CZ20002136A3 - Essential bacterial genes and use thereof - Google Patents
Essential bacterial genes and use thereof Download PDFInfo
- Publication number
- CZ20002136A3 CZ20002136A3 CZ20002136A CZ20002136A CZ20002136A3 CZ 20002136 A3 CZ20002136 A3 CZ 20002136A3 CZ 20002136 A CZ20002136 A CZ 20002136A CZ 20002136 A CZ20002136 A CZ 20002136A CZ 20002136 A3 CZ20002136 A3 CZ 20002136A3
- Authority
- CZ
- Czechia
- Prior art keywords
- test compound
- polypeptide
- yphc
- essential
- nucleic acid
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Řešení se týká dvou genů, označených "yphC" a "ygjK", objevených ve Streptococcus pneumoniae, které jsou esenciální pro přežívání mnoha bakterií. Tyto geny a esenciální polypeptidy, které kódují, stejně jako jejich homology a ortology, mohou být použity pro identifikaci antibakteriálních činidel vhodných pro léčbu širokého spektra bakteriálních infekcíThe present invention relates to two genes designated "yphC" and "ygjK" discovered in Streptococcus pneumoniae, which are essential for the survival of many bacteria. These genes and essential polypeptides that encode, as well as their homologs and orthologs, can be used to identify antibacterial agents useful for treating a wide variety of bacterial infections.
Description
Esenciální bakteriální geny a jejich použitíEssential bacterial genes and their use
Oblast technikyTechnical field
Předkládaný vynález se týká esenciálních bakteriálních genů a jejich použití v identifikaci antibakteriálních činidel.The present invention relates to essential bacterial genes and their use in identifying antibacterial agents.
Dosavadní stav technikyBACKGROUND OF THE INVENTION
Bakteriální infekce mohou být kožní, podkožní nebo systémové. Oportunní bakteriální infekce se rozvíjejí zejména u pacientů postižených AIDS nebo jiným onemocněním, které postihuje imunitní systém. Většina bakterií, které jsou patogenní pro člověka, jsou Gram-pozitivní bakterie. Bakterie Streptococcus pneumoniae, například obvykle infikuje respirační trakt a může způsobit· lobární pneumonií, stejně jako meningitidu, sinusitidu a jiné infekční nemoci.Bacterial infections can be skin, subcutaneous or systemic. Opportunistic bacterial infections develop especially in patients affected by AIDS or other diseases that affect the immune system. Most bacteria that are pathogenic to humans are Gram-positive bacteria. For example, Streptococcus pneumoniae usually infects the respiratory tract and can cause lobar pneumonia as well as meningitis, sinusitis and other infectious diseases.
Podstata vynálezuSUMMARY OF THE INVENTION
Předkládaný vynález je založen na objevu dvou genů v grampozitivní bakterii Streptococcus pneumoniae, které jsou nezbytné pro přežívání této a jiných bakterií. Tyto geny, yphC a ygjK, jsou pro usnadnění popisu společně označovány v předkládaném vynálezu jako esenciální geny a polypeptidy kódované těmito geny jsou označovány jako esenciální polypeptidy, protože buňky Streptococcus pneumoniae bez funkčních yphC nebo ygjK genů nejsou schopné přežívání.The present invention is based on the discovery of two genes in the Gram positive bacterium Streptococcus pneumoniae, which are essential for the survival of this and other bacteria. These genes, yphC and ygjK, are referred to collectively in the present invention as essential genes and polypeptides encoded by these genes are referred to as essential polypeptides because Streptococcus pneumoniae cells without functional yphC or ygjK genes are incapable of survival.
YphC a ygjK geny jsou užitečnými molekulárními nástroji pro identifikaci podobných gennů v patogenních mikroorganismech.The YphC and ygjK genes are useful molecular tools for identifying similar genes in pathogenic microorganisms.
Esenciální polypeptidy kódované těmito geny jsou použitelnými cíly pro identifikaci sloučenin, které jsou inhibitoryThe essential polypeptides encoded by these genes are useful targets for identifying compounds that are inhibitors
• · · · · · · · • · · · ···« • · ··· ···· • · ·· · · · ·· patogenů, ve kterých jsou esenciální polypeptidy exprimovány.Pathogens in which essential polypeptides are expressed.
> Takové sloučeniny snižují bakteriální růst inhibici aktivity esenciálního proteinu nebo inhibici transkripce esenciálního * genu nebo translace mRNA transkribované z esenciálního genu.Such compounds reduce bacterial growth by inhibiting the activity of an essential protein or inhibiting transcription of an essential gene or translation of mRNA transcribed from an essential gene.
Vynález se proto týká izolovaného yphC polypeptidů majícího aminokyselinovou sekvenci uvedenou v SEQ ID NO: 2, jak je . uvedena na obr. 1, nebo její konzervativní variace. Izolovaná nukleová kyselina kódující yphC je také obsažena v r předkládaném vynálezu. Dále vynález zahrnuje (a) izolovanou nukleovou kyselinu mající sekvenci SEQ ID NO: 1, jak je uvedena na obr. 1, nebo její degenerované varianty; (b) izolovanou nukleovou kyselinu mající sekvenci SEQ ID NO: 1, jak je uvedena na obr. 1, nebo její degenerované varianty, kde T je nahrazen U; (c) nukleové kyseliny komplementární k (a) a (b); a (d) fragmenty (a), (b) a (c), které mají délku alespoň 15 párů baží a které hybridizují za přísných podmínek, jak jsou popsány dále, na genomovou DNA kódující polypeptid SEQ ID NO: 2. YphC polypeptid uvedený na obr. 1 je částečnou sekvencí kompletního polypeptidů, který je uveden na obr. 2A-2B.The invention therefore relates to an isolated yphC polypeptide having the amino acid sequence shown in SEQ ID NO: 2 as is. shown in FIG. 1, or a conservative variation thereof. An isolated nucleic acid encoding yphC is also included in the present invention. Further, the invention includes (a) an isolated nucleic acid having the sequence of SEQ ID NO: 1 as shown in Figure 1, or degenerate variants thereof; (b) an isolated nucleic acid having the sequence of SEQ ID NO: 1 as shown in Figure 1, or degenerate variants thereof, wherein T is replaced by U; (c) nucleic acids complementary to (a) and (b); and (d) fragments (a), (b) and (c) having at least 15 base pairs in length and which hybridize under stringent conditions, as described below, to the genomic DNA encoding the polypeptide of SEQ ID NO: 2. FIG. 1 is a partial sequence of the full length polypeptide shown in FIGS. 2A-2B.
Vynález také obsahuje izolovaný yphC polypeptid mající aminokyselinovou sekvenci uvedenou v SEQ ID NO: 5, jak jeThe invention also includes an isolated yphC polypeptide having the amino acid sequence set forth in SEQ ID NO: 5 as is
- uvedena na obr. 2A-2B, nebo její konzervativní variace.2A-2B, or a conservative variation thereof.
Izolovaná nukleová kyselina kódující kompletní yphC je také obsažena v předkládaném vynálezu. Dále vynález zahrnuje (a) izolovanou nukleovou kyselinu mající sekvenci SEQ ID NO: 4, jak je uvedena na obr. 2A-2B, nebo její degenerované varianty; (b) izolovanou nukleovou kyselinu mající sekvenci SEQ ID NO:An isolated nucleic acid encoding complete yphC is also included in the present invention. Further, the invention includes (a) an isolated nucleic acid having the sequence of SEQ ID NO: 4 as shown in Figures 2A-2B, or degenerate variants thereof; (b) an isolated nucleic acid having the sequence of SEQ ID NO:
4, nebo její degenerované varianty, kde T je nahrazen U; a (c) nukleové kyseliny komplementární k (a) a (b) .4, or degenerate variants thereof, wherein T is replaced by U; and (c) nucleic acids complementary to (a) and (b).
Stejně jak bylo popsáno výše pro yphC, vynález obsahuje také izolovanou nukleovou kyselinu kódující ygjK. Dále, As described above for yphC, the invention also includes an isolated nucleic acid encoding ygjK. Further,
vynález zahrnuje (a) izolovanou nukleovou kyselinu mající sekvenci SEQ ID NO: 7, jak je uvedena na obr. 3, nebo její degenerované varianty; (b) izolovanou nukleovou kyselinu mající sekvenci SEQ ID NO: 7, jak je uvedena na obr. 1, nebo její degenerované varianty, kde T je nahrazen U; (c) nukleové kyseliny komplementární k (a) a (b) ; a (d) fragmenty (a) , (b) a (c), které mají délku alespoň 15 párů baží a které hybridizují za přísných podmínek, jak jsou popsány dále, na genomovou DNA kódující polypeptid SEQ ID NO: 8. Tyto sekvence jsou shrnuty v tabulce 1.the invention includes (a) an isolated nucleic acid having the sequence of SEQ ID NO: 7 as shown in Figure 3, or degenerate variants thereof; (b) an isolated nucleic acid having the sequence of SEQ ID NO: 7 as shown in Figure 1, or degenerate variants thereof, wherein T is replaced by U; (c) nucleic acids complementary to (a) and (b); and (d) fragments (a), (b) and (c) having at least 15 base pairs in length and which hybridize under stringent conditions, as described below, to genomic DNA encoding the polypeptide of SEQ ID NO: 8. summarized in Table 1.
Tabulka 1: Esenciální nukleové kyseliny a polypeptidyTable 1: Essential nucleic acids and polypeptides
Identifikace těchto esenciálních genů umožní vyhledávání homologů těchto genů v jiných kmenech v rámci druhu a umožní vyhledávání ortologů těchto esenciálních genů také v jiných organismech (například Bacillus sp., H. influenzae, H. pylori a E. coli). Zatímco homology jsou strukturálně podobné geny obsažené v rodu Streptococcus, ortology jsou funkčně ekvivalentní geny z jiných kmenů a mohou být zjištěny, například, standardním komplementačním testem. Proto mohou býtThe identification of these essential genes will allow for the search for homologues of these genes in other strains within the species, and will allow for the search for orthologs of these essential genes also in other organisms (e.g. Bacillus sp., H. influenzae, H. pylori and E. coli). While homologues are structurally similar genes contained in the genus Streptococcus, orthologs are functionally equivalent genes from other strains and can be detected, for example, by a standard complementation assay. Therefore, they can be
99
9 9 9 ······· · · * · ·· ·· · · · ·· ·· esenciální polypeptidy použity nejen jako model pro identifikaci podobných genů v jiných kmenech Streptococcus, ale také pro identifikaci homologů a ortologů esenciálních genů v jiných kmenech (například v jiných gram-pozitivních bakteriích, zejména v těch bakteriích, které jsou patogenní pro člověka, a v jiných bakteriích obecně). Takové ortology mohou být identifikovány, například, běžným komplementačním testem. Kromě toho, nebo alternativně, lze předpokládat existenci takových ortologů u bakterií ze stejné větve fylogenetického stromu, jak jsou uvedeny, například, v ftp*7/ftp.cme.msu.edu/pub/RDP/SSU_rRNA/SSU/Prok.phylo.. Například, B. subtilis patří do B. subtilis podskupiny B. subtilis skupiny v Bacillus-Lactobaccillus-Streptococcus podskupiny Gram-pozitivního kmene. Podobně, S. pneumoniae patří do S. pneumoniae podskupiny Streptokoků, které patří také do Bacillus-Lactobaccillus-Streptococcus podskupiny Grampozitivního kmene. E. coli náleží do Escherichia-Salmonella skupiny enterálních bakterií a je příbuzná s Gamma-podskupinou purpurových bakterií. Lze předpokládat, že také jiné bakterie ze stejného kmene (zejména bakterie ze stejné větve, skupiny nebo podskupiny) obsahují ortology yphC a/nebo ygjK genů, které jsou zde popsány.9 9 9 Essential polypeptides used not only as a model for identifying similar genes in other Streptococcus strains, but also for identifying homologues and orthologs of essential genes in other strains (for example, in other gram-positive bacteria, especially those that are pathogenic to humans, and in other bacteria in general). Such orthologs may be identified, for example, by a conventional complementation assay. In addition, or alternatively, such orthologs may be expected to exist in bacteria from the same branch of the phylogenetic tree as listed, for example, in ftp * 7 / ftp.cme.msu.edu / pub / RDP / SSU_rRNA / SSU / Prok.phylo. For example, B. subtilis belongs to the B. subtilis subgroup of the B. subtilis group in the Bacillus-Lactobaccillus-Streptococcus subgroup of the Gram-positive strain. Similarly, S. pneumoniae belongs to the S. pneumoniae subgroup of Streptococci, which also belongs to the Bacillus-Lactobaccillus-Streptococcus subgroup of the Gram positive strain. E. coli belongs to the Escherichia-Salmonella family of enteral bacteria and is related to the Gamma-subgroup of purple bacteria. It is also contemplated that other bacteria from the same strain (especially bacteria from the same branch, group, or subgroup) contain the orthologs of the yphC and / or ygjK genes described herein.
Příklady ortologů yphC a ygjK genů Streptococcus jsou uvedeny v tabulce 2. Jak je uvedeno v tabulce 2, yphC gen Streptococcus má ortolog v B. subtilis, který je označen ByphC, a ortolog v E. coli, který je označen yfgK a který bývá také označován jako f503. Streptokokový gen ygjK má také ortolog v B. subtilis, který je označen Β-ygjK, a ortolog v E. coli, který je označen elaC a který bývá také označován jako o311. Jak je uvedeno dále, ortology esenciálních genů mohou být esenciálními nebo neesenciálními geny v organismech, ve kterých se vyskytují.Examples of Streptococcus yphC and ygjK orthologs are shown in Table 2. As shown in Table 2, the Streptococcus yphC gene has an ortholog in B. subtilis, designated ByphC, and an ortholog in E. coli, designated yfgK and also referred to as f503. The ygjκ streptococcal gene also has an ortholog in B. subtilis, which is designated Β-γgjκ, and an ortholog in E. coli, which is designated elaC, which is also referred to as o311. As discussed below, the essential gene orthologs may be essential or non-essential genes in the organisms in which they occur.
9 · · · · • 9 · 99 99 9 99 99
Jak bylo určeno v pokusech popsaných dále, B-yphC, yfgK a B-ygjK ortology jsou esenciální pro přežívání bakterií, ve kterých se nacházejí. Proto mohou být tyto esenciální ortologní geny a polypeptidy kódované těmito ortologními geny použity pro identifikaci sloučenin, které inhibují růst hostitelského organismu (například sloučenin, které inhibují aktivitu esenciálního proteinu nebo které inhibují transkripci esenciálního genu).As determined in the experiments described below, B-yphC, yfgK and B-ygjK orthologs are essential for the survival of the bacteria in which they are found. Therefore, these essential orthologous genes and the polypeptides encoded by these orthologous genes can be used to identify compounds that inhibit growth of the host organism (for example, compounds that inhibit the activity of an essential protein or that inhibit the transcription of an essential gene).
Tabulka 2: Ortology yphC a ygjKTable 2: Orthology of yphC and ygjK
• 4 · · 4 · • ·4 · 4
Mezi yphC polypeptidy a geny popsané v předkládaném vynálezu patří polypeptidy a geny uvedené na obr. 1 a 2A-2B, stejně jako izoenzymy, varianty a konzervativní variace sekvence uvedené na obr. 1 a 2A-2B. Vynález zahrnuje různé izoenzymy yphC a ygjK. Například, vynález zahrnuje geny, které kódují esenciální polypeptid, I když tento gen obsahuje jednu nebo více bodových mutací, deleci nebo promotorových variant, s podmínkou, že výsledný esenciální polypeptid si zachovává biologické funkce esenciálního polypeptidu.The yphC polypeptides and genes described in the present invention include the polypeptides and genes shown in Figures 1 and 2A-2B, as well as the isoenzymes, variants, and conservative sequence variations shown in Figures 1 and 2A-2B. The invention encompasses various isoenzymes of yphC and ygjK. For example, the invention encompasses genes that encode an essential polypeptide, although the gene comprises one or more point mutations, deletions, or promoter variants, provided that the resulting essential polypeptide retains the biological functions of the essential polypeptide.
YphC polypeptid má strukturální charakteristiky známých GTPas. Za použití BLAST analýzy bylo zjištěno, že yphC polypeptid obsahuje dvě domény, které jsou pravděpodobně GTPasovými doménami, a yphC vykazuje GTPasovou aktivitu in vitro. Tato GTPasová akitvita je vázána na esencialitu yphC polypeptidu. Pokud jsou v každé GTPasové doméně yphC provedeny bodové mutace, tak jsou takové mutanty neschopné vazby na GTP, takže nejsou tyto mutanty dále schopny doplňovat bakteriální kmeny, kterým chybí yphC. YgjK polypeptid má strukturální charakteristiky známých sulfatas. Proto si různé izoenzymy, varianty a konzervativní variace yphC a ygjK sekvencí uvedených na obr. 1 a 2A-2B zachovávají biologické funkce yphC nebo ygjK, jak je stanoveno například v testu na GTPasovou nebo sulfatasovou aktivitu nebo v běžném komplementačním testu. Vhodné testy na GTPasovou a sulfatasovou aktivitu jsou v oboru známé (viz například Bollag et al., Meth. Enzymol.The YphC polypeptide has the structural characteristics of known GTPases. Using BLAST analysis, yphC polypeptide was found to contain two domains that are likely to be GTPase domains, and yphC exhibits GTPase activity in vitro. This GTPase activity is linked to the essentiality of the yphC polypeptide. If point mutations are made in each yphC GTPase domain, such mutants are incapable of binding to GTP, so that these mutants are no longer capable of complementing bacterial strains lacking yphC. The YgjK polypeptide has the structural characteristics of known sulfatases. Therefore, various isoenzymes, variants, and conservative variations of the yphC and ygjK sequences shown in Figures 1 and 2A-2B retain the biological functions of yphC or ygjK, as determined, for example, in a GTPase or sulfatase activity assay or a conventional complementation assay. Suitable assays for GTPase and sulfatase activity are known in the art (see, for example, Bollag et al., Meth. Enzymol.
255: 161 (1995) a Barbeyron et al., Microbiol. 141: 2897 (1995), které jsou zde uvedeny jako odkaz). GTPasová aktivita ♦ · · · · fl • » ·ΛΛ Λ255: 161 (1995) and Barbeyron et al., Microbiol. 141: 2897 (1995), incorporated herein by reference). GTPase activity fl · fl • • •
yphC může být také testována za použití běžného testu uvolňování fosforu malachitovou zelení (viz například Lanzetta et al., 1979, Analytical Biochemistry 100: 95-97). Použití KC1 v takových testech vede k přibližně 70-násobné stimulaci GTPasové aktivity.yphC can also be tested using a conventional malachite green phosphorus release assay (see, for example, Lanzetta et al., 1979, Analytical Biochemistry 100: 95-97). The use of KCl in such assays results in approximately 70-fold stimulation of GTPase activity.
Termín yphC gen také zahrnuje degenerované varianty sekvence nukleové kyseliny uvedené na obr. 1 a 2A-2B (SEQ ID NO: 1 a 4). Degenerované varianty sekvence nukleové kyseliny existují z důvodu degenerace aminokyselinového kódu; proto spadají ty sekvence, které se liší od sekvence uvedené v SEQ ID NO: 1 a 4, ale kódující přesto yphC polypeptid, do rozsahu předkládaného vynálezu.The term yphC gene also includes degenerate variants of the nucleic acid sequence shown in Figures 1 and 2A-2B (SEQ ID NOs: 1 and 4). Degenerate nucleic acid sequence variants exist because of the degeneracy of the amino acid code; therefore, those sequences that differ from the sequences set forth in SEQ ID NOs: 1 and 4 but which encode the yphC polypeptide nevertheless fall within the scope of the present invention.
Podobně, z důvodu podobnosti struktury aminokyselin, mohou být provedeny konzervativní variace (jak jsou zde dále propsané) aminokyselinové sekvence yphC polypeptid, které si uchovávají funkci polypeptidu (jak je stanovena například běžným komplementačním testem). Jiné yphC polypeptidy a geny identifikované v dalších bakteriálních kmenech mohou být takové konzervativní variace nebo degenerované varianty určitého yphC polypeptid a nukleové kyseliny uvedené na obr. 1 a 2A-2B (SEQ ID NO: 1-6). YphC polypeptid a gen mají alespoň 80%, například 90%, identitu sekvence se SEQ ID NO: 2 a 1, v příslušném pořadí, nebo se SEQ ID NO: 5 a 4, v příslušném pořadí. Bez ohledu na procento identity sekvence mezi sekvencí yphC a sekvencí uvedenou v SEQ ID NO: 1, 2, 4 a 5 jsou yphC geny a polypeptidy podle předkládaného vynálezu schopné doplňovat chybění funkce yphC (například u mutantů citlivých na teplotu) ve standardním komplementačním testu.Similarly, because of the similarity of amino acid structure, conservative variations (as described herein below) of the yphC polypeptide amino acid sequences that retain the function of the polypeptide (as determined, for example, by a conventional complementation assay) can be made. Other yphC polypeptides and genes identified in other bacterial strains may be such conservative variations or degenerate variants of a particular yphC polypeptide and nucleic acid set forth in Figures 1 and 2A-2B (SEQ ID NOs: 1-6). The YphC polypeptide and gene have at least 80%, for example, 90%, sequence identity to SEQ ID NOs: 2 and 1, respectively, or to SEQ ID NOs: 5 and 4, respectively. Regardless of the percent sequence identity between the yphC sequence and the sequence set forth in SEQ ID NOs: 1, 2, 4 and 5, the yphC genes and polypeptides of the present invention are capable of complementing the lack of yphC function (e.g., temperature sensitive mutants) in a standard complementation assay.
Další yphC geny, které jsou identifikovány a klonovány z dalších bakteriálních kmenů zejména z patogenních grampozitivních kmenů, mohou být použity pro produkci yphC polypeptidů pro použití v různých metodách popsaných v předkládaném vynálezu, například v metodách pro identifikaci antibakteriálních činidel. Podobně, termín ygjK zahrnuje izoenzymy, varianty a konzervativní variace sekvence uvedené na obr. 3. V různých provedeních je esenciální polypeptid použitý v testech podle předkládaného vynálezu odvozen z nepatogenní nebo patogenní gram-pozitivní bakterie. Například, polypeptid může být odvozen od kmene Streptococcus, jako je Streptococcus pneumoniae, Streptococcus pyogenes,Other yphC genes that are identified and cloned from other bacterial strains, in particular from pathogenic Gram-positive strains, can be used to produce yphC polypeptides for use in various methods described in the present invention, for example in methods for identifying antibacterial agents. Similarly, the term γγκ includes isoenzymes, variants, and conservative variations of the sequence shown in Figure 3. In various embodiments, the essential polypeptide used in the assays of the present invention is derived from a non-pathogenic or pathogenic gram-positive bacterium. For example, the polypeptide may be derived from a Streptococcus strain such as Streptococcus pneumoniae, Streptococcus pyogenes,
Streptococcus agalactiae, Streptococcus endocarditís, Streptococcus faecium, Streptococcus sangus, Streptococcus viridans a Streptococcus hemolyticus. Ortology yphC a ygjK genů mohou být odvozeny od širokého spektra bakterií, jako je E. coli a B. subtilis.Streptococcus agalactiae, Streptococcus endocarditis, Streptococcus faecium, Streptococcus sangus, Streptococcus viridans and Streptococcus hemolyticus. The orthologs of the yphC and ygjK genes can be derived from a wide variety of bacteria such as E. coli and B. subtilis.
Po identifikaci yphC a genů ygjK genů podle předkládaného vynálezu jako genů esenciálních pro přežívání bakterií mohou být tyto esenciální geny a polypeptidy kódované těmito esenciálními geny a jejich esenciální homology a ortology použity pro identifikaci antibakteriálních činidel. Taková antibakteriální činidla mohou být snadno identifikována vysoceúčinnými testy pro detekci inhibice metabolické dráhy, které se účastní esenciální polypeptid. Taková inhibice může být způsobena malými molekulami interagujícími s (například přímou vazbou nebo nepřímo) esenciálním polypeptidem nebo jinými esenciálními polypeptidy v této dráze.After identifying the yphC and ygjK genes of the present invention as essential for bacterial survival, these essential genes and polypeptides encoded by these essential genes and their essential homologs and orthologs can be used to identify antibacterial agents. Such antibacterial agents can be readily identified by high performance assays for detecting inhibition of the metabolic pathway involved in an essential polypeptide. Such inhibition may be due to small molecules interacting with (for example, direct binding or indirectly) an essential polypeptide or other essential polypeptides in this pathway.
Příkladný způsob pro identifikaci antibakteriálních sloučenin obsahuje vyhledávání malých molekul, které specificky interaguji s (například přímou vazbou nebo nepřímo) esenciálním polypeptidem. Různé vhodné interakční a vazebné testy jsou známé v oboru a jsou popsány, například, v U.S.An exemplary method for identifying antibacterial compounds comprises screening for small molecules that specifically interact with (for example, direct binding or indirectly) an essential polypeptide. Various suitable interaction and binding assays are known in the art and are described, for example, in U.S. Pat.
«suun.«Suun.
Φ· φφφφ ·· ·· • · · φ · φ φ φ φ φ φφφ · · · φφφφ Λ ·♦ ·»·φ·φφ·φφ .······· φφφ· ·· ·· ·· φ φφ φφ patentech č. 5585277 a 5679582, které jsou zde uvedené jako odkaz. Například, v různých běžných testech mohou být testované sloučeniny testovány na svou schopnost interakce s esenciálním polypeptidem měřením schopnosti malých molekul stabilizovat esenciální polypeptid v jeho složeném, lépe než nesloženém, stavu. Přesněji, může být měřen stupeň ochrany před skládáním, který je dosažen za použití testované sloučeniny. Testované sloučeniny, které se váží na esenciální polypeptid s vysokou afinitou mohou způsobit, například značný posun teploty, při které je polypeptid denaturován. Testované sloučeniny, které stabilizují esenciální polypeptid ve složeném stavu, mohou být dále testovány na antibakteriální aktivitu ve standardních testech citlivosti.Φ · φφφφ ·· ·· • · · φ φ φ φ φ φ φφφ · · · · φφφφ Λ ♦ · »· φ · · φφ φφ. ······· φφφ · ·· ·· ·· φ U.S. Patent Nos. 5,585,577 and 5,679,582, which are incorporated herein by reference. For example, in various conventional assays, test compounds can be tested for their ability to interact with an essential polypeptide by measuring the ability of small molecules to stabilize the essential polypeptide in its folded, better than unfolded, state. More specifically, the degree of folding protection achieved using the test compound can be measured. Test compounds that bind to an essential polypeptide with high affinity can cause, for example, a significant shift in the temperature at which the polypeptide is denatured. Test compounds that stabilize an essential polypeptide in a folded state can be further tested for antibacterial activity in standard susceptibility tests.
Jiná příkladná metoda pro identifikaci antibakteriálních činidel obsahuje měření schopnosti testované sloučeniny vázat se na jeden .z esenciálních polypeptidů podle předkládaného vynálezu. Vazba může být testována v běžném kapilárním elektroforetickém testu, ve kterém mění vazba testované sloučeniny na esenciální polypeptid elektroforetickou mobilitu esenciálního polypeptidů.Another exemplary method for identifying antibacterial agents comprises measuring the ability of a test compound to bind to one of the essential polypeptides of the present invention. Binding can be tested in a conventional capillary electrophoretic assay in which binding of a test compound to an essential polypeptide converts the electrophoretic mobility of the essential polypeptide.
