CN203768362U - Haemophilus paragallinarum pyrG gene PCR (Polymerase Chain Reaction) detection kit - Google Patents
Haemophilus paragallinarum pyrG gene PCR (Polymerase Chain Reaction) detection kit Download PDFInfo
- Publication number
- CN203768362U CN203768362U CN201420065510.2U CN201420065510U CN203768362U CN 203768362 U CN203768362 U CN 203768362U CN 201420065510 U CN201420065510 U CN 201420065510U CN 203768362 U CN203768362 U CN 203768362U
- Authority
- CN
- China
- Prior art keywords
- reagent tube
- pcr
- pyrg
- kit
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The utility model relates to a Haemophilus paragallinarum pyrG gene PCR (Polymerase Chain Reaction) detection kit. The kit comprises a kit body (1), wherein a first spongy cushion (2), an isolating hard paper board (3) and a second spongy cushion (4) are sequentially arranged in the kit body (1) from top to bottom, four small holes for placing reagent tubes, namely a 10*PCR Buffer (containing Mg<2+>) reagent tube (5), a dNTP reagent tube (6), a primer pyrG A reagent tube (7) and a primer pyrG B reagent tube (8), are formed in the first spongy cushion (2), four small holes for placing reagent tubes, namely a TaqDNA polymerase reagent tube (9), a Marker DL-2000 reagent tube (10), a negative control reagent tube (11) and a positive control reagent tube (12), are formed in the second spongy cushion (4), and a specification (13) is placed at the bottom layer of the kit body (1). The kit has the advantages that the design is reasonable, the high sensitivity of PCR is maintained, the specificity of a detected gene is greatly improved, the use is convenient, the cost is low, and pathogens can be quickly diagnosed.
Description
Technical field
The utility model belongs to biological technical field, relate to secondary chicken fowl bacillus pyrG gene detecting kit, by round pcr, to amplify the gene fragment of 939bp, the PCR detection kit of the para bacillus fowl blood phili existing in hole secretory product under the socket of the eye of sick chicken in detection morbidity chicken group.
Background technology
Infectious coryza of chicken (infectious coryza IC) is acute upper respiratory tract infection and the detoxifying function disease of a kind of chicken of being caused by para bacillus fowl blood phili (Haemophilus paragallinarum Hpg).The maximum loss causing is that the decline (10%-40%) of laying rate of laying hen and poor growth and the mortality that is bred as chicken and broiler chicken increase, and to poultry husbandry, has caused larger financial loss.Press the classifying method of Page; para bacillus fowl blood phili can be divided into A, B and tri-serotypes of C; between each serotype, there is no cross protection, the immunoprotection of Type B has certain type specificity, so understand the serotype distribution of cause of disease, can better prevent and control this disease.
In several serological methods that adopted, hemagglutination-inhibition test is almost the most suitable method of early diagnosis infective rhinitis, and some common antigen in three serotypes, so the antigen of preparing by single serotype still likely detects veriform lectin.The generation of HI antibody is later than agglutinating antibody and fine jade expands antibody, and the HI antigen using is mainly used in the mensuration of A serological type strain; When C type bacterial strain is done HI test, antigen need be processed with potassium thiocyanate, ultrasonic treatment, and red corpuscle need to be processed diluent for the PBS containing 0.1% bovine serum albumin by glutaraldehyde.But this method is unsuitable for the antibody horizontal of early infection or immune chicken.
