CZ20002465A3 - Essential bacterial genes and use thereof - Google Patents

Abstract

23 genes, called "GEP" genes, are described in Streptococcus Pneumoniae, which are located in operons that are necessary for survival. Next, it is described a related essential gene found in Bacillus substilis. These genes and polypeptides they encode, as well as theirs homologues can be used to identify antibacterial agents for the treatment of bacterial infections, such as streptococcal pneumonia.

Description

Essential bacterial genes and their use

BACKGROUND OF THE INVENTION

The invention relates to essential (essential) bacterial genes and their use in identifying bacterial agents.

Bacterial infections can be skin, subcutaneous or systemic. Opportunistic bacterial infections proliferate especially in patients suffering from AIDS or other diseases that affect the immune system. Streptococcus pneumoniae typically infects the respiratory tract and can cause lobe inflammation as well as meningitis, paranasal sinusitis and other infections.

SUMMARY OF THE INVENTION

The invention is based on the discovery of 23 genes in bacteria

Streptococcus pneumoniae and related genes in Bacillus subtilis found on operons that are essential for the survival of the microorganism. These 23 genes of Streptococcus are referred to herein as "essential essential protein (GEP) genes, and the polypeptides encoded by these genes are referred to herein as" GEP polypeptides. Each GEP gene is located on an operon that contains a gene that is essential for the survival of Streptococcus pneumoniae; the essential gene may be a GEP gene or another gene found in the same operon. Bacterial operons contain several genes that are related, for example, with respect to function or biochemical pathway. Transcription of an operon results in the production of a single transcript in which multiple coding regions are linked. Thus, an operon containing one or more essential genes can be considered as a "essential operon, because damage to the expression of one gene that is located in the operon will interfere with the expression of other genes ^- the operon. Each coding region of the transcript is translated separately into an individual polypeptide by ribosomes that initiate translation at multiple points along the transcript. If one gene has been identified in an operon, it is easy to identify and sequenced other genes located in the operon.

Genes encoding GEP polypeptides are useful molecular tools suitable for identifying similar genes in pathogenic organisms such as pathogenic Bacillus strains. In addition, operons containing genes encoding GEP polypeptides and polypeptides encoded by such operons can be used as targets for identifying agents that are pathogen inhibitors in which GEP polypeptides are expressed. Such inhibitors inhibit bacterial growth by being bacteriostatic (e.g., inhibiting cell reproduction or division) or by being bacteriocidal (i.e., causing cell death).

The invention provides an isolated polypeptide encoded by a nucleic acid that is located in an operon encoding a GEP polypeptide, called gep 103, and having the amino acid sequence set forth in SEQ ID NO: 1 or a conservative variant thereof. The invention further provides an isolated operon comprising a nucleic acid encoding gep 103. In addition, the invention includes an isolated nucleic acid of a) an operon comprising the sequence of SEQ ID NO: 2 as shown in Figure 1, or degenerate variants thereof, b) an operon comprising the sequence of SEQ. SEQ ID NO: 2 or degenerate variants thereof, wherein T has been replaced by U, c) nucleic acids complementary to a) and b) and d) of fragments a), b) and c) that contain at least 15 bp and hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 1. As described above for gep 103, the invention also encompasses additional nucleic acids and polypeptides encoded by nucleic acids that are found in operons encoding GEP polypeptides, including: (a) operons comprising the nucleic acids represented by SEQ ID NOs, set forth below, depicted in the figures below, or dege thereof unrated variants, (b) operons containing the nucleic acids represented by SEQ ID NO below, in the text where T is replaced by U, c) nucleic acids acids complementary to a) and b) and d) fragments a), b) and c) which contain at least 15 base pairs and which hybridize under stringent conditions to the genomic DNA encoding the polypeptides represented by SEQ ID NO, hereinafter.

Table 1: Nucleic acids and GEP polypeptides

Nukleová acid a polypeptide GEP Picture no. SEQ ID NO: Aminokyseli- new sequence SEQ ID NO: Coding chain sequence nuclear acid SEQ ID NO: nekóduj ícíh o strings sequence nuclear acid gepl03 1 1 2 3 gep1119 2 4 5 6 gep1112 3 7 8 9 gepl315 4 10 11 12 gepl4 93 5 13 14 15 Dec gepl507 6 16 17 18 gepl511 7 19 Dec 20 May 21 gepl518 8 22nd 23 24 gepl54 6 9 25 26 27 Mar: gepl551 10 28 29 30 gepl561 11 31 32 33 gepl580 12 34 35 36 gepl713 13 37 38 39 gep222 14 40 -41 42 gep2283 15 Dec ⁴³ 44 45 gep273 16 46 47 48 gep286 17 49 50 51 gep311 18 - 52 - 53 54 - gep3262 19 Dec 55 56 57 gep3387 20 May 58 59 60

• ·

gep47 21 61 62 63 gep61 22nd 64 65 66 gep7 6 23 67 68 69

The invention also encompasses allelic variants (i.e., genes encoding isozymes) of genes located in operons encoding the GEP polypeptides set forth above. For example, the invention encompasses a gene that encodes a GEP polypeptide but whose gene includes one or more point mutations, deletions, promoter variants, or splice site variants resulting in a GEP polypeptide functioning as a GEP polypeptide (for example, as determined by a conventional complementation assay).

Identifying these GEP genes and determining that they are found in operons that contain the essential gene makes it possible to find homologues of the GEP genes in Streptococcus strains. Orthologists can also be identified in these species (e.g., Bacillus sp.). While "homologues are structurally similar genes contained in the same species," orthologs are functionally equivalent genes from other species (in or outside the genus, for example, from Bacillus subtilis or E. coli). Such homologues and orthologs were expected to be found in operons that are essential for survival. Such homologous and orthologous genes and polypeptides can be used to identify agents that inhibit growth of the host organism (e.g., agents that function bacteriocidally or bacteriostatically against pathogenic strains of the organism). Homologous and orthogenic genes and polypeptides that are essential for survival may serve as targets to identify a broad spectrum of antibacterial agents.

The gep1493 ortholog, called B-yneS, has been identified in the B-γ subtilis-microorganism. The amino acid sequence of JJSEQ ID NO: 70, the coding sequence (SEQ ID NO: 71), and the non-coding sequence (SEQ ID NO: 72) of the B-yneS is shown in Figure 24. As with other polypeptides and genes described herein, The B-yneS polypeptide and gene can be used in the methods described herein to identify antibacterial antigens.

The term "gep103 polypeptide or gene is intended to include the polypeptide or gene shown in Figure 1, as well as the homologues of the sequences shown in Figure 1. The term" gep103 gene also includes degenerative variants of the nucleic acid sequences shown in Figure 1 (SEQ ID NO: 2). . Degenerative variants of the nucleic acid sequence exist due to the degeneracy of the amino acid code; Thus, the invention encompasses sequences that differ from the sequence represented by SEQ ID NO: 2, but which nevertheless encode a gep103 polypeptide. Similarly, due to the similarity in amino acid structures, conservative variations (as described herein) can be made in the amino acid sequence of gep103 polypeptides while maintaining the function of the polypeptides (e.g., as determined in a conventional complementation assay). Such conserved or degenerative variants of a particular gewp103 and nucleic acid polypeptide shown in Fig. 1 (SEQ ID NOs: 1 and 2, respectively) may be other polypeptides and gep103 genes identified in other Streptococcus strains. The polypeptide and the gep103 gene share at least 80%, for example 90%, of sequence identity with SEQ ID NO: 1, rsp. Regardless of the percent sequence identity between the gep103 sequence and the sequence represented by SEQ ID NOs: 1 and 2, the gep103 genes and polypeptides of the invention are capable of complementing the missing gep103 function (e.g., a temperature sensitive mutant) in a standard complementation assay. Other gep103 genes that have been identified and cloned from Streptococcus strains and especially pathogenic strains can be used in the production of gep103 polypeptides for use in the methods described herein, for example, in the identification of antibacterial agents. Similarly, the terms gep1119, gep1122, gep1315, gep1493, gep1507, gep1511, gep1518, gep1546, gep1551, gep1561, gep1713, gep222, qep2283, gep273, gep286, gep286, gep286, gep286, gep286, gep286, gep286, gep286, gep286, variation and degenerative

Such variants, conservative and degenerative variants are also contemplated by the invention.

Since the various GEP genes described herein have been identified, it has been found that they are found in operons that are essential for survival, GEP genes and polypeptides encoded by amino acid sequences located in operons containing GEP genes and their homologues and orthologs can be used to identify antibacterial agents. In particular, polypeptides encoded by nucleic acid sequences located in operons containing GEP genes may be used separately or together in assays to identify test substances that bind to these polypeptides. Such test agents are expected to be antibacterial agents, unlike agents that do not bind to these GEP polypeptides. Any of a variety of known methods can be used to detect binding of test compounds to polypeptides. The invention includes, for example, a method for identifying an antibacterial agent, comprising: a) contacting a polypeptide encoded by a nucleic acid sequence located in an operon containing a GEP gene or a homolog or ortholog thereof with a test substance, b) detecting binding of the test substance to a polypeptide or homolog or ortholog determining whether the test substance that binds the polypeptide or homolog or ortholog inhibits bacterial growth relative to the growth of bacteria grown in the absence of the test substance that binds to the polypeptide or homolog or ortholog as an indication that the test substance is an antibacterial agent.

In various embodiments, the GEP polypeptide is derived from a non-pathogenic or pathogenic strain of Streptococcus, such as pneumoniae, Streptococcus pyogenes, agalactiae, Streptococcus endocarditis,

Streptococcus faecium, Streptococcus sangus, Streptococcus viridans and Streptococcus hemolyticus. Suitable orthologs of Streptococcus GEP genes can be obtained from bacteria

Streptococcus

Streptococcus

Bacillus subtilis. The test substance can be immobilized on the substrate and binding of the test substance to the polypeptide or homolog or ortholog can be detected as the immobilization of the polypeptide or homolog or ortholog on the immobilized test substance, for example in an immunoassay with an antibody that specifically binds the polypeptide.

If necessary, the test substance may be a test polypeptide (for example, a polypeptide having a random or predetermined amino acid sequence or a naturally occurring or synthetic polypeptide). Alternatively, the test substance is a nucleic acid, such as an RNA or DNA molecule. In addition, small organic molecules can be tested. The test substance may be a naturally occurring substance or may be produced synthetically, if necessary. Synthetic libraries, chemical libraries, and the like can be tested to identify substances that bind to polypeptides. Binding of a test substance to a polypeptide or a Homolog or ortholog can be detected in vivo or in vitro. Regardless of the source of the test substance, the polypeptides described herein can be used to identify substances that are bacterial or bacteriostatic to a number of pathogenic or non-pathogenic strains.

Binding of the test substance to a polypeptide encoded by an operon-localized nucleic acid that contains the GEP gene can be detected in a conventional two hybrid system for detecting protein / protein interactions (e.g., yeast or welder cells). Generally, in such a method, a) a polypeptide encoded by a nucleic acid located in an operon containing a GEP gene occurs as a fusion protein comprising a polypeptide fused to a) a transcriptional activation region, or ii) a DNA binding transcription factor region, b) a test polypeptide it occurs as a fusion protein comprising a test polypeptide fused to (a) a transcriptional activation region, or (ii) a transcription factor region that binds DNA and (c) binding of the test polypeptide to the polypeptide is detected as a reconstitution of the transcription factor. Homologues and orthologs of GEP polypeptides can be used in similar ways

methods. Reconstitution of the transcription factor can be detected, for example, by detecting the transcription of the gene, which is possible

operatively linked to DNA sequences tied to region binding DNA reconstituted transcriptional factor (describing se for example in the publication White 1996 Why . Nati. Acad. Sci. 93: 10001-10003, See et al et al., 1996, Why. Nati. Acad. Sci. 93:

10315-10320).

In another method, an isolated operon comprising a nucleic acid molecule encoding a GEP polypeptide is used to identify a substance that reduces the expression of GEP polypeptides in vivo. Such substances can be used as antibacterial agents. In order to discover such agents, cells that express the GEP polypeptide are cultured, exposed to the test substance (or mixtures of test substances), and the level of expression or activity is compared to that of GEP polypeptides or activity in cells that are otherwise identical but not exposed the test substance (s). A variety of standard quantitative gene expression assays can be utilized in the present invention.

To identify agents that modulate the expression of GEP polypeptides (or homologous or orthologous sequences), the test substance (s) may be added at various concentrations to the cell culture medium expressing the GEP polypeptide (or homolog or ortholog). Such test substances may include small molecules (typically not proteins or polysaccharides), polypeptides, and nucleic acids. Expression of GEP polypeptides is then measured, for example, by Northern blot PCR analysis or RNase protection analysis, where the nucleic acid molecule of the invention is used as a probe. The level of expression in the presence of the test molecule as compared to the level of expression if it is absent will indicate whether the test molecule alters the expression of the GEP polypeptide. Since GEP polypeptides are expressed from operons that are essential for survival, test substances that inhibit the expression and / or function of the GEP polypeptide will inhibit cell growth or cell death.