Jiná vhodná metoda pro identifikaci esenciálních polypeptidů vyžaduje identifikaci biochemické aktivity esenciálního polypeptidů a potom vyhledávání malých molekul, které inhibují tuto aktivitu, například za použití vysoceúčinného způsobu. YphC polypeptid má strukturální charakteristiky známých GTPas a vykazuje GTPasovou aktivitu in vitro. Proto mohou být inhibitory tohoto polypeptidů identifikovány podle své schopnosti inhibovat GTPasovou aktivitu yphC v běžném testu na GTPasovou aktivitu. Vhodné testy byly popsány dříve (například Gollag et al., Meth.Another suitable method for identifying essential polypeptides requires identifying the biochemical activity of the essential polypeptide and then screening for small molecules that inhibit this activity, for example using a highly efficient method. The YphC polypeptide has the structural characteristics of known GTPases and exhibits GTPase activity in vitro. Therefore, inhibitors of this polypeptide can be identified by their ability to inhibit the GTPase activity of yphC in a conventional GTPase activity assay. Suitable assays have been described previously (e.g., Gollag et al., Meth.
φφφφ φ φ · φ φ φφφ φ φ φ φ φφφφ φφφφ φ φ φφ φφ φφ ·» φφ φ φφφφ * φφφ» • φ φ φ φ φ • φφφφ • φφ «φφ φ φ · · φ φ φ φ φ φ φ φ φ φ φ φ φ · · · · φ φ φ φ φ φ φ φ φ φ φ φ
Enzymol. 255: 161-170, 1995, zde uvedeno jako odkaz). Podrobný příklad vhodného testu je uveden dále.Enzymol. 255: 161-170, 1995, incorporated herein by reference). A detailed example of a suitable test is given below.
YgjK polypeptid má strukturální charakteristiky sulfatas a předpokládá se, že působí jako sulfatasa. V souladu s tím mohou být inhibitory ygjK polypeptidu identifikovány testováním schopnosti testované sloučeniny inhibovat sulfatasovou aktivitu ygjK. Příklad vhodného testu je uveden v Barbeyron et al., Microbiol. 141: 2897-2904, 1995, zde uvedeno jako odkaz.The YgjK polypeptide has the structural characteristics of sulfatase and is believed to act as a sulfatase. Accordingly, inhibitors of the ygjK polypeptide can be identified by assaying the ability of a test compound to inhibit the sulfatase activity of ygjK. An example of a suitable assay is given in Barbeyron et al., Microbiol. 141: 2897-2904, 1995, incorporated herein by reference.
Vynález také obsahuje způsob pro identifikaci antibakteriálních činidel, který vyžaduje: (a) kontaktování esenciálního polypeptidu nebo jeho homologu nebo ortologu, s testovanou sloučeninou; (b) detekování vazby testované sloučeniny na polypeptid nebo jeho homolog nebo ortolog; a volitelně (c) stanovení toho, zda testovaná sloučenina, která se váže na polypeptid nebo homolog nebo ortolog, inhibuje růst bakterií, ve srovnání s růstem bakterií kultivovaných za nepřítomnosti testované sloučeniny, která se váže na polypeptid nebo homolog nebo ortolog, kde tato inhibice ukazuje na to, že testovaná sloučenina je antibakteriální činidlo.The invention also includes a method for identifying antibacterial agents which requires: (a) contacting an essential polypeptide, or a homologue or ortholog thereof, with a test compound; (b) detecting binding of the test compound to the polypeptide or a homolog or ortholog thereof; and optionally (c) determining whether the test compound that binds to the polypeptide or homolog or ortholog inhibits bacterial growth compared to the growth of bacteria grown in the absence of the test compound that binds to the polypeptide or homolog or ortholog, wherein the inhibition indicates that the test compound is an antibacterial agent.
V jiném vhodném testu je promotor, který reaguje na depleci esenciálního polypeptidu zvýšenou nebo sníženou expresí, navázán na reporterový gen. Pro identifikaci promotoru, který zvyšuje nebo snižuje svou expresi v reakci na depleci esenciálního proteinu je gen kódující esenciální protein deletován z genomu' a je nahrazen verzí genu, ve které je sekvence kódující esenciální protein operativně navázána na regulovatelný promotor. Buňky obsahující tento regulovatelný genetický konstrukt jsou udržovány při životě esenciálním «eeaWEHSSSW φφφφ φφ φφφφ • · · φφφ ·· φφ β 9 9 « φ · φ « φφφIn another suitable assay, a promoter that responds to depletion of an essential polypeptide by increased or decreased expression is linked to a reporter gene. To identify a promoter that increases or decreases its expression in response to an essential protein depletion, the gene encoding the essential protein is deleted from the genome and is replaced by a version of the gene in which the sequence encoding the essential protein is operably linked to a controllable promoter. Cells containing this controllable genetic construct are kept alive with the essential "eeaWEHSSSW" eaφφφ ·φ φφφφ ·· · · 9 9φ
ΦΦ 0ΦΦ 0
Φ Φ ΦΦ Φ Φ
ΦΦΦΦ
Φ Φ Φ Φ φ Φ ·· polypeptidem produkovaným z genetického konstruktu obsahujícího regulovatelný promotor. Nicméně, regulovatelný promotor umožňuje redukci exprese esenciálního polypeptidu na úroveň, která způsobuje inhibici růstu. Celková RNA připravená z bakterií za takových podmínek omezujících růst je srovnávána s RNA z přirozených buněk. Standardní metody transkripčního profilování mohou být použity pro identifikaci typů mRNA, které jsou více nebo méně hojné (t.j. více nebo méně transkribovány) při expresi za podmínek omezujících růst. Informace týkající se genomové sekvence, například od GenBank, může být použita pro identifikaci promotoru, který řídí expresi identifikovaných typů RNA. Takové promotory jsou regulovány směrem nahoru nebo dolů deplecí esenciálního polypeptidu.A polypeptide produced from a genetic construct containing a controllable promoter. However, the controllable promoter allows the expression of an essential polypeptide to be reduced to a level that causes growth inhibition. Total RNA prepared from bacteria under such growth-limiting conditions is compared to native cell RNA. Standard transcriptional profiling methods can be used to identify types of mRNA that are more or less abundant (i.e., more or less transcribed) when expressed under growth-limiting conditions. Genomic sequence information, for example from GenBank, can be used to identify a promoter that directs the expression of identified types of RNA. Such promoters are regulated up or down by depletion of an essential polypeptide.
Po identifikaci promotoru, který je regulován směrem nahoru nebo dolů deplecí esenciálního polypeptidu, je takový promotor operativně navázán na reporterový gen (například na βgalaktosidasu, gus, nebo na zelený fluorescentní protein (GFP)). Bakteriální kmen obsahující tento reporterový genový konstrukt je potom vystaven působení testované sloučeniny. Sloučeniny, které inhibují esenciální polypeptid (nebo jiný polypeptid v esenciální dráze, které se účastní esenciální polypeptid) způsobuje funkční depleci esenciálního polypeptidu a proto vede ke zvýšení nebo ke snížení exprese reporterového genu. Sloučeniny, které inhibují esenciální polypeptidy v takových testech, by měly působit antibakteriálně a mohou být dále testovány, pokud je to žádoucí, ve vhodných testech citlivosti.Upon identification of a promoter that is up-regulated by depletion of an essential polypeptide, such a promoter is operably linked to a reporter gene (e.g., βgalactosidase, gus, or green fluorescent protein (GFP)). The bacterial strain containing this reporter gene construct is then exposed to the test compound. Compounds that inhibit an essential polypeptide (or other polypeptide in the essential pathway that participates in the essential polypeptide) cause functional depletion of the essential polypeptide and therefore result in an increase or decrease in the expression of the reporter gene. Compounds that inhibit essential polypeptides in such assays should be antibacterial and can be further tested, if desired, in appropriate susceptibility tests.
V podobné metodě pro identifikaci antibakteriálních sloučenin jsou esenciální polypeptidy použity pro izolaci peptidových nebo nukleokyselinových ligandů, které se • · • · • · · ·In a similar method for identifying antibacterial compounds, essential polypeptides are used to isolate peptide or nucleic acid ligands, which are
Λ Λ Λ ΛΛ Λ Λ Λ
specificky váží na esenciální polypeptidy. Tyto peptidové nebo nukleokyselinové ligandy jsou potom použity při vyhledávání vytěsňováním, které vede k identifikaci malých molekul, které interagují s esenciálním polypeptidem. Takové testy mohou být provedeny způsobem popsaným výše.specifically binds to essential polypeptides. These peptide or nucleic acid ligands are then used in the displacement screen, which leads to the identification of small molecules that interact with the essential polypeptide. Such assays can be performed as described above.
V ještě jiné metodě může být interakce testované sloučeniny s esenciálním polypeptidem (t.j. přímá nebo nepřímá vazba) detekována v běžném dvou-hybridním systému pro detekci interakcí protein/protein (například na kvasinkách nebo na savčích buňkách). Testovaná sloučeniny, o které bylo zjištěno, že interaguje s esenciálním polypeptidem, může být dále testována na antibakteriální aktivitu v běžném testu citlivosti. Obecně, v takovém dvou-hybridním testu je (a) esenciální polypeptid připraven jako fúsní protein, který obsahuje polypeptid fušovaný na (i) transkripci aktivující doménu transkripčního faktoru, nebo (ii) DNA vazebnou doménu transkripčního faktoru; (b) testovaný polypeptid připraven jako fúsní protein, který obsahuje polypeptid fúsovaný na (i) transkripci aktivující doménu transkripčního faktoru, nebo (ii) DNA vazebnou doménu transkripčního faktoru; a (c) je detekována vazba testovaného polypeptidů na polypeptid podle rekonstituce transkripčního faktoru. Homology a ortology esenciálních polypeptidů mohou být použity v podobných metodách. Rekonstituce transkripčního faktoru může být detekována, například, pomocí detekce transkripce genu, který je operativně navázán na DNA sekvenci vázanou DNA vazebnou doménou rekonstituovaného transkripčního faktoru (viz například White, 1996, Proč. Nati. Acad. Sci. 93: 10001-10003 a odkazy zde citované a Vidal et al., 1996, Proč. Nati. Acad. Sci. 93: 10315-10320).In yet another method, the interaction of a test compound with an essential polypeptide (i.e., direct or indirect binding) can be detected in a conventional two-hybrid system for detecting protein / protein interactions (e.g., in yeast or mammalian cells). A test compound that has been found to interact with an essential polypeptide can be further tested for antibacterial activity in a conventional susceptibility assay. Generally, in such a two-hybrid assay, (a) the essential polypeptide is prepared as a fusion protein comprising a polypeptide fused to (i) a transcription activating domain of a transcription factor, or (ii) a DNA binding domain of a transcription factor; (b) a test polypeptide prepared as a fusion protein comprising a polypeptide fused to (i) a transcription activating transcription factor domain, or (ii) a transcription factor binding DNA domain; and (c) binding of the test polypeptide to the polypeptide is detected according to the reconstitution of the transcription factor. Homologues and orthologs of essential polypeptides can be used in similar methods. Reconstitution of a transcription factor can be detected, for example, by detecting the transcription of a gene that is operably linked to a DNA sequence by a DNA-binding domain of the reconstituted transcription factor (see, for example, White, 1996, Proc. Natl. Acad. Sci. 93: 10001-10003 and references). and Vidal et al., 1996, Proc. Natl. Acad. Sci. 93: 10315-10320).
• · • · · ·• • •
V alternativním způsobu je izolovaná molekula nukleové kyseliny kódující esenciální polypeptid použita pro identifikaci sloučeniny, která snižuje expresi esenciálního polypeptidu in vivo. Takové sloučeniny mohou být použity jako antibakteriální činidla. Pro identifikaci takových sloučenin jsou buňky, které exprimují esenciální polypeptid kultivovány, vystaveny působení testované sloučeniny (nebo směsi testovaných sloučenin) a úroveň exprese nebo aktivity je srovnávána s úrovní exprese nebo aktivity esenciálního polypeptidu v buňkách, které jsou identické, ale které nebyly vystaveny působení testované sloučeniny. Mnoho standardních kvantitativních testů genové exprese může být použito v tomto aspektu předkládaného vynálezu.In an alternative method, an isolated nucleic acid molecule encoding an essential polypeptide is used to identify a compound that reduces the expression of the essential polypeptide in vivo. Such compounds can be used as antibacterial agents. To identify such compounds, cells that express an essential polypeptide are cultured, exposed to the test compound (or mixture of test compounds) and the level of expression or activity is compared to the level of expression or activity of the essential polypeptide in cells that are identical but not exposed compounds. Many standard quantitative gene expression assays can be used in this aspect of the present invention.
Pro identifikaci sloučenin, které modulují expresi esenciálního polypeptidu (nebo homologní nebo ortologní sekvence) může být testovaná sloučenina přidána v různých koncentracích do kultivačního media buně-k, které exprimují esenciální polypeptid (nebo homolog nebo ortolog), jak je zde popsán. Mezi takové testované sloučeniny patří malé molekuly (obvykle neproteinové, nepolysacharidové chemické entity), polypeptidy a nukleové kyseliny. Exprese esenciálního polypeptidu je potom měřena, například northernovým přenosem, PCR analýzou nebo analýzou chránění před působením RNAsy, za použití molekuly nukleové kyseliny podle předkládaného vynálezu jako sondy. Hladina exprese v přítomnosti testované molekuly je srovnávána s hladinou exprese za nepřítomnosti testované molekuly a tak je zjištěno, zda testovaná molekula mění expresi esenciálního polypeptidu. Protože jsou yphC a ygjK polypeptidy esenciální pro přežívání buněk, bude testovaná sloučenina, která inhibuje expresi a/nebo funkci esenciálního polypeptidu nebo jeho homologu nebo ortologu • · · · · ·To identify compounds that modulate the expression of an essential polypeptide (or homologous or orthologous sequence), the test compound can be added at various concentrations to the cell culture medium that expresses the essential polypeptide (or homolog or ortholog) as described herein. Such test compounds include small molecules (usually non-proteinaceous, non-polysaccharide chemical entities), polypeptides, and nucleic acids. Expression of the essential polypeptide is then measured, for example, by northern blotting, PCR analysis, or RNAse protection, using the nucleic acid molecule of the present invention as a probe. The level of expression in the presence of the test molecule is compared to the level of expression in the absence of the test molecule, and thus it is determined whether the test molecule alters the expression of the essential polypeptide. Because yphC and ygjK polypeptides are essential for cell survival, a test compound that inhibits expression and / or function of an essential polypeptide or its homolog or ortholog will be tested.
inhibovat růst, nebo bude usmrcovat buňky, které exprimují takové polypeptidy.inhibit growth or kill cells that express such polypeptides.
Polypeptidy kódované esenciálními geny mohou být použity, samostatně nebo společně, v testech pro identifikací sloučenin, které interagují s takovými polypeptidy. Testované sloučeniny interagující s těmito polypeptidy mohou být potom snadno testovány, v běžných testech, na svou schopnost inhibovat bakteriální růst. Testované sloučeniny, které interagují s esenciálními polypeptidy, jsou potenciálními antíbakteriálními činidly, oproti sloučeninám, které neinteraguji s esenciálními polypeptidy. Jak je zde popsáno, jakákoliv z mnoha metod známých v oboru může být použita pro testování interakcí testovaných sloučenin s esenciálními polypeptidy.Polypeptides encoded by essential genes can be used, alone or together, in assays to identify compounds that interact with such polypeptides. Test compounds interacting with these polypeptides can then be readily tested, in conventional assays, for their ability to inhibit bacterial growth. Test compounds that interact with essential polypeptides are potential antibacterial agents, as opposed to compounds that do not interact with essential polypeptides. As described herein, any of a variety of methods known in the art can be used to test interactions of test compounds with essential polypeptides.
Obvykle bude testovanou sloučeninou malá organická molekula. Alternativně může být testovanou sloučeninou testovaný polypeptid (například polypeptid mající náhodnou nebo předem určenou polypeptidovou sekvenci; nebo přirozený nebo syntetický polypeptid) nebo nukleová kyselina, jako je molekula DNA nebo RNA. Testovaná sloučenina může být přirozená sloučenina nebo to může být syntetická sloučenina. Syntetické knihovny, chemické knihovny a podobně, mohou být vyšetřovány pro identifikaci sloučenin, které se váží na esenciální polypeptid. Obecněji, vazba testované sloučeniny na polypeptid, jeho homolog nebo ortolog, může být detekována buď in vitro, nebo in vivo. Pokud je to žádoucí, mohou být výše popsané metody pro identifikaci sloučenin, které modulují expresi polypeptidů podle předkládaného vynálezu, kombinovány s měřením koncentrací esenciálních polypeptidů exprimovaných v buňkách, například provedením analýzy westernovým přenosem za použití protilátek, které se váží na esenciální polypeptid.Usually, the test compound will be a small organic molecule. Alternatively, the test compound may be a test polypeptide (for example, a polypeptide having a random or predetermined polypeptide sequence; or a natural or synthetic polypeptide) or a nucleic acid such as a DNA or RNA molecule. The test compound may be a natural compound or it may be a synthetic compound. Synthetic libraries, chemical libraries, and the like can be screened to identify compounds that bind to an essential polypeptide. More generally, binding of a test compound to a polypeptide, homolog or ortholog thereof can be detected either in vitro or in vivo. If desired, the above-described methods for identifying compounds that modulate the expression of the polypeptides of the present invention can be combined with measuring the concentrations of essential polypeptides expressed in cells, for example, by Western blot analysis using antibodies that bind to the essential polypeptide.
esBBasBawBsassssjffssesBBasBawBsassssjffss
Bez ohledu na zdroj testované sloučeniny mohou být esenciální polypeptidy podle předkládaného vynálezu použity pro identifikaci sloučenin, které inhibují aktivitu esenciálního proteinu nebo transkripci esenciálního genu nebo translaci mRNA transkribované z esenciálního genu. Tato antibakteriální činidla mohou být použita pro inhibici širokého spektra patogenních nebo nepatogenních bakteriálních kmenů.Regardless of the source of the test compound, the essential polypeptides of the present invention can be used to identify compounds that inhibit the activity of an essential protein or the transcription of an essential gene or translation of mRNA transcribed from the essential gene. These antibacterial agents can be used to inhibit a wide variety of pathogenic or non-pathogenic bacterial strains.
V jiných provedeních vynález obsahuje farmaceutické prostředky, které obsahují farmaceuticky přijatelné přísady a antibakteriální činidlo identifikované za použití metod podle předkládaného vynálezu. Konkrétně, vynález obsahuje farmaceutické prostředky, které obsahují antibakteriální činidla, která inhibují růst nebo usmrcují patogenní bakteriální kmeny (například patogenní gram-pozitivní bakteriální kmeny jako jsou patogenní kmeny Streptococcus). Takové farmaceutické prostředky mohou být použity ve způsobech léčby bakteriálních infekcí v organismu (například streptokokových infekcí). Taková metoda obsahuje podání terapeuticky účinného množství farmaceutického prostředku do organismu, například množství dostatečné pro zmírnění příznaků a/nebo známek bakteriální infekce. Konkrétně, takové farmaceutické prostředky mohou být použity pro léčbu bakteriálních infekcí u savců jako jsou lidé a domácí zvířata (například krávy, prasata, psi a kočky) a u rostlin. Účinnost takových antibakteriálních činidel u člověka může být hodnocena na zvířecích modelech dobře známých odborníkům v oboru (například na myších nebo králičích modelech, například, streptokokové pneumonie).In other embodiments, the invention comprises pharmaceutical compositions comprising pharmaceutically acceptable excipients and an antibacterial agent identified using the methods of the present invention. In particular, the invention includes pharmaceutical compositions comprising antibacterial agents that inhibit growth or kill pathogenic bacterial strains (e.g., pathogenic gram-positive bacterial strains such as pathogenic Streptococcus strains). Such pharmaceutical compositions can be used in methods of treating bacterial infections in an organism (e.g., streptococcal infections). Such a method comprises administering to the body a therapeutically effective amount of a pharmaceutical composition, for example an amount sufficient to alleviate the symptoms and / or signs of a bacterial infection. In particular, such pharmaceutical compositions can be used to treat bacterial infections in mammals such as humans and pets (e.g., cows, pigs, dogs and cats) and plants. The efficacy of such antibacterial agents in humans can be evaluated in animal models well known to those skilled in the art (e.g., mouse or rabbit models, e.g., streptococcal pneumonia).
sssgaSBSSasswsssgaSBSSassw
ΦΦ φφφφ φφ φφφφ φφ ·· ·· φ φ · · φφφφ φφφ φφφ φφφ· • · φ · · ·· · * · · · φφφφ ··· φ··· φφ φφ φφ φ φφ φφΦΦ φ φ · · φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ · φ φ • · ·
Různá afinitní činidla, která procházejí mikrobiální membránou (t.j. protilátky a fragmenty protilátek) jsou použitelná v provádění způsobů podle předkládaného vynálezu. Například polyklonální a monoklonální protilátky, které se specificky váží na yphC polypeptid nebo ygjK polypeptid, mohou usnadnit detekci esenciálních polypeptidů v různých bakteriálních kmenech (nebo v jejich extraktech). Tyto protilátky jsou také užitečné pro detekci vazby testované sloučeniny na esenciální polypeptidy (například v testech zde popsaných). Kromě toho, monoklonální protilátky, které se váží na esenciální polypeptidy, mohou být sami o sobě použity jako antibakteriální činidla.Various affinity agents that cross the microbial membrane (i.e., antibodies and antibody fragments) are useful in practicing the methods of the present invention. For example, polyclonal and monoclonal antibodies that specifically bind to a yphC polypeptide or a ygjK polypeptide may facilitate the detection of essential polypeptides in various bacterial strains (or extracts thereof). These antibodies are also useful for detecting binding of a test compound to essential polypeptides (for example, in the assays described herein). In addition, monoclonal antibodies that bind to essential polypeptides can themselves be used as antibacterial agents.
Vynález dále obsahuje způsoby pro identifikaci kmenů nesoucích podmíněně letální mutace z velké skupiny mutantů· Obecně, postupně se identifikují gen a příslušný produkt genu, ačkoliv ve skríningových nebo diagnostických testech mohou být použity kmeny samotné. Mechanismus účinku identifikovaných genů a genových produktů je základem pro vývoj nových antibakteriálních činidel. Tato antibakteriální činidla redukují účinky genového produktu v přirozeném kmenu a proto jsou použitelná pro léčbu jedinců infikovaných tímto typem nebo podobně citlivým typem tak, že uvedenému jedinci se podá farmaceuticky účinné množství sloučeniny. Redukce účinku produktu genu zahrnuje kompetitivní inhibici genového produktu na aktivním místu enzymu nebo receptoru; nekompetitivní inhibici; narušení intracelulární kaskády, které se účastní genový produkt; vazbu na genový produkt samotný, před nebo po jeho post-translačním zpracováním; a účinkem jako mimetikum genového produktu, což snižuje jeho aktivitu. Mezi terapeutická činidla patří monoklonální protilátky namířené proti produktu genu.The invention further encompasses methods for identifying strains carrying conditionally lethal mutations from a large group of mutants. In general, the gene and the respective gene product are sequentially identified, although strains alone may be used in screening or diagnostic assays. The mechanism of action of the identified genes and gene products is the basis for the development of new antibacterial agents. These antibacterial agents reduce the effects of the gene product in the native strain and are therefore useful for treating individuals infected with this type or similarly sensitive type by administering to said individual a pharmaceutically effective amount of the compound. Reducing the effect of a gene product involves competitively inhibiting a gene product at an active site of an enzyme or receptor; non-competitive inhibition; disrupting the intracellular cascade involved in the gene product; binding to the gene product itself, before or after its post-translational processing; and acting as a mimetic of the gene product, reducing its activity. Therapeutic agents include monoclonal antibodies directed against the gene product.
• · ♦«* · • · · · ·· ··• ♦ ♦ · * * * *
Dále může být stanovena přítomnost genové sekvence v některých buňkách (například v patogenních bakteriích stejného rodu nebo podobných druhů) a absence nebo divergence sekvence v hostitelských buňkách, pokud je to žádoucí. Terapeutická činidla namířená proti genům nebo produktům genu, které nejsou přítomny u hostitele, mají několik výhod, včetně nízkého výskytu nežádoucích účinků a nízké celkové nutné dávky.Further, the presence of the gene sequence in some cells (e.g., pathogenic bacteria of the same genus or similar species) and the absence or divergence of the sequence in the host cells can be determined, if desired. Therapeutic agents directed against genes or gene products that are not present in the host have several advantages, including a low incidence of adverse events and a low total necessary dose.
Nukleové kyseliny zahrnují RNA a DNA, včetně genomové DNA a syntetické (například chemicky syntetizované) DNA. Nukleové kyseliny mohou být dvouřetězcové nebo jednořetězcové. Pokud jsou jednořetězcové, tak se může jednat o kódující řetězec nebo o protismyslný řetězec. Nukleové kyseliny mohou být syntetizovány za použití oligonukleotidových analogů nebo derivátů (například inosinových nebo fosforothioatových nukleotidů). Takové oligonukleotidy mohou být použity, například, pro přípravu nukleových kyselin, které mají pozměněnou schopnost párování baží nebo zvýšenou resistenci na nukleasy.Nucleic acids include RNA and DNA, including genomic DNA and synthetic (e.g., chemically synthesized) DNA. The nucleic acids may be double-stranded or single-stranded. If they are single-stranded, they may be coding strands or antisense strands. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (for example, inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids having altered base-pairing ability or increased nuclease resistance.
Izolovaná nukleová kyselina je DNA nebo RNA, která nenavazuje bezprostředně na obě kódující sekvence, na které bezprostředně navazuje (na jednu na 5' konci a na druhou na 3' konci) v přirozeném genomu organismu, ze kterého je získána. Tak v jednom provedení obsahuje izolovaná nukleová kyselina některé nebo všechny 5'-nekódující (například promotorové) sekvence, které bezprostředně sousedí s kódující sekvencí. Termín proto zahrnuje, například, rekombinantní DNA, která je inkorporována do vektoru, do autonomně se replikujícího plasmidu nebo viru nebo do genomové DNA prokaryota nebo eukaryota, nebo která existuje jako samostatná molekula (například genomový DNA fragment produkovaný PCR nebo trávením • 9 · ·· · • · · · • · ······· ···· • · · · ·· · · · ·· restrikční endonukleasou) nezávislá na jiných sekvencích. Také tento termín zahrnuje rekombinantní DNA, která je částí hybridního genu kódujícího další polypeptidové sekvence.An isolated nucleic acid is a DNA or RNA that does not bind immediately to both coding sequences to which it directly binds (one at the 5 'end and the other at the 3' end) in the natural genome of the organism from which it is derived. Thus, in one embodiment, the isolated nucleic acid comprises some or all of the 5'-non-coding (e.g., promoter) sequences immediately adjacent to the coding sequence. Therefore, the term includes, for example, recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid or virus, or a prokaryote or eukaryote genomic DNA, or that exists as a separate molecule (e.g., a genomic DNA fragment produced by PCR or digestion). • restriction endonuclease) independent of other sequences. Also, the term includes recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequences.