More successfully DNA probe and round pcr at present, Chen little Ling equals from the HpgDNA library of its foundation, filtered out 4 species specificity segments and carried out mark by digoxin for 1996, can detect purify DNA amount all between 7.8-31.25ug. by the mensuration to minimum probe portion sequence, two pairs of PCR primers have been designed, two kinds of PCR diagnostic methods have been set up, when 41 Hpg strain isolateds are measured, result is all positive, and mensuration to 26 non-Hpg. result is all negative, and all can detect the DNA10 of Hpg
3-10
3individual mycetocyte.The specificity that the method is good and susceptibility make it to be used for direct-detection Hpg, for the directly detection of sample clinically, thereby have improved the susceptibility of diagnosis, but can not be applied to the classification of serotype.And Song Minxun etc. have entered major step especially in the susceptibility of the aroA-PCR of calendar year 2001 foundation.They have utilized aroA gene design 1 pair of primer. respectively the Hpg bacterial strain of 10 strain standard para bacillus fowl blood phili (Hpg) bacterial strains, 14 strain separation is carried out to pcr amplification. result has all obtained and expection fragment of the same size. and the non-Hpg bacterial strain of 10 strain and 3 strain virus are increased and without respective segments, produced; This PCR can examine to going out 10 mycetocytes.
Bacterium separation is to detect the conventional method of secondary chicken fowl bacillus in sick chicken pathological material of disease, but the growth of secondary chicken fowl bacillus relies on NAD, to the separation and Culture of bacterium, can operate routinely pathological material of disease is inoculated in to blood nutrient agar (near growth streptococcus aureus line), the chicken soup culture medium of supplementing NAD.The separation and Culture of bacterium is necessary making a definite diagnosis extremely, but often can not be successful, and this is because secondary chicken fowl bacillus is very tender and lovely, is difficult to meet its growth needs.And round pcr is with its high specificity, required pathological material of disease tissue is few, sensitivity, and the advantage such as convenient has obtained universally acknowledged, and the clinical detection and the cause of disease that are widely used in the many animals cause of diseases such as various microorganisms, pathogenic agent are made a definite diagnosis.
Summary of the invention
The purpose of this utility model is not high for overcoming bacterium isolation identification separation rate success ratio, cannot make a definite diagnosis, and the weak point that testing cost is high, adopts round pcr, and a kind of secondary chicken fowl bacillus pyrG gene detecting kit is provided.
The utility model test kit comprises by box body, in body, be disposed with from top to bottom the first sponge pad, isolation fiber board, the second sponge pad, the first sponge pad is provided with 4 apertures of putting Reagent Tube, place respectively: 10 * PCR Buffer (containing Mg2+) Reagent Tube, dNTP Reagent Tube, primer pyrG A Reagent Tube, primer pyrG B Reagent Tube, the second sponge pad is provided with 4 apertures of putting Reagent Tube, place respectively: TaqDNA polysaccharase Reagent Tube, Marker DL-2000 Reagent Tube, negative control Reagent Tube, positive control Reagent Tube, box body 1 bottom is placed specification sheets.
Detection has two pairs with primer: upstream, pyrG A; Downstream: pyrG B.
PyrG A upstream 5-GCGGGACACGATGTGGCTAT-3
PyrG B downstream 5-TGGCGATGACGTTCCTCAAT-3
Reference substance is divided into positive control and negative control, the positive contrast of negative control, and positive control is that secondary chicken fowl bacillus Apg-8 type strain (CVCC254) is purchased from China Veterinary Drugs Supervisory Inst..
This test kit is stored in 4 ℃, reduces multigelation as far as possible.
The utility model is mainly used under sick chicken socket of the eye in hole tissue that bacterial detection is carried out disease diagnosis to chicken group and cause of disease is made a definite diagnosis, thereby instruct clinical disease chicken group's clinical application and feeding and management, prevent morbidity and the healthy chicken of secondary chicken fowl bacillus dead, reduce plant and raiser's loss.
The utility model has been set up the method for utilizing round pcr to detect secondary chicken fowl bacillus, and after testing under sick chicken frame hole secretory product sample confirm that the method is practical.PCR detection sensitivity is very high.But the false positive that primer dimer, strand secondary structure and wrong amplified production cause can affect quantitative accuracy.In this test item, by optimizing primer and PCR reaction solution, avoided nonspecific amplification, kept the high sensitivity of PCR simultaneously, and the specificity of detected gene is improved greatly.Compare with pathological material of disease separation of bacterial method and probe method, convenient and cheap.