Substances that alter expression of polypeptides of the invention can be identified by performing the assays described herein and then measuring the amount of GEP polypeptides expressed in cells, for example, by performing Western blot analysis using antibodies that bind to the GEP polypeptide.

The invention further provides methods that identify from a large group of mutants those strains having conditional lethal mutations. Generally, the gene and product corresponding to said gene are essentially identified, although the strains themselves may be used for screening or diagnostic assays.

The mechanism (s) of action to identify genes and gene products provide a rational basis for the design of antibacterial therapeutic agents. These antibacterial agents reduce the action of the gene product in the wild-type strain, therefore, they are useful in treating a subject with a strain of the type or a type similarly susceptible to infection of a subject's agent in a pharmaceutically acceptable. Limiting the action of a gene product includes a competitive gene product for a receptor enzyme active site, non-competitive inhibition, disruption of the intracellular cascade required by the gene product, binding of the gene product itself before and after posttranslational processing, and acting as a mimic of the gene product thereby reducing activity. Therapeutic agents include monoclonal antibodies that are raised against a gene product. _ __

Further, the presence of a gene sequence in certain cells (e.g., a pathogenic bacterium of the same genus or a similar species) and the absence or reagent of a type and wild-type application may be determined, if necessary, to inhibit or divide the sequence in hosts. Therapeutic agents for genes or gene products that are not present in the host provide several advantages: they have few side effects and are administered at a lower total dose.

Also included within the scope of the invention are pharmaceutical formulations which include a pharmaceutically acceptable excipient and an antibacterial agent that can be identified using the methods described herein. In particular, the invention includes pharmaceutical formulations containing antibacterial agents that inhibit growth or kill Streptococcus strains. Such pharmaceutical formulations may be used to treat an infection caused by Streptococcus microorganisms in an organism. Such a method comprises administering to the body a therapeutically effective amount of a pharmaceutical composition. Such pharmaceutical formulations may in particular be used for the treatment of streptococcal pneumonia in mammals such as man and domesticated animals (e.g. cattle, pigs, dogs and cats) and plants. The efficacy of such antibacterial agents in humans can be estimated in an animal model well known in the art (e.g., a mouse or rabbit model).

The invention further encompasses polyclonal and monoclonal antibodies that specifically bind to various GEP polypeptides described herein (e.g., gep103). Such antibodies can facilitate detection of GEP polypeptides in various strains of Streptococcus. These antibodies can also be used to detect binding of a test substance to GEP polypeptides (for example, by the assays described herein). In addition, monoclonal antibodies that bind GEP polypeptides are themselves adequate antibacterial agents when administered to mammals, as monoclonal antibodies as such are expected to prevent one or more functions of the GEP polypeptides.

The term "nucleic acid" encompasses both RNA and DNA, including genomic DNA and synthetic DNA (for example, synthesized chemically). The nucleic acid may be double-stranded or single-stranded. If it is a single-stranded nucleic acid, it may be a nucleic acid with an anti-coding strand or a coding strand. The nucleic acid can be synthesized using oligonucleotide analogs or derivatives (for example, inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, in the preparation of nucleic acids having altered base-pairing ability or increased nuclease resistance.

An "isolated nucleic acid" is a DNA or RNA that does not directly bind to the two coding sequences to which it is directly linked (one at the 5 'end and one at the 3' end) in the naturally occurring genome of the organism from which it is derived. Thus, in one embodiment of the invention, the isolated nucleic acid comprises some or all of the 5 'non-coding sequences (for example, a promoter) that immediately bind to the coding sequence. The term therefore includes, for example, recombinant DNA that is incorporated into a vector, a self-replicating plasmid or virus, or a genomic DNA of a prokaryotic or eukaryotic organism, or that exists as a separate molecule (e.g. a genomic DNA fragment generated by PCR or restriction endonuclease) on other sequences. It also includes recombinant DNA that is part of a hybrid gene encoding another polypeptide sequence. The term "isolated" may refer to a nucleic acid or polypeptide that is substantially free of cellular material, viral material or culture medium (when produced by recombinant DNA method) or free of chemical precursors or other chemicals (when synthesized by chemical means). In addition, "an isolated nucleic acid fragment is a nucleic acid fragment that does not naturally occur as a fragment and is not found in the natural state. The term " isolated nucleic acid molecule " includes an operon comprising a continuous cluster of linked sequences. "Isolated operons" are those non-natural operons that are not linked to sequences that normally surround them in the bacterial genome.

A nucleic acid sequence that is "substantially identical to the EP nucleotide sequence is at least 80% (e.g., 85%) identical to the nucleotide sequence selected from the nucleotide sequences represented by SEQ ID NO: which are listed in Table 1 as 1 to 23. In order to compare nucleic acids, the reference nucleic acid sequence is generally made up of at least 40 nucleotides, for example at least 60 nucleotides or more nucleotides. Sequence matching can be determined using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705).

GEP polypeptides that are used in the practice of the invention include recombinant and natural polypeptides. It is also possible according to the invention to use nucleic acid sequences that encode forms of GEP polypeptides in which naturally occurring amino acid sequences are altered or deleted. Preferred nucleic acids encode polypeptides that are soluble under normal physiological conditions. The invention further encompasses nucleic acids encoding fusion proteins wherein a portion of the GEP polypeptides fuse to a non-related polypeptide (e.g., a marker polypeptide or fusion to form a fusion protein. The polypeptide may be fused to a tag containing six histidines to purify bacterially expressed polypeptides / or hemagglutinin). The invention also further encompasses, for example, isolated polypeptides (and nucleic acids that encode tytyo polypeptides) that comprise a first portion and a second portion. The first portion includes, for example, a GEP polypeptide and a partner), for example. sequence. Such as a preprotein.

To facilitate secretion, the fusion polypeptide with the second portion comprises an immunoglobulin constant region (Fc) or a detectable marker.

For example, the fusion partner may be a polypeptide that most commonly refers to a secretory

The secretion sequences can be cleaved by the host cell to produce the mature protein. The invention further encompasses nucleic acids that encode a GEP polypeptide fused to the polypeptide sequence to form an inactive preprotein. Preproteins can be converted to the active form of the protein by removing the inactivating sequence.

The invention also encompasses nucleic acids that hybridize, for example, under stringent hybridization conditions (as defined herein), with all or a portion of the nucleotide sequences set forth in the Hybridizing Part of the Sequences represented by SEQ ID NO:, in Table 1, or supplements thereof, hybridizing nucleic acids typically comprise at least 15 (e.g., 20, 30, or 50) nucleotides. The hybridizing portion of the hybridizing nucleic acid is at least 80%, for example, 95% or at least 98% identical to the sequence of all or part of the nucleic acid encoding the GEP polypeptide or complement thereof. Hybridizing nucleic acids of the type described herein can be used as a cloning probe, a primer (e.g., a PCR primer) or a diagnostic probe. Nucleic acids that hybridize to the nucleotide sequences represented by SEQ ID NO: which are listed in Table 1 are considered to be "antisense oligonucleotides." The invention further encompasses ribozymes that inhibit operon function comprising the GEP genes of the invention, as determined, for example, by a complementation assay.

The invention further provides various cells, for example transformed host cells, which comprise the GEP nucleic acid described herein. "A transformed cell is a cell into which (or its predecessor) is introduced by the *« method.

recombinant DNA nucleic acid encoding a GEP polypeptide. Both prokaryotic and eukaryotic cells can be used. These are, for example, Streptococcus, Bacillus or the like.

The invention further provides genetic constructs (e.g., vectors and plasmids) that comprise a nucleic acid of the invention that is operably linked to a transcriptional or translational sequence that allows expression, such as expression vectors. The term "operably linked" means that a selected nucleic acid, such as a molecule encoding a GEP polypeptide, is located adjacent to one or more sequence elements, for example, a promoter that directs transcription and / or translation of the sequence so that the sequence elements can direct transcription and / or translation nucleic acids.

The invention further provides purified or isolated polypeptides encoded by nucleic acids that are found in operons containing GEP genes as set forth in Table 1. Both the term "protein and" polypeptide mean any amino acid chain, regardless of the length of the post-translational modification ( such as glycosylation or phosphorylation). Terms gep103 polypeptide, gep119 polypeptide, gep 1122 polypeptide, gep 1315 polypeptide, gep1493 polypeptide, gep1507 polypeptide, gep1511 polypeptide, gep1518 polypeptide, gep1551 polypeptide, gep1551 polypeptide, gep155 polypeptide, gep155 polypeptide, g3 polypeptide3, g3 polypeptide3 gep47, the gep76 polypeptide includes the full length of the naturally occurring proteins gep103, gep119, gep1122, gep1115, gep1493, gep1507, gep1511, gep1546, gep1551, gep1556, gep1562, gep3116, gep313, gep313, gep313, gep1313, gep1313 , gep3387, gep47, gep61 and gep76, as well as recombinantly or synthetically produced polypeptides that correspond to all or part of the naturally occurring or synthetic polypeptides.

polypeptide polypeptide gep1713, gep273, gep3262, gep61 and gep222 polypeptide, gep286 polypeptide,

Purity is measured by suitable column chromatography,

The term "purified or" isolated agent means a compound that constitutes at least 60% by weight of said agent, such as a GEP polypeptide or antibody. It is preferred that the formulation constitutes at least 75% (for example at least 90% or 99%) by weight of said substance by a standard method, for example by polyacrylamide gel electrophoresis or by HPLC.

Preferred GEP polypeptides include a sequence substantially identical to all or part of a naturally occurring GEP polypeptide. For example, they include all or part of the sequences shown in Figures 1 to 23. Polypeptides that are "substantially identical to the GEP polypeptide sequences described herein have an amino acid sequence that is at least 80% (e.g., 85%, 90%, 95% or 99%) identical to the amino acid sequence of the GEP polypeptides represented by SEQ ID NO: which are shown in Table 1. For comparison purposes, the length of the GEP polypeptide sequence is generally at least 16 amino acids, such as at least 20 or 25 amino acids. .

In the case of polypeptide sequences that show less than 100% identity to a reference sequence, the positions that are not identical are preferably, but not necessarily, conservative substitutions of the reference sequence. Conservative substitutions of the case include substitutions in the following glycine and alanine; valine, isoleucine and leucine;

aspartic acid and glutamic acid; asparagine and glutamine; serine and jthreonine; lysine and arginine; and phenylalanine and tyrosine.

When it is said that a polypeptide has a specific percent identity with a reference polypeptide of defined length, then the percent identity is relative to the reference polypeptide. A polypeptide that is 50% identical to a reference polypeptide that is Ό10 amino acids may be a 50 amino acid polypeptide that is completely identical to the 50 amino acid region of the reference polypeptide. It can also be in typical groups:

A * # F polypeptide of 100 amino acids that is 50% identical to the reference polypeptide over its entire length. Other polypeptides will also meet the same criteria.

The invention further provides purified and isolated antibodies that specifically bind to a GEP polypeptide. The term "specifically binds" means that the antibodies recognize and bind to a particular antigen, such as a GEP polypeptide, but do not substantially recognize and bind to other molecules in the sample. For example, a biological sample that naturally includes a GEP polypeptide.

Furthermore, the invention provides a method suitable for detecting a GEP polypeptide in a sample. The method comprises: obtaining a sample believed to contain a GEP polypeptide; contacting the sample with an antibody that specifically binds to the GEP polypeptide under conditions that allow the formation of antibody-GEP polypeptide complexes, and detecting the complexes, if any, to serve as an indication of the presence of the GEP polypeptide in the sample.

The invention further provides a method of obtaining a gene that is related to a GEP gene (i.e., a functional homolog or ortholog thereof). Such a method comprises obtaining a labeled probe that comprises an isolated nucleic acid that encodes all or part of a GEP nucleic acid or a homolog or ortholog thereof; testing a library of labeled probe nucleic acid fragments under conditions that allow hybridization of the probe to the nucleic acid fragments in the library to form nucleic acid duplexes; isolating the labeled duplexes, if any, and preparing a sequence of whole genes from the nucleic acid fragments in any labeled duplex to produce a gene that is related to the GEP gene.

offers several advantages. For example, antibactexic agent methods can be designed with high permeability of a number of candidates for

The invention identifies for testing an antibacterial agent.

• · · «« ♦ '· <· ♦

Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as used in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein may be used in the practice and testing of the invention.

Determination of Streptococcus genes in essential operons

As shown by the experiments described below, each of the GEP genes is located in an operon that is essential for the survival of Streptococcus pneumonia. Streptococcus pneumonia can be obtained from ATCC. Streptococcus pneumonia mutants were produced to identify genes found in essential operons. In general, the mutagenesis of Streptococcus pneumonia is carried out using various methods well known in the art.

