CZ20002136A3 - Essential bacterial genes and use thereof - Google Patents

Abstract

The present invention relates to two genes designated "yphC" and "ygjK" discovered in Streptococcus pneumoniae, which are essential for the survival of many bacteria. These genes and essential polypeptides that encode, as well as their homologs and orthologs, can be used to identify antibacterial agents useful for treating a wide variety of bacterial infections.

Description

Essential bacterial genes and their use

Technical field

The present invention relates to essential bacterial genes and their use in identifying antibacterial agents.

BACKGROUND OF THE INVENTION

Bacterial infections can be skin, subcutaneous or systemic. Opportunistic bacterial infections develop especially in patients affected by AIDS or other diseases that affect the immune system. Most bacteria that are pathogenic to humans are Gram-positive bacteria. For example, Streptococcus pneumoniae usually infects the respiratory tract and can cause lobar pneumonia as well as meningitis, sinusitis and other infectious diseases.

SUMMARY OF THE INVENTION

The present invention is based on the discovery of two genes in the Gram positive bacterium Streptococcus pneumoniae, which are essential for the survival of this and other bacteria. These genes, yphC and ygjK, are referred to collectively in the present invention as essential genes and polypeptides encoded by these genes are referred to as essential polypeptides because Streptococcus pneumoniae cells without functional yphC or ygjK genes are incapable of survival.

The YphC and ygjK genes are useful molecular tools for identifying similar genes in pathogenic microorganisms.

The essential polypeptides encoded by these genes are useful targets for identifying compounds that are inhibitors

Pathogens in which essential polypeptides are expressed.

Such compounds reduce bacterial growth by inhibiting the activity of an essential protein or inhibiting transcription of an essential gene or translation of mRNA transcribed from an essential gene.

The invention therefore relates to an isolated yphC polypeptide having the amino acid sequence shown in SEQ ID NO: 2 as is. shown in FIG. 1, or a conservative variation thereof. An isolated nucleic acid encoding yphC is also included in the present invention. Further, the invention includes (a) an isolated nucleic acid having the sequence of SEQ ID NO: 1 as shown in Figure 1, or degenerate variants thereof; (b) an isolated nucleic acid having the sequence of SEQ ID NO: 1 as shown in Figure 1, or degenerate variants thereof, wherein T is replaced by U; (c) nucleic acids complementary to (a) and (b); and (d) fragments (a), (b) and (c) having at least 15 base pairs in length and which hybridize under stringent conditions, as described below, to the genomic DNA encoding the polypeptide of SEQ ID NO: 2. FIG. 1 is a partial sequence of the full length polypeptide shown in FIGS. 2A-2B.

The invention also includes an isolated yphC polypeptide having the amino acid sequence set forth in SEQ ID NO: 5 as is

2A-2B, or a conservative variation thereof.

An isolated nucleic acid encoding complete yphC is also included in the present invention. Further, the invention includes (a) an isolated nucleic acid having the sequence of SEQ ID NO: 4 as shown in Figures 2A-2B, or degenerate variants thereof; (b) an isolated nucleic acid having the sequence of SEQ ID NO:

4, or degenerate variants thereof, wherein T is replaced by U; and (c) nucleic acids complementary to (a) and (b).

As described above for yphC, the invention also includes an isolated nucleic acid encoding ygjK. Further,

the invention includes (a) an isolated nucleic acid having the sequence of SEQ ID NO: 7 as shown in Figure 3, or degenerate variants thereof; (b) an isolated nucleic acid having the sequence of SEQ ID NO: 7 as shown in Figure 1, or degenerate variants thereof, wherein T is replaced by U; (c) nucleic acids complementary to (a) and (b); and (d) fragments (a), (b) and (c) having at least 15 base pairs in length and which hybridize under stringent conditions, as described below, to genomic DNA encoding the polypeptide of SEQ ID NO: 8. summarized in Table 1.

Table 1: Essential nucleic acids and polypeptides

Essential nuclear acid or polypeptide Giant. C. Amino acid your sequence SEQ ID NO: Sequence coding - SEQ ID NO: Sequence noncoding - SEQ ID NO: yphC-partial sequence 1 2 1 3 yphC - complete sequence 2A- 2B 5 4 6 ygjK 3 8 7 9

The identification of these essential genes will allow for the search for homologues of these genes in other strains within the species, and will allow for the search for orthologs of these essential genes also in other organisms (e.g. Bacillus sp., H. influenzae, H. pylori and E. coli). While homologues are structurally similar genes contained in the genus Streptococcus, orthologs are functionally equivalent genes from other strains and can be detected, for example, by a standard complementation assay. Therefore, they can be

9

9 9 9 Essential polypeptides used not only as a model for identifying similar genes in other Streptococcus strains, but also for identifying homologues and orthologs of essential genes in other strains (for example, in other gram-positive bacteria, especially those that are pathogenic to humans, and in other bacteria in general). Such orthologs may be identified, for example, by a conventional complementation assay. In addition, or alternatively, such orthologs may be expected to exist in bacteria from the same branch of the phylogenetic tree as listed, for example, in ftp * 7 / ftp.cme.msu.edu / pub / RDP / SSU_rRNA / SSU / Prok.phylo. For example, B. subtilis belongs to the B. subtilis subgroup of the B. subtilis group in the Bacillus-Lactobaccillus-Streptococcus subgroup of the Gram-positive strain. Similarly, S. pneumoniae belongs to the S. pneumoniae subgroup of Streptococci, which also belongs to the Bacillus-Lactobaccillus-Streptococcus subgroup of the Gram positive strain. E. coli belongs to the Escherichia-Salmonella family of enteral bacteria and is related to the Gamma-subgroup of purple bacteria. It is also contemplated that other bacteria from the same strain (especially bacteria from the same branch, group, or subgroup) contain the orthologs of the yphC and / or ygjK genes described herein.

Examples of Streptococcus yphC and ygjK orthologs are shown in Table 2. As shown in Table 2, the Streptococcus yphC gene has an ortholog in B. subtilis, designated ByphC, and an ortholog in E. coli, designated yfgK and also referred to as f503. The ygjκ streptococcal gene also has an ortholog in B. subtilis, which is designated Β-γgjκ, and an ortholog in E. coli, which is designated elaC, which is also referred to as o311. As discussed below, the essential gene orthologs may be essential or non-essential genes in the organisms in which they occur.

9 9 99 99

As determined in the experiments described below, B-yphC, yfgK and B-ygjK orthologs are essential for the survival of the bacteria in which they are found. Therefore, these essential orthologous genes and the polypeptides encoded by these orthologous genes can be used to identify compounds that inhibit growth of the host organism (for example, compounds that inhibit the activity of an essential protein or that inhibit the transcription of an essential gene).

Table 2: Orthology of yphC and ygjK

Nukleová Ortolog Giant. Aminoky- Sequence Sequence acid No - selinium nuclear don't code i- or orto- sequence acid whose poly- peptide log orthologist SEQ ID NO: orthologist SEQ ID NO: chain orthologist SEQ ID NO: yphC B. subtilis B-yphC GenBank incremental No. Z99115 4A-4B 11 10 12 yphC E. coli yfgK GenBank incremental No. AE000337 5A-5B 14 13 15 Dec ygjK B. subtilis B-ygjK GenBank incremental No. Z99116 6 17 16 18

4 · 4

ygjK E. coli elaC 7 20 May 19 Dec 21 GenBank incremental No. AE000316

The yphC polypeptides and genes described in the present invention include the polypeptides and genes shown in Figures 1 and 2A-2B, as well as the isoenzymes, variants, and conservative sequence variations shown in Figures 1 and 2A-2B. The invention encompasses various isoenzymes of yphC and ygjK. For example, the invention encompasses genes that encode an essential polypeptide, although the gene comprises one or more point mutations, deletions, or promoter variants, provided that the resulting essential polypeptide retains the biological functions of the essential polypeptide.

The YphC polypeptide has the structural characteristics of known GTPases. Using BLAST analysis, yphC polypeptide was found to contain two domains that are likely to be GTPase domains, and yphC exhibits GTPase activity in vitro. This GTPase activity is linked to the essentiality of the yphC polypeptide. If point mutations are made in each yphC GTPase domain, such mutants are incapable of binding to GTP, so that these mutants are no longer capable of complementing bacterial strains lacking yphC. The YgjK polypeptide has the structural characteristics of known sulfatases. Therefore, various isoenzymes, variants, and conservative variations of the yphC and ygjK sequences shown in Figures 1 and 2A-2B retain the biological functions of yphC or ygjK, as determined, for example, in a GTPase or sulfatase activity assay or a conventional complementation assay. Suitable assays for GTPase and sulfatase activity are known in the art (see, for example, Bollag et al., Meth. Enzymol.

255: 161 (1995) and Barbeyron et al., Microbiol. 141: 2897 (1995), incorporated herein by reference). GTPase activity fl · fl • • •

yphC can also be tested using a conventional malachite green phosphorus release assay (see, for example, Lanzetta et al., 1979, Analytical Biochemistry 100: 95-97). The use of KCl in such assays results in approximately 70-fold stimulation of GTPase activity.

The term yphC gene also includes degenerate variants of the nucleic acid sequence shown in Figures 1 and 2A-2B (SEQ ID NOs: 1 and 4). Degenerate nucleic acid sequence variants exist because of the degeneracy of the amino acid code; therefore, those sequences that differ from the sequences set forth in SEQ ID NOs: 1 and 4 but which encode the yphC polypeptide nevertheless fall within the scope of the present invention.

Similarly, because of the similarity of amino acid structure, conservative variations (as described herein below) of the yphC polypeptide amino acid sequences that retain the function of the polypeptide (as determined, for example, by a conventional complementation assay) can be made. Other yphC polypeptides and genes identified in other bacterial strains may be such conservative variations or degenerate variants of a particular yphC polypeptide and nucleic acid set forth in Figures 1 and 2A-2B (SEQ ID NOs: 1-6). The YphC polypeptide and gene have at least 80%, for example, 90%, sequence identity to SEQ ID NOs: 2 and 1, respectively, or to SEQ ID NOs: 5 and 4, respectively. Regardless of the percent sequence identity between the yphC sequence and the sequence set forth in SEQ ID NOs: 1, 2, 4 and 5, the yphC genes and polypeptides of the present invention are capable of complementing the lack of yphC function (e.g., temperature sensitive mutants) in a standard complementation assay.

Other yphC genes that are identified and cloned from other bacterial strains, in particular from pathogenic Gram-positive strains, can be used to produce yphC polypeptides for use in various methods described in the present invention, for example in methods for identifying antibacterial agents. Similarly, the term γγκ includes isoenzymes, variants, and conservative variations of the sequence shown in Figure 3. In various embodiments, the essential polypeptide used in the assays of the present invention is derived from a non-pathogenic or pathogenic gram-positive bacterium. For example, the polypeptide may be derived from a Streptococcus strain such as Streptococcus pneumoniae, Streptococcus pyogenes,

Streptococcus agalactiae, Streptococcus endocarditis, Streptococcus faecium, Streptococcus sangus, Streptococcus viridans and Streptococcus hemolyticus. The orthologs of the yphC and ygjK genes can be derived from a wide variety of bacteria such as E. coli and B. subtilis.

After identifying the yphC and ygjK genes of the present invention as essential for bacterial survival, these essential genes and polypeptides encoded by these essential genes and their essential homologs and orthologs can be used to identify antibacterial agents. Such antibacterial agents can be readily identified by high performance assays for detecting inhibition of the metabolic pathway involved in an essential polypeptide. Such inhibition may be due to small molecules interacting with (for example, direct binding or indirectly) an essential polypeptide or other essential polypeptides in this pathway.

An exemplary method for identifying antibacterial compounds comprises screening for small molecules that specifically interact with (for example, direct binding or indirectly) an essential polypeptide. Various suitable interaction and binding assays are known in the art and are described, for example, in U.S. Pat.

«Suun.

Φ · φφφφ ·· ·· • · · φ φ φ φ φ φ φφφ · · · · _φφφφ Λ ♦ · »· φ · · φφ φφ. ······· φφφ · ·· ·· ·· φ U.S. Patent Nos. 5,585,577 and 5,679,582, which are incorporated herein by reference. For example, in various conventional assays, test compounds can be tested for their ability to interact with an essential polypeptide by measuring the ability of small molecules to stabilize the essential polypeptide in its folded, better than unfolded, state. More specifically, the degree of folding protection achieved using the test compound can be measured. Test compounds that bind to an essential polypeptide with high affinity can cause, for example, a significant shift in the temperature at which the polypeptide is denatured. Test compounds that stabilize an essential polypeptide in a folded state can be further tested for antibacterial activity in standard susceptibility tests.