Termín izolovaná může označovat nukleovou kyselinu nebo polypeptid, který je významně prostý buněčného materiálu, virového materiálu nebo kultivačního media (je-li připraven technikami rekombinantní DNA), nebo chemických prekursorů nebo jiných chemických sloučenin (je-li syntetizovaná chemicky).The term isolated may refer to a nucleic acid or polypeptide that is substantially free of cellular material, viral material or culture medium (if prepared by recombinant DNA techniques), or chemical precursors or other chemical compounds (if synthesized chemically).
D81e, fragment izolované nukleové kyseliny je fragment nukleové kyseliny, který se v přirozeném stavu nevyskytuje jako fragment a který nemůže být v přirozeném stavu detekován.D81e, an isolated nucleic acid fragment is a nucleic acid fragment that does not occur naturally as a fragment and that cannot be detected in the natural state.
Sekvence nukleové kyseliny, která je významně identická s esenciální nukleotidovou sekvencí je alespoň z 80% (například z alespoň 85%) identická s nukleotidovou sekvencí yphC nebo ygjK, jak je uvedena v SEQ ID NO: uvedenými v tabulce 1, které jsou popsány na obr. 1-3. Pro srovnání nukleových kyselin by měla být délka referenční nukleotidové sekvence nejméně 40 nukleotidů, například alespoň 60 nukleotidů nebo více.The nucleic acid sequence that is significantly identical to the essential nucleotide sequence is at least 80% (e.g. at least 85%) identical to the nucleotide sequence of yphC or ygjK as set forth in SEQ ID NO: set forth in Table 1, which are described in FIG. 1-3. For nucleic acid comparison, the length of the reference nucleotide sequence should be at least 40 nucleotides, for example at least 60 nucleotides or more.
Pro stanovení procenta identity dvou aminokyselinových sekvencí nebo dvou nukleových kyselin jsou sekvence přiřazeny pro optimální srovnání (například mohou být do sekvence první aminokyselinové sekvence nebo sekvence nukleové kyseliny vloženy mezery, které umožní optimální přiřazení druhé aminokyselinové nebo nukleotidové sekvence). Potom jsou srovnávány aminokyselinové zbytky nebo nukleotidy v příslušných aminokyselinových pozicích nebo nukleotidových pozicích. Je-li pozice v první sekvenci obsazena stejným aminokyselinovým zbytkem nebo nukleotidem jako v příslušné pozici ve druhé sekvenci, tak jsou molekuly v této pozici identické. Procento identity mezi dvěma sekvencemi je funkcí • ft • ftTo determine the percent identity of two amino acid sequences or two nucleic acids, the sequences are aligned for optimal alignment (for example, gaps may be inserted into the sequence of the first amino acid sequence or nucleic acid sequence to allow optimal alignment of the second amino acid or nucleotide sequence). The amino acid residues or nucleotides at the respective amino acid positions or nucleotide positions are then compared. If the position in the first sequence is occupied by the same amino acid residue or nucleotide as in the corresponding position in the second sequence, the molecules in that position are identical. Percent identity between two sequences is a function of • ft • ft
počtu identických pozic v obou sekvencích (tj. % identity = počet identických pozic/celkový počet překrývajících se pozic x 100). Výhodně mají obě tyto sekvence stejnou délku.the number of identical positions in both sequences (i.e.,% identity = number of identical positions / total number of overlapping positions x 100). Preferably, both sequences are of equal length.
Stanovení procenta identity nebo homologie mezi dvěma sekvencemi může být provedeno za použití matematického algoritmu. Vhodným matematickým algoritmem použitým pro srovnání dvou sekvencí je algoritmus dle Karlina a Altschula (1990) Proč. Nati. Acad. Sci. USA 87: 2264-2268, modifikovaný způsobem podle dle Karlina a Altschula (1993) Proč. Nati.The determination of percent identity or homology between two sequences can be performed using a mathematical algorithm. A suitable mathematical algorithm used to compare two sequences is the algorithm of Karlin and Altschul (1990) Proc. Nati. Acad. Sci. USA 87: 2264-2268, modified according to the method of Karlin and Altschul (1993) Proc. Nati.
Acad. Sci. USA 90: 5873-5877. Takový algoritmus je použit v NBLAST a XBLAST programech navržených Altschulem et al., (1990), J. Mol. Biol. 215: 403-410. BLAST srovnávání nukleotidů může být provedeno za použití NBLAST programu, skoré = 100, délka slova = 12, pro získání nukleotidové sekvence homologické k yphC nebo ygjK molekule nukleové kyseliny podle předkládaného vynálezu. BLAST proteinové srovnávání může být provedeno za použití XBLAST programu, skoré = 50, délka slova = 3, pro získání aminokyselinové sekvence homologické k yphC nebo ygjK proteinovým molekulám podle předkládaného vynálezu. Pro získání sestavení beroucího v úvahu mezery může být použito gapped BLAST, jak je popsán v Alschul et al., (1997), Nucleic Acids Res. 25: 3389-3402.Acad. Sci. USA 90: 5873-5877. Such an algorithm is used in NBLAST and XBLAST programs designed by Altschul et al., (1990), J. Mol. Biol. 215: 403-410. BLAST nucleotide comparison can be performed using the NBLAST program, early = 100, wordlength = 12, to obtain a nucleotide sequence homologous to the yphC or ygjK nucleic acid molecule of the present invention. BLAST protein comparison can be performed using the XBLAST program, early = 50, wordlength = 3, to obtain an amino acid sequence homologous to the yphC or ygjK protein molecules of the present invention. A gapped BLAST as described in Alschul et al., (1997), Nucleic Acids Res. 25: 3389-3402.
Při použití BLAST a gapped BLAST programů mohou být použity chybové parametry příslušných programů (například XBLAST a NBLAST) . Viz http://www.ncbi.nlm.nih.gov. Jiným příkladem matematického algoritmu používaného pro srovnávání sekvencí je algoritmus, který popsali Myers a Miller, CABIOS (1989). Takový algoritmus je použit v ALIGN programu (verze 2.0), který je součástí softwarového balíčku využívajícího GCG seřazování sekvence.When using BLAST and gapped BLAST programs, error parameters of the respective programs (for example, XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another example of a mathematical algorithm used for sequence comparison is the algorithm described by Myers and Miller, CABIOS (1989). Such an algorithm is used in the ALIGN program (version 2.0), which is part of a GCG sequence alignment software package.
Při použití ALIGN programu pro srovnávání aminokyselinových sekvencí může být použito PAM120 tabulky váhy zbytků, pokuty za délku mezery 12 a pokuty za mezeru 4.When using the ALIGN program for amino acid sequence comparison, the PAM120 residue weight table, gap length penalty 12, and gap fines 4 can be used.
•« ···· ·· · · «· • · · · « · • · · · · · « « 9 9 9 9 9 « 0 · 8 8 9• · · 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9
89 99 988 99 9
Procento identity mezi dvěma sekvencemi může být stanoveno za použití technik popsaných výše, s nebo bez povolení mezer. Při výpočtu identity jsou započítány pouze přesně identické pozice.The percent identity between two sequences can be determined using the techniques described above, with or without allowing gaps. When calculating identity, only exactly identical positions are counted.
Esenciální polypeptidy podle předkládaného vynálezu zahrnují, ale nejsou omezeny na, rekombinantní polypeptidy a přirozené polypeptidy. Také jsou v předkládaném vynálezu použitelné sekvence nukleových kyselin, které kódují formy esenciálních polypeptidů, ve kterých jsou přirozené aminokyselinové sekvence alterovány nebo deletovány. Výhodné nukleové kyseliny kódují polypeptidy, které jsou solubilní za normálních fyziologických podmínek. Vynález také zahrnuje nukleové kyseliny kódující fúsní proteiny, ve kterých je část esenciálního polypeptidu fúsována na nepříbuzný polypeptid (například na markerový polypeptid nebo na fúsní partnér) za vzniku fúsního proteinu. Například, polypeptid může být fúsovaný na hexa-histidinovou koncovku pro usnadnění přečištění bakteriálně exprimovaných polypeptidů, nebo na hemaglutininovou koncovku pro usnadnění přečištění polypeptidů exprimovaných v eukaryotických buňkách. Předkládaný vynález také zahrnuje, například, izolované polypeptidy (a nukleové kyseliny kódující takové polypeptidy), které obsahují první část a druhou část; první část obsahuje esenciální polypeptid a druhá část obsahuje konstantní region (Fc) imunoglobulinu nebo detekovatelný markér.Essential polypeptides of the present invention include, but are not limited to, recombinant polypeptides and natural polypeptides. Also useful in the present invention are nucleic acid sequences that encode forms of essential polypeptides in which natural amino acid sequences are altered or deleted. Preferred nucleic acids encode polypeptides that are soluble under normal physiological conditions. The invention also encompasses nucleic acids encoding fusion proteins in which a portion of an essential polypeptide is fused to an unrelated polypeptide (e.g., a marker polypeptide or a fusion partner) to form a fusion protein. For example, the polypeptide may be fused to a hexa-histidine tail to facilitate purification of bacterially expressed polypeptides, or to a hemagglutinin tail to facilitate purification of polypeptides expressed in eukaryotic cells. The present invention also includes, for example, isolated polypeptides (and nucleic acids encoding such polypeptides) that comprise a first portion and a second portion; the first part comprises an essential polypeptide and the second part comprises an immunoglobulin constant region (Fc) or a detectable marker.
Fúsní partner může být, například, polypeptid usnadňující sekreci, například sekreční sekvence. Takový fúsní polypeptid je obvykle označován jako preprotein. Sekreční sekvence může být štěpena hostitelskou buňkou za vzniku zralého proteinu.The fusion partner may be, for example, a secretion facilitating polypeptide, for example, a secretory sequence. Such a fusion polypeptide is usually referred to as a preprotein. The secretion sequence can be cleaved by the host cell to produce the mature protein.
Předkládaný vynález také zahrnuje nukleové kyseliny, kteréThe present invention also encompasses nucleic acids which
SBBWSSSSSSS???'??'SBBWSSSSSSS ??? '??'
9999 99 9999 9« 99 • 9 · · · 9 9 · 9 ·9999 99 9999 9 «99 • 9 · · · 9 · 9 · 9 ·
9 · 9 9 9 99999 · 9 9 9 9999
9 999 99 99 99 99,999 99,999 9
9999 999 99999999 999 9999
99 99 9 99 99 kódují esenciální polypeptid fúsované na polypeptidovou sekvenci, za vzniku inaktivního preproteinu. Preproteiny mohou být přeměněny na aktivní formu proteinu odstraněním inaktivující sekvence.99 99 9 99 99 encode an essential polypeptide fused to the polypeptide sequence to form an inactive preprotein. Preproteins can be converted to the active form of the protein by removing the inactivating sequence.
Předkládaný vynález také zahrnuje nukleové kyseliny, které hybridizují například za přísných podmínek hybridizace (jak jsou zde definovány) na celou nebo na část nukleotidové sekvence uvedené v SEQ ID NO: 1 nebo 7 nebo na jejich komplementární sekvence. Hybridizující část hybridizující nukleové kyseliny je alespoň 15 (například 20, 25, 30 nebo 50) nukleotidů dlouhá. Hybridizující část hybridizující nukleové kyseliny má alespoň 80% (například alespoň 95% nebo 98%) identitu s částečnou nebo celou sekvencí nukleové kyseliny kódující esenciální polypeptid nebo s k této sekvenci komplementární sekvencí. Hybridizující nukleové kyseliny podle předkládaného vynálezu mohou být použity, například, jako klonovací sondy, primery (například PCR primery) nebo diagnostické sondy. Nukleové kyseliny, které hybridizují na nukleotidové sekvence uvedené v SEQ ID NO: 1 a 7 jsou považovány za protismyslné oligonukleotidy.The present invention also encompasses nucleic acids that hybridize, for example, under stringent hybridization conditions (as defined herein) to all or part of the nucleotide sequence set forth in SEQ ID NO: 1 or 7, or to their complementary sequences. The hybridizing portion of the hybridizing nucleic acid is at least 15 (e.g., 20, 25, 30, or 50) nucleotides long. The hybridizing portion of the hybridizing nucleic acid has at least 80% (e.g., at least 95% or 98%) identity to a partial or all of the nucleic acid sequence encoding the essential polypeptide or a complementary sequence to that sequence. The hybridizing nucleic acids of the present invention can be used, for example, as cloning probes, primers (e.g. PCR primers) or diagnostic probes. Nucleic acids that hybridize to the nucleotide sequences set forth in SEQ ID NOs: 1 and 7 are considered antisense oligonucleotides.
Součástí předkládaného vynálezu jsou také různé geneticky upravené buňky, například transformované hostitelské buňky, které obsahují esenciální nukleové kyseliny podle předkládaného vynálezu. Transformovaná buňka je buňka, do které (nebo do jejíhož předka) byla vložena technikami rekombinantní DNA nukleová kyselina kódující esenciální polypeptid. Patří sem jak prokaryotické, tak eukaryotické buňky, například bakterie jako je Streptococcus, Bacillus a podobně.Also provided by the present invention are various genetically engineered cells, such as transformed host cells, that contain the essential nucleic acids of the present invention. A transformed cell is a cell into which (or whose ancestor) a recombinant DNA nucleic acid encoding an essential polypeptide has been inserted by recombinant DNA techniques. These include both prokaryotic and eukaryotic cells, for example bacteria such as Streptococcus, Bacillus and the like.
φ * φφφφφ * φφφφ
ΦΦ φφ φφ φ φφ φ φφφφΦΦ φφ φφ φ φφ φ φφφφ
Φ φ · 9 9 9 9 9 9 9Φ φ · 9 9 9 9 9 9 9
Φ · ΦΦΦ Φφ φφ φφ φΦ · ΦΦΦ Φφ φφ φφ φ
ΦΦΦΦ ΦΦΦ φφφφΦΦΦΦ ΦΦΦ φφφφ
ΦΦ ΦΦ ΦΦ Φ »· ΦΦ· ΦΦ ΦΦ Φ · »ΦΦ
Součástí předkládaného vynálezu jsou také genetické konstrukty (například vektory a plasmidy), které obsahují nukleovou kyselinu podle předkládaného vynálezu, která je operativně navázaná na transkripční a/nebo translační sekvenci umožňující expresi, například ve formě expresního vektoru. Vybraná nukieová kyselina, například DNA molekula kódující esenciální polypeptid, je operativně navázána na transkripční a/nebo translační sekvenci, kde je umístěna v sousedství jednoho nebo více prvků sekvence, například v sousedství promotoru, který řídí transkripci a/nebo translaci sekvence tak,, že elementy sekvence mohou kontrolovat transkripci a/nebo translaci vybrané nukleové kyseliny.Also provided by the present invention are genetic constructs (e.g., vectors and plasmids) that comprise a nucleic acid of the present invention that is operably linked to a transcriptional and / or translational sequence allowing expression, for example in the form of an expression vector. The selected nuclic acid, for example a DNA molecule encoding an essential polypeptide, is operably linked to a transcriptional and / or translational sequence, where it is located adjacent to one or more elements of the sequence, for example, a promoter that directs transcription and / or translation of the sequence such that the sequence elements may control the transcription and / or translation of the selected nucleic acid.
Předkládaný vynález se také týká přečištěných a izolovaných polypeptidů kódovaných esenciálními geny yphC a ygjK. Termíny protein a polypeptid oba označují jakýkoliv řetězec aminokyselin, bez ohledu na jeho délku nebo posttranslační modifikace (například glykosylaci nebo fosforylací). Proto zahrnují termíny yphC polypeptid a ygjK polypéptid kompletní, přirozené, izolované yphC a ygjK proteiny, stejně jako rekombinantně nebo synteticky připravené polypeptidy, které odpovídají kompletním přirozeným proteinům, nebo části přirozených nebo syntetických polypeptidů (s podmínkou, že část yphC polypeptidů obsahuje část sekvence uvedené na obr.The present invention also relates to purified and isolated polypeptides encoded by the essential yphC and ygjK genes. The terms protein and polypeptide both refer to any amino acid chain, regardless of its length or post-translational modifications (e.g., glycosylation or phosphorylation). Thus, the terms yphC polypeptide and ygjK polypeptide include complete, natural, isolated yphC and ygjK proteins, as well as recombinantly or synthetically produced polypeptides that correspond to the complete natural proteins, or portions of natural or synthetic polypeptides (provided that a portion of the yphC polypeptides comprises part of the sequence FIG.
1) ·1) ·
Přečištěná nebo izolovaná sloučenina je prostředek, který je tvořen z alespoň 60% hmotnosti požadovanou sloučeninou, například esenciálním polypeptidem nebo protilátkou. Výhodně je prostředek tvořen z alespoň 75% (například z alespoň 90%,A purified or isolated compound is a composition that is at least 60% by weight of the desired compound, for example an essential polypeptide or antibody. Preferably, the composition is at least 75% (e.g., at least 90%,
95% nebo i z 99%) hmotnosti vybranou sloučeninou. Čistota může být měřena jakoukoliv vhodnou standardní metodou, například95% or even 99%) by weight of the selected compound. Purity can be measured by any suitable standard method, for example
BSBSS^ST'BSBSS ^ ST '
Φφ ΦΦΦΦ ·* ···· ΦΦ 44 • Φ Φ Φ · Φ · Φ φ ΦΦφΦΦΦΦ · * ···· ΦΦ 44 • Φ φ · Φ · Φ φ Φ
ΦΦΦ ΦΦΦ ΦΦΦΦΦΦΦ ΦΦΦ ΦΦΦΦ
ΦΦ ΦΦΦΦΦ ΦΦΦΦΦΦΦ ΦΦΦΦΦ ΦΦΦΦΦ
ΦΦΦΦ ΦΦΦ ΦΦΦΦΦΦΦΦ ΦΦΦ ΦΦΦΦ
ΦΦΦΦ ΦΦΦ Φφ ΦΦ chromatografií na koloně, polyakrylamidovou gelovou elektroforesou nebo HPLC analýzou.ΦΦΦΦ ΦΦΦ Φφ ΦΦ column chromatography, polyacrylamide gel electrophoresis or HPLC analysis.
Výhodné esenciální polypeptidy zahrnují sekvence významně identické s celou nebo s částí přirozeného esenciálního polypeptidu, například včetně celé nebo části sekvence uvedené na obr. 1, 2A-2B a 3 (s podmínkou, že část yphC polypeptidu obsahuje část sekvence uvedené na obr. 1). Polypeptidy významně identické se sekvencemi esenciálních polypeptidů podle předkládaného vynálezu mají aminokyselinovou sekvenci, která je alespoň z 80% identická s aminokyselinovou sekvencí esenciálních polypeptidů uvedených v SEQ ID NO: uvedených v tabulce 1 (jak je stanoveno zde popsaným způsobem). Nové polypeptidy mohou mít také vyšší procento identity, například 85%, 90%, 95% nebo vyšší. Pro srovnání by měla být délka referenční sekvence esenciálního polypeptidu nejméně 16 aminokyselin, například alespoň 20 nebo 25 aminokyselin.Preferred essential polypeptides include sequences substantially identical to all or part of the natural essential polypeptide, for example, including all or part of the sequence shown in Figures 1, 2A-2B and 3 (provided that a portion of the yphC polypeptide comprises a portion of the sequence shown in Figure 1) . Polypeptides significantly identical to the essential polypeptide sequences of the present invention have an amino acid sequence that is at least 80% identical to the amino acid sequence of the essential polypeptides set forth in SEQ ID NO: listed in Table 1 (as determined by the method described herein). The novel polypeptides may also have a higher percent identity, for example, 85%, 90%, 95% or greater. For comparison, the length of the essential polypeptide reference sequence should be at least 16 amino acids, for example at least 20 or 25 amino acids.
V případě polypeptidových sekvencí, které mají menší než 100% identitu s referenční sekvencí, jsou neidentické pozice výhodně, ale ne nutně, konzervativní substituce v referenční sekvenci. Konzervativní substituce obvykle zahrnují substituce v rámci následujících skupin: glycin a alanin; valin, isoleucin a leucin; kyselina asparagová a kyselina glutamová; asparagin a glutamin; serin a threonin; lysin a arginin; a fenylalanin a tyrosin.In the case of polypeptide sequences having less than 100% identity to a reference sequence, the non-identical positions are preferably, but not necessarily, conservative substitutions in the reference sequence. Conservative substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine.
Pokud je o určitém polypeptidu uvedeno, že má určité procento identity s referenčním polypeptidem definované délky, pak je procento identity vztaženo k referenčnímu polypeptidu. Tak může být polypeptid, který je z 50% identický s referenčním polypeptidem, který má délku 100 aminokyselin, polypeptid o 50 aminokyselinách, který je zcela identický s 50 φ · « · · « · φφφ φ φ φφφφ φ φ φφ φφ ·· ·· aminokyselin dlouhou částí referenčního polypeptidu.If a particular polypeptide is said to have a certain percent identity to a reference polypeptide of defined length, then the percent identity is relative to the reference polypeptide. Thus, a polypeptide that is 50% identical to a reference polypeptide having a length of 100 amino acids can be a polypeptide of 50 amino acids that is completely identical to a 50% amino acid polypeptide that is entirely identical to a 50% amino acid polypeptide. · Amino acids with a long portion of the reference polypeptide.
Alternativně se může jednat o polypeptid délky 100 aminokyselin, který je z 50% identický s referenčním polypeptidem v celé jeho délce. Samozřejmě, jiné polypeptidy budou také splňovat stejná kriteria.Alternatively, it may be a 100 amino acid polypeptide that is 50% identical to the reference polypeptide over its full length. Of course, other polypeptides will also meet the same criteria.
Předkládaný vynález také obsahuje přečištěné a izolované protilátky, které se specificky váží na esenciální polypeptid. Protilátka se specificky váže na určitý antigen, například na esenciální polypeptid, pokud se váže na antigen, ale významně nerozpoznává a neváže se na jiné molekuly ve vzorku, například v biologickém vzorku, který přirozeně obsahuje esenciální polypeptid.The present invention also encompasses purified and isolated antibodies that specifically bind to an essential polypeptide. An antibody specifically binds to a particular antigen, for example an essential polypeptide, when it binds to an antigen but does not significantly recognize and bind to other molecules in the sample, for example, a biological sample that naturally contains the essential polypeptide.
V jiném aspektu se vynález týká způsobu detekce esenciálního polypeptidu ve vzorku. Tento způsob obsahuje: získání vzorku podezřelého z toho, že obsahuje esenciální polypeptid; kontaktování vzorku s protilátkou, která se specificky váže na esenciální polypeptid za podmínek, které umožňují tvorbu komplexů protilátky a esenciálního polypeptidu; a detekci komplexů, pokud nějaké vzniknou, které jsou důkazem přítomnosti esenciálního polypeptidu ve vzorku.In another aspect, the invention relates to a method for detecting an essential polypeptide in a sample. The method comprises: obtaining a sample suspected of containing an essential polypeptide; contacting the sample with an antibody that specifically binds to an essential polypeptide under conditions that allow complexation of the antibody and the essential polypeptide; and detecting complexes, if any, that are indicative of the presence of an essential polypeptide in the sample.
Předkládaný vynález se také týká způsobu pro získání genu příbuzného s esenciálním genem. Takový způsob obsahuje získání značené sondy, která obsahuje izolovanou nukleovou kyselinu kódující celou nebo část esenciální nukleové kyseliny nebo její homolog; skríning knihovny fragmentů nukleových kyselin značenou sondou za podmínek, které umožňují hybridizací sondy na fragmenty nukleové kyseliny v knihovně, za vzniku duplexů nukleové kyseliny; izolování značených duplexů, pokud nějaké vzniknou; a přípravu kompletní genové sekvence z fragmentů nukleové kyseliny v jakémkoliv značeném duplexu pro získání flfl · fl «· « ·· fl · · · · • flfl «·· fl · · fl »»♦»··· ·»** ·· »· ·· * ·* ·« ♦ · ·fl· · • fl ···· genu příbuzného s esenciálním genem. Alternativně mohou být takové příbuzné geny identifikovány pomocí BLAST prohledávání různých sekvencovaných bakteriálních genomů, jak bylo popsáno výše.The present invention also relates to a method for obtaining a gene related to an essential gene. Such a method comprises obtaining a labeled probe that comprises an isolated nucleic acid encoding all or part of an essential nucleic acid or a homologue thereof; screening the library of nucleic acid fragments with a labeled probe under conditions that allow hybridization of the probe to the nucleic acid fragments in the library to form nucleic acid duplexes; isolating labeled duplexes, if any; and preparing the complete gene sequence from the nucleic acid fragments in any of the labeled duplexes to obtain flflf flflf flflf flflf The fl related gene related to the essential gene. Alternatively, such related genes can be identified by BLAST screening of various sequenced bacterial genomes as described above.
Vynález také nabízí několik výhod. Například, způsob pro identifikaci antibakteriálních činidel může být upraven pro vysoce účinný skríning mnoha potenciálních antibakteriálních činidel. Protože se předpokládá, že esenciální geny popsané v předkládaném vynálezu jsou vysoce konzervované, předpokládá se, že antibakteriální činidla namířená proti těmto genům nebo jejich genovým produktům budou mít antibakteriální aktivitu proti mnoha bakteriím.The invention also offers several advantages. For example, the method for identifying antibacterial agents may be adapted to highly screen many potential antibacterial agents. Since it is believed that the essential genes described in the present invention are highly conserved, it is expected that antibacterial agents directed against these genes or their gene products will have antibacterial activity against many bacteria.
Pokud není definováno jinak, mají všechny technické a vědecké termíny použité v předkládaném vynálezu běžné v oboru používané významy. Ačkoliv mohou být v provádění nebo testování předkládaného vynálezu použity způsoby a materiály podobné popsaným způsobům a materiálům, jsou vhodnými způsoby a materiály zde popsané způsoby a materiály. Všechny publikace, patentové přihlášky, patenty a jiné citované odkazy jsou zde uvedeny jako odkazy ve své úplnosti. V případě konfliktu bude předkládaná přihláška, včetně definic, kontrolována. Kromě toho, materiály, způsoby a příklady jsou ilustrativní a nijak neomezují rozsah předkládaného vynálezu, jak je definován v připojených patentových nárocích.Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood in the art. Although methods and materials similar to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are those described herein. All publications, patent applications, patents, and other references cited herein are hereby incorporated by reference in their entirety. In the event of a conflict, the present application, including definitions, will be reviewed. In addition, the materials, methods, and examples are illustrative and in no way limit the scope of the present invention as defined in the appended claims.
Další charakteristiky a výhody předkládaného vynálezu budou zřejmé z následujícího podrobného popisu a z připojených patentových nároků.Other features and advantages of the present invention will be apparent from the following detailed description and from the appended claims.
