CN203639460U - Fully enclosed integrated nucleic acid amplification and detection tube - Google Patents
Fully enclosed integrated nucleic acid amplification and detection tube Download PDFInfo
- Publication number
- CN203639460U CN203639460U CN201320429171.7U CN201320429171U CN203639460U CN 203639460 U CN203639460 U CN 203639460U CN 201320429171 U CN201320429171 U CN 201320429171U CN 203639460 U CN203639460 U CN 203639460U
- Authority
- CN
- China
- Prior art keywords
- test strip
- nucleic acid
- detector tube
- acid amplification
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The utility model relates to the field of molecular biology, relates to the field of nucleic acid amplification and detection, and in particular relates to a fully enclosed integrated nucleic acid amplification and detection tube. Furthermore, the utility model also relates to a method for amplifying and detecting nucleic acid, which adopts the fully enclosed integrated nucleic acid amplification and detection tube, as well as a kit comprising the fully enclosed integrated nucleic acid amplification and detection tube, and an application of the fully enclosed integrated nucleic acid amplification and detection tube in preparing the kit.
Description
Technical field
The application relates to biology field, particularly nucleic acid amplification and detection field.Particularly, the application relates to a kind of totally-enclosed integral type nucleic acid amplification and detector tube.In addition, the application also relates to a kind of amplification and detects the method for nucleic acid, and it comprises the totally-enclosed integral type nucleic acid amplification and the detector tube that use the application.In addition, the application also relates to the test kit that comprises described totally-enclosed integral type nucleic acid amplification and detector tube, and described totally-enclosed integral type nucleic acid amplification and detector tube are for the preparation of the purposes of test kit.
Background technology
Polymerase chain reaction technology (hereinafter to be referred as round pcr), it is the technology of a kind of DNA of rapid amplifying in vitro, it generally includes multiple circulations, each circulation comprises sex change, annealing and three steps of extension, and in the ideal situation, every through a circulation, the number of object nucleic acid molecule just increases one times.Generally speaking,, after 30-40 circulation, object nucleic acid molecule number just can increase and arrive original nearly 10
9doubly.Therefore, PCR is the most effectual way of external a large amount of acquisition target DNA fragments, and the nucleic acid molecule obtaining can be used for further analysis and verifying.
At present, round pcr has been widely used in fundamental research and applied research.For example, in fundamental research, PCR, as one " acellular gene amplification system ", can be used for clone gene, and can carry out direct sequence analysis to genomic dna thus, detects mutational site, analyzes Chromosome recombination etc.In applied research, PCR can be for the detection of the diagnosis of transmissible disease, genetic diseases, antenatal diagnosis, legal medical expert's research etc.United States Patent (USP) 4,683,202; 4,683,159; 4,800,159; 4,965,188 grades have been made detailed description to round pcr.
In the body of DNA, amplification refers to, in cell, under the participation of Related Factors, double-helical DNA molecular is unwind into 2 strands, synthetic DNA primer under the effect of primase, and primer and single-chain DNA base complementary pairing, form primer single stranded DNA mixture; Under archaeal dna polymerase effect, along 5 '-3 ' direction, by base complementrity pair principle, start at primer 3 ' end, one by one complementary triphosphate deoxy-nucleotide is connected, finally form a new double chain DNA molecule.
The external pcr amplification of DNA molecular has been simulated three steps in body: first, under the high temperature of about 95 DEG C, heat double chain DNA molecule, so that the hydrogen bond rupture between two strands, thereby make DNA thermolysis become two complementary single strand dnas (this process is called high temperature solution chain reaction); Then, temperature drops to rapidly in the scope of about 50-65 DEG C, and at this temperature, single stranded DNA is combined (this process is called low-temperature annealing reaction) by base complementrity pair principle with primer; After annealing reaction finishes, temperature is elevated to rapidly again 72 DEG C of left and right, at this temperature, under the condition of archaeal dna polymerase and suitable magnesium ion concentration, start in conjunction with mononucleotide from 3 ' end of primer, be called extension thereby form this process of new DNA().Through such process, a DNA double chain molecule originally has just formed two DNA moleculars, has increased by one times.Repeatedly carry out unwind-low-temperature annealing of high temperature-middle temperature and extend three processes, just can obtain the more two strands that copies, and the two strands of these new formation can be used as again the template of circulation next time.
By a kind of so cyclic amplification method, through 30-40 circulation, object nucleic acid molecule number can be increased to original nearly 10 by 1
9doubly.But the highly sensitive of PCR is accompanied by such drawback all the time, that is, it is extremely easily contaminated.Only the pollution of 1 DNA copy just may cause obtaining wrong detected result.Therefore, for fear of the sample contamination in testing process, health ministry clearly specifies: PCR clinical diagnosis must be carried out sample preparation, amplification and detection in the room of cutting apart, and logistics is from sample preparation, be expanded to detect a direction carry out, otherwise amplification after test tube can not open detection.
Therefore, how in the whole process of PCR, avoiding polluting is also an important research direction of nucleic acid amplification and detection field now, and has also obtained a lot of progress.For example, the appearance of fluorescent PCR makes the detection of nucleic acid product avoid the step of open pipe sampling, thereby has greatly reduced the chance that nucleic acid product is polluted.In addition, the pollution of PCR process amplifying nucleic acid amplified production has also been avoided in the use of UNG enzyme.But the above method all needs expensive reagent or accurate instrument, and complicated operation, is not suitable for the field quick detection for nucleic acid.
Therefore, this area is still in the urgent need to a kind of simple to operate, quick, with low cost, the method and apparatus that can effectively avoid the pollution in nucleic acid amplification and testing process.For this reason, the application has developed a kind of totally-enclosed integral type nucleic acid amplification and detector tube.In the time using the application's totally-enclosed integral type nucleic acid amplification and detector tube to carry out nucleic acid amplification and detection, after nucleic acid amplification, can carry out detection of nucleic acids without open pipe, thereby effectively avoided amplified production leak and increase and detect in pollution.In addition, when use the application's totally-enclosed integral type nucleic acid amplification and detector tube carry out nucleic acid amplification and detect, instrument simple to operate, with low cost, need not to use expensive reagent or precision, thereby, the application's totally-enclosed integral type nucleic acid amplification and detector tube can be widely used in the in-vitro diagnosis of nucleic acid, and are suitable for especially the field quick detection of nucleic acid.