Another exemplary method for identifying antibacterial agents comprises measuring the ability of a test compound to bind to one of the essential polypeptides of the present invention. Binding can be tested in a conventional capillary electrophoretic assay in which binding of a test compound to an essential polypeptide converts the electrophoretic mobility of the essential polypeptide.

Another suitable method for identifying essential polypeptides requires identifying the biochemical activity of the essential polypeptide and then screening for small molecules that inhibit this activity, for example using a highly efficient method. The YphC polypeptide has the structural characteristics of known GTPases and exhibits GTPase activity in vitro. Therefore, inhibitors of this polypeptide can be identified by their ability to inhibit the GTPase activity of yphC in a conventional GTPase activity assay. Suitable assays have been described previously (e.g., Gollag et al., Meth.

φ φ φ · · φ φ φ φ φ φ φ φ φ φ φ φ φ · · · · φ φ φ φ φ φ φ φ φ φ φ φ

Enzymol. 255: 161-170, 1995, incorporated herein by reference). A detailed example of a suitable test is given below.

The YgjK polypeptide has the structural characteristics of sulfatase and is believed to act as a sulfatase. Accordingly, inhibitors of the ygjK polypeptide can be identified by assaying the ability of a test compound to inhibit the sulfatase activity of ygjK. An example of a suitable assay is given in Barbeyron et al., Microbiol. 141: 2897-2904, 1995, incorporated herein by reference.

The invention also includes a method for identifying antibacterial agents which requires: (a) contacting an essential polypeptide, or a homologue or ortholog thereof, with a test compound; (b) detecting binding of the test compound to the polypeptide or a homolog or ortholog thereof; and optionally (c) determining whether the test compound that binds to the polypeptide or homolog or ortholog inhibits bacterial growth compared to the growth of bacteria grown in the absence of the test compound that binds to the polypeptide or homolog or ortholog, wherein the inhibition indicates that the test compound is an antibacterial agent.

In another suitable assay, a promoter that responds to depletion of an essential polypeptide by increased or decreased expression is linked to a reporter gene. To identify a promoter that increases or decreases its expression in response to an essential protein depletion, the gene encoding the essential protein is deleted from the genome and is replaced by a version of the gene in which the sequence encoding the essential protein is operably linked to a controllable promoter. Cells containing this controllable genetic construct are kept alive with the essential "eeaWEHSSSW" eaφφφ ·φ φφφφ ·· · · 9 9φ

ΦΦ 0

Φ Φ Φ

ΦΦ

A polypeptide produced from a genetic construct containing a controllable promoter. However, the controllable promoter allows the expression of an essential polypeptide to be reduced to a level that causes growth inhibition. Total RNA prepared from bacteria under such growth-limiting conditions is compared to native cell RNA. Standard transcriptional profiling methods can be used to identify types of mRNA that are more or less abundant (i.e., more or less transcribed) when expressed under growth-limiting conditions. Genomic sequence information, for example from GenBank, can be used to identify a promoter that directs the expression of identified types of RNA. Such promoters are regulated up or down by depletion of an essential polypeptide.

Upon identification of a promoter that is up-regulated by depletion of an essential polypeptide, such a promoter is operably linked to a reporter gene (e.g., βgalactosidase, gus, or green fluorescent protein (GFP)). The bacterial strain containing this reporter gene construct is then exposed to the test compound. Compounds that inhibit an essential polypeptide (or other polypeptide in the essential pathway that participates in the essential polypeptide) cause functional depletion of the essential polypeptide and therefore result in an increase or decrease in the expression of the reporter gene. Compounds that inhibit essential polypeptides in such assays should be antibacterial and can be further tested, if desired, in appropriate susceptibility tests.

In a similar method for identifying antibacterial compounds, essential polypeptides are used to isolate peptide or nucleic acid ligands, which are

Λ Λ Λ Λ

specifically binds to essential polypeptides. These peptide or nucleic acid ligands are then used in the displacement screen, which leads to the identification of small molecules that interact with the essential polypeptide. Such assays can be performed as described above.

In yet another method, the interaction of a test compound with an essential polypeptide (i.e., direct or indirect binding) can be detected in a conventional two-hybrid system for detecting protein / protein interactions (e.g., in yeast or mammalian cells). A test compound that has been found to interact with an essential polypeptide can be further tested for antibacterial activity in a conventional susceptibility assay. Generally, in such a two-hybrid assay, (a) the essential polypeptide is prepared as a fusion protein comprising a polypeptide fused to (i) a transcription activating domain of a transcription factor, or (ii) a DNA binding domain of a transcription factor; (b) a test polypeptide prepared as a fusion protein comprising a polypeptide fused to (i) a transcription activating transcription factor domain, or (ii) a transcription factor binding DNA domain; and (c) binding of the test polypeptide to the polypeptide is detected according to the reconstitution of the transcription factor. Homologues and orthologs of essential polypeptides can be used in similar methods. Reconstitution of a transcription factor can be detected, for example, by detecting the transcription of a gene that is operably linked to a DNA sequence by a DNA-binding domain of the reconstituted transcription factor (see, for example, White, 1996, Proc. Natl. Acad. Sci. 93: 10001-10003 and references). and Vidal et al., 1996, Proc. Natl. Acad. Sci. 93: 10315-10320).

• • •

In an alternative method, an isolated nucleic acid molecule encoding an essential polypeptide is used to identify a compound that reduces the expression of the essential polypeptide in vivo. Such compounds can be used as antibacterial agents. To identify such compounds, cells that express an essential polypeptide are cultured, exposed to the test compound (or mixture of test compounds) and the level of expression or activity is compared to the level of expression or activity of the essential polypeptide in cells that are identical but not exposed compounds. Many standard quantitative gene expression assays can be used in this aspect of the present invention.

To identify compounds that modulate the expression of an essential polypeptide (or homologous or orthologous sequence), the test compound can be added at various concentrations to the cell culture medium that expresses the essential polypeptide (or homolog or ortholog) as described herein. Such test compounds include small molecules (usually non-proteinaceous, non-polysaccharide chemical entities), polypeptides, and nucleic acids. Expression of the essential polypeptide is then measured, for example, by northern blotting, PCR analysis, or RNAse protection, using the nucleic acid molecule of the present invention as a probe. The level of expression in the presence of the test molecule is compared to the level of expression in the absence of the test molecule, and thus it is determined whether the test molecule alters the expression of the essential polypeptide. Because yphC and ygjK polypeptides are essential for cell survival, a test compound that inhibits expression and / or function of an essential polypeptide or its homolog or ortholog will be tested.

inhibit growth or kill cells that express such polypeptides.

Polypeptides encoded by essential genes can be used, alone or together, in assays to identify compounds that interact with such polypeptides. Test compounds interacting with these polypeptides can then be readily tested, in conventional assays, for their ability to inhibit bacterial growth. Test compounds that interact with essential polypeptides are potential antibacterial agents, as opposed to compounds that do not interact with essential polypeptides. As described herein, any of a variety of methods known in the art can be used to test interactions of test compounds with essential polypeptides.

Usually, the test compound will be a small organic molecule. Alternatively, the test compound may be a test polypeptide (for example, a polypeptide having a random or predetermined polypeptide sequence; or a natural or synthetic polypeptide) or a nucleic acid such as a DNA or RNA molecule. The test compound may be a natural compound or it may be a synthetic compound. Synthetic libraries, chemical libraries, and the like can be screened to identify compounds that bind to an essential polypeptide. More generally, binding of a test compound to a polypeptide, homolog or ortholog thereof can be detected either in vitro or in vivo. If desired, the above-described methods for identifying compounds that modulate the expression of the polypeptides of the present invention can be combined with measuring the concentrations of essential polypeptides expressed in cells, for example, by Western blot analysis using antibodies that bind to the essential polypeptide.

esBBasBawBsassssjffss

Regardless of the source of the test compound, the essential polypeptides of the present invention can be used to identify compounds that inhibit the activity of an essential protein or the transcription of an essential gene or translation of mRNA transcribed from the essential gene. These antibacterial agents can be used to inhibit a wide variety of pathogenic or non-pathogenic bacterial strains.

In other embodiments, the invention comprises pharmaceutical compositions comprising pharmaceutically acceptable excipients and an antibacterial agent identified using the methods of the present invention. In particular, the invention includes pharmaceutical compositions comprising antibacterial agents that inhibit growth or kill pathogenic bacterial strains (e.g., pathogenic gram-positive bacterial strains such as pathogenic Streptococcus strains). Such pharmaceutical compositions can be used in methods of treating bacterial infections in an organism (e.g., streptococcal infections). Such a method comprises administering to the body a therapeutically effective amount of a pharmaceutical composition, for example an amount sufficient to alleviate the symptoms and / or signs of a bacterial infection. In particular, such pharmaceutical compositions can be used to treat bacterial infections in mammals such as humans and pets (e.g., cows, pigs, dogs and cats) and plants. The efficacy of such antibacterial agents in humans can be evaluated in animal models well known to those skilled in the art (e.g., mouse or rabbit models, e.g., streptococcal pneumonia).

sssgaSBSSassw

ΦΦ φ φ · · φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ · φ φ • · ·

Various affinity agents that cross the microbial membrane (i.e., antibodies and antibody fragments) are useful in practicing the methods of the present invention. For example, polyclonal and monoclonal antibodies that specifically bind to a yphC polypeptide or a ygjK polypeptide may facilitate the detection of essential polypeptides in various bacterial strains (or extracts thereof). These antibodies are also useful for detecting binding of a test compound to essential polypeptides (for example, in the assays described herein). In addition, monoclonal antibodies that bind to essential polypeptides can themselves be used as antibacterial agents.

The invention further encompasses methods for identifying strains carrying conditionally lethal mutations from a large group of mutants. In general, the gene and the respective gene product are sequentially identified, although strains alone may be used in screening or diagnostic assays. The mechanism of action of the identified genes and gene products is the basis for the development of new antibacterial agents. These antibacterial agents reduce the effects of the gene product in the native strain and are therefore useful for treating individuals infected with this type or similarly sensitive type by administering to said individual a pharmaceutically effective amount of the compound. Reducing the effect of a gene product involves competitively inhibiting a gene product at an active site of an enzyme or receptor; non-competitive inhibition; disrupting the intracellular cascade involved in the gene product; binding to the gene product itself, before or after its post-translational processing; and acting as a mimetic of the gene product, reducing its activity. Therapeutic agents include monoclonal antibodies directed against the gene product.

• ♦ ♦ · * * * *

Further, the presence of the gene sequence in some cells (e.g., pathogenic bacteria of the same genus or similar species) and the absence or divergence of the sequence in the host cells can be determined, if desired. Therapeutic agents directed against genes or gene products that are not present in the host have several advantages, including a low incidence of adverse events and a low total necessary dose.

Nucleic acids include RNA and DNA, including genomic DNA and synthetic (e.g., chemically synthesized) DNA. The nucleic acids may be double-stranded or single-stranded. If they are single-stranded, they may be coding strands or antisense strands. Nucleic acids can be synthesized using oligonucleotide analogs or derivatives (for example, inosine or phosphorothioate nucleotides). Such oligonucleotides can be used, for example, to prepare nucleic acids having altered base-pairing ability or increased nuclease resistance.

An isolated nucleic acid is a DNA or RNA that does not bind immediately to both coding sequences to which it directly binds (one at the 5 'end and the other at the 3' end) in the natural genome of the organism from which it is derived. Thus, in one embodiment, the isolated nucleic acid comprises some or all of the 5'-non-coding (e.g., promoter) sequences immediately adjacent to the coding sequence. Therefore, the term includes, for example, recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid or virus, or a prokaryote or eukaryote genomic DNA, or that exists as a separate molecule (e.g., a genomic DNA fragment produced by PCR or digestion). • restriction endonuclease) independent of other sequences. Also, the term includes recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequences.

The term isolated may refer to a nucleic acid or polypeptide that is substantially free of cellular material, viral material or culture medium (if prepared by recombinant DNA techniques), or chemical precursors or other chemical compounds (if synthesized chemically).

D81e, an isolated nucleic acid fragment is a nucleic acid fragment that does not occur naturally as a fragment and that cannot be detected in the natural state.

The nucleic acid sequence that is significantly identical to the essential nucleotide sequence is at least 80% (e.g. at least 85%) identical to the nucleotide sequence of yphC or ygjK as set forth in SEQ ID NO: set forth in Table 1, which are described in FIG. 1-3. For nucleic acid comparison, the length of the reference nucleotide sequence should be at least 40 nucleotides, for example at least 60 nucleotides or more.