In general, genes located in essential operons of Streptococcus pneumonia can be identified using genes from the Sterptococcus pneumonia RX1 genomic library prepared using standard methods (Kim et al., Nucl. Acids. Res. 20). : 1083-1085 (1992) and Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY). The genes in this library of Streptococcus were disrupted using the TnPho-A transposon mutagenesis approach. Each disrupted gene was then tested to determine if it was in an operon that is essential for the survival of Streptococcus pneumonia. In this method, 2 ml of LB broth supplemented with chloramphenicol (10 µg / ml), MgSO ₄ (10 mM) and maltose (0.2%) were inoculated with 50 µΐ of the RX-1 plasmid library of Streptococcus pneumonia. 37 ° C with stirring to •

· .. ·· .. ·

The OD ₅₀ reached 0.8 (approximately 2 hours). An aliquot of 1 ml phage containing TnPho-A (10 ⁹ phage-forming units / ml) was added to the Streptococcus culture. The production ratio is approximately ten phages per cell. The phage and cells were incubated at 37 ° C for 30 minutes. A 4 ml aliquot of LB pre-heated to 37 ° C was added to the phage / cell mixture. The mixture was then incubated at 37 ° C with stirring for one hour. The cells were then centrifuged in a Beckman bench centrifuge at 3500 rpm. for 5 minutes.

The cells in the pellet were then resuspended in 800 μΐ LB broth and an aliquot of 200 μΐ cells was plated on each of four petri dishes containing LB agar enriched with chloramphenicol (10 μρ / πιΐ), kanamycin (50 μς / πιΐ) and erythromycin ( 300 μg / ml). The plates were then incubated overnight at 37 ° C and the number of colonies that appeared on the plate was determined. Approximately 18,000 colonies were harvested and used to inoculate 50 ml of LB broth, which was incubated overnight at 37 ° C. Using the Qiagen MIDI Prep kit, plasmid DNA was extracted from the culture to replace other extraction methods known in the art.

The extracted DNA concentration was measured and 100 ng of DNA was transformed by electroporation into DH10B E. coli (Gibco BRL) cells. An aliquot of 1 ml SOC broth was added to the transformed cells and the cells were incubated at 37 for 1 hour, then centrifuged at 3500 rpm. for 5 minutes. The cells were then resuspended in 200 μΐ of LB broth and aliquots 2, 20 and 50 μΐ were plated on petri dishes containing LB agar and antibiotics as described above. After incubating the plates overnight at 37 ° C, 93 colonies were isolated and used individually to inoculate 1.25 µml of Terri-fic broth supplemented with chloramphenicol (10 μς / πιΐ), kanamycin (50 μς / ιηΐ) and erythromycin (300 μg / ml). The cultures were incubated at 37 ° C for approximately 20 hours with stirring. DNA was extracted from each culture using a conventional alkaline lysis method.

Samples extracted to transform cells then used pneumonia to transform and sequenced with transposon sequences,

5'GCAGCCCGGTTTTCCAGAACAGG3 'primer

NO:

se j sou

73)

DNA se

Streptococcus 96-well microtiter plates. Transposon promotes insertion of the mutagenized strain into the bacterial chromosome. Non-transforming clones indicate that the mutation occurred in an operon that contains the essential gene. Untreated orbiting clones were then cultured in 50 ml Terrific broth supplemented with chloramphenicol (10 μρ / πιΐ), kanamycin (50 pg / ml) and erythromycin (300 μg / ml). DNA from these clones was extracted and re-transformed into Streptococcus pneumonia and plated on petri dishes to confirm that these clones with the genes located in essential operons were then using a primer that hybridized to the Sequence (SEQ ID NO).

5'GATTTAGCCCAGTCGGCCGCACG3 '(SEQ ID NO: 74).

In another method used, transposon Tn 10 was used to damage genes in the Streptococcus pneumonia phosmid library, which was prepared using standard methods. An aliquot of 50 ml TBMM broth was supplemented with chloramphenicol (10 µg / ml), MgSO ₄ (10 mM) and maltose (0.2%) was inoculated with a single phosmid colony from the phosmid library and cultured overnight at 37 ° C. . The cells were then centrifuged and the pellet was resuspended in 5 ml of LB soil supplemented with chloramphenicol (10 µ9 / ml), MgSO ₄ (10 mM) and maltose (0.2%). Cell aliquots of 100 μΐ was then mixed with 100 μΐ phage lysate TnlO (10 ¹⁰ phage forming units / ml) and the mixture ^- incubated at room temperature 'for 15 minutes, and then incubated for 15 minutes at 37 Deň: 32 ° C.

A 5 mL aliquot of LB broth was supplemented with IPTG (1 mM) and sodium citrate (50 mM) and heated to 37 ° C and added to the cell / phage mixture. After incubation of the cell / phage mixture at 37 ° C, the cells were centrifuged to pellet while stirring, and resuspended in 800 μΐ of LB soil. Cells were then plated on 4 LB agar plates supplemented with chloramphenicol (10 µg / ml) and erythromycin (300 µg / ml). After incubating the cells overnight at 37 ° C, at least 10,000 resultant colonies were used to inoculate 50 ml of LB soil. The DNA was then extracted and quantified using standard methods, and 100 ng of DNA was then used to transform E. coli DH10B cells (Gibco ERL) by electroporation. After addition of 1 ml SOC broth, the cells were incubated for 1 hour at 37 ° C. The cells were then centrifuged and the pellet suspended in 200 μΐ of LB soil and aliquots of 2, 20 and 50 μΐ were plated on LB agar plates supplemented with chloramphenicol (10 µg / ml), kanamycin (50 µg / ml) and erythromycin ( 300 pg / ml). The plates were then incubated overnight at 37 ° C and 93 colonies were isolated and used to inoculate 1.25 ml of Terrific broth supplemented with chloramphenicol (10 µg / ml), kanamycin (50 µg / ml) and erythromycin (300 µg / ml). ml). The cultures were then incubated for approximately 20 hours with stirring, and DNA was isolated using the standard miniprep method. The extracted DNA was then used to transform Streptococcus pneumonia and genes located in essential operons were sequenced as described above. Primer sequence. used in sequencing were 5'CCGCCATTCTTTGCTGTTTCG3 '(SEQ ID NO: 75) and 5'TTACACGTTACTAAAGGGAATG3' (SEQ ID NO: 76). _

Identifying gep1493, gep1507, gep1546, gep273, gep286 and gep76 genes as essential genes

As shown in the experiments described below, each gene of the group; gep1493, gep1507, gepl546 _{c -} gep273 genes _in gep286 and gep76 are essential for survival - Streptococcus pneumoniac Each of the gep1493, gep1507, gepl546, gep273, gep286 and gep76 genes was determined to be essential for the microorganism, . and deletion of each gene.

Each of the gep1493, gep1507, gep1546, gep273, gep286, and gep76 genes was each replaced with a nucleic acid sequence that bears erythromycin resistance (the erm gene). Another genetic marker may also be used as a marker of antibiotic resistance. Polymerase chain reaction (PCR) amplification is used to prepare target deletions in the genomic DNA of Streptococcus as shown in Figure 25. Several PCR reactions have been used to produce the DNA molecules required to perform targeted gene deletions. First, the erm gene from pIL252 of B. subtilis (available from Bacillus Genetic Stock Center, Columbus, OH) was amplified using primers 5 and 6. Primer 5 contains 21 nucleotides that are identical to the promoter region of the erm gene and complementary to sequence A. Primer 5 has the sequence 5'GTG TTC GTG CTG ACT TGC ACC3 '(SEQ ID NO: 77). Primer 6 contains 21 nucleotides that are complementary to the 3 'end of the erm gene. Primer 6 has the sequence 5'GAA TTA TTT CCT CCC GTT AAA 3 '(SEQ ID NO: 78). PCR amplification of the erm gene was performed under the following conditions: 30 cycles were performed at 94 ° C for 1 minute, at 55 ° C for one minute and 72 ° C for one minute, followed by one cycle at 72 ° C. ° C for 10 minutes.

In the second and third PCR reactions, sequences flanking the gene of interest were amplified to produce hybrid DNA molecules that also contained part of the erm gene. The second reaction produced a double-stranded DNA molecule (referred to as the "left-flanking molecule"), which includes sequences upstream of the 5 'end and the first 21 nucleotides of the erm gene. As shown ^- in FIG. 25, this reaction uses one primer consisting of 21 nucleotides is identical to a sequence located about 500 bp upstream of the 5 'end with • · interest. 21 gene expression flanking true gene expression from the translation origin site. Primers 1 and 2 are gene specific primers suitable for the gep1493 gene and include the 5'CTC CGT GAA GTC CAC CTG AT3 'sequences (SEQ ID NO: 79) and the 5'GGT GCA AGT CAG CAC GAA CAC GCG ACA TAG GTT CCA GTT AGG3' (SEQ ID NO: 80). Primer 2 consists of 42 nucleotides, with 21 nucleotides at the 3 'end of the primer being complementary to the positive strand of the gene, which is the center of the nucleotides at the 5' end of the primer being identical to sequence A and therefore complementary to the 5 'end of the erm gene. PCR amplification using primers 1 and 2 produced a DNA molecule flanking the left side of the gene, a hybrid DNA molecule containing a sequence upstream of the gene of interest and 21 base pairs of the erm gene, as shown in Figure 25.

The third PCR reaction was similar to the second reaction, but produced the DNA molecule flanking the right side of the gene, as shown in Figure 25. The DNA molecule flanking the right side of the gene contains 21 bp 3 'ends of the erm gene, 21 bp 3' ends of the gene is the center of interest and the sequence in the direction of interest. The DNA side of the gene was generated using gene specific primers 3 and 4. For the gep1493 gene, primers 3 and 4 included the sequences 5'TTT AAC GGG AGG AAA TAA TTC CCA TAT CGT GGC TCC TGA AT 3 '(SEQ ID NO: 81) and 5'TAA AGC CCT CAT GTC GAA CC3 '(SEQ ID NO: 82). Primer 3 contains 42 nucleotides, with 21 nucleotides at the 5 'end of primer 3' identical to sequence B and are therefore identical to the 3 'end of the erm gene. The 21 nucleotides at the 3 'end of primer 3 are identical to the 3' end of the gene of interest. Primer 4 contains 21 nucleotides and is complementary to a sequence located approximately 500 bp downstream of the gene of interest. As discussed above, primers 1-4 are gene specific, and the sequences described above are used for the gep1493 gene. Gene-specific primers were used to identify other essential genes described herein, as shown in Table 1.

2.

Table 2: Primers used to determine essential genes

gene primer 1 primer 2 primer 3 primer 4 gepl4 93 5'CTC CGT 5'GGT GCA 5'TTT AAC 5'TAA AGC GAA GTC CAC AGT CAG CAC GGG AGG AAA CCT CAT GTC CTG AT3 ' GAA CAC GCG TAA TTC CCA GAA CC3 ' (SEQ ID NO: ACA TAG GTT TAT CGT GGC (SEQ ID NO: 79) CCA GTT AGG3 ' (SEQ ID NO: 80). TCC TGA AT 3 ' (SEQ ID NO: 81) 82) gepl507 5'GCA TGA 5'GGT GCA 5'TTT AAC 5'TAA AGC GAA ACC CAG AGT CAG CAC GGG AGG AAA CCT CAT GTC TCT CC3 ' GAA CAC GCG TAA TTC CCA GAA CC3 ' (SEQ ID NO: ACA TAG GTT TAT CGT GGC (SEQ ID NO: 83) CCA GTT AGG3 '(SEQ NO ID: 84) TCC TGA AT3 '(SEQ NO ID: 85) 86) gepl54 6 5'CAG TGA 5'GGT GCA 5'TTT AAC 5'CCA GCA CGA TAC AGA AGT CAG CAC GGG AGG AAA AAG GAA AAC TGA AGA A3 ' GAA CAC GAT TAA TTC GTC CGA TA3 ' (SEQ ID NO: GCT GGC TTC GCG ACT CCT (SEQ ID NO: - 87) GTT GAG TG3 '(SEQ NO ID: 88) AGC CAT AC3 '(SEQ ID NO: 89) 90) gep273 5'GGT CAG 5'GGT GCA 5'TTT AAC 5'CCC ATA TGA CAG AGT CAG CAC GGG AGG AAA ACC GTA TCA CAG AT3 ' GAA CAC GGC TAA TTC CCG CCT GG3 ' - (SEQ_ID NO: CTT GGA AAA CTT AAA TTC (SE1 ID NO: - 91) AAG ACC- TGC CAA 94) AT3 '(SEQ NO ID: 92) TC3 '(SEQ NO ID: 93)

* <

gep28 6 5'CGG AAC 5'GGT GCA 5'TTT AAC 5'TCG CCC GGC TAT GAA AGT CAG CAC GGG AGG AAA TAC TTT TCG AAA AA (SEQ GAA CAC ACG TAA TTC TGG TAT GC3 ' NO ID: 95) ACG AAA GGC TAT GGG GGT (SEQ ID NO: AAC CAT TGA TGA 98) AC3 '(SEQ AG3 '(SEQ NO ID: 96) NO ID: 97) gep7 6 5'AGC GAT 5'GGT GCA 5'TTT AAC 5'GGG ATT ATT AGT GCG AGT CAG CAC GGG AGG AAA GTC ACG GTA GGA GA3 ' GAA CAC CAG TAA TTC CTG AAA CC3 ' (SEQ ID NO: CAA TTT TGT GGG TAA TGG (SEQ ID NO: 99). CAT CAG AGC ACA 102) TCG3 '(SEQ GT3 '(SEQ ID NO: 100) NO ID: 101)

49 ° C for 30 seconds, at 72 ° C for minutes, repeating the cycle at 94 ° C, 49 ° C and times, at 72 ° C for 10 minutes, then stopping the reactions. An aliquot of each reaction volume of 15 - A, i7 <· was analyzed for electrophoresis on / agarose gel ta

Amplification of the PCR molecules flanking the left and right sides of the gene was performed separately in a 50 μΐ reaction mixture containing: 1 μΐ Streptococcus pneumoniar (RX1) DNA (0.25 μρ), 2.5 μΐ primer 1 or primer 4 (10 pmol / μΐ) ), 2.5 μΐ of primer 2 or primer 3 (20 pmol / μΐ), 1.2 μΐ of a mixture of dNTPs (10 mM each dNTP), 37 μΐ of water, 0.7 μΐ of Taq polymerase (5 ϋ / μΐ) and 5 μΐ 10x concentrated buffer suitable for Taq polymerase (10 mM Tris, 50 mM KCl, 2.5 mM MgCl ₂ ). DNA molecules flanking the left and right sides of the gene were amplified using the following PCR program: at 95 ° C for 2 minutes, at 72 ° C for 1 minute, at 94 ° C for 30 seconds, at 1 72 ° C 30 followed by μΐ at low temperature in TAE buffer and then stained with ethidium bromide. Fragments amplified DNA molecules comprising flanking DNA • «right and left side of the gene was excised from the gel and purified using the QIAquick extraction kit ^{1 1} ™ (Qiagen, Inc.). Other methods known in the art for DNA amplification and isolation, which are well known in the art, may be replaced by the method. DNA fragments flanking the right or left side of the gene were eluted into 30 μΐ TE buffer at pH 8.0.