This test kit using method:
Each detection all should be set up the positive and negative control.
The preparation of template DNA
Choose under socket of the eye hole secretory product a little, add in 20 μ L water, 95 ℃ of heating 10min, deposit after 10 minutes for then-20 ℃ and are PCR,
Pcr amplification
25 μ L reaction systems (2.5 μ L10 * buffer, 2.0 μ L dNTP, primer A and primer B each 1.0 μ L, template 0.5 μ L, rTaq enzyme 0.5 μ L, ultrapure water 17 μ L) are in 95 ℃ of sex change 5min, then 25 circulation (94 ℃ of 1min, 53.9 ℃ of 1min, 72 ℃ of 2min) last 72 ℃ of extension 10min.Electrophoresis product is reclaimed to test kit specification sheets by glue to be reclaimed.
The feature the utlity model has is: the utility model, by the primer of optimize PCR and the condition of PCR, has been avoided nonspecific amplification, and kept the high sensitivity of PCR, and the specificity of detected gene is improved greatly.The utility model is reasonable in design, compares with existing culture method, does not need pathological material of disease separation and Extraction bacterium, easy to use and cost is low.
Accompanying drawing explanation
Fig. 1 is the utility model test kit structural representation.
Embodiment
The utility model with specific embodiments and the drawings is described further.Should be understood that these embodiment are only for illustration purpose, and be not used in the restriction scope of the invention.
Embodiment 1
Referring to Fig. 1, the utility model test kit comprises by box body 1, in body 1, be disposed with from top to bottom the first sponge pad 2, isolation fiber board 3, the second sponge pad 4, the first sponge pad 2 is provided with 4 apertures of putting Reagent Tube, place respectively: 10 * PCR Buffer (containing Mg2+) Reagent Tube 5, dNTP Reagent Tube 6, primer pyrG A Reagent Tube 7, primer pyrG B Reagent Tube 8, the second sponge pad 4 is provided with 4 apertures of putting Reagent Tube, place respectively: TaqDNA polysaccharase Reagent Tube 9, Marker DL-2000 Reagent Tube 10, negative control Reagent Tube 11, positive control Reagent Tube 12, box body 1 bottom is placed specification sheets 13.
Embodiment 2
Secondary chicken fowl bacillus Henan Strain pyrG gene PCR technology for detection and application
1 material and method
1.1 bacterial classifications and substratum
Secondary chicken fowl bacillus Apg-8 type strain (CVCC254) is purchased from China Veterinary Drugs Supervisory Inst., doubtful secondary chicken fowl bacillus Puyang oilfield of Henan to be identified strain isolated is numbered HN-1, other control strain tools think that by Binzhou occupation key lab of institute provides, secondary chicken fowl bacillus substratum reference data self-control.
1.2 pathological material of disease
The doubtful infective rhinitis of Puyang, the Henan Province censorship laying hen that dies of illness, cuts open inspection nose and paranasal sinuses mucous membrane catarrhal inflammation, and there is a large amount of mucus on surface, under nasal sinus, socket of the eye, in hole and eye conjunctival sac, has cheesy thing, gathers hole under the socket of the eye of typical case's morbidity chicken with sterile cotton swab
1.3 main agents and toolenzyme
10 * Buffer is (containing Mg
2+), dNTP, TaqDNA polysaccharase, pMD18-T Vector, DNA gel reclaims test kit, all purchased from Dalian precious biotechnology company limited.Competent cell DH5 α, is provided by the court key lab.
1.4 pathological material of disease microscopy and separation and Culture
Get respectively hole secretory product smear under the socket of the eye of disease chicken, microscopy after gramstaining.And hole pathological material of disease under the socket of the eye of 50 chickens of taking is distinguished to streak inoculation on chicken blood agar, chicken bouillon agar, maconkey agar substratum, with candle jar method, put under 37 ℃ of conditions and cultivate 24h to 48h, select canescence, translucent, the large small colonies of needle point carries out pure culture, while smear, gramstaining, microscopy.