To determine the percent identity of two amino acid sequences or two nucleic acids, the sequences are aligned for optimal alignment (for example, gaps may be inserted into the sequence of the first amino acid sequence or nucleic acid sequence to allow optimal alignment of the second amino acid or nucleotide sequence). The amino acid residues or nucleotides at the respective amino acid positions or nucleotide positions are then compared. If the position in the first sequence is occupied by the same amino acid residue or nucleotide as in the corresponding position in the second sequence, the molecules in that position are identical. Percent identity between two sequences is a function of • ft • ft

the number of identical positions in both sequences (i.e.,% identity = number of identical positions / total number of overlapping positions x 100). Preferably, both sequences are of equal length.

The determination of percent identity or homology between two sequences can be performed using a mathematical algorithm. A suitable mathematical algorithm used to compare two sequences is the algorithm of Karlin and Altschul (1990) Proc. Nati. Acad. Sci. USA 87: 2264-2268, modified according to the method of Karlin and Altschul (1993) Proc. Nati.

Acad. Sci. USA 90: 5873-5877. Such an algorithm is used in NBLAST and XBLAST programs designed by Altschul et al., (1990), J. Mol. Biol. 215: 403-410. BLAST nucleotide comparison can be performed using the NBLAST program, early = 100, wordlength = 12, to obtain a nucleotide sequence homologous to the yphC or ygjK nucleic acid molecule of the present invention. BLAST protein comparison can be performed using the XBLAST program, early = 50, wordlength = 3, to obtain an amino acid sequence homologous to the yphC or ygjK protein molecules of the present invention. A gapped BLAST as described in Alschul et al., (1997), Nucleic Acids Res. 25: 3389-3402.

When using BLAST and gapped BLAST programs, error parameters of the respective programs (for example, XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another example of a mathematical algorithm used for sequence comparison is the algorithm described by Myers and Miller, CABIOS (1989). Such an algorithm is used in the ALIGN program (version 2.0), which is part of a GCG sequence alignment software package.

When using the ALIGN program for amino acid sequence comparison, the PAM120 residue weight table, gap length penalty 12, and gap fines 4 can be used.

• · · 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9

88 99 9

The percent identity between two sequences can be determined using the techniques described above, with or without allowing gaps. When calculating identity, only exactly identical positions are counted.

Essential polypeptides of the present invention include, but are not limited to, recombinant polypeptides and natural polypeptides. Also useful in the present invention are nucleic acid sequences that encode forms of essential polypeptides in which natural amino acid sequences are altered or deleted. Preferred nucleic acids encode polypeptides that are soluble under normal physiological conditions. The invention also encompasses nucleic acids encoding fusion proteins in which a portion of an essential polypeptide is fused to an unrelated polypeptide (e.g., a marker polypeptide or a fusion partner) to form a fusion protein. For example, the polypeptide may be fused to a hexa-histidine tail to facilitate purification of bacterially expressed polypeptides, or to a hemagglutinin tail to facilitate purification of polypeptides expressed in eukaryotic cells. The present invention also includes, for example, isolated polypeptides (and nucleic acids encoding such polypeptides) that comprise a first portion and a second portion; the first part comprises an essential polypeptide and the second part comprises an immunoglobulin constant region (Fc) or a detectable marker.

The fusion partner may be, for example, a secretion facilitating polypeptide, for example, a secretory sequence. Such a fusion polypeptide is usually referred to as a preprotein. The secretion sequence can be cleaved by the host cell to produce the mature protein.

The present invention also encompasses nucleic acids which

SBBWSSSSSSS ??? '??'

9999 99 9999 9 «99 • 9 · · · 9 · 9 · 9 ·

9 · 9 9 9 9999

9,999 99,999 9

9999 999 9999

99 99 9 99 99 encode an essential polypeptide fused to the polypeptide sequence to form an inactive preprotein. Preproteins can be converted to the active form of the protein by removing the inactivating sequence.

The present invention also encompasses nucleic acids that hybridize, for example, under stringent hybridization conditions (as defined herein) to all or part of the nucleotide sequence set forth in SEQ ID NO: 1 or 7, or to their complementary sequences. The hybridizing portion of the hybridizing nucleic acid is at least 15 (e.g., 20, 25, 30, or 50) nucleotides long. The hybridizing portion of the hybridizing nucleic acid has at least 80% (e.g., at least 95% or 98%) identity to a partial or all of the nucleic acid sequence encoding the essential polypeptide or a complementary sequence to that sequence. The hybridizing nucleic acids of the present invention can be used, for example, as cloning probes, primers (e.g. PCR primers) or diagnostic probes. Nucleic acids that hybridize to the nucleotide sequences set forth in SEQ ID NOs: 1 and 7 are considered antisense oligonucleotides.

Also provided by the present invention are various genetically engineered cells, such as transformed host cells, that contain the essential nucleic acids of the present invention. A transformed cell is a cell into which (or whose ancestor) a recombinant DNA nucleic acid encoding an essential polypeptide has been inserted by recombinant DNA techniques. These include both prokaryotic and eukaryotic cells, for example bacteria such as Streptococcus, Bacillus and the like.

φ * φφφφ

ΦΦ φφ φφ φ φφ φ φφφφ

Φ φ · 9 9 9 9 9 9 9

Φ · ΦΦΦ Φφ φφ φφ φ

ΦΦΦΦ ΦΦΦ φφφφ

· ΦΦ ΦΦ Φ · »ΦΦ

Also provided by the present invention are genetic constructs (e.g., vectors and plasmids) that comprise a nucleic acid of the present invention that is operably linked to a transcriptional and / or translational sequence allowing expression, for example in the form of an expression vector. The selected nuclic acid, for example a DNA molecule encoding an essential polypeptide, is operably linked to a transcriptional and / or translational sequence, where it is located adjacent to one or more elements of the sequence, for example, a promoter that directs transcription and / or translation of the sequence such that the sequence elements may control the transcription and / or translation of the selected nucleic acid.

The present invention also relates to purified and isolated polypeptides encoded by the essential yphC and ygjK genes. The terms protein and polypeptide both refer to any amino acid chain, regardless of its length or post-translational modifications (e.g., glycosylation or phosphorylation). Thus, the terms yphC polypeptide and ygjK polypeptide include complete, natural, isolated yphC and ygjK proteins, as well as recombinantly or synthetically produced polypeptides that correspond to the complete natural proteins, or portions of natural or synthetic polypeptides (provided that a portion of the yphC polypeptides comprises part of the sequence FIG.

1) ·

A purified or isolated compound is a composition that is at least 60% by weight of the desired compound, for example an essential polypeptide or antibody. Preferably, the composition is at least 75% (e.g., at least 90%,

95% or even 99%) by weight of the selected compound. Purity can be measured by any suitable standard method, for example

BSBSS ^ ST '

ΦφΦΦΦΦ · * ···· ΦΦ 44 • Φ φ · Φ · Φ φ Φ

ΦΦΦ ΦΦΦ ΦΦΦΦ

ΦΦ ΦΦΦΦΦ ΦΦΦΦΦ

ΦΦΦΦ ΦΦΦ ΦΦΦΦ

ΦΦΦΦ ΦΦΦ Φφ ΦΦ column chromatography, polyacrylamide gel electrophoresis or HPLC analysis.

Preferred essential polypeptides include sequences substantially identical to all or part of the natural essential polypeptide, for example, including all or part of the sequence shown in Figures 1, 2A-2B and 3 (provided that a portion of the yphC polypeptide comprises a portion of the sequence shown in Figure 1) . Polypeptides significantly identical to the essential polypeptide sequences of the present invention have an amino acid sequence that is at least 80% identical to the amino acid sequence of the essential polypeptides set forth in SEQ ID NO: listed in Table 1 (as determined by the method described herein). The novel polypeptides may also have a higher percent identity, for example, 85%, 90%, 95% or greater. For comparison, the length of the essential polypeptide reference sequence should be at least 16 amino acids, for example at least 20 or 25 amino acids.

In the case of polypeptide sequences having less than 100% identity to a reference sequence, the non-identical positions are preferably, but not necessarily, conservative substitutions in the reference sequence. Conservative substitutions typically include substitutions within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; and phenylalanine and tyrosine.

If a particular polypeptide is said to have a certain percent identity to a reference polypeptide of defined length, then the percent identity is relative to the reference polypeptide. Thus, a polypeptide that is 50% identical to a reference polypeptide having a length of 100 amino acids can be a polypeptide of 50 amino acids that is completely identical to a 50% amino acid polypeptide that is entirely identical to a 50% amino acid polypeptide. · Amino acids with a long portion of the reference polypeptide.

Alternatively, it may be a 100 amino acid polypeptide that is 50% identical to the reference polypeptide over its full length. Of course, other polypeptides will also meet the same criteria.

The present invention also encompasses purified and isolated antibodies that specifically bind to an essential polypeptide. An antibody specifically binds to a particular antigen, for example an essential polypeptide, when it binds to an antigen but does not significantly recognize and bind to other molecules in the sample, for example, a biological sample that naturally contains the essential polypeptide.

In another aspect, the invention relates to a method for detecting an essential polypeptide in a sample. The method comprises: obtaining a sample suspected of containing an essential polypeptide; contacting the sample with an antibody that specifically binds to an essential polypeptide under conditions that allow complexation of the antibody and the essential polypeptide; and detecting complexes, if any, that are indicative of the presence of an essential polypeptide in the sample.

The present invention also relates to a method for obtaining a gene related to an essential gene. Such a method comprises obtaining a labeled probe that comprises an isolated nucleic acid encoding all or part of an essential nucleic acid or a homologue thereof; screening the library of nucleic acid fragments with a labeled probe under conditions that allow hybridization of the probe to the nucleic acid fragments in the library to form nucleic acid duplexes; isolating labeled duplexes, if any; and preparing the complete gene sequence from the nucleic acid fragments in any of the labeled duplexes to obtain flflf flflf flflf flflf The fl related gene related to the essential gene. Alternatively, such related genes can be identified by BLAST screening of various sequenced bacterial genomes as described above.

The invention also offers several advantages. For example, the method for identifying antibacterial agents may be adapted to highly screen many potential antibacterial agents. Since it is believed that the essential genes described in the present invention are highly conserved, it is expected that antibacterial agents directed against these genes or their gene products will have antibacterial activity against many bacteria.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood in the art. Although methods and materials similar to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are those described herein. All publications, patent applications, patents, and other references cited herein are hereby incorporated by reference in their entirety. In the event of a conflict, the present application, including definitions, will be reviewed. In addition, the materials, methods, and examples are illustrative and in no way limit the scope of the present invention as defined in the appended claims.

Other features and advantages of the present invention will be apparent from the following detailed description and from the appended claims.

ΦΦ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ »»

Description of the figures in the attached drawings

Giant. 1 shows the amino acid and nucleotide sequences of the yphC polypeptide and the coding and non-coding strands of the yphC gene from Streptococcus pneumoniae (SEQ ID NOs: 2, 1 and 3, respectively).

Giant. 2A-2B depict the complete amino acid and nucleotide sequences of the yphC polypeptide and the coding and non-coding strands of the yphC gene from Streptococcus pneumoniae (SEQ ID NOs: 5, 4, and 6, respectively).

Giant. 3 shows the amino acid and nucleotide sequences of the ygjK polypeptide and the coding and non-coding strands of the ygjK gene from Streptococcus pneumoniae (SEQ ID NOs: 8, 7 and 9, respectively).

Giant. 4A-4B show the amino acid and nucleotide sequences of the Β-yphC polypeptide and the coding and non-coding strands of the Β-yphC gene from the B. subtilis strain (SEQ ID NOS: 11, 10, and 12, respectively).

Giant. 5A-5B show the amino acid and nucleotide sequences of the yfgK polypeptide and the coding and non-coding strands of the yfgK gene from an E. coli strain (SEQ ID NOS: 14, 13 and 15, respectively).

Giant. 6 shows the amino acid and nucleotide sequences of the BygjK polypeptide and the coding and non-coding strands of the B-ygjK gene from the B. subtilis strain (SEQ ID NOs: 17, 16 and 18, respectively).

·· »**« ···· 46 46 • 4 4 9 4 4 9 4 9 4

4 4 4 4 4 4 4 4

4 4 4 4 4 4 4 4 4 4

ΊΊ 4 4 4 4 4 4 4 9 4 4 9 · «« 9 · '·

Giant. 7 shows the amino acid and nucleotide sequences of elaC polypeptides and a gene from an E. coli strain (SEQ ID NOs: 20, 19 and 21, respectively).

Giant. 8 is a schematic representation of the PCR strategy used to produce DNA molecules used for targeted deletion of essential genes in Streptococcus pneumoniae.

Giant. 9 is a schematic representation of the strategy used to produce targeted deletions of essential genes in Streptococcus pneumoniae.

Giant. 10 is a schematic representation of the strategy used to obtain non-polar gene deletions in the yphC and ygjK genes in B. subtilis.

Giant. 11A-11C are schematic representations of the strategy used to prepare conditional null mutants of the yphC and ygjK genes.

