CN1997737B - For controlling the composition and method of insect infestations in plant - Google Patents
For controlling the composition and method of insect infestations in plant Download PDFInfo
- Publication number
- CN1997737B CN1997737B CN200580019203.4A CN200580019203A CN1997737B CN 1997737 B CN1997737 B CN 1997737B CN 200580019203 A CN200580019203 A CN 200580019203A CN 1997737 B CN1997737 B CN 1997737B
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- segment
- nucleotide
- insect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to the controls to pest infestation, this is by inhibiting to realize without one of vertebra harmful organism or a variety of biological functions.The invention discloses the method and compositions for controlling pest infestation, this is to be realized by the way that one or more different recombination double stranded rna molecules are fed to harmful organism by obtaining the reduction of pest infestation to the containment of gene expression.The invention further relates to manufacture expression double stranded rna molecule genetically modified plants method, and for protect plant keep out pest infestation transgenic insecticidal agent specific combination.
Description
Cross-reference to related applications
The present invention claims following U.S. Provisional Applications:It is filed in the 60/560,842 of on April 9th, 2004, is filed in 2004
On April 27,60/565,632, be filed on June 11st, 2004 60/579,062, be filed on August 20th, 2004
60/603,421, it is filed in the 60/617,281 of on October 11st, 2004 and is filed on April 7th, 2005
60/__________, they every part be all incorporated herein by reference in their entirety.
Invention field
In general, the present invention relates in plant and in animal and on animal to pest infestation carry out
Heredity control.More particularly, the present invention relate to modify the endogenous expression of coded sequence in specific pest cell or tissue
Method.More specifically, the present invention utilizes recombinant DNA technology, the expression of target coding sequence in pest cell is subject to
Contain after transcription or inhibit, this is by being fed with part or all one or more from target coding sequence to harmful organism
Thus the double-strand or small interference ribonucleic acid (RNA) molecule of transcription are controlled invasion come what is realized.Therefore, this hair
It is bright to be related to inhibiting the sequence-specific that coded sequence is expressed by double-stranded RNA (dsRNA) or siRNA (siRNA), to obtain
Obtain the control to the desirable level of harmful organism.
The present invention also provides it is novel, by separation and highly purified nucleic acid molecules comprising but be not limited to use in
DsRNA of the present invention or siRNA molecule, non-naturally occurring nucleotide sequence and recombinant dna construct are transcribed, when being introduced into
The evil biochron, it can contain or inhibit the expression of endogenous coding sequence or target coding sequence in harmful organism.The present invention also mentions
Following genetically modified plants are supplied, (a) described plant contains following nucleotide sequence, the nucleotide sequence coded process separation
With highly purified nucleic acid molecules and non-naturally occurring recombinant dna construct, it is used to control to plant pest for transcribing
Biological attack dsRNA or siRNA molecule, and (b) show the tolerance of resistance and/or raising to insect infestations.
Invention further describes:Composition containing dsRNA nucleotide sequence of the invention is used on plant or on animal or dynamic
Topical application in the environment of object, so that pest infestation is eliminated or reduced.
Background of invention
The environment of human survival is filled with pest infestation.Harmful organism includes:It is insect, spider, shellfish, true
It is bacterium, bacterium, virus, nematode, flatworm, roundworm, pinworm, hookworm, tapeworm, trypanosoma, blood fluke, horse botfly, flea, flat
Lice, mite, lice etc., they be it is in human environment generally existing, applied multiple means and attempted to control these harmful organisms
Invasion.Composition for controlling small harmful organism (such as bacterium, fungi and virus) invasion has been provided as antibiotic group
Close object, antiviral composition and antifungal composition form.For control larger harmful organism (for example, nematode, flatworm,
Roundworm, pinworm, heartworm, tapeworm, trypanosoma, blood fluke etc.) invasion composition typically as the shape of Chemical composition that
Formula exists, they can be applied to the known material surface that will appear pest infestation, or with pill, powder, tablet, soft
The forms such as cream or capsule are by affected animal consumption.The present invention relates to offers:Compared with composition known in the art, for controlling
The improved method of pest infestation processed.
Commercial crops are usually the target of attack of insect.In over the past several decades, about exploitation for controlling elder brother in plant
The more efficient way and composition of worm invasion, there has been the progress of some substances.Chemical insecticide is harmful for eradicating
Biological attack is highly effective.But using chemical insecticide, there are many disadvantages.Chemical insecticide is non-selective.People's meaning
Applied chemistry insecticide is intended to control the harmful no vertebra harmful organism for various crop and other plants.But because
Lack selectivity, chemical insecticide can also apply its effect for non-targeted animal, also, answer used one in chemical insecticide
The section time, it will usually keep field barren.Chemical insecticide is continuously present in environment, is usually metabolized slowly very much, if completely not
If being metabolized.They can be accumulated in food chain, in the food chain of especially high carnivore.These chemical insecticides
Accumulation leads to development to these reagent resistances and leads to the high-end species of ladder of evolving, the insecticide as mutagens with/
Or carcinogen is had an effect, and irreversible harmful genetic modification is typically resulted in.Therefore people need the side friendly to environment strongly
Method is used to controlling or eradicating insect infestations in plant or on plant, that is, selective, environment is inert, non-continuous reservation
And it is biodegradable, and can be the method for Pest-resistant management system well.
Composition including Bacillus thuringiensis (B.t.) bacterium can be obtained through commercial channels,
It has used as environmentally safe and acceptable insecticide more than 30 years.The insecticidal effect of Bt bacterium is this
The protein of a little proprietary generations of bacterium as a result, the protein will not be continuously present in environment, also, for impacted
Target species have the selectivity of height, only apply its effect by being absorbed by object noxious livings, they have shown that
To the innocuousness of environment and other nontarget organisms (including the mankind).One or more bases containing encoding insecticidal B.t. albumen
The genetically modified plants of cause can also obtain in the art, their significant effectives are in the invasion of control harmful insect.Use expression Bt
The substance of the recombinant plant of insecticidal protein is applied to environment as a result, in the area using such genetically modified crops to control
The amount of the chemical insecticide of fabrication field pest infestation significantly reduces.Chemical insecticide application reduction so that soil more
To clean, and the water for flowing to surrounding streams, rivers, pond and lake from soil is also more cleaned.Except these environment are good
Except place, the crop field of the anti-insect plant growth of transgenosis, the quantity of advantageous insect is dramatically increased, this is because chemistry kills
The reason of the use reduction of worm agent.
Antisense approach and composition are had reported in this field, they are believed can be by single strand RNA molecule (theoretically,
Can complementary with height positive-sense strand RNA molecule hybridization in vivo) synthesis apply its effect.Antisense technology is difficult in many systems
Middle use, there are three main causes for this.Firstly, the antisense sequences expressed in transformed cells are unstable.Second, table in transformed cells
The unstability of the antisense sequences reached is transported to host, cell type or biology far from transgenic cell to by the sequence therewith
System causes difficulty.Third, as the difficulty that the transport of unstability and antisense sequences encounters also is made for attempting as follows
Difficulty is made, the attempt is:Target justice nucleosides can effectively be adjusted by providing inside the recombinant cell for encoding the antisense sequences
The dosage of acid sequence expression.
Technology for adjusting gene expression dose in cell, tissue or biology rarely has improvement, particularly, lack and be used for
Postpone, contain or reduce the technology of the development of specific gene expression by using recombinant DNA technology.In addition, as these hands
Section Unpredictability as a result, in eukaryon or prokaryotes adjust specific gene expression, business way
Means obtained by diameter.
In the past it has been shown that carrying out the inhibition of double chain RNA mediate to specific gene in a variety of harmful organisms.In drosophila
(Tabara et is detected for genetically controlled means to what dsRNA was mediated in Drosophila melanogaster
Al., 282 1998, Science:430-431).Tabara et.al. describes a kind of method, turns for transporting to be related to generating
DsRNA solution is injected into insect bodies or before embryonic development by the dsRNA of gene insect (it expresses double stranded rna molecule)
It is injected into egg capsule.It is shown before researcher, by the way that the solution containing double-strand or siRNA molecule is fed to line
Nematode is dipped in the solution by worm, and by injection dsRNA molecule, the gene of double chain RNA mediate can be obtained in nematode
Containment.Rajagopal et al. describes the attempt to fail as follows:By being fed with containing the molten of the dsRNA for being specific to target gene
Liquid, or by the way that larva to be dipped in the solution, to contain the endogenous gene of harmful insect Spodoptera litura larva, but
It is, after dsRNA is injected into the hemolymph of the 5th state larva with micro syringe (microapplicator),
Rajagopal et al. but successfully contained (J.Biol.Chem., 2002,277:46849-46851).Similarly,
Mesa et al. (Us 2003/0150017) is predictably described for using the dsRNA for being transported to larva to inhibit lepidoptera
The preferred gene seat of larva Hellcoverpa armigera, it is described to be carried through the plant for taking in and being converted into and generating dsRNA
Object is realized.It is believed that providing dsRNA molecule in the diet of most of no vertebra pests or will contain
It is unpractical that the composition of dsRNA, which is injected into no vertebra harmful organism body,.DsRNA points are provided to no vertebra harmful organism
The diet method of son be it is unpractical, because of RNA molecule, even stable double stranded rna molecule, in mild alkalinity or acid
It is in environment (for example, found in most of no vertebra harmful organism alimentary canals) and highly unstable, it is easy by ring
Nuclease in border is degraded.Accordingly, it is desirable to by containment, delay or reduce base in specific no vertebra harmful organism
The improved method that gene expression is adjusted because of expression, the method is in order to control the purpose of pest infestation or for introducing
New phenotypic character.
Summary of the invention
The present invention, in one embodiment, the method comprising inhibiting to express without target gene in vertebra harmful organism.It is special
Not, the present invention includes to no vertebra harmful organism (particularly, Western corn rootworm (WCR, Diabrotica
Virgifera virglfera LeConte)) in one or more target genes the expression method that is adjusted or inhibited,
The method can cause feed, growth, development, breeding and propagation to stop, and eventually lead to insect death.The method includes:
Some or all of double-stranded RNA (dsRNA) or its modified forms (for example, siRNA (siRNA) sequence) will be stabilized to draw
Enter into no vertebra harmful insect body in cell or extracellular environment (for example, middle intestines), in no vertebra harmful insect body,
DsRNA or siRNA are entered in cell, are inhibited to the expression of at least one or more of target gene, and, wherein it is right
The inhibition of one or more target gene expression is applied with harmful effect on no vertebra harmful organism.Special consideration should be given to,
Method and composition of the invention will be used for:It is one or more comprising dsRNA molecule by being provided in harmful organism diet
Composition, any harmful organism host, harmful organism homobium or harmful organism hobby environment in limit or eliminate nothing
The invasion of vertebra harmful organism, as long as harmful organism digestive system pH, in the range of about 4.5 to about 9.5, about 5 to big
About 9, about 6 to about 7 and about pH7.0.
The invention discloses illustrative sequence tables, wherein containing Western corn rootworm (WCR, Diabrotica is come from
Virgifera nucleotide and amino acid sequence), such as SEQ ID NO:1 to SEQ ID NO:143 and SEQ ID NO:169
To SEQ ID NO:Shown in 174, also contains and come from other coleopterous insects, including Colorado potato bug (CPB,
) and red flour beetle (RFB, Tribolium castaneum) Leptinotarsadecemlineata;From lepidopterid,
Including European corn borer (ECB, Ostrinia nubilalis), black cutworm (BCW, Agrotis ipsilon), corn
Noctuid (CEW, Hellcoverpa zea), armyworm in autumn (FAW, Spodoptera frugiperda), boll weevil
(BWV, Anthonomusgrandis), silkworm (Bombyx mori) and Manduca sexta, and dipteron is come from,
Sequence including Drosophila melanogaster, Anopheles gambiae and Aedesaegypti, such as SEQ
ID NO:144 to SEQ ID NO:Shown in 159.Sequence table is wrapped in the form of CD-ROM CD with the papery copy of the application
It includes.
It is submitting, contain the sequence table information for following sequence corresponding to the computer-reader form of sequence table:Corn
Rootworm Unigene sequence, est sequence, corn rootworm specific probe sequence, primer sequence, amplification subsequence and coding are double
The sequence and v-ATPase of chain RNA sequence and ribosomes L19 from above-mentioned other insects are directly to autoploid (SEQ ID NO:
144 to SEQ ID NO:159).
The present invention provides a kind of methods, for containing without in vertebra harmful organism (such as corn rootworm or relative species)
Gene expression, described method includes following steps:At least one of gene containment amount is provided in the diet of harmful organism
DsRNA molecule, the dsRNA molecule are by SEQ ID NO in sequence table:1 to SEQ ID NO:143 and SEQ ID NO:
169 to SEQ ID NO:The transcription of nucleotide sequence shown in 174 comes, and is at least formed in one section of segment and pest cell
MRNA sequence it is complementary, and observe the death of harmful organism or feed is suppressed, hinders or stops.
In another aspect of this invention, described method includes following steps:One warps are fed with to harmful organism
Cross stable dsRNA molecule or its modified forms, such as siRNA molecule, nucleic acid sequence with selected from by SEQ ID NO:1 to
SEQ ID NO:143 and SEQID NO:169 to SEQ ID NO:The RNA that the nucleotide sequence transcription of 174 groups constituted comes divides
Son at least about 80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99 or about
100% is identical.
Therefore, in another aspect of this invention, the SEQ ID NO that sequence represents is provided:1 to SEQ ID NO:143
And SEQ ID NO:169 to SEQ ID NO:One group of nucleotide sequence by separation and purifying shown in 174.It is disclosed herein
SEQ ID NO:1 to SEQID NO:Nucleotide sequence shown in 143 is from the complementary DNA prepared by WCR insect larvae
(cDNA) library separates and is substantially purified into.SEQ IDNO in sequence table disclosed herein:169 to SEQ ID NO:174
Shown in nucleotide sequence separation and highly purified genomic DNA or nocuousness elder brother from harmful Southern corn rootworm
The library mRNA of worm, by the library this class mRNA obtain or based on nucleotide sequence disclosed herein or as is generally known in the art be used as T7
The cDNA nucleotide sequence of phage rna polymerase promoter sequence de novo formation.The present invention provides pass through stable dsRNA
Or the expression of siRNA molecule or one or more miRNA, for inhibiting without target in vertebra harmful organism, such as WCR insect
The expression of gene.By stable dsRNA, miRNA or siRNA molecule may include relatively at least one promoter with justice or
Antisense orientation arrangement at least two coded sequences comprising the nucleotide sequence of positive-sense strand and antisense strand by least about
Interval (spacer) sequence of five to about 1,000 nucleotide connects or is coupled, wherein positive-sense strand and antisense chain length are not
Together, and wherein, each in two kinds of coded sequences and SEQ ID NO in sequence table:1 to SEQID NO:One of 143 or
SEQ ID NO:169 to SEQ ID NO:Nucleotide sequence shown in one of 174 shares at least 90%, at least 95%, at least
98% or even 100% sequence identity.
The present invention also provides non-naturally occurring (NNO) nucleotide sequences, and it is raw without vertebra nocuousness to can be used for targeting
Gene in object, for the containment of double chain RNA mediate, to obtain the desired inhibition to target gene.SEQ ID NO:1 to
SEQ ID NO:143 or SEQ IDNO:169 to SEQ ID NO:Any one of nucleotide sequence shown in 174 can be used for
Construct such NNO nucleotide sequence.
The present invention also provides the recombination dNA constructs for the dsRNA molecule that the coding present invention is included, for introducing host
Cell.Recombinant dna construct includes the nucleotide sequence that RNA is transcribed by host cell.The RNA of transcription forms at least one
DsRNA molecule so that a chain of dsRNA molecule by with selected from by SEQ ID NO:1 to SEQ ID NO:143 and SEQ ID
NO:169 to SEQ ID NO:The identical nucleosides of nucleotide sequence at least about 80% to about 100% of 174 groups constituted
Coded by a part of acid sequence.Recombinant DNA construction physical efficiency generates dsRNA molecule in host cell, can inhibit endogenous gene
Or target gene or derivatives thereof or its complementary series absorb transformed host in host cell, or without vertebra harmful organism
Expression after cell in pest cell.Nucleotide sequence of the invention is opened in what can be operated in host cell
Under promoter sequences control, and it is expressed to generate the RNA sequence for forming dsRNA molecule in host cell.In place
Chief cell or without dsRNA molecule is further processed in vertebra harmful organism, forms siRNA molecule.
The present invention also provides the recombinant DNA sequence for Plant Transformation, it is built as containing single stranded RNA can be converted into
The non-naturally occurring nucleotide sequence of at least one of molecule.In the case where being provided in the diet of no vertebra harmful organism,
Single strand RNA molecule passes through molecule intermolecular hybrid in vivo and forms double stranded rna molecule, inhibits without in vertebra pest cell at least one
The expression of kind target gene.Non-naturally occurring nucleotide sequence is operably connected at least one promoter sequence, described
Promoter sequence plays a role in transgenic plant cells, and the non-naturally occurring nucleotide sequence being operably connected is turned
Record is one or more RNA sequences.RNA sequence itself assembly is double stranded rna molecule, is provided in genetically modified plants
In the diet without vertebra harmful organism of upper feed.The supply of dsRNA molecule in the diet of harmful organism, obtains to nocuousness
The desired inhibition of one or more target gene expression in biology.
The present invention also provides following recombinant host cells, the host cell has at least one weight in its genome
Group DNA sequence dna, the DNA sequence dna can be transcribed in host cell, to generate at least one dsRNA molecule, when by no vertebra
When harmful organism digests, the dsRNA molecule plays a role, to inhibit the expression of target gene in harmful organism.DsRNA molecule
It is by a part of encoded of following nucleotide sequence, the nucleotide sequence is shown and SEQ ID NO in sequence table:1
To SEQ ID NO:143 or SEQ ID:169 to SEQ ID NO:At least about 80 of nucleotide sequence shown in 174 are to about
The 100% phase same sex.It is shown in for constructing targeting WCR gene with the Exemplary nucleotide sequences of the dsRNA reagent inhibited
SEQ ID NO in sequence table:1 to SEQ ID NO:143 and SEQ ID:169 to SEQ IDNO:174.
The present invention also provides the recombinant dna construct for Plant Transformation, the construct is different by least two
Non-naturally occurring Sequence composition, when expressing as RNA sequence and provided in the diet of no vertebra harmful organism in vivo
When, the sequence can inhibit the expression of at least two different target genes in no vertebra pest cell.The first non-natural
Existing sequence is converted into RNA, forms the first at least one dsRNA molecule.A part of quilt of the first dsRNA molecule
Coded by a part of the first non-naturally occurring sequence, show and SEQ ID NO in sequence table:1 to SEQ ID
NO:143 or SEQ ID:169 to SEQ ID NO:The nucleotide sequence of nucleotide sequence, the first target gene shown in 174,
The phase same sex of at least about 80 to about 100% of its derivative or its complementary series.Second of non-naturally occurring sequence quilt
It is converted into RNA, forms second of dsRNA molecule.A part of second of dsRNA molecule is by second of non-naturally occurring sequence
Coded by a part of column, show and the SEQ ID NO in sequence table:1 to SEQ ID NO:143 or SEQ ID:169
To SEQ ID NO:The nucleotide sequence of nucleotide sequence shown in 174 and second of target gene, its derivative or its
The phase same sex of at least about 80 to about 100% of complementary series.Two kinds of non-naturally occurring sequences are operationally placed in
Under the control of at least one promoter sequence.Promoter sequence functions, to express first in transgenic plant cells
Kind and second of dsRNA molecule.It is in the diet without vertebra harmful organism fed on genetically modified plants, harmful organism is provided
The dsRNA molecule of inhibition concentration, harmful organism can obtain to target gene expression in harmful organism the intake of plant cell
Desired inhibition.
The present invention also provides the plant cells by conversion, have in its genome mentioned above for plant
At least one of recombinant DNA sequence of conversion.Plant cell by conversion generates genetically modified plants, genetically modified plants manufacture
Progeny plants, seed and plant product, each of which includes recombinant DNA.
Method and composition of the invention can be applied to any unifacial leaf and dicotyledon, this is depending on wanting without ridge
Vertebra harmful organism control, alternatively, it can be by pharmaceutically acceptable formulation application to invertebrate, so as to have without vertebra
The reduction of certain level occurs for evil biological attack.Particularly, plant includes but is not limited to:Alfalfa, dill (aneth), apple
Fruit, apricot, globe artichoke, rocket salad, asparagus, avocado, banana, barley, beans, beet (beet), blackberry, blueberry, blueberry, cabbage, armful son are sweet
The small citrus of indigo plant, cabbage, leaf mustard, muskmelon, carrot, cassava, cauliflower, celery, cherry, coriander, citrus, Ke Laimenshi, coffee
Coffee, corn, cotton, cucumber, pesudotsuga taxifolia, eggplant, hare's-lettuce, wide leaf lettuce, eucalyptus, fennel, fig, cucurbit, grape, shaddock,
"Hami" melon, yam bean, Chinese grooseberry, lettuce, leek, lemon, bitter orange, torch pine, mango, melon, mushroom, nut, oat, okra,
Onion, tangerine, decoration with plant, pawpaw, parsley, pea, peach, peanut, pears, pepper, persimmon, pine tree, pineapple, plantain, Lee, pomegranate,
White poplar, potato, pumpkin (pumpkin), quince, pine, witloof, radish, raspberry, rice, naked barley, sorghum, Southern Pine,
Soybean, spinach, pumpkin (squash), strawberry, beet (sugarbeet), sugarcane, sunflower, sweet potato, storax, mandarin orange, tea,
Tobacco, tomato, turf, trailing plant, watermelon, wheat, Chinese yam and small cucumber plant.
The present invention also provides a kind of harmful organisms to control reagent, wherein comprising coming from nucleotide sequence transcription of the invention
DsRNA molecule.SEQ IDNO in the nucleotide sequence and sequence table:1 to SEQ ID NO:143 or SEQ ID:169 to
SEQ ID NO:Nucleotide sequence shown in 174 shares the phase same sex of about 80 to about 100%.In one form, harmful
Biocontrol agent includes dsRNA molecule.In another form, harmful organism control reagent includes siRNA molecule.Another
In kind form, it includes the recombinant DNA sequence for encoding following mRNA molecules that harmful organism, which controls reagent, and the mRNA molecule can be formed
DsRNA or siRNA molecule for introduced plant and microorganism.In still another form, it is micro- life that harmful organism, which controls reagent,
Object, contains the recombinant DNA sequence for encoding following mRNA molecules, and the mRNA molecule can form dsRNA or siRNA molecule.Have
Evil biocontrol agent is preferably insect or nematode pests biocontrol agent.
People need harmful biocontrol agent to play a role, and to reduce or eliminate the invasion of corn rootworm, but also examine
Consider, method and composition shown in this article can be used to obtain the correlated series from other harmful organisms, and utilize this
A little derivatives are to control the invasion of other (a variety of) harmful organisms.It is also contemplated that insect pest can be selected from corn rootworm
Affiliated same genus, mutually equal or mesh.In addition, the present inventor, which is also contemplated that, can be used the present invention, it is applied to control
It makes raw without vertebra from Bugdom and from nematode, fungal pathogens, virus, bacterium and any other pair of plant pest
Any species of object.
The present invention also provides the combinations for controlling the method and composition without vertebra pest infestation.A kind of means
Provide for protect plant from insect infestation, dsRNA method and composition as described herein and one or more kill
Insect agent, the property different from the property that dsRNA method and composition is shown that the insecticide is shown.For example, working as
When Bt albumen is provided in the diet of insect pest, the binding mode with method and composition of the invention has just been shown
The dramatic different binding mode for being used to control insect pest.It is formulated as the composition of topical application, or use turns base
Because of the composition that dsRNA method and composition and Bt method and composition combine that method obtains, collaboration effect can be generated
It answers, this is unknown in the past in the field for control insect infestations.Generating one or more dsRNA or siRNA molecule (can inhibit mesh
Mark some necessary biological functions in harmful organism) genetically modified plants and one kind or more toxic for object noxious livings
Kind B.t. insecticidal protein together provides astonishing synergistic effect.A kind of synergistic effect is (a variety of) dsRNA or (more
Kind) expression needed for Bt albumen reduces.When being grouped together, every kind of pest control agent all only needs lower to have
Imitate dosage.It is believed that Bt insecticidal protein is manufactured that access aperture, dsRNA or siRNA molecule pass through the access aperture
The space far from insect gut can be more effectively penetrated into, or more effectively to penetrate into wound manufactured by Bt albumen attached
Close cell, thus only need lesser amount of Bt or dsRNA that can obtain desired insecticidal as a result, want to target
The inhibition or containment of harmful organism target organism function.
Multinomial invention is described herein in the present inventor, invades including for controlling without vertebra harmful organism
The method attacked, the method are carried out by providing following reagents into the diet of no vertebra harmful organism, the reagent
It is constituted included in the ribonucleic acid to play a role when being absorbed by harmful organism, or by the ribonucleic acid, to inhibit harmful raw
The expression of the intracellular Target Nucleotide Sequence of object.The ribonucleic acid provided in diet is by being Target Nucleotide Sequence or and mesh
The ribonucleotide for marking nucleotide sequence complementation is constituted.Ribonucleotide is transcribed by following continuous DNA sequence dnas
Come, the DNA sequence dna there are at least about 19 to about 5000 nucleotide long, selected from by SEQ ID NO:1 to SEQ ID
NO:143,SEQ ID:169 to SEQ ID NO:174 and its group that is constituted of complementary series.The method is provided to following cores
The building of nucleotide sequence, the nucleotide sequence can be used for expressing RNA molecule, and the RNA molecule is being supplied to harmful organism
It is absorbed in diet by harmful organism.Diet can be artificial diet, carried out preparing to it and be protected on such diet with reaching
Hold the specific nutrition requirement of harmful organism, the diet can be supplemented with harmful organism control amount, from individual expression system
The RNA being purified into system is used for following purposes to the supplement of diet:Determine the harmful organism control amount of RNA composition, or really
It is fixed --- it, can with one of harmful organism or plurality of target sequence-specific when harmful organism absorbs the diet being added
Whether have in conjunction with the specific RNA with partial hybridization, one or more buildings for obtaining some gene containment activity.Diet is also
It can be the recombinant cell transformed with DNA sequence dna, the DNA is the expression building for reagent, RNA or gene containment agent
's.When harmful organism absorbs one or more such cells by conversion, it may be observed that desired genotype or phenotypic results,
This shows that the reagent has the function of inhibiting Target Nucleotide Sequence expression in pest cell.
No vertebra harmful organism is preferably insect, spider, nematode, flatworm, capsule worm, fungi harmful organism or base
Because containing technology other any no vertebra harmful organisms applicatory.It is highly preferred that being in animal or plant without vertebra harmful organism
Object invasion aspect no vertebra harmful organism especially under a cloud.More particularly, no vertebra harmful organism is that preference invasion crop is planted
Strain, the insect of ornament and/or meadow or nematode or fungi harmful organism.
It selects to express preferably about 19 to about 5000 nucleotide of DNA sequence dna of gene containment agent of the invention
Length, at least partly justice or antisense with target sequence present in one or more specific objective pest DNA
Chain height in sequence is identical.Phrase " at least partly " is intended to indicate following concepts:Select the DNA sequence for carrying out expressing gene containment agent
Column can be used for expressing following RNA, institute from the single sequence construct obtained from one or more object noxious livings
Stating RNA can play a role again in the containment of individual gene or gene family in one or more object noxious livings;Or it can
The DNA sequence dna as chimera is constructed from a variety of DNA sequence dnas.A variety of DNA sequence dnas can be with each all from single nocuousness
One or more nucleotide sequences in biology obtain, or can be from one or more nucleotide of a variety of different harmful organisms
Sequence obtains.Particularly, the sequence selected should can be shown with the nucleotide sequence from pest DNA about
The nucleotide sequence identity of 80 to about 100%.The DNA of pest can be identified by following methods:From nocuousness
DNA is isolated in biological species, or by being identified the RNA in pest, is oppositely changed RNA sequence
For DNA.It is SEQ in shown herein, sequence table that example, which comes out from the sequence of the DNA of corn rootworm pest,
ID NO:1 to SEQ IDNO:143,SEQ ID:169 to SEQ ID NO:174 and its complementary series.
Select the DNA sequence dna for carrying out expressing gene containment property RNA molecule that can be included in polynucleotide compositions, described group
Object is closed to use in plant cell.Particularly, DNA sequence dna can be included in the carrier for converting plant cell gene group, and
And it can be included in expression cassette, the expression cassette contains at least one Plant functional promoters, the promoter and selection
DNA sequence dna and other any expression control elements (wanting the expression for obtaining suitable intracellular time or plant space level)
It is operably associated.Polynucleotide compositions are introduced into the genome of plant cell and provide transformed cells, if appropriate
Selection approach together included then it can be selected, and being regenerated as transgenosis recombinant plant with polynucleotide compositions.
Genetically modified plants, event can be provided that in the diet of one or more harmful organisms, to obtain the control to pest infestation
System.Genetically modified plants can produce progeny plants, plant cell and seed, each of which contains polynucleotides combination
Object.
The present invention provides a kind of methods for protecting plant from insect infestation, and the method is by insect pest
There is provided one of following plant cells or it is a variety of realize, the RNA molecules of every kind of the cell all expressing gene containment property,
The RNA molecule comes from following DNA sequence dnas, and the DNA sequence dna is selected from the group being made of the sequence illustrated herein.To containing base
Because of the intake of the plant cell of containment property RNA, harmful organism or insect-controlling agent, result in a kind of in harmful organism or insect
Or the inhibition of multiple biological function.
The present invention provides a kind of compositions, wherein containing two or more different insecticides, wherein every kind all to same
The harmful organism of sample or insect species are toxic.As described herein, one of these insecticides can be for raw in nocuousness
Contain the RNA molecule of necessary biological function in one or more cells of object.Second of insecticide can be wrapped with the first
It includes.Second of insecticide can be can select different from second of gene containment property RNA of the first or second of insecticide
The group constituted from following substance:Patatin patatin, Bacillus thuringiensis insecticidal egg
White, Xenorhabdus insecticidal protein, Photorhabdus insecticidal protein, Bacillus laterosporous insecticidal
Albumen, Bacillussphearicus insecticidal protein and lignin.Bacillus thuringiensis insecticidal protein
It can be any type in a large amount of insecticidal proteins, the albumen includes but is not limited to:Cry1,Cry3,TIC851,
CryET70, Cry22, binary insecticidal protein CryET33 and CryET34, binary insecticidal protein CryET80 and CryET76,
Binary insecticidal protein TIC100 and TIC101, binary insecticidal protein PS149B1, VIP insecticidal protein, TIC900 or related
Any kind of insecticidal chimera of albumen, TIC901, TIC1201, TIC407, TIC417 and aforementioned insecticidal protein.
It is targeted or for containment for the function in pest cell or as the physiology of harmful organism or metabolism side
The necessary albumen of gene codified that the function (expression for the gene that containment is targeted can be generated) in face is targeted, institute
The expectation function for stating albumen is selected from the group being made of following function:Muscle is formed, the formation of juvenile hormone, the tune of juvenile hormone
Control, ion regulation and transhipment, the synthesis of digestibility enzyme, the holding of cell membrane gesture, amino acid bio synthesis, amino acid degradation, essence
Son is formed, the synthesis of pheromones, and pheromones sensing, the formation of day linear protein (antennae), wing is formed, the formation of leg, hair
Educate and break up, the formation of ovum, larval maturation, the formation of digestibility enzyme, the synthesis of hemolymph, the holding of hemolymph, neurotransmission,
Cell division, energetic supersession, breathing and apoptosis.Preferably, it selects to construct and contain that the DNA sequence dna of construct is from sequence table
What nucleotide sequence show, for containing corn rootworm gene obtained.We expect, for controlling without vertebra harmful organism
The method of invasion will include:Reagent is provided in the diet of no vertebra harmful organism, for example, expressed from the first DNA sequence dna
The first ribonucleotide, functions when being absorbed by harmful organism, to inhibit the biology in the harmful organism
Function further contemplates, the first DNA sequence dna is shown with the coded sequence about 85 that obtains from the harmful organism to about
100% nucleotide sequence identity.The first ribonucleotide can hybridize with second of ribonucleotide, described
The complementation complementary or substantial with the first ribonucleotide of second of ribonucleotide, second of ribonucleotide sequence
Column are expressed by second of DNA sequence dna, and second of DNA sequence dna corresponds to the coded sequence obtained from no vertebra harmful organism,
It is selected from the sequence shown in sequence table or its complement herein.Preferably, the first and second of DNA sequence dna include and sequence
One of sequence shown in list or a variety of identical continuous sequences, the continuous sequence have about 14 to about 25 or more
More continuous nucleotides.
When the insecticide containing pest gene containment amount is (for example, one kind as shown in this paper sequence table or more
One or more RNA molecules that the expression of kind of sequence generates) diet when being provided to following no vertebra harmful organisms, the present invention
Optimal function is played, the harmful organism shows about 4.5 to about 9.5, about 5.0 to about 9.0, about 5.5 to big
About 8.5, about 6.0 to about 8.0, about 6.5 to about 7.0 or about 7.0 digestive system pH.Optionally, described herein
Method, nucleic acid, ribonucleic acid, ribonucleotide, composition, plant, plant cell, progeny plants, seed, insect control
Preparation, pest control agent, any type in expression cassette are being directed to one or more nocuousness comprising above-mentioned pH in digestive tract
Function is provided when providing in the diet of biology.
Diet of the invention can be any enough harmful organism diets comprising but is not limited to, artificial diet or matches
Side, plant cell, various plants cell, plant tissue, the root of plant, vegetable seeds and the plant come from vegetable seeds growth
Object, wherein RNA molecule that the diet includes pest inhibitory amount, being encoded by following DNA moleculars, the DNA molecular are
Or substantially one or more nucleotide sequences shown in the sequence table, or selected from from specific no vertebra harmful organism object
Continuous at least about 19 to about 5000 nucleotide of kind of the nucleotide sequence obtained, or be complementary or substantially mutual
It mends.
Agriculturally with commercially important product and/or composition (including but not limited to, animal feed, agricultural product and jade
Rice product and byproduct, corn product and byproduct are used for the food consumed for the mankind, or for being intended to
Composition and agricultural product for mankind's consumption comprising but be not limited to, corn flour, maize flour, corn syrup, corn oil,
Cornstarch, puffed rice, corn-dodger, cereal containing corn and corn byproducts etc.) it is intended to fall into the scope of the present invention, if
These products and composition contain it is detectable amount, shown in this article, turn base containing any of such nucleotide sequence as diagnosis
Because event nucleotide sequence if.These products be it is useful, may be obtained from crop at least because of them, and can give birth to
It produces, in the big Tanaka breeding containing less insecticide and organic phosphine, this is that they include into nucleotide of the invention for controlling
The result of invasion without vertebra harmful organism in plant.This agricultural products and commodity product are produced from by genetically modified plants
Seed produce, wherein the following RNA of Expressed in Transgenic Plant, the RNA is from one or more companies of the invention
Continuous nucleotide or the nucleotide and its complement of one or more no vertebra harmful organisms.This agricultural products and commodity product
Can also have for control this agricultural products and commodity product without vertebra harmful organism, for example, control plane powder weevil because
It there are the RNA that can contain pest gene, the RNA is gene shown in the present invention in agricultural product or commodity product
Expressed by sequence.
The present invention also provides computer-readable medium, it is recorded on SEQ ID NO shown in ordered list:1
To SEQ ID NO:143 or SEQ ID NO:169 to SEQ IDNO:One in nucleotide sequence or its complement shown in 174
Kind is a variety of, is used for a large amount of computer based applications, including but not limited to, the DNA phase same sex and similarity searching, protein phase
The same sex and similarity searching, transcription situation signature analysis, comparison and artificial hybridization analysis between genome.
Detailed description of the invention
It is hereafter detailed description of the present invention, is provided to that those skilled in the art is assisted to practice the present invention.Ability
Domain those of ordinary skill can without departing from present inventive concept or range in the case where improvement is made in embodiment as described herein
And variation.
Herein inventors have found that with the introduction of this field on the contrary, will be containing double stranded rna molecule (by no vertebra object
Kind one or more nucleotide sequences being expressed in the Sequence composition that finds) composition be fed to and therefrom obtain the core
Nucleotide sequence without vertebra species, result in the inhibition to one or more biological functions in no vertebra species.Particularly, it invents
People's discovery, is fed to corn rootworm for the double stranded rna molecule being made of corn rootworm RNA sequence respectively, and it is such to result in intake
The death of the corn rootworm of composition, or development and differentiation are suppressed.
Inventor is subject to the nucleotide sequence of the thousands of kinds of cDNA sequences obtained from every kind without vertebra pest
Identification.Be pushed off out by the encoded amino acid sequence of cDNA sequence, and with all known amino acid alignments.
The following albumen of coding are much expected to be in cDNA sequence, the albumen has some annotation informations being associated with.With
Specific nucleotide sequence and the relevant annotation information of its encoded protein sequence are based on:Pass through cDNA sequence as described herein
The publicly available database of the translation amino acid sequence being inferred to and this field in it is same between known amino acid sequence
Source property and similitude.For all known amino acid sequences, the amino acid sequence shown in this article being inferred to is carried out
BLAST is based on comparison result, assigns possible function to the amino acid sequence that every kind is inferred to.It encodes known in the art
Critically important albumen or protein part are (for example, be related to a variety of metabolism or catalysis biochemical route, cell division, numerous for existence
Grow, energetic supersession, digestion, nervous function etc. amino acid sequence) cDNA sequence be selected it is raw in no vertebra nocuousness to prepare
The double stranded rna molecule provided in the diet of object.As described herein, object noxious livings intake contains one or more dsRNA (its
At least one section of segment corresponds to the identical segment of at least one section of height of the RNA generated in object noxious livings cell) combination
Object leads to death, hypoevolutism or the other inhibition situations of object noxious livings.These results indicate that raw from no vertebra nocuousness
The nucleotide sequence that object obtains, DNA or RNA can be used for building recombination harmful organism host or pest infestation target
Homobium.Harmful organism host or homobium can be converted into containing from the nucleotide sequence that no vertebra harmful organism obtains
It is one or more.Nucleotide sequence coded one or more RNA of harmful organism host or homobium are transformed into, the RNA exists
DsRNA is formed in the intracorporal cell of host or symbiosis or biofluid being converted, so that:If/exist when harmful organism
It is fed on transformed host or homobium, dsRNA is can get in the diet of harmful organism, this will lead to harmful organism
The containment of one or more gene expressions in cell eventually leads to death, hypoevolutism or the other inhibition situations of harmful organism.
In general, the present invention relates to control the heredity in host organism without vertebra pest infestation.More specifically,
The present invention includes the method that pest control agent is transported to no vertebra harmful organism.Such pest control agent directly or
Cause indirectly harmful organism keep its own, growth or invasion target host or the ability of homobium it is impaired.The present invention provides
Using the method that is stabilized dsRNA in harmful organism diet, this means as target gene in containment harmful organism,
Thus to obtain in the host or homobium targeted to harmful organism or the desired control of the pest infestation of surrounding.Use weight
Group by stable dsRNA or siRNA molecule, genetically modified plants can be manufactured.
To complete foregoing teachings, the present invention provides a kind of methods, for inhibiting without vertebra harmful organism (particularly,
Western corn rootworm (WCR) or other coleopterous insect species) in target gene expression, cause feed, growth, development,
Breeding, the stopping propagated, may finally lead to the death of harmful organism.The method includes:Stable double-stranded RNA will be passed through
(dsRNA) nucleic acid molecule or its form (such as siRNA (siRNA) molecule) by modification partly or entirely introduce
In the alimentation composition relied on to harmful organism as food source, and the alimentation composition feeds harmful organism
For be obtainable.To the intake containing double-strand or the composition of siRNA molecule, cause pest cell to the molecule
Absorption, to inhibit the expression of at least one of pest cell target gene.It is raw to nocuousness to the inhibition of target gene
Object causes harmful influence.DsRNA molecule or siRNA are by SEQ ID NO:1 to SEQ ID NO:143 and SEQ ID NO:
169 to SEQ ID NO:Nucleotide sequence shown by any sequence is constituted in 174, inhibits to lead to the life for harmful organism
Critically important albumen or nucleotide agent are reduced or remove for long and development or other biological functions.The nucleosides of selection
Acid sequence is shown and SEQ IDNO in sequence table:1 to SEQ ID NO:143 and SEQ ID NO:169 to SEQ ID NO:174
Shown in one of nucleotide sequence or its complementary series about 80% at least about 100% sequence identity.Such suppression
System is specific, because the nucleotide sequence from target gene a part is selected from what inhibition dsRNA or siRNA transcription came
What sequence was selected.The method can be used for inhibiting in harmful organism very effective in the expression of at least one target gene of inhibition
Mostly other types of target gene.