The amplified erm gene and the DNA molecules flanking the left and right sides of the gene were fused together to form the fusion product as shown in Figure 25. The fusion PCR reaction was performed at 50 μΐ and contains: 2 μΐ of each of the flanking DNA from right and left erm gene gene and PCR product, 5 μΐ 10x concentrated buffer, 2.5 μΐ primers 1 (10 pmol / μΐ), 2.5 μΐ primers 4 (10 pmol / μΐ, 1.2 μΐ of a dNTP mix (each dNTP is 10 mM ), 32 μΐ water and 0.7 μΐ Taq polymerase PCR reaction was performed using the following cycle program: at 95 ° C for 2 minutes, at 72 ° C for 1 minute, at 94 ° C for 2 minutes 30 seconds, at 48 ° C for 30 seconds, at 72 ° C for 3 minutes, repeat cycles at 94 ° C, 48 ° C and incubate at 72 ° C 25 times, followed by a cycle at 72 ° C for 10 minutes After the reaction stopped, an aliquot of the 12 µ reakční reaction mixture was analyzed for agarose gel electrophoresis to confirm the presence of the final product of approximately 2 kb.

An aliquot of a 5 μΐ fusion product was used to transform S. pneumoniae, which was cultured in a culture medium containing erythromycin in accordance with standard methods. As shown in Figure 26, the S. pneumoniae fusion product and genome undergoes homologous recombination by replacing the erm gene with a chromosomal copy of the gene of interest, thereby actually shutting down the gene. Disruption of the essential gene results in growth on erythromycin-containing culture medium. Using the gene shutdown method, it is possible to determine that each gene from the group comprising gep1493, gep1507, gep1546, gep273, gep286 and gep76 is essential for survival.

Identification of homologs and orthologs of GEP polypeptides

To demonstrate that the various GEP genes are essential and are found in operons that are essential for the survival of Streptococcus, homologues and orthologs of the polypeptides encoded by these genes can be expected to be present in other organisms, such as microorganism B. subtilis, are essential or are found in operons that are essential for the survival of the organism as well as useful as targets in the determination of antibacterial agents. Using the GEP polypeptide sequences identified in Streptococcus, homologues and orthologs of said polypeptides can be identified in other organisms. For example, the GEP nucleic acid coding sequences can be used to search the GenBank database of nucleotide sequences to identify homologs and orthologs that are expressed from essential operons in other organisms. Sequence alignment can be performed using the Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215: 403-410, 1990). The percent sequence identity shared by GEP polypeptides and their homologues and orthologs can be determined using the GAP program from the Genetics Computer Group (GCG) Wisconsin Sequence Analysis Package (Wisconsin Package Version 9.0, GCG; Madison, WI). The following parameters are appropriate: the number of gaps formed is 12 (for protein) and 50 (for DNA); the gap extension value is 4 (for protein) and 3 (for DNA). Typically, the GEP polypeptides and their homologues share at least 25% (e.g. at least 40%) sequence identity. Typically, DNA sequences encoding GEP polypeptides and their homologues share at least 35% (e.g., at least 45%) sequence identity. To confirm that homologs or orthologs of GEP polypeptides are expressed from operons that are essential for bacterial survival, the operon encoding each of the homologs or orthologs may be separately deleted from the genome of the host organism.

Determination of essential operons in other strains of microorganism Streptococcus.

Now that it has been found that various GEP genes are found in operons that are essential for survival, these genes or fragments thereof can be used to detect homologous or orthologous genes in other organisms. These genes can be used in the analysis of various pathogenic or non-pathogenic bacteria strains. Nucleic acid fragments (DNA or RNA) encoding anGEP polypeptide or homolog or ortholog (or their complementary sequences) can be used as probes in conventional nucleic acid hybridization assays of a pathogenic bacterium. Nucleic acid probes (typically 8 to 30 or typically 15 to 20 nucleotides) can be used to detect GEP genes or their homologs or orthologs in molecular biology methods such as Southern blot, northern blot, dot and slot blot, methods PCR amplification, colony hybridization methods and the like. Typically, an oligonucleotide probe based on the nucleic acid sequences or fragments thereof described herein is labeled and used to test a genomic library constructed from an mRNA obtained from a Streptococcus microorganism or bacterial strain of interest. A suitable labeling method involves using a polynucleotide kinase added to the ³² P-labeled ATP and to the nucleotide to be used as a probe. This method is well known in the art, as are a number of other suitable methods (for example biotinylation and enzyme labeling).

Hybridization of an oligonucleotide probe with a library or other nucleic acid in a sample typically occurs under stringent to highly stringent conditions. The nucleic acid duplex and hybrid stability is expressed as half the denaturation temperature (melting point) T _m , which is the temperature at which the probe dissociates from the target DNA. This melting point is used to define the desired stringency conditions. If it is determined that the sequences are related and substantially identical to the probe, rather than identical, it is first possible to determine the lowest temperature at which only hybridization by homology occurs at a certain salt concentration (e.g., SSC or SSPE). Assuming that 1% of the incorrect pairs results in a T _m decrease of one degree, then the final wash temperature in the hybridization reaction decreases according to (for example, if the sequence showing a probe match greater than or equal to 95%, then the final wash temperature decreased by five degrees). In practice, the temperature change is between 0.5 ° and 1.5 ° C for 1% mismatch.

The term high stringency means that the hybridization proceeds at 68 ° C in 5x concentrated SSC / 5x concentrated Denhardt's solution / 1% SDS and washing is performed in 0.2x concentrated SSC / 0.1% SDS at 42 ° C. Strict conditions mean washing in 3x concentrated SSC at 42 ° C. The salt concentration and temperature parameters may vary to achieve an optimal degree of match between the probe and the target nucleic acid. Further advice on selecting stringency hybridization conditions is available in the art, for example, in Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y. and Ausubel et al., (eds.), 1995, Current Protocols in Molecular Biology (John Wiley &amp; Sons, N.Y.) in unit 2.10.

Libraries constructed from a pathogenic or non-pathogenic Streptococcus microorganism or from bacterial strains were tested. For example, such strains can be tested for expression of GEP genes by Northern blot analysis. In detecting transcripts of GEP genes or homologs or orthologs, RNA libraries isolated from a suitable strain can be constructed using standard methods well known in the art.

in the field. Alternatively, a library of total genomic DNA can be tested using a probe suitable for the GEP gene (or probes directed to its homolog or ortholog).

For example, novel gene sequences can be isolated by performing PCR using two degenerative oligonucleotide primers that have been designed based on the nucleotide sequences in the GEP genes or in their homologues and orthologs. The reaction template may be DNA obtained from strains known or suspected to express GEP alleles or alleles of their homologues or orthologs. The PCR product may be subcloned and sequenced to show that the amplified sequence represents the nucleic acid sequence of the new GEP genes or the homolog or ortholog sequence thereof.

The synthesis of various GEP polypeptides or homologs or orthologs (or antigenic fragments thereof) suitable for use as antigens or for other purposes may be accomplished using any method known in the art. The polypeptide or homolog or ortholog or antigen fragment (s) thereof may be synthesized chemically in vitro or enzymatically (for example, by in vitro transcription and translation). Alternatively, the gene can be expressed in a cell (e.g., a cultured cell) using any number of available gene expression systems. For example, the polypeptide antigen may be produced in a prokaryotic host (e.g., E. coli and B. subtilis) or in eukaryotic cells, such as yeast or insect cells (e.g., using a baculovirus-based expression vector).

Proteins and polypeptides can also be produced, if desired, in plant cells. For plant cells, viral expression vectors (for example cauliflower mosaic virus and tobacco mosaic virus) and plasmid expression vectors (for example plasmid Ti) are suitable. Such cells are available from a wide variety of sources (for example, the American Type Culture Collection, Rockland, MD; see, for example, U.S. Pat.

Ausubel et al., Current Protocols in Molecular Biology, John Wiley &amp; Sons, New York, 1994). The optimal methods of transformation or transfection and the choice of expression tool will depend on the host system selected. Transformation and transfection methods are described in Ausubel et al., Current Protocols in Molecular Biology, John Wiley &amp; Sons, New York, 1994). Expression vectors may be selected from those described in Cloning Vectors: A Laboratory Manual (P. H. Pouwels et al., 1985, Supp. 1987). Host cells carrying an expression tool can be cultured in a conventional nutritional medium, adapted, if desired, to activate the selected gene, suppress the selected gene, select transformants, or amplify the selected gene.

If necessary, GEP polypeptides or homologs and orthologs thereof can be produced as fusion proteins. For example, the expression vector pUR278 (Ruther et al., EMBO J., 2: 1791, 1983) can be used to prepare lacZ fusion proteins. The well-known pGEX vector can be used in the expression of foreign polypeptides as glutathione transferase (GST) fusion proteins. Generally, such fusion proteins are soluble and can be easily purified from lysed cells by adsorption on glutathione-agarose particles, followed by elution in the presence of free glutathione. PGEX vectors were designed to include thrombin or factor Xa protease cleavage sites such that the cloned target gene product can be released from GST.

As an example of an insect cell expression system, baculoviruses, such as Autographa californica nuclear polyhedrin virus (AcNPV), which grows in Spodoptera frugiperda cells, can be used. These viruses can be used as a vector for the expression of foreign genes. Sequences encoding a GEP polypeptide, or a homolog or ortholog thereof, may be cloned into a non-essential region (e.g., a polyhedrin gene) of the viral genome and positioned such that it is under the control of a promoter or exogenous promoter. Successful incorporation of a gene encoding a GEP polypeptide, or a homolog or ortholog thereof, may result in inactivation of the polyhedrin gene and production of an unclosed recombinant virus (i.e., the virus does not include the protein envelope encoded by the polyhedrin gene). These recombinant viruses can then be used to infect insect cells (e.g. Spodoptera frugiperda cells) in which the inserted gene is expressed (see, e.g., Smith et al., J. Virol., 46: 584, 1983; Smith, US Patent No. 4,215,051).

A variety of virus-based expression systems can be utilized in mammalian host cells. When an adenovirus is used as an expression vector, a nucleic acid sequence encoding a GEP polypeptide or a homolog or ortholog can be ligated into an adenoviral complex that controls transcription / translation, for example, a late promoter and a tripartite leader sequence. This chimeric gene can then be inserted into the adenoviral genome by recombination in vivo or in vitro. Incorporation into a non-essential region of the viral genome (e.g., the E1 or E3 region) will result in a recombinant virus that is capable of expressing a substantial gene product in infected hosts (e.g., Logan, Proc. Natl. Acad. Sci. USA, 81: 3655). , 1984).

Specific initiation signals may be necessary for efficient translation of the inserted nucleic acid sequences. These signals include the ATG initiation codon and flanking sequences. In general, exogenous translational control signals comprising an ATG initiation codon should be provided. Further, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire sequence. These exogenous translational control signals and initiation codons can be of different origins. They can be both synthetic and natural. Expression efficiency may be enhanced by the inclusion of suitable transcription enhancer elements or transcription terminators (Bittner et al., Methods in Enzymol., 153: 516, 1987).

GEP polypeptides and homologues and orthologs can be expressed individually as fusions to a heterogeneous polypeptide, such as a signal sequence or other polypeptide having a specific cleavage site at the N- and / or C-terminus of the protein or polypeptides. The heterogeneous signal sequence selected should be one that is recognized and processed. That is, it is cleaved by a signal peptidase by a host cell in which the fusion protein is expressed.