Giant. 12 is a schematic representation of the strategy used to produce deletion of essential genes in E. coli and shows the essential phenotype of the E. coli yfgK gene, which is an ortholog, of the yphC gene of S. pneumoniae.

It has been found that at least two genes in Streptococcus pneumoniae are essential for the survival of these bacteria. These so-called essential genes, yphC and ygjK, encode proteins referred to herein as essential polypeptides. The YphC and ygjK genes are useful molecular tools for identifying similar genes in pathogenic microorganisms, such as pathogenic Bacillus sp. Essential polypeptides are useful targets for identifying compounds that are

SBHSBHHKSJÍS * '

9499

9 9

9 9

4 4 9

9 4 4

# 4 9994

9 4

4 4

4 4

4 9 »

49

4 4 4

4 4 9

Pathogen inhibitors in which essential polypeptides are expressed.

Identification of essential Streptococcal genes

As noted in the experiments described below, both the yphC and ygjK genes are essential for the survival of Streptococcus pneumoniae. Streptococcus pneumoniae is available from the ATCC. In general, and for the examples below, essential genes can be identified by creating targeted deletions in selected genes in bacteria, for example S. pneumoniae. These selected genes were selected as follows. Libraries containing Streptococcus pneumoniae genor fragments were prepared using standard molecular biology techniques using M13 phage or plasmid DNA as a vector. The open reading frames (ORFs) contained in these libraries were randomly sequenced, using primers hybridizing to the vector. The selected genes for targeted deletions met four criteria, as determined by sequence comparison with the GenBank nucleotide sequence database: (i) ORF had no known function; (ii) the ORF had an ortholog in Bacilus subtilis; (iii) the ORF was preserved in other bacteria, with ρ <10 ^-10 ; and (iv) ORF had no eukaryotic ortholog, with ρ <10 ^"3. The yphC and ygjK streptococcal genes meet all of these criteria, suggesting that a compound that inhibits yphC and ygjK genes or gene products will have a broad spectrum of antibacterial activity.

The YphC and ygjK genes were each replaced by a nucleic acid sequence conferring resistance to the antibiotic erythromycin (erm gene). Other genetic markers may be used in place of this antibiotic resistance gene. Polymerase chain reaction (PCR) amplification can be used for

MUM is creating a targeted deletion in Streptococcal genomic DNA, as shown in Figure 8. Several PCR reactions have been used to produce the DNA molecules required to perform a targeted deletion of selected genes. First, the erm gene from B. subtilis pIL252 (obtained from the Bacillus Genetic Stock Center, Columbus, OH) was amplified using primers 5 and 6. Primer 5 consists of 21 nucleotides that are identical to the promoter region of the erm gene and which are complementary to sequence A. Primer 5 has the sequence 5 'GTG TTC GTG CTG ACT TGC ACC 3' (SEQ ID NO: 22). Primer 6 consists of 21 nucleotides that are complementary to the 3 'end of the erm gene. Primer 6 has the sequence 5 'GAA TTA TTT CCT CCC GTT AAA 3' (SEQ ID NO: 23). PCR amplification of the erm gene was performed under the following conditions: 30 cycles of 94 ° C for 1 minute, 55 ° C for 1 minute, and 72 ° C for 1.5 minutes, followed by one cycle of 72 ° C for 10 minutes minutes.

In the second and third PCR reactions, sequences flanking the selected gene were amplified and prepared as hybrid DNA molecules that also contained part of the erm gene. In a second reaction, a double stranded DNA molecule (designated as the left adjacent molecule) was prepared which contained the sequences upstream of the 5 'end of the selected gene and the first 21 nucleotides of the erm gene. As shown in Figure 8, this reaction utilized a primer of 21 nucleotides in length and identical to a sequence that is located approximately 500 bp upstream of the translational start site of the selected gene. Primers 1 and 2 are gene specific and have the sequences 5 'TGA AGC CTG TCA AGG ACG AGG 3' (SEQ ID NO: 24) and 5 'CCT TAC GTG GTC GAA TTG TGG 3' (SEQ ID NO: 25), respectively. order, for ygjK. For yphC, primers 1 and 2 had 5 'TGT ATG AAT sequences and TGG TAC CTC AAG 3' (SEQ ID NO: 26) and

5 'ACA ATG GCA ATA GTT GGT AGG 3' (SEQ ID NO: 27), respectively. Primer 2 has a length of 42 nucleotides, with 21 nucleotides at the 3 'end of the primers complementary to the 5' cotta ··· ·················· φ φ φ << << << << << << << << << << << << << << << << << << << << << << << << << << << << << << << The 21 nucleotides at the 5 'end of the primer are identical to sequence A and are therefore complementary to the 5' end of the erm gene. Thus, by PCR amplification using primers 1 and 2, a left adjacent molecule is prepared, which is a hybrid DNA molecule containing sequences upstream of the selected gene and 21 pairs of erm gene as shown in Figure 8.

The third PCR reaction is similar to the second reaction but produces the right flanking DNA molecule as shown in Figure 8. The flanking DNA molecule contains 21 bp 3 'ends of the erm gene, 21 bp 3' ends of the selected gene and sequence behind the selected gene. This right flanking molecule was prepared using gene-specific primers 3 and 4. For ygjκ, primers 3 and 4 had the sequences 5 'GTG GAA ATC TAG CAG 3' (SEQ ID NO: 28) and 5 'ATC TGG TTC TAG CAG GAA GCG 3 '(SEQ ID NOS:

29), respectively. For yphC, primers 3 and 4 had the sequence 5 'CAT TGC CAG TCC TGT TGC TGG 3' (SEQ ID NO: 30). and 5 'ATG GCA TCC ATG ACA TCG 3' (SEQ ID NO: 31), respectively.

Primer 3 is 42 nucleotides in length, with 21 nucleotides at the 5 'end of primer 3 being identical to sequence B and are therefore identical to the 3' end of the erm gene. The 21 nucleotides at the 3 'end of primer 3 are identical to the 3' end of the selected gene. Primer 4 is 21 nucleotides in length and is complementary to a sequence located approximately 500 bp downstream of the selected gene.

PCR amplification of the left and right neighboring DNA molecules was performed, separately, in a 50 μΐ reaction mixture containing: 1 μΐ DNA (0.25 μς) of Streptococcus pneumoniae (RXI), 2.5 μΐ primer 1 or primer 4 (10 pmol / μΐ) , 2.5 μΐ of primer 2 or primer 3 (20 pmol / μΐ), 1.2 μΐ of dNTP mix (10 mM each), 37 μΐ HžO, 0.7 μΐ Tag polymerase (5 U / μΐ) and 5 μΐ 10x Taq polymerase buffer (10 ························ Qi · Tris, 50 mM KCl, 2.5 mM MgCl 2). Left and right adjacent DNA molecules were amplified using the following PCR cycles: 95 ° C for 2 minutes; 72 ° C for 1 minute; 94 ° C for 30 seconds; 49 ° C for 30 seconds; 72 ° C for 1 minute; repeated incubations at 94 ° C, 49 ° C and 72 ° C 30 times; 72 ° C for 10 minutes and then quenching. 15 μΐ aliquots of each reaction mixture were then electrophoresed on a 1.2% low melting point agarose gel in TAE buffer, and the gels were then stained with ethidium bromide. Fragments containing left and right neighboring DNA molecules were excised from the gel and purified using a QIAQUICK ^™ gel extraction kit (Qiagen Inc). Other methods known in the art for amplifying and isolating DNA can also be used. Neighboring left and right DNA fragments were eluted into 30 μΐ TE buffer at pH 8.0.

The amplified erm gene and the left and right neighboring DNA molecules were then fused together to obtain a fusion product as shown in Figure 8. The fusion PCR reaction was performed in a volume of 50 μΐ containing: 2 μΐ of the right and 2 μΐ of the left neighboring DNA molecule, and 2 μΐ erm gene PCR product; 5 μΐ 10x buffer; 2.5 μΐ of primer 1 (10 pmol / μΐ), 2.5 μΐ of primer 4 (10 pmol / μΐ), 1.2 μΐ of a mixture of dNTPs (10 mM each), 32 μΐ of H2O and 0.7 μ polymer of Taq polymerase. PCR reactions were performed using the following PCR cycles: 95 ° C for 2 minutes; 72 ° C for 1 minute; 94 ° C for 30 seconds; 48 ° C for 30 seconds; 72 ° C for 3 minutes; repeated incubations at 94 ° C, 48 ° C and 72 ° C 25 times; 72 ° C for 10 minutes. At the end of the reaction, 12 μΐ aliquots of the reaction mixture were subjected to agarose gel electrophoresis to confirm the presence of a final product of approximately 2 ΐ ΐ size. standard techniques. As shown in Fig. 9, the fusion product and the S. pneumoniae genome undergo homologous recombination, so that the erm gene replaces the chromosomal copy of the selected gene, causing the gene to be knocked out. The knockout of the essential gene leads to growth arrest on erythromycin containing medium. Using this gene exclusion method, the yphC and ygjK genes were identified as essential for survival. The portion of the yphC open reading frame that was sequenced prior to the targeted deletion is shown in Figure 1. The complete yphC sequence (shown in Figures 2A-2B) was folded using a TIGR database search for a S. pneumoniae clone having overlapping sequences 1 and combining the 3 'end of the gene from the database with the 5' end of the gene shown in FIG. 1. The function of the sequence contained in the clone from the database was unknown.

Identification of orthologs of essential genes

After demonstrating that the yphC and ygjK genes are essential for Streptococcal survival, the orthologs of these genes that have been identified in other organisms, such as B. subtilis or E. coli, can be tested to determine whether they are also essential for survival of these organisms. . To date, the coding sequences of yphC and ygjK have been used to search the GenBank database of nucleotide sequences, and the orthologs of each sequence have been identified in B. subtilis and E. coli. Sequence comparison was performed using the Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215: 403410, 1990). Percent sequence identity between essential polypeptides and their orthologs was determined using a GAP program from the Genetics Computer Group (GCG) Wisconsin Seguence

············ · · 999

9 · ·· · «··· • 9 9 φ ·· 9 9 9 * 9 9 99999 99999

9999 999 9999 «9 99 99 99 99 99

Analysis Package (Wisconsin Package Version 9.1; Madison, Wl). Penalty values for gap size (12) and gap length (4) were used.

Typically, the essential polypeptides and their orthologs have at least 25% (e.g., at least 30% or 40%) sequence identity. Typically, DNA sequences encoding essential polypeptides and homologues or orthologs thereof have at least 20% (e.g., 30%, 35%, 40%, or 45%) sequence identity. Bioinformation analysis of the yphC and ygjK genes showed that these genes are extensively conserved among bacteria.

To determine whether the identified orthologs yphC and ygjK are essential for the survival of other bacteria, each orthologous gene was separately deleted from the genome of the host organism, as described in more detail below. The observation that B. subtilis and E. coli orthophys yphC (B-yphC and yfgK, respectively) are also essential for survival of B. subtilis and E. coli suggests that the yphC gene is essential for all bacteria in which it occurs . Therefore, it is expected that antibacterial agents directed against this gene or its product will have a broad spectrum of antibacterial activity. The observation that the ortholog of B. subtilis ygjK (B-ygjK) but not the E. coli ortholog (elaC) is essential for survival suggests that this gene is essential in all gram-positive bacteria in which it is present but that it is not essential in gram-negative bacteria. Therefore, it is anticipated that antibacterial agents directed against the ygjK gene or product of this gene will have antibacterial activity against all gram-positive bacteria.

Deletion and determination of essentiality of yphC and ygjK genes in Bacilus subtilis

The following examples illustrate that yphC and ygjK orthologs in B. subtilis (i.e. Β-yphC and Β-ygjK) are essential for survival of B. subtilis. Two strategies were used to prepare knockout mutations of the sub-yphC and Β-ygjK genes in B. subtilis and the determination of the essential phenotype of the Β-yphC and B-ygjK genes was described in detail below. The first strategy (illustrated in Figure 10) was similar to the targeted deletion strategy used for gene cleavage in Streptococcus, as described above. The strategy included the following significant differences:

(A) In PCR, the B. subtilis chloramphenicol (CmR) resistance gene from plasmid pDG283 was used in place of the erythromycin resistance gene. Alternatively, any marker for B. subtilis may be used;

(B) the primers used to amplify the CmR gene and the B and C primers immediately adjacent to the yphC ORF contained a sequence of 27 nucleotides referred to as universal overlapping sequences. These universal overlapping sequences can be effectively used in PCR amplification and facilitate the use of various insertion sequences in fusion PCR reactions. Resistance markers, promoters, regulatory elements or any other nucleic acid sequences can be amplified with such overlapping sequences and can be used with the same set of gene deletion primers (primers A, B, C and D).