ΦΦ φφ φφ φφφ φφφφφ φφφ φφφ φφφφ φφ φφφφφ φφφφφ φφφφ φφφ φφφφ φφ φφ φφ φ φφ φφ φ « ·»»· •φ φφφφΦΦ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ »»
Popis obrázků na připojených výkresechDescription of the figures in the attached drawings
Obr. 1 ukazuje aminokyselinovou a nukleotidovou sekvenci yphC polypeptidu a kódujícího a nekódujícího řetězce yphC genu z kmene Streptococcus pneumoniae (SEQ ID NO: 2, 1 a 3, v příslušném pořadí).Giant. 1 shows the amino acid and nucleotide sequences of the yphC polypeptide and the coding and non-coding strands of the yphC gene from Streptococcus pneumoniae (SEQ ID NOs: 2, 1 and 3, respectively).
Obr. 2A-2B uvádějí kompletní aminokyselinovou a nukleotidovou sekvenci yphC polypeptidu a kódujícího a nekódujícího řetězce yphC genu z kmene Streptococcus pneumoniae (SEQ ID NO: 5, 4 a 6, v příslušném pořadí).Giant. 2A-2B depict the complete amino acid and nucleotide sequences of the yphC polypeptide and the coding and non-coding strands of the yphC gene from Streptococcus pneumoniae (SEQ ID NOs: 5, 4, and 6, respectively).
Obr. 3 ukazuje aminokyselinovou a nukleotidovou sekvenci ygjK polypeptidu a kódujícího a nekódujícího řetězce ygjK genu z kmene Streptococcus pneumoniae (SEQ ID NO: 8, 7 a 9, v příslušném pořadí).Giant. 3 shows the amino acid and nucleotide sequences of the ygjK polypeptide and the coding and non-coding strands of the ygjK gene from Streptococcus pneumoniae (SEQ ID NOs: 8, 7 and 9, respectively).
Obr. 4A-4B ukazují aminokyselinovou a nukleotidovou sekvenci Β-yphC polypeptidu a kódujícího a nekódujícího řetězce Β-yphC genu z kmene B. subtilis (SEQ ID NO: 11, 10 a 12, v příslušném pořadí).Giant. 4A-4B show the amino acid and nucleotide sequences of the Β-yphC polypeptide and the coding and non-coding strands of the Β-yphC gene from the B. subtilis strain (SEQ ID NOS: 11, 10, and 12, respectively).
Obr. 5A-5B ukazují aminokyselinovou a nukleotidovou sekvenci yfgK polypeptidu a kódujícího a nekódujícího řetězce yfgK genu z kmene E. coli (SEQ ID NO: 14, 13 a 15, v příslušném pořadí).Giant. 5A-5B show the amino acid and nucleotide sequences of the yfgK polypeptide and the coding and non-coding strands of the yfgK gene from an E. coli strain (SEQ ID NOS: 14, 13 and 15, respectively).
Obr. 6 ukazuje aminokyselinovou a nukleotidovou sekvenci BygjK polypeptidu a kódujícího a nekódujícího řetězce B-ygjK genu z kmene B. subtilis (SEQ ID NO: 17, 16 a 18, v příslušném pořadí).Giant. 6 shows the amino acid and nucleotide sequences of the BygjK polypeptide and the coding and non-coding strands of the B-ygjK gene from the B. subtilis strain (SEQ ID NOs: 17, 16 and 18, respectively).
·· »**« ···· 49 46 • 4 4 9 4 4 9 4 9 4·· »**« ···· 46 46 • 4 4 9 4 4 9 4 9 4
4 4 4 4 4 4 4 4 44 4 4 4 4 4 4 4
4 4 4 4 4 4 4 4 4 4 44 4 4 4 4 4 4 4 4 4
ΊΊ 4 4 4 4 4 4 4 9 4 4 9 ' ·« «· ·9 « 9· *«ΊΊ 4 4 4 4 4 4 4 9 4 4 9 · «« 9 · '·
Obr. 7 ukazuje aminokyselinovou a nukleotidovou sekvenci elaC polypeptidů a genu z kmene E. coli (SEQ ID NO: 20, 19 a 21, v příslušném pořadí).Giant. 7 shows the amino acid and nucleotide sequences of elaC polypeptides and a gene from an E. coli strain (SEQ ID NOs: 20, 19 and 21, respectively).
Obr. 8 je schematické znázornění PCR strategie použité pro produkci DNA molekul použitých pro cílené delece esenciálních genů v Streptococcus pneumoniae.Giant. 8 is a schematic representation of the PCR strategy used to produce DNA molecules used for targeted deletion of essential genes in Streptococcus pneumoniae.
Obr. 9 je schematické znázornění strategie použité pro produkci cílených delecí esenciálních genů v Streptococcus pneumoniae.Giant. 9 is a schematic representation of the strategy used to produce targeted deletions of essential genes in Streptococcus pneumoniae.
Obr. 10 je schematické znázornění strategie použité pro získání nepolárních genových delecí v yphC a ygjK genech v B. subtilis.Giant. 10 is a schematic representation of the strategy used to obtain non-polar gene deletions in the yphC and ygjK genes in B. subtilis.
Obr. 11A-11C jsou schematická znázornění strategie použité pro přípravu podmíněných nulových mutantů yphC a ygjK genů.Giant. 11A-11C are schematic representations of the strategy used to prepare conditional null mutants of the yphC and ygjK genes.
Obr. 12 je schematické znázornění strategie použité pro produkci delecí esenciálních genů v E. coli a ukazuje esenciální fenotyp E. coli yfgK genu, který je ortologem, yphC genu S. pneumoniae.Giant. 12 is a schematic representation of the strategy used to produce deletion of essential genes in E. coli and shows the essential phenotype of the E. coli yfgK gene, which is an ortholog, of the yphC gene of S. pneumoniae.
Bylo zjištěno, že alespoň dva geny v bakterii Streptococcus pneumoniae jsou esenciální pro přežívání těchto bakterií. Tyto takzvané esenciální geny, yphC a ygjK, kódují proteiny, které jsou zde označovány jako esenciální polypeptidy. YphC a ygjK geny jsou užitečnými molekulárními nástroji pro identifikaci podobných genů v patogenních mikroorganismech, jako jsou patogenní kmeny Bacillus sp. Esenciální polypeptidy jsou použitelnými cíly pro identifikaci sloučenin, které jsouIt has been found that at least two genes in Streptococcus pneumoniae are essential for the survival of these bacteria. These so-called essential genes, yphC and ygjK, encode proteins referred to herein as essential polypeptides. The YphC and ygjK genes are useful molecular tools for identifying similar genes in pathogenic microorganisms, such as pathogenic Bacillus sp. Essential polypeptides are useful targets for identifying compounds that are
SBHSBHHKSJÍS*'SBHSBHHKSJÍS * '
94999499
9 99 9
9 99 9
4 4 94 4 9
9 4 49 4 4
94 #4 9994# 4 9994
9 49 4
4 44 4
4 44 4
4 9 »4 9 »
4949
4 4 44 4 4
4 4 94 4 9
4 4 4 4 • · · · ·· ΦΦ inhibitory patogenů, ve kterých jsou exprimovány esenciální polypeptidy.Pathogen inhibitors in which essential polypeptides are expressed.
Identifikace esenciálních Streptokokových genůIdentification of essential Streptococcal genes
Jak je uvedeno v pokusech popsaných dále, oba yphC a ygjK geny jsou esenciální pro přežívání Streptococcus pneumoniae. Streptococcus pneumoniae je dostupný od ATCC. Obecně, a pro příklady uvedené dále, mohou být esenciální geny identifikovány vytvořením cílených delecí ve vybraných genech v bakterii, například v S. pneumoniae. Tyto vybrané geny byly vybrány následujícím způsobem. Za použití standardních technik molekulární biologie byly za použití M13 fágu nebo plasmidové DNA jako vektoru připraveny knihovny obsahující fragmenty genornu Streptococcus pneumoniae. Otevřené čtecí rámce (ORF) obsažené v těchto knihovnách byly náhodně sekvencovány, za použití primerů hybridizujících na vektor. Vybrané geny pro cílené delece splňovaly čtyři kriteria, jak byly stanoveny srovnáním sekvencí s GenBank databází nukleotidových sekvencí: (i) ORF neměl žádnou známou funkci; (ii) ORF měl ortolog v Bacilus subtilis; (iii) ORF byl konzervován v jiných bakteriích, s ρ < 1O~10; a (iv) ORF neměl žádný eukaryotický ortolog, s ρ < 10“3. Streptokokové geny yphC a ygjK splňují všechna tato kriteria, což naznačuje, že sloučenina, která inhibuje yphC a ygjK geny nebo produkty genů bude mít široké spektrum antibakteriální aktivity.As noted in the experiments described below, both the yphC and ygjK genes are essential for the survival of Streptococcus pneumoniae. Streptococcus pneumoniae is available from the ATCC. In general, and for the examples below, essential genes can be identified by creating targeted deletions in selected genes in bacteria, for example S. pneumoniae. These selected genes were selected as follows. Libraries containing Streptococcus pneumoniae genor fragments were prepared using standard molecular biology techniques using M13 phage or plasmid DNA as a vector. The open reading frames (ORFs) contained in these libraries were randomly sequenced, using primers hybridizing to the vector. The selected genes for targeted deletions met four criteria, as determined by sequence comparison with the GenBank nucleotide sequence database: (i) ORF had no known function; (ii) the ORF had an ortholog in Bacilus subtilis; (iii) the ORF was preserved in other bacteria, with ρ <10 -10 ; and (iv) ORF had no eukaryotic ortholog, with ρ <10 "3. The yphC and ygjK streptococcal genes meet all of these criteria, suggesting that a compound that inhibits yphC and ygjK genes or gene products will have a broad spectrum of antibacterial activity.
YphC a ygjK geny byly každý nahrazeny sekvencí nukleové kyseliny způsobující resistenci na antibiotikum erythromycin (erm gen) . Místo tohoto genu pro resistenci na antibiotika mohou být použity jiné genetické markéry. Amplifikace polymerasovou řetězovou reakcí (PCR) může být použita proThe YphC and ygjK genes were each replaced by a nucleic acid sequence conferring resistance to the antibiotic erythromycin (erm gene). Other genetic markers may be used in place of this antibiotic resistance gene. Polymerase chain reaction (PCR) amplification can be used for
MUMjv vytvoření cílené delece ve Streptokokové genomové DNA, jak je uvedeno na obr. 8. Několik PCR reakcí bylo použito pro výrobu DNA molekul potřebných pro provedení cílené delece vybraných genů. Nejprve byl za použití primerů 5 a 6 amplifikován erm gen z pIL252 z B. subtilis (který byl získán od Bacillus Genetic Stock Center, Columbus, OH). Primer 5 se skládá z 21 nukleotidů, které jsou identické s promotorovým regionem erm genu a které jsou komplementární k sekvenci A. Primer 5 má sekvenci 5' GTG TTC GTG CTG ACT TGC ACC 3' (SEQ ID NO: 22). Primer 6 se skládá z 21 nukleotidů, které jsou komplementární k 3' konci erm genu. Primer 6 má sekvenci 5' GAA TTA TTT CCT CCC GTT AAA 3' (SEQ ID NO: 23). PCR amplifikace erm genu byla provedena za následujících podmínek: 30 cyklů o 94 °C po dobu 1 minuty, 55 °C po dobu 1 minuty a 72 °C po dobu 1,5 minuty, a potom následoval jeden cyklus 72 °C po dobu 10 minut.MUM is creating a targeted deletion in Streptococcal genomic DNA, as shown in Figure 8. Several PCR reactions have been used to produce the DNA molecules required to perform a targeted deletion of selected genes. First, the erm gene from B. subtilis pIL252 (obtained from the Bacillus Genetic Stock Center, Columbus, OH) was amplified using primers 5 and 6. Primer 5 consists of 21 nucleotides that are identical to the promoter region of the erm gene and which are complementary to sequence A. Primer 5 has the sequence 5 'GTG TTC GTG CTG ACT TGC ACC 3' (SEQ ID NO: 22). Primer 6 consists of 21 nucleotides that are complementary to the 3 'end of the erm gene. Primer 6 has the sequence 5 'GAA TTA TTT CCT CCC GTT AAA 3' (SEQ ID NO: 23). PCR amplification of the erm gene was performed under the following conditions: 30 cycles of 94 ° C for 1 minute, 55 ° C for 1 minute, and 72 ° C for 1.5 minutes, followed by one cycle of 72 ° C for 10 minutes minutes.
Ve druhé a třetí PCR reakci byly sekvence sousedící s vybraným genem amplifikovány a byly připraveny jako hybridní DNA molekuly, které také obsahovaly část erm genu. V druhé reakci byla připravena dvouřetězcová molekula DNA (označené jako levá sousední molekula), která obsahovala sekvence před 5' koncem vybraného genu a prvních 21 nukleotidů erm genu. Jak je uvedeno na obr. 8, tato reakce využívala primer 1, který má délku 21 nukleotidů a který je identický se sekvencí, která je umístěna přibližně 500 bp před translačním start místem vybraného genu. Primery 1 a 2 jsou genově specifické a mají sekvence 5' TGA AGC CTG TCA AGG ACG AGG 3' (SEQ ID NO: 24) a 5' CCT TAC GTG GTC GAA TTG TGG 3' (SEQ ID NO: 25), v příslušném pořadí, pro ygjK. Pro yphC měly primery 1 a 2 sekvence 5' TGT ATG AAT TGG TAC CTC AAG 3' (SEQ ID NO: 26) aIn the second and third PCR reactions, sequences flanking the selected gene were amplified and prepared as hybrid DNA molecules that also contained part of the erm gene. In a second reaction, a double stranded DNA molecule (designated as the left adjacent molecule) was prepared which contained the sequences upstream of the 5 'end of the selected gene and the first 21 nucleotides of the erm gene. As shown in Figure 8, this reaction utilized a primer of 21 nucleotides in length and identical to a sequence that is located approximately 500 bp upstream of the translational start site of the selected gene. Primers 1 and 2 are gene specific and have the sequences 5 'TGA AGC CTG TCA AGG ACG AGG 3' (SEQ ID NO: 24) and 5 'CCT TAC GTG GTC GAA TTG TGG 3' (SEQ ID NO: 25), respectively. order, for ygjK. For yphC, primers 1 and 2 had 5 'TGT ATG AAT sequences and TGG TAC CTC AAG 3' (SEQ ID NO: 26) and
5' ACA ATG GCA ATA GTT GGT AGG 3' (SEQ ID NO: 27), v příslušném pořadí. Primer 2 má délku 42 nukleotidů, kdy 21 nukleotidů na 3' konci primerů je komplementárních k 5' kaftď ·· ··*· ·· ···· ·· ·· φ φ φ φ · φ · * · · • · · φφφ φφφφ φφφφ φφφ φφφφ «φ << << * # φ φφ kódujícího řetězce vybraného genu. 21 nukleotidů na 5' konci primeru je identických se sekvencí A a jsou proto komplementární k 5' konci erm genu. Tak je při PCR amplifikaci za použití primerů 1 a 2 připravena levá sousední molekula, která je hybridní DNA molekulou obsahující sekvence umístěné před vybraným genem a 21 párů baží erm genu, jak je uvedeno na obr. 8.5 'ACA ATG GCA ATA GTT GGT AGG 3' (SEQ ID NO: 27), respectively. Primer 2 has a length of 42 nucleotides, with 21 nucleotides at the 3 'end of the primers complementary to the 5' cotta ··· ·················· φ φ φ << << << << << << << << << << << << << << << << << << << << << << << << << << << << << << << The 21 nucleotides at the 5 'end of the primer are identical to sequence A and are therefore complementary to the 5' end of the erm gene. Thus, by PCR amplification using primers 1 and 2, a left adjacent molecule is prepared, which is a hybrid DNA molecule containing sequences upstream of the selected gene and 21 pairs of erm gene as shown in Figure 8.
Třetí PCR reakce je podobná druhé reakci, ale je při ní získána pravá sousední DNA molekula, jak je uvedeno na obr. 8. Pravá sousední DNA molekula obsahuje 21 párů baží 3' konce erm genu, 21 párů baží 3' konce vybraného genu a sekvence za vybraným genem. Tato pravá sousední molekula byla připravena za použití genově specifických primerů 3 a 4. Pro ygjK měly primery 3 a 4 sekvence 5' GTG GAA ATC TAG CAG TCA CAG 3' (SEQ ID NO: 28) a 5' ATC TGG TTC TAG CAG GAA GCG 3' (SEQ ID NO:The third PCR reaction is similar to the second reaction but produces the right flanking DNA molecule as shown in Figure 8. The flanking DNA molecule contains 21 bp 3 'ends of the erm gene, 21 bp 3' ends of the selected gene and sequence behind the selected gene. This right flanking molecule was prepared using gene-specific primers 3 and 4. For ygjκ, primers 3 and 4 had the sequences 5 'GTG GAA ATC TAG CAG 3' (SEQ ID NO: 28) and 5 'ATC TGG TTC TAG CAG GAA GCG 3 '(SEQ ID NOS:
29), v příslušném pořadí. Pro yphC měly primery 3 a 4 sekvence 5' CAT TGC CAG TCC TGT TGC TGG 3' (SEQ ID NO: 30). a 5' ATG GCA TCC ATG ACA TCG 3' (SEQ ID NO: 31), v příslušném pořadí.29), respectively. For yphC, primers 3 and 4 had the sequence 5 'CAT TGC CAG TCC TGT TGC TGG 3' (SEQ ID NO: 30). and 5 'ATG GCA TCC ATG ACA TCG 3' (SEQ ID NO: 31), respectively.
Primer 3 má délku 42 nukleotidů, kdy 21 nukleotidů na 5' konci primeru 3 jsou identické se sekvencí B a jsou proto identické s 3' koncem erm genu. 21 nukleotidů na 3' konci primeru 3 jsou identické s 3' koncem vybraného genu. Primer 4 má délku 21 nukleotidů a je komplementární k sekvenci umístěné přibližně 500 bp za vybraným genem.Primer 3 is 42 nucleotides in length, with 21 nucleotides at the 5 'end of primer 3 being identical to sequence B and are therefore identical to the 3' end of the erm gene. The 21 nucleotides at the 3 'end of primer 3 are identical to the 3' end of the selected gene. Primer 4 is 21 nucleotides in length and is complementary to a sequence located approximately 500 bp downstream of the selected gene.
PCR amplifikace levé a pravé sousední DNA molekuly byla provedena, odděleně, v 50 μΐ reakční směsi obsahující: 1 μΐ DNA (0,25 μς) Streptococcus pneumoniae (RXI), 2,5 μΐ primeru 1 nebo primeru 4 (10 pmol/μΐ), 2,5 μΐ primeru 2 nebo primeru 3 (20 pmol/μΐ), 1,2 μΐ směsi dNTP (10 mM každý), 37 μΐ HžO, 0,7 μΐ Tag polymerasy (5 U/μΐ) a 5 μΐ lOx Taq polymerasového pufru (10 ·· ···· ·· ···· ·· ·· ·· t · · ··*·· ·«· ··· ···· • · ··· <· · · ·· · qi ······· ···· «· ·· «· · ·· ·· mM Tris, 50 mM KC1, 2,5 mM MgCl2) . Levá a pravá sousední DNA molekuly byly amplifikovány za použití následujících PCR cyklů: 95 °C po dobu 2 minut; 72 °C po dobu 1 minuty; 94 °C po dobu 30 sekund; 49 °C po dobu 30 sekund; 72 °C po dobu 1 minuty; opakování inkubací při 94 °C, 49 °C a 72 °C 30-krát; 72 °C po dobu 10 minut a potom ukončení reakcí. 15 μΐ alikvoty každé reakční směsi se potom zpracují elektroforesou na 1,2% agarosovém gelu s nízkou teplotou tání v TAE pufru a gely se potom barvily ethidiumbromidem. Fragmenty obsahující levé a pravé sousední molekuly DNA byly excidovány z gelu a byly přečištěny za použití QIAQUICKtm kitu pro extrakci z gelu (Qiagen lne.). Mohou být použity také jiné v oboru známé způsoby pro amplifikaci a izolaci DNA. Sousední levé a pravé DNA fragmenty byly eluovány do 30 μΐ TE pufru při pH 8,0.PCR amplification of the left and right neighboring DNA molecules was performed, separately, in a 50 μΐ reaction mixture containing: 1 μΐ DNA (0.25 μς) of Streptococcus pneumoniae (RXI), 2.5 μΐ primer 1 or primer 4 (10 pmol / μΐ) , 2.5 μΐ of primer 2 or primer 3 (20 pmol / μΐ), 1.2 μΐ of dNTP mix (10 mM each), 37 μΐ HžO, 0.7 μΐ Tag polymerase (5 U / μΐ) and 5 μΐ 10x Taq polymerase buffer (10 ························ Qi · Tris, 50 mM KCl, 2.5 mM MgCl 2). Left and right adjacent DNA molecules were amplified using the following PCR cycles: 95 ° C for 2 minutes; 72 ° C for 1 minute; 94 ° C for 30 seconds; 49 ° C for 30 seconds; 72 ° C for 1 minute; repeated incubations at 94 ° C, 49 ° C and 72 ° C 30 times; 72 ° C for 10 minutes and then quenching. 15 μΐ aliquots of each reaction mixture were then electrophoresed on a 1.2% low melting point agarose gel in TAE buffer, and the gels were then stained with ethidium bromide. Fragments containing left and right neighboring DNA molecules were excised from the gel and purified using a QIAQUICK ™ gel extraction kit (Qiagen Inc). Other methods known in the art for amplifying and isolating DNA can also be used. Neighboring left and right DNA fragments were eluted into 30 μΐ TE buffer at pH 8.0.
Amplifikovaný erm gen a levá a pravá sousední molekula DNA byl potom fúsovány dohromady za zisku fúsního produktu, jak je uveden na obr. 8. Fúsní PCR reakce byla provedena v objemu 50. μΐ obsahujícím: 2 μΐ pravé a 2 μΐ levé sousední molekuly DNA a 2 μΐ erm genového PCR produktu; 5 μΐ lOx pufru; 2,5 μΐ primeru 1 (10 pmol/μΐ), 2,5 μΐ primeru 4 (10 pmol/μΐ), 1,2 μΐ směsi dNTP (10 mM každý), 32 μΐ H2O a 0,7 μΐ Taq polymerasy. PCR reakce byly provedeny za použití následujících PCR cyklů: 95 °C po dobu 2 minut; 72 °C po dobu 1 minuty; 94 °C po dobu 30 sekund; 48 °C po dobu 30 sekund; 72 °C po dobu 3 minut; opakování inkubací při 94 °C, 48 °C a 72 °C 25-krát; 72 °C po dobu 10 minut. Po ukončení reakce byly 12 μΐ alikvoty reakční směsi zpracovány elektroforesou na agarosovém gelu pro potvrzení přítomnosti konečného produktu velikosti přibližně 2 φ φ · φ • · · φ • · μΐ alikvota fúsního produktu byla použita pro transformaci S. pneumoniae kultivovaného na mediu obsahujícím erytromycin za použití standardních technik. Jak je uvedeno na obr. 9, fúsní produkt a genom S. pneumoniae podléhají homologní rekombinaci, takže erm gen nahrazuje chromosomální kopii vybraného genu, což způsobuje vyřazení genu. Vyřazení esenciálního genu vede k zástavě růstu na mediu obsahujícím erythromycin. Pomocí této metody vyřazení genů byly yphC a ygjK geny identifikovány jako geny esenciální pro přežívání. Část yphC otevřeného čtecího rámce, která byla sekvencována před provedením cílené delece, je uvedena na obr. 1. Kompletní sekvence yphC /uvedená na obr. 2A-2B) byla složena za použití prohledávání TIGR databáze na klon z S. pneumoniae mající sekvence překrývající se sekvencí uvedenou na obr. 1 a kombinováním 3' konce genu z databáze s 5' koncem genu uvedeného na obr. 1. Funkce sekvence obsažené v klonu z databáze nebyla známá.The amplified erm gene and the left and right neighboring DNA molecules were then fused together to obtain a fusion product as shown in Figure 8. The fusion PCR reaction was performed in a volume of 50 μΐ containing: 2 μΐ of the right and 2 μΐ of the left neighboring DNA molecule, and 2 μΐ erm gene PCR product; 5 μΐ 10x buffer; 2.5 μΐ of primer 1 (10 pmol / μΐ), 2.5 μΐ of primer 4 (10 pmol / μΐ), 1.2 μΐ of a mixture of dNTPs (10 mM each), 32 μΐ of H2O and 0.7 μ polymer of Taq polymerase. PCR reactions were performed using the following PCR cycles: 95 ° C for 2 minutes; 72 ° C for 1 minute; 94 ° C for 30 seconds; 48 ° C for 30 seconds; 72 ° C for 3 minutes; repeated incubations at 94 ° C, 48 ° C and 72 ° C 25 times; 72 ° C for 10 minutes. At the end of the reaction, 12 μΐ aliquots of the reaction mixture were subjected to agarose gel electrophoresis to confirm the presence of a final product of approximately 2 ΐ ΐ size. standard techniques. As shown in Fig. 9, the fusion product and the S. pneumoniae genome undergo homologous recombination, so that the erm gene replaces the chromosomal copy of the selected gene, causing the gene to be knocked out. The knockout of the essential gene leads to growth arrest on erythromycin containing medium. Using this gene exclusion method, the yphC and ygjK genes were identified as essential for survival. The portion of the yphC open reading frame that was sequenced prior to the targeted deletion is shown in Figure 1. The complete yphC sequence (shown in Figures 2A-2B) was folded using a TIGR database search for a S. pneumoniae clone having overlapping sequences 1 and combining the 3 'end of the gene from the database with the 5' end of the gene shown in FIG. 1. The function of the sequence contained in the clone from the database was unknown.
Identifikace ortologů esenciálních genůIdentification of orthologs of essential genes
Po důkazu, že yphC a ygjK geny jsou esenciální pro přežívání Streptokoků, mohou být ortology těchto genů, které byly identifikované v jiných organismech, například v B. subtilis nebo E. coli, testovány pro stanovení toho, zda jsou také esenciální pro přežívání těchto organismů. Doposud byly kódující sekvence yphC a ygjK použity pro -prohledávání GenBank databáze nukleotidových sekvencí a ortology každé sekvence byly identifikovány v B. subtilis a E. coli. Porovnání sekvence bylo provedeno za použití Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215: 403410, 1990). Procento identity sekvence mezi esenciálními polypeptidy a jejich ortology bylo stanoveno za použití GAP programu od Genetics Computer Group (GCG) Wisconsin Seguence After demonstrating that the yphC and ygjK genes are essential for Streptococcal survival, the orthologs of these genes that have been identified in other organisms, such as B. subtilis or E. coli, can be tested to determine whether they are also essential for survival of these organisms. . To date, the coding sequences of yphC and ygjK have been used to search the GenBank database of nucleotide sequences, and the orthologs of each sequence have been identified in B. subtilis and E. coli. Sequence comparison was performed using the Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215: 403410, 1990). Percent sequence identity between essential polypeptides and their orthologs was determined using a GAP program from the Genetics Computer Group (GCG) Wisconsin Seguence
·· ··»· ·* 999· ·· ·············· · · 999
9 · ·· · «··· • 9 9 φ·· 9 9 9 * «9 99999 999999 · ·· · «··· • 9 9 φ ·· 9 9 9 * 9 9 99999 99999
9999 999 9999 «9 99 99 9 99 999999 999 9999 «9 99 99 99 99 99
Analysis Package (Wisconsin Package Version 9.1; Madison, Wl). Byly použity trestné hodnoty pro velikost mezery (12) a délku mezery (4).Analysis Package (Wisconsin Package Version 9.1; Madison, Wl). Penalty values for gap size (12) and gap length (4) were used.