The present invention also provides various forms of pest control agents, for obtaining subtracting for desired pest infestation
It is few.In one form, pest control agent includes dsRNA molecule.In another form, pest control agent includes
SiRNA molecule.In another form, pest control agent includes recombinant dna construct, and the construct can be used for stablizing
It is converted into biology and plant, transformed microorganism or plant is enabled to encode dsRNA or siRNA molecule.In another form
In, pest control agent is microorganism, wherein the recombinant dna construct containing coding dsRNA or siRNA molecule.
Nucleotide sequence pair by separation and purifying is provided from cDNA library and/or genomic library information.Nucleotide
Sequence is used as hot amplimer to being preferably to be obtained from any without vertebra harmful organism, of the invention to generate
DsRNA or siRNA molecule.
The present invention provides recombinant dna construct, for obtaining to the specific host of harmful organism targeting or homobium
Stable conversion.By conversion, harmful organism targeting host or homobium expression have effective desinsection it is horizontal, from recombination
The preferred dsRNA or siRNA molecule of DNA construct, and the molecule is provided in the diet of harmful organism.
As by the convert, host of harmful organism target organism or the example of homobium, the present invention also provides warps
Cross the plant cell of conversion and the plant by conversion and their offspring.What plant cell and process by conversion converted
Plant expresses one or more dsRNA or siRNA sequence of the invention, and the sequence comes from SEQ ID shown in sequence table
NO:1 to SEQ ID NO:143 and SEQ ID NO:169 to SEQ ID NO:One or more DNA sequence dnas shown in 174 or
Its complementary series.
Vocabulary " gene containment " used herein is at the same time in use, be used to refer to:For reducing the albumen water of generation
Flat any known method, albumen generate the result for being genetic transcription into mRNA and subsequent mRNA translation.Gene containment is also used
To refer to the reduction of the protein expression from gene or coded sequence, including posttranscriptional gene containment and transcription containment.Base after transcription
Because containment be from containment targeting gene or coded sequence transcription come mRNA all or part of with for the corresponding of containment
What the homology between double-stranded RNA mediated, refer to the obtainable quality entity for the mRNA in conjunction with ribosomes in cell
On or the reduction that can measure.RNA by transcription can be just direction, play so-called total containment effect, or
It can be antisense orientation, play so-called antisense containment effect, or generate dsRNA with two kinds of directions, it is dry to play so-called RNA
The effect of disturbing (RNAi).Transcription containment is that the presence of dsRNA in cell is mediated, and the dsRNA is gene containment agent, is shown
Out with the high sequence identities of promoter DNA sequence or its complementary series, plays and be referred to as that promoter is counter contains.Gene containment
Can play a role for natural plant gene relevant to character, for example, provided to plant have drop it is low-level, by natural
The albumen of gene coding, or with increasing or decreasing horizontal impacted metabolin.It is following right that gene containment can be also directed to
Target gene in the biology of plant pest plays a role, and the harmful organism can absorb or contact the plant containing gene containment agent
Object material, the gene containment agent, which is specifically designed, can inhibit or contain one or more homologous sequences in pest cell
Or the expression of complementary series.
It is disclosed in U.S. Patent number 5,107,065,5,759,829,5,283,184 and 5,231,020:Antisense or justice are fixed
To RNA carry out posttranscriptional gene containment, to regulate and control the gene expression in plant cell.DsRNA is for containing gene in plant
Purposes be disclosed WO 99/53050, WO 99/49029, U.S. Patent Application Publication No. 2003/0175965 and 2003/
0061626, in U.S. Patent Application No. 10/465,800 and U.S. Patent number 6,506,559 and 6,326,193.
In plant carry out posttranscriptional gene containment preferred method using justice orientation and antisense orientation, by stabilization
Transcription come RNA, for example, as hair fastener and loop-stem structure.Preferred DNA construct for carrying out posttranscriptional gene containment is
It is following such, wherein first segment fragment encoding shows the RNA of antisense orientation, shows and target gene to be contained
Perfect homology between segment, the first segment segment are connected with second segment segment, and second segment fragment encoding is shown and the
One section of segment has the RNA of height complementarity.Such construct is expected to will form loop-stem structure that (this is by first segment segment
Hybridize with second segment segment and to be formed) and from the nucleotide sequence for both connecting section segment ring structure (see WO94/01550,
WO98/05770, US 2002/0048814 and US 2003/0018993).
Term " nucleic acid " used herein refers to the DNA or ribonucleic acid base that from 5 ' to 3 ' ends are read
Single or double chain polymerization object.Optionally, " nucleic acid " allows also containing base that is non-naturally occurring or being changed by poly-
The correct reading of synthase, will not reduce the expression of the polypeptide of the nucleic acid encode.Term " nucleotide sequence " or " nucleic acid sequence " refer to
As the individually justice and antisense strand of single-stranded presence or the nucleic acid being present in two-body.Term " ribonucleic acid " (RNA) includes
RNAi (inhibitory RNA), dsRNA (double-stranded RNA), siRNA (siRNA), mRNA (mRNA), miRNA (Microrna),
TRNA (transfer RNA, quilt or charge is not added by corresponding acylated amino) and cRNA (complementary RNA), term " deoxidation core
Ribosomal ribonucleic acid " (DNA) includes cDNA and genomic DNA and DNA RNA hybrid.Vocabulary " nucleic acid fragment ", " nucleic acid sequence piece
It is disconnected " or more common " segment " will be understood by those skilled in the art for:It includes genome sequence, ribosomal RNA sequences, turns
Transport the nucleotide sequence of RNA sequence, mRNA sequence, operon sequence and smaller engineered mistake, sequence expression or
Expression protein, polypeptide or peptide can be transformed into.
Term " harmful organism " used herein refer to insect, spider, shellfish, fungi, bacterium, virus, nematode,
Flatworm, roundworm, pinworm, hookworm, tapeworm, trypanosoma, blood fluke, horse botfly, flea, tick, mite, lice etc., they are
Nature is generally existing, can take in or contact that one or more (being converted into can table by harmful organism host or homobium
Up to double-stranded gene containment agent, or be coated with the containment agent) generate cell, tissue or fluid, or can take in containing
The vegetable material of gene containment agent." Pest-resistant " used herein is genetically modified plants, transgenic animals, transgenosis
The feature of host or transgenosis homobium, so that the plant, animal, host or homobium have the attack of harmful organism
Resistance, the attack typically can be damaged or be lost to the plant, animal, host or homobium.Such harmful organism
Resistance is produced from the addition for assigning the recombinant DNA of Pest-resistant there may be from natural mutation, or more typically.
There is insect-resistant for render transgenic plant, recombinant DNA can be for example, coding insect lethal or insect inhibitory protein, example
Delta endotoxin such as from B.thuringiensis bacterium is (for example, can get in kind in the business of cotton and corn makes
), or it can be transcribed into RNA molecule, dsRNA molecule is formed in the tissue or fluid of recombinant plant.DsRNA molecule portion
Subpackage contains:To the identical RNA piece of corresponding RNA segment of DNA sequence encoding in the harmful insect that preference is fed on recombinant plant
It is disconnected.The expression of gene is contained by dsRNA in object noxious insect, leads to plant to the containment of gene expression in object noxious insect
With insect-resistant.Fire et al. (U.S. Patent number 6,506,599) generally describes the suppression to pest infestation
System, only for several nucleotide sequences in nematode kind Caenorhabditis elegans with suppressor function
Column provide details.Similarly, Plaetinck et al. (US 2003/0061626) describes dsRNA in a variety of lines
The purposes of worm harmful organism kind suppressor function.Mesaet al. (US 2003/0150017) is described:Use dsRNA sequence
Column remove conversion host cell, with expression and the identical corresponding dsRNA sequence of target sequence height in special pathogen, and especially
It describes:Recombinant plant is constructed, these dsRNA sequences (for by the biological uptake of a variety of pairs of plant pests) are expressed, is assisted
To the negative tune of gene in pest gene group, and plant is improved to the resistance of pest infestation.
The present invention provides the bases used by stable dsRNA to target genes one or more in object noxious livings
The method inhibited by expression.Present invention is particularly useful in eukaryotic gene expression is adjusted, especially present in adjusting insect
The expression of gene, the insect shows about 4.5 to about 9.5, more preferably about 5.0 to about 8.0, it is further more excellent
The digestive system pH of selection of land about 6.5 to about 7.5.Digestive system with the pH level except these ranges must have plant
Harmful biology is not the preferred candidate person of following methods, the method double chain RNA mediate, method for gene containment,
It is middle to use the Transfer method for needing to absorb preferred dsRNA molecule.Adjustment effect is suitable for a variety of bases for expressing harmful organism
Cause, for example, being responsible for the endogenous gene of endocellular metabolism or cellular transformation, including household's gene, transcription factor and Codocyte
The other genes for the polypeptide that intracellular metabolite is related to.
Term " expression " used herein refers to, the transcription of the justice or antisense RNA that obtain from nucleic acid disclosed by the invention
It is accumulated with stablizing.Expression also may indicate that translation of the mRNA to polypeptide or protein.Term " justice " RNA used herein refers to
Corresponding to following sequences or the rna transcription sheet of segment, when being generated by object noxious livings, the sequence or segment are can pass through
Object noxious livings cell translation exists at the form of the mRNA of protein.Term " antisense RNA " used herein refers to and mesh
All or part of complementary RNA of the mRNA normally generated in mark pest cell.The complementation of antisense RNA, which can be, to be directed to
Specific gene transcript it is any portion of, that is, 5 ' non-coding sequences, 3 ' non-translated sequences, introne or coded sequence.Herein
Used in term " rna transcription sheet " refer to, the obtained product of transcription by RNA polymerase catalysis that DNA sequence dna is carried out.When
When rna transcription is originally the perfect complementary copy of DNA sequence dna, being referred to as level-one transcript or its can be and transcribe to level-one
This carries out the RNA that transcription post-processing obtains, and is referred to as mature rna.
Phrase " inhibition to gene expression " used herein or " inhibit insect cell in target gene expression " refer to,
(or observable reduction) is not present in the albumen and/or mRNA product level of target gene.Specificity refers to:Inhibit target gene
And without effect and do not have influential ability to the intracellular any gene for generating dsRNA molecule to the other genes of cell.To having
The inhibition of the gene expression of target gene may cause the new phenotypic character in harmful insect in evil insect.
In the case where not limiting the scope of the invention, the present invention provides a method in one aspect, is used for:Use warp
Stable dsRNA strategy is crossed to control the invasion of object noxious livings.The method is related to:Manufacture is by stable dsRNA points
Son, the gene silencing as a kind of insect-controlling agent, in inducing harmful insect.Insect-controlling agent of the invention can be directly or indirectly
Ground induces the posttranscriptional gene silencing event of target gene in insect.The negative tune of target gene expression can be prevented or at least postponed
Growth, development, breeding and the propagation to host of insect.Phrase " stable dsRNA molecule is passed through in manufacture " used herein
Refer to:Using be easily obtained in this field recombinant DNA technology (for example, see Sambrook, et al, In:Molecular
Cloning, ALaboratory Manual, 2nd Edition, Cold Spring Harbor Press, ColdSpring
Harbor, New York, 1989), to construct transcription by the method for the DNA nucleotide sequence of stable dsRNA.Of the invention
Detailed construction method is disclosed in this specification hereinafter.Term " silencing " used herein refers to, to Target Nucleotide Sequence table
What is reached is effective " negative to adjust ", and therefore the sequence ability that generation acts in insect cell disappears.
A part of the invention provides a kind of movement system, and for insect-controlling agent to be transported in insect, this is logical
It crosses and they is exposed to the diet containing insect-controlling agent of the present invention to realize.According to one of embodiment, by stable
DsRNA or siRNA molecule can be included in insect diet, or can be placed to the top of the diet of insect consumption.
A part of the invention is additionally provided for insect-controlling agent to be transported in insect, this is to pass through:They are sudden and violent
Reveal to the microorganism containing insect-controlling agent of the present invention or host, for example, plant, by intake microorganism or host cell or carefully
It is intracellular tolerant to realize.According in another embodiment, the present invention relates to:Transgenic plant cells or plant are manufactured,
In containing the recombinant dna construct of the invention by stable dsRNA molecule can be transcribed.Phrase " manufacture used herein
Transgenic plant cells or plant " refers to following methods, including using the recombinant DNA technology being easily obtained in this field (for example, seeing
Sambrook, et al.), building can transcribe the plant conversion carrier of the invention by stable dsRNA molecule, convert plant
Cell or plant, and generate containing by transgenic plant cells or transgenosis transcribing, by stable dsRNA molecule
Plant.Particularly, method of the invention may include the recombinant precursor in plant cell, can generate in insect genes groups
The dsRNA transcript of nucleotide sequence coded RNA sequence very high homology.Insect genes groups inner nucleotide sequential coding is for elder brother
For the survival and propagation of worm in the case where critically important gene, insect existence and infection host will lead to its negative regulator
The ability of cell reduces.Therefore, such negative regulator results in the holding viability to insect and propagated adverse effect, because
It prevent or reduces insect by the ability of nutrients feed, life from host cell.Utilize above-mentioned insect survival
Property and propagated reduction, promote the resistance to insect infection and/or the tolerance of raising in plant cell.In insect
Gene can be targeted in the stage of mature (adult), prematurity (larva) or ovum.
In yet another embodiment, the weakening bacterial strain of the avirulence of microorganism is used as the load for insect-controlling agent
Body, in this case, the microorganism for carrying such reagent are also referred to as insect-controlling agent.It can be subject to engineering to microorganism to change
Make, it made to express the nucleotide sequence of target gene, to generate following RNA molecules, the RNA molecule include in insect cell
The RNA sequence complementation of typical case's discovery or homologous RNA sequence.Insect is exposed to the microorganism, so that microorganism is ingested,
And the negative tune to target gene expression directly or indirectly mediated by RNA molecule or segment or derivatives thereof.
Alternatively, the present invention provides:Insect is exposed to insect-controlling agent of the invention, the controlling agent is included in spray
In mist mixer, it is applied to host, for example, the surface of host plant.In a kind of illustrative embodiment, insect is to insect
Insect-controlling agent is transported to insect digestive tract by the intake of controlling agent, is then transported in the intracorporal cell of insect.In another kind
In embodiment, insect-controlling agent otherwise (such as injection or other physical methods) can also allow that the infection of insect
The transport of insect-controlling agent.In yet another embodiment, RNA molecule itself is encapsulated into the matrix of synthesis, such as polymer,
And it is applied to host, such as the surface of plant.Insect allows insect-controlling agent to be transported to insect the intake of host cell,
Lead to the negative tune to target gene in host.
It is also contemplated that composition of the invention can be included in the seed of plant species, it can be used as and be included in plant
The expression product of the recombination of object cellular genome, or it is included in the coating or seed being applied on seed before planting
In processing.Plant cell containing recombination is counted as transgenic event herein.
It is believed that insecticidal seed treatment can provide significantly when combining with the transgenic event for providing following protections
The advantages of, the invasion protected for keeping out no vertebra harmful organism, the event is for the preferred of object noxious livings
Within the scope of validity.In addition, there are following situations it is believed that well known to those skilled in the art, wherein have preferred
Validity within the scope of such transgenic event be advantageous.
The invention also includes the seed having more than a kind of transgenic event and plants.Such combination is referred to as " stacking "
Transgenic event.The transgenic event of the stacking can be for the event of same object noxious livings or they can
To be directed to different object noxious livings.In a preferred embodiment, there is expression Cry3 albumen or its insecticidal to become
The seed of allogeneic ability also has the ability for expressing at least one other insecticide comprising but be not limited to and Cry3 albumen
Different albumen and/or following RNA molecules, the sequence of the RNA molecule is from the sequence of the RNA expressed in object noxious livings
Column form duplex-RNA constructs when it is expressed in planting the plant cell that sub or slave seed is grown, wherein object noxious livings
Inhibition to rna expression in object noxious livings cell is resulted in the intake of one or more cells of plant.
In another preferred method, there is the seed for expressing following dsRNA abilities also to have offer herbicide tolerant
Property transgenic event, the sequence of the dsRNA comes from object noxious livings.Preferably, provide herbicide tolerant turns base
Because event is to provide to glyphosate, the resistance of N- (phosphine carboxymerhyl) glycine (the isopropyl amine salt form including such herbicide)
Event.
In the method for the invention, going processing with insecticide includes the seed of transgenic event.It is believed that transgenosis kind
Son (shows the bioactivity for object noxious livings, this is insecticidal amount, transgenic seed or comes from the seed growth
Plant cell in insecticidal dsRNA production result) with seed is carried out with certain chemical or protein insecticidal agents processing
In conjunction with, unexpected collaboration can be provided to the seed with such processing, including:For object noxious livings to obtaining
The damages of genetically modified plants protection, unexpected outstanding effect are provided.Particularly, it is believed that, extremely with about 100gm
Certain insecticides (for every 100kg seed) of about 400gm certain will form dsRNA molecule (its sequence be to that can express
What the one or more sequences expressed from corn rootworm obtained) the transgenic seed of construct handled, provide to
Keep off the unexpected outstanding protection of corn rootworm.In addition, it is believed that such combination is also for the damage for unregistered land tiger
The harmful corn plant to protect the state of emergency.Seed of the invention is also believed with the property for reducing insecticide use cost,
Because the case where compared with no composition for using invention and method, for the protection for obtaining requirement, less kill can be used
Worm agent.In addition, because used less insecticide, and because it is applied before the planting, without individual field
Using, it is believed that, method of the invention is therefore all safer for operator and environment, and potentially compared with biography
System method is more cheap.
When some effects are mentioned as " collaboration ", this expression includes:The combination pair of transgenic event and insecticide
In the combination acts synergistically of insecticidal activity (or efficiency).But this is not offered as such synergistic effect being limited to insecticidal activity,
They should include also following unexpected advantages, for example, increased field of activity, advantageous activity curve (are relevant to damage
The reduced type and quantity of evil), reduction, the distribution of insecticide environment of insecticide and application cost are reduced, insecticide is to production exercise
Make and the exposure of the personnel of maize planting seed reduces and further advantage well known by persons skilled in the art.
It can be used for the insecticide that combines with method and composition of the invention of the present invention and insecticide (including as seed
Processing and coating) and can be found in such as U.S. Patent number 6,551,962 using the method for such composition, full text is logical
It crosses and is incorporated herein by reference.
It has been found that the present invention has the agricultural pest for protecting seed and plant to keep out broad range, including elder brother
Worm, mite, fungi, yeast, mould, bacterium, nematode, weeds and plastics and saprophyte.
Preferably, seed treatment as described herein and coating are used together with transgenic seed of the invention, particularly, are removed
The SEQ ID NO shown in the sequence table is applied to transgenic seed:1 to SEQ ID NO:143 and SEQ ID NO:169 to
SEQ ID NO:Except the dsRNA molecule that sequence shown in 174 or its sequence obtain, also to transgenic seed application insecticide.
Although it is believed that seed treatment can be to the transgenic seed application for being in any physiological status, it is preferable that seed is in
(durable) state of enough lasting stabilities, will not incur damage during treatment process.Typically, seed is from field
It is harvesting, removed from genetically modified plants under and separate with any other non-seed vegetable material.Preferably, seed
It will also be biologically to be stabilized to following degree, so that processing not will lead to the biology damage to seed.In a kind of reality
It applies in mode, for example, processing may be used on following corn seeds, the seed has been harvested, has cleaned and has been dried to moisture content
Content is less than about 15% by weight.In another embodiment, seed can be following seeds:It is dried, then
It applies (prime) and has gone up water and/or other material, be dried again before then being handled again with insecticide or during processing.Rigid
In the limitation just described, it is believed that, in harvest seed and any event between seed can be sowed, processing is applied to seed
On.The term as used herein " seed that do not sowed " is for including:It is harvested in seed and in ground sowing seed (in order to plant
Object germination and growth purpose) between any period.
When mentioning the seed that do not sowed by insecticide " processing ", such processing is not used in including operations described below:
Wherein, insecticide is applied to soil, rather than is applied to seed.For example, while being sowed with seed, in soil band
(band), such processing is applied in " T " band or ditch dug with a plow, is not considered as included by the present invention.
The combination of insecticide or insecticide can " purely (neat) " application, that is, it is any dilution or there are other
Component.But typically, insecticide is applied on seed in the form of insecticidal formulation.The formula can be containing a kind of or more
The desired other components of kind comprising but be not limited to, liquid diluent, it is used as the adhesive of pesticide substrate, for coercing
The filler of seed is protected under the conditions of compeling and for improving coating elasticity, adhesion and/or the plasticizer of ductility.In addition, right
For containing little or no the oiliness insecticidal formulation of filler, it may be necessary to desiccant be added into formula, for example, carbon
Sour calcium, kaolin or bentonite, perlite, diatomite or any other adsorbent material.Use of these components in seed treatment
Way is known in the art.For example, seeing, U.S. Patent number 5,876,739.Those skilled in the art can be readily selected desired
Component, be used for insecticidal formulation, this is depended on processed kind of subtype and the specific insecticide selected.Furthermore, it is possible to
Using commercial formulations be easy to get, known insecticides, shown in embodiment as follows.
The component that insecticide of the invention can be used as seed coating is applied on seed.By the way that insecticide of the present invention is added
After one of combined embodiment is improved, seed coating method and composition known in the art can be used.For it
This kind of coating method and equipment of application are disclosed, for example, U.S. Patent number 5,918,413,5,891,246,5,554,
445, in 5,389,399,5,107,787,5,080,925,4,759,945 and 4,465,017.Seed coating composition is disclosed
In, such as U.S. Patent number 5,939,356,5,882,713,5,876,739,5,849,320,5,834,447,5,791,084,
5,661,103、5,622,003、5,580,544、5,328,942、5,300,127、4,735,015、4,634,587、4,383,
391, in 4,372,080,4,339,456,4,272,417 and 4,245,432 etc..
The insecticide used in the coating is those described herein insecticide.The desinsection used in the processing to seed
The amount of agent will depend on the type of kind of subtype and active constituent and change, but the processing will include, by seed with have
The insecticide composition of the amount of insecticidal action is in contact.When insect is object noxious livings, the amount will be with insecticidal
The amount of the insecticide of effect.Amount used herein with insecticidal effect indicates that the amount of insecticide will kill place
In the larva or the harmful organism in pupa stage of growth, or by it is lasting reduction or delay harmful insect generate damage amount.
In general, being changed in following ranges in processing to the amount of the insecticide of seed application:To every 100kg seed weight
Speech, the pesticide active ingredient of about 100gm to about 2000gm.Preferably, the amount of insecticide is in following ranges:To every
The active constituent of about 50gm to about 1000gm for 100kg seed;It is highly preferred that in following ranges:To every 100kg kind
The active constituent of about 100gm to about 600gm for son;Even more preferably, in following ranges:To every 100kg kind
The active constituent of about 200gm to about 500gm for son.Alternatively, it has been found that being more than big for every 100kg seed
The amount of the insecticide of the pesticide active ingredient of about 60gm is preferably, it is highly preferred that being more than about 80gm (every 100kg kind
Son).
Necessarily to inhibit germination for the insecticide in handling, but should can be in targeted insect life cycle
It can lead to the period to seed or plant injury, effective in protection seed and/or plant.In general, after planting, coating will be effectively big
About 0 to 120 day.
Insecticide of the invention can be applied on seed in the form of coating.The use of coating is negative with high insecticide
Lotus (can be needed to typically handle fire resisting harmful organism, for example, corn rootworm) when it is especially effective, while prevent by
The unacceptable toxicity to plant caused by increased pesticidal loads.
The coating formed with insecticide composition disclosed herein preferably can be by spreading or by matrix movement, by desinsection
Agent is discharged at a slow speed in medium around.
Except removing coating, also with one of following compositions or a variety of seed can be handled:Other insecticides, including kill true
Microbial inoculum and herbicide;Herbicide-safener;Fertilizer and/or biological control agent.These ingredients can be used as individual layer and be added, or
It can be added in insecticide coating.
Traditional coating technique and machinery can be used, insecticidal formulation is applied on seed, for example, fluidized bed technology,
Roller grinds method, roller electrostatic (rotostatic) seed processing machine and drum coater.Other methods, such as the bed with mouth can also
To use.Seed can be classified (presized) in advance before being applied.After coating, typically, seed can be dried,
It transfers them in grader and is classified.Such method is known in the art.
" insect-controlling agent " used herein or " gene containment agent " refers to specific RNA molecule, by passing through third section
The connected first segment RNA segment of RNA segment and second segment RNA segment are constituted.First segment and second segment RNA segment are in RNA points
Within the length of son, they are in height inverted repeat from each other, are connected together by third section RNA segment.First segment and
Complementarity between second segment RNA segment causes two sections of segments to hybridize the ability for forming duplex molecule in vivo or in vitro, that is, shape
At stem, wherein first segment is connected with every section in second segment segment one end by third section segment, ring is formed, so that total
Loop-stem structure is formed, or even more closely hybrid structure can form stem ring knotting (knotted) structure.Second segment and
Second segment segment indistinguishably, not respectively corresponds to the justice and antisense sequences of target RNA, and the RNA is object noxious
What the target gene transcription of insect came, the gene can be contained by the intake of dsRNA molecule.Insect-controlling agent can also be high
The nucleic acid molecules of degree purifying (or separation), more particularly, nucleic acid molecules from genomic DNA (gDNA) or cDNA library or its
Nucleic acid fragment molecule.Alternatively, the segment may include smaller oligonucleotides, there are about 15 to about 250 nucleosides
Sour residue, it is highly preferred that about 15 to about 30 nucleotide residues." insect-controlling agent " can also refer to DNA construct, described
Construct includes by the nucleic acid molecules or its nucleic acid fragment molecule of separation and purifying, and the molecule is from gDNA or cDNA text
Library." insect-controlling agent " can also refer to the microorganism comprising this DNA construct, the DNA construct include from gDNA or
CDNA library, by separating and the nucleic acid molecules purified or its nucleic acid fragment molecule.Phrase " manufacture insect used herein
Controlling agent " refers to following methods, wherein using be easily obtained in this field recombinant DNA technology (for example, see Sambrook, et
Al.), the recombinant dna construct for passing through stable dsRNA or siRNA molecule can be transcribed to prepare, can be transcribed with building by steady
The carrier of fixed dsRNA or siRNA molecule, and/or conversion or manufacture obtained containing transcription, by stable dsRNA or
The cell of siRNA molecule or microorganism.The inventive process provides the production to dsRNA transcript, nucleotide sequence with
Target RNA sequence very high homology, the target RNA sequence are that the Target Nucleotide Sequence in object noxious insect genes groups is compiled
Code.
Term " genome " used herein is when being used for insect or host cell, not only comprising discovery in core
Chromosomal DNA also includes the organelle DNA that finds in the subcellular components of cell.Therefore, DNA of the invention is introduced into
Process into plant cell can be carried out by chromosomal integration or by organelle positioning.Term " genome " application
It include the chromosome and plasmid in bacterial host cell when to bacterium.Therefore, DNA of the invention is introduced in bacterial host
Process in cell can be positioned by chromosomal integration or by plasmid device to carry out.
The inhibition of target gene expression can be quantified, this is produced by measurement endogenous targets RNA or target RNA translation
Come what is carried out, the consequence of inhibition can be verified raw albumen by the inspection to cell or biological extrinsic property.For to RNA
It is well known to those skilled in the art with the method for protein quantification.It assigns big to ampicillin, bleomycin, chloramphenicol, celebrating
Mycin, hygromycin, card receive mycin, lincomycinum, methotrexate (MTX), glufosinate, puromycin, miramycin, rifampin and tetracycline etc.
Resistance multiple choices label be obtainable.
In some preferred embodiments, gene expression is inhibited by least 10%, it is preferable that and at least 33%, it is more excellent
Selection of land, at least 50%, even more preferably, at least 80%.In particularly preferred embodiment of the invention, insect cell
Interior gene expression is inhibited by least 80%, it is highly preferred that at least 90%, it is highly preferred that at least 95%, or at least
99%, so that significant inhibit to occur.It is significant to inhibit to be used to refer to enough inhibition, lead to the phenotype that can be detected
RNA corresponding to (for example, larva growth stops, paralysis or death etc.) or repressed target gene and/or protein can
The reduction being detected.Although In some embodiments of the present invention, inhibiting to send out in the essentially all of cell of insect
It is raw, but in other preferred embodiments, inhibit only to occur in the cell subgroup for expressing the gene.For example, if will
Repressed gene plays a significant role in the cell in insect nutrition digestion road, is just enough to the inhibition of these genes within cells
Harmful effect is applied to insect.
Advantages of the present invention can include but is not limited to following:It is easy to dsRNA introducing insect cell, low concentration can be used
DsRNA or siRNA, the validity of the stability and inhibition of dsRNA or siRNA.Using low concentration, by stable
The ability of dsRNA avoids many disadvantages of antisense interference.The present invention is not to be limited to use in vitro, or be restricted to it is special
Sequence composition, specific target gene group, the specific part of target gene nucleotide sequence, or specific Transgenics or
Specific Transfer method, this is runed counter to some in obtainable method known in the art, for example, antisense and holding back altogether
System.In addition, genetic manipulation and the biology of non-classical genetic model in be also it is feasible.
In practicing the present invention, following main points are important:The nucleotide sequence come from recombinant precursor transcription
In the presence of harmless to the plant cell that wherein they can be expressed according to the present invention, and to the animal food chain especially mankind also without
Evil.Because the product of plant may be negative tune that is obtainable, expressing Target Nucleotide Sequence for human consumption
It betides in insect.
Therefore, in order to selectively it is desirable that obtaining the inhibition to target gene in the insect species controlled, it is preferable that
The sequence identity of corresponding gene should be minuent in target gene and plant or vertebrate.Preferably, sequence identity
Degree is less than about 80%.It is highly preferred that sequence identity degree is less than about 70%.Most preferably, sequence identity degree
Less than about 60%.
For one kind according to the present invention embodiment there is provided a kind of nucleotide sequence, vivoexpression can lead to following warps
The transcription of stable RNA sequence is crossed, the RNA molecule very high homology of target gene in the RNA sequence and insect, the RNA points
The encoded RNA sequence of attached bag nucleotide sequence containing insect genes groups.Therefore, it is absorbed in insect and passes through stable RNA sequence
After (be contained in diet or be sprayed on plant surface), realize to the corresponding nucleotides sequence of target gene in targeted insect cell
The negative tune of column.Holding to insect, survival, proliferation, breeding are led to by the negative nucleotide sequence adjusted in insect and propagated harmful
Effect.Therefore, nucleotide sequence of the invention can be used for adjusting or controlling the invasion of the insect within the scope of certain.
Another embodiment according to the present invention provides a kind of nucleotide sequence, the table in microbial cell
Up to the transcription for leading to following RNA sequences, the RNA molecule very high homology of target gene, the RNA in the RNA sequence and insect
Molecule includes the RNA sequence of insect genes groups nucleotide sequence coding.Therefore, the warp contained in insect intake microbial cell
It crosses after stable RNA sequence, the nucleotide sequence that will lead to target gene in insect cell is adjusted by negative.By negative tune in insect
Nucleotide sequence leads to holding, survival, proliferation, breeding and the harmful effect of propagation to insect.Therefore, nucleotide of the invention
Sequence can be used for adjusting or controlling the invasion of the insect within the scope of certain.
Another embodiment according to the present invention provides a kind of nucleotide sequence, the expression in plant cell
Lead to the transcription of following RNA sequences, the RNA molecule very high homology of target gene in the RNA sequence and insect, the RNA points
The RNA sequence of attached bag nucleotide sequence containing insect genes groups coding.Therefore, the process contained in insect intake plant cell is steady
After fixed RNA sequence, the nucleotide sequence that will lead to target gene in insect cell is adjusted by negative.By the negative nucleosides adjusted in insect
Acid sequence leads to holding, survival, proliferation, breeding and the harmful effect of propagation to insect.Therefore, nucleotide sequence of the invention
It can be used for adjusting or controlling the invasion of the insect within the scope of certain.
Term " very high homology " used herein or " high homology " are indicated when mentioning with acid sequence tight
Under the conditions of careful with SEQ ID NO shown in sequence table:1 to SEQID NO:Any sequence or SEQ ID NO in 143:169
To SEQ ID NO:The nucleotide sequence that coded sequence shown in any sequence in 174 or its complementary series can hybridize.Tight
Under the conditions of careful with SEQ ID NO shown in sequence table:1 to SEQ ID NO:Any sequence or SEQ ID NO in 143:169
To SEQ ID NO:The sequence that any sequence or its complementary series in 174 can hybridize is that anti-put down occurs between allowing two sequences
The sequence that row compares, then two sequences can form hydrogen bond under high stringency conditions with the correspondence base on opposite strand, to form two
Body molecule, under high stringency conditions be it is sufficiently stable, can be detected using approach well known.Preferably, such height
SEQ ID NO shown in homologous sequence and sequence table:1 to SEQ ID NO:Any sequence or SEQ ID NO in 143:
169 to SEQ ID NO:Shown in any sequence in 174 control nucleotide sequence or its complementary series have about 65% to
About 70% sequence identity, perhaps it is highly preferred that the sequence identity of about 80% to about 85% or most preferably
Ground, the sequence identity of about 90% to about 95%, until about 99% sequence identity.
Term " sequence identity " used herein, " sequence similar figures " or " homology " be used to describe two or more
Relationship between nucleotide sequence.The percentage of " sequence identity " is measured by following methods between two sequences
's:Compare two sequences for being optimised alignment in comparison window, wherein (do not include addition compared with control sequence or lack),
A part of sequence may include addition or missing (that is, notch) in comparison window, for optimizing alignment two sequences.Under
Method is stated to calculate percentage:It measures in two sequences there are identical nucleic acid base or the quantity of the position of amino acid residue, with
The quantity for generating matching position removes the total number of positions in comparison window with the quantity of matching position, by result multiplied by 100 to generate
The percentage of sequence identity.And the identical sequence in each position is considered identical as control sequence when compared with control sequence,
Vice versa.If first nucleotide sequence shows the complete complementarity with Article 2 or control sequence, with 5 ' to 3 ' sides
When always observing, first nucleotide sequence is considered as the Article 2 or control nucleotide sequence with 3 ' to 5 ' directions to observe
Complementary series or be complementary.Herein, with each nucleotide in a sequence of 5 ' to 3 ' directions reading and with 3 '
When each nucleotide for the other sequences read to 5 ' directions is complementary, we say that nucleic acid molecule is shown " completely
It is complementary ".The reverse complemental sequence that the nucleotide sequence complementary with control nucleotide sequence will show with compare nucleotide sequence
Arrange identical sequence.These terms and description have good detailed description in the art, are that those of ordinary skill in the art are easy
In understanding.
" comparison window " used herein refers to, the conceptual segment of at least six continuous position, generally about 50 to about 100,
More commonly, about 100 to about 150 continuous positions, wherein two sequences are optimised after alignment, by a sequence
Compared with the control sequence with same number continuous position.Compared with control sequence (not including addition or missing), comparison window can
To be aligned two sequences for optimizing comprising about 20% or less addition or missing (that is, notch).Those skilled in the art
Member will refer to Wisconsin Genetics SoftwarePackage Release 7.0, Genetics Computer
Group, 575Science DriveMadison, Wis., USA) in for sequence alignment method detailed or refer to Ausubel
Being discussed in detail about sequence analysis in et al. (1998).
Target gene of the invention is obtained from insect cell or it is foreign gene, for example, coming from virus, fungi, elder brother
The foreign genetic sequence of worm or nematode etc.." acquisition " refers to that sequence is the naturally occurring of the target gene from insect cell gene group
Nucleotide sequence all or part;If fruit gene is structural gene, particularly, being coupled with cap, montage one
Grade gather polyadenylation mRNA naturally occurring nucleotide sequence a part, the mRNA be found in cell it is naturally occurring
DNA sequence dna expression;Or simultaneously all or part of sequence of the RNA of nonstructural gene comprising but it is not limited to tRNA, catalysis
RNA, rRNA, Microrna etc..If the sequence obtained is that the nucleotide sequence based on natural RNA manufactures, show
With the sequence identity of about 80% to about 100% of native sequences, and can under stringent hybridisation conditions with native sequences
Hybridization, then sequence is exactly to obtain from the RNA sequence of these naturally occurring.In one embodiment, target gene includes
SEQ IDNO shown in sequence table:1 to SEQ ID NO:Any sequence or SEQ ID NO in 143:169 to SEQ IDNO:
Nucleotide sequence shown in any sequence in 174 or its complementary series.Depending on specific target gene and dsRNA molecule
Dosage is transported, this method can make the function of target gene completely or partially lose, or what is fallen between any think
The containment wanted is horizontal.
It the present invention also provides artificial DNA sequence, can be expressed in cell or microorganism, also, it can inhibit insect
The expression of target gene in cell, tissue or organ, wherein artificial DNA sequence, which includes at least, encodes one or more different IPs
The dsDNA molecule of nucleotide sequence, wherein each in different nucleotide sequences all includes the just core that intervening sequence is connected
Nucleotide sequence and antisense base sequences, the intervening sequence encode dsRNA molecule of the invention.Intervening sequence constitutes justice
The part of nucleotide sequence and antisense base sequences will be formed in the dsRNA intramolecular between justice and antisense sequences.Just
Nucleotide sequence of sense nucleotide sequence and antisense base sequences and target gene or derivatives thereof or its complementary series height
It is identical.DsDNA molecule is operationally placed under the control of promoter sequence, the promoter sequence host cell,
It plays a role in tissue or organ, expresses dsDNA, generate dsRNA molecule.In one embodiment, artificial DNA sequence can be from
SEQ IDNO shown in sequence table:1 to SEQ ID NO:143 or SEQ ID NO:169 to SEQ ID NO:Shown in 174
Nucleotide sequence obtains.
The present invention also provides artificial DNA sequences, for expressing in plant cell, also, as DNA is expressed as RNA
And absorbed by object noxious livings, the containment to the expression of target gene in insect pest cell, tissue or organ can be obtained.
DsRNA includes at least one or more structural gene sequences, wherein every kind of structural gene sequence all includes that intervening sequence is connected
Positive sense nucleotide sequence and antisense base sequences, the interval sequence forms ring in complementary and antisense sequences.Just nucleosides
Acid sequence and antisense base sequences and nucleotide sequence of target gene or derivatives thereof or its complementary series height are identical.One
Kind or various structures gene order are operationally placed under the control of one or more promoter sequences, wherein at least one
It is operable in the cell, tissue or organ of protokaryon or eucaryote, especially insect.In one embodiment,
Artificial DNA sequence includes about SEQ ID NO shown in sequence table:1 to SEQ ID NO:143 or about SEQ ID NO:
169 to SEQ ID NO:174 sequence.
Term used herein, for transcribing the " non-naturally occurring of dsRNA or siRNA or its segment of the invention
Gene ", " non-naturally occurring coded sequence ", " artificial sequence " or " composite coding sequence " refer to, to be related to any kind of something lost
Those of the means preparation of separation and manipulation is passed, the means, which can be prepared, transcribes dsRNA or siRNA or its segment of the invention
Coded sequence.This includes separating coded sequence from its naturally occurring state, is manipulated to coded sequence, this is to pass through
(1) nucleotides inserted, missing or substitution, (2) segment insertion, deletion or substitution, (3) chemical synthesis, such as deoxyribonucleoside phosphorous
Amide chemical method etc., mutation site-specific, to the truncation of coded sequence or any other manipulation or separation method.
This respect according to the present invention can be cloned for the non-naturally occurring gene order of WCR control or its segment
To between Liang Zhong operable in transgenic plant cells tissue-specific promoter, such as two kinds of root-specific promoters,
The gene order or its segment can be expressed here, and mRNA is generated in transgenic plant cells, to form dsRNA points
Son.The dsRNA molecule contained in plant tissue is absorbed by insect, is inhibited to obtain to the expectation that target gene is expressed.
The present invention also provides a kind of methods, for obtaining the nucleic acid comprising following nucleotide sequence, the nucleotides sequence
Column can produce dsRNA or siRNA of the invention.In a preferred embodiment, the side for being used to obtain nucleic acid of the invention
Method includes:(a) the detection library cDNA or gDNA is gone to hybridization probe, the probe includes the nucleotide sequence from targeted insect
Or all or part of its homologue;(b) DNA clone that can hybridize with hybridization probe is identified;(c) it isolates in step (b)
The DNA clone of identification;And (d) cDNA the or gDNA segment for being included in separation clone in step (c) is sequenced,
In, the nucleic acid molecules being sequenced can transcribe RNA nucleotide sequence or the whole or the overwhelming majority of its homologue.