The host cell that modulates the expression of the inserted sequences or modifies and processes the gene product in a specific manner desired may be selected. Such modifications and processing (e.g., cleavage) of protein products may allow optimal protein function. Different host cells have characteristic and specific mechanisms for post-translational processing and processing of proteins and gene products. Appropriate cell lines or host systems well known in the art of molecular biology can be selected to ensure proper modification and processing of the exorbed foreign protein. Eukaryotic host cells provide cellular equipment for proper processing of the primary transcript and phosphorylation of the gene product. Such mammalian host cells include, but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and choroid knitted cell lines.

If necessary, the GEP polypeptide or homolog or ortholog thereof may produce a stably transfected mammalian cell line. Professionals available number of vectors suitable for stable transfection of mammalian cells (e.g., see Pouwels et al., Mentioned above ^- below). Methods suitable for the construction of such cell lines are also generally known (see, for example, Ausubel et al., (Eds.), 1995, Current Protocols in < RTI ID = 0.0 &gt;).&Lt; / RTI &gt; • · «•« • · · - · • · • · • · · · · · · · ⁴ • «• <Y ·

Molecular Biology, (John Wiley &amp; Sons, NY)). In one example, the DNA encoding the reductase protein was cloned into an expression vector that includes the dihydrofolate reductase (DHFR) gene. Incorporation into the plasmid and therefore incorporation of the gene encoding the GEP polypeptide into the chromosome of the host cell was selected in a cell culture medium containing 0.01 to 300 μΜ of methotrexate (Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY)). This dominant selection can take place in most cell types.

Expression of the recombinant protein can be enhanced by amplifying the transfected gene. Methods suitable for selecting a cell line carrying gene amplification products are described in Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY). Such methods generally include cultivation in a culture medium that contains progressively increasing amounts of methotrexate. DHFR-containing expression vectors used for these purposes include pCVSEII-DHFR and pAdD26SV (A) (described in Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY)).

A variety of other selection systems can be used, including, for example, the herpes simplex virus thymidine kinase genes, hypoxanthine-guanine phosphoribosyl transferase genes, and adenine phosphoribosyltransferase genes, which can be used in tk, hgprt or aprt cells. In addition, gpt genes which possess mycophenolic acid resistance (Mulligan et al., Proc. Natl. Acad. Sci. USA, 78: 2072, 1981), neo which possess aminoglycoside G418 resistance (described in U.S. Pat. (Colberre-Garapin et al., J. Mol. Biol., 150: 1, 1981) and the hygro gene conferring hygromycin resistance (Santerre et al., Gene, 30: 147, 1981). ).

• • • • • (eds.) · · · · · · · · · · · · · (Eds.)

Wiley & Sons, NY)

Alternatively, the fusion protein can simply be purified using antibodies or another molecule that specifically binds to the fusion protein being expressed. For example, the system described in Janknecht et al., Proc. Nati. Acad. Sci. USA, 88: 8972 (1981) allows simple purification of non-denatured fusion proteins expressed in a human cell line. In this system, the gene of interest is subcloned into a recombinant vaccinia plasmid such that the open reading frame of the gene is fused translationally to an N-terminal tag that contains 6 histidine residues. Extracts from cells infected with recombinant vaccinia virus were loaded onto Ni ²⁺ nitriloacetic acid-containing agarose columns and proteins containing the tag sequence of 6 histidine residues were selectively eluted with buffers containing imidazole.

Alternatively, the GEP polypeptide or a homolog or ortholog thereof, or a portion thereof, may be fused to an immunoglobulin Fc region. Such a fusion protein can be purified, for example, using a protein A column. Such fusion proteins allow the production of a chimeric form of GEP polypeptides or a homolog or ortholog that exhibits enhanced stability in vivo.

After expression of the recombinant PEG polypeptide (or homolog or ortholog thereof), it can be isolated (i.e. purified). The secreted forms of the polypeptides may be isolated from the cell culture medium, while the non-secreted forms must be isolated from the host cells. Polypeptides can be isolated, for example, by affinity chromatography. For example, anti-gep103 antibodies (produced as described herein) can be captured on the column and used to isolate the protein. Lysis and cell division of the protein-bearing cells prior to affinity chromatography can be accomplished by standard methods (see, for example, Ausubel et al., 1995, Current Protocols in Molecular Biology). And use in the isolation of GEP polypeptides (e.g., the gep103-maltose-binding fusion protein, the gep-103-βgalactosidase fusion protein, or the gep103-trpE fusion protein, Ausubel et al., Eds. , 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY); New England Catalog, Beverly, MA) The recombinant protein, if necessary, was further purified, for example, by high performance liquid chromatography using standard methods (described see, for example, Fisher, Laboratory Techniques in Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980).

Standard chemical synthesis (for example, the methods described in Solid Phase Peptide Synthesis, 2 ^nd ed., The Pierce Chemical Co., Rockford, IL, 1984) was performed. can produce the amino acid sequences and polypeptides described herein that are used in the practice of the invention (see Solid Phase Peptide Synthesis, 2 ^nd ed., The Pierce Chemical Co., Rockford, IL, 1984) and can be used, for example, as antigens.

(describe Synthesis,

Antibodies

GEP polypeptides (or antigenic fragments or analogs of such polypeptides) can be used to generate antibodies useful in the present invention, and such polypeptides can be produced by recombinant methods and peptide synthesis methods such as Solid Phase-Peptide 2 ^nd ed., The Pierce Chemical Co. , Rockford, IL

1984; Ausubel et al., (Eds.), 1995, Current Protocols in

Molecular Biology, (John Wiley &amp; Sons, NY)). Antibodies can be raised against GEP homologues and orthologs. In general, polypeptides may be coupled to a carrier protein such as KLH as described by Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology, (John).

Wiley and Sons, NY)), which are mixed with an adjuvant and injected into a mammalian host. Antibodies can be purified, for example, by affinity chromatography methods wherein the polypeptide antigen is immobilized on a resin.

Various host animals can be immunized by introducing polypeptides of interest by injection. Examples of suitable host animals include rabbits, mice, guinea pigs and rats. Various adjuvants may be used to enhance the immunological response depending on the host species. Adjuvants include Freund's (complete or incomplete) adjuvant such as aluminum hydroxide, surfactants such as lysolecithin, polyols, polyanions, peptides, oil emulsions, gastropod hemocyanin, dinitrophenol, BCG (Calmette-Guerin bacillus) and Corynebacterium parvum. Polyclonal antibodies are a heterogeneous population of antibody molecules derived from the sera of immunized animals.

Antibodies useful in the invention include monoclonal antibodies, polyclonal antibodies, humanized and chimeric, single chain antibodies. antibodies, Fab fragments, F (ab ') ₂ fragments, and molecules produced using a Fab expressing library.

Monoclonal antibodies (mAbs), which are a homogeneous population of antibodies to a particular antigen, can be prepared

using or GEP polypeptides of his homologues or orthologists and standard technology hybridomas (described se for example in the publication Kohler et al . , Nature, 256: 495, 1975; Kohler et al. , Eur. J. Immunol. 6: 511, 1976; Kohler et al . , Eur. J. Immunol. , 6: 292, 1976; Hammerling et al. , In

Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY, 198I; Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology (John Wiley &amp; Sons, NY).

Monoclonal antibodies can be obtained by any method that provides production of antibody molecules by cell lines in culture as described by Kohler et al., Nature, 256: 495, 1975 and U.S. Pat. Patent No. 4,376,110, the human B-cell hybridoma procedure may be used (Kosbor et al., Immunology Today, 4: 72, 1983; Cole). et al., Proc. Natl. Acad. Sci. USA, 80: 2026, 1983) and by the EBV-hybridoma procedure (Cole et al., Monoclonal Antibidies and Cancer Therapy, Alan R. Liss, Inc. pp. 77-96, 1983). Such antibodies may be any class of immunoglobulin that includes IgG, IgM, IgE, IgA, IgD, and any subclass thereof. The mAbs producing the mAbs of the invention can be cultured in vivo or in vitro. The polyclonal and monoclonal antibodies produced are tested for their ability to specifically recognize a GEP polypeptide or homolog or ortholog thereof in an immunoassay such as Western blotting or immunoprecipitation using a standard method as described by Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY)). Antibodies that specifically bind to GEP polypeptides or conservative variants, homologs, and orthologs can be used in accordance with the invention. For example, such antibodies can be used in an immunoassay to detect GEP polypeptides in pathogenic or non-pathogenic bacteria strains.

It is preferred that the antibodies of the invention are produced using fragments of GEP polypeptides that are likely to appear antigenic based on the high frequency criterion of charged residues. In one specific example, such fragments were prepared by standard PCR methods and then cloned into the pGEX expression vector (Ausubel et al., (Eds.), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY)). The fusion proteins were expressed

in microorganism E. coli and they were cleaned for use glutathionagarózové matrix, how is described in publication Ausubel et al., (Eds 1995) Current Protocols in Molecular Biology, (John Wiley and Sons, NY))

If necessary, several fusions (for example one or two) may be produced for each protein and each fusion may be injected into at least two rabbits. Antisera may develop against the introduction of a series of injections. Typically, three doses are administered. Typically, antisera are assayed for the ability to immunoprecipitate a recombinant polypeptide or a homolog or ortholog thereof, or unrelated control proteins, such as a glucocortococcal receptor, chloramphenicol acetyltransferase, or luciferase.

Methods developed for the production of "chimeric antibodies (Morrison et al., Proc. Natl. Acad. Sci., 81: 6851, 1984; Neuberger et al., Nature, 312: 604, 1984; Takeda et al., Nature, 314: 452, 1984) can be used to splice genes from a mouse antibody molecule of appropriate antigen specificity together with human antibody molecule genes of appropriate biological activity. A chimeric antibody is a molecule in which different portions are obtained from different animal species such that those having a variable region are obtained from mouse mAbs and from a human immunoglobulin constant region.

Alternatively, the single chain antibody method (U.S. Pat.

U.S. Patent Nos. 4,946,778 and 4,704,692) may be adapted to produce single-chain antibodies against a GEP polypeptide or a homolog or ortholog thereof. Single chain antibodies are produced by attaching heavy and light chain fragments to the Fv region via an amino acid bridge to form a single chain polypeptide.

Antibody fragments that recognize and bind to specific epitopes can be generated by methods well known in the art. Such fragments may include, for example, F (ab ') ₂ fragments, which may be generated by pepsin cleavage of antibody molecules and Fab fragments, which may be formed by reducing the sulfide bridges of F (ab') ₂ fragments. Alternatively, Fab expressing libraries can be constructed (see tri Huse et al., Science, 246: 12757-198-9) to allow rapid and simple identification of monoclonal Fab fragments with the desired specificity.

described in the production of patent 4,946,778 and U.S. Pat.

Polyclonal and monoclonal antibodies that specifically bind to GEP polypeptides or homologs and orthologs can be used, for example, to detect expression of the GEP gene or homolog or orthologs in another bacterial strain. For example, the GEP polypeptide can be readily detected in conventional immunological assays of bacterial cells or extracts. Examples of suitable assays include Western blotting, ELISA, radioimmunoassays, and the like.

Test for the determination of antibacterial agents

The invention provides a method for identifying antibacterial agents. Although the inventors are not bound by any particular theory as to the biological mechanism, it is contemplated that novel antibacterial agents specifically inhibit (1) the function of the nucleic acid encoded polypeptides found in operons containing the GEP gene, or (2) gene expression located in operons containing the GEP gene or its homologues or orthologs. Identification of antibacterial agents can be readily accomplished by identifying substances (e.g., polypeptides or small molecules) that specifically bind to a polypeptide encoded by a nucleic acid in operons that contains a GEP gene. In the methods described herein, a homolog or ortholog of the GEP polypeptides may be used in place of the GEP polypeptides. Specific binding of the test substance to the polypeptide can be detected, for example, by in vitro back or permanent immobilization of the test substance (s) to the substrate, for example, on the well surface of 96-well polystyrene microtiter plates. Methods for immobilizing polypeptides and other small molecules are well known in the art. For example, microtiter plates may be coated with a polypeptide encoded by a nucleic acid embedded in operons containing a GEP gene (e.g., a GEP polypeptide or a combination of GEP polypeptides and / or homologs and / or orthologs) by adding the polypeptides (s) to solution (typically at a concentration of 0.05 to 1). mg / ml (1 to 100 μΐ) in each well known in the art, specifically binds to the immunoassay.

well and incubate the plates at room temperature to 37 ° C for 0.1 to 36 hours. Polypeptides that are not bound to the plate are removed by mixing in excess solution and then the plates are washed (once or repeatedly) with water or buffer. Typically, the polypeptide, homolog, or ortholog is contained in water or buffer. The plate is then washed in a buffer that does not contain bound polypeptide. In order to block the free binding sites of the protein on the platelets, the platelets are blocked by a protein that is not related to the bound polypeptide. For example, 300 μΐ bovine serum albumin (BSA) at a concentration of 2 mg / ml Tris-HCl should be used. Suitable substrates include those that contain defined crosslinking (e.g., plastic substrates such as polystyrene, styrene, or polypropylene substrates from Corning Costar Corp. (Cambridge, MA). If necessary, beads, such as agarose beads or sepharose.