Utility model content
In this application, except as otherwise noted, otherwise Science and Technology noun used herein has the implication that those skilled in the art understand conventionally.And molecular genetics used herein, nucleic acid chemistry, Immunology Lab operation steps are widely used conventional steps in corresponding field.Meanwhile, in order to understand better the application, provide definition and the explanation of relational language below.
As used herein, term " amplification " should be from broadly understanding, and it comprises from RNA or DNA and obtain the process of DNA, and include but not limited to PCR reaction, reverse transcription reaction, with and various modification (for example real-time PCR reactions).
As used herein, term " totally-enclosed " refers to, assembles when complete when amplification pipe (1) and detector tube (2), and the two forms a complete totally enclosed environment.
In one aspect, the application provides a kind of totally-enclosed integral type nucleic acid amplification and detector tube, it comprise cooperatively interact for completing the amplification pipe (1) of amplified reaction, with for amplified production being detected and the detector tube (2) of result interpretation, wherein amplification pipe (1) and airtight connection of detector tube (2), and amplification pipe (1) is positioned at the below of detector tube (2), and detector tube (2) comprises that being fixed on test strip holds the test strip (6) in fixed area (7).
In a preferred embodiment, amplification pipe (1) and detector tube (2) are realized airtight connection by screw thread bayonet arrangement, ring-type bayonet arrangement or salient point buckle structure.
In a preferred embodiment, amplification pipe (1) comprises liquid storage district (3) and nucleic acid amplification district (4), and wherein liquid storage district (3) are positioned at the top of nucleic acid amplification district (4).Optionally, liquid storage district is preinstalled with the reagent for nucleic acid amplification in (3), such as but not limited to, primer, dNTP mixture, enzyme (for example archaeal dna polymerase or reversed transcriptive enzyme), probe, interior mark, damping fluid etc.
In a preferred embodiment, amplification pipe (1) is the amplification pipe that is applicable to Reynolds-Ben Nade convection current pcr amplification.Reynolds-Ben Nade convection current pcr amplification refers to, utilizes natural convection (being Reynolds-Ben Nade convection current) principle to carry out the method for pcr amplification.This technology is that PCR reaction solution is placed in the cylindricality reaction chamber of a sealing, and the upper and lower surface of reaction chamber is carried out respectively thermostatic control, and upper end temperature is 60 DEG C conventionally, and lower end temperature is 97 DEG C.Drive liquid through different warm areas by the temperature difference of upper and lower surface, realize pcr amplification.This method does not need to change the temperature of device, does not need additional driving to realize flowing of sample yet, only needs a reaction chamber, and the temperature of controlling its upper and lower two ends is constant temperature, just can realize pcr amplification.Therefore, the method has the advantages such as simple to operate, with low cost.
Therefore, in a preferred embodiment, amplification pipe (1) is the amplification pipe that is applicable to Reynolds-Ben Nade convection current pcr amplification, and it comprises liquid storage district (3) and nucleic acid amplification district (4), and wherein liquid storage district (3) are positioned at the top of nucleic acid amplification district (4).
In a preferred embodiment, height/internal diameter ratio in described nucleic acid amplification district (4) is 3-12.In a further preferred embodiment, height/internal diameter ratio in described nucleic acid amplification district (4) is 6-9, the maximum inner diameter in described nucleic acid amplification district (4) is less than or equal to 10mm, and the internal diameter in described nucleic acid amplification district (4) is less than the internal diameter in described liquid storage district (3).Further preferably, the maximum inner diameter in described nucleic acid amplification district (4) is less than or equal to 5mm.
In a preferred embodiment, the inner chamber in described nucleic acid amplification district (4) is cross section taper hollow structure wide at the top and narrow at the bottom or the trapezoidal hollow structure of multilayer.
In another preferred embodiment, the inner chamber in described nucleic acid amplification district (4) is the columnar hollow structure that upper and lower internal diameter is equal.
In a preferred embodiment, described nucleic acid amplification district (4) is provided with visible volume markings mark.In a preferred embodiment, the outer wall in described liquid storage district (3) is provided with non-slip groove.
In a preferred embodiment, described nucleic acid amplification district (4) is round and smooth lead angle structure with the inside, junction in liquid storage district (3).
In a preferred embodiment, amplification pipe (1) by screw thread bayonet socket (5) and and the airtight connection of detector tube (2).Preferably, screw thread bayonet socket (5) is positioned at the inside of liquid storage district (3).But screw thread bayonet socket (5) also can be positioned at the outside of liquid storage district (3).
In a preferred embodiment, test strip (6) comprises sample pad district (8) for contacting with amplified production and for reacting and present the detection zone (9) of result.
In the art, the method for utilizing test strip to detect nucleic acid amplification product is well set up.For example, a typical method is, in amplification process, make amplified production (for example carry the first mark and the second mark simultaneously, increase for example, with the probe of the first mark (FITC) and with the primer pair sample of the second mark (biological example element) by using), and be equipped with and can move with fluid in the provided upstream of test strip, the detection agent (being for example marked with the latex particle of mouse FITC antibody) of specific recognition the first mark, in downstream (, detection line place) be fixed with immovable, the trapping agent (for example Streptavidin) of specific recognition the second mark.Thus, in the time there is target DNA in sample, after amplification, the amplified production that simultaneously carries the first mark and the second mark will be produced; This amplified production is in the time flowing through test strip, first form amplified production/detector complex in conjunction with detection agent, then this mixture is further caught by trapping agent, and in the position of fixed trapped agent (, detection line place) accumulation, and finally show coloured band.In addition, in order to verify the validity of test strip, can also be in the downstream of detection line the material (for example sheep anti mouse two is anti-) of (, nature controlling line place) fixing specific recognition detection agent, thereby detection agent will be hunted down at nature controlling line place and accumulate, and show coloured band.In addition, in order to verify the validity of amplification procedure, mark in can also adding in amplification procedure, and make interior target amplified production (for example carry the first mark and the 3rd mark, by using for example, with the interior mark specific probe of the first mark (FITC) with for example, with the interior mark Auele Specific Primer of the 3rd mark (digoxin)), and in detection agent downstream, nature controlling line upstream (, internal standard line place) be fixed with trapping agent (for example anti digoxin antibody) immovable, specific recognition the 3rd mark.Thus, in amplification procedure, interior mark will be amplified and produce the amplified production that carries the first mark and the 3rd mark, when this amplified production moves through test strip in connection with detection agent, and caught by the trapping agent of specific recognition the 3rd mark, thereby accumulate and develop the color at internal standard line place.About the detailed description of test strip and related detecting method, can be referring to for example, the people such as Chinese patent application 200610109620.4 and Magda Anastassova Dineva, JOURNAL OF CLINICAL MICROBIOLOGY, in August, 2005,4015th-4021 pages, its whole disclosures are incorporated to herein by reference.