In another preferred embodiment, of the invention (wherein includes for producing this for obtaining nucleic acid fragment
Invention dsRNA or siRNA the overwhelming majority nucleotide sequences) method include the following steps:(a) first and second is synthesized
Oligonucleolide primers, they are corresponding with the part of one of nucleotide sequence from targeted insect;And (b) use step
(a) first and Article 2 Oligonucleolide primers expand cDNA present in cloning vector or gDNA insertion, wherein amplification
Obtained nucleic acid molecules can transcribe the overwhelming majority of the overwhelming majority of dsRNA or siRNA of the present invention.
In practicing the present invention, target gene can be obtained from corn rootworm (CRW), such as WCR or SCR, Huo Zhecong
Can cause crop plants be compromised and any insect species of the subsequent underproduction obtain.It is presently believed that several standard can
It is used to select preferred target gene.The gene is such gene:Its protein product has quick circulating rate, makes
DsRNA is obtained to inhibit to can lead to the quick reduction of protein level.In some embodiments, expression is selected to drop on a small quantity
The gene to the illeffects of insect is caused to be advantageous.If it is desired to targeting broad spectrum insect species, then to select in these objects
The highly conserved gene of inter-species.On the contrary, In some embodiments of the present invention, selection is containing each in order to bring specificity
The gene in the low region of conservative between kind of insect species or between insect and other biologies.In some embodiments, it selects
The gene for not having the known homologue of other biologies is that people want.
Term used herein " from ... obtain " refer to, it can be obtained from specific special source or species special
Nucleotide sequence, although need not be directly from the special source or species.
In one embodiment, the gene expressed in insect digestive tract is selected.Target the base expressed in alimentary canal
The needs of dsRNA are spread inside insect because avoiding.May include for target gene of the invention, for example, with coding matter
Those of the nucleotide sequence very high homology of known alimentary canal expressing gene of the sub- V-ATPase protein component of film quality (Dow et
Al., 1997, J.Exp.Biol., 200:237-245;Dow, Bioenerg.Biomemb., 1999,31:75-83).The albumen
Complex is the sole energy supplier of epithelial cell example transhipment, the alkalization for middle enteral chamber.V-ATPase is also in geneva
(Malpighian) expressed in pipe, the Malpighian tube is that insect hindgut grows body (outgrowth), with mammal kidney
The similar mode of organ plays a role in fluid balance and removing toxic substances to xenobiontics.
In another embodiment, gene critically important involved in insect growth, development and breeding is selected.It is exemplary
Gene include but is not limited to CHD3 gene and 'beta '-tubulin gene.CHD3 base in Drosophila melanogaster
There is the albumen of ATP dependent form DNA helicase activities, the Chromatin assembly/de-assembly being related in core because encoding.Similar sequence
Column it has also been found that in it is a variety of biology in, such as Arabidopsis thaliana, Caenorhabditis elegans and
Saccharomyces cerevisiae.Beta- microtubule protein gene family encodes is to microcosmic relevant albumen, the albumen
The composition part of cytoskeleton.Correlated series it has also been found that in it is a variety of biology in, such as Caenorhabditis elegans and
Manduca Sexta。
May include for other target genes of the invention, for example, playing the part of in survival, growth, development, breeding and propagation
Drill those of key player.These target genes can be one of the following:Household's gene, transcription factor and insect specificity gene
Or lethal knockout mutations in Drosophila.The target gene being used in the present invention can also be that from other biologies
A bit, for example, coming from nematode (such as C.elegans).In addition, may also come from following plants for nucleotide sequence of the invention
The function of object, virus, bacterium or fungal gene, the gene has been established in document, nucleotide sequence and insect genes
Target gene shares the similitude of height in group.A method according to the present present invention, for WCR control, target sequence can be with base
This is obtained from target WCR insect.Coding and the D.v.virgifera albumen of known albumen homology or its segment, come from WCR
Some exemplary goal sequences of cDNA library can be found from sequence table.
The nucleic acid molecules of albumen homology object known to coding from D.virgifeta are known (Andersen et
Al., US Patent Application Serial No.10/205,189).
Although sequence Primary Reference WCR described in Andersen et al., in the practice of the invention, it is preferable to use tool
There is the DNA segment of following sequences, the sequence is corresponding with gene or coded sequence in object noxious livings to be controlled is needed
Sequence has at least about 80% phase same sex, perhaps at least about 90% phase same sex perhaps at least 95% phase same sex or at least
The 98% phase same sex, or at least about 100% phase same sex.Sequence with the phase same sex of target sequence less than about 80% does not have more
With.Inhibit the one or more genes for being specific to harmful organism, the sequence of the gene corresponds to dsRNA.Independent basis because expression
It is unaffected.This species specificity allows to be subject to selectively targeting to pest, thus to the present composition is exposed to
Other biologies do not influence.
It is at least about 19 to about 23 nucleotide for DNA segment length of the invention, or about 23 to about
100 nucleotide, but it is less than about 2000 nucleotide.
The present invention is not limited to specific genes as described herein, further include following any genes, the inhibition to the gene
Illeffects can be applied to harmful insect.
For many in the insect for the potential target being then controlled through the invention, about most of genes
The information of sequence and the phenotype obtained from the mutation to specific gene may be limited.Therefore, the present inventor proposes, from nocuousness
Insect selects suitable gene for process of the invention, can by using can to model organism (such as
Drosophila), some other insect species, or even nematode species, fungal species, plant species are (in these species
Corresponding gene has been analyzed) in the information that obtains of research of corresponding gene carry out.In some cases, it would be possible to by using
It comes from, such as the sequence of Drosophila, insect in addition, nematode, fungi or plant (wherein the gene is therefrom cloned)
Or gene name, garbled data library, such as GenBank obtain the sequence of targeted insect corresponding gene.Once sequence is obtained, it can
The gene segment in the insect suitably selected is expanded to use PCR, for the present invention.
In order to obtain the DNA segment of the corresponding gene in insect species, based on its therefrom cloned in WCR or gene
The sequence that finds in its insect designs PCR primer.Primer is designed to:The DNA segment of sufficient length can be expanded, this hair is used for
It is bright.DNA (genomic DNA or cDNA) is prepared from insect species, with PCR primer come DNA amplification segment.Amplification condition is selected
For:Even if amplification can also be carried out in the case where primer accurately cannot match target sequence.Alternatively, WCR base can be used
Because or other known insect genes be used as probe, from preparing from the gDNA or cDNA library of harmful insect species, clone base
Because of (or part of it).Technology for implementing PCR and cloning from library is known.Based in the past from WCR or other elder brothers
The gene order cloned in worm species struggles the further details of the method for DNA segment from object noxious insect, is implementing
It is provided in example.It will be appreciated by those of ordinary skill in the art that a variety of different technologies can be used for from harmful insect species
Isolate gene segment corresponding with the gene separated in the past from other species kinds.
Classified based on feeding methods, may cause the damaged insect of plant and generally fall into three categories, these three types are respectively
Belong to Coleoptem, Lepidoptera, Diptera, Orthoptem, Heteroptera, Ctenophalides,
Chewing type, suctorial type and the hole drilling type insect of Arachnidiae and Hymenoptera mesh.Chewing type insect eats the tissue of plant,
Such as root, leaf, flower, bud and spray, lead to big damage.Example from this big caste includes beetle and its larva.
WCR and SCR belongs to chewing type insect.Their larva feeds on the root of plant, particularly, on the root of corn plant, at
Worm mainly feeds blade.The gene of any species can be used to open as target from WCR or SCR or in above-mentioned mesh
The exhibition present invention.
It has been found that the present invention can be used for protecting seed and plant to keep out extensive agricultural pest, including insect,
Mite, fungi, yeast, mould, bacterium, nematode, weeds and parasitism and saprophyte etc..
When insect is object noxious livings of the invention, such harmful organism includes but is not limited to come from
Lepidoptera purpose, for example,
Acleris spp.、Adoxophyes spp.、Aegeria spp.、Agrotis spp.、
Alabamaargillaceae、Amylois spp.、Anticarsia gemmatalis、Archips spp、
Argyrotaenia spp.、Autographa spp.、Busseola fiisca、Cadra cautella、Carposina
nipponensis、Chilo spp.、Choristoneura spp.、Clysiaambiguella、Cnaphalocrocis
spp.、Cnephasia spp.、Cochylis spp.、Coleophora spp.、Crocidolomia binotalis、
Cryptophlebia leucotreta、Cydiaspp.、Diatraea spp.、Diparopsis castanea、Earias
spp.、Ephestia spp.、Eucosma spp.、Eupoecilia ambiguella、Euproctis spp.、Euxoa
spp.、Grapholita spp.、Hedya nubiferana、Heliothis spp.、Hellula undalis、
Hyplumtria cunea、Keiferia lycopersicella、Leucoptera scitella、Lithocollethis
spp.、Lobesia botrana、Lymantria spp.、Lyonetia spp.、Malacosoma spp.、Mamestra
brassicae、Manduca sexta、Operophteraspp.、Ostrinia Nubilalis、Pammene spp.、
Pandemis spp.、Panolisflammea、Pectinophora gossypiella、Phthorimnaea
operculella、Pierisrapae、Pieris spp.、Plutella xylostella、Prays spp.、
Scirpophaga spp.、Sesamia spp.、Sparganothis spp.、Spodoptera spp.、Synanthedon
Spp., Thaumetopoea spp., Tortrix spp., Trichoplusia ni and Yponomeuta spp.;
From Coleoptera purpose, for example,
Agriotes spp.、Anthonomus spp.、Atomaria linearis、Chaetocnematibialis、
Cosmopolites spp.、Curculio spp.、Dermestes spp.、Diabroticaspp.、Epilachna spp.、
Eremnus spp.、Leptinotarsa decemlineata、Lissorhoptrus spp.、Melolontha spp.、
Orycaephilus spp.、Otiorhynchusspp.、Phlyctinus spp.、Popillia spp.、Psylliodes
spp.、Rhizopertha spp.、Scarabeidae 、Sitophilus spp.、Sitotroga spp.、Tenebrio
Spp., Tribolium spp. and Trogoderma spp.;
From Orthoptera purpose, for example,
Blatta spp.、Blattella spp.、Gryllotalpa spp.、Leucophaea maderae、
Locusta spp., Periplaneta ssp. and Schistocerca spp.;
From Isoptera purpose, for example,
Reticulitemes ssp;
From Psocoptera purpose, for example,
Liposcelis spp.;
From Anoplura purpose, for example,
Haematopinus spp., Linognathus spp., Pediculus spp., Pemphigus spp. and
Phylloxera spp.;
From Mallophaga purpose, for example,
Damalinea spp. and Trichodectes spp.;
From Thysanoptera purpose, for example,
Franklinella spp.、Hercinothrips spp.、Taeniothrips spp.、Thripspalmi、
Thrips tabaci and Scirtothrips aurantii;
From Heteroptera purpose, for example,
Cimex spp.、Distantiella theobroma、Dysdercus spp.、Euchistus spp.、
Eurygaster spp.、Leptocorisa spp.、Nezara spp.、Piesma spp.、Rhodniusspp.、
Sahlbergella singularis, Scotinophara spp., Triatoma spp., Miridae family spp. (such as
Lygus hesperus and Lygus lineoloris), Lygaeidae family spp. (such as Blissus leucopterus)
With Pentatomidae family spp.;
From Homoptera purpose, such as
Aleurothrixus floccosus、Aleyrodes brassicae、Aonidiella spp.、
Aphididae、Aphis spp.、Aspidiotus spp.、Bemisia tabaci、Ceroplaster spp.、
Chrysomphalus aonidium、Chrysomphalus dictyospermi、Coccushesperidum、Empoasca
spp.、Eriosoma larigerum、Erythroneura spp.、Gascardia spp.、Laodelphax spp.、
Lacanium corrii、Lepidosaphes spp.、Macrosiphus spp.、Myzus spp.、Nehotettix
spp.、Nilaparvata spp.、Paratoriaspp.、Pemphigus spp.、Planococcus spp.、
Pseudaulacaspis spp.、Pseudococcus spp.、Psylla ssp.、Pulvinaria aethiopica、
Quadraspidiotusspp.、Rhopalosiphum spp.、Saissetia spp.、Scaphoideus spp.、
Schizaphisspp., Sitobion spp., Trialeurodes vaporariorum, Trioza erytreae and
Unaspiscitri;
From Hymenoptera purpose, for example,
Acromynnex、Atta spp.、Cephus spp.、Diprion spp.、Diprionidae、Gilpinia
polytoma、Hoplocampa spp.、Lasius sppp.、Monomoriumpharaonis、Neodiprion spp、
Solenopsis spp. and Vespa ssp.;
From Diptera purpose, for example,
Aedes spp.、Antherigona soccata、Bibio hortulanus、
Calliphoraerythrocephala、Ceratitis spp.、Chrysomyia spp.、Culex spp.、
Cuterebraspp.、Dacus spp.、Drosophila melanogaster、Fannia spp.、Gastrophilus
spp.、Glossina spp.、Hypoderma spp.、Hyppobosca spp.、Liriomysa spp.、Lucilia
spp.、Melanagromyza spp.、Musca ssp.、Oestrus spp.、Orseoliaspp.、Oscinella frit、
Pegomyia hyoscyami、Phorbia spp.、Rhagoletispomonella、Sciara spp.、Stomoxys
Spp., Tabanus spp., Tannia spp. and Tipula spp.;
From Siphonaptera purpose, for example,
Ceratophyllus spp. and Xenopsylla cheopis, and
From Thysanura purpose, for example,
Lepisma saccharina。
It has been found that when harmful insect is Diabrotica spp., particularly, when harmful organism is Diabrotica
Virgifera virgifera (Western corn rootworm, WCR), Diabroticabarberi (Northern corn rootworm,
NCR), (Brazil is beautiful by Diabrotica virgifera zeae (Mexican Corn Rootworm, MCR), Diabrotica balteata
Rice rootworm, BZR) or Brazilian Com Rootworm complex (BCR, by Diabrotica viridula and Diabrotica
Speciosa composition) or Diabrotica undecimpunctata howardii (Southern corn rootworm, SCR) when
It waits, the present invention is particularly useful.
The present invention also especially can pierce through plant cell and tissue and the therefrom insect species of sucking fluid effective in controlling,
Including but not limited to, the fleahopper (plant bug) in smelly stinkbug (species of Pentatomidae family) and Miridae family, example
Such as western fleahopper (western tarnishedplant bug, Lygus hesperus species), fleahopper (tarnished
Plant bug, Lyguslineolaris species) and white peas or beans fleahopper (pale legume bug, Lygus elisus).
Improvement to method disclosed herein is unexpectedly particularly useful in the crop harmful organism of control Lepidoptera.
The present invention provides stable dsRNA or siRNA molecule is passed through, for controlling insect infestations.DsRNA or siRNA
Molecule includes the aggregated ribonucleotide of double-strand, may include the modification to phosphate sugar backbone or nucleosides.In RNA structure
Modification can be coupled with tail, to allow specific genetic to inhibit.
In one embodiment, dsRNA molecule can be modified by enzyme method, can produce siRNA molecule.
SiRNA can effectively mediate negative tune to act on for some target genes in some insects.This enzyme method can be by eukaryon
It is completed in RNAi approach using RNAse III enzyme present in insect, vertebrate, fungi or plant cell or DICER enzyme
(Elbashir et al., 2002, Methods, 26 (2):199-213;Hamilton and Baulcombe, 1999,
Science 286:950-952).This method is also using the recombination being introduced into targeted insect cell by recombinant DNA technology
DICER or RNAse III is carried out, this is that those skilled in the art are easy to know.It is naturally present in insect or passes through
Biggish dsRNA chain can be cut into lesser oligonucleotides by the DICER enzyme and RNAse III of recombinant DNA technology manufacture.
DsRNA molecule specifically can be cut into siRNA segment by DICER enzyme, wherein each siRNA segment is about 19-25 core
Thuja acid is long, and dsRNA molecule is usually cut into the siRNA of 12-15 base-pair by RNAse III enzyme.Pass through above-mentioned any enzyme
The siRNA molecule of generation has 3 ' suspensions and the 5 ' phosphoric acid and 3 ' C-terminals of 2 to 3 nucleotide.It is produced by RNAse III enzyme
Raw siRNA, by the identical of Dicer manufacture, therefore, then can be targeted, and after loose in eucaryotic RNA i approach
It is degraded by inherent intracellular rna degradation mechanism, is separated into single stranded RNA, and hybridize with the RNA sequence of target gene transcription.
This method be can the RNA sequence nucleotide sequence coded to target gene in insect effectively degraded or removed.As a result
It is exactly the silencing of the nucleotide sequence especially targeted in insect.To the datail description of enzyme method can Hannon (2002,
Nature, 418:It is found in 244-251).
To inhibit through stabilizing dsrna technology target gene be sequence-specific using of the invention, because, with RNA bis-
The corresponding nucleotide sequence of body region is targeted for heredity inhibition.Contain a part of identical nucleotides sequence with target gene
The RNA of column is optimized for inhibiting.There is relative target sequence the RNA sequence of insertion, missing and simple point mutation to be also found to have
Inhibiting effect.In aspect of performance of the invention, it is preferable that a part of inhibition dsRNA and target gene is shared at least about
80% sequence identity, the perhaps sequence identity higher than about 90% or the sequence identity higher than about 95%, or
Person is higher than about 99% sequence identity, or even about 100% sequence identity.Alternatively, two body regions of RNA can
Functionally it is defined as:The nucleotide sequence that can hybridize with a part of target gene transcript.It shows higher homologous
Property the sequence less than overall length can be equivalent to (compensate) it is longer but only have less homology sequence.Identical nucleotides sequence
The length of column can be at least about 25,50,100,200,300,400,500 or at least about 1000 bases.In general, answering
When the sequence for using more than 20-1100 nucleotide, although being more than the sequence of about 200-300 nucleotide is preferably, to surpass
Cross about 500-1000 nucleotide sequence be it is especially preferred, this depend on target gene size.The present invention has such as
Lower advantage:It can endure sequence variant, and the variant may be since genetic mutation, strain polymorphism or evolutionary divergence are made
At.Level-one transcription product relative to target gene or the mRNA by processing completely, the nucleic acid molecules of introducing may be not required to
Will absolutely it is homologous, it may not be necessary to overall length therefore, those skilled in the art it will be appreciated that as disclosed herein, RNA and
100% sequence identity between target gene is for practicing for the present invention not necessarily.
DsRNA molecule can be by synthesizing in vivo or in vitro.DsRNA can be formed by the RNA chain of single self-complementary, or
Person can be formed by two complementary RNA chains.The Endogenous RNA polymerase of cell can be with mediate transcription in vivo, or the RNA of clone
Polymer can be used for transcribing in vivo or in vitro.It can be by following methods come targeted inhibition:In organ, tissue or cell type
In specific transcriptional;The stimulation (for example, infection, stress, temperature, chemical inducer) of environmental condition;And/or in the stage of development
Or the engineering transcription that the age carries out.RNA chain may or may not be gather it is polyadenylation;RNA chain can or cannot be by cell
Translating equipment is translated as polypeptide.
RNA, dsRNA, siRNA or miRNA of the invention by those skilled in the art by chemical method or enzyme method come
Production, this is carried out through manual or automatic reaction or in another organism.It can also be by having partially or completely
Machine synthesizes to manufacture RNA;Any ribonucleotide by modification can be introduced by external enzymatic synthesis or organic synthesis.It can lead to
Intracellular RNA polymerase or phage rna polymerase (for example, T3, T7, SP6) are crossed to synthesize RNA.The use of expression construct
With manufacture be it is known in the art (see, for example, WO97/32016, U.S. Patent number 5,593,874,5,698,425,5,712,
135,5,789,214 and 5,804,693).If, can be right before introducing cell by chemical synthesis or by external enzymatic synthesis
RNA is purified.For example, can be pure from mixture by with solvent or resin extraction, precipitating, electrophoresis, chromatography or combinations thereof
Dissolve RNA.Alternatively, RNA can be used, under the case where not purifying or only carrying out minimal purifying to avoid due to sample
Loss caused by product processing.RNA can be dried to store, or be dissolved in aqueous solution.Solution can contain buffer and salt,
To promote the stabilization and/or annealing of two-body chain.
To be transcribed in vivo from Transgenics or expression construct, it can be used regulatory region (for example, promoter, increasing
Hadron, silencer and gather polyadenylation) transcribe (or a plurality of) RNA chain.Therefore, in one embodiment, for manufacturing
The nucleotide sequence of RNA molecule can start with having functional one or more in microorganism, fungi or plant host cell
Subsequence is operably associated.It is desirable that nucleotide sequence is placed under the control of endogenesis promoter, the endogenous starting
Son is generally in host genome.Nucleotide sequence of the present invention under the promoter sequence control being operably connected,
Flank can also have additional sequence, and the additional sequence can advantageously influence the steady of the transcript that it is transcribed and/or obtains
It is qualitative.The downstream that such sequence is usually located at the upstream for the promoter being operably connected and/or expression construct 3 ' is held, can
To exist simultaneously in the downstream of promoter upstream and the end of expression construct 3 ', although having sequence on only such is also to be included
's.
In another embodiment, nucleotide sequence of the invention may include separated by " intervening sequence " it is reversed
It repeats.Intervening sequence can be the region comprising following any nucleotide sequences, if necessary, the nucleotide sequence energy
Secondary structure between every section of repetition is promoted to be formed.In one embodiment of the invention, intervening sequence be for mRNA just
A part of justice or antisense coded sequence.Alternatively, intervening sequence may include can with nucleic acid molecules be covalently attached nucleotide or
Any combination of its homologue.Intervening sequence may include the nucleotide sequence that length is at least about 10-100 nucleotide, or
Person's length is at least about 100-200 nucleotide, and length is that at least about 200-400 nucleotide or length is at least
About 400-500 nucleotide.
For purposes of the invention, dsRNA or siRNA molecule can be obtained from CRW, this is by from corn rootworm
The target CRW gene order or part thereof that gDNA or cDNA library obtain carries out polymerase chain (PCR) amplification to realize.It can
To prepare WCR larva with method known to persons of ordinary skill in the art, DNA/RNA can be extracted.It can will be different size of
Larva for purposes of the present invention from the 1st age to the CRW being fully grown-up to carries out DNA/RNA extraction.Genomic DNA or cDNA text
Library can be used for PCR amplification, to produce dsRNA or siRNA.
Then the method being easy to get in this field can be used, PCR amplification and sequencing are carried out to target gene.This field skill
Art personnel can change PCR condition, be formed with the PCR product for ensuring optimal.PCR product by verifying be used as
Template is used for vivo transcription, to generate the justice and antisense RNA with the minimum limit promoter being included.
Of the invention turns over famous person's proposition, can from any insect species identification in Bugdom and the nucleic acid sequence being purified into
For the present invention, to control WCR and other targeted insects.It in one aspect of the invention, can be from the object from coleoptera species
Kind is to obtain nucleic acid.Particularly, Diabrotica can be subordinated to and belong to the chrysomelid worm of (coleoptera, Chrysomelidae) to obtain nucleic acid, more
Particularly, nucleic acid of the invention can be obtained from virgifera group.Most particularly, nucleic acid of the invention can be from Diabrotica
Virgifera virgifera LeConte is obtained, and is commonly known as WCR.It can be used for by isolated nucleic acid, such as identify
Target gene, and the following recombinant vectors of building, the carrier can produce of the invention by stable dsRNA or siRNA, use
WCR insect infestations are kept out in protection plant.
Therefore, in one embodiment, the present invention includes the nucleosides by separation and purifying from WCR or Lygus
Acid sequence is used as insect-controlling agent.It include the SEQ listed in sequence table by the nucleotide sequence for separating and purifying
ID NO:1 to SEQ ID NO:143 or SEQ ID NO:169 to SEQ ID NO:Sequence shown in 174.
From WCR or other insects, nucleic acid for use in the present invention also may include by separation and highly purified
Unigenes and EST nucleic acid molecules or its nucleic acid fragment molecule.EST nucleic acid molecules can encode the marking area of polypeptide, or
In fact, the major part of polypeptide.Alternatively, the segment may include smaller oligonucleotides, the oligonucleotides has about
15 to about 250 nucleotide residues, it is highly preferred that about 15 to about 30 nucleotide residues.Alternatively, for of the invention
Nucleic acid molecules can come from the cDNA library of the no vertebra pest of WCR, lygus or any other.
Phrase " highly purified nucleic acid " used herein, " artificial sequence ", " by separation and highly purified core
Acid " refers to following nucleic acid " by separation and highly purified nucleotide sequence ", and it is adjoint to be no longer accompanied by its native state
Substance in some or its structure it is any all different from naturally occurring nucleic acid.The example of highly purified nucleic acid
Including:(1) DNA, the partial sequence with naturally occurring genomic DNA molecule, but its flank be not in the DNA molecular day
So two coded sequences existing for the molecular moiety flank in existing biological genome;(2) carrier or protokaryon are included in
Or the nucleic acid in eukaryotic gene group DNA, the means included are so that obtained molecule and any naturally occurring load
Body or genomic DNA are all different;(3) independent molecule, for example, cDNA, genomic fragment, pass through polymerase chain reaction (PCR)
The segment or restriction fragment of generation;(4) recombinant DNA;And (5) synthetic DNA.Highly purified nucleic acid can also be by one or more
CDNA, genomic DNA or synthetic DNA composition.
Nucleic acid molecules and its segment from the no vertebra pest of WCR, Lygus or other can be used for being come
From other nucleic acid molecules of other species, dsRNA and siRNA molecule for being wanted in the present invention with generation.Such nucleic acid point
Attached bag includes following nucleic acid molecules, the complete coded sequence of the nucleic acid molecule encoding protein and the promoter of such molecule
And flanking sequence.In addition, such nucleic acid molecules include:The nucleic acid molecules of encoding gene family member.Use above-mentioned nucleic acid molecules
Or its segment goes to screen from D.v.virgifera or the library cDNA or gDNA obtained from Lygus hesperus, can be easy
Such molecule must be obtained.Method for such library to be made is well known in the art.
Nucleic acid molecules from WCR or Lygus and its segment can be used for obtaining other nucleic acid molecules, such as nucleic acid is homologous
Object, dsRNA and siRNA molecule for being wanted in the present invention with generation.Such homologue includes:Wholly or partially encode
The nucleic acid molecules of the protein homology object of other species, plant or other biologies.It goes to sieve using above-mentioned nucleic acid molecules or its segment
The library EST, cDNA or gDNA is selected, such molecule can be readily available.Method for such library to be made is this field public affairs
Know.The nucleotide sequence of such homologue molecule can be with SEQ ID NO shown in sequence table disclosed herein:1 to SEQ
ID NO:143 or SEQ IDNO:169 to SEQ ID NO:One of 174 or a variety of sequences in the nucleotide sequence that finds or
Its complementary series is different, because not needing complete complementary for hybridization for stablizing.These nucleic acid molecules further include, though
So with nucleic acid molecules specific hybrid but it can may lack the molecule of complete complementarity.In a kind of specific implementation, use
It can be used for obtaining such sequence (Frohman, M.A.et at, Proc.Natl.Acad.ScL in the method for 3 ' or 5 ' RACE
(U.S.A.)85:8998-9002(1988);Ohara, O.et at, Proc.Natl.Acad.ScL (U.S.A.) 86:5613-
5611(1989)).In general, any type in above-mentioned nucleic acid molecules or segment all can be used for generating following dsRNA or
SiRNA, the RNA are suitable for the invention diet, spraying mixture or recombinant dna construct.
Phrase " coded sequence ", " structural nucleotide sequence " or " structural nucleic acid molecule " used herein refers to, is placed in
When under suitable regulating and controlling sequence control, it can be translated into the nucleotide sequence of polypeptide, usually this is carried out by mRNA.Coding
The boundary of sequence is determined by the translation initiation codon of 5 ' ends and the translation termination codon of 3 ' ends.Coded sequence
It can include but is not limited to, genomic DNA, cDNA, EST and recombinant nucleotide sequence.
Term " recombinant DNA " or " recombinant nucleotide sequence " refer to that the DNA containing genetic engineering modification, the modification is logical
The manipulation of mutagenesis, restriction enzyme etc. is crossed to carry out.
The segment of above-mentioned nucleic acid molecules or nucleic acid molecules or other nucleic acid molecules from WCR can be special under certain conditions
Property with other making nucleic acid molecular hybridizations.Herein, if two molecules can form antiparallel double-strandednucleic acid structure, two are just said
Nucleic acid molecules can mutual specific hybrid.If two nucleic acid molecules show complete complementarity, we just say nucleic acid point
Son is the complementary series of another nucleic acid molecules.If two molecules can be with foot under the conditions of at least traditional " low rigor "
Enough stability hybridizes mutually, them is allowed to remain the state annealed mutually, we just say that this two molecules are " minimum limits
Complementary ".Similarly, if under the conditions of at least traditional " high rigor ", two molecules can be mutual with enough stability
Hybridization, allows them to remain the state annealed mutually, we just say that this two molecules are complementary.Traditional high stringency conditions exist
Sambrook, et al. and Haymes, et al.In:Nucleic Acid Hybridization, A Practical
It is described in Approach, IRL Press, Washington, DC (1985).
Therefore, have with complete complementary away from being allowed, as long as this away from the energy that molecule will not be made to form duplex structure
Power completely disappears.Therefore, the segment to make nucleic acid molecules or nucleic acid molecules is used as primer or probe, it is only necessary to sequence
It is complementary enough, stable duplex structure can be formed under specific solvent and salinity used.
Can promote the suitable high stringency conditions of DNA hybridization is, for example, being carried out at 6.0x sodium chloride/lemon at about 45 DEG C
It in sour sodium (SSC), then goes to wash with 2.0xSSC at 50 DEG C, this is known to the skilled in the art, or can be in Current
Protocols in MolecularBiology, John Wiley&Sons, N.Y. (1989) are found in 6.3.1-6.3.6.Example
Such as, the salinity in cleaning step can be selected from:Low rigor is 50 DEG C lower, about 2.0xSSC, and supreme rigor is 50 DEG C lower, about
0.2xSSc.In addition, the temperature in cleaning step can increase under supreme rigor from (about 22 DEG C) of room temperature under low rigor
About 65 DEG C.Temperature and salt can all change, alternatively, temperature or salinity can be kept constant, other variables change.
For nucleic acid of the invention can with from WCR one or more nucleic acid molecules or its complementary series medium tight
Specific hybrid under the conditions of careful, for example, at about 2.0xSSC and about 65 DEG C.To include for nucleic acid of the invention:In Gao Yan
Under the conditions of careful degree, the SEQ ID NO that can be represented with sequence:1 to SEQ ID NO:143 or SEQ ID NO:169 to SEQID
NO:Those of one of nucleic acid molecules or its complementary series disclosed in 174 or a variety of specific hybrids nucleic acid molecules.It is preferred that
Ground will show the SEQ ID NO represented with sequence for nucleic acid molecules of the invention:1 to SEQ ID NO:143 or SEQ
ID NO:169 to SEQ ID NO:Shown in 174 or one or more nucleic acid molecules as disclosed herein have at least
About 80%, perhaps at least about 90% perhaps at least about 95% perhaps at least about 98% or even about 100%
Sequence identity;It is isolated alternatively, will be shown for nucleic acid sequence of the invention with the genomic DNA from harmful insect
, the SEQ ID NO that such as sequence represents:1 to SEQ ID NO:143 or SEQ ID NO:169 to SEQ IDNO:Show in 174
One or more nucleic acid molecules out have at least about 80%, perhaps at least about 90% perhaps at least about 95% or
At least about 98%, or even about 100% sequence identity.
The whole of nucleic acid from WCR or the overwhelming majority can be used for separating coding from same species or other species
CDNA, gDNA and nucleic acid of Diabrotica albumen homology object or its segment.About from the library cDNA and gDNA separate and identify
The detailed description of the technology of nucleic acid of the invention, is disclosed in embodiment.
Nucleic acid of the invention can also be to be synthesized completely or partially by methods known in the art, especially when needing
When the sequence of favorite plant is provided.Therefore all or part of nucleic acid of the present invention can be using the close of the host's preference selected
Numeral synthesizes.The codon of species preference can be by, for example, using in the albumen expressed from specific host species
Most frequent codon determines.It can cause mutant that there is the activity slightly changed other modifications of nucleotide sequence.
A part of the present invention provides a kind of delivery system, is used for insect transporting insects controlling agent.Process of the invention
Stable dsRNA or siRNA molecule can be introduced directly into the cell of insect, or be introduced into extracellular chamber, void space, leaching
Bar system, digestive system, are introduced into the circulatory system of insect, this is can use by orally ingestible or those skilled in the art
Other means carry out.For including by the oral method introduced:By the direct mixture of the food of RNA and insect, with
And following engineering methods, wherein be used as food species have passed through it is engineered, be able to expression dsRNA or siRNA, so
It is fed to be influenced insect afterwards.In one embodiment, for example, dsRNA or siRNA can by microbial expression,
And root, stem can be introduced by microbe application to plant surface or by physical means, such as injection.In another embodiment
In, can to plant carry out it is genetically engineered, make its expression be enough to kill the insect for having notified infection plant amount dsRNA or
siRNA。
Particularly, when practicing the present invention in WCR, it is intracorporal insect will can be introduced by stable dsRNA or siRNA
Middle intestines obtain preferably to the inhibition of target gene.As described above, dsRNA or siRNA molecule can be included in diet or cover
It is placed on diet, can be absorbed by insect.Under any circumstance, dsRNA of the invention is provided in the meals of object noxious livings
In food.Object noxious livings of the invention will show about 4.5 to about 9.5 or about 5 to about 8.5 or about 6 to
About 8 or about 6.5 to about 7.7 or about 7.0 pH in digestive tract.The alimentary canal of object noxious livings is determined herein
Justice is following positions in harmful organism, and in the position, the food that harmful organism is absorbed is exposed to this hair of energy favorable for absorption
The environment of bright dsRNA molecule is extremely arrived without meeting with so that Hydrogen bond cleavage between dsRNA double-strand is to form single-stranded point
The pH of son.
In addition, the dsRNA of insect control is transported by spraying application for the purpose of insect infestations in control plant
It is sent to plant surface and provides the means of another protection plant.In this case, by engineered to generate and accumulate
The bacterium of dsRNA can be fermented, and fermented product is formulated that compatible spray product can be applied with common agricultural.It is described with can
To include:Suitable sicker and wetting agent needed for high-efficiency blade covering, and the UV for protecting dsRNA to damage from UV
Protective agent.Such additives be it is common in bioinsecticidal agent industry, be also well known to those skilled in the art.Similarly,
Formula for soil application may include following granular recipes, be used as soil harmful insect (for example, corn rootworm) children
The bait of worm.
It is also foreseeable that can be formulated with the consistent mode of conventional agricultural practices by chemistry or enzymatic synthesis production
DsRNA is used as spray product, to control insect infestations.The formula may include:Conjunction needed for high-efficiency blade covering
Suitable sicker and wetting agent, and the UV protective agent for protecting dsRNA to damage from UV.Such additives are that biology kills elder brother
It is common in worm agent industry, also it is well known to those skilled in the art.Such application can (be or not with other spraying insecticides
It is based on biology) application combination, to improve the protection to plant in terms of keeping out insect feeding damage.
The present inventor proposes that the bacterium bacterial strain for producing insecticidal protein can be used for production and control mesh for insect
DsRNA.These bacterial strains show the insect domination property of raising.A variety of different bacterial hosts can be used for producing insect
Control dsRNA.Illustrative bacterium may include E.coli, B.thuringiensis, Pseudomonas sp.,
Photorhabdus sp., Xenorhabdus sp., Serratia entomophila and relevant Serratia sp.,
B.sphaericus, B.cereus, B.laterosponis, B.popilliae, Clostridiumbifermentans and its
Its Clostridium species or other gram-positive bacteriums for forming spore.
The invention further relates to the recombinant dna construct for expressing in microorganism.Methods known in the art can be used,
The exogenous nucleic acid that target RNA can therefrom be transcribed out is introduced into microbial host cell, for example, bacterial cell or fungal cell.
Nucleotide sequence of the invention can be introduced in the protokaryon and eucaryon host of wide scope, be generated by stable
DsRNA or siRNA molecule.Term " microorganism " includes protokaryon and eukaryotic microorganisms species, such as bacterium and fungi.Fungi includes
Yeast and there is fungi etc..Illustrative prokaryotes, existing Gram-negative also have it is gram-positive, including
Enterobacteriaceae, such as Escherichia, Erwinia, Shigella, Salmonella and Proteus;
Bacillaceae;Rhizobiceae, such as Rhizobium;Spirillaceae, for example, photobacteria, Zymomonas,
Serratia,Aeromonas,Vibrio,Desulfovibrio,Spirillu m;Lactobacillaceae;
Pseudomonadaceae, such as Pseudomonas and Acetobacter;Azotobacteraceae,
Actinomycetales and Nitrobacteraceae.Eucaryote includes fungi, for example, Phycomycetes and
Ascomycetes comprising yeast, for example, Saccharomyces and Schizosaccharomyces;And
Basidiomycetes yeast, for example, Rhodotorula, Aureobasidium, Sporobolomyces etc..
For the purpose for insect protection plant, it is known that inhabit the blade face (leaves of plants of a variety of different important crops
Son surface) and/or a large amount of microorganisms of rhizosphere (soil of surrounding plant roots) be also possible to for disclosed herein heavy
Group construct is manipulated, is bred the desired host cell of propagation, storage, transport and/or mutagenesis.These microorganisms include thin
Bacterium, algae and fungi.What it is with special interest is microorganism, for example, bacterium, example belongs to described as follows:Bacillus (including it is following
Kind and subspecies:B.thuringiensis kurstaki HD-I,B.thuringiensiskurstaki HD-73,
B.thuringiensis sotto、B.thuringiensis berliner、B.thuringiensis thuringiensis、
B.thuringiensis tolworthi、B.thuringiensisdendrolimus、B.thuringiensis alesti、
B.thuringiensis galleriae、B.thuringiensis aizawai、B.thuringiensis subtoxicus、
B.thuringiensisentomocidus, B.thuringiensis tenebrionis and B.thuringiensis
sandiego);Pseudomonas, Erwinia, Serratia, Klebsiella, Zanthomonas, Streptomyces,
Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacterium, Acetobacter,
Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc and Alcaligenes;Fungi, especially ferment
Mother, for example, following categories:Saccharomyces, Cryptococcus, Kluyveromyces, Sporobolomyces,
Rhodotorula and Aureobasidium.What it is with special interest is the bacterial species of such surrounding plants, such as
Pseudomonas syringae, Pseudomonas, fluorescens, Serratiamarcescens, Acetobacter
Xylinum, Agrobacterium tumefaciens, Rhodobacter sphaeroides, Xanthomonas
Campestris, Rhizobium melioti, Alcaligenes eutrophus and Azotobacter vinlandii;With
And the yeast species of surrounding plants, for example, Rhodotorula rubra, R.glutinis, R.marina, R.aurantiaca,
Cryptococcus albidus, C.diffluens, C.laurentii, Saccharomyces rosei,
S.pretoriensis, S.cerevisiae, Sporobolomyces roseus, S.odorus, Kluyveromyces
Veronae and Aureobasidium pollulans.
Bacterium recombinant DNA carrier can be linear or closed cyclic plasmid.Carrier system can be single carrier or
Plasmid or two or more carriers or plasmid, they contain the total DNA that will be introduced in bacterial host gene group together.This
Outside, bacteria carrier can be expression vector.SEQ ID NO shown in sequence table:1 to SEQ ID NO:143 or SEQ ID
NO:169 to SEQ ID NO:174 or its segment shown in nucleic acid molecules can be with for example, being adapted for insertion into carrier, the load
Body is under the control of suitable promoter, and the promoter plays a role in one or more microbial hosts, with driving
The expression of the coded sequence or other DNA sequence dnas that are connected.For this purpose, many carriers be all it is obtainable, to suitable carrier
The selection particular host cell that will primarily depend upon the size for the nucleic acid that band is inserted into carrier and will be converted with carrier.Often
Kind carrier all contains various ingredients, and the specific host that this depends on its function (DNA amplification or expression DNA) and is compatible with is thin
Born of the same parents.Carrier component for bacterium conversion typically includes, but not limited to one of following components or a variety of:Signal sequence, duplication
Starting point, one or more selectable marker genes and the inducible promoter for allowing exogenous DNA to express.
Expression and cloning vector usually contain selection gene, are also referred to as selected marker.The gene is encoded in selectivity
Albumen necessary to the survival of inverted host cell or growth that are grown on culture medium.Typical selection gene encodes following eggs
It is white, the albumen energy:(a) it assigns to antibiotic or other toxin, for example, ampicillin, neomycin, methotrexate (MTX) or Fourth Ring
The resistance of element, (b) supplies auxotrophy, or (c) provides the critical nutrients that can not be obtained from complex medium, for example, right
For Bacilli, the gene of encoding D-alanine racemase.These can be produced by the cell of heterologous protein or its segment successful conversion
The raw albumen assigned to drug resistance, thus, it is possible to survive in selection is handled.