Binding of the test substance to the novel polypeptides (or homologues or orthologs thereof) can be detected by any method of the antibody, such as a GEP polypeptide,

If necessary, it labels (for example, by fluorescence or radioisotope) and detects directly (see, for example, West and McMahon, J. Cell Biol. 74: 264, 1977). Alternatively, a second antibody (e.g., a labeled antibody that binds to the Fc portion of anti-GEP103 antibodies) may be used for detection. In another method of detection, the GEP-polypeptide is labeled and a label is detected (for example, the GEP polypeptide is labeled with a radioisotope, fluorine, chromophore and the like). In another method, a GEP polypeptide is produced as a fusion protein with a protein that can be detected optically, for example, a protein exhibiting green fluorescence (which can be detected under UV light). In another method, a polypeptide (e.g., gep103) can be produced as a fusion protein with an enzyme that exhibits an antibody with and detectable enzymatic activity, such as horseradish peroxidase, alkaline phosphatase, β-galactosidase, or glucose oxidase. Genes encoding all of these enzymes have been cloned and are readily available. If necessary, the fusion protein may comprise an antigen, and such antigen may be detected and measured by polyclonal or monoclonal antibodies using conventional methods. Suitable antigens include enzymes (e.g., horseradish peroxidase, alkaline phosphatase, and β-galactosidase) and non-enzymatic polypeptides (e.g., serum proteins such as BSA and globulins and milk proteins such as caseins).

Conventional two hybrid protein / protein interaction assays can be used in a variety of in vivo methods suitable for identifying polypeptides that bind to GEP polypeptides (Chien et al., Proc. Natl. Acad. Sci. USA, 88: 9578, 1991; Eields et al., US Patent No. 5,283,173; Fields and Song, Nature, 340: 245, 1989; Le Douarin et al., Nucleic Acids Research, 23: 876, 1995; See et al., Proc. Natl. Acad. Sci. USA, 93: 10315-10320, 1996; and White, Proc. Natl. Acad. Sci. USA, 93: 10001-10003, 1996). Kits are available commercially for use in a variety of two-hybrid methods (e.g., from Clontech, Palo Alfo, CA).

In general, two-hybrid methods involve in vivo two separable regions of the factor. The transcription factor DNA-binding region (DB) is required for recognition of the selected promoter. The activation region (AD) is required to contact other components of the transcription process of the host cell. The transcription factor was reconstituted using hybrid proteins. One hybrid contains AD and the first protein of interest. The second hybrid comprises DB and the second protein of interest. - __ - _ -

Useful reporter genes are those which are operably linked to a promoter that specifically recognizes DB. Typically, a two-hybrid system uses yeast to reconstitute transcriptional

Saccharomyces cerevisiae and reporter genes whose expression can be selected under appropriate conditions. Other eukaryotic cells including mammalian and insect cells may be used if necessary. The two hybrid system provides a conventional method of cloning a gene encoding a polypeptide (i.e., a candidate antibacterial agent) that binds to a second preselected polypeptide (e.g., gep103). Typically, but not required, a DNA library was constructed such that randomly selected sequences were fused to AD and the protein of interest was fused to DB.

Such two hybrid methods produce two fusion proteins. One fusion protein comprises a GEP polypeptide (or homolog or ortholog thereof) fused to a trans-activator region or transcription factor DNA-binding domain (e.g., Gal4). Another fusion protein comprises a test polypeptide fused to either a DNA binding region or a transactivator factor transactivator region. When both co-exist in one cell (e.g., a yeast cell or a mammalian cell), one of the fusion proteins comprises a transactivator region and the other fusion protein comprises a DNA binding region. Therefore, binding of GEP polypeptides to a test polypeptide (i.e., a candidate antibacterial agent) reconstitutes the transcription factor. Reconstitution of a transcription factor can be detected by detecting the expression of a gene (i.e., a reporter gene) that is operably linked to a DNA sequence that binds to the transcription factor DNA binding region.

The methods described above can be used to test a variety of high permeability substances which are used to identify candidate antibacterial agents. If the test substance is determined to be a candidate antibacterial agent, it may be tested for its ability to inhibit bacterial growth in vivo or in vitro (for example, using animals, such as a rodent model). Using other variants of such methods known in the art, one can test the ability of a nucleic acid (e.g., DNA or RNA) to bind to a polypeptide encoded by a nucleic acid sequence located in an operon that contains a GEP gene or a homolog or ortholog thereof.

Further in vitro testing can be performed by methods known in the art, such as an enzyme inhibition assay or a bacterial growth inhibition assay performed with whole cells. The Agar Dilution Test identifies substances that inhibit bacterial growth. Microtiter plates contain serial dilutions of test substance, add a given amount of growth substrate and add cells of Streptococcus. Growth inhibition was determined, for example, by observing changes in the optical density of bacterial cultures.

Inhibition of bacterial growth was demonstrated, for example, by comparing (in the presence or absence of) the test substance with the growth rate or absolute growth of bacterial cells. Inhibition includes a reduction of one of the above measurements by at least 20% (e.g., at least 25%, 30%, 40%, 50%, 75%, 80% or 90%).

Animal rodent (e.g., mice) and rabbit models of streptococcal infections are known in the art, and such animal model systems are accepted for testing antibacterial agents as an indication of their efficacy in human therapy. Typically, an in vivo test is performed by infecting an animal with a pathogenic strain of Streptococcus, for example, by inhalation of Streptococcus pneumoniae, and then determining whether the mammal is affected by streptococcal pneumonia using conventional methods and criteria. The antibacterial agent candidate is then administered to the mammal at a dose of 1-100 mg / kg body weight, and the mammal is monitored for disease symptoms. Alternatively, the test substance can be administered to a mammal before being infected with Streptococcus and the ability of the mammal to withstand infection is measured. The results obtained in the presence of the test substance are, of course, compared to the results in control animals not treated with the test substance. For example, administration of a candidate antibacterial agent to a mammal can be carried out as described below.

grow

0.1 sucrose, phosphate

Pharmaceutical formulations

Treatment comprises administering to a subject in need of such treatment a pharmaceutically effective amount of a composition comprising an antibacterial agent, thereby inhibiting bacterial. Such composition typically comprises up to about 90% (w / w) (1 to 20% or 1 to 10%) antibacterial. agents of the invention on a pharmaceutically acceptable carrier.

Solid formulations of compositions suitable for oral administration may contain suitable carriers or excipients such as corn starch, gelatin, lactose, acacia, microcrystalline cellulose, kaolin, mannitol, calcium, calcium carbonate, sodium chloride or alginic acid. Deintegrators that may be used include microcrystalline cellulose, corn starch, sodium glycolate and alginic acid. Tablets that may be used include gum arabic, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone (Povidone), hydroxypropylmethylcellulose, sucrose, starch and ethylcellulose. Useful lubricants include magnesium stearate, stearic acid, silicone fluid, talc, waxes, oils and colloidal silica.

Liquid formulations of compositions suitable for oral administration prepared in water or in another aqueous vehicle may contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone and polyvinyl alcohol. Liquid formulations may also include solutions, emulsions, syrups and elixirs which contain, together with the active ingredients, wetting agents, sweetening and coloring and flavoring agents. Various liquid and powder formulations with formulations, which are salt forms, can be prepared by conventional methods suitable for inhalation into the lungs of the mammal to be treated.

Injectable formulation compositions may contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like). In the case of intravenous injections, the water-soluble substances may be administered by the drop method, by infusion of a pharmaceutical composition comprising an antibacterial agent and a physiologically acceptable excipient. Physiologically acceptable excipients may include, for example, 5% dextrose, 0.9% saline, Ringer's solution, and other suitable excipients. Intramuscular sterile formulations suitably dissolved and administered in a pharmaceutical excipient such as injection water, 0.9% saline or 0.5% glucose solution. Suitable insoluble forms of the substance may be prepared and administered as a suspension in an aqueous base or in a pharmaceutically acceptable oil base such as a long chain fatty acid ester (e.g. ethyl oleate).

Surface semi-solid ointments typically contain a concentration of active ingredient in the range of 1 to 20%, for example, 5 to 10% in a carrier such as a pharmaceutical cream base. Various formulations suitable for topical use include drops, elixirs, creams, solutions and ointments containing the active ingredient and various supplements and vehicles.

The optimum percentage of antibacterial agent in a pharmaceutical formulation varies depending on the formulation and the desired therapeutic effect that is required for a specific disease and correlated therapeutic regimens. Appropriate doses of antibacterial agents can be readily determined by monitoring signs of amelioration or inhibition of the disease and increasing or decreasing the dose and / or frequency of treatment. Optimum amount of antibacterial agent in each alone

which is used to treat conditions caused by a bacterial infection may depend on the route of administration, the age and body weight of the subject, and the conditions of the subject being treated. In a circulating case, the antibacterial agent may be administered at a dose of 1 to 100 mg / kg body weight, and typically at a dose of 1 to 10 mg / kg body weight.

Overview of the drawings

Figure 1 shows the amino acid and the coding strand and non-coding strand of the gep103 polypeptide and gene sequences from the Streptococcus pneumonia strain (SEQ ID NOs: 1, 2 and 3).

Figure 2 shows the amino acid and the coding and non-coding strand of the gep1119 polypeptide and the gene from the Streptococcus pneumonia strain (SEQ ID NOs: 4, 5 and 6).

Figure 3 shows the amino acid and the coding and non-coding strand of the gep1122 polypeptide and gene from Streptococcus pneumonia (SEQ ID NOs: 7, 8 and 9).

Figure 4 shows the amino acid and the coding and non-coding strand of the gep1315 polypeptide and the gene from the Streptococcus pneumonia (SEQ ID NOs: 10, 11 and 12).

Figure 5 shows the amino acid and the coding and non-coding strand of the gep1493 polypeptide and gene from Streptococcus pneumonia (SEQ ID NOs: 13, 14 and 15).

Figure 6 shows the amino acid and the coding and non-coding strand of gep1507 α-gene polypeptide sequences from Streptococcus pneumonia (SEQ ID NOs: 16, 17 and 18).

4Ί

Figure 7 depicts the amino acid and coding and non-coding strand sequences of gep1511 polypeptides and a gene from Streptococcus pneumonia (SEQ ID NOs: 19, 20, and 21).

Figure 8 depicts the amino acid and coding and non-coding strand sequences of gep1518 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOS: 22, 23 and 24).

Figure 9 depicts the amino acid and coding and non-coding strand sequences of gep1546 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOS: 25, 26, and 27).

Figure 10 shows the amino acid and the coding and non-coding strand of the gep1555 polypeptide and the gene from the Streptococcus pneumonia (SEQ ID NOs: 28, 29 and 30).

Figure 11 depicts the amino acid and coding and non-coding strand sequences of gep1561 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOs: 31, 32, and 33).

Figure 12 depicts the amino acid and coding and non-coding strand sequences of gep1580 polypeptides and a gene from Streptococcus pneumonia (SEQ ID NOs: 34, 35, and 36).

Figure 13 depicts the amino acid and coding and non-coding strand sequences of gep1713 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOs: 37, 38, and 39).

Figure 14 shows the amino acid and the coding and non-coding strand of the gep222 polypeptides and the Streptococcus pneumonia gene (SEQ ID NOs: 40, 41 and 42J). an acid of gep2283 polypeptides and a gene from a Streptococcus pneumonia strain (SEQ ID NOS: 43, 44, and 45).

Figure 16 depicts the amino acid and coding and non-coding strand sequences of gep273 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOs: 46, 47, and 48).

Figure 17 depicts the amino acid and coding and non-coding strand sequences of gep286 polypeptides and a gene from Streptococcus pneumonia (SEQ ID NOs: 49, 50, and 51).

Figure 18 shows the amino acid and coding and non-coding strand sequences of gep311 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOS: 52, 53 and 54).

Figure 19 depicts the amino acid and coding and non-coding strand sequences of gep3262 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOS: 55, 56 and 57).

Figure 20 depicts the amino acid and coding and non-coding strand sequences of gep3387 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOS: 58, 59 and 60).

Figure 21 depicts the amino acid and coding and non-coding strand sequences of gep47 polypeptides and a gene from Streptococcus pneumonia (SEQ ID NOs: 61, 62 and 63).

Figure 22 depicts the amino acid and coding and non-coding strand sequences of gep61 polypeptides and a gene from Streptococcus pneumonia (SEQ ID NOs: 64, 65 and 66).

Figure 23 depicts the amino acid and coding and non-coding strand sequences of gep76 polypeptides and a gene from the Streptococcus pneumonia strain (SEQ ID NOS: 67, 68 and 69).

* * * * *

Figure 24 shows the amino acid and the coding and non-coding strand of the ByneS polypeptide nucleic acid sequences and the gene from the Bacillus subtilis strain (SEQ ID NOs: 70, 71, and 72).