Therefore, in a preferred embodiment, the detection zone (9) of test strip (6) comprises testing wire, and it is for determining whether target nucleic acid molecules is present in sample; And optionally comprise nature controlling line and/or internal standard line, wherein said nature controlling line is for verifying the validity of test strip itself; Described internal standard line is for verifying the validity of amplification procedure.In a preferred embodiment, the detection zone (9) of test strip (6) can comprise one or more testing wire, thereby can be used for substance or Multiple detection (, detecting one or multiple target nucleic acid molecule).
In a preferred embodiment, test strip is held fixed area (7) and is comprised test strip base (10) and test strip upper cover (11), wherein, test strip base portion (10) and test strip upper cover part (11) can airtight connections and test strip (6) are fixed therein.
In a preferred embodiment, test strip base portion (10) comprises the tabula (12) for supporting test strip (6), for the groove (13) of test strip (6) location, be used for realizing the sample pad district (8) of test strip (6) and the tabula (14) of detection zone (9) physical property separation, be used for realizing the airtight raised line (15) in the top of test strip base portion (10) and the top of test strip upper cover part (11) that detector tube (2) test strip is held fixed area (7), the test strip that is used for realizing detector tube (2) is held the side of test strip base portion (10) and the airtight salient point (16) of the side of test strip upper cover part (11) of fixed area (7), for the screw thread bayonet socket (17) coordinating with the screw thread bayonet socket (5) of amplification pipe (1), and
Test strip upper cover part (11) comprises the tabula with respect to tabula (12) (18) for test strip (6) is clamped, for the groove with respect to groove (13) (19) of test strip (6) location, be used for realizing the sample pad district (8) of test strip (6) and the tabula with respect to tabula (14) (20) of detection zone (9) physical property separation, the test strip that is used for realizing detector tube (2) is held the airtight groove with respect to raised line (15) (21) in the top of test strip base portion (10) and the top of test strip upper cover part (11) of fixed area (7), the test strip that is used for realizing detector tube (2) is held the side of test strip base portion (10) and the airtight groove with respect to salient point (16) (22) of the side of test strip upper cover part (11) of fixed area (7), for realizing the airtight screw thread bayonet socket (23) with respect to screw thread bayonet socket (17) with amplification pipe (1).
In a preferred embodiment, test strip upper cover part (11) also comprises the transparent window (24) of the detection zone (9) for observing test strip (6).
In a preferred embodiment, after pipe (1) and detector tube (2) assembling of increasing, the two forms a totally enclosed environment, thereby prevents that the amplified production in pipe from leaking, and avoids the pollution of possible foreign matter.
In a preferred embodiment, after will increase pipe (1) and detector tube (2) assembling, by ultrasonic wave, each assembling parts is welded, and/or, by described totally-enclosed integral type nucleic acid amplification and detector tube entirety are carried out to coating processing, thereby realize more excellent obturation effect.
In a preferred embodiment, amplification pipe (1) or detector tube (2) are made up of polymeric material.In a preferred embodiment, amplification pipe (1) or detector tube (2) are made up of glass or plastics.
In a preferred embodiment, described nucleic acid is DNA or RNA.
In a preferred embodiment, described amplification is PCR reaction.
In a preferred embodiment, described amplification is reverse transcription reaction.
In yet another aspect, the application provides a kind of amplification and has detected the method for the object nucleic acid in sample, and it comprises the totally-enclosed integral type nucleic acid amplification and the detector tube that use the application.
In a preferred embodiment, the application's method comprises the following steps:
A) in amplification pipe (1), carry out nucleic acid amplification reaction;
B) after amplified reaction completes, reverse totally-enclosed integral type nucleic acid amplification and detector tube, and under totally-enclosed condition, make the amplified production in amplification pipe (1) enter detector tube (2), and it is upper to be transferred to test strip (6), and without opening integral type nucleic acid amplification and detector tube; With
C) read the detected result in test strip (6).
In a preferred embodiment, in step b), make the amplified production in amplification pipe (1) enter detector tube (2) by centrifugal or vibrations, and contact the sample pad district (8) of test strip (6), then, amplified production moves the detection zone (9) through test strip (6) by wicking action.
In a preferred embodiment, in step c), preferably, by transparent window (24), preferably read the detected result in test strip (6) by naked eyes.
In a preferred embodiment, after detection finishes, do not open described integral type nucleic acid amplification and detector tube, and its entirety is discarded in safe place.
In a preferred embodiment, step a) comprises:
A1) be added into nucleic acid amplification district (4) by sample to be detected with for carrying out the reagent of amplified reaction, and for example by centrifugal or vibrations, reaction mixture mixed;
A2) by detector tube (2) and amplification pipe, (1) is airtight is connected (for example, by screw thread bayonet socket (5), screw thread bayonet socket (17) and screw thread bayonet socket (23)); With
A3) the totally-enclosed integral type nucleic acid amplification after airtight connection and detector tube insertion amplification instrument are carried out to nucleic acid amplification.
In a preferred embodiment, described nucleic acid is DNA or RNA.
In a preferred embodiment, described amplification is PCR reaction.
In a preferred embodiment, described amplification is reverse transcription reaction.
In yet another aspect, the application provides a kind of test kit, totally-enclosed integral type nucleic acid amplification and detector tube that it comprises the application.The application's test kit is used under totally enclosed condition, carries out nucleic acid amplification and detection in same pipe.
In yet another aspect, also provide the application's totally-enclosed integral type nucleic acid amplification and detector tube for carrying out the purposes of nucleic acid amplification and detection.Nucleic acid amplification and detect as a general platform, can be widely used in all respects: for example, it can be used for non-diagnostic purpose, for example detect not with the specific gene of disease-related or the existence of sudden change; In addition, it also can be used for diagnostic purpose, the diagnosis of for example transmissible disease, the detection of genetic diseases, antenatal diagnosis, legal medical expert's research etc.
In yet another aspect, also provide the application's totally-enclosed integral type nucleic acid amplification and the detector tube purposes for the preparation of test kit, described test kit is used for carrying out nucleic acid amplification and detection.