Obvykle mají esenciální polypeptidy a jejich ortology alespoň 25% (například alespoň 30% nebo 40%) identitu sekvence. Obvykle mají DNA sekvence kódující esenciální polypeptidy a jejich homology nebo ortology alespoň 20% (například 30%, 35%, 40% nebo 45%) identitu sekvence. Bioinformační analýza yphC a ygjK genů ukázala, že tyto geny jsou značně konzervované mezi bakteriemi.Typically, the essential polypeptides and their orthologs have at least 25% (e.g., at least 30% or 40%) sequence identity. Typically, DNA sequences encoding essential polypeptides and homologues or orthologs thereof have at least 20% (e.g., 30%, 35%, 40%, or 45%) sequence identity. Bioinformation analysis of the yphC and ygjK genes showed that these genes are extensively conserved among bacteria.
Pro stanovení toho, zda jsou identifikované ortology yphC a ygjK esenciální pro přežívání jiných bakterií byl každý ortologní gen separátně deletován z genomu hostitelského organismu, jak je podrobněji popsáno dále. Pozorování, že B. subtilis a E. coli ortology yphC (B-yphC a yfgK, v příslušném pořadí) jsou také esenciální pro přežívání B. subtilis a E. coli naznačuje, že yphC gen je esenciální pro všechny bakterie, ve kterých se vyskytuje. Proto se předpokládá, že antibakteriální činidla namířená proti tomuto genu nebo jeho produktu budou mít široké spektrum antibakteriální aktivity. Pozorování, že ortolog ygjK B. subtilis (B-ygjK), ale nikoliv ortolog E. coli (elaC) je esenciální pro přežívání naznačuje, že tento gen je esenciální ve všech gram-pozitivních bakteriích, ve kterých je přítomen, ale že není esenciální v gram-negativních bakteriích. Proto se předpokládá, že antibakteriální činidla namířená proti ygjK genu nebo proti produktu tohoto genu budou mít antibakteriální aktivitu proti všem gram-pozitivním bakteriím.To determine whether the identified orthologs yphC and ygjK are essential for the survival of other bacteria, each orthologous gene was separately deleted from the genome of the host organism, as described in more detail below. The observation that B. subtilis and E. coli orthophys yphC (B-yphC and yfgK, respectively) are also essential for survival of B. subtilis and E. coli suggests that the yphC gene is essential for all bacteria in which it occurs . Therefore, it is expected that antibacterial agents directed against this gene or its product will have a broad spectrum of antibacterial activity. The observation that the ortholog of B. subtilis ygjK (B-ygjK) but not the E. coli ortholog (elaC) is essential for survival suggests that this gene is essential in all gram-positive bacteria in which it is present but that it is not essential in gram-negative bacteria. Therefore, it is anticipated that antibacterial agents directed against the ygjK gene or product of this gene will have antibacterial activity against all gram-positive bacteria.
Delece a stanovení esenciality yphC a ygjK genů v Bacilus subtilisDeletion and determination of essentiality of yphC and ygjK genes in Bacilus subtilis
Následující příklady ilustrují, že ortology yphC a ygjK v B. subtilis (t.j. Β-yphC a Β-ygjK) jsou esenciální pro přežívání B. subtilis. Dvě strategie byly použity pro přípravu vyřazovacích mutací Β-yphC a Β-ygjK genů v B. subtilis a bylo provedeno stanovení esenciálního fenotypu Β-yphC a B-ygjK genů, jak je podrobně popsáno dále. První strategie (ilustrovaná na obr. 10) byla podobná cílené deleční strategii použité pro vyřazení genů v Streptococcus, jak byla 'popsána výše. Strategie obsahovala následující významné odlišnosti:The following examples illustrate that yphC and ygjK orthologs in B. subtilis (i.e. Β-yphC and Β-ygjK) are essential for survival of B. subtilis. Two strategies were used to prepare knockout mutations of the sub-yphC and Β-ygjK genes in B. subtilis and the determination of the essential phenotype of the Β-yphC and B-ygjK genes was described in detail below. The first strategy (illustrated in Figure 10) was similar to the targeted deletion strategy used for gene cleavage in Streptococcus, as described above. The strategy included the following significant differences:
(A) v PCR byl místo genu pro resistenci na erythromycin použit gen pro resistenci na chloramfenikol (CmR) B. subtilis z plasmidu pDG283. Alternativně může být použit jakýkoliv markér pro B. subtilis;(A) In PCR, the B. subtilis chloramphenicol (CmR) resistance gene from plasmid pDG283 was used in place of the erythromycin resistance gene. Alternatively, any marker for B. subtilis may be used;
(B) primery použité pro amplifikaci CmR genu a primery B a C, které bezprostředně sousedí s yphC ORF, obsahovaly řetězec 27 nukleotidů označovaný jako universální přesahující sekvence. Tyto universální přesahující sekvence mohou být účinně použity při PCR amplifikaci a usnadňují použití různých inserčních sekvencí ve fúsních PCR reakcích. Markéry pro resistenci, promotory, regulační elementy nebo jakékoliv jiné sekvence nukleové kyseliny mohou být amplifikovány s takovými překrývajícími se sekvencemi a mohou být použity se stejnou sadou primerů pro genové delece (primery A, B, C a D).(B) the primers used to amplify the CmR gene and the B and C primers immediately adjacent to the yphC ORF contained a sequence of 27 nucleotides referred to as universal overlapping sequences. These universal overlapping sequences can be effectively used in PCR amplification and facilitate the use of various insertion sequences in fusion PCR reactions. Resistance markers, promoters, regulatory elements or any other nucleic acid sequences can be amplified with such overlapping sequences and can be used with the same set of gene deletion primers (primers A, B, C and D).
Sekvence pro 5' přesahující region je 5' CACAGGAAACAGC TATGACCATGATTA 3’ (SEQ ID NO: 25) a sekvence pro 3' přesahující region je 5' GAAATAAATGCATCTGTATTTGAATG 3' (SEQ ID NO: 26);The sequence for the 5 'overhang region is 5' CACAGGAAACAGC TATGACCATGATTA 3 '(SEQ ID NO: 25) and the sequence for the 3' overhang region is 5 'GAAATAAATGCATCTGTATTTGAATG 3' (SEQ ID NO: 26);
(C) levá a pravá sousední DNA molekula získaná při PCR by měly mít délku alespoň 900 (například 1000) nukleotidů pro optimalizaci rekombinace do chromosomu B. subtilis;(C) the left and right adjacent DNA molecules obtained by PCR should be at least 900 (e.g., 1000) nucleotides in length to optimize recombination into the B. subtilis chromosome;
(D) pro získání fúsního produktu byly použity dvě simultání PCR reakce. Jedna reakce byla provedena při teplotě (D) Two simultaneous PCR reactions were used to obtain the fusion product. One reaction was carried out at temperature
·· ··« ·· ···· ·· ·· • · · ·· · · · · · φ ·Φ» ······· ··«·<·· ···· · · ·· «· * * * * · zpracování 50 °C a druhá byla provedena při teplotě 65 °C. Byly použity delší extenční časy (o 30-60 sekund) a dlouhá polymerasa s vysokou spolehlivostí byla také použita podle návodu výrobce (Boehringer Mannheim);·········································· The treatment was 50 ° C and the second was carried out at 65 ° C. Longer extension times (30-60 seconds) were used and long polymerase with high reliability was also used according to the manufacturer's instructions (Boehringer Mannheim);
(E) kompetentní buňky přirozeného kmene PY79 byly použity podle standardních protokolů pro B. subtilis (Molecular Biological Methods for Bacillus, 1990, Harwood and Cutting, eds. Wiley and Sons, Ltd., England);(E) competent cells of the native PY79 strain were used according to standard protocols for B. subtilis (Molecular Biological Methods for Bacillus, 1990, Harwood and Cutting, eds. Wiley and Sons, Ltd., England);
(F) sekvence primerů uvedených na obr. 10 byly následující: primer Ra (5'CACAGGAAACAGCTATGACCATGATTAAACTAAAGCACCCATTAGTTCA 3' (SEQ ID NO: 27), který hybridizuje na sekvenci před CmR promotorem; primer Rb (5’ CATTCAAATACAGATGCATTTTATTTCCTCATATT ATAAAAGCCAGTCATT 3' (SEQ ID NO: 28)), který hybridizuje na sekvenci umístěnou v sousedství s transkripčním terminátorem; primer A-YPHC (5' GCCATTGCGTTTGAAAG 3' (SEQ ID NO: 29)); primer A-YQJK (5' TGCTTCGCCGATTTCTT 3' (SEQ ID NO: 30; primer B-YPHC (5' TAATCATGGTCATAGCTGTTTCCTGTGTATGAAAAGAAACCCTTCAGAG 3' (SEQ ID NO: 31)), který je umístěn v sousedství yphC start kodonu; primer B-YQJK (5' TAATCATGGTCATAGCTGTTTCCTGTGCATACCG AACGCCTTTCTT 3' (SEQ ID NO: 32)), který je umístěn v sousedství ygjK start kodonu; primer C-YPHC (5' GAAATAAATGCATCTGTATTTGAA TGTTTTAGAAAACCGAATCAGAGA 3' (SEQ ID NO: 33)), který je umístěn v sousedství yphC stop kodonu; primer C-YQJK (5' GAAATAAATGCA TCTGTATTTGAATGAATAGCGTGGCGGCATA 3’ (SEQ ID NO: 34)), )), který je umístěn v sousedství ygjK stop kodonu; primer D-YPHC (5' ATTCAGATCGAATACTCCTG 3' (SEQ ID NO: 35)); a primer D-YQJK· (5' AAAGCGGGCAAAGCAGA 3' (SEQ ID NO: 36)).(F) the sequences of the primers shown in Figure 10 were as follows: primer Ra (5'CACAGGAAACAGCTATGACCATGATTAAACTAAAGCACCCATTAGTTCA 3 '(SEQ ID NO: 27) that hybridizes to the sequence upstream of the CmR promoter; 28)) which hybridizes to a sequence located adjacent to a transcriptional terminator; primer A-YPHC (5 'GCCATTGCGTTTGAAAG 3' (SEQ ID NO: 29)) primer A-YQJK (5 'TGCTTCGCCGATTTCTT 3' (SEQ ID NO: 30; primer B-YPHC (5 'TAATCATGGTCATAGCTGTTTCCTGTGTATGAAAAGAAACCCTTCAGAG 3' (SEQ ID NO: 31)) which is located adjacent to the yphC start codon; which is located adjacent to the ygjK start codon; primer C-YPHC (5 'GAAATAAATGCATCTGTATTTGAA TGTTTTAGAAAACCGAATCAGAGA 3' (SEQ ID NO: 33)) which is located adjacent to the yphC stop codon; primer C-YQJK (5 'GAAATAGATGTG' SEQ ID NO: 34) ,)), which is located adjacent to the ygjK stop codon; primer D-YPHC (5 'ATTCAGATCGAATACTCCTG 3' (SEQ ID NO: 35)); and primer D-YQJK · (5 'AAAGCGGGCAAAGCAGA 3' (SEQ ID NO: 36)).
Kompetentní buňky, které byly transformovány fúsovanými levými a pravými sousedními molekulami DNA byly inkubovány po dobu 18 hodin při 37 °C na selektivním mediu (LB, 5 μΐ/ml Cm) pro stanovení toho, zda je vybraný gen esenciální (což se • 9 ··*· ·· ···· ·· »9 • 9 9 9 · 9 ♦ · 9 * » · · · · · · · · « • 9 444 4 4 9« · · 9 • 9 · · · · · «999Competent cells that were transformed with the fused left and right flanking DNA molecules were incubated for 18 hours at 37 ° C on selective medium (LB, 5 μΐ / ml Cm) to determine if the selected gene was essential (which • 9 · 9 9 9 9 9 9 9 9 444 4 4 9 9 9 9 9 9 9 «999
99 99 · · · «9 projeví absencí růstu kolonií) nebo ne-esenciální (což se projeví růstem desítek až stovek kolonií). Když byly tyto deleční pokusy provedeny s yphC a ygjK geny samostatně, nebyly na selektivním mediu detekovány žádné kolonie, což ukazuje na to, že každý z těchto genů je esenciální pro přežívání B. subtilis.99 99 · · · «9 (absence of colony growth) or non-essential (which results in growth of tens to hundreds of colonies). When these deletion experiments were performed with the yphC and ygjK genes alone, no colonies were detected on the selective medium, indicating that each of these genes is essential for B. subtilis survival.
Několik kontrolních pokusů bylo provedeno pro potvrzení toho, že pozorovaná absence růstu byla způsobena esenciálním charakterem Β-yphC a Β-ygjK genů. Při podobných PCR reakcích a transformacích za využití genů, o kterých je známo, že nejsou esenciální, byly získány stovky kolonií, což ukazuje na to, že pokusné podmínky byly adekvátní pro zajištění toho, aby byla absence růstu kolonií ukazatelem esenciality genu. Také bylo prokázáno, že inserce CmR genu má nepolární vliv na dále lokalizované geny a umožňuje účinnou expresi dále lokalizovaných genů.Several control experiments were performed to confirm that the observed absence of growth was due to the essential character of the Β-yphC and Β-ygjK genes. In similar PCR reactions and transformations using genes known not to be essential, hundreds of colonies were obtained, indicating that the experimental conditions were adequate to ensure that the absence of colony growth was an indicator of gene essentiality. It has also been shown that insertion of the CmR gene has a non-polar effect on downstream genes and allows efficient expression of downstream genes.
Druhá strategie použitá pro získání delečních mutantů yphC a ygjK genů B. subtilis obsahovala konstrukci podmíněných nulových mutantů, u kterých může být ukončena exprese vybraného genu a na kterých může být pozorován mutantní fenotyp (obr. 11A-11C). V těchto mutantech byla přirozená kopie yphC nebo ygjK genu umístěna pod kontrolu B. subtilis Para promotoru, což je jemně regulovatelný promotor, který může účinně vypínat expresi genu. Tyto regulovatelné genetické konstrukty byly potom insertovány do chromosomu B. subtilis. Jak je uvedeno na obr. 11A, regulovatelné genetické konstrukty obsahovaly sekvenci amylasového genu (amy) a CmR sekvenci pro integraci do chromosomu v amy lokusu. Narušení amy genu dvojitým crossing-overem je pro buňku neškodné a rekombinanty jsou snadno detekovány na škrobových plotnách, protože amy buňky rostou v koloniích s transparentním halo.The second strategy used to obtain deletion mutants of the B. subtilis yphC and ygjK genes involved the construction of conditional null mutants in which expression of the selected gene could be terminated and on which a mutant phenotype could be observed (Figs. 11A-11C). In these mutants, a natural copy of the yphC or ygjK gene was placed under the control of the B. subtilis Para promoter, which is a finely-regulated promoter that can effectively turn off gene expression. These controllable genetic constructs were then inserted into the B. subtilis chromosome. As shown in Fig. 11A, controllable genetic constructs contained the amylase gene (amy) sequence and the CmR sequence for integration into the chromosome at the amy locus. Disruption of the amy gene by double crossing-over is harmless to the cell and recombinants are readily detected on starch plates because amy cells grow in transparent halo colonies.
·· ···· ·» ♦·«· ·· ·· • · · Φ Φ ' Φ « · ♦ · • φ φ φφφ φφφφ φ φ φφφ φφ φφ φφ φ φφφφ φφφ φφφφ φφ φφ φ» · · · «φ· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Φ »» »φ» φ
Po integraci regulovatelných yphC nebo ygjK genů do chromosomu přirozených buněk se získané buňky připraví a transformují se fúsním PCR fragmentem obsahujícím odstranitelný markér pro resistenci (obr. 11B), jak byl popsán výše. V tomto případě obsahoval fúsní PCR fragment gen pro resistenci na kanamycin z B. subtilis (Kan) místo CmŘ genu. Selekce pro tento Kan markér během transformace buněk obsahujících ektopicky insertované regulované yphC a ygjK geny byla provedena za přítomnosti arabinosy pro umožnění exprese yphC a ygjK genů a trans-komplementaci delece (obr. 11C).After the integration of the regulatable yphC or ygjK genes into the chromosome of the natural cells, the obtained cells are prepared and transformed with a fusion PCR fragment containing a removable resistance marker (Fig. 11B) as described above. In this case, the fusion PCR fragment contained the kanamycin resistance gene from B. subtilis (Kan) instead of the CmR gene. Selection for this Kan marker during transformation of cells containing ectopically inserted regulated yphC and ygjK genes was performed in the presence of arabinose to allow expression of yphC and ygjK genes and trans-complementation of the deletion (Fig. 11C).
YphC a ygjK mutanty získané tímto způsobem byly schopné růstu na selektivním mediu (LB Kan) za přítomnosti 0,2% arabinosy, zatímco selekce provedená na přirozených buňkách nevedla k zisku žádných mutantů. Kolonie obsahující regulované geny a jejich delece byly potom odebrány a umístěny na podobné medium (LB Kan, 0,2% arabinosa) a na plotny obsahující selektivní medium s nižší koncentrací arabinosy, žádnou arabinosu nebo 0,2% glukosu. Po 18 hodinové inkubaci pro umožnění růstu kolonií byly jedinými plotnami obsahujícími — kolonie ty plotny, které obsahovaly 0,2%, 0,02% nebo 0,002% arabinosu. Nižší koncentrace indukčních nebo represních podmínek (t.j. chybění arabinosy nebo přítomnost glukosy) neumožňovaly růst buněk a tvorbu kolonií. Proto tyto pokusy ukazují, že: (I) delece vytvořená fúsní PCR neovlivňuje předpokládané esenciální geny za yphC nebo ygjK, protože exprese pouze jednoho z těchto genů vedla k účinné komplementaci; a (ii) exprese yphC a ygjK genů je nezbytná-pro přežívání buněk B. subtilis.The YphC and ygjK mutants obtained by this method were able to grow on selective medium (LB Kan) in the presence of 0.2% arabinose, while selection performed on natural cells did not yield any mutants. Colonies containing the regulated genes and their deletions were then picked and plated on a similar medium (LB Kan, 0.2% arabinose) and on plates containing a selective medium with a lower arabinose concentration, no arabinose or 0.2% glucose. After an 18 hour incubation to allow colony growth, the only colonies containing the colonies were those containing 0.2%, 0.02% or 0.002% arabinose. Lower concentrations of induction or repression conditions (i.e., lack of arabinose or the presence of glucose) did not allow cell growth and colony formation. Therefore, these experiments show that: (I) the deletion generated by the fusion PCR does not affect the putative essential genes beyond yphC or ygjK, since expression of only one of these genes resulted in efficient complementation; and (ii) expression of the yphC and ygjK genes is necessary for the survival of B. subtilis cells.
Pokusy popsané výše potvrdily, že Β-yphC a Β-ygjK geny jsou esenciální pro B. subtilis. Tyto pokusy vedly k zisku ftft ftftftft ftft ftftftft • · · · ♦ · ftftftft ftftft ftftft ftftftft ····»··»»«· ftft ftft ftft · ftft ftft podmíněně lethálních kmenů, které mohou být použity v různých skríningových testech a postupech, včetně testů využívájicích nadměrné nebo snížené exprese, transkripčního profilování atd. Příprava vyřazovacích mutací yphC a ygjK genů může být provedena za použití jakýchkoliv v oboru známých technik.The experiments described above confirmed that the Β-yphC and Β-ygjK genes are essential for B. subtilis. These experiments have led to the acquisition of ftft ftftftft ftft ftftftft conditionally lethal strains, which can be used in various screening tests and procedures , including assays using over or under expression, transcriptional profiling, etc. Preparation of knockout mutations of yphC and ygjK genes can be performed using any techniques known in the art.
Testy esenciálního charakteru ortologů yphC a ygjK v E. coliEssential character tests of yphC and ygjK orthologs in E. coli
Objev toho, že yphC a ygjK geny jsou esenciální pro Streptococcus pneumoniae a B. subtilis naznačuje, že tyto geny jsou esenciální pro všechny gram-pozitivní bakterie. Pro další rozšíření tohoto zjištění na gram-negativní bakterie, a proto na všechny bakterie, byly připraveny deleční mutanty pro ortology yphC a ygjK v E. coli.The discovery that yphC and ygjK genes are essential for Streptococcus pneumoniae and B. subtilis suggests that these genes are essential for all gram-positive bacteria. To further extend this finding to gram-negative bacteria and therefore to all bacteria, deletion mutants were prepared for yphC and ygjK orthologs in E. coli.
Obecná strategie použitá pro přípravu genových deleci v E. coli vedoucích k zisku podmíněně nulových mutantů je schematicky znázorněna na obr. 12. Nejprve byla kopie přirozeného genu, který má být deletován, klonována do selektovateiného vektoru obsahujícího Pbad promotor E. coli.The general strategy used to prepare gene deletions in E. coli resulting in conditionally zero mutants is shown schematically in Figure 12. First, a copy of the natural gene to be deleted was cloned into a selectable vector containing the E. coli Pbad promoter.
Tento E. coli promotor se spouští přítomností arabinosy a je jemně kontrolovatelný, stejně jako promotor použitý pro B. subtilis, jak bylo popsáno výše. Buňky obsahující tento vektor byly potom použity pro vložení delece ve čtecím rámci vybraného genu pomocí nahrazení genu bezmarkerovou malou sekvencí velikosti přibližně 30 nukleotidů.This E. coli promoter is triggered by the presence of arabinose and is finely controllable, as is the promoter used for B. subtilis as described above. Cells containing this vector were then used to insert a deletion in the reading frame of the selected gene by replacing the gene with a nomarker small sequence of approximately 30 nucleotides.
Regiony před a za vybraným genem byly amplifikovány PCR za použití primerů, které vkládají 27-30 nukleotidovou sekvenci.The regions upstream and downstream of the selected gene were amplified by PCR using primers that insert a 27-30 nucleotide sequence.
Fúsní PCR reakce byly provedeny pouze s těmito dvěma fragmenty, které jsou spojeny sekvencí umístěnou mezi nimi, která nahrazuje vybraný gen.Fusion PCR reactions were performed only with these two fragments, which are joined by a sequence located between them that replaces the selected gene.
·*··*··« : .: :· * ·· * ·· «:.
tftf ··« tf • « · · « tftftf ·· t tf «tf
Tento fragment byl potom klonován do teplotně sensitivního selektovatelného plasmidu pKO-3 a byl ínsertován do chromosomu za použití běžných technik (viz například Church et al., 1997, J. Bacteriol.). Vzniklá delece ve čtecím rámci byla komplementována expresí přirozeného genu z Pbad vektoru za přítomnosti arabinosy (obr. 11C, P zapnut). Deleční mutant může potlačovat genovou expresi v nepřítomnosti arabinosy, v přítomnosti glukosy (P vypnut) nebo v přítomnosti streptomycinu bez IPTG, což umožňuje ztrátu plasmidu (protože sekvence rozpoznávající počátek.replikace komplementující Pbad plasmid je pod lac-IPTG kontrolou).This fragment was then cloned into the temperature-sensitive selectable plasmid pKO-3 and was inserted into the chromosome using conventional techniques (see, for example, Church et al., 1997, J. Bacteriol.). The resulting deletion in the reading frame was complemented by expression of the natural gene from the Pbad vector in the presence of arabinose (Fig. 11C, P on). The deletion mutant may suppress gene expression in the absence of arabinose, in the presence of glucose (P switched off), or in the presence of streptomycin without IPTG, thus allowing plasmid loss (since the Pbad plasmid complementary origin recognition sequence is under lac-IPTG control).
Jak je uvedeno na obr. 12, delece yphC sekvence v E. coli a její nahrazení sekvencí v přítomnosti komplementujícího plasmidu Pbad-yphC ortolog vede k zisku mutantů, které dobře rostou na arabinosových plotnách, ale které nerostou na glukosových nebo streptomycinových plotnách. Tento výsledek naznačuje, že yfgK gen (t.j. yphC ortolog E. coli) je esenciální pro přežívání E. coli. Naopak, podobné pokusy provedené s ygjK ortologem E. coli, elaC, ukázaly významný růst buněk za všech podmínek, což naznačuje, že ygjK gen není esenciální pro E. coli. Alternativně je možné, že i jiné E. coli geny mající arylsulfatasovou/fosfatasovou aktivitu, které nemají podobnou sekvenci, jsou schopné doplňovat chybějící funkci elaC.As shown in Fig. 12, deletion of the yphC sequence in E. coli and its replacement by sequences in the presence of the complementing plasmid Pbad-yphC ortholog results in mutants that grow well on arabinose plates but which do not grow on glucose or streptomycin plates. This result suggests that the yfgK gene (i.e., the yphC ortholog of E. coli) is essential for survival of E. coli. In contrast, similar experiments performed with the ygjK ortholog of E. coli, elaC, showed significant cell growth under all conditions, suggesting that the ygjK gene is not essential for E. coli. Alternatively, it is possible that other E. coli genes having arylsulfatase / phosphatase activity that do not have a similar sequence are capable of complementing the missing elaC function.
Skutečnost, že ortology yphC genu v B. subtilis a E. coli jsou esenciální pro přežívání naznačuje, že tento gen je esenciální pro všechny bakterie, ve kterých je přítomen. YgjK gen, který je esenciální pro přežívání S. pneumoniae a B. subtilis, je patrně esenciální pro všechny gram-pozitivní bakterie, ale není esenciální pro E. coli. Proto seThe fact that the orthologs of the yphC gene in B. subtilis and E. coli are essential for survival suggests that this gene is essential for all bacteria in which it is present. The YgjK gene, which is essential for the survival of S. pneumoniae and B. subtilis, appears to be essential for all gram-positive bacteria but not essential for E. coli. That's why
BMBwamasgBMBwamasg
4499 99 9444 44 494499 99 9444 44
4 Φ * Φ φ Φ · » Φ4 Φ * Φ φ Φ · »Φ
ΦΦΦ Φ Φ Φ ΦΦΦΦΦΦΦΦ Φ Φ Φ ΦΦΦΦ
Φ Φ · Φ Φ ΦΦ φφ ΦΦ Φ •ΦΦΦ ΦΦΦ ΦΦΦΦΦ Φ · Φ Φ φφ ΦΦ Φ • ΦΦΦ ΦΦΦ ΦΦΦΦ
ΦΦ ΦΦ ΦΦ · ΦΦ ΦΦ předpokládá, že antibakteriální činidlo namířené proti yphC genu nebo proti produktu tohoto genu bude mít široké spektrum antibakteriální aktivity (včetně gram-pozitivních a gramnegativní ch bakterií), zatímco antibakteriální činidlo namířené proti ygjK genu nebo proti produktu tohoto genu bude mít patrně antibakteriální aktivitu proti gram-pozitivním bakteriím.ΦΦ ΦΦ ΦΦ · ΦΦ ΦΦ anticipates that the antibacterial agent directed against the yphC gene or the product thereof will have a broad spectrum of antibacterial activity (including gram-positive and gram-negative bacteria), while the antibacterial agent directed against or the product of this gene will be to have antibacterial activity against gram-positive bacteria.