Expression vector for producing mRNA can also be containing following inducible promoters, and the promoter can be by host bacteria
Bio-identification, and being operably connected with following nucleic acid, the nucleic acid for example, encoding D .v.virgifera mRNA or its can draw
Play the nucleic acid of the segment of interest.Inducible promoter suitable for bacterial host includes beta-lactam enzyme promoters, E.coli λ
Bacteriophage PL and PR promoter and E.coli galactose promoter, Arabinose promoter, alkaline phosphatase promoter, color
Propylhomoserin (trp) promoter and lactose operon promoter and its variant and hybrid promoters, for example, tac promoter.But
Other known bacteria-inducible promoter is also suitable.
When mentioning regulating and controlling sequence and structural nucleotide sequence, term " being operably connected " refers to that regulating and controlling sequence leads to phase
The expression of structural nucleotide sequence even is adjusted." regulating and controlling sequence " or " control element " refers to positioned at structural nucleotide sequence upstream
(5 ' non-coding sequence), intermediate or downstream (3 ' non-translated sequence) nucleotide sequence, can influence dependency structure nucleotide
The opportunity and level of transcription, the RNA processing or stability or translation of sequence or quantity.Regulating and controlling sequence may include promoter, turn over
It translates boot sequence, introne, enhancer, loop-stem structure, the sub- binding sequence of containment and gathers polyadenylation identification sequence etc..
Alternatively, expression vector can be integrated into bacterial genomes with integration vector.Typically integration vector contains and allows
The homologous at least one sequence of the bacterial chromosome of vector integration.Integration looks like homologous in carrier DNA and bacterial chromosome
Caused by recombination between DNA.For example, can be integrated into the integration vector of the DNA building from a variety of Bacillus bacterial strains
Bacillus chromosome (EP 0,127,328).Integration vector also may include bacteriophage or transposon sequence.Suicide type carries
Body is also known in the art.
To containing one or more elements listed above suitable carrier building using the recombinant DNA technology of standard come
It carries out.To being cut by isolated plasmid or DNA fragmentation, in addition tail, and it is connected as generating required plasmid again desired
Form.The example of obtainable bacterial expression vector includes but is not limited to multi-functional E.coli clone and expression vector, example
Such as, Bluescript (Stratagene, La Jolla, CA), wherein for example, D.v.virgifera albumen or its segment energy quilt
It connects into carrier, the connection is to meet the reading frame for beta galactosidase amino terminal Met and subsequent seven residues
Mode carry out, thus generate hybrid protein;PIN carrier (Van Heeke and Schuster, 1989,
J.Biol.Chem.264:5503-5509) etc..
Typically, yeast recombinant precursor includes one of following components or a variety of:Promoter sequence, fusion partner sequence
Column, boot sequence, translation termination sequence, selected marker.These elements can be combined into expression cassette, and expression cassette can be held in multiple
In system, such as extra-chromosomal element (for example, plasmid), it can stablize and be held in host (such as yeast or bacterium).Duplication
Son can have two sets of dubbing systems, thus it be allowed to be held in, for example, for expressing in yeast, in prokaryotes host
For cloning and expanding.The example of such yeast-bacteria shuttle carrier include YEp24 (Botstein et al., 1979,
Gene, 8:17-24), pCl/1 (Brakeet al., 1984, Proc.Natl.Acad.Sci USA, 81:4642-4646) and
YRpl7 (Stinchcomb et al., 1982, J.MoI.Biol., 158:157).In addition, replicon can be high or low copy
Several plasmids.High copy number plasmid will be usually with the copy number in about 5 to about 200 ranges, typically, and about 10 to big
About 150.Host containing high copy number plasmid will preferably have at least about 10, more preferably at least about 20 copies.
Useful yeast initiating sequence the gene of enzyme can be obtained from encoding metabolic pathway.The example of this genoid includes alcohol
Dehydrogenase (ADH) (EP 0 284044), enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate dehydrogenation
Enzyme (GAP or GAPDH), hexokinase, phosphofructokinase, 3-phosphoglycerate mutase and pyruvate kinase (PyK)
(EP0 3215447).The yeast PHO5 gene of encoding acid phosphatase also provides useful promoter sequence (Myanohara
Et al., Proc.Natl.Acad.Sci.USA, 80:1,1983).In addition, the synthetic promoter being naturally not present also can be used as
Yeast promoter plays a role.The example of such hybrid promoters includes the ADH regulating and controlling sequence being connected with GAP transcriptional activation region
(U.S. Patent number 4,876,197 and 4,880,734).Other examples of hybrid promoters include, by ADH2, GAL4, GAL10 or
PHO5 gene regulatory sequence group closes the promoter (EP of the transcriptional activation region composition of carbohydrate-splitting enzyme gene (such as GAP or PyK)
0 164556).In addition, Yeast promoter may include:With in conjunction with yeast RNA polymerase and originate transcription ability,
The naturally occurring promoter in non-yeast source.
The example of transcription terminator and other termination sequences (for example, those of coding carbohydrate-splitting enzyme) that can be identified by yeast
Son is known to the skilled in the art.
Alternatively, expression construct can be integrated into Yeast genome with integration vector.Typically, integration vector contains and permits
Perhaps the homologous at least one sequence of the yeast chromosomal of vector integration, and it is homologous in two kinds of table construct to preferably comprise flank
Sequence.Integrate caused by the recombination looked like in carrier and yeast chromosomal between homologous dna (Orr-Weaver et al.,
1983, Methods in Enzymol., 101:228-245).Integration vector can be for the particular locus in yeast, this is
It include being realized into carrier by selecting suitable homologous sequence.See above the Orr-Weaver et al..It is a kind of or
A variety of expression constructs can be integrated, possibly, influence the recombinant protein generated level (Rine et al., 1983,
Proc.Natl.Acad.Sci.USA, 80:6750).The chromosome sequence for including in carrier can be used as single segment and be present in
In carrier, this will lead to entire carrier integration or its can be used as two segments and exist, two segments and chromosome
In adjacent segment it is homologous, expression construct of the flank in carrier will lead to the stable integration of only expression construct.
It is further proposed that nucleotide sequence of the invention is transformed into plant, enable one or more dsRNA molecules
With the expression of harmful organism suppression level.Using method obtained by this field, conversion carrier can be easily prepared.Conversion carrier
Comprising one or more following nucleotide sequences, the sequence can be transcribed into RNA molecule, and encoded with insect genes groups
One or more nucleotide sequence very high homologies and/or complementation, so that:Insect absorbs from one or more nucleotide sequence molecules
When the RNA that transcription comes, negative tune can be subject to the expression of at least one of nucleotide sequence each in insect genes groups.
Conversion carrier can also indicate dsDNA construct, in addition to this, can also be taken as recombinant molecule, insect-controlling agent,
Genetic molecule or chimeric (chimeric) genetic constructs.Chimeric genetic construct of the invention may include, for example, encoding one kind
Or a variety of antisense transcript sheets, one or more sense transcript sheets, above-mentioned every kind of one or more nucleotide sequences, wherein
The all or part of all or part and following RNA molecules from its transcript is homologous, and the RNA molecule includes insect base
Because of a group RNA sequence for nucleotide sequence coding.
In one embodiment, plant conversion carrier is the DNA molecular by separating and purifying, wherein including and this hair
The operably associated starting word of bright one or more nucleotide sequences.Nucleotide sequence is selected from as shown in sequence table
SEQ ID NO:1 to SEQ ID NO:143 or SEQ ID NO:169 to SEQ ID NO:174 groups constituted.Nucleotide sequence
Including following segments, all or part of RNA present in encoding target harmful organism rna transcription sheet also has comprising target
The evil all or part of inverted repeat of biology RNA.DNA molecular comprising expression vector can also contain functional intron sequences
(its upstream for being positioned at coded sequence or even among coded sequence), the molecule can also skim that (5 ') are non-to be turned over containing five
Boot sequence (that is, UTR or 5 '-UTR) is translated, is positioned between promoter and translation initiation site.
Plant conversion carrier can contain the sequence from more than one gene, and more than one dsRNA is thus allowed to produce
It is raw, for inhibiting the expression of two or more genes in object noxious livings cell.It should be readily apparent to one skilled in the art that having
The DNA segment of sequence corresponding to sequence present in different genes is combined into single compound DNA segment, for turning base
Because being expressed in plant.Alternatively, can be modified the plasmid of the present invention for having contained at least one DNA segment, this is by by volume
Outer DNA segment, which is sequentially inserted between enhancer and promoter and terminator sequence, to carry out.It is being designed to inhibit a variety of
In the insect-controlling agent of the present invention of gene, gene to be suppressed can be obtained from same insect species, to enhance insect-controlling agent
Efficiency.In some embodiments, gene can be obtained from different insects, to widen effective insect range of reagent.When being directed to
It, can be according to Fillatti, number of patent application US 2004- when containing or targeting several genes for the combination of expression and containment
0029283 illustrates and disclosed, to manufacture polycistron DNA element.
In the case where going conversion plant with nucleotide sequence of the invention, selection shows the following startings of following ability
Son, the promoter can drive the expression of coded sequence in the specific plant species.There is function in different plant species
The promoter of energy is well known in the art.Can be used for expressing the example of the promoter of polypeptide in plant is Odell et al.
(1985, Nature313:Induction type, virus, synthesis or constitutive promoter described in 810-812), and/or by from the time
Regulation, the spatially promoter of regulation and spatiotemporal database.Preferred promoter include enhancing CaMV35S promoter and
FMV35S promoter.For purposes of the invention, for example, preferably existing for the optimum control for the species fed in root
The highest level expression of these genes is obtained in plant root.A large amount of root enhancing promoter, which has been accredited, to be come out, they are
(Lu et al., 2000, J.Plant Phys., 156 (2) known in the art:277-283;U.S. Patent number 5,837,848
With 6,489,542).Typically, recombinant DNA carrier of the invention or construct will include selected marker, can be in plant cell
Upper imparting selects phenotype.Selected marker can also be used to selecting the plant containing the exogenous nucleic acid for encoding polypeptide or albumen of the present invention or
Plant cell.Label can encode biocide resistance, antibiotic resistance (for example, card receive mycin, G418 bleomycin, tide it is mould
Element etc.) or Herbicid resistant (for example, glyphosate etc.).The example of selected marker includes but is not limited to, and coding card receives chloramphenicol resistance
Neo gene, can be selected for mycin, G418 etc. is received using card;Encode the bar gene of bialaphos-resistant;Mutant
Epsp synthase gene, coding glyphosate resistance;Nitrilase gene assigns the resistance to Brominal;Mutant acetyl cream
Synthase genes (ALS) assign the resistance to imidazolone or sulfonylurea;And the DHFR gene of anti-methopterin.
Recombinant vector or construct of the invention may also include selection markers.Selection markers can be used for monitoring expression.Show
The selection markers of example property include beta-glucuronidase or uidA gene (GUS), and coding is known, and there are many enzymes of chromophoric substrate
(Jefferson, 1987, Plant Mol.Biol, Rep.5:387-405;Jefferson et al, 1987, EMBO J.6:
3901-3907);R- locus gene, what coding can regulate and control the generation of anthocyania pigment in plant tissue (red)
Product (Dellaporta et al, 1988, Stadler Symposium 11:263-282);Beta-lactam enzyme gene
(Sutcliffe et al., 1978, Proc.Natl.Acad.Sci 75:3737-3741), there are many known to gene coding
The enzyme of chromophoric substrate (for example, PADAC, color development cephalosporin);Luciferase genes (Ow et al., 1986, Science
254:856-859);XylE gene (Zukowsky et al., 1983, Proc.Natl.Acad.Sci 50:1101-1105),
It encodes catechol dioxygenase, and the enzyme can convert the catechol of color development;Alpha-amylase gene (Ikatu et al., 1990,
Bio/Technol.8:241-242);Tyrosinase cdna (Katz et al., 1983, J.Gen.Microbiol.129:
2703-2714), oxidizing tyrosine can be the enzyme of DOPA and DOPA quinone by coding, and DOPA quinone then polymerize (condense)
For melanin;Alpha-galactosidase can be catalyzed α-galactose substrate of color development.
Generally, it is preferred to which non-specific location introduces functional recombinant DNA in the plant genome.Under special circumstances, may be used
Recombinant dna construct is inserted by site-directed integration.Implant can be made to have functional a variety of fixed point recombination systems there are known,
It includes FLP-FRT disclosed in cre-lox disclosed in United States Patent (USP) 4,959,317 and United States Patent (USP) 5,527,695.
In practice, in any single transformation experiment, DNA is only introduced in the target cell of small percentage.Coding choosing
The gene for selecting label is used to provide for for identifying that the conversion is by connecing by the efficient system of these cells of stable conversion
It receives transgene DNA construct and is integrated into their genome to realize.Preferred marker gene, which provides, to be assigned to choosing
The selected marker of the resistance of selecting property reagent (for example, antibiotic or herbicide).Plant of the invention can have to its resistance
Any herbicide contributes to the useful reagent of selected marker.The cell that will likely be converted is exposed to selective reagent.It is depositing
It will be following cells in the population of living cells, wherein in general, resistance-conferring gene is integrated, and allow cell survival enough
Horizontal expression.Cell can further be tested, to verify the stable integration of exogenous DNA.Usually used selectivity mark
Remember that gene includes assigning to those of antibiotic resistance, such as receive mycin (nptII), hygromycin B (aph IV) and celebrating greatly to card
Mycin (aac3 and aacC4), or to those of Herbicid resistant/tolerance, such as to glufosinate-ammonium (bar or pat), glyphosate
(EPSPS) and AMPA (phnO).The example of such selected marker is described in United States Patent (USP) 5,550318,5,633,435,5,
In 780,708 and 6,118,047.There is provided the selection markers visually identified transformant can also be used, for example, expression is coloured
Or fluorescin (for example, luciferase or green fluorescent protein (GFP)) gene or express beta- glucuronidase base
Cause or uidA gene (GUS), it is known that there are many chromophoric substrates for it.
Preferred plant conversion carrier includes the Ti-plasmids from Agrobacterium tumrfaciens (for example, the U.S.
4,536,475,4,693,977,4,886,937,5,501,967 and EP of the patent No. 0 122 is 791).Agrobacterium
Rhizogens plasmid (or " Ri ") can also be used, they are known in the art.Other preferred plant conversion carriers include
Herrera-Estrella (1983, Nature 303:209-213), (1983, Nature 304 Bevan:184-187),Klee
(1985, Bio/Technol.3:Those of disclosed in 637-642 and EP 0 120516.
Method and composition for converting plant by introducing from recombinant dna construct to Plant Genome includes big
Measure any method in means known in the art.A kind of method for constructing the plant by conversion is microinjection blast technique,
Such as United States Patent (USP) 5,015,580,5,550,318,5,538,880,6,153,812,6,160,208,6,288,312 and 6,399,
Described in 861.Another method for constructing inverted plant is the conversion that Agrobacterium is mediated, such as United States Patent (USP) 5,
159,135, described in 5,824,877,5,591,616 and 6,384,301.Alternatively, other non-Agrobacterium objects can be used
Kind, for example, Rhizobium and the other prokaryotic cells for showing following abilities, their energy infection plant cells, by heterologous nucleotide
Acid sequence introduces the genome of infected plant cell.
DNA construct of the invention can be introduced into mesh by the way that well known to a person skilled in the art a variety of Conventional reformat technologies
Mark plant.With regard to Agrobacterium mediate conversion purpose for, suitable plant conversion carrier include from
The carrier that the Ti-plasmids of Agrobacterium tumrfaciens obtains.The plant conversion carrier mediated except Agrobacterium
Except, other methods may be alternatively used for for DNA construct of the invention being inserted into plant cell.Such method may include but
It is not limited to, for example, electroporation increases the absorption of dissociative DNA using liposome, the fortune for carrying out dissociative DNA is bombarded by microinjection
It send and is converted using virus or pollen.
Other something lost can be combined by of the invention by any nucleic acid in isolated nucleic acid by permanently or temporarily means
Element, such as promoter, introne, enhancer and untranslated boot sequence etc. is passed to be introduced into plant cell.Coding can be manufactured
Coleoptera species RNA, or the RNA from hole drilling type and suctorial type insect species, or preferably D.v.virgifera RNA or
Any nucleic acid molecules of LygusHesperus RNA, and by allow in plant cell generate dsRNA molecule means by its
Introduced plant cell provides one or more specific dsRNA of insecticidal amount in the diet of object noxious insect.
Term " transgenic plant cells " or " genetically modified plants " refer to, plant cell or plant containing exogenous nucleic acid, institute
Stating exogenous nucleic acid can obtain from WCR, or obtain from different insect species or any other non-insect species.Genetically modified plants are also used
Come include such transgenosis any generation offspring (descendants (decedent), descendant etc.) or all such genetically modified plants
Any generation seed comprising the DNA sequence dna of coding RNA, sRNA, dsRNA, siRNA or its segment of the invention
The offspring or seed are also importance of the invention.
Typically, contained using the genetically modified plants that Agrobacterium method for transformation is formed and be inserted into item chromosome
In single simple recombinant DNA sequence, be referred to as transgenic event.Such genetically modified plants are referred to alternatively as:About insertion
Exogenous array, heterozygosis.Homozygous genetically modified plants can be obtained by following methods for Transgenics:It will be containing single
Independent separate (independent segregant) genetically modified plants of one exogenous gene sequence, for example, F0 plant, certainly with it
Body carries out sexual cross (selfing), to generate F1 seed.A quarter in the F1 seed of generation will be that Transgenics are come
Say heterozygosis.Make F1 germination, just produce the plant that can be examined by heterozygosity, typically, is increased using SNP test or thermal expansion
To carry out, the test allows the difference (that is, zygosity test) between heterozygote and homozygote for test.By heterozygote plant and its
Itself or another heterozygote plant hybridize, and only generate heterozygosis offspring.
It, can be by that will have recombinant dna construct other than carrying out directly conversion to plant with recombinant dna construct
The first plant and second of plant hybridization for lacking the construct carry out prepare transgenosis plant.For example, for gene containment
Recombinant DNA can be introduced in the first plant lines, and the strain can be influenced by converting, and generation can be with second of plant product
It is the genetically modified plants of hybridization, the recombinant DNA for being used for gene containment is penetrated into second of plant lines.
Can by the practice present invention come the genetically modified plants that manufacture, including but not limited to, alfalfa, dill, apple,
Apricot, globe artichoke, rocket salad, asparagus, avocado, banana, barley, beans, beet (beet), blackberry, blueberry, blueberry, cabbage, brussels sprout, volume
The small citrus of heart dish, leaf mustard, muskmelon, carrot, cassava, cauliflower, celery, cherry, coriander, citrus, Ke Laimenshi, coffee, jade
Rice, cotton, cucumber, pesudotsuga taxifolia, eggplant, hare's-lettuce, wide leaf lettuce, eucalyptus, fennel, fig, cucurbit, grape, shaddock, Hami
Melon, yam bean, Chinese grooseberry, lettuce, leek, lemon, bitter orange, torch pine, mango, melon, mushroom, nut, oat, okra, onion,
Tangerine, decoration with plant, pawpaw, parsley, pea, peach, peanut, pears, pepper, persimmon, pine tree, pineapple, plantain, Lee, pomegranate, white poplar,
Potato, pumpkin (pumpkin), quince, pine, witloof, radish, raspberry, rice, naked barley, sorghum, Southern Pine, soybean,
Spinach, pumpkin (squash), strawberry, beet (sugarbeet), sugarcane, sunflower, sweet potato, storax, mandarin orange, tea, tobacco,
Tomato, turf, trailing plant, watermelon, wheat, Chinese yam and small cucumber plant.
In practice, the present invention can control character with other insects in plant and combine, and be used to increase with what acquisition was wanted
To the character of the control of insect infestations.Will using different role mode insect control and combination, can provide for insect into
The genetically modified plants of row protection have outstanding lasting stability compared with the plant for using single insect to control character, because
It is reduced in the probability that field develops resistance.
In over the past several decades, the insecticidal mechanism of B.thuringiensis crystalline protein is conducted extensive research.
It has been shown that only after absorbing albumen, albumin crystal albumen just can larval form to insect it is toxic.In Lepidopteran larvae
In, alkaline pH and proteolytic enzyme meeting soluble protein in insect midgut, so that the component toxic to insect discharges.These
Toxic component destroys midgut epithelial cells, causes insect to stop feed, and final, causes insect death.For this reason,
Confirm that B.thuringiensis toxin and is to environment from being effective during handle a variety of harmful insects
The insecticide of safety.Coleoptera and hemipteran, and be likely to, diptera, lygus bug and other hole drilling types and suction
Suck formula insect and illustrate slightly sour intestinal pH, thus effective in keep out Lepidopteran larvae Bt toxin to above-mentioned harmful organism not
It works.The slightly sour intestinal pH of these insects is also believed to be more friendly to composition of the invention, is being not intended to limit
In the case where specific theory, it appears that, the alkaline pH of Lepidopteran larvae enteron aisle attempts to show that the attempt of dsRNA effect is lost before being
The reason of losing (Fire et al. U.S. Patent number 6,506,559;Mesa et al. patent publication No. US2003/0150017;
Rajagopal et al., 2002, J.Biol.Chem.277:46849-46851;Tabara et al., 1998, Science
282:430-431).Therefore it is believed that dsRNA method disclosed herein should be preferentially used for control coleoptera, diptera, half
Wing class, lygus bug, hole drilling type and suctorial type insect plant and composition in.Method and composition shown in this article is particularly useful
In targeting the gene in following insects for containment, the insect shows about 4.5 to about 9.5, about 5.0 to about
9.0, about 5.5 to about 8.5, about 6.0 to about 8.0, about 6.5 to about 7.7 or about 6.8 to about 7.6 or
About 7.0 intestinal pH.But show about 7.5 to about 11.5, or about 8.0 to about 11.0, or about 9.0 to
The insect of about 10.0 intestinal pH and other pests, such as lepidopterid larva, also fall into model of the invention
In enclosing.The dsRNA for inhibiting Lepidopteran larvae gene is specific to when providing together with one or more Bt albumen in larva diet
When, this is especially true, and when with threshold value or higher than the horizontal offer of threshold value, Bt albumen can be according to conventional route to lepidoptera children
Worm generates toxicity.Have the presence of virose one or more Bt toxin for insect species of the same race, intestinal pH will be effectively reduced,
The stable environment for being directed to double stranded rna molecule is provided, is acted on applying them to the containment of harmful insect target gene.
By one or more generation dsRNA molecules of the invention by stable dsRNA construct in object noxious elder brother
It is combined in the diet of worm with one or more insecticidal proteins, so that dsRNA and insecticidal protein have same harmful insect
Toxicity will be useful.Insecticidal protein can be obtained from B.thuringiensis, can also can be generated from known in the art
Insecticidal protein it is other biology obtain, for example, entomopathogenic nematode bacterial symbiont (for example, Photorhabdus sp.,
Xenorhabdus sp.), Serratia entomophila and relevant Serratia sp., B.sphaericus,
B.cereus, B.laterosporus, B.popilliae, Clostridium bifermentans and insecticidal can be shown
The gram-positive bacterium of other formation spores of property.Similarly, it is also proposed that, generate two kinds of dsRNA molecule of the invention
Or it is a variety of it is different can be provided in together in single plant by stable dsRNA construct, with ensure insect control phenotype
Lasting stability.These dsRNA molecules can target same gene for silencing, alternatively, targeting different genes for sinking
It is silent.Two or more differences dsRNA can be combined in same plant, and every kind of dsRNA has toxicity to different harmful insects,
It is toxic to same insect species without which kind of dsRNA.
It is expected that certain groups by stable dsRNA construct and one or more insects control protein gene
Synergistic effect will be generated by closing, and can enhance the insect control phenotype of genetically modified plants.Using artificial diet or entire plant tissue into
Capable insect biologic test, which can be used for determining, uses dsRNA and insect when controlling albumen about dead larvae or growth inhibiting dose
Measure response.Those skilled in the art can examine the mixture of dsRNA molecule and insect protein in biologic test, with mirror
Make active component, the combination be have for the application (deployment) in insect protection plant concertedness and be people
Desired (Tabashnik, 1992).It has been reported that killing the concertedness of harmful insect between different insect control albumen
(summary referring to Schnepf et al., 1998).It is expected that between certain dsRNA and certain dsRNA and certain insects
There are concertednesses between control albumen.
It is expected that the combination of dsRNA will disclose the unexpected toxicity for being directed to certain harmful insects.
Rajagopol et al (2002, J Biol Chem.277:It 46849-46851) reports, dsRNA is fed to lepidoptera nocuousness
The larva of biological S.litura, for allow coding in intestines aminopeptidase gene silencing for be do not have it is effective.It is worth mentioning
, the alkaline pH environment of intestines is friendly environment for dsRNA in typical lepidoptera, because RNA two-body is in alkaline pH
Under denaturation will be expected to cause rapidly to degrade.The B.thuringiensis toxin protein being inserted into midgut epithelium film
The hole of formation, resulting in the neutralization of middle intestines pH, (summary is shown in Gill, 1995, Mem.Inst.Osaldo Cruz, Rio de
Janeiro, 90:69-74).Therefore, it is only capable of being formed temporary ion channel in lepidoptera midgut epithelium film without will lead to extremely
The B.thuringiensis toxin died, which is enough for middle intestines pH to be reduced to be more advantageous to, absorbs dsRNA's by midgut epithelial cell
It is horizontal.As an example, it is known that Cry1Ac albumen is directed to beet armyworm, and Spodoptera exigua is not effective toxin
(Chambers et al, 1991, J.Bacteriol.173:3966-3976).But middle intestines pH caused by Cry1Ac albumen
It temporarily reduces to have and is used to stablize the dsRNA absorbed altogether, so that them is had the target gene for silencing S.exigua, thus provide
The means of unexpected this harmful insect of control.Using any egg of lepidopterid midgut epithelial cells ion regulation can be upset
It is white, whether is it can insecticidal, can observe the effect, this to coleoptera, diptera, Hemiptera, lygus bug and its
Its hole drilling type and suctorial type harmful insect etc. are also useful.
Some insecticidal proteins from B.thuringiensis, such as Cyt albumen, can lead to sensitive insect larva
The temporary opening of midgut epithelium film, this is because the formation of structural porous or the generality class detergent activity due to albumen are made
At (Butko, 2003, Appl.Environ.Microbiol.69:2415-2422).Such opening even can be dead to causing
DsRNA molecule is assisted to pass through midgut epithelial cell under the protein concentration of suboptimization for dying.It is expected that can cause on insect
Any albumen being temporarily open in epithelium promotes regardless of whether energy insecticidal, can assist dsRNA molecule to enter insect cell
Cell silencing.
SEQ ID NO shown in sequence table:1 to SEQ ID NO:143 or SEQ IDNO:169 to SEQ ID NO:174
The nucleotide sequence of middle offer or its segment or its complementary series, can be by " offer " in a variety of culture mediums, to assist to use.This
Its subgroup can also be provided in class culture medium, and the form of the subgroup allows those skilled in the art to check sequence.
Commodity product containing one or more sequences of the present invention, and from contain one or more nucleotide of the present invention
Sequence recombinant plant or seed manufacture commodity product as embodiments of the present invention quilt particularly including.Containing a kind of or
The commodity product of a variety of sequences of the present invention includes but is not limited to, grits, oil, pulverize or entire grain or plant species
Son, or comprising any grits, oil, following pulverizing or entire grain any food product, the grain be containing
The recombinant plants of one or more sequences of the invention or seed.The one or more agricultural product or agricultural product for including herein
Agricultural product or commodity product are by genetically modified plants to be proved to the detection of one or more sequences of the invention in product
Constitute, the genetically modified plants are configured to express one or more nucleotide sequences of the invention, for by using
The gene that dsRNA is mediated contains method to control the purpose of insect infestations.
In a kind of application of present embodiment, nucleotide sequence of the invention can be recorded to computer-readable medium
On." computer-readable medium " used herein refers to:Conscientiously existing for, the expression of computer direct reading and access can be passed through
Medium.Such medium includes but is not limited to:Magnetic-based storage media, such as floppy disk, hard disk, storage medium and tape;Optical storage
Medium, such as CD-ROM;Electronic storage medium, such as RAM and ROM;The computer document of optical character identification format, Yi Jishang
The hybrid of type is stated, for example, magnetism/optical storage medium.It will be readily apparent to those skilled in the art that any at present
Known computer-readable medium can be used to manufacture following products, and the product includes to be recorded on computer-readable medium
Nucleotide sequence of the invention.
" record " used herein refers to, the method for storage information on a computer-readable medium.Art technology
Personnel easily can record information using any method being currently known on a computer-readable medium, to generate comprising this
The medium of invention nucleotide sequence information.To those skilled in the art, a variety of different data store organisations are can to obtain
, for manufacturing the computer-readable medium for being recorded on nucleotide sequence of the present invention.Selection to data storage medium
It will usually be accessed based on selecting by the means of storage information.In addition, a variety of different data processor programs and format are available
It stores in by nucleotide sequence of the present invention onto computer-readable medium.Sequence information can be showed in word processing text document,
It is formatted with the software that can be obtained through commercial channels, such as WordPerfect and Microsoft Word, or
Its form that can be shown as ASCII text document, is stored in database application, such as DB2, Sybase, Oracle etc..Ability
Field technique personnel can be easy to use any amount of data processor architecture format (for example, text document or data
Library), to obtain the computer-readable medium for being recorded on nucleotide sequence information of the present invention.
It is public for allowing those skilled in the art to access the computer software of the sequence information provided in computer-readable medium
Obtained by crowd.BLAST (Altschul et al., J.Mol.Biol.215 are executed in Sybase system:403-410
And BLAZE (Brutlag, et al, Comp.Chem.17 (1990)):203-207 (1993)) searching algorithm software can by with
In identification sequence in open reading frame (ORF), for example, it is provided herein, containing with ORF or protein from other biologies
Homology Unigene and EST.Such ORF is the segment of coding protein in sequence of the present invention, can be used for producing commercially
Important protein, for example, for Amino acid synthesis, metabolism, transcription, translation, RNA processing, nucleic acid and protein degradation, protein
Modification and DNA replication dna, limitation, modification, recombination and the enzyme of reparation.
The present invention also provides the systems for containing sequence information as described herein, particularly, computer based system.This
Class system is designed to:The commercially important segment in nucleic acid molecules of the invention can be identified.It is used herein " to be based on
System for computer " refers to the hardware device, software equipment and data storage device for analyzing nucleotide information of the present invention.This hair
The minimum limit hardware device of bright computer based system is set comprising central processor unit (CPU), input equipment, output
Standby and data storage device.Those skilled in the art can easily instruct, in currently available computer based system
Any one is suitable for the present invention.
The most preferably length of target sequence is about 10 to about 100 amino acid, or about 23 to about 300 nucleosides
Sour residue.
" object construction primitive (motif) " or " target primitive " used herein refer to, any sequence for rationally selecting or
Combined sequence, wherein the 3-d modelling that is formed selects one or more sequences when being folded based on target primitive.It is known in the art
Plurality of target primitive.Protein target primitive includes but is not limited to enzyme active sites and signal sequence.Target set nucleic acid primitive includes
But it is not limited to, promoter sequence, cis-acting elements, hairpin structure and inducible expression elements (protein binding sequence).
Embodiment
Inventor is identified herein for controlling the method without vertebra pest infestation, this is by raw in nocuousness
Double stranded ribonucleic acid molecule is provided in object diet to carry out.Surprisingly, inventor by harmful organism it is disclosed that take the photograph
When taking, double stranded ribonucleic acid molecule can play a role, and inhibit the biological function of harmful organism, cause one of following characteristics or
It is a variety of:Harmful organism feed is reduced, and harmful organism survival rate reduces, and harmful organism is dead, the differentiation of harmful organism and development quilt
Inhibit, the reduction or disappearance of the sexual propagation ability of harmful organism, muscle are formed, the formation of juvenile hormone, the tune of juvenile hormone
Control, ion regulation and transhipment, the holding of cell membrane gesture, amino acid bio synthesis, amino acid degradation, spermiogenesis tail, pheromones
Synthesis, pheromones sensing, the formation of day linear protein, wing formed, formation, development and the differentiation of leg, the formation of ovum, larva at
Ripe, digestibility enzyme formation, the synthesis of hemolymph, the holding of hemolymph, neurotransmission, cell division, energetic supersession, breathing and
Any component of apoptosis and eukaryocyte cytoskeletal structure, for example, Actin and tubulin.Appoint in these characteristics
A kind of what or any combination can lead to effective inhibition to pest infestation, in the case where the biology to plant pest,
Inhibition to plant invasion.For example, when be used as being supplied to local mode plant, containing being enough to inhibit the amount of harmful organism
One or more double stranded ribonucleic acid molecules dietary composition when, be used as seed treatment, the soil as surrounding plants
Using, or by plant out of plant cell existing recombinant DNA molecules come biological attack meeting when producing, to plant pest
Unexpectedly dramatically reduce.When being applied to single harmful organism, the embodiments shown herein is for illustrating the present invention.
But it would be recognized by those skilled in the art that method, formula and idea in embodiment are used with no restriction, can be used for can
To consume the institutes of following food sources whether there is or not vertebra pest, to contain related to harmful organism or inside it play
Some important features of effect, the food source are that can be formulated for the harmful organism inhibitor containing sufficient amount, by
At least one or more of double stranded rna molecule is constituted.
Embodiment 1
Present embodiment describes the identification to following nucleotide sequence, the nucleotide sequence is with the shape of double stranded rna molecule
When formula is provided in corn rootworm diet, have for controlling corn rootworm.
Constructed from entire larva and from the middle intestines dissection of incision corn rootworm cDNA library (LIB 149, LIB 150,
LD33027, LIB3373), nucleotide sequence information is obtained (see Andersen et al. is filed on July 24th, 2002
U.S. Patent Application Serial Number 10/205,189 is specifically incorporated to herein entirely through reference).In addition, from different hairs are in
The entire larva for educating different time in stage and each stage of development, comes construction cDNA library, is come from maximizing
The quantity of the different est sequences of Diabrotica species.Respectively by the Western from the first age (1 gram) and third age (2.9 grams)
Construct library LIB5444 and LIB5462 in the library mRNA that Corn rootworm larvae obtains.By being inserted into liquid nitrogen, by what is obtained
Insect quick freeze.To insect is ground in the mortar and pestle for being held in -20 DEG C, temperature holding is by refrigerating on dry ice
And/or liquid nitrogen is added into mortar and is realized until organizing to be grated for fine powder.It usesReagent
(Invitrogen), according to manufacturers instruction, RNA is extracted.Using Dynabeads Oligo dT (Dynal Inc., NY), press
According to manufacturers instruction, Poly A+RNA is isolated from total serum IgE preparation.Use SuperScriptTM Plasmid System
(Invitrogen) come construction cDNA library from Poly A+RNA.Size separation is carried out to cDNA using chromatography.The fourth stage and
Pyatyi segment is collected, and is connected into pSPORT1 carrier (Life Technologies Ind., Gaithersburg MD)
Sal1 and Not1 restriction enzyme enzyme recognition site between, it is thin into E.coli DH10B Electrocompetent by Electroporation Transformation
Born of the same parents.First instar larvae library produces about 420,000 colony forming units.Third instar larvae library produces about 2.78
×106A colony forming unit.The bacterium colony from LIB149, LIB150 is washed down from plate, by simply shaking uniform mixing,
Pour Tris-EDTA buffer into again.The half washed in the substance to get off is loaded into 10% glycerol, dispenses into freezing tubule, storage
It is stored in -70 DEG C.The other half be used to generate Plasmid DNA with the micro-purified column of Quiagen or its product of equal value.It will be purified
Plasmid DNA is dispensed into micro-centrifuge tube, is stored in -20 DEG C.
In high viscosity culture medium individually amplification from Diabrotica virgifera cDNA library LIB5444 and
The bacterium colony of LIB5462.At 37 DEG C, 500ml LB culture medium (contains 0.3%SeaPrep agaroseWith 50mg/l carboxylic benzyl mould
Element) in individually placed stirring plate, mixing from LIB5444 about 200,000 colony forming unit and come from
Then the 600 of LIB5462,000 colony forming unit cool down 1 hour rapidly in water ice bath, so that bacterial clump is uniform
It suspends.Then the library by inoculation is cultivated 42 hours at 30 DEG C.After incubation, 5 points are carried out to cell on stirring plate
The mixing of clock.It then will be in the centrifugal bottle of media transfer to two 250ml.It is handled 10 minutes in 10,000xg, precipitates bacterium
Cell.Culture medium is removed from bottle, cell is resuspended in the LB culture medium of 20ml in total, wherein the carboxylic containing 50mg/l
Parasiticin.Dimethyl sulfoxide is added to 10%, cell is remained into freezing state.Two kinds of libraries are expanded, until every milli
Rise the final potency of 108 colony forming units.Combine Diabrotica virgifera cDNA library LIB5444 and
The sample of LIB5462 is adjusted to the DNA of every microlitre of about 1.25 micrograms in by aseptic distillation and deionized water
Concentration is dispensed into 25 freezing tubules, and each freezing tubule contains the DNA of about 8.75 micrograms.Applicant/inventor is in 2004
On June 10, in is by these sample preservations to positioned at 10801University Boulevard, Manassas, Virginia USA
The American Type Culture Colleciton (ATCC) of ZIP 20110-2209, is referred to as LIB5444/62.
For ATCC to applicant provide preservation receipts, specifying ATCC deposit number is PTA-6072.
Substantially according to described above for the method for generating corn rootworm cDNA library, corn rootworm high molecular weight is prepared
CDNA library, i.e. LIB5496 and LIB5498.Respectively from by the first age (1 gram) and third age (1 gram) Western corn rootworm children
The library mRNA that worm obtains constructs library LIB5496 and LIB5498.In short, the quick freeze insect in liquid nitrogen, by grinding
It mills in alms bowl and pestle, the insect of freezing is become into fine powder.It usesReagent (Invitrogen), according to factory
Quotient's specification extracts RNA.Using Dynabeads OligodT (Dynal Inc., NY), according to manufacturers instruction, from total serum IgE
PolyA+RNA is isolated in preparation.Use SuperScriptTMPlasmid System (Invitrogen) is from 20 micrograms
Poly A+RNA constructs high molecular weight cDNA library.On 1% Ago-Gel in TAE, size separation is carried out to cDNA.
The cDNA within the scope of 1Kb to 10Kb is collected, connects between Sal1 the and Not1 restriction site of pSPORT1 carrier, leads to
Electroporation Transformation is crossed into E.coll DH10B Electrocompetent cells.LIB5496 produces about 3.5 × 106A bacterium colony forms list
Member.LIB5498 produces about 1.0 × 106A colony forming unit.Amplification comes from corn root individually in high viscosity culture medium
The bacterium colony of worm high molecular weight cDNA library LIB5496 and LIB5498.At 37 DEG C, 500ml LB culture medium (contains 0.3%
SeaPrep agaroseWith 50mg/l carbenicillin) in individually placed stirring plate, mixing from LIB5496 and
Then about the 600 of LIB5498,000 colony forming unit cool down 1 hour rapidly in water ice bath, so that bacterial clump
Even suspension.Then the library by inoculation is cultivated 42 hours at 30 DEG C.After incubation, cell is carried out on stirring plate
Mixing in 5 minutes.It then will be in the centrifugal bottle of media transfer to two 250ml.It is handled 10 minutes in 10,000xg, precipitating is thin
Bacterium cell.Culture medium is removed from bottle, cell is resuspended in the LB culture medium of 20ml in total, wherein containing 50mg/l's
Carbenicillin.Dimethyl sulfoxide is added to 10%, cell is remained into freezing state.Two kinds of libraries are expanded, until every
The final potency of 108 colony forming units of milliliter.The cDNA sequence of insertion is obtained from corn rootworm species specific plasmids library
Column information.
The al. corn rootworm library Andersen et and additional sequences from the library LIB5444 and LIB5462 are initial
It generates and comes about 18,415 individual est sequences, by about 1.0 × 107A nucleotide residue is constituted.Est sequence is put down
Equal length is about 586 nucleotide residues.These est sequences are used for bioinformatics, have obtained contig
(contig) assembly of sequence, this is referred to herein as UNIGENE sequence, cannot pass through the overlapping phase same sex and other EST sequences
It equips the individual est sequence matched and is referred to herein as singlet (singleton).Then to the library LIB5444 and LIB5462 into
The sequencing of row more depth, obtains additional individual est sequence.Will from library, i.e. LIB149, LIB150, LIB3027,
The est sequence that LIB3373, LIB5444, LIB5462, LIB5496 and LIB5503 are obtained is showed in sequence table, from SEQ ID
NO:1 to SEQ ID NO:143 and SEQ ID NO:169 to SEQ ID NO:174.