The beneficial effect of utility model
The application provides a kind of totally-enclosed integral type nucleic acid amplification and detector tube, and the method for carrying out nucleic acid amplification and detection in described totally-enclosed integral type pipe.Compared with prior art, the application's technical scheme is integrated into nucleic acid amplification and detection paper in same closed amplification and detection reaction pipe, and it has following beneficial effect:
(1) in same pipe, carry out nucleic acid amplification and ELISA test strip, i.e. amplification is totally enclosed with testing process, can effectively prevent that nucleic acid amplification product from leaking, and avoids crossed contamination, and can effectively avoid the pollution in nucleic acid amplification and testing process;
(2) easy and simple to handle, quick: to be different from traditional ELISA test strip mode (it also needs to carry out probe interpolation after amplification completes, hatch and/or the step such as dilution), method described in the application only need be reversed reaction tubes after amplification completes, by centrifugal, vibrations or other modes, make amplified production enter detector tube, and contact with test strip, leave standstill and can carry out result viewing after several minutes;
(3) with low cost, effectively reduce the high price threshold of nucleic acid amplification and detection.
In addition, the application's technical scheme meets the relevant regulations of national health department to diagnostic nucleic acid reagent, and the field quick detection of nucleic acid is had great importance.
Below in conjunction with drawings and Examples, the application's embodiment is described in detail, but it will be understood by those skilled in the art that following drawings and Examples are only for the application's embodiment is described, instead of restriction to the claimed scope of the application.With the following detailed description of preferred embodiment, it is obvious that the application's various objects and favourable aspect will become to those skilled in the art with reference to the accompanying drawings.
Brief description of the drawings
Figure 1A-Fig. 1 D schematically illustrates the structure of totally-enclosed integral type nucleic acid amplification and detector tube.What wherein, Figure 1A, Figure 1B, Fig. 1 C presented respectively is front view, side-view and rear view.What Fig. 1 D presented is the skeleton view of detector tube (2).
Fig. 2 A-Fig. 2 B has schematically illustrated the application's preferred totally-enclosed integral type nucleic acid amplification and the structure of detector tube.What Fig. 2 A presented is totally-enclosed integral type nucleic acid amplification and detector tube face Directional Decomposition figure, that Fig. 2 B presents is the backsight Directional Decomposition figure of totally-enclosed integral type nucleic acid amplification and detector tube.Wherein, the groove (19) of the groove (13) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, locates for test strip; The tabula (18) of the tabula (12) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for support and the clamping of test strip (6); The tabula (20) of the tabula (14) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, separates for realizing the sample pad district (8) of test strip (6) and the physical property of detection zone (9); The groove (21) of the raised line (15) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for realizing up airtight of test strip base portion (10) and test strip upper cover part (11); The groove (22) of the salient point (16) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for realizing airtight at side of test strip base portion (10) and test strip upper cover part (11); The screw thread bayonet socket (23) of the screw thread bayonet socket (17) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, manages the airtight of (1) for realizing detector tube (2) with amplification; The transparent window (24) of test strip upper cover part (11) is for the detected result observation of test strip (6).
Fig. 3 A-Fig. 3 F has schematically illustrated and has used the application's totally-enclosed integral type nucleic acid amplification and the flow process that detector tube carries out nucleic acid amplification and detection.Wherein, Fig. 3 A represents, reaction reagent is injected to amplification pipe; Fig. 3 B represents, will increase and manage and detector tube fastening; Fig. 3 C represents, increases; Fig. 3 D represents, takes out totally-enclosed integral type pipe after amplification; Fig. 3 E represents, reverses totally-enclosed integral type pipe gently getting rid of; Fig. 3 F represents, leaves standstill and observes detected result after several minutes.
Embodiment
The application provides a kind of totally-enclosed integral type nucleic acid amplification and detector tube.Especially, Figure 1A-Fig. 1 D and Fig. 2 A-Fig. 2 B have shown the application's totally-enclosed integral type nucleic acid amplification and a kind of preferred embodiment of detector tube, it comprise cooperatively interact for completing the amplification pipe (1) of amplified reaction and for amplified production being detected and the detector tube (2) of result interpretation; Wherein, amplification pipe (1) comprises the nucleic acid amplification district (4) that is positioned at the liquid storage district (3) of top and is positioned at below, and wherein inside, liquid storage district (3) is useful on detector tube (2) and realizes airtight screw thread bayonet socket (5); Detector tube (2) comprises that test strip (6) and test strip hold fixed area (7).
In a preferred embodiment, test strip is held fixed area (7) and is comprised test strip base portion (10) and test strip upper cover part (11), for holding and fixing test strip (6).Wherein, the groove (19) of the groove (13) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, locates for test strip; The tabula (18) of the tabula (12) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for support and the clamping of test strip (6); The tabula (20) of the tabula (14) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, separates for realizing the sample pad district (8) of test strip (6) and the physical property of detection zone (9); The groove (21) of the raised line (15) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for realizing up airtight of test strip base portion (10) and test strip upper cover part (11); The groove (22) of the salient point (16) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for realizing airtight at side of test strip base portion (10) and test strip upper cover part (11); The screw thread bayonet socket (23) of the screw thread bayonet socket (17) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, manages the airtight of (1) for realizing detector tube (2) with amplification; The transparent window (24) of test strip upper cover part (11) is for the detected result observation of test strip (6).
In a preferred embodiment, after the pipe (1) that will increase is assembled with detector tube (2), can weld each assembling parts by ultrasonic wave, and/or, by described totally-enclosed integral type nucleic acid amplification and detector tube entirety are carried out to coating processing, to realize more excellent obturation effect.
The application also provides a kind of amplification and has detected the method for the object nucleic acid in sample, and it comprises the totally-enclosed integral type nucleic acid amplification and the detector tube that use the application.Especially, Fig. 3 A-Fig. 3 F has shown a kind of preferred embodiment of the application's method, and it comprises:
1) by sample to be detected be added into the nucleic acid amplification district (4) of amplification pipe (1) for carrying out the reagent of amplified reaction, and for example by centrifugal or vibrations, reaction mixture is mixed;
2) by screw thread bayonet socket (5), screw thread bayonet socket (17) and screw thread bayonet socket (23), detector tube (2) and amplification are managed to (1) is airtight is connected (, fastening);
3) pipe after airtight connection is inserted to amplification instrument and carry out nucleic acid amplification;
4), after amplified reaction completes, take out totally-enclosed integral type pipe;
5) reverse totally-enclosed integral type pipe, and make the amplified production in amplification pipe (1) enter detector tube (2) by centrifugal or vibrations, and be transferred in test strip (6); With
6) read the detected result in test strip (6) by transparent window (24).