Figure 25 is a schematic diagram of the PCR strategy used to produce DNA molecules used for targeted deletions of essential genes of Streptococcus pneumoniae.

Figure 26 is a schematic diagram of the PCR strategy used to produce targeted deletions of essential Streptococcus pneumoniae genes.

DETAILED DESCRIPTION OF THE INVENTION

Example 1:

Using the above-described transposon-based mutagenesis methods, the genome of Streptococcus pneumonia was mutagenized and 23 genes were found to be located on operons that are essential for the survival of Streptococcus pneumonia. These genes are listed in Table 1 above and their nucleic acid and amino acid sequences are set forth in SEQ ID NOS: 1 to 69 and are shown in Figures 1 to 23.

Because each of these genes is known to be located in operons that are essential for the survival of Streptococcus, the polypeptides encoded by the nucleic acids located in these operons can be used to identify antibacterial agents using the assays described herein. For known nucleic acids located in operons containing GEP genes and gene products and their hmologs and orthologs, other known test methods can be used to detect interactions of the test compounds with proteins or to detect ^- inhibition of bacterial growth. Example 2:

»· *

The invention further provides fragments, variants, analogs and derivatives of the GEP polypeptides described above that retain one or more biological activities of the GEP polypeptides, for example, as determined in a complementation assay. The invention further describes natural and unnatural allelic variants. Compared to the naturally occurring GEP gene shown in Figures 1 to 23, the nucleic acid sequences encoding allelic variants may exhibit the substitution, deletion or addition of one or more nucleotides. Preferred allelic variants are a functional equivalent of a GEP polypeptide, as determined, for example, in a complementation assay.

Claims (24)