If it would be possible, by assembling from the isolated est sequence of CRW cDNA library as UNIGENE group, these dresses
The Unigene sequence matched is showed in sequence table.UNIGENE is the cluster of gene location, is formed from single est sequence and carries sequence
Overlapping in column phase same sex region, to form bigger sequence.Every nucleotide sequence shown in sequence table is analyzed,
Identify the presence of open reading frame.By the amino acid sequence information being inferred to from open reading frame with can be obtained from public database
Known amino acid sequence information compare, to be inferred to amino acid sequence and these known amino acid sequence phase same sexes or similar
The degree of property.If any, it with biological function relevant to known amino acid sequence in public database, gives from cDNA library
The amino acid sequence that nucleotide sequence information is inferred to adds following annotations.The protein that annotation provides hint property (may be from
Provide the specific gene expression of specific cDNA sequence) functional information, but this and indecisive result.Based on hint property
Annotation information, certain cDNA sequences are accredited as:Coding may relate to the albumen of some biological functions in corn rootworm cell,
The function be for life it is critically important, perhaps to ensure cell health and survival for be necessary or may
It is related to complete cell, cell holding, fertility etc..
Several cDNA sequences are isolated from the cDNA sequence subgroup that may encode albumen, their inhibition may be led
Cause the morbidity or death of CRW or other invertebral living creature Species Cells.Then these sequences are used for dsrna construct molecule,
Including into CRW diet.
Thermal expansion is designed based on the cDNA sequence reported in CRW cDNA library increases primer pair.Primer pair is built as
A pair of of nucleotide sequence, each member of primer pair show the complete complementarity with justice or antisense sequences.It constructs
Primer pair sequence, so that each members show of the centering goes out in its sequence of the 5 ' end containing T7 phage rna polymerase promoter
Column, such as such as SEQ ID NO:Shown in 5 nucleotide sites 1 to nucleotide site 23.Preferably, use genomic DNA as
Template carries out high-fidelity with the first primer pair for lacking T7 promoter and expands for the first time, generates the first amplicon.Preferably,
CDNA or mRNA sequence are used as template, for synthesizing dsRNA molecule used in the present invention, because eukaryon is raw in this field
Object genome sequence is considered containing the sequence being not present in mature rna molecule.It then will be from high-fidelity first time amplified reaction
The the first amplification subsample generated is used as template in second of hot amplified reaction, with second pair containing T7 promoter sequence
Primer pair produces the second amplicon, wherein contains in 5 ' ends of every chain of the second amplicon or in which opens embedded with T7
Mover.The whole nucleotide sequence that the second amplicon is obtained with both direction, by itself and the nucleotide sequence for cDNA report
It is compared, if it exists, pointing out the difference between two sequences.In general, genomic DNA is used to prepare as template
Sequence with for obtaining the not consistent as further using for dsRNA molecule of level of signifiance containment because have in mRNA or
The variation for the genome sequence being not present in cDNA sequence.
Typically, the linearisation DNA profiling that reaction contains about 1 to about 2 microgram is transcribed in vitro, comes from 10X concentrate
T7 polymeric enzyme reaction buffer, (wherein concentration is every kind 50 to 100mM) and 1 by ribonucleotide ATP, CTP, GTP and UTP
The t7 rna polymerase of a unit.According to manufacturers instruction, in (several minutes to a few hours) progress of about 37 DEG C of incubation a period of times
RNA polymerase reaction, this depends on RNA polymerase used.In general, reaction carries out about 2 to about 6 hours, for transcribing
Longest is up to the template sequence of about 400 nucleotide, and carries out up to 20 hours, is greater than about 400 for Transcript Length
The template sequence of a nucleotide.Reaction is heated to 65 DEG C, 15 minutes, to terminate rna transcription.Rna transcription is precipitated in ethanol
Product is washed, and is air-dried, and is resuspended in the water without RNAse, until concentration is every milliliter of about 1 microgram.Using anti-
Double-stranded RNA is produced in responsive transcription in vivo to most of transcript of T7 starting substrategy (as outlined above), but
It is, by the way that purified RNA is heated to 65 DEG C, to be then slowly cooled to room temperature to ensure justice and antisense RNA segment
Correct annealing just obtains the double-stranded RNA of high yield.Then one is carried out to double stranded RNA product at 37 DEG C with DNAse I and RNAse
The incubation of hour, to remove any DNA or single stranded RNA present in mixture.According to manufacturers instruction (AMBION
MEGASCRIPT RNAi KIT), in purified on columns double stranded RNA product, it is resuspended in 10mM Tris-HCl buffering
In liquid (pH7.5) or water without RNAse, until the concentration of every microlitre 0.1 to 1.0 microgram.
Double-stranded RNA sample is added directly into each hole containing the insect diet being indicated above, or is being added to
It is modified before insect diet.RNAse III (AMBION is directed to according to what manufacturer provided to the modification of double-stranded RNA
CORPORATION, Austin, Texas) or DICER (STRATAGENE, La Jolla, California) specification come into
Row.RNAse III produces the two-body of 21 and 22 nucleotide to the digestion of double-stranded RNA, contains 5 ' phosphorylations
End and 3 ' C-terminals with 2-3 base overhang, similar to the two-body short interfering rna of about 21-26 base-pair
(siRNA) segment, this be Hamilton et.al. (Science, 1999,286:950-952) and Elbashir et.al.
(Genes&Development, 2001,15:Dicer enzyme manufacture 188-200) identify, in eukaryon approach.To this receipts
The short interfering rna two-body collected is further purified, and is analyzed with polyacrylamide gel electrophoresis sample, to measure two
The integrality and efficiency that body is formed.Then the purity sum number of sample is measured by spectrophotometry under 250 nanometers of wavelength
Amount, not used sample is stored in -20 DEG C, for further using.
The sample of siRNA or overall length double-stranded RNA (dsRNA) be used to carry out to be carried out with the object noxious livings of selected quantity
Biologic test.According to following processes, the artificial meals of corn rootworm are applied to using the various dose of dsRNA or siRNA as overlapping
On food.From CropCharacteristics, Inc., Farmington, Minnesota obtains Diabrotica
The ovum of virgiferavirgifera (WCR).In the soil, in 24 DEG C, 60% relative humidity under complete darkness, is stopped to non-
The WCR ovum of dormancy phase carries out culture in about 13 days.At the 13rd day, the soil containing WCR ovum is placed between #30 and #60 mesh
Sieve in, wash away soil using high pressure garden water.Desinsection is carried out by steeping three minutes surfaces to ovum in LYSOL
(disinfest), it three times with sterilizing washing, is washed once with 10% formalin solution, then additional three times with sterilizing washing.
The ovum handled in this way is suspended in sterilizing coffee strainer, at 27 DEG C, 60% relative humidity, under complete darkness,
Incubated overnight.
Substantially according to Pleau et al. (Entomologia Experimentalis et Applicata, 2002,
105:It is 1-11) described to manufacture insect diet, wherein be made that following change.9.4 grams of SERVA agar is suspended into 540 millis
It rises in purified water, stirring is until agar is completely dispersed.Water/agar is mixed and heated to boiling, to be completely dissolved agar, so
After be poured into WARING blender.Blender is remained into low speed, at this time by 62.7 grams of BIO-SERV DIET mixtures
(F9757), corn root, 1.25 milliliters of non-polluted edible pigment and the 0.6 milliliter of formalin of 3.75 grams of freeze-dryings are added to heat
Agar mixture in.Then mixture pH is adjusted to 9.0 by the way that 10% potassium hydroxide reservoir is added.In magnetic stirring heat
On plate, with the magnetic stir bar for using sterilizing NALGENE coating, continued with liquid dietary of the high speed to about 600 milliliters of volumes
It is mixed, remains at about 48 DEG C to about 60 DEG C, and it is each to be separated into 96 hole round bottom titer plate of FALCOM
200 microlitres of aliquots in hole.The diet in plate is enabled to solidify and be air-dried in the biological air extracting cabinet (biohood) of sterilizing.
Using running fire type micropipettor, the test specimen of 30 (30) microlitre volume is taken, wherein containing different number
Reagent or double-stranded RNA are controlled, the insect diet surface in each hole is covered.After application test sample, insect
Diet is allowed to be held up in the biological air extracting cabinet of sterilizing one and a half hours (one half hour), so that diffusion of reagents
Into diet, and allow diet dry tack free.A WCR newborn larvae is put into each hole with paintbrush.Then close with MYLAR
Plate is sealed, is divulged information with insect needle.For every kind of dosage, 12-72 insect larvae is tested, quantity depends on test and sets
Meter.Culture in 12-14 days is carried out to biologic test plate under 27 DEG C, 60% relative humidity and complete darkness.At 12-14 days
Time point, under every kind of dosage survive larva quantity recorded.Using suitable microbalance, survive for every
Larva measures larva quality.It usesStatistical software (SASInstitue, 1995) analyzes data, with Dunnet ' s
It examines to carry out complete factorial ANOVA, to find the effect (P < 0.05) of processing compared with untreated control.Carry out Tukey-
Kramer subsequent (post hoc) is examined, and carrys out all processing of comparison to (P < 0.05).
Following nucleotide sequence is obtained initially as the cDNA sequence identified in intestines cDNA library in corn rootworm
(Andersen et al., ibid), is used for dsrna construct molecule, feeds in harmful organism diet for upchecking
Double stranded rna molecule is raised to the inhibitory effect of harmful organism biological function.
Chd3 homologous sequence
Identified in a variety of eucaryotes come CHD gene, corresponding albumen be considered as chromatin reconstruct because
Son plays a role.Three kinds of sequence homology structural domains that term CHD has found in CHD albumen:Chromo (repair by chromosome organization
Decorations person) structural domain, SNF2- relational coiling be mould/ATPase structural domain and DNA binding structural domain, every kind is all believed and can assign
Different chromatin related activities.Based on another sequence homology structural domain (PHD Zinc finger domain, typically, with chromosome
Related activity is related) whether there is, CHD albumen is divided into two classes.CHD3 GAP-associated protein GAP has PHD Zinc finger domain, still
CHD1 GAP-associated protein GAP is then not.Germicidal efficacy imply that CHD3 albumen containment transcription in effect, in some species by
It is shown as containing ingredient of the histone as the complex of subunit.The deacetylation of histone is related to transcriptional inactivation, so
CHD3 albumen has been implied to be:Using as the property of the ingredient of histidine deacetylase complex, transcription containment agent can be used as
Play a role (Ogas et al., 1999, PNAS 96:13839-13844).It therefore, can be with to the containment of CHD3 albumen synthesis
As useful target, for the inhibition to no vertebra harmful organism with double chain RNA mediate.
SEQ ID NO:Intestines cDNA nucleotide sequence in 4 corresponding CRW, amino acid sequence translation are noted as:With
Drosophila melanogaster CHD3 amino acid sequence (GenBank number AF007780) is homologous.SEQ ID NO:5 Hes
SEQ ID NO:40609 correspond respectively to:The genome amplification primer (i.e. primer pair) of forward and reverse, the primer is for producing
From birth from crw genomic dna, the amplicon from the library CRW mRNA or from the cDNA generated from this class libraries.Such amplicon
Sequence correspond to encoding D .melanogasterCHD3 amino acid sequence homologous body CRW gene a part.SEQ ID
NO:5 contain T7 polymerase promoter sequence (nucleotide 1-23), the promoter sequence and SEQ ID NO at its 5 ' end:In 5
CRW Genome Primer sequence (being forcibly appointed as forward primer sequence) shown in 24-45 nucleotide is connected, and very corresponds to
SEQ ID NO:The the 31st to the 52nd nucleotide shown in 4.SEQ ID NO:6 contain T7 polymerase promoter sequence at its 5 ' end
Column, as shown in 1-23 nucleotide.T7 promoter sequence is in its 3 ' end and mandatory specified reverse genomic primer sequence phase
Even, correspond to SEQ ID NO:24-44 shown in 6 nucleotide, the reverse complementary sequence of the sequence are shown in SEQ ID
NO:298-319 nucleotide in 4.In using amplified reaction of the crw genomic dna as template, using by SEQID NO:5
With SEQ ID NO:The primer pair of 6 compositions, generating includes SEQ ID NO:335 base-pairs of nucleotide sequence shown in 7
Amplicon, correspond in CRW genome and encode the parts of following albumen, the protein display goes out and Drosophila
The phase same sex of melanogasterCHD3 amino acid sequence about 66%.SEQ ID NO:1-23 shown in 7 nucleosides
Acid and 314-335 nucleotide reverse complementary sequences correspond to the T7 promoter sequence of any end of amplicon.SEQ ID
NO:The genome nucleotide that amplification in 7 shown in the 24th nucleotide to the 313rd nucleotide obtains is substantially corresponding to SEQ
ID NO:The cDNA nucleotide sequence being reported in 4 shown in the 31st nucleotide to the 319th nucleotide, only in addition to following
Difference:SEQ ID NO:The 63rd in 4,87,117,177,198,213,219-220,246,249 and 261 nucleotide reported
Road be T, T, G, G, G, T, T, T, C, C and A respectively, and with SEQ ID NO:7 corresponding position when being compared be the 56th,
80,110,170,191,206,212-213,239,242 and 254 nucleotide contain C, C, A, A, A, C, A, C, G, A and G.This
Kind of difference corresponds to the cDNA sequence reported in the past and from nucleotide sequence between the amplification subsequence that genomic DNA template generates
About 4% difference in composition, this is consistent with the accuracy that the cDNA sequence reported in the past is likely less than 99% (aforementioned
Andersen et al.)。
Corresponding SEQ ID NO will be shown:The amplicons cloned of 7 sequence is carried into the plasmid that can be replicated in E.coli
Body recycles the Plasmid DNA of sufficient amount, to allow to restrain (convergent) T7 promoter from the insertion of any end of cloned sequence
Carry out external t7 rna polymerase transcription.Double-stranded RNA is generated, biologic test is carried out;One RNA segment is by SEQ ID NO:In 7
Sequence composition shown in about the 24th nucleotide to as little as the about the 313rd nucleotide is (the difference is that in SEQ ID
NO:Each position of thymidine is shown as in 7, and there are uracil residues), other RNA segments are SEQ ID NO:In 7 about
The substantially reverse complementary series of nucleotide sequence shown in 313rd nucleotide to as little as the about the 24th nucleotide, wherein urine
Pyrimidine suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate foot
The siRNA (siRNA) enough measured.Sample containing 0.15 part every million siRNA or dsRNA is used for previously described
CRW diet biologic test, larva are allowed to feed 13 days.Compared with control, the CRW larva for feeding the diet containing dsRNA is shown
Obvious growth inhibition and the death rate are gone out, the dsRNA corresponds to SEQ ID NO:The whole of sequence shown in 4 or
Part.
In biologic test, it is parallel to CHD3 sequence, the other nucleotide sequences obtained from CRW are also examined,
Including being noted as that the nucleotide sequence of the CRW equivalent of following albumen may be encoded, the albumen is for example, beta- micro-pipe egg
White, 40kDa V-ATPase protein subunit, 26S proteosome subunit p28 albumen, protects children at elongation factors albumen EF1 α and EF1 α 48D
Hormone epoxide hydrolase protein, the chloride channel albumen for relying on expansion, Robison ester 1- apodehydrogenase, actin
42A albumen, 1 albumen of ADP- ribosylation factor, transcription factor IIB, chitinase protein and ubiquitin combine (conjugating)
Enzyme.
Beta- tubulin homologous sequence
Tubulin is the important feature component of structure in various kinds of cell in all eukaryocytes, is primarily used to form micro-
Pipe.The inhibition formed to micro-pipe in cell will lead to catastrophic effect, including, it is right to the interference that mitosis spindle is formed
Fissional obstruction etc..Therefore, the containment formed to tubulin can be the useful target of the inhibition of double chain RNA mediate.
The beta- tubulin correlated series obtained from CRW are identified, for the present invention.SEQ ID NO:
18 correspond to intestines cDNA nucleotide sequence in CRW, and amino acid sequence translation is noted as:With Manduca sexta beta-
1- tubulin amino acid sequence homeologous, and with Drosophila melanogaster beta-1- tubulin ammonia
Base acid sequence (GenBank number is respectively AF030547 and M20419) homeologous.SEQ ID NO:19 and SEQ ID NO:
20 correspond respectively to the genome amplification primer (i.e. primer pair) of forward and reverse, and the primer is used for from crw genomic dna,
Amplicon is manufactured from the library CRW mRNA or the cDNA generated from thus class libraries.The sequence of such amplicon corresponds to coding
The all or part of the CRW gene of beta- tubulin.SEQ ID NO:19 and SEQ IDNO:Each of 20 contain 23 cores
The T7 promoter sequence of thuja acid, respectively in 1-23 nucleotide.SEQ ID NO:24-44 shown in 19 nucleotide pair
It should be in SEQ IDNO:96-116 nucleotide shown in 18.SEQ ID NO:24-44 shown in 20 nucleotide pair is answered
In SEQ ID:The reverse complementary sequence of sequence in 18 shown in 428-448 nucleotide.Use crw genomic dna as template
Amplified reaction in, using by SEQID NO:19 and SEQ ID NO:The primer pair of 20 compositions, produces comprising SEQ ID NO:
The amplicon of 339 base-pairs of nucleotide sequence shown in 21 is substantially corresponding to encode following CRW genomes
A part, the protein display have gone out micro- with beta- present in Drosophilamelanogaster and Manduca sexta
The perfect homology of tubulin homologue.SEQ ID NO:Nucleotide sequence shown in 21 is substantially corresponding to SEQ ID NO:
Nucleotide sequence in 18 shown in 96-448 nucleotide.Corresponding sequence in genome amplification subsequence and cDNA sequence it
Between sequence difference is not observed.
It will show corresponding to SEQ ID NO:The amplicons cloned of 21 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 21
Sequence composition shown in thuja acid to as little as the about the 376th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 21
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 21
The substantially reverse complementary series of nucleotide sequence shown in about the 376th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 18 it is complete
Portion or part.
40kDa V-ATPase homologous sequence
The intraorganic energetic supersession of eukaryotic systems sub-cellular is very important function.Vacuole atp synthase participates in
The ATP of enough levels is kept in vacuole.Therefore, vacuole atp synthase can be the target of the inhibition of double chain RNA mediate.
The nucleotide sequence for encoding following albumen is obtained from CRW, the protein display goes out the phase with 40kDa V-ATPase
Like property.SEQ ID NO:32 amino acid sequence translation is shown and Manduca sexta 40-kDa V-ATPase subunit ammonia
The homology of base acid sequence (GenBank number X98825).SEQ ID NO:33 and SEQ ID NO:34 correspond respectively to forward direction
With reversed genome amplification primer (i.e. primer pair), the primer is used for from crw genomic dna, from the library CRW mRNA or from
Thus the cDNA that class libraries generates manufactures amplicon.The sequence of such amplicon should correspond to coding 40kDa V-ATPase's
The all or part of CRW gene.But the nucleotide sequence for the amplicon for using crw genomic dna as template and obtaining with
SEQ ID NO:The cDNA sequence being reported shown in 32 is not consistent.
SEQ ID NO:33 and SEQ ID NO:34 represent the primer of thermal expansion increasing.Every primer is all containing 23 nucleotide
T7 promoter sequence, respectively in 1-23 nucleotide.SEQ IDNO:24-40 shown in 33 nucleotide corresponds to SEQ
ID NO:95-111 nucleotide shown in 32.SEQ ID NO:24-43 shown in 34 nucleotide corresponds to SEQ
ID:The reverse complementary sequence of sequence in 32 shown in 362-381 nucleotide.Use crw genomic dna as the amplification of template
In reaction, using by SEQ ID NO:33 and SEQ IDNO:The primer pair of 34 compositions, produces comprising SEQ ID NO:Show in 35
The amplicon of 291 base-pairs of nucleotide sequence out.It is compared based on Martinez/Needleman-Wunsch DNA, SEQ
ID NO:The 24th nucleotide to the 268th nucleotide only illustrates and SEQ ID NO in 35:Nucleotide sequence shown in 32
About 50% homology.Increase the amplification subsequence and SEQ ID NO that primer pair obtains using the thermal expansion of selection:It is shown in 32
The sequence being reported it is not consistent.Preferably, amplicon is manufactured using the library CRW mRNA or the cDNA obtained from this class libraries.
Following amplicons are manufactured, the amplicon is shown corresponding to SEQ ID NO:The about the 95th nucleotide is extremely in 32
The sequence of about the 381st nucleotide, is cloned the Plasmid DNA that sufficient amount is recycled into plasmid vector, to allow from clone's piece
The insertion convergence T7 promoter of the end Duan Renyi carries out external t7 rna polymerase transcription.Double-stranded RNA is generated, sample is carried out
Biologic test;One RNA segment, positive-sense strand, by SEQ ID NO:The about the 85th nucleotide is to as little as the about the 381st in 32
Sequence composition shown in nucleotide is (the difference is that in SEQ ID NO:It deposits each position that thymidine is shown as in 32
In uracil residues), reverse complemental RNA segment or antisense strand are SEQ ID NO:The about the 381st nucleotide is to as little as in 32
The substantially reverse complementary series of nucleotide sequence shown in about the 95th nucleotide, wherein uracil suitably replaces thymus gland
Pyrimidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate the siRNA of sufficient amount
(siRNA).Sample containing 0.15 part every million siRNA or dsRNA is used for previously described CRW diet biologic test,
Larva is allowed to feed 13 days.Compared with control, the CRW larva for feeding the diet containing dsRNA illustrates obvious life
Long inhibition and the death rate, the dsRNA correspond to SEQ ID NO:The all or part of sequence shown in 32.
EF1 α homologous sequence
Transcription extends and transcription factor is critically important for metabolism, they can be the inhibition for double chain RNA mediate
Favo(u)rable target.
At least two CRW cDNA sequences are identified for the present invention, they by with once for can the code extension factor
The homologue of 1alpha (EF1 α).
Such as SEQ ID NO:The amino acid translation of singlet CRW cDNA sequence shown in 36 illustrate with
The homology of Drosophila melanogaster EF-1-alpha amino acid sequence (GenBank number X06870).Also from
The other sequences for being predicted to be coding EF1 α homologous protein are identified in CRW cDNA in intestines library.These sequences are compared, are produced
Raw UNIGENE sequence, such as SEQ ID NO:Shown in 40, it is predicted to be the EF1 α albumen that can encode referred to herein as 48D
Homologue.Several of the sequence for including in the singlet, which are predicted to be, can encode following amino acid sequences, the amino acid sequence
Show the homology with a variety of EF1 α homologous protein sequences comprising but be not limited to, Bombyx mori EF1 α (GenBank
Number D13338), Alternia species EF1 α (GenBank number X03704), Spragueialeo EF1 α (GenBank number
U85680), Apis mellifera EF1 α (GenBank number AF015267), Anlsakis simplex EF1 α
(GenBank number AJ250539), Papaipema species EF1 α (GenBank number AF151628),
EphedruspersicaeEF1 α (GenBank number Z83663), Papilio garamas EF1 α (GenBank number
AF044833), Alysia lucicola EF1 α (GenBank number Z83667), Braco species EF1 α (GenBank number
Z83669), Histeromerus mystacinusEF1 α (GenBank number Z83666) and Caenorhabditis
Elegans EF1 α (GenBank number U41534).
A CRW cDNA sequence for being predicted to be a part of coding EF1 α homologue is referred to herein as B2 sequence,
It is showed in SEQ ID NO:In 36.SEQ ID NO:37 and SEQ ID NO:38 correspond respectively to the gene of forward and reverse
Group amplimer (i.e. primer pair, referring to SEQ ID NO:Corresponding or reverse complementary sequence shown in 36), the primer is used for
From crw genomic dna, amplicon is manufactured from the library CRW mRNA or the cDNA generated from thus class libraries.The sequence of such amplicon
Column correspond to all or part of the CRW gene of coding EF1 α homologous protein.But when using crw genomic dna as template
The nucleotide sequence and SEQ ID NO of the amplicon of acquisition:The cDNA sequence of report shown in 36 is not consistent.
SEQ ID NO:37 and SEQ ID NO:38 represent the sequence for being used for hot amplimer.Each of which contains 23
The T7 promoter sequence of nucleotide, respectively in 1-23 nucleotide.SEQ ID NO:24-44 shown in 37 nucleotide
Corresponding to SEQ ID NO:8-29 nucleotide shown in 36.SEQ ID NO:24-42 shown in 38 nucleotide pair
It should be in SEQ ID:The reverse complementary sequence of sequence in 36 shown in 310-328 nucleotide.Use crw genomic dna as mould
In the amplified reaction of plate, using by SEQ IDNO:37 and SEQ ID NO:The primer pair of 38 compositions, produces comprising SEQ ID
NO:The amplicon of 933 base-pairs of nucleotide sequence shown in 39.SEQ ID NO:Nucleotide sequence shown in 39 with
SEQ ID NO:8th nucleotide shown in 36 is not consistent to the 328th nucleotide.Preferably, with the library CRW mRNA or
The cDNA obtained from this class libraries, for example, SEQ ID NO:36 manufacture amplicon.
Using the library CRW mRNA, or the cDNA prepared from this class libraries, to manufacture following amplicons, the amplicon is shown
Corresponding to SEQ ID NO:The about the 8th nucleotide is cloned and is carried into plasmid to the sequence of the about the 328th nucleotide in 36
Body.The Plasmid DNA of sufficient amount is recycled, external with the insertion convergence T7 promoter progress of permission from any end of cloned sequence
T7 rna polymerase transcription.Double-stranded RNA is generated, sample is subjected to biologic test;One RNA segment, positive-sense strand, by SEQ ID
NO:Sequence composition shown in about the 8th nucleotide to as little as the about the 328th nucleotide in 36 (the difference is that
SEQ ID NO:Each position of thymidine is shown as in 36, and there are uracil residues), reverse complemental RNA segment or antisense
Chain is SEQ ID NO:The reality of nucleotide sequence shown in about the 328th nucleotide to as little as the about the 8th nucleotide in 36
Matter reverse complementary sequence, wherein uracil suitably replaces thymidine.Processing double-stranded RNA is removed with DICER or RNAse III
(dsRNA) sample, to generate the siRNA (siRNA) of sufficient amount.Every million siRNA or dsRNA 0.15 will be contained
The sample divided is used for previously described CRW diet biologic test, and larva is allowed to feed 13 days.Compared with control, feed contains
The CRW larva of the diet of dsRNA illustrates obvious growth inhibition and the death rate, and the dsRNA corresponds to SEQ
IDNO:The all or part of sequence shown in 36.
With SEQ ID NO:Sequence shown in 40 goes to the primer pair designed for expanding following crw genomic dna sequences, institute
State sequential coding EF1 α 48D homologous protein sequence.SEQ IDNO:41 and SEQ ID NO:42 respectively correspond forward and reverse gene
Group amplimer (that is, primer pair).SEQ ID NO:41 and SEQ ID NO:Each of 42 T7 startings containing 23 nucleotide
Subsequence, respectively in 1-23 nucleotide.SEQ ID NO:24-41 shown in 41 nucleotide corresponds to SEQ ID
NO:61-79 nucleotide shown in 40.SEQ ID NO:24-45 shown in 42 nucleotide corresponds to SEQ ID:40
The reverse complementary sequence of sequence shown in middle 562-583 nucleotide.Use crw genomic dna as the amplified reaction of template
In, using by SEQ ID NO:41 and SEQ ID NO:The primer pair of 42 compositions, produces comprising SEQ ID NO:It is shown in 43
Nucleotide sequence 569 base-pairs amplicon, height corresponds to one of the CRW genome for encoding following albumen
Point, the protein display go out in Drosophila melanogaster there is also EF1 α albumen have perfect homology.
SEQ ID NO:From nucleotide sequence shown in the about the 24th nucleotide to about 546 nucleotide and SEQ ID NO in 43:
Nucleotide sequence height shown in about 61-583 nucleotide shown in 40 is corresponding.In genome amplification subsequence and
Sequence difference is not observed between corresponding sequence in cDNA.
It will show corresponding to SEQ ID NO:The amplicons cloned of 43 sequence is into plasmid vector.Recycle the matter of sufficient amount
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 43
Sequence composition shown in thuja acid to as little as the about the 546th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 43
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 43
The substantially reverse complementary series of nucleotide sequence shown in about the 546th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 43 it is complete
Portion or part.
26S proteosome subunit p28 homologous sequence
26S proteosome is big, dependency ATP, multimeric protein enzyme, highly conserved in all eucaryotes.Its
There is general function during a variety of short-lived albumen are selectively removed, the albumen is conjugated with ubiquitin connects before this,
Then it is degraded by 26S proteasome.Ubiquitin pathway has important role, the control in the control of cell cycle
Realized by the selective degradation to a variety of modulins, the albumen include mitotic cell cyclin and to according to
The inhibitor for relying the kinases of cyclin, for example, the p27 of mammalian cell.Therefore, 26S proteosome synthesis is held back
System and it is formed subunit and degree containment can be double chain RNA mediate inhibition selected objective target (Smith et al.,
Plant Phys.1997,113:281-291).
The cDNA sequence that intestines library obtains from CRW be accredited as it is homologous with 26S proteosome subunit amino acid Sequence,
It is used for the present invention.SEQ ID NO:44 are substantially corresponding to intestines cDNA nucleotide sequence in CRW.SEQ ID NO:44 ammonia
The translation of base acid sequence illustrates the homology with 26S proteosome subunit p28 albumen (GenBank number AB009619).SEQ
ID NO:45 and SEQ ID NO:46 correspond respectively to the genome amplification primer (i.e. primer pair) of forward and reverse, the primer
For manufacturing amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.With the generation of this approach
Amplicon should show following sequences, all or part of the following CRW genes of sequential coding, the gene coding
The homologue of 26S proteosome protein subunit.SEQ ID NO:45 and SEQ ID NO:Each of 46 T7 containing 23 nucleotide
Promoter sequence, respectively in 1-23 nucleotide.SEQ ID NO:24-46 shown in 45 nucleotide corresponds to
SEQID NO:130-152 nucleotide shown in 34.SEQ ID NO:24-41 shown in 46 nucleotide corresponds to
SEQ ID:The reverse complementary sequence of sequence in 44 shown in 423-440 nucleotide.Use crw genomic dna as template
In amplified reaction, using by SEQ ID NO:45 and SEQ ID NO:The primer pair of 46 compositions, produces comprising SEQID NO:47
Shown in nucleotide sequence 1113 base-pairs amplicon.SEQ IDNO:Sequence shown in 47 and SEQ ID NO:44
Shown in sequence and uncorrelated, therefore with SEQ ID NO:The cDNA sequence being reported shown in 44 is not consistent.Preferably, make
With CRW mRNA library or thus the cDNA that class libraries obtains manufactures amplicon.
Manufacture shows the amplicon of following sequences, and is cloned into plasmid vector, and the sequence corresponds to SEQ ID
NO:44 the about the 130th nucleotide recycles the Plasmid DNA of sufficient amount, to the about the 440th nucleotide to allow from clone
The insertion convergence T7 promoter of any end of segment carries out external t7 rna polymerase transcription.Generate double-stranded RNA, by sample into
Row biologic test;One RNA segment, positive-sense strand, by SEQ ID NO:The about the 130th nucleotide is to as little as about in 44
Sequence composition shown in 440 nucleotide is (the difference is that in SEQ ID NO:Each position of thymidine is shown as in 44
Set that there are uracil residues), reverse complemental RNA segment or antisense strand are SEQ ID NO:The about the 440th nucleotide is extremely in 44
The substantially reverse complementary series of nucleotide sequence shown in as little as the about the 110th nucleotide, wherein uracil suitably replaces
Thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate the siRNA of sufficient amount
(siRNA).Sample containing 0.15 part every million siRNA or dsRNA is used for previously described CRW diet biologic test,
Larva is allowed to 13 days of feed compared with control, and the CRW larva for feeding the diet containing dsRNA illustrates obvious life
Long inhibition and the death rate, the dsRNA correspond to SEQ ID NO:The all or part of sequence shown in 44.
Juvenile hormone epoxide hydrolase protein
Corpus allatum hormone is controlled and regulates and controls, the mistake to necessary biological processes a variety of in insect life cycle
Journey includes but is not limited to abnormal, breeding and diapause.When suitable, juvenile hormone (JH) concentration is required in harmful elder brother
Reach peak value in worm larva (especially lepidoptera and coleoptera larva) form hemolymph, then it must be degraded, with middle finger
Hormone response effect.The enzyme being related to during reducing juvenile hormone concentration is played by two main paths of metabolic degradation to be made
With.One approach is related to JH esterase (JHE), can hydrolyze methyl esters, provides corresponding acid.Second of approach is young using protecting
Hormone epoxide hydrolase (JHEH) causes glycol to be formed to obtain the hydrolysis to epoxides.JHE is in JH degradation
Contribution is better understood, it was found that it is indeclinable between lepidoptera and coleoptera species.Inhibition to JH esterase
It is related to serious abnormal variation, including but not limited to, larva entanglement (larval wandering), pupate postponement and deformity
The development of intermediate state.On the contrary, people understand less effect of the JHEH in JH metabolism, also, it has shown that in species
Between can change, but recent research is directed to following evidences, and the evidence implies that JHEH may be the main way of JH metabolism
Diameter (Brandon J.Fetterolf, DoctoralDissertation, North Carolina State University
(Feb.10,2002) Synthesis and Analysis of Mechanism Based Inhibitors of Juvenile
HormoneEpoxide Hydrolase from Insect Trichoplusia ni).In at any time, contained with gene
Technology can be the useful target of the harmful organism inhibition for double chain RNA mediate to the interference of any JH degradation pathway.
The corpus allatum hormone epoxide hydrolase sequence obtained from CRW is identified, the present invention is used for.
SEQ ID NO:48 are substantially corresponding to intestines cDNA nucleotide sequence in CRW.SEQ ID NO:48 amino acid sequence translation is pre-
The homology with juvenile hormone epoxide hydrolase in Manduca sexta (GenBank number U46682) is surveyed.SEQID
NO:49 and SEQ ID NO:50 correspond respectively to the amplimer (i.e. primer pair) of forward and reverse, and the primer is used for from CRW
Genomic DNA manufactures amplicon from the library CRW mRNA or the cDNA generated from thus class libraries.The sequence of such amplicon should
The all or part of CRW gene corresponding to coding JHEH homologous protein.SEQ ID NO:49 and SEQ ID NO:Each of 50
T7 promoter sequence containing 23 nucleotide, respectively in 1-23 nucleotide.SEQ ID NO:24-42 shown in 49
Position nucleotide corresponds to SEQ ID NO:7-26 nucleotide shown in 48.SEQ ID NO:24-44 shown in 50
Nucleotide corresponds to SEQ ID:The reverse complementary sequence of sequence in 48 shown in 360-380 nucleotide.With CRW genome
DNA is as in the amplified reaction of template, using by SEQ ID NO:49 and SEQ ID NO:The primer pair of 50 compositions, produces packet
NO containing SEQID:The amplicon of 95 base-pairs of nucleotide sequence shown in 52.The sequence and SEQ ID NO of amplicon:
CDNA sequence shown in 48 does not correspond to.Preferably, use the library CRW mRNA or thus class libraries obtain cDNA as expand
Template nucleotide sequence in reaction manufactures amplicon.
It will show corresponding to SEQ ID NO:The amplicons cloned of 48 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 7th nucleosides in 48
Sequence composition shown in acid to as little as the about the 380th nucleotide is (the difference is that in SEQ ID NO:Chest is shown as in 48
There are uracil residues for each position of gland pyrimidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:In 48 about
The substantially reverse complementary series of nucleotide sequence shown in 380th nucleotide to as little as the about the 7th nucleotide, wherein urine
Pyrimidine suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate foot
The siRNA (siRNA) enough measured.Sample containing 0.15 part every million siRNA or dsRNA is used for previously described
CRW diet biologic test, larva are allowed to feed 13 days.Compared with control, the CRW larva for feeding the diet containing dsRNA is shown
Obvious growth inhibition and the death rate are gone out, the dsRNA corresponds to SEQ ID NO:The whole of sequence shown in 48
Or part.
Rely on the chloride channel albumen homology sequence of expansion
The chloride channel albumen for relying on expansion is assumed to be:Play the part of angled key in eukaryon zooblast system osmotic adjustment
Color.Therefore, show the ability that can express following amino acid sequences nucleotide sequence can be in harmful organism into
The useful target that row RNA inhibits, the amino acid sequence are the chloride channel albumen shown with the dependence expansion identified in the past
Homology.
It is inferred to rely on the amino acid sequence homologous object of the chloride channel (SDCC) of expansion from CRW cDNA library, is used for
The present invention.SEQ ID NO:53 are substantially corresponding to intestines cDNA nucleotide sequence in CRW.SEQ ID NO:53 amino acid sequence
It is confirmed as:It is homologous with the SDCC albumen (GenBank number Y08484) in zebra fish Danio rerio.SEQ ID NO:54
With SEQ ID NO:55 correspond respectively to the hot amplimer (i.e. primer pair) of forward and reverse, and the primer is used for from CRW base
Because of a group DNA, amplicon is manufactured from the library CRW mRNA or the cDNA generated from thus class libraries.The sequence of such amplicon should be right
It should be in all or part of the CRW gene of coding SDCC homologous protein.SEQ ID NO:54 and SEQ ID NO:Each of 55 contain
There is the T7 promoter sequence of 23 nucleotide, respectively in 1-23 nucleotide.SEQ ID NO:24-43 shown in 54
Nucleotide corresponds to SEQ ID NO:78-97 nucleotide shown in 53.SEQ ID NO:24-41 shown in 55 core
Thuja acid corresponds to SEQ ID:The reverse complementary sequence of sequence in 53 shown in 332-349 nucleotide.With crw genomic dna
As in the amplified reaction of template, using by SEQ ID NO:54 and SEQ ID NO:The primer pairs of 55 compositions, produce and include
SEQ ID NO:The amplicon of 318 base-pairs of nucleotide sequence shown in 56, with the CRW gene for encoding following albumen
A part height of group is corresponding, and the protein display has gone out the perfect homology with SDCC albumen.SEQ ID NO:In 56 about
Nucleotide sequence shown in 24th nucleotide to the about the 295th nucleotide and SEQ ID NO:78-349 nucleotide in 53
Shown in nucleotide sequence height it is corresponding.
It will show corresponding to SEQ ID NO:The amplicons cloned of 56 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 56
Sequence composition shown in thuja acid to as little as the about the 295th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 56
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 56
The substantially reverse complementary series of nucleotide sequence shown in about the 295th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 56 it is complete
Portion or part.
Robison ester 1- apodehydrogenase homologous sequence
Robison ester 1- apodehydrogenase (G6PD) is catalyzed Robison ester to 6- phosphoglucose acid esters, while adjoint
The oxidised form of nicotinamide adenine dinucleotide phosphate (NADP+) is reduced to NADPH.NADPH is as a variety of eukaryons
Required confactor in biosynthesis reaction is as known in the art, it is known that it is able to maintain glutathione and goes back original shape for it
Formula.Street cleaner of the glutathione being reduced in eucaryote as dangerous oxidation metabolites plays a role, also, in paddy
Under the assistance of the sweet peptide peroxidase of Guang, by harmful hydrogen peroxide be changed into water (Beutler et al, 1991,
N.Engl.J.Med.324:169-174).Therefore, G6PD can be the suppression in no vertebra harmful organism of double chain RNA mediate
The selected objective target of system.
The homologous amino acid sequence of Robison ester 1- apodehydrogenase (G6PD) is inferred to from CRW cDNA library, it will
It is used for the present invention.SEQ ID NO:57 are substantially corresponding to intestines cDNA nucleotide sequence in CRW.SEQ ID NO:57 amino
Acid sequence is confirmed as:Show the homology with G6PD albumen (GenBank number U72484) in fin fish species.SEQ ID
NO:58 and SEQ ID NO:59 correspond respectively to the genome amplification primer (i.e. primer pair) of forward and reverse, and the primer is used
In from crw genomic dna, amplicon is manufactured from the library CRWmRNA or the cDNA generated from thus class libraries.The sequence of such amplicon
Column should correspond to all or part of the CRW gene of coding G6PD homologous protein.SEQ IDNO:58 and SEQ ID NO:59 is every
A T7 promoter sequence all containing 23 nucleotide, respectively in 1-23 nucleotide.SEQ ID NO:Shown in 58
24-46 nucleotide correspond to SEQ ID NO:113-136 nucleotide shown in 57.SEQ ID NO:Shown in 59
24-45 nucleotide correspond to SEQ ID:The reverse complementary sequence of sequence in 57 shown in 373-394 nucleotide.With
Crw genomic dna is as in the amplified reaction of template, using by SEQ ID NO:58 and SEQ ID NO:The primer of 59 compositions
It is right, it produces comprising SEQ ID NO:The amplicon of 328 base-pairs of nucleotide sequence shown in 60, it is following with encoding
A part height of the CRW genome of albumen is corresponding, and the protein display has gone out the homology with G6PD albumen.SEQ ID NO:
Nucleotide sequence shown in about the 24th nucleotide to the about the 305th nucleotide and SEQ ID NO in 60:113- in 57
Nucleotide sequence height shown in 394 nucleotide is corresponding.