In a preferred embodiment, after detection finishes, do not open described integral type nucleic acid amplification and detector tube, and its entirety is discarded in safe place.
Embodiment
Embodiment referring now to the following embodiment (and the claimed scope of non-limiting the application) that is intended to illustrate the application describes the application.
Unless specialized, the experimental methods of molecular biology using in the application and immunodetection, substantially with reference to people such as J.Sambrook, molecular cloning: laboratory manual, the 2nd edition, press of cold spring harbor laboratory, 1989, and the people such as F.M.Ausubel, fine works molecular biology experiment guide, the 3rd edition, John Wiley & Sons, Inc., the method described in 1995 is carried out; The condition that the use of enzyme is recommended according to goods producer.Those skilled in the art know, and embodiment describes the application's embodiment with way of example, and are not intended to limit the application's scope required for protection.
Embodiment 1: totally-enclosed integral type nucleic acid amplification and detector tube
As shown in Figure 1A-Fig. 1 D and Fig. 2 A-Fig. 2 B, the application's totally-enclosed integral type nucleic acid amplification and detector tube comprise cooperatively interact for completing the amplification pipe (1) of amplified reaction and for amplified production being detected and the detector tube (2) of result interpretation; Wherein, detector tube (2) comprises that test strip (6) and test strip hold fixed area (7).After amplification finishes, by totally-enclosed integral type nucleic acid amplification and detector tube from amplification instrument from taking out, homogeneous tube reverse and by centrifugal, vibrations or other modes, under totally-enclosed condition, make amplified production enter detector tube (2) from amplification pipe (1), and contact with test strip (6) wherein, then, amplified production moves to ELISA test strip district (9) by capillarity, and the specific immune response of Ag-Ab occurs on detection line and/or nature controlling line.
In the present embodiment, amplification pipe (1) in totally-enclosed integral type nucleic acid amplification and detector tube comprises the nucleic acid amplification district (4) that is positioned at the liquid storage district (3) of top and is positioned at below, and wherein inside, liquid storage district (3) is useful on detector tube (2) and realizes airtight screw thread bayonet socket (5).
Meanwhile, the detector tube (2) of totally-enclosed integral type nucleic acid amplification and detector tube comprises test strip base portion (10) and test strip upper cover part (11), for holding and fixing test strip (6).Wherein, the groove (19) of the groove (13) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, locates for test strip; The tabula (18) of the tabula (12) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for support and the clamping of test strip (6); The tabula (20) of the tabula (14) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, separates for realizing the sample pad district (8) of test strip (6) and the physical property of detection zone (9); The groove (21) of the raised line (15) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for realizing up airtight of test strip base portion (10) and test strip upper cover part (11); The groove (22) of the salient point (16) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, for realizing airtight at side of test strip base portion (10) and test strip upper cover part (11); The screw thread bayonet socket (23) of the screw thread bayonet socket (17) of test strip base portion (10) and test strip upper cover part (11) corresponding thereto, manages the airtight of (1) for realizing detector tube (2) with amplification; The transparent window (24) of test strip upper cover part (11) is for the detected result observation of test strip (6).
In addition, after the pipe (1) that will increase is assembled with detector tube (2), can weld each assembling parts by ultrasonic wave, and/or, by described totally-enclosed integral type nucleic acid amplification and detector tube entirety are carried out to coating processing, to realize more excellent obturation effect.
Embodiment 2: the totally-enclosed integral type nucleic acid amplification of Application Example 1 and detector tube amplification and detection that carry out, taking DNA as template
1, experiment material
Chemical reagent: LightCycler FastStart DNA Master Hybridization Mixture (Roche, Germany), divalence magnesium ion, ultrapure water
Instrument consumptive material: self-control nucleic acid augmentative instrument (referring to application CN201110456811.9); Totally-enclosed integral type nucleic acid amplification and the detector tube of embodiment 1, wherein the test strip (6) in detector tube (2) is provided with the latex particle that is marked with anti-FITC murine antibody in upstream, on the detection line (T) in downstream, be fixed with Streptavidin (SA), more on the nature controlling line in downstream (C), be fixed with sheep anti mouse two anti-(GAM-IgG).
Primer: B3F(is biotin labeled): 5 '-GGTTATCGCTGGATGTGTCTGCGGC-3 '
B3R:5’-AGGACAAACGGGCAACATACCTTGATAGT-3’
Probe: B3T(FITC mark): 5 '-CATCCTGCTGCTATGCCTCATCTTCTT-3 '
Detect model 1:HBV total length plasmid, concentration is 10
3copy/ml
Detect model 2: ultrapure water
2, experimental technique:
A) configuration of amplifing reagent: 1pmol B3F, 1pmol B3R, 0.25pmol B3T, 4 μ l LightCycler FastStart DNA Master Hybridization Mixture, 4mM divalence magnesium ion, 10 μ l detect model 1 or detect model 2, cumulative volume 40 μ l, and residual volume is supplied with ultrapure water.
B) nucleic acid amplification: the amplification reaction mixture configuring is added in the liquid storage district (3) of amplification pipe (1), detector tube (2) and amplification pipe (1) are fastened, and by centrifugal, vibration or other modes, make amplification reaction mixture flow to nucleic acid amplification district (4) and mix from liquid storage district (3); Totally-enclosed integral type nucleic acid amplification and detector tube that amplification reaction mixture is housed are inserted to self-control nucleic acid augmentative instrument, carry out PCR nucleic acid amplification.
C) detection of amplified production: totally-enclosed integral type nucleic acid amplification and detector tube are inverted and are passed through centrifugal, vibration or other modes, under totally-enclosed condition, make amplified production enter detector tube (2) from amplification pipe (1), and contact with the sample pad district (8) of test strip (6) and by its absorption, then, amplified production is detection zone (9) migration to test strip by capillarity, and successively by being marked with the latex particle of anti-FITC murine antibody, be fixed with the detection line of Streptavidin (SA) and be fixed with the nature controlling line that sheep anti mouse two resists (GAM-IgG), and on detection line and nature controlling line, occur specificity interact.Leave standstill after 5 minutes, can be by transparent detection form (24) naked-eye observation detected result.
The detected result of embodiment 2 has shown the detected result taking HBV total length plasmid as model: detection line (T line) all takes on a red color with nature controlling line (C line).Nature controlling line (C line) takes on a red color explanation detection effectively, and detection line (T line) takes on a red color and illustrates that detected result is positive.The detected result of embodiment 2 has also shown the detected result taking ultrapure water as model: not colour generation of detection line (T line), nature controlling line (C line) takes on a red color.Nature controlling line (C line) takes on a red color explanation detection effectively, and colour generation explanation detected result is not negative for detection line (T line).