The preparation of 1.5 template DNAs
Choose several bacterium colonies and add in 20 μ L water, 95 ℃ of heating 10min, deposit after 10 minutes for then-20 ℃ and are PCR.
1.6 design of primers
With reference to known secondary chicken fowl bacillus pyrG portion gene sequence in GenBank, by 1 pair of primer of Primer5.0 primer-design software design, serve Hai Shenggong synthetic, the sequence of primer is as follows:
pyrG?A：5-GCGGGACACGATGTGGCTAT-3
pyrG?B：5-TGGCGATGACGTTCCTCAAT-3
1.7PCR amplification
25 μ L reaction systems (2.5 μ L10 * buffer, 2.0 μ LdNTP, A and B each 1.0 μ L, template 0.5 μ L, rTaq enzyme 0.5 μ L, ultrapure water 17 μ L) are in 95 ℃ of sex change 5min, then 25 circulation (94 ℃ of 1min, 53.9 ℃ of 1min, 72 ℃ of 2min) last 72 ℃ of extension 10min.
The purifying of 1.8PCR product and clone identification
Electrophoresis product is reclaimed to test kit specification sheets by glue to be reclaimed.Then press document operation, will reclaim product and insert in pMD18-T cloning vector, and transform in escherichia coli DH5a, bacterium liquid is all evenly coated onto and contains on the antibiotic LB solid medium of Amp.
Extraction and the enzyme of 1.9 plasmids are cut evaluation
Picking mono-clonal bacterium colony is in containing the LB liquid nutrient medium of 1.0mg/mL Amp, 37 ℃ of shaken overnight are cultivated, by alkaline lysis, extract in a small amount plasmid, through BamH I and psk I double digestion, identify recombinant plasmid, reaction system is: template 6ul, 10 * Kbuffer1 μ L, BamH0.5 μ L, pst I0.5 μ L, ultrapure water 2 μ L, reaction process is: 37 ℃, and 2 hours.
1.10 sequencings and analysis
Get enzyme and cut the positive plasmid of evaluation, serve Hai Shenggong order-checking.Sequential analysis adopts DNAStar software to design primer sequence used to institute's cls gene sequence and we and compares, and analyzes the homology of its Nucleotide.
2 results
2.1 pathological material of disease smear for microscopic examination and separating resultings
In the visible secretory product of microscopy, there is a large amount of tiny bacillus of the dense Gram-negative of dying in the two poles of the earth single, paired or short vessel used to hold grain at the imperial sacrifice.On maconkey agar, blood agar plate, equal asepsis growth.On chicken bouillon agar, grow circle, canescence, translucent, protruding small colonies, picking colony smear, dyeing, microscopy, still can see and bacterium identical in sick chicken pathological material of disease.
2.2 somatomedin tests
In staphylococcus, fall to growing the bacterium colony of satellite shape around.With picking 1% nadide solution directly in substratum line, also there is identical phenomenon, this meets secondary chicken fowl bacillus " satellitism " that occur while growing under nadide existence condition.
2.3PCR result
By secondary chicken fowl bacillus Hpg-8, strain isolated HN-1, fowl pasteurella multocida C48-1, Actinobacillus pleuropneumoniae 265, haemophilus parasuis, Staphylococcus gallinarum.Salmonella gallinarum, chicken colibacillosis (O
1) DNA that extracts of 8 strain bacteriums is that template increases, result Hpg-8, strain isolated HN-1 all amplifies the band of an about 1kb of molecular weight.And other bacterium contrasts and ultrapure water contrast all do not amplify any band.