It will show corresponding to SEQ ID NO:The amplicons cloned of 60 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 60
Sequence composition shown in thuja acid to as little as the about the 305th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 60
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 60
The substantially reverse complementary series of nucleotide sequence shown in about the 305th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 60 it is complete
Portion or part.
Actin 42A albumen homology sequence
Actin is generally existing, highly conserved eukaryotic protein, is required for cellular activity and movement
(Lovato et al., 2001, Insect MoI.Biol.20:333-340).A large amount of CRW cDNA sequence is identified,
They are predicted to be possible encoding actin or show the albumen of amino acid sequence structure relevant to actin.Cause
This, the gene of encoding actin homologue can be the useful target of the inhibition of double chain RNA mediate in pest cell.
The UNIGENE cluster (cluster 156_1) identified in intestines cDNA library in corn rootworm is by a plurality of singlet EST sequence
Column are constituted, wherein every is all predicted to be all or part of energy encoding actin homologous protein.These singlet are aligned to
Cluster obtains SEQ ID NO:Consensus sequence shown in 61, being predicted to be can encoding actin homologue.In annotation group
Homologous actin sequence includes but is not limited to 3 segment of Drosophila melanogaster actin, Helicoverpa
Armigera cell fibrinolysin (cytoplasmin) actin A3a (GenBank number X97614), Drosophila
Melanogaster actin (GenBank number X06383), hemichordata Saccoglossus kowalevskii flesh are dynamic
Albumen mRNA sequence and Strongylocentrotus purpuratus actin (GenBank number X05739).
SEQ ID NO:62 and SEQ ID NO:63 correspond respectively to genome amplification primer (the i.e. primer of forward and reverse
It is right), the primer is used to manufacture amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.
The sequence of such amplicon should correspond to all or part of the CRW gene of encoding actin homologous protein.SEQID NO:
62 and SEQ ID NO:Each of 63 T7 promoter sequences containing 23 nucleotide, respectively in 1-23 nucleotide.SEQ
ID NO:24-45 shown in 62 nucleotide corresponds to SEQ ID NO:14-35 nucleotide shown in 61.SEQ ID
NO:24-45 shown in 63 nucleotide corresponds to SEQ ID:Sequence in 61 shown in 449-470 nucleotide it is reversed
Complementary series.In using amplified reaction of the crw genomic dna as template, using by SEQ ID NO:62 and SEQ ID NO:
The primer pair of 63 compositions, produces comprising SEQ ID NO:The amplicon of 503 base-pairs of nucleotide sequence shown in 64,
It is corresponding with a part height of CRW genome for encoding following albumen, and the protein display has gone out homologous with actin
Property.SEQ ID NO:Nucleotide sequence shown in about the 24th nucleotide to the about the 480th nucleotide and SEQ ID in 64
NO:Nucleotide sequence height shown in 14-470 nucleotide is corresponding in 61.
It will show corresponding to SEQ ID NO:The amplicons cloned of 64 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 64
Sequence composition shown in thuja acid to as little as the about the 480th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 64
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 64
The substantially reverse complementary series of nucleotide sequence shown in about the 480th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 64 it is complete
Portion or part.
1 homologous sequence of ADP- ribosylation factor
ADP ribosylation factor 1 be shown as it is critically important in cell because, they DNA damage reparation, cause
Complete effect is embodied during cancer, cell death and Genome stability.Accordingly, it is possible to which double chain RNA mediate can be used
Inhibit, the transcription of ADP- ribosylation factor is selectively interfered in no vertebra pest.
A large amount of CRW cDNA sequence is identified, they are predicted to be:Coding is shown and ADP- ribosylation factor
Homology amino acid sequence.Particularly, a UNIGENE cluster (cluster 881) is made of about 30 (30) EST singlet,
Wherein every be all predicted to be can encoding actin homologous protein all or part.These singlet are aligned to cluster, are obtained
SEQ ID NO:Consensus sequence shown in 65.The amino acid sequence translation of singlet CRW cDNA sequence comprising the cluster predicts
Following amino acid sequences, the amino acid sequence show the homology with ADP- ribosylation factor homologue.Show with
From SEQ ID NO:The ADF- ribosylation factor protein sequence packet of the significant homology for the amino acid sequence that ORF in 65 infers
Include but be not limited to Drosophila melanogaster ADP- ribosylation factor (GenBank number Y10618),
Drosophilia obscura ADP- ribosylation factor (GenBank number AF025798), Anopheles gambiae
ADP- ribosylation factor (GenBank number L11617) and Australian sheep calliphorid (Lycilia cuprina) ADP- core
Glycosylated Factor (GenBank number AF218587).
SEQ ID NO:66 and SEQ ID NO:67 correspond respectively to the amplimer (i.e. primer pair) of forward and reverse, institute
Primer is stated for manufacturing amplicon from the library CRW mRNA or the cDNA generated from thus class libraries from crw genomic dna.It is such
The sequence of amplicon should correspond to all or part of the CRW gene of coding ADP- ribosylation factor homologous protein.SEQ
ID NO:66 and SEQ ID NO:Each of 67 T7 promoter sequences containing 23 nucleotide, respectively in 1-23 nucleosides
Acid.SEQ ID NO:24-42 shown in 66 nucleotide corresponds to SEQ ID NO:70-88 nucleosides shown in 65
Acid.SEQ IDNO:24-40 shown in 67 nucleotide corresponds to SEQ ID:Sequence in 65 shown in 352-368 nucleotide
The reverse complementary sequence of column.In using amplified reaction of the crw genomic dna as template, using by SEQ ID NO:66 and SEQ
ID NO:The primer pair of 67 compositions, produces comprising SEQ ID NO:345 base-pairs of nucleotide sequence shown in 68
Amplicon, corresponding with a part height of CRW genome for encoding following albumen, the protein display has gone out and ADP- ribose
The homology of base factor protein.SEQ ID NO:In 68 shown in the about the 24th nucleotide to the about the 322nd nucleotide
Nucleotide sequence and SEQID NO:Nucleotide sequence height shown in 70-368 nucleotide is corresponding in 65.
It will show corresponding to SEQ ID NO:The amplicons cloned of 68 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 68
Sequence composition shown in thuja acid to as little as the about the 322nd nucleotide is (the difference is that in SEQ ID NO:It is shown as in 68
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 68
The substantially reverse complementary series of nucleotide sequence shown in about the 322nd nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 68 it is complete
Portion or part.
Transcription factor IIB albumen homology sequence
As it was noted above, transcription extends and the translation termination factor is extremely important for metabolism, double-stranded RNA Jie can be
The favo(u)rable target for the inhibition led, for controlling or eliminating the invasion of no vertebra harmful organism.
A kind of CRW cDNA sequence is identified, following amino acid sequences can be encoded by being predicted to be, the amino acid sequence
Column illustrate the homology with transcription factor IIB albumen.SEQ IDNO:69 are used as the basis of building primer pair, described
Primer pair be used to amplify the sequence for encoding following mRNA from CRW genome, and the mRNA is formd for the cDNA sequence
The basis of column.
SEQ ID NO:70 and SEQ ID NO:71 correspond respectively to the hot amplimer (i.e. primer pair) of forward and reverse,
The primer is used to manufacture amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.It is such
The sequence of amplicon should correspond to all or part of the CRW gene of encoding transcription factors IIB homologous protein.SEQ ID NO:
70 and SEQ ID NO:Each of 71 T7 promoter sequences containing 23 nucleotide, respectively in 1-23 nucleotide.SEQ
ID NO:24-44 shown in 70 nucleotide corresponds to SEQ ID NO:4-24 nucleotide shown in 69.SEQ ID
NO:24-44 shown in 71 nucleotide corresponds to SEQ ID:Sequence in 69 shown in 409-429 nucleotide it is reversed
Complementary series.In using amplified reaction of the crw genomic dna as template, using by SEQ ID NO:70 and SEQ ID NO:
The primer pair of 71 compositions, produces comprising SEQ ID NO:The amplicon of 472 base-pairs of nucleotide sequence shown in 72,
It is corresponding with a part height of CRW genome for encoding following albumen, and the protein display has gone out and transcription factor IIb albumen
Homology.SEQ ID NO:In 72 nucleotide sequence shown in the about the 24th nucleotide to the about the 449th nucleotide with
SEQ ID NO:Nucleotide sequence height shown in 4-429 nucleotide is corresponding in 69.
It will show corresponding to SEQ ID NO:The amplicons cloned of 72 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 72
Sequence composition shown in thuja acid to as little as the about the 449th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 72
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 72
The substantially reverse complementary series of nucleotide sequence shown in about the 449th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 72 it is complete
Portion or part.
Chitinase protein
Chitin is β (1 → 4) homopolymer of N-acetylglucosamine, is found in insect exoskeleton.Chitin
It is formed in the reaction of chitin synthase catalysis from UDP-N- acetylglucosamine.Chitin is structural homopolysaccharide,
In the building to this hyperbranched and crosslinking structure, it is related to many enzyme steps.Chitin give insect shape, rigidity and
It supports, provides internal, such as muscle is able to the bracket adhered to.Chitin should also be degraded to a certain degree, to regulate and control elder brother
The step of involved in worm molting process.Thus, it is believed that double chain RNA mediate, inhibition to albumen in these approach, it will
It can be used as means of the control without vertebra pest infestation.
From identifying to showing with chitinase protein homology, intestines cDNA library sequence in corn rootworm translation
Amino acid sequence information.From the alignment to two singlet est sequences, a chitinase consensus sequence (UNIGENE is produced
Cluster number 716_1;SEQ IDNO:73).From the alignment to four singlet sequences, second of chitinase consensus sequence is produced
(UNIGENE cluster number 12381;SEQ ID NO:77).The amino acid sequence translation obtained from the ORF of these UNIGENE is annotated
For:(GenBank is compiled horseradish ape chrysomelid (mustardbeetle) (Phaedon cochleariae) chitinase amino acid sequence
Number Y18011).SEQ ID NO:73 and SEQ ID NO:77 are used as the basis of building primer pair, are used for from CRW genome
In, two sequences are expanded from the library CRW mRNA, or from the cDNA sequence obtained by the library this class mRNA.The nucleotide of such amplicon
Sequence should correspond to all or part of the gene of chitinase encoding homologous protein.
SEQ ID NO:74 and SEQ ID NO:75 correspond respectively to the hot amplimer (i.e. primer pair) of forward and reverse,
The primer is used to manufacture amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.It is such
The sequence of amplicon should correspond to such as SEQ ID NO:The whole of the CRW gene of chitinase encoding homologous protein shown in 73
Or part.SEQ ID NO:74 and SEQ ID NO:Each of 75 T7 promoter sequences containing 23 nucleotide, respectively the
1-23 nucleotide.SEQ ID NO:24-42 shown in 74 nucleotide corresponds to SEQ ID NO:1- shown in 73
19 nucleotide.SEQ ID NO:24-47 shown in 75 nucleotide corresponds to SEQ ID:470-493 nucleosides in 73
The reverse complementary sequence of sequence shown in acid.In using amplified reaction of the crw genomic dna as template, using by SEQ ID
NO:74 and SEQ ID NO:The primer pair of 75 compositions, produces comprising SEQ ID NO:472 of nucleotide sequence shown in 76
The amplicon of a base-pair, corresponding with a part height of CRW genome for encoding following albumen, the protein display goes out
With the homology of chitinase protein.SEQ ID NO:In 76 shown in the about the 24th nucleotide to the about the 516th nucleotide
Nucleotide sequence and SEQ ID NO:Nucleotide sequence height shown in 1-493 nucleotide is corresponding in 76.
It will show corresponding to SEQ ID NO:The amplicons cloned of 76 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 76
Sequence composition shown in thuja acid to as little as the about the 516th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 76
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 76
The substantially reverse complementary series of nucleotide sequence shown in about the 516th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 76 it is complete
Portion or part.
SEQ ID NO:78 and SEQ ID NO:79 correspond respectively to genome amplification primer (the i.e. primer of forward and reverse
It is right), the primer is used to manufacture amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.
The sequence of such amplicon should correspond to such as SEQ ID NO:The CRW gene of chitinase encoding homologous protein shown in 77
It is all or part of.SEQ ID NO:78 and SEQ ID NO:Each of 79 T7 promoter sequences containing 23 nucleotide, respectively
In 1-23 nucleotide.SEQ ID NO:24-44 shown in 78 nucleotide corresponds to SEQ ID NO:Shown in 77
64-84 nucleotide.SEQ ID NO:24-44 shown in 79 nucleotide corresponds to SEQ ID:779-799 in 77
The reverse complementary sequence of sequence shown in nucleotide.In using amplified reaction of the crw genomic dna as template, using by SEQ
ID NO:78 and SEQ ID NO:The primer pair of 79 compositions, produces comprising SEQ ID NO:Nucleotide sequence shown in 80
The amplicon of 912 base-pairs.SEQ ID NO:The comparison of cDNA sequence shown in 77 and amplification subsequence discloses, at two
There is substantive difference, only about 32% sequence identity between sequence.Preferably, using primer pair, such as SEQ ID
NO:Primer pair shown in 78 boxes 79 and mRNA or cDNA manufacture amplicon as template, to avoid such inconsistent.
It will show corresponding to SEQ ID NO:The amplicons cloned of 77 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 64th core in 77
Sequence composition shown in thuja acid to as little as the about the 799th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 77
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 77
The substantially reverse complementary series of nucleotide sequence shown in about the 799th nucleotide to as little as the about the 64th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 77 it is complete
Portion or part.
Ubiquitin binding enzyme homologous sequence
Ubiquitin pathway has important role in the control of cell cycle, this is by the spy to a large amount of modulins
For specific degradation come what is realized, the albumen includes mitotic cell cyclin, or the kinases to cyclin dependent
Inhibitor, for example, the p27 of mammalian cell.Therefore, the gene for encoding ubiquitin and related component can be double-stranded RNA Jie
The inhibition led selected objective target (Smith et al., Plant Phys.1997,113:281-29).Rely on the albumen water of ubiquitin
Solution approach is one of the main path in eucaryote to intracellular protein selective destruction.The combination of ubiquitin and substrate is by obvious
In the enzyme adjustment of diverse array.The targeting of proteolysis can also be dropped with it by multi-subunit 26S protease in the ubiquitination of substrate
The step of solution is between peptide is regulated and controled.The complexity of ubiquitin system implys that it for albumen circulation in eukaryocyte regulation
Central role, and involve other albumen in approach, including ubiquitin kinase, ubiquitin binding enzyme, ubiquitin-protein ligase
And 26S proteosome subunit component.Thus, it is believed that the inhibition to the pathway protein that RNA is mediated will can be used as control nothing
The means of vertebra pest infestation use.
Following CRW cDNA library sequences are identified, following amino acid sequences, the amino can be encoded by being predicted to be
Acid sequence illustrates the homology with ubiquitin binding enzyme.SEQ IDNO:81 are used as the basis of building primer pair, described to draw
For object to for manufacturing amplicon, the amplicon includes all or part of the ubiquitin binding enzyme from corn rootworm.
SEQ ID NO:82 and SEQ ID NO:83 correspond respectively to genome amplification primer (the i.e. primer of forward and reverse
It is right), the primer is used to manufacture amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.
The sequence of such amplicon should correspond to all or part of the CRW gene of coding ubiquitin binding enzyme homologous protein.SEQ ID
NO:82 and SEQ ID NO:Each of 83 T7 promoter sequences containing 23 nucleotide, respectively in 1-23 nucleotide.
SEQ ID NO:24-42 shown in 82 nucleotide corresponds to SEQ ID NO:16-34 nucleotide shown in 81.
SEQ IDNO:24-42 shown in 83 nucleotide corresponds to SEQ ID:Sequence in 81 shown in 295-313 nucleotide
Reverse complementary sequence.In using amplified reaction of the crw genomic dna as template, using by SEQ ID NO:82 and SEQ
ID NO:The primer pair of 83 compositions, produces comprising SEQ ID NO:344 base-pairs of nucleotide sequence shown in 84
Amplicon, corresponding with a part height of CRW genome for encoding following albumen, the protein display has gone out in conjunction with ubiquitin
The homology of enzyme.SEQ ID NO:Nucleotide sequence shown in about the 24th nucleotide to the about the 321st nucleotide in 84
With SEQ ID NO:Nucleotide sequence height shown in 16-313 nucleotide is corresponding in 81.
It will show corresponding to SEQ ID NO:The amplicons cloned of 84 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 84
Sequence composition shown in thuja acid to as little as the about the 253rd nucleotide is (the difference is that in SEQ ID NO:It is shown as in 84
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 84
The substantially reverse complementary series of nucleotide sequence shown in about the 253rd nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 84 it is complete
Portion or part.
Glyceraldehyde-3-phosphate dehydrogenase homologous sequence
Sugar decomposition approach is critically important approach in most of biologies, is related to generating metabolism from the degradation of glucose
Energy.In the second stage of sugar decomposition approach, an important enzyme is glyceraldehyde-3-phosphate dehydrogenase (G3PDH), is existed
In the case where NAD+ and inorganic phosphate, the phase can be catalyzed glyceraldehyde 3-phosphate and be oxidized to glycerol 3-phosphate-phosphoric acid, be subsequently formed
NADH.The important component of the reaction is that energy encodes the base of enzyme relevant to sugar decomposition approach by the formation storage of NADH
Cause, and particularly, coding can become in the gene for possessing the enzyme in the step of being related to can be used to form energy reserve object
The particularly useful target of the inhibition of double chain RNA mediate is carried out in no vertebra harmful organism object.
Following CRW cDNA library sequences are identified, following amino acid sequences, the amino can be encoded by being predicted to be
Acid sequence illustrates and the homology of glyceraldehyde-3-phosphate dehydrogenase (G3PDH) albumen.From the weight of three singlet est sequences
Folded sequence assembly goes out SEQ ID NO:The consensus sequence of cluster shown in 85.Nucleotide sequence SEQ ID NO:The amino of ORF in 85
G3PDH amino acid sequence (the GenBank that acid sequence is illustrated and obtained from Crytococcus curvatus G3PDH gene
Number AF126158) and from Drosophilapseudoobscura G3PDH protein amino acid sequence (GenBank number
AF025809 homology).Therefore, SEQ ID NO:The amino acid sequence translation of sequence shown in 85 is predicted to be CRW
A part of G3PDH zymoprotein.SEQ ID NO:Nucleotide sequence shown in 85 is used as the base that building thermal expansion increases primer pair
Plinth, the primer pair is for manufacturing amplicon, the sequence of the amplicon coding CRW G3PDH enzyme sequence.
SEQ ID NO:86 and SEQ ID NO:87 correspond respectively to the hot amplimer (i.e. primer pair) of forward and reverse,
The primer is used to manufacture amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.It is such
The sequence of amplicon should correspond to all or part of the CRW gene of coding G3PDH homologous protein.SEQID NO:86 and SEQ
ID NO:Each of 87 T7 promoter sequences containing 23 nucleotide, respectively in 1-23 nucleotide.SEQ ID NO:86
Shown in 24-45 nucleotide correspond to SEQ ID NO:103-124 nucleotide shown in 85.SEQ ID NO:87
Shown in 24-45 nucleotide correspond to SEQ ID:The reverse complemental sequence of sequence in 85 shown in 573-594 nucleotide
Column.In using amplified reaction of the crw genomic dna as template, using by SEQ ID NO:86 and SEQ ID NO:87 compositions
Primer pair, produce comprising SEQ ID NO:The amplicon of 538 base-pairs of nucleotide sequence shown in 88, with volume
A part height of the CRW genome of the following albumen of code is corresponding, and the protein display has gone out the homology with G3PDH enzyme.SEQ
ID NO:Nucleotide sequence shown in about the 24th nucleotide to the about the 515th nucleotide and SEQ ID NO in 88:In 85
Nucleotide sequence height shown in 103-594 nucleotide is corresponding.
It will show corresponding to SEQ ID NO:The amplicons cloned of 88 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 88
Sequence composition shown in thuja acid to as little as the about the 515th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 88
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 84
The substantially reverse complementary series of nucleotide sequence shown in about the 515th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 88 it is complete
Portion or part.
Ubiquitin B homologous sequence
As described above, ubiquitin protein degradation pathway has important role in the control of cell cycle, this is to pass through
The selective degradation of a large amount of modulins is realized, the albumen includes mitotic cell cyclin, or to dependence
The inhibitor of the kinases of cyclin, for example, the p27 of mammalian cell.Therefore, the base of ubiquitin and related component is encoded
Because can be inhibition for double chain RNA mediate selected objective target (Smith et al., Plant Phys.1997,113:281-
291)。
Following CRW cDNA library sequences are identified, following amino acid sequences, the amino can be encoded by being predicted to be
Acid sequence illustrates the homology with ubiquitin B albumen.SEQ ID NO is assembled from the overlap of four singlet est sequences:
The consensus sequence of UNIGENE cluster shown in 89.Nucleotide sequence SEQ ID NO:89 amino acid sequence translation illustrate with
Polymerization ubiquitin amino acid sequence (GenBank number AF034789) from Amoeba proteus and come from Drosophila
The homology of the ubiquitin protein sequence (GenBank number M22428) of melanogaster.Therefore, SEQ ID NO:Shown in 89
The amino acid sequence translation of sequence, which is believed, can encode ubiquitin B.SEQ ID NO:89 are used as building for hot amplified reaction
Primer pair basis, the primer pair be used for amplification coding corn rootworm ubiquitin B amino acid sequence all or part of core
Nucleotide sequence.
SEQ ID NO:90 and SEQ ID NO:91 correspond respectively to the hot amplimer (i.e. primer pair) of forward and reverse,
The primer is used to manufacture amplicon from the library CRWmRNA or the cDNA generated from thus class libraries from crw genomic dna.It is such
The sequence of amplicon should correspond to all or part of the CRW gene of coding ubiquitin B homologous protein.SEQ IDNO:90 and SEQ
ID NO:Each of 91 T7 promoter sequences containing 23 nucleotide, respectively in 1-23 nucleotide.SEQ ID NO:90
Shown in 24-40 nucleotide correspond to SEQ ID NO:62-78 nucleotide shown in 89.SEQ ID NO:In 91
The 24-47 nucleotide shown correspond to SEQ ID:The reverse complemental sequence of sequence in 89 shown in 399-422 nucleotide
Column.In using amplified reaction of the crw genomic dna as template, using by SEQ ID NO:90 and SEQ ID NO:91 compositions
Primer pair, produce comprising SEQ ID NO:The amplicon of 407 base-pairs of nucleotide sequence shown in 92, with volume
A part height of the CRW genome of the following albumen of code is corresponding, and the protein display has gone out the homology with ubiquitin binding enzyme.
SEQ ID NO:Nucleotide sequence shown in about the 24th nucleotide to the about the 384th nucleotide and SEQ ID NO in 92:
Nucleotide sequence height shown in 62-422 nucleotide is corresponding in 89.
It will show corresponding to SEQ ID NO:The amplicons cloned of 92 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 24th core in 92
Sequence composition shown in thuja acid to as little as the about the 384th nucleotide is (the difference is that in SEQ ID NO:It is shown as in 92
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 92
The substantially reverse complementary series of nucleotide sequence shown in about the 384th nucleotide to as little as the about the 24th nucleotide, wherein
Uracil suitably replaces thymidine.The sample of processing double-stranded RNA (dsRNA) is removed, with DICER or RNAse III to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 92 it is complete
Portion or part.
JH esterase homologue
As described above, corpus allatum hormone necessary biological processes a variety of in insect life cycle are controlled and
Regulation comprising but be not limited to, abnormal, breeding and diapause.Using gene containment technology to JH synthesis or the interference of degradation pathway
It may be the effective target of the harmful organism control of double chain RNA mediate.
The corpus allatum hormone esterase homologous sequence obtained from CRW is identified, the present invention is used for.SEQ ID
NO:93 height correspond to intestines cDNA nucleotide sequence in CRW.SEQ ID NO:93 amino acid sequence translation predicts and protects children
The homology of hormone esterase (JHE).SEQ ID NO:94 and SEQ ID NO:95 amplifications for corresponding respectively to forward and reverse are drawn
Object (i.e. primer pair), the primer are used to make from crw genomic dna from the library CRWmRNA or the cDNA generated from thus class libraries
Make amplicon.The sequence of such amplicon should correspond to all or part of the CRW gene of coding JHE homologous protein.SEQ
IDNO:94 and SEQ ID NO:Each of 95 T7 promoter sequences containing 23 nucleotide, respectively in 1-23 nucleotide.
SEQ ID NO:24-45 shown in 94 nucleotide corresponds to SEQ ID NO:58-79 nucleotide shown in 93.
SEQ ID NO:24-46 shown in 95 nucleotide corresponds to SEQ ID:Sequence in 93 shown in 338-360 nucleotide
Reverse complementary sequence.In using amplified reaction of the crw genomic dna as template, using by SEQ ID NO:94 and SEQ
ID NO:The primer pair of 95 compositions, produces comprising SEQ ID NO:348 base-pairs of nucleotide sequence shown in 96
Amplicon preferably, uses the library CRW mRNA or from the cDNA that this class libraries obtains as the template nucleotide sequence in amplified reaction
Column.
It will show corresponding to SEQ ID NO:The amplicons cloned of 96 sequence recycles the matter of sufficient amount into plasmid vector
Grain DNA is transcribed with allowing the insertion convergence T7 promoter from any end of cloned sequence to carry out external t7 rna polymerase.It produces
Raw double-stranded RNA, carries out biologic test for sample;One RNA segment, positive-sense strand, by SEQ ID NO:About the 45th core in 96
Sequence composition shown in thuja acid to as little as the about the 302nd nucleotide is (the difference is that in SEQ ID NO:It is shown as in 96
There are uracil residues for each position of thymidine), reverse complemental RNA segment or antisense strand are SEQ ID NO:It is big in 96
The substantially reverse complementary series of nucleotide sequence shown in about the 302nd nucleotide to as little as the about the 45th nucleotide, wherein
Uracil suitably replaces thymidine to be gone to handle the sample of double-stranded RNA (dsRNA) with DICER or RNAse III, to generate
The siRNA (siRNA) of sufficient amount.Sample containing 0.15 part every million siRNA or dsRNA is used for described previously
CRW diet biologic test, larva be allowed to feed 13 days.Compared with control, the CRW larva exhibition of the diet containing dsRNA is fed
Obvious growth inhibition and the death rate are shown, the dsRNA corresponds to SEQ ID NO:Sequence shown in 96 it is complete
Portion or part.
With from the parallel biologic test that the siRNA that double stranded rna molecule generates carries out, to double-strand listed above
Ten in RNA molecule are examined.By double stranded RNA sequences sample or the small interference come from double stranded RNA sequences sample preparation
(its every kind both corresponds to following amino acid sequences to RNA sample, and it is homologous that the amino acid sequence is noted as selected target gene
Object, they include:40kDa V-ATPase homologue, 26S proteosome subunit p28 homologue, protects children at EF-1-alpha homologue
Hormone epoxide hydrolase homologue, beta- tubulin homologues, two kinds of chitinase homologues, turns CHD3 homologue
Record factor IIB homologue and JH esterase homologue (correspond respectively to SEQ ID NO:35,SEQ ID NO:39,SEQ
ID NO:47,SEQ ID NO:52,SEQ ID NO:7,SEQ ID NO:21,SEQ ID NO:76,SEQ ID NO:80,SEQ
ID NO:72 and SEQ ID NO:06)) (contain quilt for 30 microlitres to be applied to insect diet every about the concentration of 1,000,010 parts
The solution for being adjusted to the double-stranded RNA sample of suitable concentration is added to the microtitre version hole containing 200 microlitres of every hole insect diet
In).Every kind of sample uses 18 holes in total.RNA sample diffuses into after diet, and single the first instar larvae only is added to often
In a hole.As described above, to biologic test culture about 13 days, morbidity and mortality are monitored daily.By amino acid sequence
Variant Cry3Bb1 insecticidal crystalline protein (is named as killing elder brother in English et al. (U.S. Patent number 6,642,030)
Worm protein 11 231) it is used as positive control, for observing the insecticidal bioactivity particular for harmful corn rootworm.According to
Described in English et al., Cry3Bb is used for diet, the difference is that the concentration of Cry3Bb is adjusted to often in diet
Million parts 200-300.Only test is also included in the independent control sample that buffer or water are handled.Double-stranded RNA pair
In the same old way product and additional recessive control is used as from the siRNA control sample that double-stranded RNA control sample generates is included in
Come (RNAi Kit, AMBION, Austin, Texas).
It is shown using the initial evaluation and test that the double stranded rna molecule obtained from above-mentioned ten sequences carries out, is allowed to feed and contains
The larva of the diet of following double-stranded RNAs illustrates the significant death rate compared with control, and the double-stranded RNA corresponds to 40kDa V-
ATPase homologue (SEQ ID NO:35), CHD3 homologue (SEQ ID NO:And beta- tubulin homologues (SEQID 7)
NO:31).Based on such as a result, additional biologic test is carried out, to examine small interference double-stranded RNA particle whether more double than overall length
Chain RNA molecule is more effective.
Alpha tubulin homologous sequence
Eukaryotic cells usually utilize cytoskeletal structure element, they are not only important to as machinery mount, also heavy
In the half flexible microfibril of the holding to cell shape cell is moved, help them in mitosis (cytoplasm point
Split) in separation, and, in vertebrate and invertebrate, be used for contraction of muscle.Relatively hard micro-pipe by alpha and
Beta tubulin is constituted, they have important role during following:It is risen as transporter vesicle and cell a set of high
Fast highway plays a role, and for separating chromosome during mitosis (nuclear fission).Flexible intermediate filament provides pair
In at least additional intensity of entire cell results.It is also known that cytoskeleton is participated in across cytoplasmic signal process.It considers
These functions, it is believed that, any interference to cytoskeleton or even the minor alteration of its integrality all may cause
To the disease consequence of cell.
Identify at least one CRW cDNA library sequence, be accredited as to encode show it is same with following albumen
The amino acid sequence of source property, the albumen is referred to herein as alpha tubulin, more specifically, referring to sequence herein
SEQ ID NO shown in table:163.Such as SEQ ID NO:The amino acid sequence translation of sequence shown in 163, which is believed, to be encoded
Alpha tubulin or its segment.SEQ ID NO:63 are used as constructing the basis of following sequences, and the sequence is predicted to be:
When being expressed in E.coli by T7 or being expressed in plant by Plant functional promoters, double-stranded RNA can be formed.It is used as
Sequence in the basis of such double-stranded RNA coded sequence is SEQ ID NO shown in sequence table:97 the 58th nucleotide is extremely
1010th nucleotide.The sequence can be used as RNA molecule expression, is purified, tests in feeding test in vitro, with measurement
Inhibition to corn rootworm.
T7 rna polymerase promoter is introduced in SEQ ID NO:97 the 58th nucleotide to the 1010th nucleotide shows
The upstream of nucleotide sequence out generates RNA from the construct (pIC17527).Using three parts of repeat samples, for jade
Such RNA is examined in the external feeding test of rice rootworm, it is described to examine for the control of beta tubulin positive (above
It is described), 200ppm Cry3Bb and unprocessed control carry out, and measure average mortality.Unprocessed control sample
Product illustrate the death rate less than about 3-5%, and all other sample survey illustrates about 20 to about 55%
The death rate.Cry3Bb sample display has gone out the death rate of about 20 to about 36%, and pIC17527 sample (15ppm) is then shown
The death rate of about 38 to about 45% out.It is similarly D8 (beta tubulin as indicated above) sample of about 15ppm
Show the death rate of about 38 to about 52%.Based on these results, alpha tubulin construct is placed on plant function
It can be used for maize transformation plant, for the ability for resisting corn rootworm invasion, to from the conversion under the control of property promoter
The transformation event of generation is examined.
With SEQ ID NO:Nucleotide sequence area shown in 97 converts the root from R0 plant.In short, by upper
State SEQ ID NO:The sequence of dsRNA construct is encoded in 97 at 5 ' ends and by being operatively connectable to corn hsp70 introne
The sequence that e35S promoter is constituted is connected, and is connected at 3 ' ends with NOS3 ' tanscription termination and poly- polyadenylation sequence.The expression cassette is put
It is placed in the downstream of careless glycosides phosphine selection box.Then these connected boxes are placed into Agrobacterium tumefaciens plant
Transformation function carrier, new support are named as pMON72829 (alpha tubulin dsRNA construct), are used for maize transformation group
It knits, makes it have careless glycosides phosphine tolerance, select event, the root for being transferred into soil .R0 plant is fed to western corn rootworm
Larva (WCR, Diabrotica virifera).With the MS0D culture medium containing antibiotic and careless glycosides phosphine by transgenic corns root
It is transferred on culture dish, is selected in vitro.Make invasion of the every root by two WCR larvas in each ware with thin head brush.With
Parafilm seals these wares, prevents larva from escaping.Test is in 27 DEG C, 60% RH Percival incubator in completely black
Dark lower progress.Pollution and larva quality are monitored.After root tissue is fed six days, larva is transferred in 96 orifice plates
WCR diet in.Larva is allowed to feed the diet eight days, so that total test is that fortnight is long.To larva quality and survival
It is recorded, for analyzing.A kind of analyze is carried out on the basis of larva qualitative data and Dunnett ' s are examined, for seeking
Look for the significance,statistical being compared with LH244 (unconverted negative control).WCR larva is feeding two kinds of events, ZM_
After S125922 and ZM_S125938, compared with the growth of the larva of feed negative control plant, hence it is evident that hypoevolutism (α=
0.05) (p < 0.02).The larva of feed negative control plant illustrates about 0.6 to about 0.8mg average larva matter
Amount, and the larva for feeding transgenosis root then illustrates about 0.1 to about 0.2mg average larva quality.
After reaching suitable size, by transgenic plant (R0) plantation for using pMON72829 to generate to containing Metromix
In 10 inches of bottles of soil.When plant reaches V4 growth phase, make about 1000 Western corn rootworms (WCR,
Diabrotica virifera) ovum invades into root area.The non-transgenic corn of same genotype is in similar growth phase
It is invaded, to function as negative control.Preincubate is carried out to ovum, makes it possible to hatch in 24 hours of invasion.Larva quilt
Allow to unite in root system and feed 3 weeks.Plant is removed from soil, it is cleaned, so that can be subject to for larva feed to root
Evaluation and test.Root damage is classified using Node Injury Scale (NIS), wherein 0, expression does not damage, and 1 indicates root
Short 1.5 inches of a section within, 2 indicate that two sections are short, and 3 indicate that 3 sections are short.Because after the plant for evaluation and test is conversion
Directly from tissue culture, also as transformation event is unique, so only evaluating and testing single plant plant for every kind of event at this time
Strain, cannot obtain statistical result.All plant in test all illustrate the sign of larva feed, this shows to obtain success
Invasion.Negative control plant root is presented moderate and damages to serious, average out to about 1.9 on Node Injury Scale.It is right
Individual plants from eight kinds of different transgenic events are examined.Three plants of root is provided to children in these genetically modified plants
The outstanding control of worm feed, Node InjuryScale are average about 0.2 or smaller.Two plants of the root in genetically modified plants
Portion illustrates moderate feed damage, and three plants of other transgenosis five do not show the control to larva feed.The tables of data
It is bright, it is expressed in genetically modified plants and when the plant is provided in corn rootworm diet, coding can form the RNA sequence of dsRNA
The Double-stranded nucleotide sequence of column is entirely capable of providing the protection for being directed to corn rootworm pest infestation.
About lack the consistent observable death rate or select carry out the sequence of gene containment (including
EF1alpha, 26S proteosome subunit and a variety of other cDNA sequences) other effects, a kind of explanation may be, for these
For gene, expression is to encode homologue present in the gene group of following albumen, and the albumen has similar function, but
Be show sufficiently large sequence difference so that using choosing come contained these sequences when, RNAi approach cannot play work
For containing homologue.
Embodiment 2
Present embodiment describes the inhibition of significant harmful organism, this is by containing to the feeding of no vertebra harmful organism from this
The diets of the double stranded RNA sequences that harmful organism obtains is realized.
By the sample for the double stranded RNA sequences that application is obtained from six kinds of different corn rootworm cDNA library sequences, to make
It prepares enough to raise the artificial diet of Corn rootworm larvae.Corn rootworm larvae by permit feed the diet a few days, compared be only permitted into
The corn rootworm for eating control diet, monitors the death rate, disease incidence and hypoevolutism.For the nucleotide sequence in diet
It is from SEQID NO:35,SEQ ID NO:29,SEQ ID NO:47,SEQ ID NO:52,SEQID NO:7 and SEQ ID NO:
What sequence shown in 31 obtained, they every kind correspond to the nucleotide sequence that obtains from corn rootworm cDNA library, they are pushed away
Disconnected amino acid sequence translation corresponds respectively to be noted as 40kDa V-ATPase homologue, EF1 α homologue, 26S proteosome Asia
Base homologue, juvenile hormone epoxide hydroxylase enzyme homologue, CHD3 homologue and 'beta '-tubulin homologue.
As described above, the double-stranded RNA for corresponding to these sequences is generated.By using RNAseIII enzyme to corresponding
DsRNA is cut to generate siRNA, it is known that dsRNA can be cut into the dsRNA segment of 12-15bp by the enzyme, and the segment contains
There are 3 ' suspensions and the 5 ' phosphoric acid and 3 ' C-terminals of 2-3 nucleotide.The siRNA generated in this way is shown with technical ability
Property identical with the siRNA generated with Dicer enzyme (involved in eucaryotic RNA i approach).
As described above, dsRNA and siRNA is loaded in CRW diet with about 0.15ppm.As described above,
For every kind of dsRNA or siRNA sample, 12 single Corn rootworm larvaes are individually examined, assessment result after 13 days.
Compared with unprocessed control (UTC), feeds in the larva of the diet containing the following dsRNA sequences of 0.15ppm and see
The significant decrease (p < 0.05) of larva quality is observed, the dsRNA sequence is SEQ ID NO:35,SEQ ID NO:52,
SEQ ID NO:7 and SEQ ID NO:Shown in 31.Corresponding to SEQ ID NO:35,SEQ ID NO:39,SEQ ID NO:47
With SEQ ID NO:The siRNA of 7 sequence also provides the significant decrease (p < 0.05) of larva quality.But larva sample is big
It is small to be but not enough to determine foundation:Causing larva quality compared with control, utmostly the dsRNA or siRNA of reduction are to become at random actually
The result of change?Still the specific result of the inhibition to biological functions some in rootworm larvae based on double chain RNA mediate?Cause
This, is recorded a demerit based on these, with biggish larva sample size, to corresponding to SEQ ID NO:35,SEQ ID NO:39,SEQ ID
NO:7 and SEQ ID NO:31 RNA sequence is evaluated and tested again.
For each of four kinds of RNA sequences in evaluation and test, dsRNA or siRNA sample is applied in each of 72 holes.It is logical
It crosses 30 microlitres of volume applications containing RNA to diet surface and sample is allowed to immerse and allow diet dry tack free, press
According to described above, to the dsRNA or siRNA of each hole loading 0.15ppm.Single larva is added in each hole, culture 13
It.Evaluate and test larval mortality and disease incidence, the quality of measurement survival larva.Biological results are shown in table 1.
1. Biological results of table
All siRNA samples are all every hole 0.15ppm
UTC-10mM TrisHCl pH7.5
STE- standard error
In dsRNA biologic test, 1- phageλ dsRNA, EPICENTERTECHNOLOGIES, Madison,
Wisconsin;In siRNA biologic test,RNAi Kit, AMBION, Austin, Texas
2-Cry3Bb variant is 300ppm in dsRNA biologic test, is 200ppm in siRNA biologic test.
Tukey ' s HSD method is used, is mutually compared to all samples, rather than is only compared with any single compare
Compared with.It is slow that every kind of examined dsRNA or siRNA observed significant larvae development, this is by compared with survival larva
The average quality of unprocessed control reduces to judge.More importantly, double-chain small disturbance RNA sample display has gone out to cause
The ability of the death rate and disease incidence (the larva quality based on reduction) of certain level, the level is at least and positive control sample
Cry3Bb variant 11231 is equally effective.The above results show what the mRNA sequence present in the corn rootworm cell obtained
Any double stranded rna molecule, when being supplied to corn rootworm in the diet of corn rootworm, all effective in inhibiting harmful corn rootworm pair
The invasion of plant species.
Embodiment 3
Present embodiment describes the nucleotide sequences for expressing in plant cell, and mention in corn rootworm diet
For the effect of such nucleotide sequence.