Embodiment 3: the totally-enclosed integral type nucleic acid amplification of Application Example 1 and detector tube amplification and detection that carry out, taking RNA as template
1, experiment material
Chemical reagent: AccessQuick Master Mix(Promega), AMV Reverse Transcriptase, DEPC water.
Instrument consumptive material: totally-enclosed integral type nucleic acid amplification and the detector tube of self-control nucleic acid augmentative instrument (referring to application CN201110456811.9), embodiment 1, wherein the test strip (6) in detector tube (2) is provided with the latex particle that is marked with anti-FITC murine antibody in upstream, on the detection line (T) in downstream, be fixed with Streptavidin (SA), more on the nature controlling line in downstream (C), be fixed with sheep anti mouse two anti-(GAM-IgG).
Primer: C3F(is biotin labeled): 5 '-AGTGCCCCGGGAGGTCTCGTAGACCGTG-3 '
C3R:5’-ACCTGGGGCCCCTGCGCGGCAACAAGTATA-3’
Probe: C3T(FITC mark): 5 '-TCCTAAACCTCAAAGA-3 '
Detect model 1:HCV serum and extract template, concentration is 10
4copy/ml
Detect model 2:DEPC water.
2, experimental technique:
A) configuration of amplifing reagent: 1pmol C3F, 1pmol C3R, 0.25pmol C3T, 20 μ l AccessQuick Master Mix (Promega), AMV Reverse Transcriptase8u, 10 μ l detect model 1 or detect model 2, cumulative volume 40 μ l, and residual volume is supplied with ultrapure water.
B) nucleic acid amplification: the amplification reaction mixture configuring is added in the liquid storage district (3) of amplification pipe (1), detector tube (2) and amplification pipe (1) are fastened, and by centrifugal, vibration or other modes, make amplification reaction mixture flow to nucleic acid amplification district (4) and mix from liquid storage district (3); Totally-enclosed integral type nucleic acid amplification and detector tube that amplification reaction mixture is housed are inserted to self-control nucleic acid augmentative instrument, carry out reverse transcription amplification.
C) detection of amplified production: totally-enclosed integral type nucleic acid amplification and detector tube are inverted and are passed through centrifugal, vibration or other modes, under totally-enclosed condition, make amplified production enter detector tube (2) from amplification pipe (1), and contact with the sample pad district (8) of test strip (6) and by its absorption, then, amplified production is detection zone (9) migration to test strip by capillarity, and successively by being marked with the latex particle of anti-FITC murine antibody, be fixed with the detection line of Streptavidin (SA) and be fixed with the nature controlling line that sheep anti mouse two resists (GAM-IgG), and on detection line and nature controlling line, occur specificity interact.Leave standstill after 5 minutes, can be by transparent detection form (24) naked-eye observation detected result
The detected result of embodiment 3 has shown taking HCV serum extracts the detected result of template as model: detection line (T line) all takes on a red color with nature controlling line (C line).Nature controlling line (C line) takes on a red color explanation detection effectively, and detection line (T line) takes on a red color and illustrates that detected result is positive.The detected result of embodiment 3 has also shown the detected result taking ultrapure water as model: not colour generation of detection line (T line), nature controlling line (C line) takes on a red color.Nature controlling line (C line) takes on a red color explanation detection effectively, and colour generation explanation detected result is not negative for detection line (T line).The result of embodiment 2 and 3 shows, the application's totally-enclosed integral type nucleic acid amplification and detector tube and associated method are not only suitable for amplification and the detection of DNA molecular, and are applicable to amplification and the detection of RNA molecule.
Embodiment 4: the totally-enclosed integral type nucleic acid amplification of Application Example 1 and detector tube carry out, amplification and detection that monitor, taking DNA as model containing interior mark
1, experiment material
Chemical reagent: LightCycler FastStart DNA Master Hybridization Mixture (Roche, Germany), divalence magnesium ion, ultrapure water
Instrument consumptive material: self-control nucleic acid augmentative instrument (referring to application CN201110456811.9); Totally-enclosed integral type nucleic acid amplification and the detector tube of embodiment 1, wherein the test strip (6) in detector tube (2) is provided with the latex particle that is marked with anti-FITC murine antibody in upstream, on the detection line (T) in downstream, be fixed with Streptavidin (SA), on internal standard line (I), be fixed with anti digoxin antibody, more on the nature controlling line in downstream (C), be fixed with sheep anti mouse two anti-(GAM-IgG).
Primer: B3F(is biotin labeled): 5 '-GGTTATCGCTGGATGTGTCTGCGGC-3 '
B3R:5’-AGGACAAACGGGCAACATACCTTGATAGT-3’
IF(digoxigenin labeled): 5 '-TTGGCGATGGCTGTATCTGTGGGCT-3 '
IR:5’-AACGGACAAGCGGCAAACCTAGATTGTTA-3’
Probe: B3T(FITC mark): 5 '-CATCCTGCTGCTATGCCTCATCTTCTT-3 '
IT(FITC mark): 5 '-GCCTCATCCTGCTTGTTGGTTAAGCTGA-3 '
Interior mark: T-I(is in pMD-18T carrier)
5’-TTGGCGATGGCTGTATCTGTGGGCTGTTTTATCATCTTCCTCTGGCCTCATCCTGCTTGTTGGTTAAGCTGAGTTGGTTCTTCTGGTAACAATCTAGGTTTGCCGCTTGTCCGTT-3’
Detect model 1:HBV total length plasmid, concentration is 10
3copy/ml
Detect model 2: ultrapure water.
2, experimental technique:
A) configuration of amplifing reagent: 1pmol B3F, 1pmol B3R, 0.25pmol B3T, 1pmol IF, 1pmol IR, 0.25pmol IT, 4 μ l LightCycler FastStart DNA Master Hybridization Mixture, 4mM divalence magnesium ion, in 2 μ l, mark plasmid T-I(concentration is 10
5copy/ml), 10 μ l detect model 1 or 10 μ l and detect model 2, cumulative volume 40 μ l, residual volume is supplied with ultrapure water.