Identifikace esenciálních genů a polypeptidů v dalších bakteriálních kmenechIdentification of essential genes and polypeptides in other bacterial strains
YphC a ygjK geny a různé jejich ortologické geny nebo jejich fragmenty mohou být použity pro detekci homologických nebo ortologických genů I v dalších organismech, přesněji, tyto geny mohou být použity pro analýzu různých patogenních a nepatogenních kmenů bakterií. Fragmenty nukleové kyseliny (DNA nebo RNA) kódující esenciální polypeptid, homolog nebo ortolog (nebo sekvence komplementární k těmto sekvencím) mohou být použity jako sondy v běžných testech využívajících hybridizace nukleových kyselin pro testování jiných bakterií. Například, sondy tvořené nukleovou kyselinou (které mají obvykle délku 830, nebo lépe 15-20 nukleotidů) mohou být použity pro detekci esenciálních genů nebo jejich homologických nebo ortologických genů v běžných metodách molekulární biologie, jako je southernový přenos, northernový přenos, přenos na skvrnách, PCR amplifikace, metody hybridizace kolonií a podobně. Obvykle je oligonukleotidová sonda připravená podle zde popsané sekvence nebo jejího fragmentu označena a je použita pro prohledávání genomové knihovny připravené z mRNA získané z vybraného bakteriálního kmene. Mezi vhodné metody v z 32 pro značení patří použití polynukleotid kinasy pro přidaní Pznačeného ATP k oligonukleotidu použitému jako sonda. Tento φφφφ φφ φφφ φ φφ φφφ φφφ#* φφφ φφφ φφφφ • · φ φ φ · φ φφφφ· φφφφφφφ φφφ» ~ι ·· φφ φ· φ φφ φφ způsob je dobře známý v oboru, stejně jako několik dalších způsobů (například biotinylace a značení enzymem).The YphC and ygjK genes and their various orthologic genes or fragments thereof can be used to detect homologous or orthologous genes in other organisms, more specifically, these genes can be used to analyze various pathogenic and non-pathogenic strains of bacteria. Nucleic acid fragments (DNA or RNA) encoding an essential polypeptide, homolog or ortholog (or sequences complementary to these sequences) can be used as probes in conventional assays utilizing nucleic acid hybridization to test other bacteria. For example, nucleic acid probes (which are typically 830, or preferably 15-20 nucleotides in length) can be used to detect essential genes or their homologous or orthologic genes in conventional molecular biology methods such as southern transfer, northern transfer, staining , PCR amplification, colony hybridization methods and the like. Typically, an oligonucleotide probe prepared according to the sequence or fragment thereof described herein is labeled and is used to screen a genomic library prepared from an mRNA obtained from a selected bacterial strain. Suitable methods for labeling include the use of a polynucleotide kinase to add P-labeled ATP to the oligonucleotide used as a probe. This φφφφ φφ φφφ φ φφ φφφ φφφ # * φφφ φφφ φφφφ • · · φ φ φ φ φφφφ · φφφφφφφ φφφ »~ ι ·· · φφ φ φ φφ φφ method is well known in the art, as well as several other ways (such as biotinylation and enzyme labeling).
Hybridizace oligonukleotidové sondy na knihovnu nebo na jiný vzorek nukleové kyseliny je obvykle provedena za podmínek střední až vysoké přísnosti. Stabilita duplexu nebo hybridu nukleové kyseliny je vyjádřena jako teplota tání nebo Tm, což je teplota, při které sonda disociuje z cílové DNA. Tato teplota tání je použita pro definování nutných podmínek přísnosti. Pokud jsou sekvence, které mají být identifikovány, příbuzné nebo významně identické se sondou, nikoliv zcela identické, ta je výhodné nejprve určit nejnižší teplotu, při které probíhá pouze homologická hybridizace při určité koncentraci soli (například SSC nebo SSPE). Potom je teplota konečného výplachu při hybridizační reakci snížena podle předpokladu, že 1% chybných párů vede ke snížení Tm o 1 °C (například, pokud se předpokládá > 95% identita sekvence se sondou, tak je teplota konečného výplachu snížena o 5 °C) . V praxi může být změna Tm mezi 0,5 a 1,5 °C na 1% chybných párů.Hybridization of an oligonucleotide probe to a library or other nucleic acid sample is usually performed under conditions of moderate to high stringency. The stability of the duplex or nucleic acid hybrid is expressed as the melting point or T m , which is the temperature at which the probe dissociates from the target DNA. This melting point is used to define the necessary stringency conditions. If the sequences to be identified are related or significantly identical to the probe, and not entirely identical, it is preferred to first determine the lowest temperature at which only homologous hybridization occurs at a particular salt concentration (e.g., SSC or SSPE). Then, the final wash temperature in the hybridization reaction is lowered assuming that 1% mismatches result in a T m decrease of 1 ° C (for example, if> 95% sequence identity to the probe is assumed, the final wash temperature is reduced by 5 ° C ). In practice, the T m change may be between 0.5 and 1.5 ° C to 1% of the wrong pairs.
Přísnými podmínkami hybridizace jsou, například, hybridizace při 68 °C v 5X SSC/ 5x Denhartův roztok / 1,0% SDS, nebo v 0,5 M NaHPO4 (pH 7,2)/1 mM EDTA/7% SDS, nebo v 50% formamidu/0,25 M NaHPO4 (pH 7,2)/0,25 M NaCl/1 mM EDTA/ 7% SDS; a promývání ve 0,2x SSC/O,1= SDS při teplotě okolí nebo při 42 °C, nebo v 0,lx SDS při 68 °C, nebo v 40 mM NaHPO4 (pH 7,2)/1 mM EDTA/5% SDS při 50 °C, nebo v 40 mM NaHPO4 (pH 7,2)/1 mM EDTA/1% SDS při 50 °C. Středně přísné podmínky jsou například promývání ve 3x SSC při 42 °C. Parametry koncetrace solí a teploty se mohou lišit pro dosažení optimální úrovně identity mezi sondou a cílovou nukleovou kyselinou. Další popis takových podmínek lze zjistit v odborné literatuře, například v Sambrook et al., 1989, Molecular Cloning, A Laboratory ♦ · ·*· ·Stringent hybridization conditions are, for example, hybridization at 68 ° C in 5X SSC / 5x Denhart's solution / 1.0% SDS, or in 0.5 M NaHPO 4 (pH 7.2) / 1 mM EDTA / 7% SDS, or in 50% formamide / 0.25 M NaHPO 4 (pH 7.2) / 0.25 M NaCl / 1 mM EDTA / 7% SDS; and washing in 0.2x SSC / 0.1 = SDS at ambient temperature or at 42 ° C, or at 0.1x SDS at 68 ° C, or in 40 mM NaHPO 4 (pH 7.2) / 1 mM EDTA / 5% SDS at 50 ° C, or in 40 mM NaHPO 4 (pH 7.2) / 1 mM EDTA / 1% SDS at 50 ° C. Medium stringent conditions are, for example, washing in 3x SSC at 42 ° C. Salt concentration and temperature parameters may vary to achieve optimal levels of identity between the probe and the target nucleic acid. Further descriptions of such conditions can be found in the literature, for example, in Sambrook et al., 1989, Molecular Cloning, A Laboratory.
88
99
8 08 0
9 8 • 99 8 • 9
9 89 8
99
Manual, Cold Spring Harbor Press, N.Y.; a Ausubel et al. (eds), 1995, Current Protocols in Molecular Biology, (John Wiley and Sons, N.Y.) v kapitole 2.10.Manual, Cold Spring Harbor Press, N.Y .; and Ausubel et al. (eds), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.) in Chapter 2.10.
V jednom přístupu mohou být testovány knihovny konstruované z patogenních a nepatogenních kmenů bakterií. Například mohou být takové kmeny testovány na expresi esenciálních genů analýzou northernovým přenosem. Po detekci transkriptů esenciálních genů nebo jejich homologů mohou být z RNA izolované z vhodného kmene připraveny knihovny, za použití standardních technik známých v oboru. Alternativně může být za použití sondy pro esenciální gen (nebo sondy pro homolog esenciálního genu) testována knihovna úplné genomové DNA.In one approach, libraries constructed from pathogenic and non-pathogenic bacterial strains can be tested. For example, such strains can be tested for expression of essential genes by Northern blot analysis. After detection of essential gene transcripts or homologues thereof, libraries can be prepared from RNA isolated from a suitable strain, using standard techniques known in the art. Alternatively, a full genomic DNA library can be tested using an essential gene probe (or a probe for an essential gene homolog).
Nové genové sekvence mohou být izolovány, například, provedením PCR za použití dvou sestav degenerovaných oligonukleotidových primerů navržených podle nukleotidových sekvencí v esenciálních genech nebo v homologních nebo ortologních genech, jak jsou zde popsány. Templátem pro reakci může být DNA získaná z kmenů, o kterých je známo, nebo o kterých se předpokládá, že exprimují esenciální alelu nebo alelu homologního nebo ortologního genu. Produkt PCR může být subklonován a sekvencován pro potvrzení toho, že amplifikované sekvence představují sekvence nových esenciálních nukleových kyselin nebo sekvence homologů takových nukleových kyselin.New gene sequences can be isolated, for example, by performing PCR using two sets of degenerate oligonucleotide primers designed according to nucleotide sequences in essential genes or in homologous or orthologous genes as described herein. The template for the reaction may be DNA obtained from strains known or believed to express an essential allele or allele of a homologous or orthologous gene. The PCR product may be subcloned and sequenced to confirm that the amplified sequences represent new essential nucleic acid sequences or homologous sequences of such nucleic acids.
Syntéza různých esenciálních polypeptidů nebo jejich homologů nebo ortologů (nebo jejich antigenních fragmentů) pro použití jako antigeny, nebo pro jiné účely, může být snadno provedena za použití různých v oboru známých technik.The synthesis of various essential polypeptides or homologues or orthologs (or antigenic fragments thereof) for use as antigens or for other purposes can be readily accomplished using various techniques known in the art.
Například, esenciální polypeptid nebo jeho homolog nebo ortolog nebo jeho antigenní fragment může být syntetizován chemicky in vitro nebo enzymaticky (například in vitroFor example, an essential polypeptide or homolog or ortholog or antigenic fragment thereof may be synthesized chemically in vitro or enzymatically (for example, in vitro).
9 9 · · 9 *9 9 9 9 9 99 «9 • 9 9 99 9 999*9 9 · · 9 * 9 9 9 9 9 99
9 99 9 9999 *99*9 9*9999 99 9 9999 * 99 * 9 * 999 *
9*9* 999 *9*99 * 9 * 999 * 9 * 9
99 99 9 99 99 transkripcí a translací). Alternativně gen může být exprimován buňkách (například v kultivovaných buňkách) a může být přečištěn z buněk za použití mnoha dostupných systémů pro expresi genů. Například, polypeptidový antigen může být produkován v prokaryotickém hostiteli (například v E. coli nebo v B. subtilis) nebo v eukaryotických buňkách, jako jsou například kvasinky nebo hmyzí buňky (například za použití baculovirového expresního vektoru).99 99 9 99 99 transcription and translation). Alternatively, the gene can be expressed in cells (e.g., in cultured cells) and can be purified from the cells using a variety of gene expression systems available. For example, the polypeptide antigen may be produced in a prokaryotic host (e.g., E. coli or B. subtilis) or in eukaryotic cells, such as yeast or insect cells (e.g., using a baculovirus expression vector).
Proteiny a polypeptidy mohou být také produkovány v rostlinných buňkách, pokud je to žádoucí. Pro rostlinné buňky jsou vhodné virové expresní vektory (například virus květákové mozaiky a virus tabákové mozaiky). Takové buňky jsou dostupné z mnoha zdrojů (například od American Type Culture Collection, Rockland, MD; též viz Ausubel et al. (eds), 1995, Current Protocols in Molecular Biology, (John Wiley and Sons, N.Y., 1994). Optimální metoda pro transformaci nebo transfekci a volba vehikula pro expresi závisí na vybraném hostitelském systému. Metody pro transformaci a transfekci jsou popsány, například, v Ausubel et al., výše; vehikula pro expresi mohou být vybrány z vehikul uvedených například v Cloning Vectors: A Laboratory manual (P.H. Pouwels et al., 1985, Supp., 1987). Hostitelské buňky obsahující expresní vehikulum mohou být kultivovány v běžném živném mediu upraveném podle potřeby pro aktivaci vybraného genu, potlačení vybraného genu, selekci transformantů nebo pro amplifikaci vybraného genu.Proteins and polypeptides can also be produced in plant cells, if desired. Viral expression vectors (e.g., cauliflower mosaic virus and tobacco mosaic virus) are suitable for plant cells. Such cells are available from a variety of sources (e.g., American Type Culture Collection, Rockland, MD; also see Ausubel et al. (Eds), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, NY, 1994). for transformation or transfection, and the choice of expression vehicle depends on the host system selected The methods for transformation and transfection are described, for example, in Ausubel et al., supra, expression vehicles may be selected from those listed, for example, in Cloning Vectors: A Laboratory manual (PH Pouwels et al., 1985, Supp., 1987) Host cells containing an expression vehicle can be cultured in a conventional nutrient medium adapted to activate the selected gene, suppress the selected gene, select transformants, or amplify the selected gene.
Pokud je to žádoucí, mohou být yphC a ygjK polypeptidy nebo jejich homology nebo ortology produkovány jako fúsní proteiny. Například, expresní vektor pUR278 (Ruther et al., EMBO J., 2: 1791, 1983) může být použit pro vytvoření lacZ fúsních proteinů. V oboru známé pGEX vektory mohou být použity pro expresi cizorodých polypeptidů ve formě fúsních proteinů s ’esR’H®«KS535S5SSgKS5g^^ • · ··*· ♦-* » ··♦ • · ·· • ·*«· ··· ·· >· **If desired, yphC and ygjK polypeptides or homologs or orthologs thereof may be produced as fusion proteins. For example, the expression vector pUR278 (Ruther et al., EMBO J., 2: 1791, 1983) can be used to generate lacZ fusion proteins. PGEX vectors known in the art can be used to express foreign polypeptides in the form of fusion proteins with " esR " H ' KS535S5SSgKS5g ^^ < - > **
«.··· ·· ·· • «··♦ • ·#·· » ·· ·· « ♦ «·«· » ** ·* glutathion-S-transferasou (GST). Obyčejně jsou takové fúsní proteiny solubilní a mohou být snadno přečištěny z lyžovaných buněk pomocí adsorpce na glutathion-agarosové korálky, po které následuje eluce za přítomnosti volného glutathionu. pGEX vektory jsou navrženy tak, aby obsahovaly proteasová štěpící místa pro trombin nebo faktor Xa, takže může být produkt klonovaného genu uvolněn z GST skupiny.Glutathione-S-transferase (GST) *. * Glutathione-S-transferase (GST). Generally, such fusion proteins are soluble and can be readily purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. pGEX vectors are designed to contain thrombin or factor Xa protease cleavage sites so that the cloned gene product can be released from the GST moiety.
V příkladném expresním systému může být bakulovirus, jako je virus Autographa californica nukleární polyhedrosis (AcNPV), který roste v buňkách Spodoptera frugiperda, použit jako vektor pro expresi cizorodých genů. Kódující sekvence pro esenciální polypeptid nebo jeho homolog nebo ortolog může být klonována do neesenciálního regionu (například do genu pro polyhedrin) virového genomu a může být umístěna pod kontrolou promotoru, například polyhedrinového promotoru nebo exogenního promotoru. Úspěšná inserce genu kódujícího esenciální polypeptid nebo jeho homolog může vést k inaktivaci polyhedrinovéhc genu a k produkci neuzavřeného rekombinantního viru (t.j. viru bez proteinového obalu kódovaného polyhedrinovým genem). Tyto rekombinantní viry jsou potom obvykle použity pro infikování hmyzích buněk (například buněk Spodoptera frugiperda), ve kterých je insertovaný gen exprimován (viz například Smith et al., J. Virol., 46: 584, 1983; Smith, U.S. patent č. 4215051). Pokud je to vhodné, mohou být místo hmyzích buněk použity savčí buňky, s podmínkou, že virus je geneticky upraven tak, že gen kódující vybraný polypeptid je umístěn pod kontrolou promotoru, který je aktivní v savčích buňkách.In an exemplary expression system, a baculovirus such as Autographa californica nuclear polyhedrosis virus (AcNPV) that grows in Spodoptera frugiperda cells may be used as a vector for expressing foreign genes. The coding sequence for an essential polypeptide, or a homolog or ortholog thereof, may be cloned into a non-essential region (e.g., the polyhedrin gene) of the viral genome and placed under the control of a promoter, e.g., a polyhedrin promoter or exogenous promoter. Successful insertion of a gene encoding an essential polypeptide or homologue thereof may result in inactivation of the polyhedrin gene and production of an unclosed recombinant virus (i.e., a virus without a protein envelope encoded by the polyhedrin gene). These recombinant viruses are then typically used to infect insect cells (e.g. Spodoptera frugiperda cells) in which the inserted gene is expressed (see, for example, Smith et al., J. Virol., 46: 584, 1983; Smith, US Patent No. 4215051) ). If appropriate, mammalian cells may be used instead of insect cells, provided that the virus is genetically engineered such that the gene encoding the selected polypeptide is placed under the control of a promoter that is active in mammalian cells.
V savčích hostitelských buňkách může být použito mnoha virových expresních systémů. Pokud je jako expresní vektor použit adenovirus, tak může být sekvence nukleové kyseliny φ * ·,«» • · · * · · • 9 φ * φφ ·· *· φφ • · · · φ · * · • « · · ·Many viral expression systems can be used in mammalian host cells. If an adenovirus is used as an expression vector, the nucleic acid sequence may be 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9 and 9.
Φ · · 9· 9
9 4 4 kódující esenciální polypeptid nebo jeho homolog ligována na adenovirový transkripční/translační kontrolní komplex, například na pozdní promotor a trojdílnou vedoucí sekvenci. Tento chimérický gen může být potom insertován do adenovirového genornu pomocí in vitro nebo in vivo rekombinace. Inserce do neesenciálního regionu virového genornu (například do regionu El nebo E3) vede ke vzniku rekombinantního viru, který je životaschopný a který může exprimovat produkt esenciálního genu v infikovaných hostitelských buňkách (viz například Logan, Proč. Nati. Acad. Sci. USA 81: 3655, 1984).A coding essential polypeptide or homolog thereof is ligated to an adenoviral transcription / translation control complex, for example, a late promoter and a tripartite leader sequence. This chimeric gene can then be inserted into the adenoviral genorn by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (for example, into the E1 or E3 region) results in a recombinant virus that is viable and which can express the essential gene product in infected host cells (see, for example, Logan, Proc. Natl. Acad. Sci. USA 81: 3655, 1984).
Pro účinnou translaci insertovaných sekvencí nukleové kyseliny mohou být nutné specifické iniciační signály. Tyto signály obsahují ATG iniciační kodon a okolní sekvence.Specific initiation signals may be required for efficient translation of inserted nucleic acid sequences. These signals include the ATG initiation codon and surrounding sequences.
Obecně, mohou být použity exogenní translační kontrolní signály, včetně ATG iniciačního kodonu. Dále, iniciační kodon musí být ve fázi s čtecím rámcem vybrané kódující sekvence pro zajištění translace celé sekvence. Tyto exogenní translační kontrolní signály a iniciační kodony mohou být různého původu, jak přirozené, tak syntetické. Účinnost exprese může být zvýšena použitím vhodných elementů zesilujících transkripci nebo terminátorů transkripce (Bittner et al., Methods in Enzymology 153: 516, 1987).In general, exogenous translational control signals can be used, including the ATG initiation codon. Furthermore, the initiation codon must be in phase with the reading frame of the selected coding sequence to ensure translation of the entire sequence. These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. Expression efficiency can be enhanced by using appropriate transcription enhancer elements or transcription terminators (Bittner et al., Methods in Enzymology 153: 516, 1987).
Esenciální polypeptidy a jejich homology a ortology mohou být exprimovány samostatně nebo ve formě fúsních proteinů s heterologním polypeptidem, jako je signální sekvence nebo jiný polypeptid mající specifické štěpící místo na N- a/nebo Ckonci proteinu nebo polypeptidu. Vybraná heterologní signální sekvence by měla být taková sekvence, která je rozpoznávána a zpracovávána, t.j. štěpena signální peptidasou, v hostitelské buňce, ve které je fúsní protein exprimován.Essential polypeptides and their homologues and orthologs can be expressed alone or in the form of fusion proteins with a heterologous polypeptide, such as a signal sequence or other polypeptide having a specific cleavage site at the N- and / or C-terminus of the protein or polypeptide. The heterologous signal sequence selected should be one that is recognized and processed, i.e., cleaved by a signal peptidase, in a host cell in which the fusion protein is expressed.
tf· tf··· ·· ···· *· *· • tf * tftf · tftf·· • tftf ··· tftftf· • tf ····· tf···· • tftftf tftftf tftftftf • tf tftf tftf tf ·· tftftf tff tff tff tff tff tff tff tff tff tff tfff tfff tftf tf ·· tftf
Hostitelská buňka může být vybrána tak, aby ovlivňovala požadovaným způsobem expresi insertované sekvence nebo aby modifikovala a zpracovávala produkt genu požadovaným způsobem. Takové modifikace a zpracování (například štěpení) proteinových produktů může usnadnit optimální funkci proteinu. Různé hostitelské buňky mají charakteristické a specifické mechanismy pro post-translační zpracování a modifikaci proteinů a genových produktů. Vhodné buněčné linie nebo hostitelské systémy známé v oboru mohou být vybrány pro zajištění správné modifikace a zpracování exprimovaného cizorodého proteinu. Pro tento účel mohou být použity eukaryotické hostitelské buňky, které obsahují buněčný aparát pro správné zpracování primárního transkriptu a fosforylaci produktu genu. Mezi takové savčí hostitelské buňky patří, bez omezení, CHO, VĚRO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38 a buněčná linie z chorioidálního plexu.The host cell may be selected to affect the expression of the inserted sequence in a desired manner or to modify and process the gene product in a desired manner. Such modifications and processing (e.g., cleavage) of protein products can facilitate optimal protein function. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Suitable cell lines or host systems known in the art may be selected to ensure proper modification and processing of the expressed foreign protein. For this purpose, eukaryotic host cells may be used which contain a cellular machinery for proper processing of the primary transcript and phosphorylation of the gene product. Such mammalian host cells include, without limitation, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and a chorioidal plex cell line.
Pokud je to žádoucí, může být esenciální polypeptid nebo jeho homolog nebo ortolog produkován ve stabilně transfektované savčí buněčné linii. Existuje mnoho vektorů vhodných pro stabilní transfekci savčích buněk (viz například Pouwels et al., výše); způsoby pro přípravu takových buněčných linií jsou také známé v oboru (viz například Ausubel et al., výše). V jednom příkladu je DNA kódující protein klonována do expresního vektoru, který obsahuje gen pro dihydrofolatreduktasu (DHFR). Integrace plasmidu - a proto také genu kódujícího esenciální polypeptid - do chromosomu hostitelských buněk je potvrzena použitím 0,01 - 300 μΜ methotrexatu v buněčném kultivačním mediu (jak je popsáno v Ausubel et al., výše). Tato dominantní selekce může být provedena ve většině typech buněk.If desired, the essential polypeptide or homolog or ortholog thereof may be produced in a stably transfected mammalian cell line. There are many vectors suitable for stable transfection of mammalian cells (see, for example, Pouwels et al., Supra); methods for preparing such cell lines are also known in the art (see, for example, Ausubel et al., supra). In one example, the DNA encoding the protein is cloned into an expression vector that contains the dihydrofolate reductase (DHFR) gene. Integration of the plasmid - and hence the gene encoding the essential polypeptide - into the host cell chromosome is confirmed by using 0.01-300 μ - of methotrexate in the cell culture medium (as described in Ausubel et al., Supra). This dominant selection can be performed in most cell types.
9· ««·· *4' 9«W* • · · 9 9 · 9 9 9 4 ··· 4 9 9 9 4 4 49 · «· 4 '9 W W 9 9 9 9 9 4 4 9 9 9 4 4 4
9 9 4 4 9 9 4 4 4 4 49 9 4 4 9 9 4 4 4 4 5
4 4 9 9 4 4 4 9 9 94 4 9 9 4
44 44 9 99 ft<44 44 9 99 ft
Exprese rekombinantního proteinu může být zesílena DHFR zprostředkovanou amplifikací transfektovaného genu. Způsoby pro selekci buněčných linií nesoucích genové amplifikace jsou popsány v Ausubel et al., výše; takové způsoby obvykle vyžadují kultivaci v mediu obsahujícím postupně se zvyšující koncentrace methotrexatu. DHFR-obsahující expresní vektory běžně používané pro tento účel zahrnují pCVSEII-DHFR a pAdD26SV(A) (jak je popsáno v Ausubel et al., výše).Recombinant protein expression may be enhanced by DHFR mediated amplification of the transfected gene. Methods for selecting cell lines carrying gene amplifications are described in Ausubel et al., Supra; such methods usually require cultivation in a medium containing gradually increasing concentrations of methotrexate. DHFR-containing expression vectors commonly used for this purpose include pCVSEII-DHFR and pAdD26SV (A) (as described in Ausubel et al., Supra).
Může být použito mnoha dalších selekčních systémů, jako jsou například thymidin-kinasové geny viru herpes simplex, hypoxantin-guanin-fosforibosyl-transferasové geny a adeninfosforibosyltransferasové geny, které mohou být použity v tk, hgprt nebo aprt buňkách, v příslušném pořadí. Dále může být použit gpt, který způsobuje resistenci na kyselinu mykofenolovou (Mulligan et al., Proč. Nati. Acad. Sci. USA 78: 2072, 1981); neo, který způsobuje resistenci na aminoglykosid G-418 (Colberre.Garapin et al., J. Mol. Biol. 150: 1, 1981); a hygro, který způsobuje resistenci na hygromycin (Santerre et al., Gene, 30: 147, 1981).Many other selection systems can be used, such as herpes simplex virus thymidine kinase genes, hypoxanthine-guanine phosphoribosyl transferase genes, and adenine phosphoribosyltransferase genes, which can be used in tk, hgprt or aprt cells, respectively. In addition, gpt may be used which causes resistance to mycophenolic acid (Mulligan et al., Proc. Natl. Acad. Sci. USA 78: 2072, 1981); neo, which causes resistance to the aminoglycoside G-418 (Colberre, Garapin et al., J. Mol. Biol. 150: 1, 1981); and hygro, which causes resistance to hygromycin (Santerre et al., Gene, 30: 147, 1981).