It goes to construct with the CHD3 coded sequence obtained from corn rootworm cDNA library and encodes the nucleosides for being stabilized double-stranded RNA
Acid sequence.Encode CHD3 amino acid sequence ortholog or homologue a part, SEQ ID NO:CDNA sequence shown in 171
Column be used to construct primer pair, and the primer pair is used for hot amplified reaction, wherein using corn rootworm genomic templates DNA.
SEQID NO:5 and SEQ ID NO:Primer pair energy amplifying doulbe-chain genomic amplicons shown in 6 a, wherein chain shows SEQ
ID NO:Sequence shown in 7.From SEQ ID NO:Nucleotide sequence shown in 7 generates three nucleotide sequence segments.It uses
SEQ ID NO:Nucleotide sequence shown in 7 is as template, in hot amplified reaction, with showing SEQ ID NO:8 and SEQ
ID NO:The thermal expansion of sequence shown in 9 increases primer pair, produces first nucleotide fragment (SEQ ID NO:174).Use SEQ
ID NO:Nucleotide sequence shown in 7 is as template, in hot amplified reaction, with showing SEQ ID NO:11 and SEQ ID
NO:The thermal expansion of sequence shown in 12 increases primer pair, produces Article 2 nucleotide fragment (SEQ IDNO:13).Use SEQ ID
NO:Nucleotide sequence shown in 7 is as template, in hot amplified reaction, with showing SEQ ID NO:14 and SEQ ID NO:
The thermal expansion of sequence shown in 15 increases primer pair, produces Article 3 nucleotide fragment (SEQ ID NO:16).First silver chain rupture
One of 3 ' ends it is complementary with 3 ' ends of one of Article 2 piece chain rupture, thus in the hot amplified reaction containing this two segments, this
A little complementary end hybridization, to allow two chains to carry out polymerase-mediated extension from the 3 ' ends of their difference.Article 2 segment
3 ' ends of another chain are complementary with 3 ' ends of one of Article 3 piece chain rupture, thus in the hot amplified reaction containing this two segments
In, these complementary end hybridization, to allow two chains to carry out polymerase-mediated extension from the 3 ' ends of their difference.Containing
All these segments and their complementary series, i.e., first, in the hot amplified reaction of Article 2 and Article 3 segment, use SEQ
ID NO:8 and SEQ IDNO:Thermal expansion shown in 15 increases primer sequence, produces such as SEQ ID NO:New sequence shown in 17, should
When new sequence is positioned under the promoter control to work in plant, it can generate and SEQ ID NO:Sequence height shown in 17
Identical RNA nucleotide sequence, only in addition to there are uracil residues to replace thymine residue.The RNA nucleotide sequence
The reverse complemental that can use Article 3 segment Yu first segment is formed as being stabilized RNA molecule, wherein SEQ ID
NO:Part and SEQ ID in 17 corresponding to the about the 303rd nucleotide of Article 3 segment to the about the 473rd nucleotide
NO:Partial hybridization in 17 corresponding to the about the 1st nucleotide of first article of segment to the about the 171st nucleotide, first
It is connected with Article 3 segment by Article 2 nucleotide sequence segment, in this embodiment, by SEQ ID NO:Correspond in 17
About the 172nd nucleotide of Article 2 segment to the part of the about the 302nd nucleotide indicates.Corresponding to SEQ ID NO:17
Nucleotides sequence be listed in the expression in plant cell and lead to the synthesis for being stabilized RNA molecule.It can be by SEQ ID NO:Shown in 17
Nucleotide sequence be transcribed into the plant cell of RNA sequence and can be provided that in the diet of corn rootworm.As the homologous egg of CHD3
It is white to synthesize repressed as a result, feeding the corn rootworm stopping feed of such plant cell, it develops and is obstructed for adult beetles, it is numerous
It grows and is obstructed, it is dead or influenced by these any or all of.
Building coding is gone to be stabilized double-stranded RNA with the 'beta '-tubulin coded sequence obtained from corn rootworm cDNA library
Nucleotide sequence.Coding for beta-tubulin amino acid sequence ortholog or homologue a part, SEQ ID NO:18
Shown in cDNA sequence be used to construct primer pair, the primer pair is used for hot amplified reaction, wherein using corn rootworm gene
Group template DNA.SEQ ID NO:19 and SEQ ID NO:Primer pair energy amplifying doulbe-chain genomic amplicons shown in 20, wherein one
Chain shows SEQ ID NO:Sequence shown in 21.From SEQ ID NO:Nucleotide sequence shown in 21 generates three nucleosides
Acid sequence segment.Use SEQ ID NO:Nucleotide sequence shown in 21 is as template, in hot amplified reaction, with showing
SEQ ID NO:22 and SEQ ID NO:The thermal expansion of sequence shown in 23 increases primer pair, produces first nucleotide fragment (SEQ
ID NO:173).Use SEQ ID NO:Nucleotide sequence shown in 21 is as template, in hot amplified reaction, with showing
SEQ IDNO:25 and SEQ ID NO:The thermal expansion of sequence shown in 26 increases primer pair, produces Article 2 nucleotide fragment (SEQ
ID NO:27).Use SEQ ID NO:Nucleotide sequence shown in 21 is as template, in hot amplified reaction, with showing SEQ
ID NO:28 and SEQID NO:The thermal expansion of sequence shown in 29 increases primer pair, produces Article 3 nucleotide fragment (SEQID
NO:36).3 ' ends of one of the first silver chain rupture are complementary with 3 ' ends of one of Article 2 piece chain rupture, thus containing this two silver
In disconnected hot amplified reaction, these complementary end hybridization, to allow two chains to carry out polymerase Jie from the 3 ' ends of their difference
The extension led.Another chain of Article 2 segment 3 ' end it is complementary with 3 ' ends of one of Article 3 piece chain rupture, thus contain this two
In the hot amplified reaction of segment, these complementary ends hybridization, to allow two chains to be polymerize from their 3 ' ends respectively
The extension that enzyme mediates.Containing all these segments and their complementary series, i.e., first, Article 2 and Article 3 segment
In hot amplified reaction, with SEQID NO:22 and SEQ ID NO:Thermal expansion shown in 29 increases primer sequence, produces such as SEQ ID
NO:New sequence shown in 31 can generate and SEQ ID when the new sequence is positioned under the promoter control to work in plant
NO:The identical RNA nucleotide sequence of the height of sequence shown in 31, only in addition to there are uracil residues to replace thymidine residual
Base.The RNA nucleotide sequence can use the reverse complemental of Article 3 segment Yu first segment, be formed as being stabilized
RNA molecule, wherein SEQ ID NO:Corresponding to the about the 338th nucleotide of Article 3 segment to the about the 577th core in 31
The part of thuja acid and SEQ ID NO:Corresponding to the about the 31st nucleotide of first article of segment to the about the 250th nucleosides in 31
The partial hybridization of acid, first is connected with Article 3 segment by Article 2 nucleotide sequence segment, in this embodiment, by
SEQ ID NO:Part table in 31 corresponding to the about the 251st nucleotide of Article 2 segment to the about the 337th nucleotide
Show.Corresponding to SEQ ID NO:31 nucleotides sequence, which is listed in the expression in plant cell, leads to the synthesis for being stabilized RNA molecule.
It can be by SEQ IDNO:The plant cell that nucleotide sequence shown in 31 is transcribed into RNA sequence can be provided that the meals in corn rootworm
In food.It synthesizes repressed as 'beta '-tubulin as a result, the corn rootworm for feeding such plant cell stops feed, develops and be
Adult beetles are obstructed, and breeding is obstructed, dead or influence by these any or all of.
Embodiment 4
Present embodiment describes one or more combinations with insecticidal action are provided in no vertebra harmful organism diet
Object and one or more synergies from the double stranded RNA sequences obtained without vertebra harmful organism, wherein it is described a kind of or
Insecticidal effect has been had shown that out when being provided in harmful organism diet before a variety of dsRNA sequences.
As described in Example 3, the double-stranded RNA point obtained from the harmful organism is provided in the diet of no vertebra harmful organism
Son leads to the inhibition to biological functions one or more in harmful organism, and thus acts on acquisition insecticidal effect, results in
The death of harmful organism or it is some it is other it is being measured to, reduce pest infestation specific environment or host ability
Feature.One or more other insecticides are added, and (every kind different mutually, and every kind all by obtaining its desinsection with dsRNA
The mode of effect different mode obtains its insecticidal effect), can to control harmful organism it is horizontal improve, and will
It further decreases:When inhibition to obtain heap harmful organism is used alone, harmful organism may to one or more insecticides or
DsRNA develops a possibility that resistance.
To be examined to this, CRW larva is enabled to feed following diets, including the Cry3Bb rootworm into different content
Inhibit the double-stranded RNA of albumen and fixed amount, the RNA is according to preparing described in embodiment 2 or 3, for example, corresponding
In SEQ ID NO:17 or SEQ ID NO:31 dsRNA.It observed the synergy inhibited to harmful organism.Such as embodiment
Shown in 2 and 3, the LD50 amount of Cry3Bb be used to obtain the about 50% insect larvae death rate, and survival larva health
The companion reduction (being judged by Weight of larvae compared with the reduction of negative control) of degree.Reduce insecticidal protein in diet
Amount causes the companion of the death rate to reduce, and the increase of survival larva average weight.It is added and corresponds to SEQ IDNO:31 or SEQ
ID NO:17 dsRNA results in the death rate almost, the average weight of any survival object in the Cry3Bb of every kind of concentration
Amount is also greatly reduced.This demonstrate synergies.Concertedness may be by introducing the Cry3Bb of any content, and (it has been shown
For:Can in middle goldbeater's skin introduction hole) caused by the interference of intestines in larva is obtained.Hole can permit higher levels of double-strand
RNA type penetrates in cell, or even penetrates into hemolymph, cause it is highly efficient dsRNA type is transported into larva,
Thus lead to more efficiently reduction in the containment to target mRNA.Hole forms the specific of composition and double stranded RNA composition
Combination leads to increased and concertedness insecticidal action, because dsRNA can more disperse in hemolymph, to far from harmful organism intestines
The cell and tissue in road are exerted one's influence.Specific hole forms composition, from B.thuringiensis and correlation
The insecticidal toxic protein (no matter whether they can show insecticidal effect to certain specific insect) that species obtain, is further wrapped
It includes but is not limited to, the hole of this toxoid forms structural domain.This pores formation composition may also include one or more holes and form poison
Element or its structural domain or combinations thereof object, they every kind it is all different, every kind all shows different binding modes, this is to pass through
The channel of every kind of toxin or structural domain forms attribute to judge comprising, dynamics, the conductance state of ion channel formation
Size, total membrane conductance, ion specificity and ion channel gate inhibition's attribute of (conductance state).This pores shape
At the combination of composition and the dsRNA molecule for being specific to the containment one or more genes of coleoptera species by particularly including into originally
Text.
Embodiment 5
Present embodiment describes the nucleotide sequence fragments of V-ATPase, are provided in CRW species meals in the form of double-stranded RNA
When in food, have for controlling harmful insect.
SEQ ID NO:Sequence shown in 104 is cDNA clone, represents 2400 nucleotide for encoding following albumen
1870 nucleotide in mRNA, the protein display go out with Drosophila melanogaster vacuole ATPase (68kd,
Subunit 2) height sequence identity.Using the primer designed from initial sequence information, to this cDNA grams on two chains
It is grand to be sequenced completely.These sequencing primers are as SEQ ID NO:105 to SEQ IDNO:120 list.SEQ ID NO:121
With SEQ ID NO:122 be primer sequence, generates SEQ ID for the cDNA from cloning vector pSPORT (Invitrogen)
NO:104 copy.Every primer contains the T7 promoter sequence of 20 nucleotide, is 1-20 nucleotide.SEQ ID NO:
21-44 position nucleotide and SEQ ID NO in 121:The position 21-45 nucleotide pair in 122 is answered to be inserted into pSPORT carrier
The sequence of cDNA flank.These primers allow to containing cDNA segment (its arbitrary end, flank have T7 promoter) DNA profiling into
Row amplification, allows to generate double-stranded RNA in vitro with t7 rna polymerase.When will be from SEQID NO:104 obtain double-stranded RNA include into
When in CRW diet, about 80% death rate is observed.
By using following amplimer groups, to SEQ ID NO:104 six different zones are examined:SEQ ID
NO:123 and SEQ ID NO:124, correspond to SEQ ID NO:11 to 291 nucleotide (referred to as part #1,271
Base-pair);SEQ ID NO:125 and SEQ ID NO:126, correspond to 292 to 548 nucleotide (referred to as part #2,
260 base-pairs);SEQ ID NO:127 and SEQ ID NO:128, correspond to 549 to 830 nucleotide (referred to as portions
Divide #3,271 base-pairs);SEQ ID NO:129 and SEQ ID NO:130, correspond to 840 to 1345 nucleotide and (is claimed
For part #4,505 base-pairs);SEQ ID NO:131 and SEQ ID NO:132, correspond to 1360 to 1621 nucleotide
(referred to as part #5,261 base-pairs);SEQ ID NO:133 and SEQ ID NO:136, correspond to 1540 to 1870
Nucleotide (referred to as part #6,278 base-pairs).Note that part 5 and 6 has been overlapped about 80 base-pairs.When this 6 portions
When point separately including into CRW diet, #1, #2, #3 and #4 show the CRW death rate in 94% to 100% range.Part #5
It is not shown with #6 higher than the CRW death rate in unprocessed control more than visible background.The sequence quilt that part #1 is represented
Be further divided into three smaller parts, each of these three smaller parts all by the #1 of part at least about 150 to
Representated by about 180 contiguous nucleotides, so that first sub-part and second sub-part in the #1 of part in the #1 of part
It is overlapped, third sub-part is Chong Die with second sub-part in the #1 of part.To every in these sub-parts in CRW biologic test
Kind is tested respectively.Using these three shorter sequences, the death rate between 80% to 90% observed.
Second of the means examined to the bioactivity of the dsRNA molecule obtained from CRW gene are that building itself is mutual
The RNA molecule of benefit.Start sub-portfolio by the identical DNA sequence and t7 rna polymerase that will reverse-locate, can synthesize and can itself
Complementary single rna molecule.A kind of such RNA molecule is by by SEQ ID NO:In nucleotide sequence shown in 104 1 to
What 345 nucleotide and 50 to 325 nucleotide combinations obtained.Obtained sequence is illustrated as SEQ ID NO:137, it is named
For pIC17527.PIC17527 is cloned into pTOPT2.1 (Invitrogen).Using the T7 promoter in pTOP2.1, generate
The dsRNA of about 500 base pair nucleotides, including into CRW diet.The obtained death rate 80% to 100% it
Between.
Embodiment 6
Present embodiment describes dsRNA to the oral poison of Colorado potato bug (Leptinotarsadecemlineata)
Property.
Using Ambion mirVana kit (catalog number (Cat.No.) 1560) and suggested design (AmbionInc., Atustin,
TX), total serum IgE is isolated from Colorado potato bug (CPB), Leptinotarsa decemlineata.For every kind of preparation,
Use the CPB larva for occupying about 200 μ L volumes in micro-centrifuge tube.Use Invitrogen Thermoscript RT-PCR system
It unites (catalog number (Cat.No.) 11146) and recommends the scheme (nvitrogen, Carlsbad, CA) for mediating cDNA synthesis for random primer, use
5 microgram total serum IgEs prepare cDNA.The cDNA is used as template, to expand 2 ortholog sequence of V-ATPase A subunit,
Wherein use 550 (SEQ ID NO of Taq archaeal dna polymerase and oligonucleotide acid primer pr:And pr552 (SEQ IDNO 160):
161).Manduca sexta (SEQ ID NO is come from by comparing:151),Aedesaegypti(SEQ ID NO:152),
Drosophila melanogaster(SEQ ID NO:And the nearest V- of Diabrotica virgifera (WCR) 153)
ATPase A directly to autoploid nucleotide sequence, selects the region of minimum degeneracy, to design above-mentioned primer.Pr550 pairs of primer
The position the 230-252 nucleotide in M.sexta gene order is answered, and primer pr552 corresponds to the 1354- in M.sexta gene order
1331 nucleotide.
It is expanded using (touchdown) amplification program is successively decreased, wherein using following loop parameters:
Step 1.94 DEG C, 2 minutes;
Step 2.94 DEG C, 30 seconds;
Step 3.50 DEG C, 2 minutes;
Step 4.72 DEG C, 2 minutes
(step 2-4 carries out 35 circulations, and each circulation is decremented to -0.3 DEG C in step 3)
Step 5.72 DEG C, 10 minutes;And
Step 6.4 DEG C.
The DNA fragmentation of the about 1.2kb expanded from cDNA is cloned into carrier pCR2.1-TOPO
(Invitrogen), to generate recombinant plasmid pIC17105.Clone nucleotide sequence (the SEQ ID NO of insertion:144) with come from
Western corn rootworm, the 2 ortholog sequence of V-ATPase A subunit of Diabroticavirgifera only share 82%
Nucleotide sequence identity, still, deduction amino acid sequence about V-ATPase A albumen encoded but shares 97%
Sequence identity.
Use primer pr568 (SEQ ID NO:And pr569 (SEQ ID NO 162):163) plasmid pIC17105, is amplified
In V-ATPase A ortholog sequence, the primer is designed to " general " primer, for producing from pCR2.1-TOPO
The DNA profiling of the raw T7 polymerase promoter sequence with flank.It expands obtained DNA and is used as template, closed for dsRNA
At wherein using Ambion MEGAscriptTMKit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc., Austin,
TX).It is purified by being obtained from L.decemlineata V-ATPase A orthologous sequence in insect feeding test
DsRNA is fed to the larva of L.decemlineata.
CPB diet by 13.2g/L agar (Serva 11393), 140.3g/L Bio-Serve premix (F9380B),
5ml/L KOH (18.3%w/w) and 1.25ml/L formalin (37%) are constituted.Diet is dispersed into 96 with the aliquot of 200 μ L
On orifice plate, briefly dried before application sample.20 μ L sample surveys are applied into each hole, use aqua sterilisa as unprocessed
Verification (check) (UTC).Enable plate dry before insect larvae is added.One is added into each hole with fine, soft fur brush newly
Raw CPB larva.The plate described in sealable polyester film, is ventilated with insect needle.40 larvas are examined in each processing.27
DEG C, culture in 10-12 days is carried out under 60%RH and complete darkness to biologic test plate.It is slow to these plates record larvae development
And the death rate.It uses4 statistical softwares (SAS Institute, Cary, N.C., USA) analyze data.
Oral toxicity of the table 2.dsRNA to CPB larva
Processing | % lethality | StdDev | SEM | 95%CI |
Unprocessed verification | 8.33 | 10.21 | 4.17 | -2.38-19.04 |
V-ATPage A dsRNA | 87.5 | 10.83 | 3.61 | 79.18-95.82 |
It, can be by harmful organism meals based on the oral toxicity biologic test for using CPB specificity V-ATPase dsRNA
It is provided in food and expresses one or more following dsRNA sequences to control invasion of the CPB to plant, the dsRNA sequence is special
Contain one or more genes in CPB harmful organism.
Embodiment 7
Present embodiment describes what is carried out on the artificial diet using insect specificity dsRNA to a variety of Lepidopteran larvaes
The result of biologic test.
Using Ambion mirVana kit (catalog number (Cat.No.) 1560) and suggested design (AmbionInc., Atustin,
TX), from Spodoptera frugiperda, Helicoverpa zea, Agrotisipsilon and Ostrinia
The second age of nubilalis isolates total serum IgE into third instar larvae.It is big in micro-centrifuge tube using occupying for every kind of preparation
The larva of about 200 μ L volumes.
Using Invitrogen Thermoscript RT-PCR system (catalog number (Cat.No.) 11146) and recommend to be used for random primer
The scheme (nvitrogen, Carlsbad, CA) of cDNA synthesis is mediated, 5 micrograms with every kind in above-mentioned lepidoptera species are total
RNA prepares cDNA.The cDNA is used as template, with amplifying specific in the V-ATPase A subunit 2 of every kind of lepidoptera species
Ortholog sequence, wherein using 550 (SEQ ID NO of Taq archaeal dna polymerase and oligonucleotide acid primer pr:160) and
pr552(SEQ ID NO:161).
By compare from Manduca sexta, Aedes aegypti, Drosophilamelanogaster and
The nearest V-ATPase A of Diabrotica virgifera (WCR) selects minimum degeneracy directly to autoploid nucleotide sequence
The region of property, to design above-mentioned primer.Primer pr550 corresponds to the position the 230-252 nucleotide in M.sexta gene order, and draws
Object pr552 corresponds to the position the 1354-1331 nucleotide in M.sexta gene order.
It is expanded using loop parameter described in PCR scheme and embodiment 6 is successively decreased.The DNA that amplification is obtained is produced
Object clones the phase same sex being sequenced into pCR2.1-TOPO to verify them.Recombination matter containing ortholog gene order
Grain is listed in Table 3 below.
3. lepidoptera v-ATPase A subunit of table, 2 ortholog sequence
Plasmid | Insect species | SEQ ID NO: |
pIC17088 | Spodoptera frugiperda | SEQ ID NO:145 |
pIC17101 | Agrotls ipsilon | SEQ ID NO:146 |
pIC17102 | Helicoverpa zea | SEQ ID NO:147 |
pIC17103 | Ostrinia nubilalis | SEQ ID NO:148 |
Use primer pr555 (SEQ ID:And pr556 (SEQ ID NO 164):156) amplify plasmid pIC17088,
V-ATPase A ortholog sequence in pIC17101, pIC17102, pIC17102, the primer are designed to:It generates
Flank reversely has the DNA fragmentation of T7 polymerase promoter, synthesizes for external dsRNA.
Using Ambion MEGAscriptTM kit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc.,
Austin, TX), the double-strand for FAW, BCW and CEW ortholog sequence is synthesized from these obtained DNA profilings of amplification
It is used for insect biologic test with 10ppm by RNA (dsRNA).
For these tests, artificial lepidoptera diet (165g/L SouthlandMultiple Species is prepared
Diet, 14.48g/L agar), it is dispersed in 128 orifice plates, each 500 μ l of hole.By in sample dispersion to diet, it is placed in
In " drying " chamber of 27 DEG C and 35% humidity, wherein excess water evaporation.Once just being gone to invade with single newborn larvae by drying
Each hole is attacked, is sealed with the sealable polyester film item of perforation.Culture in six to eight days is carried out to the plate at 27 DEG C.Do not located
The insect of reason ran out of whole diets in each hole at six to eight days.50 holes are prepared with every hole 4ml artificial diet
All insects that diet is exhausted or almost exhausted before off-test are transferred in new plate by plate.These plates are sealed, it will
They are put back into incubator, are evaluated and tested after in total ten to 12 days, then to all biologic tests.
Compared with unprocessed verification, in terms of larval mortality or quality acquisition, lepidopterid is directed to from these
The result of the biologic test of species does not show that obvious action (is compared using Tukey-Kramer HSD for all Duis
Compared with), using the test, it observed growth (regimen).BT insecticidal egg is being formed using the hole of dsRNA and sub-lethal dose
In the biologic test that white combination (known toxic to above-mentioned lepidoptera harmful organism in pervious experiment) carries out, also do not see
Observe the influence to larval mortality and quality acquisition.
Embodiment 8
Present embodiment describes for measuring dsRNA to boll weevil, the oral toxicity of Anthonomusgrandis
Biologic test.
Using Ambion mir Vana kit (catalog number (Cat.No.) 1560) and suggested design (AmbionInc., Atustin,
TX), from boll weevil (BWV), the larva of Anthonomus grandis isolates total serum IgE.For every kind of preparation, using accounting for
According to the BWV larva of about 200 μ L volumes in micro-centrifuge tube.Use Invitrogen Thermoscript RT-PCR system (mesh
Record number is 11146) and recommendation is used for the scheme (nvitrogen, Carlsbad, CA) that random primer mediates cDNA synthesis, with 5 micrograms
Total serum IgE prepares cDNA.The cDNA is used as template, to expand 2 ortholog sequence of V-ATPase A subunit, wherein making
With 550 (SEQ ID NO of Taq archaeal dna polymerase and oligonucleotide acid primer pr:And pr552 (SEQ IDNO 160):161).
By compare from Manduca sexta, Aedes aegypti, Drosophilamelanogaster and
The nearest V-ATPase A of Diabrotica virgifera (WCR) selects minimum degeneracy directly to autoploid nucleotide sequence
The region of property, to design above-mentioned primer.Primer pr550 corresponds to the position the 230-252 nucleotide in M.sexta gene order, and draws
Object pr552 corresponds to the position the 1354-1331 nucleotide in M.sexta gene order.
It is expanded using loop parameter described in PCR scheme and embodiment 6 is successively decreased.It will expand to obtain from cDNA
The DNA fragmentation of about 1.2kb clone into pCR2.1-TOPO (Invitrogen), insertion is sequenced, to be verified.It uses
Primer pr568 (SEQ ID:And pr569 (SEQ ID NO 162):163) V-ATPase A ortholog sequence (SEQ is amplified
ID NO:149), the primer is designed to " general " primer, for generating from pCR2.1-TOPO there is the T7 of flank to polymerize
The DNA profiling of enzyme promoters sequence.
Using Ambion MEGAscriptTM kit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc.,
Austin, TX), the DNA profiling obtained from the amplification synthesizes double-stranded RNA (dsRNA).
To carry out boll weevil, the biologic test of Anthonomus grandis Boheman, according to manufacturers instruction,
Use artificial insect's diet (Bioserv-F9247B based on agar;Gast and Davich, 1966).By about 200 μ l
Thawing diet be dispersed into 96-well microtiter plate, enable its cooling and solidifying.Then sample (20 μ of 10ppm dsRNA be will contain about
L) it covers on diet, enables its drying, the dsRNA corresponds to identical sources object sequence (the SEQ ID NO of V-ATPase A:
149).Then the insect ovum (0-14) in 25 μ l, 0.1% agar is distributed on diet.Then aperture seal item is used
(Zymark#72281) sealing titer plate is gone.The culture for carrying out ten to 12 days to test at 27 DEG C, by measuring larva excrement
Just accumulation is to assess activity.The influence to larval mortality or quality acquisition is not observed, but this may be cotton boll trunk
The result of the specific feed physiology of worm.The dosage of the dsRNA of intake may be significantly reduced by digging a hole in diet, therefore significantly be subtracted
Any effect that can be observed when having lacked using surface feed physiology.Including by dsRNA in an uniform way will likely into mountain city
The quality for obtaining the significant death rate and reduction obtains.
Other target gene sequences from boll weevil can be cloned, and be used as template, for synthesizing in vitro
Then dsRNA can examine dsRNA in insect biologic test, to evaluate their effect.For example, ribosomal protein
L19 (rpl19) gene is used as the template to synthesize for dsRNA.For design degeneracy oligonucleotide primer purpose, to come
From Bombyx mori (SEQ ID NO:154),Drosophila melanogaster(SEQID NO:155),Anopholes
gambiag(SEQ ID NO:And Diabroticavirgifera (SEQ ID NO 156):157) for rpl19 directly to homologous
The nucleotide sequence of object is compared, and identifies the shared region of minimum degeneracy.Primer pr574 (SEQ ID NO:166) and
pr577(SEQ ID NO:Or primer pr575 (SEQ ID NO 168):And pr577 (SEQ ID NO 167):168) can be used for
Possible rpl19 ortholog sequence is amplified from a variety of different insects species.
It is expanded using amplification scheme and loop parameter as described in Example 6 is successively decreased.It will be from boll weevil
The DNA fragmentation for the about 0.4kb that cDNA is expanded is cloned into carrier pCR2.1-POTO (Invitrogen), and insertion is sequenced,
To be verified.Use primer pr568 (SEQ ID:And pr569 (SEQ ID NO 162):163) rpl19 is amplified directly to homologous
Object sequence (SEQ ID NO:149), the primer is designed to " general " primer, has for generating from pCR2.1-TOPO
The DNA profiling of the T7 polymerase promoter sequence of flank.
Embodiment 9
Present embodiment describes for measuring dsRNA to red flour beetle, the oral poison of Triboliumcastaneum larva
The biologic test of property.
Some harmful insects be commercially it is especially important because they can invade the agricultural product system from specific crop production
Product and the material by processing.A kind of special such harmful organism is red flour beetle.In the agricultural production from specific crop production
Exist in product product and material by processing be specific to inhibit in such harmful organism one kind of one or more genes or
A variety of dsRNA types will be used to control such pest infestation.
Using Ambion mir Vana kit (catalog number (Cat.No.) 1560) and suggested design (AmbionInc., Atustin,
TX), from red flour beetle (RFB), the larva of Tribolium castaneum isolates total serum IgE.For every kind of preparation, using accounting for
According to the RFB larva of about 200 μ L volumes in micro-centrifuge tube.Use Invitrogen Thermoscript RT-PCR system (mesh
Record number is 11146) and recommendation is used for the scheme (nvitrogen, Carlsbad, CA) that random primer mediates cDNA synthesis, with 5 micrograms
Total serum IgE prepares cDNA.The cDNA is used as template, to expand 2 ortholog sequence of V-ATPase A subunit, wherein making
With 550 (SEQ ID NO of Taq archaeal dna polymerase and oligonucleotide acid primer pr:And pr552 (SEQ IDNO 160):161).
By compare from Manduca sexta, Aedes aegypti, Drosophilamelanogaster and
The nearest V-ATPase A of Diabrbrotica virgifera (WCR) directly to autoploid nucleotide sequence, selects minimum letter
And the region of property, to design above-mentioned primer.Primer pr550 corresponds to the position the 230-252 nucleotide in M.sexta gene order, and
Primer pr552 corresponds to the position the 1354-1331 nucleotide in M.sexta gene order.
It is expanded using loop parameter described in PCR scheme and embodiment 6 is successively decreased.It will expand to obtain from cDNA
The DNA fragmentation of about 1.2kb clone into pCR2.1-TOPO (Invitrogen), insertion is sequenced, to be verified.It uses
Primer pr568 (SEQ ID:And pr569 (SEQ ID NO 162):163) V-ATPase A ortholog sequence (SEQ is amplified
ID NO:150), the primer is designed to " general " primer, for generating from pCR2.1-TOPO there is the T7 of flank to polymerize
The DNA profiling of enzyme promoters sequence.
Using Ambion MEGAscriptTM kit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc.,
Austin, TX), the DNA profiling obtained from the amplification synthesizes double-stranded RNA (dsRNA), is used for insect biologic test.It will
Wheat flour is with water and corresponding to V-ATPase A ortholog sequence (SEQ ID NO:150) dsRNA homogeneous mixture,
Its drying is enabled, composition is used as the substrate of red flour beetle biologic test.After a couple of days culture, by from flour/dsRNA
Weevil larva is extracted in mixture to observe insecticidal effect.
Other target gene sequences from red flour beetle can be cloned, and be used as template, for synthesizing in vitro
Then dsRNA can examine dsRNA in insect biologic test, to evaluate their effect.For example, ribosomal protein
L19 (rpl19) gene is used as the template to synthesize for dsRNA.For design degeneracy oligonucleotide primer purpose, to come
From Bombyx mori, Drosophila melanogaster, Anopholes gambiae and Diabrotica virgifera
The nucleotide sequence for rpl19 ortholog be compared, identify the shared region of minimum degeneracy.Primer
pr574(SEQ ID NO:And pr577 (SEQ ID NO 166):Or primer pr575 (SEQ ID NO 168):And pr577 167)
(SEQID NO:168) can be used for amplifying possible rpl19 ortholog sequence from a variety of different insects species.
It is expanded using amplification scheme and loop parameter as described in Example 6 is successively decreased.It will be from red flour beetle
The DNA fragmentation for the about 0.4kb that cDNA is expanded is cloned into carrier pCR2.1-POTO (Invitrogen), and insertion is sequenced,
To be verified.Use primer pr568 (SEQ ID:And pr569 (SEQ ID NO 162):163) rpl19 is amplified directly to homologous
Object sequence (SEQ ID NO:159), the primer is designed to " general " primer, has for generating from pCR2.1-TOPO
The DNA profiling of the T7 polymerase promoter sequence of flank.
Embodiment 10
Present embodiment describes the mouths for measuring dsRNA dialogue grub (white grub) and iron wire worm (wireworm)
The biologic test of taking poison property.
Using Ambion mir Vana kit (catalog number (Cat.No.) 1560) and suggested design (AmbionInc., Atustin,
TX), total serum IgE is isolated from the larva of white grub or iron wire worm.For every kind of preparation, using occupying about 200 μ in micro-centrifuge tube
The larva of L volume.Using InvitrogenThermoscript RT-PCR system (catalog number (Cat.No.) 11146) and recommend for random
Primer mediates the scheme (nvitrogen, Carlsbad, CA) of cDNA synthesis, prepares cDNA with 5 microgram total serum IgEs.The cDNA quilt
It is used as template, to expand 2 ortholog sequence of V-ATPase A subunit, wherein using Taq archaeal dna polymerase and core of living alone as a widow
(the SEQ ID NO of thuja acid primer pr 550:And pr552 (SEQ ID NO 160):161).
By compare from Manduca sexta, Aedes aegypti, Drosophilamelanogaster and
The nearest V-ATPase A of Diabrotica virgifera (WCR) selects minimum degeneracy directly to autoploid nucleotide sequence
The region of property, to design above-mentioned primer.Primer pr550 corresponds to the position the 230-252 nucleotide in M sexta gene order, and draws
Object pr552 corresponds to the position the 1354-1331 nucleotide in M.sexta gene order.
It is expanded using loop parameter described in PCR scheme and embodiment 7 is successively decreased.It will expand to obtain from cDNA
The DNA fragmentation of about 1.2kb clone into pCR2.1-TOPO (Invitrogen), insertion is sequenced, to be verified.It uses
Primer pr568 (SEQ ID:And pr569 (SEQ ID NO 162):163) V-ATPase A ortholog sequence (SEQ is amplified
ID NO:150), the primer is designed to " general " primer, for generating from pCR2.1-TOPO there is the T7 of flank to polymerize
The DNA profiling of enzyme promoters sequence.
Using Ambion MEGAscriptTM kit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc.,
Austin, TX), the DNA profiling obtained from the amplification synthesizes double-stranded RNA (dsRNA), is used for insect biologic test.Number
After its biologic test, the effect of oral toxicity is observed.
It can be cloned come other target gene sequences of make clear one's meaning and position grub or iron wire worm, and be used as template, for external
DsRNA is synthesized, then dsRNA can be examined in insect biologic test, to evaluate their effect.For example, ribosomes
Protein L 19 (rpl19) gene is used as the template to synthesize for dsRNA.For design degeneracy oligonucleotide primer purpose,
To from Bombyx mori, Drosophila melanogaster, Anopholes gambiae and Diabrotica
The nucleotide sequence for rpl19 ortholog of virgifera is compared, and identifies the consensus of minimum degeneracy
Domain.Primer pr574 and pr577 or primer pr575 and pr577 can be used for amplifying possibility from a variety of different insects species
Rpl19 ortholog sequence.
It is expanded using amplification scheme and loop parameter as described in Example 7 is successively decreased.It will be from red flour beetle
The DNA fragmentation for the about 0.4kb that cDNA is expanded is cloned into carrier pCR2.1-POTO (Invitrogen), and insertion is sequenced,
To be verified.Use primer pr568 (SEQ ID:And pr569 (SEQ ID NO 162):163) rpl19 is amplified directly to homologous
Object sequence, the primer are designed to " general " primer, for generating from pCR2.1-TOPO there is the T7 polymerase of flank to open
The DNA profiling of promoter sequences.
Embodiment 11
Present embodiment describes for measuring dsRNA to mosquito, the biologic test of the oral toxicity of Aedes aegypti.
Using Ambion mir Vana kit (catalog number (Cat.No.) 1560) and suggested design (AmbionInc., Atustin,
TX), total serum IgE is isolated from the larva of Aedes aegypti.For every kind of preparation, using occupying about 200 μ L in micro-centrifuge tube
The Aedes aegypti larva of volume.Using Invitrogen Thermoscript RT-PCR system (catalog number (Cat.No.) 11146) and
Recommend the scheme (nvitrogen, Carlsbad, CA) for mediating cDNA synthesis for random primer, is prepared with 5 microgram total serum IgEs
cDNA.The cDNA is used as template, to expand 2 ortholog sequence of V-ATPaseA subunit, wherein poly- using Taq DNA
550 (SEQ ID NO of synthase and oligonucleotide acid primer pr:And pr552 (SEQ ID NO 160):161).
By compare from Manduca sexta, Aedes aegypti, Drosophilamelanogaster and
The nearest V-ATPase A of Diabrotica virgifera (WCR) selects minimum degeneracy directly to autoploid nucleotide sequence
The region of property, to design above-mentioned primer.Primer pr550 corresponds to the position the 230-252 nucleotide in M.sexta gene order, and draws
Object pr552 corresponds to the position the 1354-1331 nucleotide in M.sexta gene order.
It is expanded using loop parameter described in PCR scheme and embodiment 7 is successively decreased.It will expand to obtain from cDNA
The DNA fragmentation of about 1.2kb clone into pCR2.1-TOPO (Invitrogen), insertion is sequenced, to be verified.It uses
Primer pr568 (SEQ ID:And pr569 (SEQ ID NO 162):163) V-ATPase A ortholog sequence (SEQ is amplified
ID NO:150), the primer is designed to " general " primer, for generating from pCR2.1-TOPO there is the T7 of flank to polymerize
The DNA profiling of enzyme promoters sequence.
Using Ambion MEGAscriptTM kit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc.,
Austin, TX), the DNA profiling obtained from the amplification synthesizes double-stranded RNA (dsRNA), is used for insect biologic test.Number
After its biologic test, the effect to insect larvae is observed.
Other target gene sequences from mosquito can be cloned, and be used as template, for synthesizing dsRNA in vitro, so
After dsRNA can be examined in insect biologic test, to evaluate their effect.For example, ribosomal protein L 19
(rpl19) template that gene is used as to synthesize for dsRNA.For the purpose for designing degeneracy oligonucleotide primer, to coming from
Bombyx mori, Drosophila melanogaster, Anopholes gambiae and Diabrotica virgifera
It is compared for the nucleotide sequence of rpl19 ortholog, identifies the shared region of minimum degeneracy.Primer pr574
With pr577 or primer pr575 and pr577 can be used for amplifying from a variety of different insects species possible rpl19 directly to
Homologue sequence.
It is expanded using amplification scheme and loop parameter as described in Example 7 is successively decreased.It will be expanded from cDNA
To the DNA fragmentation of about 0.4kb clone into carrier pCR2.1-POTO (Invitrogen), insertion is sequenced, to be tested
Card.Use primer pr568 (SEQID:And pr569 (SEQ ID NO 162):163) rpl19 ortholog sequence, institute are amplified
It states primer and is designed to " general " primer, for generating the T7 polymerase promoter sequence with flank from pCR2.1-TOPO
DNA profiling.
Using Ambion MEGAscriptTM kit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc.,
Austin, TX), the DNA profiling obtained from the amplification synthesizes double-stranded RNA (dsRNA), is used for insect biologic test.
Other mosquito class species can be included in the scope of the present invention.Suitable Oligonucleolide primers can be used, to coming from
The suitable targets gene order of Aedes, Culex and Anopholes species is expanded, and is cloned into carrier pCR2.1-
POTO (Invitrogen) is sequenced insertion, to be verified.Use primer pr568 (SEQ ID:And pr569 (SEQ 162)
ID NO:163) clone's target sequence is amplified, the primer is designed to " general " primer, for producing from pCR2.1-TOPO
The DNA profiling of the raw T7 polymerase promoter sequence with flank.
Using Ambion MEGAscriptTM kit (catalog number (Cat.No.) 1626) and suggested design (Ambion Inc.,
Austin, TX), double-stranded RNA (dsRNA) is synthesized from these obtained DNA profilings of amplification, is used for insect biologic test.
Embodiment 12
Present embodiment describes:DsRNA made from the 3 ' UTR regions from V-ATPase is the tune how shown to target
Control.
The segment (dsRNA of ca.300bp) of 3 ' UTR of WCR V-ATPase has been used for carrying out WCR biologic test, still
But fail to show hypoevolutism and the death rate in 12 days biologic tests.Sizable in V-ATPase coding region
It is disconnected that significant hypoevolutism and the death rate are but illustrated within the scope of a certain concentration.To from feeding 3 ' UTR of WCR V-ATPase
The total serum IgE that segment 4 days WCR larvas are extracted carries out the hybridization of the Northern marking (and going to be detected with coding region probe)
Display:Compared with unprocessed larva, V-ATPase target RNA significantly reduces (being summarised as NBP#7497215).But it leaves
The signal that can be detected, this shows with 3 ' UTR dsRNA segments (compared with coding region segment is used) to the knockout of target
It is more invalid, and/or the contribution from possible second of V-ATPase gene, second of gene has and the first V-
Visibly different 3 ' the UTR of ATPase gene of MP.Exist with genome more than one to the Southern marking hybridization data that WCR is carried out
Kind of hybrid gene sequence it is identical of views, but inspection to EST and there is the family PCR of limitation not show possible the but
Two kinds of genes are transcribed.