The sequence for the 5 'overhang region is 5' CACAGGAAACAGC TATGACCATGATTA 3 '(SEQ ID NO: 25) and the sequence for the 3' overhang region is 5 'GAAATAAATGCATCTGTATTTGAATG 3' (SEQ ID NO: 26);

(C) the left and right adjacent DNA molecules obtained by PCR should be at least 900 (e.g., 1000) nucleotides in length to optimize recombination into the B. subtilis chromosome;

(D) Two simultaneous PCR reactions were used to obtain the fusion product. One reaction was carried out at temperature

·········································· The treatment was 50 ° C and the second was carried out at 65 ° C. Longer extension times (30-60 seconds) were used and long polymerase with high reliability was also used according to the manufacturer's instructions (Boehringer Mannheim);

(E) competent cells of the native PY79 strain were used according to standard protocols for B. subtilis (Molecular Biological Methods for Bacillus, 1990, Harwood and Cutting, eds. Wiley and Sons, Ltd., England);

(F) the sequences of the primers shown in Figure 10 were as follows: primer Ra (5'CACAGGAAACAGCTATGACCATGATTAAACTAAAGCACCCATTAGTTCA 3 '(SEQ ID NO: 27) that hybridizes to the sequence upstream of the CmR promoter; 28)) which hybridizes to a sequence located adjacent to a transcriptional terminator; primer A-YPHC (5 'GCCATTGCGTTTGAAAG 3' (SEQ ID NO: 29)) primer A-YQJK (5 'TGCTTCGCCGATTTCTT 3' (SEQ ID NO: 30; primer B-YPHC (5 'TAATCATGGTCATAGCTGTTTCCTGTGTATGAAAAGAAACCCTTCAGAG 3' (SEQ ID NO: 31)) which is located adjacent to the yphC start codon; which is located adjacent to the ygjK start codon; primer C-YPHC (5 'GAAATAAATGCATCTGTATTTGAA TGTTTTAGAAAACCGAATCAGAGA 3' (SEQ ID NO: 33)) which is located adjacent to the yphC stop codon; primer C-YQJK (5 'GAAATAGATGTG' SEQ ID NO: 34) ,)), which is located adjacent to the ygjK stop codon; primer D-YPHC (5 'ATTCAGATCGAATACTCCTG 3' (SEQ ID NO: 35)); and primer D-YQJK · (5 'AAAGCGGGCAAAGCAGA 3' (SEQ ID NO: 36)).

Competent cells that were transformed with the fused left and right flanking DNA molecules were incubated for 18 hours at 37 ° C on selective medium (LB, 5 μΐ / ml Cm) to determine if the selected gene was essential (which • 9 · 9 9 9 9 9 9 9 9 444 4 4 9 9 9 9 9 9 9 «999

99 99 · · · «9 (absence of colony growth) or non-essential (which results in growth of tens to hundreds of colonies). When these deletion experiments were performed with the yphC and ygjK genes alone, no colonies were detected on the selective medium, indicating that each of these genes is essential for B. subtilis survival.

Several control experiments were performed to confirm that the observed absence of growth was due to the essential character of the Β-yphC and Β-ygjK genes. In similar PCR reactions and transformations using genes known not to be essential, hundreds of colonies were obtained, indicating that the experimental conditions were adequate to ensure that the absence of colony growth was an indicator of gene essentiality. It has also been shown that insertion of the CmR gene has a non-polar effect on downstream genes and allows efficient expression of downstream genes.

The second strategy used to obtain deletion mutants of the B. subtilis yphC and ygjK genes involved the construction of conditional null mutants in which expression of the selected gene could be terminated and on which a mutant phenotype could be observed (Figs. 11A-11C). In these mutants, a natural copy of the yphC or ygjK gene was placed under the control of the B. subtilis Para promoter, which is a finely-regulated promoter that can effectively turn off gene expression. These controllable genetic constructs were then inserted into the B. subtilis chromosome. As shown in Fig. 11A, controllable genetic constructs contained the amylase gene (amy) sequence and the CmR sequence for integration into the chromosome at the amy locus. Disruption of the amy gene by double crossing-over is harmless to the cell and recombinants are readily detected on starch plates because amy cells grow in transparent halo colonies.

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · Φ »» »φ» φ

After the integration of the regulatable yphC or ygjK genes into the chromosome of the natural cells, the obtained cells are prepared and transformed with a fusion PCR fragment containing a removable resistance marker (Fig. 11B) as described above. In this case, the fusion PCR fragment contained the kanamycin resistance gene from B. subtilis (Kan) instead of the CmR gene. Selection for this Kan marker during transformation of cells containing ectopically inserted regulated yphC and ygjK genes was performed in the presence of arabinose to allow expression of yphC and ygjK genes and trans-complementation of the deletion (Fig. 11C).

The YphC and ygjK mutants obtained by this method were able to grow on selective medium (LB Kan) in the presence of 0.2% arabinose, while selection performed on natural cells did not yield any mutants. Colonies containing the regulated genes and their deletions were then picked and plated on a similar medium (LB Kan, 0.2% arabinose) and on plates containing a selective medium with a lower arabinose concentration, no arabinose or 0.2% glucose. After an 18 hour incubation to allow colony growth, the only colonies containing the colonies were those containing 0.2%, 0.02% or 0.002% arabinose. Lower concentrations of induction or repression conditions (i.e., lack of arabinose or the presence of glucose) did not allow cell growth and colony formation. Therefore, these experiments show that: (I) the deletion generated by the fusion PCR does not affect the putative essential genes beyond yphC or ygjK, since expression of only one of these genes resulted in efficient complementation; and (ii) expression of the yphC and ygjK genes is necessary for the survival of B. subtilis cells.

The experiments described above confirmed that the Β-yphC and Β-ygjK genes are essential for B. subtilis. These experiments have led to the acquisition of ftft ftftftft ftft ftftftft conditionally lethal strains, which can be used in various screening tests and procedures , including assays using over or under expression, transcriptional profiling, etc. Preparation of knockout mutations of yphC and ygjK genes can be performed using any techniques known in the art.

Essential character tests of yphC and ygjK orthologs in E. coli

The discovery that yphC and ygjK genes are essential for Streptococcus pneumoniae and B. subtilis suggests that these genes are essential for all gram-positive bacteria. To further extend this finding to gram-negative bacteria and therefore to all bacteria, deletion mutants were prepared for yphC and ygjK orthologs in E. coli.

The general strategy used to prepare gene deletions in E. coli resulting in conditionally zero mutants is shown schematically in Figure 12. First, a copy of the natural gene to be deleted was cloned into a selectable vector containing the E. coli Pbad promoter.

This E. coli promoter is triggered by the presence of arabinose and is finely controllable, as is the promoter used for B. subtilis as described above. Cells containing this vector were then used to insert a deletion in the reading frame of the selected gene by replacing the gene with a nomarker small sequence of approximately 30 nucleotides.

The regions upstream and downstream of the selected gene were amplified by PCR using primers that insert a 27-30 nucleotide sequence.

Fusion PCR reactions were performed only with these two fragments, which are joined by a sequence located between them that replaces the selected gene.

· * ·· * ·· «:.

tftf ·· t tf «tf

This fragment was then cloned into the temperature-sensitive selectable plasmid pKO-3 and was inserted into the chromosome using conventional techniques (see, for example, Church et al., 1997, J. Bacteriol.). The resulting deletion in the reading frame was complemented by expression of the natural gene from the Pbad vector in the presence of arabinose (Fig. 11C, P on). The deletion mutant may suppress gene expression in the absence of arabinose, in the presence of glucose (P switched off), or in the presence of streptomycin without IPTG, thus allowing plasmid loss (since the Pbad plasmid complementary origin recognition sequence is under lac-IPTG control).

As shown in Fig. 12, deletion of the yphC sequence in E. coli and its replacement by sequences in the presence of the complementing plasmid Pbad-yphC ortholog results in mutants that grow well on arabinose plates but which do not grow on glucose or streptomycin plates. This result suggests that the yfgK gene (i.e., the yphC ortholog of E. coli) is essential for survival of E. coli. In contrast, similar experiments performed with the ygjK ortholog of E. coli, elaC, showed significant cell growth under all conditions, suggesting that the ygjK gene is not essential for E. coli. Alternatively, it is possible that other E. coli genes having arylsulfatase / phosphatase activity that do not have a similar sequence are capable of complementing the missing elaC function.

The fact that the orthologs of the yphC gene in B. subtilis and E. coli are essential for survival suggests that this gene is essential for all bacteria in which it is present. The YgjK gene, which is essential for the survival of S. pneumoniae and B. subtilis, appears to be essential for all gram-positive bacteria but not essential for E. coli. That's why

BMBwamasg

4499 99 9444 44

4 Φ * Φ φ Φ · »Φ

ΦΦΦΦ Φ Φ Φ ΦΦΦΦ

Φ Φ · Φ Φ φφ ΦΦ Φ • ΦΦΦ ΦΦΦ ΦΦΦΦ

ΦΦ ΦΦ ΦΦ · ΦΦ ΦΦ anticipates that the antibacterial agent directed against the yphC gene or the product thereof will have a broad spectrum of antibacterial activity (including gram-positive and gram-negative bacteria), while the antibacterial agent directed against or the product of this gene will be to have antibacterial activity against gram-positive bacteria.

Identification of essential genes and polypeptides in other bacterial strains

The YphC and ygjK genes and their various orthologic genes or fragments thereof can be used to detect homologous or orthologous genes in other organisms, more specifically, these genes can be used to analyze various pathogenic and non-pathogenic strains of bacteria. Nucleic acid fragments (DNA or RNA) encoding an essential polypeptide, homolog or ortholog (or sequences complementary to these sequences) can be used as probes in conventional assays utilizing nucleic acid hybridization to test other bacteria. For example, nucleic acid probes (which are typically 830, or preferably 15-20 nucleotides in length) can be used to detect essential genes or their homologous or orthologic genes in conventional molecular biology methods such as southern transfer, northern transfer, staining , PCR amplification, colony hybridization methods and the like. Typically, an oligonucleotide probe prepared according to the sequence or fragment thereof described herein is labeled and is used to screen a genomic library prepared from an mRNA obtained from a selected bacterial strain. Suitable methods for labeling include the use of a polynucleotide kinase to add P-labeled ATP to the oligonucleotide used as a probe. This φφφφ φφ φφφ φ φφ φφφ φφφ # * φφφ φφφ φφφφ • · · φ φ φ φ φφφφ · φφφφφφφ φφφ »~ ^ι ·· · φφ φ φ φφ φφ method is well known in the art, as well as several other ways (such as biotinylation and enzyme labeling).

Hybridization of an oligonucleotide probe to a library or other nucleic acid sample is usually performed under conditions of moderate to high stringency. The stability of the duplex or nucleic acid hybrid is expressed as the melting point or T _m , which is the temperature at which the probe dissociates from the target DNA. This melting point is used to define the necessary stringency conditions. If the sequences to be identified are related or significantly identical to the probe, and not entirely identical, it is preferred to first determine the lowest temperature at which only homologous hybridization occurs at a particular salt concentration (e.g., SSC or SSPE). Then, the final wash temperature in the hybridization reaction is lowered assuming that 1% mismatches result in a T _m decrease of 1 ° C (for example, if> 95% sequence identity to the probe is assumed, the final wash temperature is reduced by 5 ° C ). In practice, the T _m change may be between 0.5 and 1.5 ° C to 1% of the wrong pairs.

Stringent hybridization conditions are, for example, hybridization at 68 ° C in 5X SSC / 5x Denhart's solution / 1.0% SDS, or in 0.5 M NaHPO ₄ (pH 7.2) / 1 mM EDTA / 7% SDS, or in 50% formamide / 0.25 M NaHPO ₄ (pH 7.2) / 0.25 M NaCl / 1 mM EDTA / 7% SDS; and washing in 0.2x SSC / 0.1 = SDS at ambient temperature or at 42 ° C, or at 0.1x SDS at 68 ° C, or in 40 mM NaHPO ₄ (pH 7.2) / 1 mM EDTA / 5% SDS at 50 ° C, or in 40 mM NaHPO ₄ (pH 7.2) / 1 mM EDTA / 1% SDS at 50 ° C. Medium stringent conditions are, for example, washing in 3x SSC at 42 ° C. Salt concentration and temperature parameters may vary to achieve optimal levels of identity between the probe and the target nucleic acid. Further descriptions of such conditions can be found in the literature, for example, in Sambrook et al., 1989, Molecular Cloning, A Laboratory.

8

9

8 0

9 8 • 9

9 8

9

Manual, Cold Spring Harbor Press, N.Y .; and Ausubel et al. (eds), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, N.Y.) in Chapter 2.10.