Alternativně, jakýkoliv fúsní protein může být snadno přečištěn za použití protilátky nebo jiné molekuly, která se specificky váže na exprimovaný fúsní protein. Například, systém popsaný v Janknecht et al., Proč. Nati. Acad. Sci. USA, 88: 8972 (1981), umožňuje snadné přečištění nedenaturovaných fúsních proteinů exprimovaných v lidských buněčných liniích. V tomto systému je vybraný gen subklonován do vakciniového rekombinantního plasmidu tak, že otevřený čtecí rámec genu je translačně fúsován na amino-koncovou sekvenci skládající se ze šesti histidinových zbytků. Extrakty z buněk infikovaných rekombinantním vakciniovým virem jsou vneseny do Ni kyselina nitriloctová-agarosových kolon a proteiny s navázanou «··· ·· ···· ·· ·« • « ··· ····· • · · ♦ · r · · · · • · «···· · · · · *Alternatively, any fusion protein can be readily purified using an antibody or other molecule that specifically binds to the expressed fusion protein. For example, the system described in Janknecht et al., Proc. Nati. Acad. Sci. USA, 88: 8972 (1981), allows easy purification of non-denatured fusion proteins expressed in human cell lines. In this system, the selected gene is subcloned into the vaccinia recombinant plasmid such that the open reading frame of the gene is fused translationally to an amino-terminal sequence consisting of six histidine residues. Extracts from cells infected with the recombinant vaccinia virus are introduced into Ni-nitriloacetic acid-agarose columns and proteins coupled to the · · r r r r r r r r r r r r r · · · · · · · ·
0 ······· ···· «· ·· »+ ♦ ·· ·· histidinovou sekvencí jsou selektivně eluovány pufry obsahujícími imidazol.The histidine sequence is selectively eluted with buffers containing imidazole.
Alternativně může být yphC nebo ygjK nebo jejich homolog nebo ortolog fúsován na imunoglobulinovou Fc doménu. Takové fúsní proteiny mohou být snadno přečištěny, například, za použití protein A kolony. Kromě toho takové fúsní proteiny umožňují produkci chimérických forem esenciálního polypeptidu nebo jeho homologu nebo ortologu, které mají vyšší stabilitu in vivo.Alternatively, yphC or ygjK or a homolog or ortholog thereof may be fused to an immunoglobulin Fc domain. Such fusion proteins can be readily purified, for example, using a protein A column. In addition, such fusion proteins allow the production of chimeric forms of an essential polypeptide, or a homologue or ortholog thereof, that have greater stability in vivo.
Po expresi rekombinantního esenciálního polypeptidu (nebo jeho homologu) může být tento polypeptid izolován (t.j. přečištěn). Secernované formy polypeptidů mohou být izolovány z buněčného kultivačního media, zatímco nesecernované formy musí být izolovány z hostitelských buněk. Polypeptidy mohou být izolovány afinitní chromatografii. Například, anti-yphC protilátka (připravená například zde popsaným způsobem) může být navázána na kolonu a může být použita pro izolaci proteinu. Lýza a frakcionace buněk obsahujících protein před afinitní chromatografii může být provedena za použití standardních metod (viz například Ausubel et al., výše). Alternativně může být připraven fúsní protein a může být použit pro izolaci esenciálního polypeptidu (například yphCmaltosový fúsní protein, yphC-P-galaktosidasový fúsní protein nebo yphC-trpE fúsní protein; viz například Ausubel et al., výše; New England Biolabs Catalog, Beverly, MA). Rekombinantní protein může být, pokud je to vhodné, dále přečištěn, například vysoce výkonnou kapalinovou chromatografii za použití běžných technik (viz například Fisher, Laboratory Techniques in Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980).After expression of the recombinant essential polypeptide (or homologue thereof), the polypeptide may be isolated (i.e. purified). The secreted forms of the polypeptides may be isolated from the cell culture medium, while the non-secreted forms must be isolated from the host cells. Polypeptides can be isolated by affinity chromatography. For example, an anti-yphC antibody (prepared, for example, as described herein) can be coupled to a column and used for protein isolation. Lysis and fractionation of protein containing cells prior to affinity chromatography can be performed using standard methods (see, for example, Ausubel et al., Supra). Alternatively, a fusion protein may be prepared and used to isolate an essential polypeptide (e.g., a yphC-maltose fusion protein, a yphC-β-galactosidase fusion protein or a yphC-trpE fusion protein; see, e.g., Ausubel et al., Supra; New England Biolabs Catalog, Beverly, MA). The recombinant protein may, if appropriate, be further purified, for example, by high performance liquid chromatography using conventional techniques (see, for example, Fisher, Laboratory Techniques in Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980).
wiaiuji ·« ···<wiaiuji · «··· <
Za použití zde uvedené aminokyselinové sekvence mohou být polypeptidy použitelné při provádění předkládaného vynálezu, hlavně fragmenty esenciálních polypeptidu, připraveny standardní chemickou syntézou (například za použití metod popsaných v Solid Phase Peptide Synthesis, 2. vydání, The Pierce Chemical Co., Rockford, IL, 1984) a mohou být použity například jako antigeny.Using the amino acid sequence disclosed herein, polypeptides useful in practicing the present invention, especially fragments of essential polypeptides, can be prepared by standard chemical synthesis (for example, using the methods described in Solid Phase Peptide Synthesis, 2nd Edition, The Pierce Chemical Co., Rockford, IL). 1984) and can be used, for example, as antigens.
ProtilátkyAntibodies
YphC a ygjK polypeptidy (nebo jejich antigenní fragmenty nebo analogy takových polypeptidů) mohou být použity pro přípravu protilátek použitelných v předkládaném vynálezu a takové polypeptidy mohou být připraveny rekombinantně nebo technikami peptidové syntézy ( viz například Solid Phase Peptide Synthesis, výše; Ausubel et al., výše). Podobně mohou být získány protilátky namířené proti homologům a ortologům yphC a ygjK (nebo antigenním fragmentům a analogům takových homologů a ortologů). Obecně, polypeptidy mohou být navázány na proteinový nosič, jako je KLH, jak je popsáno v Ausubel et al., výše, mohou být smíseny s adjuvans a mohou být injikovány do savce. Nosič je substance, která zvyšuje stabilitu a/nebo napomáhá nebo zvyšuje transport nebo imunogenicitu molekuly, která je na něj navázána. Protilátky mohou být přečištěny, například, metodami afinitní chromatografie, ve kterých je polypeptidový antigen navázán na pryskyřici.YphC and ygjK polypeptides (or antigenic fragments thereof or analogs thereof) may be used to prepare antibodies useful in the present invention, and such polypeptides may be prepared recombinantly or by peptide synthesis techniques (see, for example, Solid Phase Peptide Synthesis, supra; Ausubel et al., above). Similarly, antibodies directed against yphC and ygjK homologs and orthologs (or antigenic fragments and analogues of such homologues and orthologs) can be obtained. In general, the polypeptides may be coupled to a carrier protein such as KLH as described in Ausubel et al., Supra, mixed with an adjuvant and injected into a mammal. A carrier is a substance that enhances stability and / or aids or enhances the transport or immunogenicity of a molecule bound thereto. Antibodies can be purified, for example, by affinity chromatography methods in which the polypeptide antigen is bound to a resin.
Konkrétně, různá zvířata mohou být imunizována injekcí vybraného polypeptidu. Příklady vhodných zvířat jsou králíci, myši, morčata a krysy. Pro zvýšení imunologické odpovědi mohou být použita různá adjuvans, v závislosti na druhu hostitele, včetně například Freundova kompletního a nekompletního adjuvans, adjuvantních anorganických gelů (jako je hydroxidIn particular, various animals can be immunized by injection of a selected polypeptide. Examples of suitable animals are rabbits, mice, guinea pigs and rats. Various adjuvants may be used to enhance the immunological response, depending on the host species, including, for example, Freund's complete and incomplete adjuvant, adjuvant inorganic gels (such as hydroxide
hlinitý), povrchově aktivních substancí (jako je lysolecitin), pluronického polyolu, polyaniontů, peptidů, olejových emulsí, přílipkového hemocyaninu, dinitrofenolu, BCG (bacila CalmetteGuerinové) a Corynebacterium parvum. Polyklonální protilátky jsou heterogenní populace protilátkových molekul získaná ze séra imunizovaných zvířat.aluminum), surfactants (such as lysolecithin), pluronic polyol, polyanions, peptides, oil emulsions, hemocyanin, dinitrophenol, BCG (CalmetteGuerin bacillus) and Corynebacterium parvum. Polyclonal antibodies are a heterogeneous population of antibody molecules obtained from the sera of immunized animals.
Mezi protilátky použitelné v předkládaném vynálezu patří monoklonální protilátky, polyklonální protilátky, humanizované nebo chimérické protilátky, jednořetězcové protilátky, Fab fragmentyz F(ab’)2 fragmenty a molekuly připravené za použití Fab expresní knihovny.Antibodies useful in the present invention include monoclonal antibodies, polyclonal antibodies, humanized or chimeric antibodies, single chain antibodies, Fab fragments of F (ab ') 2 fragments, and molecules prepared using a Fab expression library.
Monoklonální protilátky (mAb), které jsou homogenní populací protilátek proti určitému antigenů, mohou být připraveny za použití yphC, ygjK nebo jejich homologů nebo ortologů a standardních hybridních technik (viz například Kohler et al., Nátuře, 256: 495, 1975; Kohler et al., Eur. J. Immunol. 6: 511, 1976; Kohler et al., Eur. J. Immunol. 6: 292, 1976; Hammerling et al., v Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY, 1981; Ausubel et al., výše).Monoclonal antibodies (mAbs), which are a homogeneous population of antibodies against a particular antigen, can be prepared using yphC, ygjK or their homologues or orthologs and standard hybrid techniques (see, for example, Kohler et al., Nature, 256: 495, 1975; Kohler et al. al., Eur. J. Immunol. 6: 511, 1976; Kohler et al., Eur. J. Immunol. 6: 292, 1976; Hammerling et al., in Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY, 1981 Ausubel et al., Supra).
Konkrétně, monoklonální protilátky mohou být získány jakoukoliv technikou, která umožňuje produkci protilátkových molekul v kontinuální buněčné linii v kultuře, jako jsou například techniky popsané v Kohler et al., Nátuře 256: 495, 1975 a U.S. patent č. 4376110; technikou využívající lidských B-buněčných hybridů (Kosbor et al., Immunology Today, 4: 72, 1983; Cole et al., Proč. Nati. Acad. Sci. USA 80: 2026, 1983); a EBV-hybridní technikou (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, lne., str. 77-96, 1983). Takovými protilátkami mohou být imunoglobuliny jakékoliv třídy včetně IgG, IgM, IgE, IgA, IgD a jejich podtříd. Hybridy produkující mAb podle předkládaného vynálezu mohou být kultivovány in vitro nebo in vivo.In particular, monoclonal antibodies can be obtained by any technique that allows the production of antibody molecules in a continuous cell line in culture, such as those described in Kohler et al., Nature 256: 495, 1975 and U.S. Pat. U.S. Patent No. 4,376,110; a technique using human B-cell hybrids (Kosbor et al., Immunology Today, 4: 72, 1983; Cole et al., Proc. Natl. Acad. Sci. USA 80: 2026, 1983); and the EBV-hybrid technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96, 1983). Such antibodies may be immunoglobulins of any class including IgG, IgM, IgE, IgA, IgD, and subclasses thereof. The mAbs producing the mAbs of the present invention can be cultured in vitro or in vivo.
Po produkci jsou monoklonální nebo polyklonální protilátky testovány na specifické rozpoznávání esenciálního polypeptidu nebo jeho homologu nebo ortologů v imunotestu, jako je westernový přenos nebo imunoprecipitační analýza, za použití standardních technik, jak jsou popsány například v Ausubel et al., výše. Protilátky, které se specificky váží na esenciální polypeptidy, jejich konzervativní varianty, homology a ortology, jsou použitelné v předkládaném vynálezu. Například mohou být tyto protilátky použity v imunotestu pro detekci esenciálního polypeptidu v patogenních nebo nepatogenních kmenech bakterií.After production, monoclonal or polyclonal antibodies are tested for specific recognition of an essential polypeptide or its homolog or orthologs in an immunoassay, such as by Western blotting or immunoprecipitation analysis, using standard techniques as described, for example, in Ausubel et al., Supra. Antibodies that specifically bind to essential polypeptides, conservative variants, homologs, and orthologs thereof are useful in the present invention. For example, these antibodies can be used in an immunoassay to detect an essential polypeptide in pathogenic or non-pathogenic strains of bacteria.
Výhodně jsou protilátky podle předkládaného vynálezu připravovány za použití fragmentů esenciálních polypeptidů, o kterých se předpokládá, že jsou antigenní, na základě takových kriterií, jako je vysoká frekvence nabitých zbytků. V jednom konkrétním příkladu jsou takové fragmenty připraveny standardními technikami PCR a jsou potom klonovány do pGEX expresního vektoru (Ausubel et al., výše). Fúsní proteiny jsou exprimovány v E. coli a jsou přečištěny za použití glutathionagarosové afinitní matrice, jako je popsáno v Ausubel et al., výše.Preferably, the antibodies of the present invention are prepared using fragments of essential polypeptides believed to be antigenic, based on criteria such as high frequency of charged residues. In one particular example, such fragments are prepared by standard PCR techniques and are then cloned into a pGEX expression vector (Ausubel et al., Supra). The fusion proteins are expressed in E. coli and are purified using a glutathione -agarose affinity matrix as described in Ausubel et al., Supra.
Pokud je to žádoucí, může být pro každý protein připraveno několik fúsí (například dvě nebo tři) a každý fúsní protein může být injikován alespoň dvěma králíkům. Antisérum může být připraveno sérií injekcí, obvykle alespoň tří dosycovacích injekcí. Obvykle je antisérum testováno na svou schopnost imunitně srážet rekombinantní esenciální polypeptid nebo jeho homolog nebo nepříbuzné kontrolní proteiny, jako je receptorIf desired, several fusions (e.g., two or three) may be prepared for each protein and each fusion protein may be injected with at least two rabbits. The antiserum may be prepared by a series of injections, usually at least three boosting injections. Usually, the antiserum is tested for its ability to immunoprecipitate the recombinant essential polypeptide or its homologue or unrelated control proteins such as the receptor
pro glukokortikoidy, chloramfenikol acetyltransferasa nebo luciferasa.for glucocorticoids, chloramphenicol acetyltransferase or luciferase.
Techniky vyvinuté pro produkci chimérických protilátek (Morrison et al., Proč. Nati. Acad. Sci. USA 81: 6851, 1984; Neuberger et al., Nátuře 312: 604, 1984; Takeda et al.,Techniques developed for the production of chimeric antibodies (Morrison et al., Proc. Natl. Acad. Sci. USA 81: 6851, 1984; Neuberger et al., Nature 312: 604, 1984; Takeda et al.,
Nátuře, 314: 452, 1984) mohou být použity pro sestřih genů pro molekulu myší protilátky s vhodnou antigenní specificitou s geny pro molekulu lidské protilátky s vhodnou biologickou aktivitou. Chimérická protilátka je molekula, ve které pocházejí její různé části od různých zvířecích druhů, například je chimérickou protilátkou protilátka, jejíž variabilní region je z myší mAb a která dále obsahuje konstantní region lidského imunoglobulinu.Nature, 314: 452, 1984) can be used to splice genes for a murine antibody molecule of appropriate antigen specificity with human antibody molecule genes with suitable biological activity. A chimeric antibody is a molecule in which different portions thereof originate from different animal species, for example, a chimeric antibody is an antibody whose variable region is from a murine mAb and which further comprises a human immunoglobulin constant region.
Alternativně, techniky popsané pro produkci jednořetězcových protilátek (U.S. patenty č. 4946778; 4946778) mohou být upraveny pro produkci jednořetězcových protilátek proti esenciálnímu polypeptidů nebo jeho homologu nebo ortologu. Jednořetězcové protilátky jsou připravena navázáním fragmentů těžkého a lehkého řetězce Fv regionu pomocí aminokyselinového můstku, což vede ke vzniku jednořetězcového polypeptidů.Alternatively, the techniques described for the production of single chain antibodies (U.S. Pat. Nos. 4,946,778; 4,946,778) may be adapted to produce single chain antibodies against an essential polypeptide or a homologue or ortholog thereof. Single chain antibodies are prepared by linking the heavy and light chain fragments of the Fv region using an amino acid bridge, resulting in the formation of single chain polypeptides.
Protilátkové fragmenty, které rozpoznávají a které se váží na specifické epitopy, mohou být připraveny za použití známých technik. Mezi takové fragmenty patří například F(ab')2 fragmenty, které mohou být připraveny· trávením protilátkové molekuly pepsinem, a Fab fragmenty, které mohou být připraveny redukcí disulfidových můstků v F(ab')2 fragmentech.Antibody fragments that they recognize that bind to specific epitopes can be prepared using known techniques. Such fragments include, for example, F (ab ') 2 fragments, which can be prepared by digesting the antibody molecule with pepsin, and Fab fragments, which can be prepared by reducing disulfide bridges in F (ab') 2 fragments.
Alternativně mohou být vytvořeny Fab expresní knihovny (Huse et al., Science, 246: 1275, 1989), které umožňují rychlou a • · • · · ·Alternatively, Fab expression libraries can be generated (Huse et al., Science, 246: 1275, 1989) that allow rapid
• « · · » * · · · co ···♦·· e · · · · ·• co »co co co co co co co co co co co
99 99 snadnou identifikaci monoklonálních Fab fragmentů s požadovanou specificitou.99 99 easy identification of monoclonal Fab fragments with the desired specificity.
Polyklonální a monoklonální protilátky, které se specificky váží na esenciální polypeptidy, jejich homology nebo ortology, mohou být použity, například, pro detekci exprese esenciálního genu, homologu nebo ortologu v jiných bakteriích. Například, esenciální polypeptid může být snadno detekován v běžných imunotestech provedených na bakteriálních buňkách nebo extraktech. Příklady vhodných testů jsou, například, westernový přenos, ELISA, radioimunotest a podobně.Polyclonal and monoclonal antibodies that specifically bind to essential polypeptides, homologs or orthologs thereof may be used, for example, to detect expression of an essential gene, homolog, or ortholog in other bacteria. For example, an essential polypeptide can be readily detected in conventional immunoassays performed on bacterial cells or extracts. Examples of suitable assays are, for example, Western blotting, ELISA, radioimmunoassay and the like.
Testy pro antibakteriální činidlaTests for antibacterial agents
Předkládaný vynález obsahuje techniky pro identifikaci antibakteriálních činidel. Bez vazby na jakoukoliv konkrétné teorii biologického mechanismu účinku se soudí, že nová antibakteriální činidla inhibují specificky: (1) funkci yphC nebo ygjK polypeptid nebo jeho homologu nebo ortologu, nebo (2) expresi yhpC nebo ygjK genů nebo jejich homologů nebo ortologů.The present invention includes techniques for identifying antibacterial agents. Without being bound by any particular theory of biological mechanism of action, novel antibacterial agents are believed to specifically inhibit: (1) the function of the yphC or ygjK polypeptide or a homolog or ortholog thereof, or (2) the expression of yhpC or ygjK genes or homologs or orthologs.
Srovnání yhpC proteinové sekvence s podobnými sekvencemi z GenBank databáze naznačuje, že yphC protein má GTPasovou aktivitu. Podobně, srovnání ygjK proteinové sekvence s podobnými sekvencemi z GenBank databáze naznačuje, že ygjK protein má arylsulfatasovou aktivitu. V pokusech vyvinutých pro testování toho, zda mají yphC a ygjK proteiny předpokládané biochemické aktivity bylo prokázáno, že yphC protein má GTPasovou aktivitu a ygjK protein má arylsulfatasovou aktivitu.Comparison of the yhpC protein sequence with similar sequences from the GenBank database suggests that the yphC protein has GTPase activity. Similarly, a comparison of the ygjK protein sequence with similar sequences from the GenBank database suggests that the ygjK protein has arylsulfatase activity. In experiments developed to test whether yphC and ygjK proteins have predicted biochemical activity, it has been shown that yphC protein has GTPase activity and ygjK protein has arylsulfatase activity.
Enzymatická aktivita každého proteinu naznačuje nové charakteristiky každého enzymu. Například, yphC protein obsahuje dvě vazebná místa pro GTP, ale zdá se, že pouze jedno toto místo je aktivní. YgjK protein má kromě arylsulfatasové aktivity také ještě fosfatasovou aktivitu a aktivace proteinu je katalyzovaná manganovými ionty. Ve zde popsaných genetických pokusech bylo prokázáno, že pozorované biochemické aktivity yphC a ygjK jsou spojeny s esenciálním charakterem proteinů. Mutace vazebných míst yphC genu vedly ke vzniku proteinů bez GTPasové aktivity, které nebyly schopné doplňovat nulové yphC mutanty. Podobně, ygjK mutanty bez arylsulfatasové aktivity nebyly schopné doplňovat nulové ygjK mutanty. Dále, mutanty postrádající arylsulfatasovou aktivitu postrádaly také fosfatasovou aktivitu a naopak. Tyto pokusy naznačují, že inhibice enzymatických aktivit yphC nebo ygjK v buněčných . kulturách vede k poruše životaschopnosti buněk a ke smrti buněk. Proto mohou být tyto biochemické aktivity použity in vivo nebo in vitro> samostatně nebo v kombinaci s jinými známými metodami pro detekci těchto aktivit, pro identifikaci antibakteriálních činidel.The enzymatic activity of each protein indicates new characteristics of each enzyme. For example, the yphC protein contains two GTP binding sites, but only one such site appears to be active. In addition to the arylsulfatase activity, the YgjK protein also has phosphatase activity and the activation of the protein is catalyzed by manganese ions. In the genetic experiments described herein, it has been shown that the observed biochemical activities of yphC and ygjK are associated with the essential character of the proteins. Mutations in yphC gene binding sites resulted in proteins lacking GTPase activity that were unable to complement null yphC mutants. Similarly, ygjK mutants lacking arylsulfatase activity were unable to complement null ygjK mutants. Furthermore, mutants lacking arylsulfatase activity also lacked phosphatase activity and vice versa. These experiments suggest that inhibition of yphC or ygjK enzymatic activities in cellular. cultures lead to impaired cell viability and cell death. Therefore, these biochemical activities can be used in vivo or in vitro, alone or in combination with other known methods for detecting these activities, to identify antibacterial agents.
V různých vhodných metodách je vyhledávání antibakteriálních činidel provedeno pomocí identifikace těch sloučenin (například malých organických molekul), které inhibují aktivitu esenciálního polypeptidů nebo expresi esenciálního genu. Vyhledávání antibakteriálních činidel může být provedeno (I) identifikací těch sloučenin, které interagují s nebo které se váží na esenciální polypeptid, a (ii) dalším testováním takových sloučenin na jejich schopnost inhibovat bakteriální růst in vitro nebo in vivo.In various suitable methods, screening for antibacterial agents is accomplished by identifying those compounds (e.g., small organic molecules) that inhibit the activity of an essential polypeptide or the expression of an essential gene. Screening for antibacterial agents can be accomplished by (I) identifying those compounds that interact with or that bind to an essential polypeptide, and (ii) further testing such compounds for their ability to inhibit bacterial growth in vitro or in vivo.
Příklady vhodných vyhledávacích metod jsou uvedeny v U.S. patentech č. 5679582 a 5585277, které jsou zde uvedeny jako ji.ili.gj odkaz. Stručně, v těchto metodách je cílový protein inkubován za přítomnosti testované sloučeniny (t.j. testovaného ligandu) za vzniku testované kombinace a cílový protein je také inkubován za nepřítomnosti testované sloučeniny za vzniku kontrolní kombinace. Testovaná a kontrolní kombinace jsou potom zpracovány tak, aby vznikla detekovatelná frakce cílového proteinu v částečně nebo zcela nesloženém stavu.Examples of suitable screening methods are disclosed in U.S. Pat. Nos. 5,679,582 and 5,585,277, which are incorporated herein by reference. Briefly, in these methods, the target protein is incubated in the presence of the test compound (i.e., the test ligand) to form the test combination, and the target protein is also incubated in the absence of the test compound to form the control combination. The test and control combinations are then processed to produce a detectable fraction of the target protein in a partially or fully unfolded state.
Potom se stanoví poměr, ve které existuje cílový protein ve složeném stavu, nesloženém stavu nebo obou stavech v testované a kontrolní kombinaci. Pokud je cílový protein přítomen ve složeném stavu ve větším nebo menším množství v testované kombinaci než v kontrolní kombinaci, ták je testovaná sloučenina sloučeninou, která se váže na cílový protein.The ratio at which the target protein exists in the folded state, the unfolded state, or both states in the test and control combinations is then determined. When the target protein is present in the folded state in greater or lesser amounts in the test combination than in the control combination, the test compound is also a compound that binds to the target protein.
V alternativním způsobu je vazba testované sloučeniny na cílový protein detekována za použití kapilární elektroforesy. Stručně, testovaná sloučenina (například malá molekula), která se váže na cílový protein, způsobuje změnu elektroforetícké mobility cílového proteinu v kapilární elektroforese. Vhodné techniky pro kapilární elektroforesu jsou známé v oboru (viz například Freitag, J. Chromatography B, Biomedical Sciences and Applications, 722(1-2): 279-301, Feb. 5, 1999; Chu and Cheng, Cellular and Molecular Life Sciences: 54(7) 663-683, July 1998; Thormann et al., Forensic Science International: 92(2-3): 157-83, Apríl 5, 1998; Rippel et al.,In an alternative method, binding of the test compound to the target protein is detected using capillary electrophoresis. Briefly, a test compound (e.g., a small molecule) that binds to a target protein causes a change in the electrophoretic mobility of the target protein in capillary electrophoresis. Suitable techniques for capillary electrophoresis are known in the art (see, for example, Freitag, J. Chromatography B, Biomedical Sciences and Applications, 722 (1-2): 279-301, Feb. 5, 1999; Chu and Cheng, Cellular and Molecular Life Sciences : 54 (7) 663-683, July 1998; Thormann et al., Forensic Science International: 92 (2-3): 157-83, April 5, 1998; Rippel et al.
Electrophoresis: 18(12-13): 2175-83, Nov., 1997; Hage and Tweed, J. Chromatography., B. Biomedical Sciences and Applications: 699(1-2): 499-525, October 10, 1997; Mitchelson et al., Trends in Biotechnology: 15(11): 448-58, Nov. 1997; Jenkins and Guerin, J. Chromatography B. Biomedical Application: 682(1): 23-34, June 28, 1996; a Chen and Gallo, Electrophoresis, 19(16-17): 2861-9, Nov. 1998.Electrophoresis: 18 (12-13): 2175-83, Nov. 1997; Hage and Tweed, J. Chromatography., B. Biomedical Sciences and Applications: 699 (1-2): 499-525, October 10, 1997; Mitchelson et al., Trends in Biotechnology: 15 (11): 448-58; 1997; Jenkins and Guerin, J. Chromatography B. Biomedical Application: 682 (1): 23-34, June 28, 1996; and Chen and Gallo, Electrophoresis, 19 (16-17): 2861-9. 1998.
