells of hematopoietic structures. The use of claim 13, wherein the tumor cells are bone marrow cells. Use according to claim 14, wherein the tumor cells are affected by leukemia. «· ···· Use according to claim 15, wherein the leukemia is acute myelocyte leukemia (AML), chronic myelocyte leukemia (CML), acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), erythrocyte leukemia or monocytic leukemia. The use of claim 14, wherein the tumor cells are multiple myleoma cells. The use of claim 13, wherein the tumor cells are lymphoid cells. The use of claim 18, wherein the lymphoid cells are related to Hodgkin's disease or non-Hodgkin's disease. Use of an effective amount of a VEGFR receptor antagonist for the manufacture of a medicament for inhibiting the growth of non-solid tumor cells that are stimulated in a mammal by a vascular endothelial growth factor receptor (VEGFR) ligand, wherein the medicament is to be administered in combination with radiation. The use of claim 20, wherein the mammal is a human. The use of claim 20, wherein the antagonist is to be administered prior to radiation. The use of claim 20, wherein the antagonist is to be administered during radiation. The use of claim 20, wherein the antagonist is to be administered after radiation. ♦ ♦ · - · • - - - - - - - - ft -> ------- · , Τ ♦ · · · 9 9 9 9 9 9 '---- Λ- _> ------ 64 9999 8 9 99 99 25. Use according to claim 20 where the antagonist has be served before and during irradiation. 26. Use according to claim 20 where the antagonist has be served • · 9 9 9 9 9 · • · · during and after irradiation. • 9 9 • · · 9 9 9 27. Use according to claim 20 where the antagonist has be served 9 99 9 9 9 9 9 99 9 9 before and after irradiation. 9 9 9999 • 9 9 9 28. Use according to claim 20 where the antagonist has be served 9 9 98 9 9 99 99 before, during and after irradiation. 9 29. Use according to claim 20 where the radiation source is located externally to the mammal. 30. Use according to claim 20 where the radiation source is located internally to the mammal. The use of claim 20, wherein the antagonist is a monoclonal antibody. Use according to claim 20, wherein the tumors affect hematopoietic structures. Use of an effective amount of a VEGFR receptor antagonist for the manufacture of a medicament for inhibiting the growth of non-solid tumor cells that are stimulated in a mammal by a vascular endothelial growth factor receptor (VEGFR) ligand, wherein the medicament is to be administered in combination with a chemotherapeutic agent. The use of claim 33, wherein the antagonist is to be administered prior to treatment with a chemotherapeutic agent. 1 2 9 --9-999 ............ · * 9 9 · 9 9999 · 1 • 9 99 The use of claim 33, wherein the antagonist is to be administered during treatment with a chemotherapeutic agent. The use of claim 33, wherein the antagonist is to be administered after treatment with a chemotherapeutic agent. The use of claim 33, wherein the antagonist is to be administered before and during treatment with the chemotherapeutic agent. • 9 · 9 9 9 9 9 9 9 98 9 • «» « 99 9 9 The use of claim 33, wherein the antagonist is to be administered during and after treatment with the chemotherapeutic agent. The use of claim 33, wherein the antagonist is to be administered before and after treatment with the chemotherapeutic agent. The use of claim 33, wherein the antagonist is to be administered before, during and after treatment with the chemotherapeutic agent. Use according to claim 33, wherein the chemotherapeutic agent is selected from the group consisting of cisplatin, dacarbazine, dactinomycin, mechloretamine, streptozocin, cyclophosphamide, carmustine, lomustine, doxorubicin, daunorubicin, procarbazine, mitomycin, cytarabine, etarabine, etarabine, etaramine, etarabine vinblastine, vincristine, bleomycin, paclitaxel, docetaxel, aldesleukin, asparaginase, busulfan, carboplatin, cladribine, dacarbazine, floxuridine, fludarabine, hydroxyurea, ifosfamide, interferon alpha, leuprolide, megestrol, melfalanopine, melfalanopine, melfalanopine, melfalanine , plicamycin, streptozocin, tamoxifen, teniposide, testolactone, thioguanine, thiotepa, urothiocyanate, vinorelbine, chlorambucil, taxol, and combinations thereof. ·· · »tt 9 99 9999 ♦ ·.« _____________ 9 --- 9-9-9 —-------- 9 ------------ 9 9 9 99 9 9 9 9 · 9 9 9 9 9 9 9 9 9 9 9 9 · 9 9 + 9 Μ Μ t t t t tt 99 ttt · · 99 The use of claim 33, wherein the chemotherapeutic agent is selected from the group consisting of cisplatin, doxorubicin, taxol, and the like. 9 9 9 their combinations. 9 9 9 9 9 9 9 The use of claim 33, wherein the tumor cells are cells. • · • 9 hematopoietic structures. **** The use of claim 33, wherein the antagonist is a monoclonal agent.