The purifying of 2.4PCR product and clone identification
Obtained PCR product is carried out to purifying recovery, be connected Transformed E .coli DH5a with pMD18-T carrier.Amoxicillin screening, adopts BamH I and psk I double digestion, shows to filter out positive recombinant plasmid
The clone and sequence of 2.5PCR product
Enzyme is cut and identified positive plasmid sample presentation order-checking, and sequencing result is as follows:
CTGTGGGCGATATTGAATCATTGCCGTTCTTAGAAGCGTTACGCCAGTTAGCTGTTGATGTTGGGCGTGAGCGAACCATTTTTATGCATTTGACCCTTGTGCCTTATATTCCGACTGCGGGCGAGGTGAAAACTAAGCCAACTCAGCATTCAGTGAAAGAGTTGTTGTCTATCGGTATTCAGCCTGATGTGTTGATTTGTCGTTCAGATCGTATGATACCACCAAATGAGCGAAGCAAAATTGCACTGTTCTGTAATGTGCCAGAGCGTGCGGTAATTTCTTTAAAAGATGTGAATTCTATTTATCAAATTCCAGCCTTATTGAAATCCCAAGGCTTAGATGAATTTATTTGTCAGCGTTTTCGTTTAGCTTGTCCAGAAGCTGATTTAAGCGAATGGGAACAAGTGCTTTATCAACAAGCTAACCCAACAGGCGAAGTTACTATTGGTATGGTAGGGAAATATACAGAATTGCCTGATGCTTATAAATCGGTTAATGAAGCATTGAAACACGGCGGGTTAAAAAATCGTTTGAATGTAAATATTAAATATATCGATTCTGAAGATGTAGAAAGTAAAGGCACGGAGGTGTTAGCTGGATTAGATGGAATTTTAGTGCCGGGAGGCTTTGGATATCGTGGTGTAGAGGGTAAAATTCGTACAGCACAATATGCCCGTGAGAACAATATTCCTTACTTAGGGATTTGTTTGGGAATGCAGGTGGCATTAATTGAATATGCACGTCATAAAGCGGGATTAACGGAAGCTAACTCCACGGAATTTGATAAAGACTGTAAACAACCTGTGGTAGGTTTAATTACTTGAATGGCAAGATGCGGAAGGCAAGATTGAAACCCGTAGTGATAAGTCTGATCTGGGTGGTACAATGCGTTTAGGAGCTCAACAATGCCACCTTGCTGAGGGTAGTCTTGCACGCGAA
2.6 sequence comparative analyses
Sequencer address result shows, the fragment length amplifying from BZ-1 is 939bp, in full accord with expection size, the sequence homology 98% of 3 other Hpg of strain that include on this sequence and Genbank.From molecular level, show that we are defined as para bacillus fowl blood phili by the Henan Strain of separation.
Claims (1)
1. a para bacillus fowl blood phili pyrG gene PCR detection kit, comprise by box body (1), it is characterized in that: in body (1), be disposed with from top to bottom the first sponge pad (2), isolation fiber board (3), the second sponge pad (4), the first sponge pad (2) is provided with 4 apertures of putting Reagent Tube, place respectively: 10 * PCR Buffer (containing Mg2+) Reagent Tube (5), dNTP Reagent Tube (6), primer pyrGA Reagent Tube (7), primer pyrG B Reagent Tube (8), the second sponge pad (4) is provided with 4 apertures of putting Reagent Tube, place respectively: TaqDNA polysaccharase Reagent Tube (9), Marker DL-2000 Reagent Tube (10), negative control Reagent Tube (11), positive control Reagent Tube (12), box body (1) bottom is placed specification sheets (13).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201420065510.2U CN203768362U (en) | 2014-02-14 | 2014-02-14 | Haemophilus paragallinarum pyrG gene PCR (Polymerase Chain Reaction) detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201420065510.2U CN203768362U (en) | 2014-02-14 | 2014-02-14 | Haemophilus paragallinarum pyrG gene PCR (Polymerase Chain Reaction) detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN203768362U true CN203768362U (en) | 2014-08-13 |
Family
ID=51285573
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201420065510.2U Expired - Fee Related CN203768362U (en) | 2014-02-14 | 2014-02-14 | Haemophilus paragallinarum pyrG gene PCR (Polymerase Chain Reaction) detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN203768362U (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805211A (en) * | 2015-04-30 | 2015-07-29 | 广西壮族自治区农业科学院甘蔗研究所 | PCR (polymerase chain reaction) detection kit for pathogenic bacteria of pokkah boeng disease |
| CN105695579A (en) * | 2016-03-09 | 2016-06-22 | 北京市农林科学院 | Kit for rapidly detecting Avibacterium paragallinarum |