•· φφφφ φφφφ• · φφφφ φφφφ
Inhibitory yphC mohou být také identifikovány v následujících biochemických testech pro detekci inhibitorů GTPasy. Tento test využívá kolorimetrický detekční systém pro detekci nanomolárních množství anorganického fosfátu. Test může být proveden v 96-jamkové mikroplotně s jamkami s průsvitným dnem (například Corning-COSTAR katalogové č. 9710). 20 μΐ alikvota každé testované sloučeniny v 10% DMSO je umístěna do každé jamky plotny, s výjimkou těch jamek, které jsou použity jako kontroly. 20 μΐ alikvota 420 μΜ GTP je potom přidána do každé jamky plotny, s výjimkou těch jamek, které jsou použity pro kontrolní reakce. 20 μΐ IC50 kontrol, obsahujících 225 μΜ GDP, je umístěno do dvou kontrolních jamek; 20 μΐ ICioo kontrol (2,25 ml 0,5 M EDTA ve .12,75 ml 420 μΜ GTP) je umístěno do dvou kontrolních jamek; a 20 μΐ neihibujících kontrol obsahujících 420 μΜ GTP je' umístěno do čtyřech dalších' kontrolních jamek. 20 μΐ 2x-pufru (100 mM Tris-HCl, 500 mM Kel, 10 mM MgCL2, 0,2 mg/ml acetylovaného BSA, H2O) plus roztok yphC enzymu (v koncentraci 1 μς/jamku) je potom umístěn do každé jamky a plotna se inkubuje při teplotě okolí po dobu 3,5 hodin. Pro ukončení enzymové reakce se do každé jamky přidá 150 μΜ roztoku 0,045% malachitové zeleně/35 mM EDTA. Po 25 minutách se do každé jamky přidá 50 μΐ 15% citrátu pro zabránění dalšímu vývoji zabarvení. Vzorky se potom důkladně mísí (například za použití TOMTEC-Quadra-96, Model 320), dokud nevznikne homogenní roztok. Plotny se potom odečítají za použití čtečky ploten (například Wallac Victor 2 čtečky ploten) pracující při vlnové délce 650 nm. Obyčejně by plotny měly být odečítány během 24 hodin po přidání malachitové zeleni a citrátu.Inhibitors of yphC can also be identified in the following biochemical assays for the detection of GTPase inhibitors. This assay uses a colorimetric detection system to detect nanomolar amounts of inorganic phosphate. The assay can be performed in a 96-well translucent-bottom microplate (for example, Corning-COSTAR Catalog No. 9710). A 20 μΐ aliquot of each test compound in 10% DMSO is placed in each well of the plate, except for the wells used as controls. A 20 μΐ aliquot of 420 μΜ GTP is then added to each well of the plate, except for those wells used for control reactions. 20 μΐ IC50 controls containing 225 μΜ GDP are placed in two control wells; 20 μΐ ICioo controls (2.25 ml 0.5 M EDTA in .12.75 ml 420 μΜ GTP) are placed in two control wells; and 20 μΐ non-attenuating controls containing 420 μΜ GTP are 'placed in four additional' control wells. 20 μΐ of 2x buffer (100 mM Tris-HCl, 500 mM Kel, 10 mM MgCL2, 0.2 mg / ml acetylated BSA, H2O) plus the yphC enzyme solution (at a concentration of 1 μς / well) is then placed in each well and The plate is incubated at ambient temperature for 3.5 hours. 150 μΜ of a 0.045% malachite green / 35 mM EDTA solution is added to each well to terminate the enzyme reaction. After 25 minutes, 50 μΐ 15% citrate is added to each well to prevent further color development. The samples are then mixed thoroughly (for example using TOMTEC-Quadra-96, Model 320) until a homogeneous solution is obtained. Plates are then read using a plate reader (eg Wallac Victor 2 plate reader) operating at 650 nm. Normally, the plates should be read within 24 hours after the addition of malachite green and citrate.
#· *· • ·· · • · · · ♦ ♦ · · ♦ • * · ·# · · · * · * ♦ * *
• · ·· •fl ····• · ·· • fl ····
Procento inhibice pro každou jamku obsahující vzorek může být vypočítáno následujícím způsobem. Průměr ze dvou jamek obsahujících ICioo kontroly může být použit jako základní hodnota. Procento inhibice může být vypočítáno z následujícího vzorce:The percent inhibition for each well containing the sample can be calculated as follows. The mean of the two wells containing the IC10 controls can be used as baseline. Percent inhibition can be calculated from the following formula:
% inhibice = [1-(hodnota vzorku - základní hodnota)/průměrná hodnota-základní hodnota)] x 100% inhibition = [1- (sample value - baseline) / mean value - baseline)] x 100
Testovaná sloučenina vyvolávající více než 40% inhibici může být znovu testována na inhibici při vyšší dávce, pokud je to žádoucí.A test compound producing more than 40% inhibition can be retested for higher dose inhibition, if desired.
Mezi další metody pro identifikaci antibakteriálních činidel patří různé metody využívající buňky pro identifikaci polypeptidů, které se váží na yphC, ygjK nebo jejich homoiogy a ortology, jako jsou například běžné dvou-hybridní testy na interakce protein/protein (viz například Chien et al., Proč. Nati. Acad. Sci. USA, 88: 9578, 1991; Fields et al., U.S. patent č. 5283173; Fields and Song, Nátuře, 340: 245, 1989; Le Douarin et al., Nucleic Acids Research, 23: 879, 1995; Vidal et al., Proč. Nati. Acad. Sci. USA, 93: 10315-10320, 1996; a White, Proč. Nati. Acad. Sci. USA, 93: 10001-10003, 1996). Obecně, dvou-hybridní metoda vyžaduje rekonstituci dvou separovatelných domén transkripčního faktoru v buňce. Jeden fúsní protein obsahuje esenciální polypeptid (nebo jeho homolog nebo ortolog) fušovaný buď na transaktivační doménu nebo na DNA vazebnou doménu transkripčního faktoru (například na Gal4) . Druhý fúsní protein obsahuje testovaný polypeptid fúsovaný buď na transaktivační doménu nebo na DNA vazebnou doménu transkripčního faktoru. Po jejich navázání v jedné buňce (například ve kvasince či savčí buňce) obsahuje jeden fúsní protein transaktivační doménu a druhý fúsní protein • ft ftft·· ·· ««ftftOther methods for identifying antibacterial agents include various methods using cells to identify polypeptides that bind to yphC, ygjK, or homologs and orthologs thereof, such as conventional two-hybrid protein / protein assays (see, e.g., Chien et al., Proc Natl Acad Sci USA, 88: 9578, 1991; Fields et al., US Patent No. 5,283,173; Fields and Song, Nature, 340: 245, 1989; Le Douarin et al., Nucleic Acids Research, 23 Vidal et al., Proc. Natl. Acad. Sci. USA, 93: 10315-10320, 1996; and White, Proc. Natl. Acad. Sci. USA, 93: 10001-10003, 1996). In general, a two-hybrid method requires the reconstitution of two separable transcription factor domains in a cell. One fusion protein comprises an essential polypeptide (or homolog or ortholog thereof) fused to either the transactivation domain or the DNA binding domain of the transcription factor (e.g., Gal4). The second fusion protein comprises a test polypeptide fused to either the transactivation domain or the DNA binding domain of the transcription factor. Once bound in one cell (for example, a yeast or mammalian cell), one fusion protein contains a transactivation domain and the other fusion protein • ft ftft ·· · «« ftft
Oo ···· ft·· ♦ · · • · ·« *· ♦ ·· <Oo ···· ft ·· ♦ · · · · * · ·
obsahuje DNA vazebnou doménu. Proto rekonstituuje vazba esenciálního polypeptidů na testovaný polypeptid (t.j. potenciální antibakteriální činidlo) transkripční faktor. Rekonstituce transkripčního faktoru může být detekována detekcí exprese genu (t.j. reporterového genu), který je operabilně navázaný na DNA sekvenci, která je vázána DNA vazebnou doménou transkripčního faktoru. Bity pro provádění různých dvou-hybridních metod jsou komerčně dostupné (například od Clontech, Palo Alto, CA).it contains a DNA binding domain. Therefore, the binding of an essential polypeptide to a test polypeptide (i.e., a potential antibacterial agent) reconstitutes the transcription factor. Reconstitution of the transcription factor can be detected by detecting the expression of a gene (i.e., a reporter gene) that is operably linked to a DNA sequence that is bound by the DNA binding domain of the transcription factor. Bits for performing various two-hybrid methods are commercially available (e.g., from Clontech, Palo Alto, CA).
V jiném příkladném testu, ale ne jediném, je promotor reagující na depleci esenciálního polypeptidů zesílenou nebo zeslabenou expresí, navázán na reporterový gen (například na gen pro β-galaktosidasu, gus nebo GFP), jak je popsán výše. Bakteriální gen obsahující tento reporterový genový konstrukt je potom vystaven působení testované sloučeniny. Sloučeniny, které inhibují esenciální polypeptid (nebo jiné polypeptidy v esenciální metabolické dráze, na které se účastní esenciální polypeptid), způsobí funkční depleci esenciálního polypeptidů a proto povedou k zesílení nebo zeslabení exprese reporterového genu. Protože polypeptidy popsané v předkládaném vynálezu jsou esenciální pro přežívání bakterií, budou sloučeniny inhibující esenciální polypeptidy v takových testech považovány za antibakteriální činidla a budou dále testovány, pokud to bude vhodné, v běžných testech citlivosti.In another exemplary assay, but not a single, a promoter responsive to the depletion of an essential polypeptide by enhanced or attenuated expression is linked to a reporter gene (e.g., a β-galactosidase, gus, or GFP gene) as described above. The bacterial gene containing this reporter gene construct is then exposed to the test compound. Compounds that inhibit the essential polypeptide (or other polypeptides in the essential metabolic pathway in which the essential polypeptide is involved) will cause functional depletion of the essential polypeptide and will therefore result in increased or decreased expression of the reporter gene. Since the polypeptides described in the present invention are essential for bacterial survival, compounds inhibiting essential polypeptides in such assays will be considered antibacterial agents and will be further tested, if appropriate, in conventional susceptibility tests.
Způsoby popsané výše mohou být použity pro vysoce účinné testování mnoha sloučenin pro identifikaci antibakteriální činidel. Po identifikaci testované sloučeniny jako sloučeniny, která je kandidátem na antibakteriální činidlo, může být tato sloučenina dále testována na inhibici bakteriálního růstu in vitro nebo in vivo (například za použití zvířat, například hlodavců nebo modelových systémů). Za použití jiných v oboruThe methods described above can be used for highly efficient testing of many compounds to identify antibacterial agents. After identifying the test compound as a candidate for an antibacterial agent, the compound can be further tested for inhibition of bacterial growth in vitro or in vivo (e.g., using animals such as rodents or model systems). Using others in the art
Φ φ *φφφ φ · · φφφ φ φ φ φ φ φ · • φ φφφφΦ φ φ · · · · · · • • • • • •
4 Φ4 Φ
ΦΦΦ ΦΦΦ ΦΦΦ • Φ ΦΦΦΦ ΦΦΦ ΦΦΦ • Φ Φ
ΦΦ ΦΦΦΦ ΦΦ
Φ Φ Φ «Φ Φ Φ «
Φ 4 4 44 4 4
4 4 4 Φ4 4 4 Φ
Φ Φ Φ Φ • Φ ·· dobře známých variací takových metod je možno testovat schopnost vazby nukleové kyseliny (například DNA nebo RNA) použité jako testovaná sloučenina na yphC, ygjK nebo jejich homology a ortology.A well-known variation of such methods can be tested for the ability of the nucleic acid (e.g., DNA or RNA) used as a test compound to bind to yphC, ygjK or homologues and orthologs thereof.
In vitro může být další testování provedeno za použití technik známých v oboru, jako je test inhibice enzymu nebo test inhibice růstu bakterií. Například, agarový diluční test identifikuje substance, které inhibují bakteriální růst. Jsou při něm připraveny mikrotitrační plotny obsahující sériová ředění testované sloučeniny přidaná do daného množství kultivačního media a na těchto plotnách se kultivují bakterie. Inhibice bakteriálního růstu je stanovena, například pozorováním změn v optické hustotě bakteriálních kultur.In vitro, further testing may be performed using techniques known in the art, such as an enzyme inhibition assay or a bacterial growth inhibition assay. For example, the agar dilution assay identifies substances that inhibit bacterial growth. Microtitre plates containing serial dilutions of test compound added to a given amount of culture medium are prepared and cultured on these plates. Inhibition of bacterial growth is determined, for example, by observing changes in the optical density of bacterial cultures.
Inhibice bakteriálního růstu je demonstrována například srovnáním rychlosti růstu nebo absolutního růstu bakterií za přítomnosti a nepřítomnosti testované sloučeniny. Za inhibici se považuje snížení v jednom z výše uvedených měření alespoň o 20%. Zejména účinné testované sloučeniny mohou dále snižovat rychlosti růstu (například alespoň o 25%, 30%, 40%, 50%, 75%, 80% nebo o 90%).Inhibition of bacterial growth is demonstrated, for example, by comparing the growth rate or absolute growth of bacteria in the presence and absence of the test compound. An inhibition of at least 20% in one of the above measurements is considered to be an inhibition. Particularly effective test compounds may further reduce growth rates (for example, by at least 25%, 30%, 40%, 50%, 75%, 80% or 90%).
Hlodavčí (například myší) a králičí zvířecí modely bakteriální infekce jsou známé v oboru a takové zvířecí modely jsou přijatelné pro vyhledávání antibakteriálních činidel, protože ukazují na terapeutickou účinnost takových činidel u člověka. V typickém testu in vivo je zvíře infikováno patogenním kmenem bakterie, například inhalací bakterií jako je Streptococcus pneumoniae, a pro stanovení toho, zda je zvíře postiženo bakteriální infekcí, se použijí běžná kriteria. Testované potenciální antibakteriální činidlo je potom podáno savci v dávce 1-100 mg/kg tělesné hmotnosti aRodent (e.g., mouse) and rabbit animal models of bacterial infection are known in the art, and such animal models are acceptable for screening for antibacterial agents, since they indicate the therapeutic efficacy of such agents in humans. In a typical in vivo test, an animal is infected with a pathogenic bacterial strain, for example, by inhalation of a bacterium such as Streptococcus pneumoniae, and conventional criteria are used to determine whether the animal is affected by a bacterial infection. The test potential antibacterial agent is then administered to the mammal at a dose of 1-100 mg / kg body weight a
99 * 9 « • 9 9 9 · 9 999 * 9 «9 9 9 9
9 9 99 9 9
9· • 9 99 9 9 ♦ · I»»·9 · • 9 99 9 9 I · I »» ·
9 9 9 #99# 9
99 ·· · savec je sledován na příznaky zmírnění onemocnění.99 ·· · The mammal is observed for signs of alleviation of the disease.
Alternativně může být testovaná sloučenina podána savci před infekcí bakteriemi a měří se schopnost savce odolávat infekci. Samozřejmě jsou výsledky získané v přítomnosti testované sloučeniny srovnávány s výsledky získanými pro kontrolní zvířata, kterým nebyla podána testovaná sloučenina. Podání potenciálních antibakteriálních činidel savcům může být provedeno například způsobem popsaným dále.Alternatively, the test compound can be administered to a mammal prior to infection by bacteria, and the ability of the mammal to resist infection is measured. Of course, the results obtained in the presence of the test compound are compared to those obtained for the control animals not given the test compound. Administration of potential antibacterial agents to mammals may be accomplished, for example, as described below.
Farmaceutické prostředkyPharmaceutical preparations
Léčba obsahuje podání farmaceuticky účinného množství prostředku obsahujícího antibakteriální činidlo jedinci, který potřebuje takovou léčbu, čímž se inhibuje růst bakterií u jedince. Takové prostředky obvykle obsahují od 0,1 do 90% procent hmotnosti (například 1 až 20% nebo 1 až 10%) antibakteriální činidla podle předkládaného vynálezu v kombinaci s farmaceuticky přijatelným nosičem.The treatment comprises administering to the subject in need thereof a pharmaceutically effective amount of an antibacterial agent composition, thereby inhibiting bacterial growth in the subject. Such compositions typically contain from 0.1 to 90% by weight (for example 1 to 20% or 1 to 10%) of the antibacterial agent of the present invention in combination with a pharmaceutically acceptable carrier.
Pevné prostředky pro orální podání mohou obsahovat vhodné nosiče nebo přísady, jako je kukuřičný škrob, želatina, laktosa, arabská klovatina, sacharosa, mikrokrystalická celulosa, kaolin, manitol, fosforečnan vápenatý, uhličitan vápenatý, chlorid sodný nebo kyselinu alginovou. Mohou být použita činidla podporující rozpadavost, včetně například mikrokrystalické celulosy, kukuřičného škrobu, glykolatu škrobu sodného a kyseliny alginové. Mohou být použita tabletová pojivá, včetně například arabské klovatiny, methylcelulosy, karboxymethylcelulosy sodné, polyvinylpyrrolidonu (Povidonu), hydroxypropylmethylcelulosy, sacharosy, škrobu a ethylcelulosy. Mohou být použita kluzná činidla jako jsou například stearany hořečnaté, kyselina • * »00 0Solid compositions for oral administration may contain suitable carriers or excipients such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, calcium phosphate, calcium carbonate, sodium chloride or alginic acid. Disintegrants, including, for example, microcrystalline cellulose, corn starch, sodium starch glycolate and alginic acid, may be used. Tablet binders may be used, including, for example, acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone (Povidone), hydroxypropylmethylcellulose, sucrose, starch and ethylcellulose. Glidants such as magnesium stearates, acid, etc. may be used
0* 0000 • ••00·· ·· φφ ·· 0« 0 *· stearová, silikonové kapaliny, talek, vosky, oleje a koloidní oxid křemičitý.0 * 0000 • •• 00 0 · 0 * · stearic, silicone fluids, talc, waxes, oils and colloidal silica.
Kapalné prostředky pro orální podání připravené ve vodě nebo v jiném vodném vehikulu mohou obsahovat různá suspendační činidla, jako je methylcelulosa, alginaty, tragant, pektin, kelgin, karagén, arabská klovatina, polyvinylpyrrolidon a polyvinylalkohol. Mezi kapalné prostředky patří také roztoky, emulse, sirupy a elixíry obsahující kromě aktivní sloučeniny smáčivá činidla, sladidla, barviva a chuťová korigens. Mohou být připravena různé kapalné a práškové prostředky pro inhalaci do plic léčeného savce.Liquid compositions for oral administration prepared in water or other aqueous vehicle may contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone and polyvinyl alcohol. Liquid formulations also include solutions, emulsions, syrups and elixirs containing, in addition to the active compound, wetting agents, sweetening, coloring and flavoring agents. Various liquid and powder formulations may be prepared for inhalation into the lungs of a treated mammal.
Injekční prostředky mohou obsahovat různé nosiče, jako jsou rostlinné oleje, dimethylacetamid, dimethylformamid, ethyllaktat, ethylkarbonat, isopropylmyristat, ethanol, polyoly (glycerol, propylenglykol, kapalný polyethylenglykol a podobně). Při intravenosní injekci mohou být ve vodě rozpustné verze sloučenin podány infusí, při které je podán farmaceutický prostředek obsahující antibakteriální činidlo a fyziologicky přijatelné přísady. Mezi fyziologicky přijatelné přísady patří, například, 5% dextrosa, 0,9% salinický roztok, Ringerův roztok a jiné vhodné přísady. Pro intramuskulární prostředky mohou být sterilní sloučeniny ve formě vhodné rozpustné sole rozpuštěny a podány ve vhodné farmaceutické přísadě,, jako je voda pro injekce, 0,9% salinický roztok nebo 5% roztok glukosy. Mohou být připraveny vhodné nerozpustné formy sloučenin a mohou být podány jako suspenze ve vodné bázi nebo ve farmaceuticky přijatelné olejové bázi, jako je ester mastné kyseliny s dlouhým řetězcem (například ethyloleat).Injectables may contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like). For intravenous injection, water-soluble versions of the compounds may be administered by infusion, whereby a pharmaceutical composition comprising an antibacterial agent and physiologically acceptable ingredients is administered. Physiologically acceptable additives include, for example, 5% dextrose, 0.9% saline, Ringer's solution and other suitable ingredients. For intramuscular compositions, sterile compounds in the form of a suitable soluble salt may be dissolved and administered in a suitable pharmaceutical excipient such as water for injection, 0.9% saline or 5% glucose solution. Suitable insoluble forms of the compounds may be prepared and may be administered as suspensions in an aqueous base or in a pharmaceutically acceptable oil base such as a long chain fatty acid ester (e.g. ethyloleate).
Semi-solidní prostředek pro lokální podání ve formě masti obvykle obsahuje koncentraci aktivní složky od přibližně 1 do φφφφ φSemi-solid topical ointment formulation usually contains an active ingredient concentration of from about 1 to about 3
φ φ φ φφ φ φ φ
Φ Φ ♦ φ · * φ φ · φ φ φ φ • Φ φφ ·· «φφφ φφ φφ φ · φφφφ φ φ φφφφ φ φ φ φ · φ · φ φ φφφφ • Μ Φ *Φ ♦ φ · φ · φ · • • φ φ · · · φ φ φ φ φ φ · · · · φ φ φ φ φ φ · · · · · φ
20%, například 5 až 10%, v nosiči jako je farmaceutická krémová baze. Mezi různé prostředky pro lokální podání patří kapky, tinktury, pleťové vody, krémy, roztoky a masti obsahující aktivní složku a různé nosiče a vehikula.20%, for example 5 to 10%, in a carrier such as a pharmaceutical cream base. Various topical formulations include drops, elixirs, lotions, creams, solutions and ointments containing the active ingredient, and various carriers and vehicles.
Optimální procento antibakteriálního činidla v každém farmaceutickém prostředku se liší v závislosti na samotném prostředku a na požadovaném terapeutickém účinku při specifických patologických stavech a na současných terapeutických režimech. Vhodná dávka antibakteriálních činidel může být snadno stanovena odborníkem v medicíně podle sledování příznaků zmírnění nebo inhibice infekce u zvířete a snižováním nebo zvyšováním dávky a/nebo frekvence dávkování podle potřeby. Optimální množství antibakteriální sloučeniny použité pro léčbu stavů způsobených bakteriální infekcí může záviset na způsobu podání, věku a tělesné hmotnosti jedince a na celkovém stavu léčeného jedince. Obyčejně je antibakteriální sloučenina podána v dávce od 1 do 100 mg/kg tělesné hmotnosti, lépe je dávka 1 až 10 mg/kg tělesné hmotnosti.The optimum percentage of antibacterial agent in each pharmaceutical composition varies depending on the composition itself and the desired therapeutic effect in specific pathologies and current therapeutic regimens. The appropriate dose of antibacterial agents can be readily determined by one of ordinary skill in the art by following the signs of amelioration or inhibition of infection in the animal and decreasing or increasing the dose and / or frequency of dosing as necessary. The optimum amount of antibacterial compound used to treat conditions caused by a bacterial infection may depend on the route of administration, the age and body weight of the subject and the general condition of the subject being treated. Generally, the antibacterial compound is administered at a dose of from 1 to 100 mg / kg body weight, more preferably a dose of 1 to 10 mg / kg body weight.
Jiná provedeníOther embodiments
Vynález se také týká fragmentů, variant, analogů a derivátů polypeptidů popsaných výše, které si zachovávají jednu nebo více biologických aktivit yphC nebo ygjK polypeptidů, například GTPasovou nebo sulfatasovou aktivitu. Vynález zahrnuje přirozené i uměle vytvořené varianty. Vzhledem k přirozeným sekvencím esenciálních genů uvedených na obr. 1 a 3 mohou obsahovat sekvence nukleové kyseliny kódující varianty substituce, delece nebo adice jednoho nebo více nukleotidů. Výhodné varianty si zachovávají funkci esenciálního tftftftf tftftftfThe invention also relates to fragments, variants, analogs and derivatives of the polypeptides described above that retain one or more biological activities of the yphC or ygjK polypeptides, for example, GTPase or sulfatase activity. The invention encompasses both natural and man-made variants. Due to the natural sequences of the essential genes shown in Figures 1 and 3, they may contain nucleic acid sequences encoding variants of the substitution, deletion or addition of one or more nucleotides. Preferred variants retain the function of essential tftftftf tftftftf
·· «· • >· · • ·· · • · ·· · • · · · • · ♦· polypeptidů, jak může být určeno například v doplňovacím testu.The polypeptides, as can be determined, for example, in a replenishment assay.
Je třeba si uvědomit, že ačkoliv byla popsána výhodná provedení vynálezu, je předešlý popis pouze ilustrativní a neomezuje rozsah předkládaného vynálezu, jak je definován v připojených patentových nárocích. Další aspekty, výhody a modifikace spadají do rozsahu následujících patentových nároků. Například, jiné v oboru známé testy pro detekci interakcí testovaných sloučenin s proteiny nebo pro detekci inhibice bakteriálního růstu, mohou být také použity s esenciálními geny, genovými produkty a jejich homology a ortology.It will be appreciated that although preferred embodiments of the invention have been described, the foregoing description is illustrative only and does not limit the scope of the present invention as defined in the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. For example, other assays known in the art for detecting interactions of test compounds with proteins or for detecting inhibition of bacterial growth can also be used with essential genes, gene products and homologues and orthologs thereof.
Claims (29)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CZ20002136A CZ20002136A3 (en) | 1999-09-09 | 1999-09-09 | Essential bacterial genes and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CZ20002136A CZ20002136A3 (en) | 1999-09-09 | 1999-09-09 | Essential bacterial genes and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CZ20002136A3 true CZ20002136A3 (en) | 2001-01-17 |
Family
ID=5470941
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CZ20002136A CZ20002136A3 (en) | 1999-09-09 | 1999-09-09 | Essential bacterial genes and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CZ (1) | CZ20002136A3 (en) |
-
1999
- 1999-09-09 CZ CZ20002136A patent/CZ20002136A3/en unknown
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6437108B1 (en) | Essential bacterial genes and their use | |
| US6627747B1 (en) | Essential bacterial genes and their use | |
| US7074585B2 (en) | Use of ylqF, yqeG, yybQ, and ysxC, essential bacterial genes and polypeptides | |
| CZ20002136A3 (en) | Essential bacterial genes and use thereof | |
| US6995134B2 (en) | Use of yneS, essential bacterial genes and polypeptides | |
| US6664074B2 (en) | Use of yacM and yqeJ, essential bacterial genes and polypeptides and their use | |
| US6251596B1 (en) | Aspergillus N-myristoyl transferase genes and polyeptides and uses thereof | |
| US6515119B1 (en) | Use of S-ydcB and B-ydcB, essential bacterial genes | |
| US20030013106A1 (en) | CCL1 polynucleotides and polypeptides and uses thereof | |
| Samantaray et al. | Cloning and cDNA synthesis of PE & PPE gene of Mycobacterium strain H37rv5 | |
| US20030004326A1 (en) | Kin28 polynucleotides and polypeptides and uses thereof | |
| WO2000039342A2 (en) | Use of essential saccharomyces genes and polypeptides | |
| CZ20002465A3 (en) | Essential bacterial genes and their use | |
| US20020128456A1 (en) | Candida albicans kinase genes and polypeptides and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PD00 | Pending as of 2000-06-30 in czech republic |