B) nucleic acid amplification: the amplification reaction mixture configuring is added in the liquid storage district (3) of amplification pipe (1), detector tube (2) and amplification pipe (1) are fastened, and by centrifugal, vibration or other modes, make amplification reaction mixture flow to nucleic acid amplification district (4) and mix from liquid storage district (3); Totally-enclosed integral type nucleic acid amplification and detector tube that amplification reaction mixture is housed are inserted to self-control nucleic acid augmentative instrument, carry out PCR nucleic acid amplification.
C) detection of amplified production: totally-enclosed integral type nucleic acid amplification and detector tube are inverted and are passed through centrifugal, vibration or other modes, under totally-enclosed condition, make amplified production enter detector tube (2) from amplification pipe (1), and contact with the sample pad district (8) of test strip (6) and by its absorption, then, amplified production is detection zone (9) migration to test strip by capillarity, and successively by being marked with the latex particle of anti-FITC mAb, be fixed with the detection line of Streptavidin (SA), be fixed with the internal standard line (I) of anti digoxin antibody and be fixed with the nature controlling line that sheep anti mouse two resists (GAM-IgG), and at detection line, specificity occurs on internal standard line and nature controlling line to interact.Leave standstill after 5 minutes, can be by transparent detection form (24) naked-eye observation detected result.
The detected result of embodiment 4 has shown the detected result taking HBV total length plasmid as model: detection line (T line), internal standard line (I line) all take on a red color with nature controlling line (C line).Internal standard line (I line) takes on a red color explanation amplification effectively, and nature controlling line (C line) takes on a red color and illustrates that ELISA test strip is effective, and detection line (T line) takes on a red color and illustrates that detected result is positive.If arbitrary not colour generation of nature controlling line (C line) and/or internal standard line (I line), explanation amplification and/or detection have problem: internal standard line (I line) is colour generation explanation amplification existing problems not; Nature controlling line (C line) is colour generation explanation Test paper existing problems not.The detected result of embodiment 4 has also shown the detected result taking ultrapure water as model: not colour generation of detection line (T line), internal standard line (I line) all takes on a red color with nature controlling line (C line).Internal standard line (I line) takes on a red color explanation amplification effectively, and nature controlling line (C line) takes on a red color and illustrates that ELISA test strip is effective, and colour generation explanation detected result is not negative for detection line (T line).The result of embodiment 4 also shows, the application's totally-enclosed integral type nucleic acid amplification and detector tube and associated method are suitable for Multiple detection,, can be used for detecting one or more target nucleic acid molecules that is.
Finally should be noted that: above embodiment is only in order to the application's technical scheme to be described but not be limited.Although the application's embodiment has obtained detailed description, those skilled in the art will appreciate that according to disclosed all instructions, can carry out various modifications and changes to details, and these change all within the application's protection domain.The application's four corner is provided by claims and any equivalent thereof.
Claims (11)
1. a totally-enclosed integral type nucleic acid amplification and detector tube, it comprise cooperatively interact for completing the amplification pipe (1) of amplified reaction, with for amplified production being detected and the detector tube (2) of result interpretation, wherein amplification pipe (1) and airtight connection of detector tube (2), and amplification pipe (1) is positioned at the below of detector tube (2), and detector tube (2) comprises that being fixed on test strip holds the test strip (6) in fixed area (7).
2. totally-enclosed integral type nucleic acid amplification according to claim 1 and detector tube, is characterized in that, amplification pipe (1) and detector tube (2) are realized airtight connection by screw thread bayonet arrangement, ring-type bayonet arrangement or salient point buckle structure.
3. totally-enclosed integral type nucleic acid amplification according to claim 1 and detector tube, is characterized in that, amplification pipe (1) comprises liquid storage district (3) and nucleic acid amplification district (4), and wherein liquid storage district (3) are positioned at the top of nucleic acid amplification district (4).
4. totally-enclosed integral type nucleic acid amplification according to claim 3 and detector tube, is characterized in that, amplification pipe (1) by screw thread bayonet socket (5) and and the airtight connection of detector tube (2).
5. totally-enclosed integral type nucleic acid amplification according to claim 4 and detector tube, is characterized in that, screw thread bayonet socket (5) is positioned at the inside in liquid storage district (3) or is positioned at the outside of liquid storage district (3).
6. totally-enclosed integral type nucleic acid amplification according to claim 1 and detector tube, is characterized in that, test strip (6) comprises sample pad district (8) for contacting with amplified production and for reacting and present the detection zone (9) of result.
7. totally-enclosed integral type nucleic acid amplification according to claim 6 and detector tube, is characterized in that, the detection zone (9) of test strip (6) comprises one or many testing wires, and it is for determining whether target nucleic acid molecules is present in sample; And optionally comprise nature controlling line and/or internal standard line, wherein said nature controlling line is for verifying the validity of test strip itself; Described internal standard line is for verifying the validity of amplification procedure.
8. totally-enclosed integral type nucleic acid amplification according to claim 1 and detector tube, it is characterized in that, test strip is held fixed area (7) and is comprised test strip base (10) and test strip upper cover (11), wherein, test strip base portion (10) and test strip upper cover part (11) can airtight connections and test strip (6) are fixed therein.
9. totally-enclosed integral type nucleic acid amplification according to claim 8 and detector tube, is characterized in that, test strip base portion (10) comprising:
Be used for supporting the tabula (12) of test strip (6),
For the groove (13) of test strip (6) location,
Be used for realizing the sample pad district (8) of test strip (6) and the tabula (14) of detection zone (9) physical property separation,
Be used for realizing the airtight raised line (15) in the top of test strip base portion (10) and the top of test strip upper cover part (11) that detector tube (2) test strip is held fixed area (7),
The test strip that is used for realizing detector tube (2) is held the side of test strip base portion (10) and the airtight salient point (16) of the side of test strip upper cover part (11) of fixed area (7), and
For the screw thread bayonet socket (17) coordinating with the screw thread bayonet socket (5) of amplification pipe (1); And
Test strip upper cover part (11) comprising:
For the tabula with respect to tabula (12) (18) that test strip (6) is clamped,
For the groove with respect to groove (13) (19) of test strip (6) location,
Be used for realizing the sample pad district (8) of test strip (6) and the tabula with respect to tabula (14) (20) of detection zone (9) physical property separation,
The test strip that is used for realizing detector tube (2) is held the airtight groove with respect to raised line (15) (21) in the top of test strip base portion (10) and the top of test strip upper cover part (11) of fixed area (7),
The test strip that is used for realizing detector tube (2) is held the side of test strip base portion (10) and the airtight groove with respect to salient point (16) (22) of the side of test strip upper cover part (11) of fixed area (7), and
For realizing the airtight screw thread bayonet socket (23) with respect to screw thread bayonet socket (17) with amplification pipe (1).