In one approach, libraries constructed from pathogenic and non-pathogenic bacterial strains can be tested. For example, such strains can be tested for expression of essential genes by Northern blot analysis. After detection of essential gene transcripts or homologues thereof, libraries can be prepared from RNA isolated from a suitable strain, using standard techniques known in the art. Alternatively, a full genomic DNA library can be tested using an essential gene probe (or a probe for an essential gene homolog).

New gene sequences can be isolated, for example, by performing PCR using two sets of degenerate oligonucleotide primers designed according to nucleotide sequences in essential genes or in homologous or orthologous genes as described herein. The template for the reaction may be DNA obtained from strains known or believed to express an essential allele or allele of a homologous or orthologous gene. The PCR product may be subcloned and sequenced to confirm that the amplified sequences represent new essential nucleic acid sequences or homologous sequences of such nucleic acids.

The synthesis of various essential polypeptides or homologues or orthologs (or antigenic fragments thereof) for use as antigens or for other purposes can be readily accomplished using various techniques known in the art.

For example, an essential polypeptide or homolog or ortholog or antigenic fragment thereof may be synthesized chemically in vitro or enzymatically (for example, in vitro).

9 9 · · 9 * 9 9 9 9 9 99

9 99 9 9999 * 99 * 9 * 999 *

9 * 9 * 999 * 9 * 9

99 99 9 99 99 transcription and translation). Alternatively, the gene can be expressed in cells (e.g., in cultured cells) and can be purified from the cells using a variety of gene expression systems available. For example, the polypeptide antigen may be produced in a prokaryotic host (e.g., E. coli or B. subtilis) or in eukaryotic cells, such as yeast or insect cells (e.g., using a baculovirus expression vector).

Proteins and polypeptides can also be produced in plant cells, if desired. Viral expression vectors (e.g., cauliflower mosaic virus and tobacco mosaic virus) are suitable for plant cells. Such cells are available from a variety of sources (e.g., American Type Culture Collection, Rockland, MD; also see Ausubel et al. (Eds), 1995, Current Protocols in Molecular Biology, (John Wiley &amp; Sons, NY, 1994). for transformation or transfection, and the choice of expression vehicle depends on the host system selected The methods for transformation and transfection are described, for example, in Ausubel et al., supra, expression vehicles may be selected from those listed, for example, in Cloning Vectors: A Laboratory manual (PH Pouwels et al., 1985, Supp., 1987) Host cells containing an expression vehicle can be cultured in a conventional nutrient medium adapted to activate the selected gene, suppress the selected gene, select transformants, or amplify the selected gene.

If desired, yphC and ygjK polypeptides or homologs or orthologs thereof may be produced as fusion proteins. For example, the expression vector pUR278 (Ruther et al., EMBO J., 2: 1791, 1983) can be used to generate lacZ fusion proteins. PGEX vectors known in the art can be used to express foreign polypeptides in the form of fusion proteins with &quot; ^esR &quot; ^H &apos; KS535S5SSgKS5g ^^ &lt; - &gt; **

Glutathione-S-transferase (GST) *. * Glutathione-S-transferase (GST). Generally, such fusion proteins are soluble and can be readily purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. pGEX vectors are designed to contain thrombin or factor Xa protease cleavage sites so that the cloned gene product can be released from the GST moiety.

In an exemplary expression system, a baculovirus such as Autographa californica nuclear polyhedrosis virus (AcNPV) that grows in Spodoptera frugiperda cells may be used as a vector for expressing foreign genes. The coding sequence for an essential polypeptide, or a homolog or ortholog thereof, may be cloned into a non-essential region (e.g., the polyhedrin gene) of the viral genome and placed under the control of a promoter, e.g., a polyhedrin promoter or exogenous promoter. Successful insertion of a gene encoding an essential polypeptide or homologue thereof may result in inactivation of the polyhedrin gene and production of an unclosed recombinant virus (i.e., a virus without a protein envelope encoded by the polyhedrin gene). These recombinant viruses are then typically used to infect insect cells (e.g. Spodoptera frugiperda cells) in which the inserted gene is expressed (see, for example, Smith et al., J. Virol., 46: 584, 1983; Smith, US Patent No. 4215051) ). If appropriate, mammalian cells may be used instead of insect cells, provided that the virus is genetically engineered such that the gene encoding the selected polypeptide is placed under the control of a promoter that is active in mammalian cells.

Many viral expression systems can be used in mammalian host cells. If an adenovirus is used as an expression vector, the nucleic acid sequence may be 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9, 9 and 9.

· 9

A coding essential polypeptide or homolog thereof is ligated to an adenoviral transcription / translation control complex, for example, a late promoter and a tripartite leader sequence. This chimeric gene can then be inserted into the adenoviral genorn by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (for example, into the E1 or E3 region) results in a recombinant virus that is viable and which can express the essential gene product in infected host cells (see, for example, Logan, Proc. Natl. Acad. Sci. USA 81: 3655, 1984).

Specific initiation signals may be required for efficient translation of inserted nucleic acid sequences. These signals include the ATG initiation codon and surrounding sequences.

In general, exogenous translational control signals can be used, including the ATG initiation codon. Furthermore, the initiation codon must be in phase with the reading frame of the selected coding sequence to ensure translation of the entire sequence. These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. Expression efficiency can be enhanced by using appropriate transcription enhancer elements or transcription terminators (Bittner et al., Methods in Enzymology 153: 516, 1987).

Essential polypeptides and their homologues and orthologs can be expressed alone or in the form of fusion proteins with a heterologous polypeptide, such as a signal sequence or other polypeptide having a specific cleavage site at the N- and / or C-terminus of the protein or polypeptide. The heterologous signal sequence selected should be one that is recognized and processed, i.e., cleaved by a signal peptidase, in a host cell in which the fusion protein is expressed.

tf tff tff tff tff tff tff tff tff tff tff tfff tfff tftf tf ·· tftf

The host cell may be selected to affect the expression of the inserted sequence in a desired manner or to modify and process the gene product in a desired manner. Such modifications and processing (e.g., cleavage) of protein products can facilitate optimal protein function. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of proteins and gene products. Suitable cell lines or host systems known in the art may be selected to ensure proper modification and processing of the expressed foreign protein. For this purpose, eukaryotic host cells may be used which contain a cellular machinery for proper processing of the primary transcript and phosphorylation of the gene product. Such mammalian host cells include, without limitation, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and a chorioidal plex cell line.

If desired, the essential polypeptide or homolog or ortholog thereof may be produced in a stably transfected mammalian cell line. There are many vectors suitable for stable transfection of mammalian cells (see, for example, Pouwels et al., Supra); methods for preparing such cell lines are also known in the art (see, for example, Ausubel et al., supra). In one example, the DNA encoding the protein is cloned into an expression vector that contains the dihydrofolate reductase (DHFR) gene. Integration of the plasmid - and hence the gene encoding the essential polypeptide - into the host cell chromosome is confirmed by using 0.01-300 μ - of methotrexate in the cell culture medium (as described in Ausubel et al., Supra). This dominant selection can be performed in most cell types.

9 · «· 4 '9 W W 9 9 9 9 9 4 4 9 9 9 4 4 4

9 9 4 4 9 9 4 4 4 4 5

4 4 9 9 4

44 44 9 99 ft

Recombinant protein expression may be enhanced by DHFR mediated amplification of the transfected gene. Methods for selecting cell lines carrying gene amplifications are described in Ausubel et al., Supra; such methods usually require cultivation in a medium containing gradually increasing concentrations of methotrexate. DHFR-containing expression vectors commonly used for this purpose include pCVSEII-DHFR and pAdD26SV (A) (as described in Ausubel et al., Supra).

Many other selection systems can be used, such as herpes simplex virus thymidine kinase genes, hypoxanthine-guanine phosphoribosyl transferase genes, and adenine phosphoribosyltransferase genes, which can be used in tk, hgprt or aprt cells, respectively. In addition, gpt may be used which causes resistance to mycophenolic acid (Mulligan et al., Proc. Natl. Acad. Sci. USA 78: 2072, 1981); neo, which causes resistance to the aminoglycoside G-418 (Colberre, Garapin et al., J. Mol. Biol. 150: 1, 1981); and hygro, which causes resistance to hygromycin (Santerre et al., Gene, 30: 147, 1981).

Alternatively, any fusion protein can be readily purified using an antibody or other molecule that specifically binds to the expressed fusion protein. For example, the system described in Janknecht et al., Proc. Nati. Acad. Sci. USA, 88: 8972 (1981), allows easy purification of non-denatured fusion proteins expressed in human cell lines. In this system, the selected gene is subcloned into the vaccinia recombinant plasmid such that the open reading frame of the gene is fused translationally to an amino-terminal sequence consisting of six histidine residues. Extracts from cells infected with the recombinant vaccinia virus are introduced into Ni-nitriloacetic acid-agarose columns and proteins coupled to the · · r r r r r r r r r r r r r · · · · · · · ·

The histidine sequence is selectively eluted with buffers containing imidazole.

Alternatively, yphC or ygjK or a homolog or ortholog thereof may be fused to an immunoglobulin Fc domain. Such fusion proteins can be readily purified, for example, using a protein A column. In addition, such fusion proteins allow the production of chimeric forms of an essential polypeptide, or a homologue or ortholog thereof, that have greater stability in vivo.

After expression of the recombinant essential polypeptide (or homologue thereof), the polypeptide may be isolated (i.e. purified). The secreted forms of the polypeptides may be isolated from the cell culture medium, while the non-secreted forms must be isolated from the host cells. Polypeptides can be isolated by affinity chromatography. For example, an anti-yphC antibody (prepared, for example, as described herein) can be coupled to a column and used for protein isolation. Lysis and fractionation of protein containing cells prior to affinity chromatography can be performed using standard methods (see, for example, Ausubel et al., Supra). Alternatively, a fusion protein may be prepared and used to isolate an essential polypeptide (e.g., a yphC-maltose fusion protein, a yphC-β-galactosidase fusion protein or a yphC-trpE fusion protein; see, e.g., Ausubel et al., Supra; New England Biolabs Catalog, Beverly, MA). The recombinant protein may, if appropriate, be further purified, for example, by high performance liquid chromatography using conventional techniques (see, for example, Fisher, Laboratory Techniques in Biochemistry and Molecular Biology, eds., Work and Burdon, Elsevier, 1980).

wiaiuji · «··· <

Using the amino acid sequence disclosed herein, polypeptides useful in practicing the present invention, especially fragments of essential polypeptides, can be prepared by standard chemical synthesis (for example, using the methods described in Solid Phase Peptide Synthesis, 2nd Edition, The Pierce Chemical Co., Rockford, IL). 1984) and can be used, for example, as antigens.

Antibodies

YphC and ygjK polypeptides (or antigenic fragments thereof or analogs thereof) may be used to prepare antibodies useful in the present invention, and such polypeptides may be prepared recombinantly or by peptide synthesis techniques (see, for example, Solid Phase Peptide Synthesis, supra; Ausubel et al., above). Similarly, antibodies directed against yphC and ygjK homologs and orthologs (or antigenic fragments and analogues of such homologues and orthologs) can be obtained. In general, the polypeptides may be coupled to a carrier protein such as KLH as described in Ausubel et al., Supra, mixed with an adjuvant and injected into a mammal. A carrier is a substance that enhances stability and / or aids or enhances the transport or immunogenicity of a molecule bound thereto. Antibodies can be purified, for example, by affinity chromatography methods in which the polypeptide antigen is bound to a resin.

In particular, various animals can be immunized by injection of a selected polypeptide. Examples of suitable animals are rabbits, mice, guinea pigs and rats. Various adjuvants may be used to enhance the immunological response, depending on the host species, including, for example, Freund's complete and incomplete adjuvant, adjuvant inorganic gels (such as hydroxide

aluminum), surfactants (such as lysolecithin), pluronic polyol, polyanions, peptides, oil emulsions, hemocyanin, dinitrophenol, BCG (CalmetteGuerin bacillus) and Corynebacterium parvum. Polyclonal antibodies are a heterogeneous population of antibody molecules obtained from the sera of immunized animals.

Antibodies useful in the present invention include monoclonal antibodies, polyclonal antibodies, humanized or chimeric antibodies, single chain antibodies, Fab fragments _of F (ab ') 2 fragments, and molecules prepared using a Fab expression library.

Monoclonal antibodies (mAbs), which are a homogeneous population of antibodies against a particular antigen, can be prepared using yphC, ygjK or their homologues or orthologs and standard hybrid techniques (see, for example, Kohler et al., Nature, 256: 495, 1975; Kohler et al. al., Eur. J. Immunol. 6: 511, 1976; Kohler et al., Eur. J. Immunol. 6: 292, 1976; Hammerling et al., in Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY, 1981 Ausubel et al., Supra).