-
2014
- 2014-02-14 CN CN201420065510.2U patent/CN203768362U/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805211A (en) * | 2015-04-30 | 2015-07-29 | 广西壮族自治区农业科学院甘蔗研究所 | PCR (polymerase chain reaction) detection kit for pathogenic bacteria of pokkah boeng disease |
| CN105695579A (en) * | 2016-03-09 | 2016-06-22 | 北京市农林科学院 | Kit for rapidly detecting Avibacterium paragallinarum |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220003763A1 (en) | Inert Carrier Salmonella and Potential Use Thereof | |
| CN102337351B (en) | Typing detection kit for influenza virus | |
| WO2020233147A1 (en) | Inert carrier escherichia coli and potential use thereof | |
| Spackman et al. | Multiplex real-time reverse transcription–polymerase chain reaction for the detection of three viruses associated with poult enteritis complex: turkey astrovirus, turkey coronavirus, and turkey reovirus | |
| CN102719564B (en) | Triple polymerase chain reaction (PCR) kit for duck hepatitis virus type I, duck circoviruses and Muscovy duckling parvovirosis and application of triple PCR kit | |
| CN110004240A (en) | The real-time fluorescence detection kit of chicken virus mycoplasma based on RPA, test strips detection kit and application thereof | |
| Botes et al. | Identification of three novel mycoplasma species from ostriches in South Africa | |
| CN107988340A (en) | A kind of PCR amplification primer of quick detection mycoplasma ovine pneumoniae and its application | |
| CN101363858B (en) | Test paper strip for detecting PRRSV antibody colloidal gold, method for making same and applications | |
| CN111500504A (en) | Pan-type inert carrier salmonella and potential application thereof | |
| CN103981288B (en) | A kind of non-diagnosis and treatment object fowl tumprigenicity virus multiple PCR detection method | |
| CN203768362U (en) | Haemophilus paragallinarum pyrG gene PCR (Polymerase Chain Reaction) detection kit | |
| CN109212230B (en) | Sensitized polystyrene nano-microsphere for detecting canine parvovirus structural protein VP2 antibody and preparation method and application thereof | |
| CN110305975A (en) | A kind of RPA kit and application thereof of quick detection chicken Mycoplasma synoviae | |
| CN104846066A (en) | PCR detection primers and detection method of Salmonella pullorum | |
| CN108866240A (en) | For identifying primer and enzyme and its application of DAdV-3 and DAdV-A | |
| CN105861520A (en) | Application of Rv3121 protein for detecting mycobacterium tuberculosis infection | |
| CN107722121A (en) | Bee larva bacillus PLMP resists more and its application in immunochromatography paper | |
| CN103320539B (en) | The duplex RT-PCR test kit of duck tembusu virus and Avian pneumo-encephalitis virus | |
| CN105296635A (en) | PCR-HRM primer for quickly detecting salmonella pullorum and application thereof | |
| CN105524177A (en) | Mycobacterium tuberculosis specific fusion protein, and encoding gene and application thereof | |
| CN104388558A (en) | Molecular beacon probe and detection method for quickly detecting streptococcus agalactiae | |
| Dwivedi et al. | Detection of Avibacterium paragallinarum in Poultry Carcass | |
| CN103131795B (en) | Primer and kit for identifying marek's disease virus serum 1-type vaccine virus | |
| CN108866245A (en) | The foundation of chicken parvovirus, avian influenza virus and newcastle disease virus triple PCR detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140813 Termination date: 20150214 |
|
| EXPY | Termination of patent right or utility model |