10. totally-enclosed integral type nucleic acid amplification according to claim 8 and detector tube, is characterized in that, test strip upper cover part (11) comprises the transparent window (24) of the detection zone (9) for observing test strip (6).
11. according to totally-enclosed integral type nucleic acid amplification and detector tube described in claim 1-10 any one, it is characterized in that, after will increase pipe (1) and detector tube (2) assembling, by ultrasonic wave, each assembling parts is welded, and/or, described totally-enclosed integral type nucleic acid amplification and detector tube entirety are carried out to coating processing.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201320429171.7U CN203639460U (en) | 2013-07-19 | 2013-07-19 | Fully enclosed integrated nucleic acid amplification and detection tube |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201320429171.7U CN203639460U (en) | 2013-07-19 | 2013-07-19 | Fully enclosed integrated nucleic acid amplification and detection tube |
Publications (1)
Publication Number | Publication Date |
---|---|
CN203639460U true CN203639460U (en) | 2014-06-11 |
Family
ID=50870722
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201320429171.7U Expired - Lifetime CN203639460U (en) | 2013-07-19 | 2013-07-19 | Fully enclosed integrated nucleic acid amplification and detection tube |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN203639460U (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104293659A (en) * | 2013-07-19 | 2015-01-21 | 厦门万泰沧海生物技术有限公司 | Fully enclosed integrated nucleic acid amplification and detection tube |
CN104404137A (en) * | 2014-11-05 | 2015-03-11 | 浙江大学 | Closed portable test strip colourimetry nucleic acid detection apparatus, detection container and detection method |
CN105018341A (en) * | 2015-07-06 | 2015-11-04 | 西安交通大学 | Paper-based nucleic acid amplification and detection integrated detection device and detection method |
CN105063180A (en) * | 2015-06-16 | 2015-11-18 | 浙江大学 | Sealed portable nucleic acid detection apparatus and method thereof |
CN105199940A (en) * | 2015-09-22 | 2015-12-30 | 广州和实生物技术有限公司 | Anti-pollution portable gene detection method and device |
CN112812951A (en) * | 2021-02-03 | 2021-05-18 | 杭州杰毅生物技术有限公司 | Closed reaction consumable |
-
2013
- 2013-07-19 CN CN201320429171.7U patent/CN203639460U/en not_active Expired - Lifetime
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104293659A (en) * | 2013-07-19 | 2015-01-21 | 厦门万泰沧海生物技术有限公司 | Fully enclosed integrated nucleic acid amplification and detection tube |
CN104404137A (en) * | 2014-11-05 | 2015-03-11 | 浙江大学 | Closed portable test strip colourimetry nucleic acid detection apparatus, detection container and detection method |
CN105063180A (en) * | 2015-06-16 | 2015-11-18 | 浙江大学 | Sealed portable nucleic acid detection apparatus and method thereof |
CN105018341A (en) * | 2015-07-06 | 2015-11-04 | 西安交通大学 | Paper-based nucleic acid amplification and detection integrated detection device and detection method |
CN105199940A (en) * | 2015-09-22 | 2015-12-30 | 广州和实生物技术有限公司 | Anti-pollution portable gene detection method and device |
CN112812951A (en) * | 2021-02-03 | 2021-05-18 | 杭州杰毅生物技术有限公司 | Closed reaction consumable |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104293659A (en) | Fully enclosed integrated nucleic acid amplification and detection tube | |
CN203639460U (en) | Fully enclosed integrated nucleic acid amplification and detection tube | |
US7947450B2 (en) | Device, kit and method for pulsing biological samples with an agent and stabilising the sample so pulsed | |
EP2048245B1 (en) | A totally-enclosed device for quick detection of target nucleic acid amplification product | |
CA2895945C (en) | Target capture system | |
US20110244466A1 (en) | Nucleic acid testing device and method | |
CA2740150C (en) | Device, kit and method for pulsing biological samples with an agent and stabilising the sample so pulsed | |
CN103103118B (en) | Nucleic acid amplification and detection reaction tube | |
US20190009276A1 (en) | Amplification and detection of nucleic acids | |
US20110129839A1 (en) | Device, kit and method for pulsing biological samples with an agent and stabilising the sample so pulsed | |
JP2013532488A (en) | Pressurizable cartridge for polymerase chain reaction | |
CN206109407U (en) | Nucleic acid amplification reaction pipe, reaction unit and kit in steerable liquid ring flow path footpath | |
Kim et al. | On-site extraction and purification of bacterial nucleic acids from blood samples using an unpowered microfluidic device | |
WO2016188430A1 (en) | Devices and methods for sample collection cross-reference | |
Nestorova et al. | Lab-on-a-chip mRNA purification and reverse transcription via a solid-phase gene extraction technique | |
CN103937884A (en) | Loop-mediated isothermal amplification kit for detecting mycobacterium tuberculosis and application method of kit | |
CN110172502A (en) | A kind of detection method and detection kit of hpa gene parting | |
EP3327444A1 (en) | Kit for analysis and anaysis method using same | |
EP3144380A1 (en) | Analysis device, analysis chip, analysis kit, and analysis method using same | |
US9869675B2 (en) | Low resource processor using surface tension valves for extracting, concentrating, and detecting whole cells | |
CN107365684A (en) | A kind of paper micro-fluidic chip and its method for extracting nucleic acid and isothermal amplification method | |
Kulczyk et al. | Direct observation of enzymes replicating DNA using a single-molecule DNA stretching assay | |
US20220155294A1 (en) | Apparatuses for performing rapid diagnostic tests | |
CN220056885U (en) | Multiplex liquid drop digital PCR (polymerase chain reaction) kit for detecting mucor | |
CN108977512A (en) | Primer and probe and its kit and method based on digital pcr technology detection haemophilus parasuis |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
TR01 | Transfer of patent right | ||
TR01 | Transfer of patent right |
Effective date of registration: 20200106 Address after: 102206 No. 31 science Road, Beijing, Changping District Co-patentee after: XIAMEN University Patentee after: BEIJING WANTAI BIOLOGICAL PHARMACY ENTERPRISE Co.,Ltd. Address before: 361022, 130, New Garden Road, Haicang District, Fujian, Xiamen Co-patentee before: Xiamen University Patentee before: Xiamen Innovax Biotech Co.,Ltd. |
|
CX01 | Expiry of patent term | ||
CX01 | Expiry of patent term |
Granted publication date: 20140611 |