In particular, monoclonal antibodies can be obtained by any technique that allows the production of antibody molecules in a continuous cell line in culture, such as those described in Kohler et al., Nature 256: 495, 1975 and U.S. Pat. U.S. Patent No. 4,376,110; a technique using human B-cell hybrids (Kosbor et al., Immunology Today, 4: 72, 1983; Cole et al., Proc. Natl. Acad. Sci. USA 80: 2026, 1983); and the EBV-hybrid technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96, 1983). Such antibodies may be immunoglobulins of any class including IgG, IgM, IgE, IgA, IgD, and subclasses thereof. The mAbs producing the mAbs of the present invention can be cultured in vitro or in vivo.

After production, monoclonal or polyclonal antibodies are tested for specific recognition of an essential polypeptide or its homolog or orthologs in an immunoassay, such as by Western blotting or immunoprecipitation analysis, using standard techniques as described, for example, in Ausubel et al., Supra. Antibodies that specifically bind to essential polypeptides, conservative variants, homologs, and orthologs thereof are useful in the present invention. For example, these antibodies can be used in an immunoassay to detect an essential polypeptide in pathogenic or non-pathogenic strains of bacteria.

Preferably, the antibodies of the present invention are prepared using fragments of essential polypeptides believed to be antigenic, based on criteria such as high frequency of charged residues. In one particular example, such fragments are prepared by standard PCR techniques and are then cloned into a pGEX expression vector (Ausubel et al., Supra). The fusion proteins are expressed in E. coli and are purified using a glutathione -agarose affinity matrix as described in Ausubel et al., Supra.

If desired, several fusions (e.g., two or three) may be prepared for each protein and each fusion protein may be injected with at least two rabbits. The antiserum may be prepared by a series of injections, usually at least three boosting injections. Usually, the antiserum is tested for its ability to immunoprecipitate the recombinant essential polypeptide or its homologue or unrelated control proteins such as the receptor

for glucocorticoids, chloramphenicol acetyltransferase or luciferase.

Techniques developed for the production of chimeric antibodies (Morrison et al., Proc. Natl. Acad. Sci. USA 81: 6851, 1984; Neuberger et al., Nature 312: 604, 1984; Takeda et al.,

Nature, 314: 452, 1984) can be used to splice genes for a murine antibody molecule of appropriate antigen specificity with human antibody molecule genes with suitable biological activity. A chimeric antibody is a molecule in which different portions thereof originate from different animal species, for example, a chimeric antibody is an antibody whose variable region is from a murine mAb and which further comprises a human immunoglobulin constant region.

Alternatively, the techniques described for the production of single chain antibodies (U.S. Pat. Nos. 4,946,778; 4,946,778) may be adapted to produce single chain antibodies against an essential polypeptide or a homologue or ortholog thereof. Single chain antibodies are prepared by linking the heavy and light chain fragments of the Fv region using an amino acid bridge, resulting in the formation of single chain polypeptides.

Antibody fragments that they recognize that bind to specific epitopes can be prepared using known techniques. Such fragments include, for example, F (ab ') 2 fragments, which can be prepared by digesting the antibody molecule with pepsin, and Fab fragments, which can be prepared by reducing disulfide bridges in F (ab') ₂ fragments.

Alternatively, Fab expression libraries can be generated (Huse et al., Science, 246: 1275, 1989) that allow rapid

• co »co co co co co co co co co co co

99 99 easy identification of monoclonal Fab fragments with the desired specificity.

Polyclonal and monoclonal antibodies that specifically bind to essential polypeptides, homologs or orthologs thereof may be used, for example, to detect expression of an essential gene, homolog, or ortholog in other bacteria. For example, an essential polypeptide can be readily detected in conventional immunoassays performed on bacterial cells or extracts. Examples of suitable assays are, for example, Western blotting, ELISA, radioimmunoassay and the like.

Tests for antibacterial agents

The present invention includes techniques for identifying antibacterial agents. Without being bound by any particular theory of biological mechanism of action, novel antibacterial agents are believed to specifically inhibit: (1) the function of the yphC or ygjK polypeptide or a homolog or ortholog thereof, or (2) the expression of yhpC or ygjK genes or homologs or orthologs.

Comparison of the yhpC protein sequence with similar sequences from the GenBank database suggests that the yphC protein has GTPase activity. Similarly, a comparison of the ygjK protein sequence with similar sequences from the GenBank database suggests that the ygjK protein has arylsulfatase activity. In experiments developed to test whether yphC and ygjK proteins have predicted biochemical activity, it has been shown that yphC protein has GTPase activity and ygjK protein has arylsulfatase activity.

The enzymatic activity of each protein indicates new characteristics of each enzyme. For example, the yphC protein contains two GTP binding sites, but only one such site appears to be active. In addition to the arylsulfatase activity, the YgjK protein also has phosphatase activity and the activation of the protein is catalyzed by manganese ions. In the genetic experiments described herein, it has been shown that the observed biochemical activities of yphC and ygjK are associated with the essential character of the proteins. Mutations in yphC gene binding sites resulted in proteins lacking GTPase activity that were unable to complement null yphC mutants. Similarly, ygjK mutants lacking arylsulfatase activity were unable to complement null ygjK mutants. Furthermore, mutants lacking arylsulfatase activity also lacked phosphatase activity and vice versa. These experiments suggest that inhibition of yphC or ygjK enzymatic activities in cellular. cultures lead to impaired cell viability and cell death. Therefore, these biochemical activities can be used in vivo or in vitro, alone or in combination with other known methods for detecting these activities, to identify antibacterial agents.

In various suitable methods, screening for antibacterial agents is accomplished by identifying those compounds (e.g., small organic molecules) that inhibit the activity of an essential polypeptide or the expression of an essential gene. Screening for antibacterial agents can be accomplished by (I) identifying those compounds that interact with or that bind to an essential polypeptide, and (ii) further testing such compounds for their ability to inhibit bacterial growth in vitro or in vivo.

Examples of suitable screening methods are disclosed in U.S. Pat. Nos. 5,679,582 and 5,585,277, which are incorporated herein by reference. Briefly, in these methods, the target protein is incubated in the presence of the test compound (i.e., the test ligand) to form the test combination, and the target protein is also incubated in the absence of the test compound to form the control combination. The test and control combinations are then processed to produce a detectable fraction of the target protein in a partially or fully unfolded state.

The ratio at which the target protein exists in the folded state, the unfolded state, or both states in the test and control combinations is then determined. When the target protein is present in the folded state in greater or lesser amounts in the test combination than in the control combination, the test compound is also a compound that binds to the target protein.

In an alternative method, binding of the test compound to the target protein is detected using capillary electrophoresis. Briefly, a test compound (e.g., a small molecule) that binds to a target protein causes a change in the electrophoretic mobility of the target protein in capillary electrophoresis. Suitable techniques for capillary electrophoresis are known in the art (see, for example, Freitag, J. Chromatography B, Biomedical Sciences and Applications, 722 (1-2): 279-301, Feb. 5, 1999; Chu and Cheng, Cellular and Molecular Life Sciences : 54 (7) 663-683, July 1998; Thormann et al., Forensic Science International: 92 (2-3): 157-83, April 5, 1998; Rippel et al.

Electrophoresis: 18 (12-13): 2175-83, Nov. 1997; Hage and Tweed, J. Chromatography., B. Biomedical Sciences and Applications: 699 (1-2): 499-525, October 10, 1997; Mitchelson et al., Trends in Biotechnology: 15 (11): 448-58; 1997; Jenkins and Guerin, J. Chromatography B. Biomedical Application: 682 (1): 23-34, June 28, 1996; and Chen and Gallo, Electrophoresis, 19 (16-17): 2861-9. 1998.

• · φφφφ φφφφ

Inhibitors of yphC can also be identified in the following biochemical assays for the detection of GTPase inhibitors. This assay uses a colorimetric detection system to detect nanomolar amounts of inorganic phosphate. The assay can be performed in a 96-well translucent-bottom microplate (for example, Corning-COSTAR Catalog No. 9710). A 20 μΐ aliquot of each test compound in 10% DMSO is placed in each well of the plate, except for the wells used as controls. A 20 μΐ aliquot of 420 μΜ GTP is then added to each well of the plate, except for those wells used for control reactions. 20 μΐ IC50 controls containing 225 μΜ GDP are placed in two control wells; 20 μΐ ICioo controls (2.25 ml 0.5 M EDTA in .12.75 ml 420 μΜ GTP) are placed in two control wells; and 20 μΐ non-attenuating controls containing 420 μΜ GTP are 'placed in four additional' control wells. 20 μΐ of 2x buffer (100 mM Tris-HCl, 500 mM Kel, 10 mM MgCL2, 0.2 mg / ml acetylated BSA, H2O) plus the yphC enzyme solution (at a concentration of 1 μς / well) is then placed in each well and The plate is incubated at ambient temperature for 3.5 hours. 150 μΜ of a 0.045% malachite green / 35 mM EDTA solution is added to each well to terminate the enzyme reaction. After 25 minutes, 50 μΐ 15% citrate is added to each well to prevent further color development. The samples are then mixed thoroughly (for example using TOMTEC-Quadra-96, Model 320) until a homogeneous solution is obtained. Plates are then read using a plate reader (eg Wallac Victor 2 plate reader) operating at 650 nm. Normally, the plates should be read within 24 hours after the addition of malachite green and citrate.

# · · · * · * ♦ * *

• · ·· • fl ····

The percent inhibition for each well containing the sample can be calculated as follows. The mean of the two wells containing the IC10 controls can be used as baseline. Percent inhibition can be calculated from the following formula:

% inhibition = [1- (sample value - baseline) / mean value - baseline)] x 100

A test compound producing more than 40% inhibition can be retested for higher dose inhibition, if desired.

Other methods for identifying antibacterial agents include various methods using cells to identify polypeptides that bind to yphC, ygjK, or homologs and orthologs thereof, such as conventional two-hybrid protein / protein assays (see, e.g., Chien et al., Proc Natl Acad Sci USA, 88: 9578, 1991; Fields et al., US Patent No. 5,283,173; Fields and Song, Nature, 340: 245, 1989; Le Douarin et al., Nucleic Acids Research, 23 Vidal et al., Proc. Natl. Acad. Sci. USA, 93: 10315-10320, 1996; and White, Proc. Natl. Acad. Sci. USA, 93: 10001-10003, 1996). In general, a two-hybrid method requires the reconstitution of two separable transcription factor domains in a cell. One fusion protein comprises an essential polypeptide (or homolog or ortholog thereof) fused to either the transactivation domain or the DNA binding domain of the transcription factor (e.g., Gal4). The second fusion protein comprises a test polypeptide fused to either the transactivation domain or the DNA binding domain of the transcription factor. Once bound in one cell (for example, a yeast or mammalian cell), one fusion protein contains a transactivation domain and the other fusion protein • ft ftft ·· · «« ftft

Oo ···· ft ·· ♦ · · · · * · ·

it contains a DNA binding domain. Therefore, the binding of an essential polypeptide to a test polypeptide (i.e., a potential antibacterial agent) reconstitutes the transcription factor. Reconstitution of the transcription factor can be detected by detecting the expression of a gene (i.e., a reporter gene) that is operably linked to a DNA sequence that is bound by the DNA binding domain of the transcription factor. Bits for performing various two-hybrid methods are commercially available (e.g., from Clontech, Palo Alto, CA).

In another exemplary assay, but not a single, a promoter responsive to the depletion of an essential polypeptide by enhanced or attenuated expression is linked to a reporter gene (e.g., a β-galactosidase, gus, or GFP gene) as described above. The bacterial gene containing this reporter gene construct is then exposed to the test compound. Compounds that inhibit the essential polypeptide (or other polypeptides in the essential metabolic pathway in which the essential polypeptide is involved) will cause functional depletion of the essential polypeptide and will therefore result in increased or decreased expression of the reporter gene. Since the polypeptides described in the present invention are essential for bacterial survival, compounds inhibiting essential polypeptides in such assays will be considered antibacterial agents and will be further tested, if appropriate, in conventional susceptibility tests.

The methods described above can be used for highly efficient testing of many compounds to identify antibacterial agents. After identifying the test compound as a candidate for an antibacterial agent, the compound can be further tested for inhibition of bacterial growth in vitro or in vivo (e.g., using animals such as rodents or model systems). Using others in the art

Φ φ φ · · · · · · • • • • • •

4 Φ

ΦΦΦ ΦΦΦ ΦΦΦ • Φ Φ

ΦΦ ΦΦ

Φ Φ Φ «

4 4 4

4 4 4 Φ

A well-known variation of such methods can be tested for the ability of the nucleic acid (e.g., DNA or RNA) used as a test compound to bind to yphC, ygjK or homologues and orthologs thereof.