PATENT CLAIMS An isolated allele operon comprising a nucleotide sequence or variant or homolog of a nucleotide sequence encoding: a gep113 polypeptide comprising the amino acid sequence of SEQ ID NO: 1 shown in Figure 1, a gep1119 polypeptide comprising the amino acid sequence of SEQ ID NO: 4 shown in Figure 2, a gep1122 polypeptide comprising the amino acid sequence of SEQ ID NO: 7 shown in Figure 3 gep1315 polypeptide comprising the amino acid sequence of SEQ ID NO: 10 shown in Figure 4, gep1449 polypeptide comprising the amino acid sequence of SEQ ID NO: 13 shown in Figure 5, gep1507 polypeptide comprising the amino acid sequence of SEQ ID NO: 16 shown in Figure 4. 6, a gep1511 polypeptide comprising the amino acid sequence of SEQ ID NO: 19 shown in Figure 7, a gep1518 polypeptide comprising the amino acid sequence of SEQ ID NO: 22 shown in Figure 8, a gep1546 polypeptide comprising the amino acid sequence of SEQ ID NO: 25 shown in Figure 6. 9, a gep1551 polypeptide comprising amino acid sequence S EQ ID NO: 28 shown in Figure 10, a gep1561 polypeptide comprising the amino acid sequence of SEQ ID NO: 31 shown in Figure 11, a gep1580 polypeptide comprising the amino acid sequence of SEQ ID NO: 34 shown in Figure 12, a gep-1713 polypeptide comprising the amino acid sequence of SEQ ID NO: 37 shown in Figure 13, the gep222 polypeptide comprising the amino acid sequence of SEQ ID NO: 40 shown in Figure 14, » W · «δ S4 «« fc ·· ·· · * · w · «ř # •« -. Gep2283 polypeptide comprising the amino acid sequence of SEQ ID NO: 43 shown in Figure 15, gep273 polypeptide comprising the amino acid sequence of SEQ ID NO: 46 shown in Figure 16, the gep286 polypeptide comprising the amino acid sequence of SEQ ID NO: 43; 17, a gep311 polypeptide comprising the amino acid sequence of SEQ ID NO: 52 shown in Figure 18, a gep3262 polypeptide comprising the amino acid sequence of SEQ ID NO: 55 shown in Figure 19, a gep3387 polypeptide comprising the amino acid sequence SEQ ID NO: 58 shown in Figure 20, a gep47 polypeptide comprising the amino acid sequence of SEQ ID NO: 61 shown in Figure 21, a gep61 polypeptide comprising the amino acid sequence of SEQ ID NO: 64 shown in Figure 22, or a gep76 polypeptide comprising the amino acid sequence SEQ ID NO: 67 shown in Figure 23. An isolated nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of: (1) an operon comprising the sequence of SEQ ID NO: 2 as depicted in Figure 1, or a degenerate variant thereof, (2) an operon comprising the sequence of SEQ ID NO: 2, or a degenerate variant thereof, wherein T is replaced by U, (3) ) nucleic acids complementary to (1) and (2), (4) operon and nucleic acid fragments described in (1), (2) and (3), respectively, containing at least 15 bp and hybridizing under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 1, (5) an operon comprising the sequence of SEQ ID NO: 5 as shown in Figure 2, or degenerate variants thereof, (6) an operon comprising the sequence of SEQ ID NO: 5 or degenerate variants thereof, wherein T is replaced by U, ((7) nucleic acid complementary to (5) and (6), (8) operon and nucleic acid fragments described in (5), (6) and (7), respectively. ), which contain at least 15 base pairs and which hybridize under stringent conditions to genomic DNA k (9) an operon comprising the sequence of SEQ ID NO: 8 as depicted in Figure 3, or a degenerate variant thereof, (10) an operon comprising the sequence of SEQ ID NO: 8 or a degenerate thereof variants wherein T is replaced by U, (11) nucleic acid complementary to (9) and (10), (12) operon and nucleic acid fragments described in (9), (10) and (11), respectively, containing at least 15 (1) an operon comprising the sequence of SEQ ID NO: 11, as depicted in Figure 4, or a degenerate variant thereof, (14) an operon comprising the sequence of SEQ ID NO: 11 or degenerate variants thereof, wherein T is replaced by U, (15) the nucleic acid complementary to (13) and (14), (16) the operon and nucleic acid fragments described in (13), ( 14) and (15), respectively, which contain at least 15 pairs of baits and which h they hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 10, (17) an operon comprising the sequence of SEQ ID NO: 14 as shown in Figure 5, or degenerate variants thereof, (18) an operon comprising the sequence of SEQ. ID NO: 14 or degenerate variants thereof, wherein T is replaced by U, (19) nucleic acid complementary to (17) and (18), (2Ό) operon and nucleic acid fragments described in (17), (18) and (19), respectively, which contain at least 15 pairs of bases and which hybridize under stringent ♦ S4 conditions of genomic DNA encoding a polypeptide of SEQ ID NO: 13, (21) an operon comprising the sequence of SEQ ID NO: 17, as depicted in Figure 6, or degenerate variants thereof, (22) an operon comprising the sequence of SEQ ID NO: 17 or degenerate variants thereof, wherein T is replaced by U, (23) a nucleic acid complementary to (21) and (22) (24) operon and nucleic acid fragments described in (21), (22) and (23), respectively, which contain at least 15 bp and which hybridize under stringent conditions to genomic DNA encoding a polypeptide of SEQ ID NO: 16, ( (25) an operon comprising the sequence of SEQ ID NO: 20 as depicted in Figure 7, or a degenerate variant thereof, (26) an operon comprising the sequence of SEQ ID NO: 20 or a degenerate variant thereof, wherein T is replaced by U, (27) nucleic acids complementary to (25) and (26), (28) operon and nucleic acid fragments described in (25), (26) and (27), respectively, which contain at least 15 base pairs and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 19, (29) an operon comprising the sequence of SEQ ID NO: 23, as shown in Figure 8, or degenerate variants thereof, (30) an operon comprising the sequence of SEQ ID NO: 23 or degenerate variants thereof, wherein T is replaced by U, (31) a nucleic acid complementary to (29) and (30) (32) the operon and nucleic acid fragments described in (39), (30) and (31), respectively, which contain at least 15 bp and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO 22, (33) ) an operon comprising the sequence of SEQ ID NO: 26 as shown in Figure 9, or degenerate variants thereof, (34) (35) (36) (37) (38) (39) (40) (41) (42) (43) (44) (45) (46) (47) operon comprising the sequence of SEQ ID NO: 26 or degenerate variants thereof, wherein T is replaced by U, nucleic acids complementary to (33) and (34), operon and nucleic acid fragments described in (33), (34) and (35), respectively, containing at least 15 bp and hybridizing under strict conditions to the genomic DNA encoding a polypeptide of SEQ ID NO: 25, an operon comprising the sequence of SEQ ID NO: 29 as depicted in Figure 10, or degenerate variants thereof, an operon comprising the sequence of SEQ ID NO: 29 or degenerate variants thereof, wherein T is replaced by U, nucleic acids complementary to (37) and (38), operon and nucleic acid fragments described in (37), (38) and (39), which contain at least 15 bp and which hybridize under stringent conditions to genomic DNA encoding a polypeptide of SEQ ID NO: 26, an operon comprising the sequence of SEQ ID NO: 32 as depicted in Figure 11, or degenerate variants thereof, an operon comprising the sequence of SEQ ID NO: 32, or degenerate thereof variants wherein T is replaced by U, nucleic acids complementary to (41) and (42), operon and nucleic acid fragments described in (41), (42) and (43), respectively, containing at least 15 bp and hybridizing to stringent conditions with a genomic DNA encoding a polypeptide of SEQ ID NO: 31, an operon comprising the sequence of SEQ ID NO: 35 as shown in Figure 12, or a degenerate variant thereof, an operon comprising the sequence of SEQ ID NO: 35 or a degenerate variant thereof wherein T is replaced by N, nucleic acids complementary to (45) and (46), v (48) operon and nucleic acid fragments described in (45), (46) and (47), respectively, which contain at least 15 bp and which hybridize under stringent conditions to genomic DNA encoding the polypeptide of SEQ ID NO. NO: 34, (49) an operon comprising the sequence of SEQ ID NO: 38 as depicted in Figure 13, or a degenerate variant thereof, (50) an operon comprising the sequence of SEQ ID NO: 38 or a degenerate variant thereof, wherein T is replaced U, (51) nucleic acids complementary to (49) and (50), (52) operon and nucleic acid fragments described in (49), (50) and (51), respectively, containing at least 15 bp and hybridizing to the (53) an operon comprising the sequence of SEQ ID NO: 41, as depicted in Figure 14, or a degenerate variant thereof, (54) an operon comprising the sequence of SEQ ID NO. : 41 or a degenerate variant thereof y, wherein T is replaced by U, (55) the nucleic acid complementary to (53) and (54), (56) the operon and nucleic acid fragments described in (53), (54) and (55), respectively, containing at least 15 bovine pairs that hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 40, (57) an operon comprising the sequence of SEQ ID NO: 44, as shown in Figure 15, or degenerate variants thereof, (58) an operon comprising the sequence of SEQ ID NO: 44 or degenerate variants thereof, wherein T is replaced by U, (59) nucleic acid complementary to (57) and (58), (60) operon and nucleic acid fragments described in (57), ( 581 and (59), respectively, which contain at least 15 pairs of bases and which hybridize at a strict $ 5; ; ; *::: 5-g conditions with genomic DNA encoding a polypeptide of SEQ ID NO: 39, (61) an operon comprising the sequence of SEQ ID NO: 47, as depicted in Figure 16, or degenerate thereof variants, (62) an operon comprising the sequence of SEQ ID NO: 47 or degenerate variants thereof, wherein T is replaced by U, (63) nucleic acid complementary to (61) and (62), (64) operon and nucleic acid fragments described in para. (61), (62) and (63), respectively, which comprise at least 15 pairs of baffles and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 46, (65) an operon comprising the sequence of SEQ ID NO: 50 as is shown in Figure 17, or a degenerate variant thereof, (66) an operon comprising the sequence of SEQ ID NO: 50 or a degenerate variant thereof, wherein T is replaced by U, (67) a nucleic acid complementary to (65) and (66), (68) operon and nucleic acid fragments described in (65), (66), respectively ktive (67) that contain at least 15 base pairs and that hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 49, (69) an operon comprising the sequence of SEQ ID NO: 53, as shown in Figure 18 , or a degenerate variant thereof, (70) an operon comprising the sequence of SEQ ID NO: 53 or degenerate variants thereof, wherein T is replaced by U, (71) nucleic acids complementary to (69) and (70), (72) operon fragments and nucleic acids acids described in (69), (70) and (71), respectively, which contain at least 15 base pairs and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 52, (73) an operon comprising the sequence of SEQ ID NO : 56, as shown in Figure 19, or degenerate variants thereof, (74) (75) (76) (77) (78) (79) (80) (81) (82) (83) (84) (85) - (87) an operon comprising the sequence of SEQ ID NO: 56 or degenerate variants thereof, wherein T is replaced by U, nucleic acids complementary to (73) and (74), operon and nucleic acid fragments described in (73), (74) and (75) containing at least 15 base pairs and which hybridize under stringent conditions to a genomic DNA encoding a polypeptide of SEQ ID NO: 55, an operon comprising the sequence of SEQ ID NO: 59 as shown in Figure 20, or degenerate variants, an operon comprising the sequence of SEQ ID NO: 59 or degenerate variants thereof, wherein T is replaced by U, nucleic acids complementary to (77) and (78), operon and nucleic acid fragments described in (77), (78) and (78), respectively. (79) that contain at least 15 bp and which hybridize under stringent conditions to genomic DNA encoding a polypeptide of SEQ ID NO: 58, an operon comprising the sequence of SEQ ID NO: 62, as shown in Figure 21, or degenerate variants thereof, an operon comprising the sequence of SEQ ID NO: 62 or degenerate variants thereof, wherein T is replaced by U, nucleic acids complementary to (81) and (82), operon and nucleic acid fragments described in (81), (82) and (83) containing at least 15 base pairs and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 61, an operon comprising the sequence of SEQ ID NO: 65 as shown in Figure 22, or a degenerate variant, an operon comprising the sequence of SEQ ID NO: 65, or degenerate variants thereof, wherein T is replaced, complementary -s (85) and (86) nucleic acids, Μ (88) operon and nucleic acid fragments described in (85), (86) and (87), respectively, that contain at least 15 base pairs and that hybridize under stringent conditions to genomic DNA encoding the polypeptide of SEQ ID NO: 66, ( (89) an operon comprising the sequence of SEQ ID NO: 68 as depicted in Figure 23, or a degenerate variant thereof, (90) an operon comprising the sequence of SEQ ID NO: 68 or a degenerate variant thereof, wherein T is replaced by U, (91) nucleic acids complementary to (89) and (90), (92) operon and nucleic acid fragments described in (89), (90) and (91), respectively, containing at least 15 bp and hybridizing under stringent conditions to genomic DNA encoding a polypeptide of SEQ ID NO: 67. An isolated Streptococcus operon comprising a nucleotide sequence at least 85% identical to a nucleotide sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID 26: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 65 and SEQ ID NO: 68. 4. An isolated nucleic acid molecule. which comprises at least 15 base pairs and hybridizes under stringent conditions to a nucleotide sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, ŠEQ ID NO: 53, SEQ ID NO: 56, - SEQ ID * YES: 59, SEQ ID NO: 62, SEQ ID NO: 65 a SEQ ID NO: 68. A vector comprising an operon according to claim 1. • · -6Q A vector comprising the nucleic acid molecule of claim 2. An expression vector comprising an operon according to claim 1, which is operably linked to a nucleotide sequence of a regulatory element that directs the expression of said operon. An expression vector comprising the nucleic acid molecule of claim 2, wherein said nucleic acid molecule is operably linked to a nucleotide sequence of a regulatory element that directs expression of said nucleic acid. 9. A host cell comprising the exogenously introduced operon of claim 1. 10. A host cell comprising the exogenously introduced nucleic acid molecule of claim 2. 11. A host cell according to claim 9 which is a yeast or a bacterium. 12. The host cell of claim 10, wherein: 13. Host engineering that is a yeast or bacterium. a cell modified by methods characterized in that the operably linked comprises an operon according to claim 1 with a regulatory element of a heterologous nucleotide sequence that directs the expression of operons in the host cell. 14. The host cell of claim 13 which is a yeast or a bacterium. 15. A genetically engineered host cell comprising the nucleic acid molecule of claim 2 operably linked to a nucleotide sequence regulatory element that directs expression of the nucleic acid in the host cell. 16. A host cell according to claim 15, characterized in that it is a yeast or a bacterium. * «$ 4 An isolated operon comprising a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequence SEQ ID NO: 1, as is Shown on Figure 1 amino acid sequence SEQ ID NO: 4, as is Shown on Figure 2 amino acid sequence SEQ ID NO: 7 as is Shown on Figure 3 amino acid sequence SEQ ID NO: 10 how is shown in Figure 4, amino acid sequence SEQ ID NO: 13 how is shown in Figure 5, amino acid sequence SEQ ID NO: 16, how is shown in Figure 6, amino acid sequence SEQ ID NO: 19 how is shown in Figure 7, amino acid sequence SEQ ID NO: 22, how is shown in Figure 8, amino acid sequence SEQ ID NO: 25 how is shown in Figure 9, - amino acid sequence SEQ ID NO: 28 how is shown in Figure 10, amino acid sequence SEQ ID NO: 31 how is shown in Figure 11, amino acid sequence SEQ ID NO: 34 how is shown in Figure 12, amino acid sequence SEQ ID NO: 37, how is shown in Figure 13, amino acid sequence SEQ ID NO: 40 how is shown in Figure 14, amino acid ” sequence SEQ ID NO: 43 how is shown in Figure 15, amino acid sequence 5o • · how • · Yippee shown SEQ ID NO: 46, in Figure 16, amino acid sequence SEQ ID NO: 49, how Yippee shown in Figure 17, amino acid sequence SEQ ID NO: 52, how Yippee shown in Figure 18, amino acid sequence SEQ ID NO: 55, how Yippee shown in Figure 19, amino acid sequence SEQ ID NO: 58, how Yippee shown in Figure 20, amino acid sequence SEQ ID NO: 61, how Yippee shown in Figure 21, amino acid sequence SEQ ID NO: 64, how Yippee shown in Figure 22 amino acid and sequence SEQ ID NO: 67, how Yippee shown in Figure 23. An isolated polypeptide encoded by a nucleic acid located in operons comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65 68. An isolated polypeptide that encodes an operon according to claim 1. 20. An isolated polypeptide that encodes a nucleic acid molecule of claim 2. An isolated polypeptide that encodes an operon according to claim 3. 22. A method for determining an antibacterial agent; marked u j i c i are you m, which includes: (a) contact tested Substance s or polypeptide with his homologem coded sequences nuclear acid placed in operons containing a GEP gene selected from groups including gep103 geplll9, gepll22, gepl315, gepl493, gepl507, gepl511, gepL518, gepl54 6, gepl551, gepi561, gepl580, gepl713, gep222, gep2283, gep273, gep28 6, gep311, gep3262, gep3387, gep47, gep61 and gep76 a 9 / (b) detecting binding of the test substance to the polypeptide, wherein the binding indicates that the test substance is an antibacterial agent. 23. The method of claim 22, further comprising: determining whether the test polypeptide inhibits growth indicative of a bacterial-binding agent relative to the growth of bacteria grown in the absence of the test substance that binds to the polypeptide, wherein inhibiting growth indicates that the test polypeptide the substance is an antibacterial agent. 24. The method of gep103, gep1511, according to claim 22, 26. (a) characterized in that the polypeptide is selected from the group consisting of gep1119, gep1122, gep1315, gep1493, gep1507, gep155, gep1557, gep1551, gep1580, gep1713, gep222, gep2283, gep2333, gep2333, gep2333, gep2333, gep2333, gep2333 , gep61, and gep76. The method of claim 22, wherein the test substance is immobilized to the substrate, and binding of the test substance to the polypeptide is detected as immobilizing the polypeptide to the immobilized test substance. The method of claim 25, wherein immobilizing the polypeptide to the test substance is detected in an immunoassay with an antibody that specifically binds to the polypeptide. The method of claim 22, wherein the test substance is selected from polypeptides and small molecules. The method of claim 22, wherein the polypeptide is provided as a fusion protein comprising a polypeptide fused to (i) a transcription activating region of a transcription factor or (ii) a transcription factor DNA binding region and from a group of test substances (b) is a polypeptide that is available as a fusion protein comprising a test polypeptide fused to (i) a transcription factor activation region or (ii) a transcription factor DNA binding region to interact with the fusion protein and binding of the test substance to the polypeptide is detected as reconstitution transcription factor. An antibody that specifically binds to the GEP polypeptide of claim 19. The antibody of claim 29 which is monoclonal: c) the antibody. A method for identifying an antibacterial agent comprising: (a) contacting the polypeptide encoded by a nucleic acid placed in an operon containing the GEP gene with a test substance, (b) detecting a weakening of the polypeptide function that is in contact with the test substance, and (c) determining whether the test substance that attenuates the polypeptide function with which it is in contact inhibits the growth of bacteria relative to the growth of bacteria cultured in the absence of a test substance that attenuates the function of the polypeptides with which it is contacted, wherein growth inhibition indicates that the test substance is an antibacterial agent. 32. The method of claim 31, wherein the polypeptide is selected from the group consisting of gep103, gep119, gep1122, gep1315, gep1493, gep1507, gep1511, gep1518, gep1546, gep1551, gep1556, gep1713, gep1713, gep1713, gep1713, gep1713, gep1713, gep1713, gep1713, gep1713, gep286, gep311, gep3262, gep3387, gep47, gep61, and gep76. 33. The method according to claim 31, characterized in that - from the e test substance is selected from the ^- group consisting of polypeptides and small molecules. π 34. A method of determining antibacterial comprising: agents, contacting a nucleic acid comprising an operon comprising a gene encoding a GEP polypeptide with a test agent, wherein the GEP polypeptide is selected from the group consisting of gep103, gep1149, gep1149, gep1146, gep2283, gep1507, gep1511, gep1111, gep11518, gep15518 gep1713, gep326, gep1551, gep151, gep273, gep286, gep3387, gep47, gep61 and gep76; and (b) detecting binding of the test agent to the nucleic acid, wherein the binding detects that the test agent is an antibacterial agent. 35. The method of claim 34, further comprising: (c) determining whether the test substance that binds to the nucleic acid inhibits bacterial growth relative to the growth of bacteria grown in the absence of the test substance that binds to the nucleic acid, wherein growth inhibition indicates that the test substance is an antibacterial agent. 36. The method of claim 34, wherein the test substance is selected from the group consisting of polypeptides and small molecules. 37. An isolated nucleic acid or allelic variant thereof encoding: a gep1493 polypeptide comprising the amino acid sequence of SEQ ID NO: 13, as depicted in Figure 5, a gep1507 polypeptide comprising the amino acid sequence of SEQ SEQ ID NO: 16, as depicted in Figure 6, a gep1546 polypeptide comprising the amino acid sequence of SEQ ID NO: 25, as depicted in Figure 9, a ~ gep273 polypeptide comprising the amino acid sequence ~ SEQ 16, * gep286 polypeptide comprising the amino acid sequence of SEQ ID NO: 49, as depicted in Figure 17, or gep76 polypeptide comprising the amino acid sequence of SEQ ID NO: 67, as depicted in Figure 16; in Figure 23. 38. An isolated nucleic acid comprising a sequence selected from the group consisting of: (1) SEQ ID NO: 14, as depicted in Figure 5, or degenerate variants thereof, (2) SEQ ID NO: 14, or degenerate variants thereof, wherein T is replaced by U, (3) a nucleic acid complementary to ( (1) and (2), (4) the nucleic acid fragments described in (1), (2) and (3), which contain at least 15 base pairs and which hybridize under stringent conditions to genomic DNA encoding the polypeptide of SEQ ID NO. (13) (6) SEQ ID NO: 17 or degenerate variants thereof, (6) SEQ ID NO: 17 or degenerate variants thereof, wherein T is replaced by U, (7) nucleic acids complementary to (5) and (6), (8) the nucleic acid fragments described in (5), (6) and (7), which contain at least 15 bp and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of the sequence SEQ ID NO: 16, (9) SEQ ID NO: 26, as depicted in Figure 9, or degenerate variants thereof, (10) SE Q ID NO: 26 or degenerate variants thereof, wherein T is replaced by U, (11) nucleic acids complementary to (9) and (10), (12) the nucleic acid fragments described in (9), (10) and (11). ) which contain at least 15 base pairs and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 25, (13) of SEQ ID NO: 47, as shown in the figure (14) SEQ ID NO: 47 or degenerate variants thereof, wherein T is replaced by U, (15) nucleic acids complementary to (13) and (14), (16) the nucleic acid fragments described herein. in (13), (14) and (15), which contain at least 15 bp and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 46, (17) SEQ ID NO: 50, as depicted in Figure 17, or a degenerate variant thereof, (18) SEQ ID NO: 50 or a degenerate variant thereof, wherein T is replaced by U, (19) nucleic acids complementary to (i) and (j), (20) the nucleic acid fragments described in (i), (j) and (k), which contain at least 15 bp and which hybridize to stringent conditions with genomic DNA encoding a polypeptide of SEQ ID NO: 49, (21) SEQ ID NO: 68, as depicted in Figure 23, or a degenerate variant thereof, (22) SEQ ID NO: 68, or a degenerate variant thereof. wherein T is replaced by U, (23) nucleic acids complementary to (21) and (22), (24) the nucleic acid fragments described in (21), (22) and (23), which contain at least 15 pairs of bands and which hybridize under stringent conditions to the genomic DNA encoding the polypeptide of SEQ ID NO: 67, determining an antibacterial agent, comprising: test substances with a polypeptide or a homologue thereof encoded by a nucleic acid sequence located in an operon containing the B-yneS gene; and 39. The method recognizes (a) contacting a (b) detecting binding of a test substance to a polypeptide, wherein the binding detects that the test substance is an antibacterial agent. 40. The method of claim 39, further comprising: (c) determining whether the test substance that binds to the polypeptide inhibits bacterial growth relative to the growth of bacteria grown in the absence of the test substance that binds to the polypeptide, wherein inhibiting growth indicates that the test substance is an antibacterial agent.