In vitro, further testing may be performed using techniques known in the art, such as an enzyme inhibition assay or a bacterial growth inhibition assay. For example, the agar dilution assay identifies substances that inhibit bacterial growth. Microtitre plates containing serial dilutions of test compound added to a given amount of culture medium are prepared and cultured on these plates. Inhibition of bacterial growth is determined, for example, by observing changes in the optical density of bacterial cultures.

Inhibition of bacterial growth is demonstrated, for example, by comparing the growth rate or absolute growth of bacteria in the presence and absence of the test compound. An inhibition of at least 20% in one of the above measurements is considered to be an inhibition. Particularly effective test compounds may further reduce growth rates (for example, by at least 25%, 30%, 40%, 50%, 75%, 80% or 90%).

Rodent (e.g., mouse) and rabbit animal models of bacterial infection are known in the art, and such animal models are acceptable for screening for antibacterial agents, since they indicate the therapeutic efficacy of such agents in humans. In a typical in vivo test, an animal is infected with a pathogenic bacterial strain, for example, by inhalation of a bacterium such as Streptococcus pneumoniae, and conventional criteria are used to determine whether the animal is affected by a bacterial infection. The test potential antibacterial agent is then administered to the mammal at a dose of 1-100 mg / kg body weight a

99 * 9 «9 9 9 9

9 9 9

9 · • 9 99 9 9 I · I »» ·

# 9

99 ·· · The mammal is observed for signs of alleviation of the disease.

Alternatively, the test compound can be administered to a mammal prior to infection by bacteria, and the ability of the mammal to resist infection is measured. Of course, the results obtained in the presence of the test compound are compared to those obtained for the control animals not given the test compound. Administration of potential antibacterial agents to mammals may be accomplished, for example, as described below.

Pharmaceutical preparations

The treatment comprises administering to the subject in need thereof a pharmaceutically effective amount of an antibacterial agent composition, thereby inhibiting bacterial growth in the subject. Such compositions typically contain from 0.1 to 90% by weight (for example 1 to 20% or 1 to 10%) of the antibacterial agent of the present invention in combination with a pharmaceutically acceptable carrier.

Solid compositions for oral administration may contain suitable carriers or excipients such as corn starch, gelatin, lactose, acacia, sucrose, microcrystalline cellulose, kaolin, mannitol, calcium phosphate, calcium carbonate, sodium chloride or alginic acid. Disintegrants, including, for example, microcrystalline cellulose, corn starch, sodium starch glycolate and alginic acid, may be used. Tablet binders may be used, including, for example, acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone (Povidone), hydroxypropylmethylcellulose, sucrose, starch and ethylcellulose. Glidants such as magnesium stearates, acid, etc. may be used

0 * 0000 • •• 00 0 · 0 * · stearic, silicone fluids, talc, waxes, oils and colloidal silica.

Liquid compositions for oral administration prepared in water or other aqueous vehicle may contain various suspending agents such as methylcellulose, alginates, tragacanth, pectin, kelgin, carrageenan, acacia, polyvinylpyrrolidone and polyvinyl alcohol. Liquid formulations also include solutions, emulsions, syrups and elixirs containing, in addition to the active compound, wetting agents, sweetening, coloring and flavoring agents. Various liquid and powder formulations may be prepared for inhalation into the lungs of a treated mammal.

Injectables may contain various carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid polyethylene glycol, and the like). For intravenous injection, water-soluble versions of the compounds may be administered by infusion, whereby a pharmaceutical composition comprising an antibacterial agent and physiologically acceptable ingredients is administered. Physiologically acceptable additives include, for example, 5% dextrose, 0.9% saline, Ringer's solution and other suitable ingredients. For intramuscular compositions, sterile compounds in the form of a suitable soluble salt may be dissolved and administered in a suitable pharmaceutical excipient such as water for injection, 0.9% saline or 5% glucose solution. Suitable insoluble forms of the compounds may be prepared and may be administered as suspensions in an aqueous base or in a pharmaceutically acceptable oil base such as a long chain fatty acid ester (e.g. ethyloleate).

Semi-solid topical ointment formulation usually contains an active ingredient concentration of from about 1 to about 3

φ φ φ φ

Φ ♦ φ · φ · φ · • • φ φ · · · φ φ φ φ φ φ · · · · φ φ φ φ φ φ · · · · · φ

20%, for example 5 to 10%, in a carrier such as a pharmaceutical cream base. Various topical formulations include drops, elixirs, lotions, creams, solutions and ointments containing the active ingredient, and various carriers and vehicles.

The optimum percentage of antibacterial agent in each pharmaceutical composition varies depending on the composition itself and the desired therapeutic effect in specific pathologies and current therapeutic regimens. The appropriate dose of antibacterial agents can be readily determined by one of ordinary skill in the art by following the signs of amelioration or inhibition of infection in the animal and decreasing or increasing the dose and / or frequency of dosing as necessary. The optimum amount of antibacterial compound used to treat conditions caused by a bacterial infection may depend on the route of administration, the age and body weight of the subject and the general condition of the subject being treated. Generally, the antibacterial compound is administered at a dose of from 1 to 100 mg / kg body weight, more preferably a dose of 1 to 10 mg / kg body weight.

Other embodiments

The invention also relates to fragments, variants, analogs and derivatives of the polypeptides described above that retain one or more biological activities of the yphC or ygjK polypeptides, for example, GTPase or sulfatase activity. The invention encompasses both natural and man-made variants. Due to the natural sequences of the essential genes shown in Figures 1 and 3, they may contain nucleic acid sequences encoding variants of the substitution, deletion or addition of one or more nucleotides. Preferred variants retain the function of essential tftftftf tftftftf

The polypeptides, as can be determined, for example, in a replenishment assay.

It will be appreciated that although preferred embodiments of the invention have been described, the foregoing description is illustrative only and does not limit the scope of the present invention as defined in the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. For example, other assays known in the art for detecting interactions of test compounds with proteins or for detecting inhibition of bacterial growth can also be used with essential genes, gene products and homologues and orthologs thereof.

Claims (29)

»1 4994« · · · · • · φ 9 4 4 44 * · 99 9999 » 1. (1) the sequence of SEQ ID NO: 1 as shown in Figure 1, or degenerate variants thereof; An isolated nucleic acid molecule that is at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: (2) the sequence of SEQ ID NO: 1 as shown in Figure 1, or degenerate variants thereof, wherein T is replaced by U; The isolated nucleic acid molecule of claim 1, which encodes: a yphC polypeptide comprising the amino acid sequence of SEQ ID NO: 2 as shown in Figure 1; a yphC polypeptide comprising the amino acid sequence of SEQ ID NO: 5 as set forth in Figures 2A-2B; or a ygjK polypeptide comprising the amino acid sequence of SEQ ID NO: 8 as shown in Figure 3. (3) nucleic acid sequences complementary to (1) and (2); An isolated nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of: 4 9 11 · β 4 · ··· bl 4 9 4 4 4 4 · 4 ·· · 4 · An isolated nucleic acid molecule having a length of at least 15 nucleotides and which hybridizes under stringent conditions to SEQ ID NO: 1 or SEQ ID NO: 4. (4) nucleic acid fragments having the sequences of (1), (2) and (3) that are at least 15 nucleotides in length and that hybridize under stringent conditions to genomic DNA encoding the polypeptide of SEQ ID NO: 2; A vector comprising the nucleic acid molecule of claim (5) the sequence of SEQ ID NO: 4 as shown in Figures 2A-2B, or degenerate variants thereof; A host cell comprising the exogenously inserted nucleic acid molecule of claim 1, 2 or 3. (6) the sequence of SEQ ID NO: 4 as shown in Figures 2A-2B, or degenerate variants thereof, wherein T is replaced by U; The isolated polypeptide encoded by the nucleic acid molecule of claim 1. (7) nucleic acids complementary to (5) and (6); Tf tftff tff tff tff tff tff tff tff 7. A method for identifying an antibacterial agent comprising: (a) contacting the yphC or γgjκ polypeptides with the test compound; and (b) detecting the interaction of the test compound with the yphC or ygjK polypeptide, wherein the interaction indicates that the test compound is an antibacterial agent. Ftft ftft ftft ftft ft ft ft ft ft ft ft ft ft ft ft ft ft ft ft ft ··· ft ft ftft · 66 ···· ftftft ftftftft ^vv ftft * · ftft ft ftft ftft (8) the sequence of SEQ ID NO: 7 as shown in Figure 3, or degenerate variants thereof; The method of claim 8, further comprising: (c) determining whether the test compound that interacts with the polypeptide inhibits the growth of bacteria as compared to the growth of bacteria grown in the absence of a test compound that interacts with the polypeptide, wherein growth inhibition indicates that the test compound is an antibacterial agent. (9) the sequence of SEQ ID NO: 7 or degenerate variants thereof, wherein T is replaced by U; 10. The method of claim 8, wherein the polypeptide is derived from a non-pathogenic bacterial strain. (10) nucleic acids complementary to sequences (8) and (9); and (11) nucleic acid fragments having sequences (8), (9) and (10) that are at least 15 nucleotides in length and that hybridize under stringent conditions to genomic DNA encoding the polypeptide of SEQ ID NO: 8. 11. The method of claim 8, wherein the polypeptide is derived from a pathogenic bacterial strain. 12. The method of claim 8, wherein the test compound is selected from the group consisting of polypeptides, ribonucleic acids, small molecules, and deoxyribonucleic acids. 13. A pharmaceutical composition comprising an antibacterial agent identified by the method of claim 8 and a pharmaceutically acceptable excipient. 14. A method of treating a bacterial infection of an organism comprising administering to said organism a therapeutically effective amount of the pharmaceutical composition of claim 13. 15. The method of claim 14 wherein the organism is a human. An antibody that specifically binds to the polypeptide of claim 7. 17. The method of claim 8, wherein said interaction is detected by detecting a decrease in the function of the polypeptide contacted with the test compound, and further comprising: determining whether a test compound that reduces the function of a contacted polypeptide inhibits the growth of bacteria as compared to the growth of bacteria grown in the absence of a test compound that reduces the function of a contacted polypeptide, wherein growth inhibition indicates that the test compound is an antibacterial agent. 18. A method for identifying an antibacterial agent comprising: (a) contacting the nucleic acid encoding yphC or ygjK with the test compound; and (b) detecting the interaction of the test compound with the nucleic acid, wherein the interaction indicates that the test compound is an antibacterial agent. 19. The method of claim 18, further comprising: (c) determining whether the test compound that interacts with the nucleic acid inhibits bacterial growth compared to the growth of bacteria cultured in the absence of a test compound that interacts with the nucleic acid, wherein growth inhibition indicates that the test compound is an antibacterial agent. 20. A method for identifying an antibacterial agent comprising: (A) contacting the orthophys of the yphC or γgjκ polypeptide with the test compound; and (b) detecting the interaction of the test compound with an ortholog, wherein the interaction indicates that the test compound is an antibacterial agent. 21. The method of claim 20, further comprising: (c) determining whether a test compound that interacts with an ortholog inhibits bacterial growth as compared to the growth of bacteria grown in the absence of a test compound that interacts with an ortholog, where growth inhibition indicates that the test compound is an antibacterial agent. 22. The method of claim 21 wherein the ortholog is selected from the group consisting of y-yphC, BygjK, yfgK, and eiac. 23. The method of claim 21, wherein the ortholog is derived from a pathogenic bacterium. 24. A method for identifying an antibacterial agent comprising: (a) contacting the γphC or γgjκ polypeptide orthologs with the test compound; and (b) detecting a decrease in the function of the orthologs contacted with the test compound; and (c) determining whether the test compound that reduces the function of the contacted ortholog inhibits bacterial growth as compared to the growth of bacteria cultured in the absence of the test compound that reduces the function of the contacted ortholog, where growth inhibition indicates that the test compound is an antibacterial agent. The method of claim 24, wherein the ortholog is selected from the group consisting of y-yphC, BygjK, yfgK, and elaC. 26. A method for identifying an antibacterial agent comprising: (a) contacting a nucleic acid encoding a γphC or γgjκ ortholog with a test compound; and (b) detecting the interaction of the test compound with the nucleic acid, wherein the interaction indicates that the test compound is an antibacterial agent. 27. The method of claim 26, further comprising: (c) determining whether the test compound that interacts with the nucleic acid inhibits bacterial growth compared to the growth of bacteria cultured in the absence of a test compound that interacts with the nucleic acid, wherein growth inhibition indicates that the test compound is an antibacterial agent. 28. The method of claim 27 wherein the ortholog is selected from the group consisting of y-yphC, BygjK, yfgK, and elaC. 29. A method of treating mammals with Streptococcus pneumoniae infection comprising inhibiting the function of yphC or ygjK polypeptides in Streptococcus pneumoniae infecting mammals.