Want herein it is important to note that, although it is crucial for determining that larvae development of sening as an envoy to is slow and kills the potential target of larva
, but hybridized by the Northern marking or quantitative PCR carries out easy detection to the expression of target gene can also find transport
With the target of RNAi strategy.The above results add be conceived to V-ATPase target other Northern experiment it has been shown that
In insect, in a few hours existing for dsRNA, influence of the RNA for Transcript abundance be can be seen that.
Embodiment 13
Present embodiment describes a kind of methods, and silencing methods for being mediated using ta-siRNA are executed to harmful insect
The containment of gene.
Used the method for gene silencing in the biology to plant pest it has recently found that trans-acting siRNA
(ta-siRNA) class group (Dalmay et al., Cell 101:543-553,2000;Mourrain et al., Cell 101:
533-542,2000;Peragine et al, Genes andDevelopment, 18:2368-2379,2004;Vazquez et
Al, MoI Cell 16 (l):69-79,2004;Yu et al., Mol Plant Microbe Interact 16:206-216,
2003).Ta-siRNA is that the single stranded RNA transcript targeted from naturally occurring miRNA obtains.Using Microrna to induce
Method of the ta-siRNA for carrying out gene silencing in plant is described in U.S. Provisional Patent Application Serial No. 60/643,
In 136 (Carrington et al.2004), it is incorporated herein by reference in their entirety.At least one is identified in corn root
The harmful organism specificity miRNA expressed in worm larva intestinal epithelial cell.Then it goes to reflect with harmful organism specificity miRNA
It makes:The miRNA expressed in this sequence of at least one target rna transcription, the sequence and cell is complementary.Corresponding target sequence
It is no more than the short sequence of 21 contiguous nucleotides, in the cell type with functional r NAi approach, rna transcription sheet
When a part of corresponding miRNA is contacted, the short sequence leads to the cutting to the transcript of silencer mediation.Once
MiRNA target sequence is identified, at least one miRNA target sequence is merged with Article 2 sequence, the Article 2 sequence
A part corresponding to the pest gene that will use this method progress silencing.For example, by miRNA target sequence and corn root
The sequence of worm vacuole ATPase (V-ATPase) gene merges.MiRNA target sequence can be placed on the 5 ' of V-ATPase gene
End, 3 ' hold or are embedded among the gene.Use a variety of miRNA target sequences for corresponding to a variety of miR-96 genes, Huo Zhe
It may be excellent that same miRNA target sequence use is used for multiple times in miRNA target sequence and the chimera of V-ATPase sequence
Choosing.V-ATPase sequence can be random length, but minimum 21bp.
Using any substance in a large amount of suitable promoters or other transcriptional regulatory elements, by miRNA target sequence and
The chimera of v-ATPase is expressed in plant cell, at least will be provided in harmful organism diet cell type (for example,
For controlling the corn root of corn rootworm) in can transcribe.
This method can have additional advantage:Longer RNA molecule can be transported to object noxious livings.Typically, exist
The dsRNA generated in plant can be short rna by Dicer rapid processing, when being fed to some harmful organisms in a manner of external source, this
It may not use.In the method, single-stranded transcript is generated in plant cell, is absorbed by harmful organism, in harmful organism
DsRNA is converted into cell, in cell, then being processed into can be to one of one or more harmful organisms or a variety of base
The ta-siRNA of silencing after being transcribed because caused by.
Embodiment 14
Present embodiment describes compared with the sequence in other sources from non-CRW and right to CRW cDNA sequence
(1) identification of the sequence as the sequence in other sources and the exclusive sequence of (2) CRW.It is guarded in two kinds of biologies
CDNA sequence is potential RNAi candidate sequence, can be used for the expression and function of genes for targeting both biologies.Alternatively, choosing
Following sequences for the containment of CRW gene may be what people needed out, in (a) other harmful organisms, (b) nontarget organism with
And (c) it is chosen to be contained in Sequence Transformed Plant Genome with CRW exist without the known homologous sequence of the sequence.
Six CRW cDNA sequences are selected, are compared for the sequence in other sources.Specific sequence includes coding
Alpha- tubulin, beta- tubulin, CHD3, vacuolar proton pump E subunit, V-ATPase A subunit and silk-fibroin
The sequence of (thread protein).Nucleotide sequence is shown in SEQ ID NO:98,SEQ ID NO:99,SEQ ID NO:
100,SEQ ID NO:101,SEQ ID NO:102,SEQ ID NO:In 103.Use NCBI megablast program
(Altschul et al., J.Mol.Biol.215:403-410,1990), by CRW cDNA sequence and from the more of GenBank
All open cDNA of kind biology are compared, and search parameter is as follows:
-W21 -b50 -v50
This needs the perfect matching of at least 21 bodies (21-mer), only retains best 50 matchings and alignment.To result into
Row filtering only includes belonging to the biology of Insecta mesh, and honeybee (Apis mellifera) is left out.Although only existing
It is analyzed in six CRW cDNA sequences, but same method can be used for cDNA all in CRW or other target organisms
Or unigene sequence, without having excessive burden and experiment.
Using six CRW cDNA sequences, 145 kinds of matchings in total are identified in the insect biology different from 20 kinds.They
Including several pests, for example, acyrthosiphum pisim (Acyrthosiphon pisum), Asia diaphorina citri (Diaphorina
) and pediculus humanus capitis (Pediculus humanus) citri.
These results are showed in the following table 4, which show search sequence with hit matching between sequence, match percentage
Than the insect species that the phase same sex and acquisition hit sequence.For example, identifying, SEQ ID NO is come from:The 844th to 1528 in 98
The segment of position nucleotide and the GenBank sequence number GI for coming from acyrthosiphum pisim (Acyrthosiphon pisum):In 47521748
The segment height of 812nd to 128 nucleotide is identical.The phase same sex of this two sequences shared about 85%.
Table 4.CRW Unigene sequence and insect nucleotide sequence homologs
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
98 | 171-1529 | GI:14279671 | 89-1447 | 83% | Chironomus tentans |
98 | 175-938 | GI:602997223 | 69-832 | 88% | Diaprepes abbreviatus |
98 | 171-779 | GI:49394745 | 79-687 | 89% | Drosophila melaogaster |
98 | 769-1528 | GI:47537494 | 827-68 | 85% | Acyrthosiphon pisnm |
98 | 529-1339 | GI:55814359 | 56-865 | 85% | Acyrthosiphon pisum |
98 | 729-1469 | GI:46995994 | 1-741 | 85% | Acyrthosiphon pisum |
98 | 171-740 | GI:49395093 | 79-652 | 88% | Drosophila melanogaster |
98 | 166-903 | GI:60297353 | 68-804 | 85% | Diaprepes abbreviatus |
98 | 171-875 | GI:37593891 | 66-769 | 85% | Pediculns humanus |
98 | 844-1528 | GI:47521748 | 812-128 | 85% | Acyrthosiphon pisum |
98 | 351-1255 | GI:55798571 | 1-903 | 83% | Acyrthosiphon pisum |
98 | 862-1528 | GI:55815587 | 8-674 | 86% | Acyrthosiphon pisum |
98 | 415-1520 | GI:19773419 | 309-1414 | 81% | Bombyx mori |
98 | 171-296 | GI:19773419 | 65-190 | 88% | Bombyx mori |
98 | 415-1520 | GI:608680 | 309-1414 | 81% | Bombyx mori |
98 | 171-296 | GI:608680 | 65-190 | 88% | Bombyx mori |
98 | 738-1434 | GI:55811699 | 1-697 | 85% | Acyrthosiphon pisum |
98 | 171-899 | GI:37593910 | 70-799 | 85% | Pediculus humanus |
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
98 | 171-1029 | GI:55799535 | 53-911 | 83% | Acyrthosiphon pisum |
98 | 817-1492 | GI:35508998 | 7-681 | 85% | Acyrthosiphon pisum |
98 | 171-845 | GI:25959177 | 50-724 | 85% | Meladema coriacea |
98 | 862-1528 | GI:55803725 | 726-60 | 85% | Acyrthosiphon pisum |
98 | 171-695 | GI:49394718 | 79-603 | 88% | Drosophila melanogaster |
98 | 838-1528 | GI:55813912 | 827-137 | 85% | Acyrthosiphon pisum |
98 | 171-692 | GI:49395499 | 54-575 | 88% | Drosophila melanogaster |
98 | 171-1025 | GI:46997250 | 92-945 | 83% | Acyrthosiphon pisum |
98 | 171-1022 | GI:47533429 | 4-855 | 83% | Acyrthosiphon pisum |
98 | 171-998 | GI:34788002 | 122-949 | 83% | Callosobruchns maculatus |
98 | 171-839 | GI:25959137 | 50-717 | 85% | Meladema coriacea |
98 | 171-677 | GI:49395221 | 84-590 | 88% | Drosophila melanogaster |
98 | 171-809 | GI:25959136 | 50-688 | 86% | Meladema coriacea |
98 | 171-816 | GI:37593801 | 66-712 | 85% | Pediculus humanus |
98 | 171-816 | GI:37593472 | 67-712 | 85% | Pediculus humanus |
98 | 171-848 | GI:25959229 | 47-724 | 85% | Meladema coriacea |
98 | 171-677 | GI:49395496 | 75-581 | 88% | Drosophila melanogaster |
98 | 171-659 | GI:49395250 | 83-571 | 89% | Drosophila melanogaster |
98 | 171-1029 | GI:46997155 | 98-953 | 83% | Acyrthosipbon pisum |
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
98 | 904-1528 | GI:47519891 | 752-128 | 86% | Acyrthosiphon pisun |
98 | 199-1061 | GI:55813341 | 8-870 | 83% | Acyrthosiphon pisum |
98 | 760-1430 | GI:60298750 | 9-679 | 85% | Diaphorina citri |
98 | 171-998 | GI:46997667 | 106-933 | 83% | Acyrthosiphon pisum |
98 | 171-785 | GI:25959104 | 69-684 | 85% | Meladema coriacea |
98 | 922-1528 | GI:25959369 | 697-91 | 86% | Meladema coriacea |
98 | 922-1528 | GI:25959412 | 698-92 | 86% | Meladema coriacea |
98 | 171-772 | GI:25959233 | 68-669 | 86% | Meladema coriacea |
98 | 171-677 | GI:49395121 | 74-582 | 88% | Drosophila melanogaster |
98 | 199-1029 | GI:47534273 | 1-830 | 83% | Acyrthosiphon pisum |
99 | 90-1385 | GI:34787982 | 56-1351 | 83% | Callosobruchus maculatus |
99 | 74-797 | GI:25958562 | 14-739 | 88% | Curculio glandium |
99 | 572-1374 | GI:60297081 | 25-827 | 86% | Diaprcpes abbreviatus |
99 | 100-1425 | GI:19773425 | 91-1416 | 81% | Bombyx mori |
99 | 100-1425 | GI:2073100 | 111-1436 | 81% | Bombyx mori |
99 | 55-738 | GI:60297565 | 7-684 | 87% | Diaprepes abbreviatus |
99 | 131-1425 | GI:39842328 | 28-1322 | 81% | Laodelphax striatellus |
99 | 688-1449 | GI:60298019 | 9-770 | 85% | Diaprepes abbreviatus |
99 | 61-606 | GI:49394901 | 10-557 | 87% | Drosophila melanogaster |
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
99 | 61-605 | GI:49395418 | 12-558 | 87% | Drosophila melanogaster |
99 | 100-1008 | GI:2613140 | 68-976 | 81% | Manduca sexta |
99 | 1064-1416 | GI:2613140 | 1032-1384 | 83% | Manduca sexta |
99 | 61-573 | GI:49395445 | 15-528 | 87% | Drosophila melanogaster |
99 | 40-582 | GI:49395189 | 4-551 | 86% | Drosophila melanogaster |
99 | 104-918 | GI:47518537 | 27-841 | 82% | Acyrthosiphon pisum |
99 | 104-784 | GI:25959017 | 39-719 | 83% | Meladema coriacea |
99 | 104-879 | GI:47538212 | 85-860 | 82% | Acyrthosiphon pisum |
99 | 104-852 | GI:47520002 | 32-780 | 82% | Acyrthosiphon pisum |
99 | 104-789 | GI:47519819 | 118-803 | 83% | Acyrthosiphon pisum |
99 | 104-789 | GI:47532797 | 106-791 | 83% | Acyrthosiphon pisum |
99 | 100-708 | GI:53910346 | 73-681 | 84% | Heliconius erato petiverana |
99 | 100-880 | GI:6902132 | 54-834 | 82% | Bombyx mori |
99 | 104-789 | GI:46999310 | 91-777 | 83% | Acyrthosiphon pisum |
101 | 113-263 | GI:41578101 | 124-274 | 90% | Culicoides sonorensis |
101 | 113-263 | GI:41577171 | 65-215 | 90% | Culicoides sonorensis |
101 | 113-308 | GI:1546650 | 140-335 | 86% | Drosophila melanogaster |
101 | 113-308 | GI:15530478 | 140-335 | 85% | Drosophila melanogaster |
101 | 112-308 | GI:15516090 | 140-336 | 85% | Drosophila melanogaster |
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
101 | 113-308 | GI:49393479 | 52-247 | 85% | Drosophila melanogaster |
101 | 113-263 | GI:41577256 | 99-249 | 88% | Culicoides sonorensis |
101 | 113-308 | GI:41403307 | 84-279 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:41402978 | 79-274 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:41401487 | 82-277 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:38628155 | 176-371 | 85% | Drosophila melanogaster |
101 | 118-293 | GI:16901350 | 70-245 | 87% | Ctenocephalides felis |
101 | 118-293 | GI:16900951 | 78-253 | 87% | Ctenocephalides felis |
101 | 113-308 | GI:14708726 | 170-365 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14707923 | 171-366 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14708035 | 139-334 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14705944 | 135-330 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14705959 | 95-290 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14705165 | 108-303 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14703451 | 150-345 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14703188 | 95-290 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14700853 | 108-303 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14700635 | 136-331 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14699645 | 95-290 | 85% | Drosophila melanogaster |
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
101 | 113-308 | GI:14697887 | 94-289 | 85% | Drosophila melanpgaster |
101 | 113-308 | GI:14697103 | 136-331 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14696099 | 137-332 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14696107 | 136-331 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14695238 | 95-290 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14693081 | 133-328 | 85% | Drosophila melanogaster |
101 | 113-308 | GI:14691490 | 138-333 | 85% | Drosophila melanogaster |
102 | 694-1364 | GI:2454487 | 811-1481 | 84% | Aedes aegypti |
102 | 715-1220 | GI:2039978 | 3-507 | 86% | Ctenocephalides felis |
102 | 694-1175 | GI:4734043 | 166-647 | 85% | Aedes aegypti |
102 | 895-1286 | GI:16899106 | 3-393 | 87% | Ctenocephalides felis |
102 | 895-1286 | GI:16899780 | 6-395 | 87% | Ctenocephalides felis |
102 | 895-1286 | GI:16899721 | 6-396 | 86% | Ctenocephalides felis |
102 | 961-1286 | GI:22039013 | 8-333 | 87% | Ctenocephalides felis |
102 | 874-1327 | GI:33376955 | 30-483 | 83% | Glossina morsitans morsitans |
102 | 636-1136 | GI:46997165 | 360-859 | 81% | Acyrthosiphon pisum |
102 | 874-1220 | GI:33376948 | 25-371 | 84% | Glossina morsitans morsitans |
102 | 943-1364 | GI:3514814 | 74-495 | 82% | Drosophila melanogaster |
102 | 943-1364 | GI:24583987 | 1055-1476 | 82% | Drosophila melanogaster |
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
102 | 694-884 | GI:24583987 | 806-996 | 82% | Drosophila melanogaster |
102 | 943-1364 | GI:24583985 | 967-1388 | 82% | Drosophila melanogaster |
102 | 694-884 | GI:24583985 | 718-908 | 82% | Drosophila melanogaster |
102 | 943-1364 | GI:24583983 | 1052-1473 | 82% | Drosophila melanogaster |
102 | 694-884 | GI:24583983 | 803-993 | 82% | Drosophila melanogaster |
102 | 943-1364 | GI:18467973 | 1049-1470 | 82% | Drosophila melanogaster |
102 | 694-884 | GI:18467973 | 800-990 | 82% | Drosophila melanogaster |
102 | 943-1364 | GI:19527546 | 1052-1473 | 82% | Drosophila melanogaster |
102 | 694-884 | GI:19527546 | 803-993 | 82% | Drosophila melanogaster |
102 | 1045-1365 | GI:4734199 | 1-321 | 84% | Aedes aegypti |
102 | 943-1280 | GI:51961912 | 81-418 | 83% | Drosophila simulans |
102 | 734-947 | GI:22039138 | 73-285 | 87% | Ctenocephalides felis |
102 | 959-1364 | GI:24583991 | 1081-1486 | 81% | Drosophila melanogaster |
102 | 959-1364 | GI:18467977 | 1081-1486 | 81% | Drosophila melanogaster |
102 | 943-1340 | GI:21355198 | 994-1391 | 81% | Drosophila melanogaster |
102 | 694-884 | GI:21355198 | 745-935 | 82% | Drosophila melanogaster |
102 | 959-1364 | GI:19528270 | 1021-1426 | 81% | Drosophila melanogaster |
102 | 959-1364 | GI:18859618 | 951-1356 | 81% | Drosophila melanogaster |
102 | 943-1340 | GI:1373432 | 994-1391 | 81% | Drosophila melanogaster |
SEQ ID NO1 | Position with the phase same sex2 | Gene number3 | Position with the phase same sex4 | The % phase same sex5 | Belong to kind6 |
102 | 694-884 | GI:1373432 | 745-935 | 82% | Drosophila melanogaster |
102 | 959-1364 | GI:5851682 | 1021-1426 | 81% | Drosophila melanogaster |
102 | 142-345 | GI:22039875 | 163-366 | 87% | Ctenocephalides felis |
102 | 142-345 | GI:16901137 | 217-420 | 87% | Ctenocephalides felis |
102 | 82-595 | GI:34787824 | 112-625 | 79% | Callosobruchus maculatus |
102 | 142-345 | GI:16901267 | 156-360 | 87% | Ctenocephalides felis |
102 | 771-1022 | GI:22005558 | 58-309 | 84% | Aedes aegypti |
102 | 96-357 | GI:46996282 | 118-379 | 83% | Acyrthosiphon pisum |
102 | 963-1364 | GI:18898890 | 11-412 | 80% | Anopheles gambiae |
102 | 967-1364 | GI:18936027 | 25-422 | 80% | Anopheles gambiae |
102 | 61-344 | GI:37952369 | 124-407 | 81% | Ips pini |
103 | 1230-1251 | GI:33371240 | 247-268 | 100% | Glossina morsitans morsitans |
103 | 1230-1251 | GI:33374947 | 249-270 | 100% | Glossina morsitans morsitans |
1. WCR SEQ ID NO shown in sequence table;
2. showing the nucleosides with the 3rd column with gene number in a line with sEQ ID NO in the 1st column of perfect homology
Sour position;
3. showing corresponding matching that there is perfect homology to the 1st column SEQ ID NO, identifying in public database
The gene of sequence is numbered;
4. with the fixed CRW nucleotides match of a line middle finger, the nucleotide position of sequence that is identified in the 3rd column;
Between 5.WCR SEQ ID NO and gene number percent identities (in any given row, the 2nd column and
The comparison of the phase same sex between 4th column sequence);And
6. therefrom obtaining the category and kind of the gene numbered sequence.
Embodiment 15
Present embodiment describes:Using the matching for sharing model with known array and existing structural domain, to public herein
The protein functional structural domain and gene family of the nucleotide sequence opened translated to identify prediction.
Protein sequence is generated with " translater " program first, Unigene is translated as titanium sequence by described program, this is to pass through
What following step carried out:With the homology of known albumen;The prediction of gene structure from the beginning started based on model;And it is longest
Opening code-reading frame (ORF).Correction is as being sequenced caused by mistake position of frameing shift.Then for Pfam database, (covering is many common
The big collection of Hidden Markov model (HMM) and a variety of sequence alignments of protein family) search for protein sequence (The Pfam
Protein Families Database, Bateman et al., Nucleic Acids Research 32:D138-D141,
2004).Using default rigor, with program HMMPAM (Durbin et al., Biological Sequence Analysis:
ProbabilisticModels of Proteins and Nucleic Acids, Cambridge University Press,
1998) albumen HMM model is searched for.It is further filtered, only retaining desired value is 0.1 or smaller those matching conducts
Significant matching.In 20303 corn rootworm peptide sequences, 4199 are identified with 1317 kinds of different protein structure domains and family
(21%) item.
Analysis result is showed in region feature (feature) of sequence table file, has following characteristics:Pfam,
Pfam description and the quantity copied with structural domain in the matching level, desired value (E- value) and peptide sequence of HMMPFAM score.
Embodiment 16
Present embodiment describes a kind of methods, for providing the DNA sequence dna for being used for the gene silencing that dsRNA is mediated.More
Body, present embodiment describes the selections to the improved DNA in the gene silencing that can be used for dsRNA mediation, this is under
Step is stated to realize:(a) initial DNA sequence dna is selected from target gene comprising the contiguous nucleotide more than 21;(b)
Identify at least one shorter DNA sequence dna, the region from initial dna sequence, by be predicted to be do not generate it is undesired
The region of polypeptide is constituted;And (c) select the DNA sequence dna of the gene silencing for dsRNA mediation comprising at least one is shorter
DNA sequence dna.Undesired polypeptide includes but is not limited to, with the polypeptide of sensitization homologous peptide and with known polypeptide toxin
Homologous polypeptide.
WCR V-ATPase has shown that out:It can play a role in corn rootworm feeding test, to examine dsRNA to mediate
Silencing (means as control larva growth).From Western corn rootworm (WCR) (Diabrotica cirgifera
Virgifera LeConte) the cDNA sequence of vacuole ATPase gene of MP (V-ATPase) be selected, be used as initial DNA
Sequence (SEQ ID NO:104).It is screened for following regions DNA sequence dna initial to this, in this region, each
Connected segments comprising at least 21 nucleotide only in 21 contiguous nucleotides in known vertebrate sequence less than 21
Matching.It identifies three and is more than the segment of about 100 contiguous nucleotides, wherein being hit without above-mentioned 21/21;First sequence
Column-slice is disconnected to correspond to SEQ ID NO:The position 739-839 nucleotide in 104, Article 2 sequence fragment correspond to SEQ ID NO:
The position 849-987 nucleotide in 104, Article 3 sequence fragment correspond to SEQ ID NO:The position 998-1166 nucleotide in 104.
This three sequences are combined, gomphosis DNA array (SEQ ID NO is constructed:1), for mutually deserved CRW V-ATPase coded sequence
Carry out the gene silencing of dsRNA mediation.Novel gomphosis DNA array is examined in CRW biologic test described above.
All disclosures, patent and the disclosed patent application mentioned in this specification all pass through reference and are incorporated into this
Text, this with particularly, individually statement it is individually open herein or patent is incorporated herein by reference by every kind.
<110>Monsanto Technology LLC
Baum, James A
Gilbertson, Larry A
Kovalic, David K
LaRosa, Thomas J
Lu, Maolong
Munyikwa, Tichifa R.I.
Roberts, James K
Wu, Wei
Zhang, Bei
<120>For controlling the composition and method of insect infestations in plant
<130>38-21(53597)
<150>60560842
<151>2004-04-09
<150>60565632
<151>2004-04-27
<150>60579062
<151>2004-06-11
<150>60603421
<151>2004-08-20
<150>60617261
<151>2004-10-11
<150>60669175
<151>2005-04-07
<160>174
<210>1
<211>409
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>1
ggacaagaaa cttgcccaac gtaagcactt cccttcagta gactggcttg gatcatattc 60
caaatattta agagcattgg acgactttta tgacaaaaac tttattcctc ttagaaccaa 120
agttaaggaa attcttcagg aagaagatga tctagccgaa attgtgcagc tggtaggtaa 180
agcatctctg gcagaaacgg acaaaatcac cttggaaatt gccaggcttc ttaaagaaga 240
caaaactcat actcttctta tgacagattc tgtccattct ataaaactgt cggtatgttg 300
agaaacatga tcggtttgta cgacatggcg agacacgctg tagaatcaac cgcacaatca 360
gaaaataaga tcacttggaa cgtaataaga gattcaatga gtggaattt 409
<210>2
<211>157
<212>DNA
<213>Diabrotica virgifera
<400>2
atgtttcagg tgggctcaat aagcaccaac tttcaatttt atttttcatt tttgtattta 60
tttacagtaa ctcctcagtt tgctaacaat attacattgt taacgcattc atatgttgtt 120
taatataata gttttggaat ataattacaa gtttgtc 157
<210>3
<211>338
<212>DNA
<213>Diabrotica virgifera
<400>3
atttttattc tgttaatagt ttttcacatt tcatgtttca cacatactta gatctagtca 60
agattgttag agttttggca aagaaattaa ataaaaattc ttttcataaa aatcatttct 120
ttaatattac attagagaaa aattatattt ttatactgag tacaaatttg aacaagttat 180
taattttaag ttacaaaata cgcttttata ggttaacaat tatcaaagcg cttaaatcta 240
atagatacta cacaacatta aggactgcaa accatatctt tcacgaagta atccctacta 300
gtgaccaatt gctcgctagg agcagatgca aattacac 338
<210>4
<211>458
<212>DNA
<213>Diabrotica virgifera
<400>4
aaaagagtga ggaaacaggt taattataat gacggaggaa tgacaactga cacacgagaa 60
gatacgacat ggcaagaaaa tctctctgat taccattctg acttttctgc gggatcggat 120
gaggataagg aagacgatga tttcgatgag aagaacgacg ccgatttaag cagaaggagt 180
cgaagaaaga tggaaaggaa agacgagaag gatcgtcctt taccaccgtt actagccaga 240
gttggcggca atattgaagt actcggtttt aatgccaggc agcgtaaagc gttccttaat 300
gctattatgc gctacggaat gccaccacaa gacgctttca attcacagtg gctggtgaga 360
gatcttcgag gaaaatctga gaagatattc aaggcttacg tgtctctctt tatgaggcat 420
ctttgcgaac ctggtgcaga taatgctgat acgtttgc 458
<210>5
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>5
taatacgact cactataggg agagacggag gaatgacaac tgaca 45
<210>6
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>6
taatacgact cactataggg agat tccgta gcgcataata gcat 44
<210>7
<211>335
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>7
taatacgact cactataggg agagacggag gaatgacaac tgacacacga gaagacacga 60
catggcaaga aaatctctcc gattaccatt ctgacttttc tgcgggatca gatgaggata 120
aggaagacga tgatttcgat gagaagaacg acgccgattt aagcagaaga agtcgaagaa 180
agatggaaag aaaagacgag aaggaccgtc cactaccacc gttactagcc agagttgggg 240
gaaatattga agtgctcggt tttaatgcca ggcagcgtaa agcgttcctt aatgctatta 300
tgcgctacgg aatctcccta tagtgagtcg tatta 335
<210>8
<211>29
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>8
tctgaattct ccgtagcgca taatagcat 29
<210>9
<211>21
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>9
gacgccgatt taagcagaag a 21
<210>10
<211>171
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>10
tctgaattct ccgtagcgca taatagcatt aaggaacgct ttacgctgcc tggcattaaa 60
accgagcact tcaatatttc ccccaactct ggctagtaac ggtggtagtg gacggtcctt 120
ctcgtctttt ctttccatct ttcttcgact tcttctgctt aaatcggcgt c 171
<210>11
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>11
tcttctgctt aaatcggcgt cgaagacacg acatggcaag aaaat 45
<210>12
<211>32
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>12
gatcccgcag aaaagtcaga atggtaatcg ga 32
<210>13
<211>112
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>13
tcttctgctt aaatcggcgt cgaagacacg acatggcaag aaaatctctc cgattaccat 60
tctgactttt ctgcgggatc tccgattacc attctgactt ttctgcggga tc 112
<210>14
<211>24
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>14
ctccgattac cattctgact tttc 24
<210>15
<211>30
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>15
tctggatcct tccgtagcgc ataatagcat 30
<210>16
<211>245
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>16
ctccgattac cattctgact tttctgcggg atcagatgag gataaggaag acgatgattt 60
cgatgagaag aacgacgccg atttaagcag aagaagtcga agaaagatgg aaagaaaaga 120
cgagaaggac cgtccactac caccgttact agccagagtt gggggaaata ttgaagtgct 180
cggttttaat gccaggcagc gtaaagcgtt ccttaatgct attatgcgct acggaaggat 240
ccaga 245
<210>17
<211>473
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>17
tctgaattct ccgtagcgca taatagcatt aaggaacgct ttacgctgcc tggcattaaa 60
accgagcact tcaatatttc ccccaactct ggctagtaac ggtggtagtg gacggtcctt 120
ctcgtctttt ctttccatct ttcttcgact tcttctgctt aaatcggcgt cgaagacacg 180
acatggcaag aaaatctctc cgattaccat tctgactttt ctgcgggatc tccgattacc 240
attctgactt ttctgcggga tcagatgagg ataaggaaga cgatgatttc gatgagaaga 300
acgacgccga tttaagcaga agaagtcgaa gaaagatgga aagaaaagac gagaaggacc 360
gtccactacc accgttacta gccagagttg ggggaaatat tgaagtgctc gttttaatgc 420
caggcagcgt aaagcgttcc ttaatgctat tatgcgctac ggaaggatcc aga 473
<210>18
<211>536
<212>DNA
<213>Diabrotica virgifera
<400>18
accgccatca tgttattggc atcacacatg tgctgtgtga gctctggaac tttcaacggt 60
ctgtattgtt ggctgcctct tgaggtgagt ggagcgaatc cgggcatgaa gaagtggaga 120
cgggggaagg gaaccatgtt gacagccaat tttctaagat cagcattcaa ctgacctggg 180
aacctaagac aggtggttac accggacatt gtgagggata ccaaatggtt taagtctcca 240
tatgtgggtg ttgtgagttt caaagttctg aagcaaatgt catagagagc ttcattatca 300
atacagtatg tttcatctgt gttttctacc aattgatgta ctgaaagtgt ggcattgtat 360
ggttctacta cggtatctga tactttgggt gaggggacta ctgagtatgt gttcataatt 420
ctgtctgggt attcttcacg gatttttgag atagggaggg tacccatacc tgatccagta 480
ccacctccaa gtgagtgtgt gagttggaat ccttgtaaac aatcacatga tcagct 536
<210>19
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>19
taatacgact cactataggg agagaatccg ggcatgaaga agtg 44
<210>20
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>20
taatacgact cactataggg agacaaaaat ccgtgaagaa tacc 44
<210>21
<211>399
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>21
taatacgact cactataggg agagaatccg ggcatgaaga agtggagacg ggggaaggga 60
accatgttga cagccaattt tctaagatca gcattcaact gacctgggaa cctaagacag 120
gtggttacac cggacattgt gagggatacc aaatggttta agtctccata tgtgggtgtt 180
gtgagtttca aagttctgaa gcaaatgtca tagagagctt cattatcaat acagtatgtt 240
tcatctgtgt tttctaccaa ttgatgtact gaaagtgtgg cattgtatgg ttctactacg 300
gtatctgata ctttgggtga ggggactact gagtatgtgt tcataattct gtctgggtat 360
tcttcacgga tttttgtctc cctatagtga gtcgtatta 399
<210>22
<211>26
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>22
actgaattct ccgggcatga agaagt 26
<210>23
<211>19
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>23
tattcttcac ggatttgac 19
<210>24
<211>267
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>24
actgaattct ccgggcatga agaagtggag acgggggaag ggaaccatgt tgacagccaa 60
ttttctaaga tcagcattca actgacctgg gaacctaagg caggtggtta caccggacat 120
tgtgagggat accaaatggt ttaagtctcc gtatgtgggt gttgtgagtt tcaaagttct 180
gaagcaaatg tcatagagag cttcattatc aatacagtat gtttcatctg tgttttctac 240
caattgatgt caaatccgtg aagaata 267
<210>25
<211>17
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>25
caaatccgtg aagaata 17
<210>26
<211>19
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>26
ctgaaagtgt ggcgt tgta 19
<210>27
<211>106
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>27
caaatccgtg aagaataccc agatagaatt atgaacacat actcagtagt cccctctccc 60
aaagtatcag ataccgtagt agaaccatac aacgccacac tttcag 106
<210>28
<211>22
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>28
tagaaccata caacgccaca ct 22
<210>29
<211>25
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>29
tctggatcca cgggggaagg gaacc 25
<21030
<211>257
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>30
tagaaccata caacgccaca ctttcagtac atcaattggt agaaaacaca gatgaaacat 60
actgtattga taatgaagct ctctatgaca tttgcttcag aactttgaaa ctcacaacac 120
ccacatacgg agacttaaac catttggtat ccctcacaat gtccggtgta accacctgcc 180
ttaggttccc aggtcagttg aatgctgatc ttagaaaatt ggctgtcaac atggttccct 240
tcccccgtgg atccaga 257
<210>31
<211>586
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>31
actgaattct ccgggcatga agaagtggag acgggggaag ggaaccatgt tgacagccaa 60
ttttctaaga tcagcattca actgacctgg gaacctaagg caggtggtta caccggacat 120
tgtgagggat accaaatggt ttaagtctcc gtatgtgggt gttgtgagtt tcaaagttct 180
gaagcaaatg tcatagagag cttcattatc aatacagtat gtttcatctg tgttttctac 240
caattgatgt caaatccgtg aagaataccc agatagaatt atgaacacat actcagtagt 300
cccctctccc aaagtatcag ataccgtagt agaaccatac aacgccacac tttcagtaca 360
tcaattggta gaaaacacag atgaaacata ctgtattgat aatgaagctc tctatgacat 420
ttgcttcaga actttgaaac tcacaacacc cacatacgga gacttaaacc atttggtatc 480
cctcacaatg tccggtgtaa ccacctgcct taggttccca ggtcagttga atgctgatct 540
tagaaaattg gctgtcaaca tggttccctt cccccgtgga tccaga 586
<210>32
<211>399
<212>DNA
<213>Diabrotica virgifera
<400>32
acgcgtccag ttaatatccc gtgagatatt tttgcagtcc ttttaataag attcttcata 60
attcaccatg aagggctgcg ttttcaacat cgacaacggt tatttggaag gcctgtgtcg 120
tggctttaaa tgtgggatcc tgaaacacgc cgattatttg aatttggtcc agtgtgaaac 180
tcttgaagat ttaaaactgc acttgcaagg cactgactat ggaacttttt tggccaatga 240
accttcacct ttgtcagtat ccgtcatcga ttcaagactt cgacaaaaac tcctgattga 300
gttccagcac atgcgtaacc aagcagtaga gcctctctcg acatttatgg gcttcattac 360
ctacagttac atgatcgaca acataatttt gcttattac 399
<210>33
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>33
taatacgact cactataggg agaaacggtt atttggaagg 40
<210>34
<211>43
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>34
taatacgact cactataggg agat tgtcga tcatgtaact gta 43
<210>35
<211>291
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>35
taatacgact cactataggg agaaacggtt atttgcaagg tttgactgta tattattatt 60
tttatgtatc gacatygatg aattgattta tttatcgtaa agaaattcaa atacatttaa 120
agcttcaaat attaataata atgaacaagc tttgaagggt tacaaacaac caatcgatct 180
attaatatag tctattgact ctgaagttgc aaacggtaat agggccaatg caatggtttg 240
attctcccta cagttacatg atcgacaact ccctatagtg agtcgtatta a 291
<210>36
<211>451
<212>DNA
<213>Diabrotica virgifera
<400>36
ccacatacca cgctatgaaa cccccttata tggggccgat ctaacaggag tgtggaactc 60
tatatccatt atatctaaaa tggttaacag aaaagaattc ataattaaca ttcaattgcc 120
attgtacacg tatattctgg taaatctact actactggac atttaattta caaatgtagt 180
ggtatcgaca aacttaccat cgaaaagttc caaaaagaat cccaacaaat gggtaaaggc 240
taattcaaat atgcctgggt actctacata cttacagccc atagagaacg tggtattacc 300
attgatattg ctgtgcggaa attcgaaaca gctaaatact attgaaccat cattgatgcc 360
cctggcacag atatttcatt aataacatta tcactggtac attacaatct gactgtgctg 420
tactcattga tgcaactggt acttggtaat t 451
<210>37
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>37
taatacgact cactataggg agacacgcta tgaaaccccc ttat 44
<210>38
<211>42
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>38
taatacgact cactataggg agatttcgaa tttccgcaca gc 42
<210>39
<211>933
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>39
taatacgact cactataggg agatttcgaa tttccgcaca gcaagtgtgt aacttaaatt 60
tcaaaaaact tttcgttgtc ccaatttttt ttcataatct tagcggttac gattcgcata 120
tgatgattag agatcttgcg aaaaatggta gtatcagctt actaccaata aataaggaaa 180
agtatatttc atttacaata tacgattctg aggtcagtat taggttgagg ttcgttgatt 240
cactgagatt tttaaattca tcattggaca agttggctgc cacattgcaa cctgaggatt 300
taagatattt agctagcgaa tttccaaata ccactaccga acaaatggaa ttattgaaac 360
gaaaaggcat attcccatac gaatatattg agtctttcaa taaattgaat gaaacgcaac 420
taccatcaat tgataaattt tacagctcat tatcgggtga aaacatctcc aaaaatatgt 480
atcatcatgc tcagaatgtt tggcagtcat tcggtattaa aaatattttg gaatatagta 540
tgttgtacat gaaaactgat attatgttac tgacttgcat ttttgaaaat tttcgacaaa 600
aatgtcgaag tacatacagt cttgatcctg catggtacta taccatgcct ggattttctt 660
gggatgcaat gcttaaatat actggatgta aacttgaact gctgaatgat atcgataaaa 720
tcatgtttat tgagaaagct atccgaggtg gtataagtca agtaagtaat cggtattctg 780
aggcaaataa caaatacatg cataattatg atccatcaaa gcctagtaaa tatgtgctat 840
atttagatgt caacaatttg tatggttggg caatgtctca attattacca taagggggtt 900
tcatagcgtg tctccctata gtgagtcgta tta 933
<210>40
<211>918
<212>DNA
<213>Diabrotica virgifera
<400>40
cccaagcgtc cgcccacgcg tccgcccacg cggccccccc cgccgcccgc acggtgtgga 60
cctcgcgcct ggtgttacat cccaagtagt gttcctttta ttctaagttt aatttcgaac 120
agttgcattt actttatttc caaacaatca aaatgggtaa agaaaagatt catattaaca 180
tcgttgtcat tggacacgta gattctggta aatctactac tactggacat ttaatttaca 240
aatgtggtgg tatcgacaaa cgtaccatcg aaaagttcga aaaagaagcc caagaaatgg 300
gtaaaggttc attcaaatat gcctgggtac tcgacaaact taaggccgag agagaacgtg 360
gtattaccat tgatattgct ttgtggaaat tcgaaacagc taaatactat gtaaccatca 420
ttgatgcccc tggacacaga gatttcatta agaacatgat cactggtaca tcacaagctg 480
actgtgctgt actcattgtt gcagctggta ctggtgaatt tgaagcaggt atttcaaaga 540
atggacaaac acgtgaacat gctcttcttg ctttcaccct tggtgtaaaa caacttattg 600
ttggtgtcaa caaaatggac tcgactgaac cagcatacag tgaatcacgt ttcgaggaaa 660
tcaagaagga agtatcctca tacatcaaga aaattggtta caacccagct gccgttgctt 720
tcgtaccaat ttcaggatgg cacggagaca acatgttaga aggatctgac aagatgccat 780
ggttcaaggg atggcaaatc gaacgtaaag aaggaaaagc tgaaggaaag tgcttgattg 840
aggctttgga tgctatcctt cccccacctc gtccaactga gaaacccctc cgtcttccac 900
tccaggatgt ctacaaaa 918
<210>41
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>41
taatacgact cactataggg agacctcgcg cctggtgtta c 41
<210>42
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>42
taatacgact cactataggg agaccaaggg tgaaagcaag aagag 45
<210>43
<211>569
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>43
taatacgact cactataggg agacctcgcg cctggtgtta catcccaagt agtgttcctt 60
ttattctaag tttaatttcg aacagttgca tttactttat ttccaaacaa tcaaaatggg 120
taaagaaaag attcatatta acatcgttgt cattggacac gtagattctg gtaaatctac 180
tactactgga catttaattt acaaatgtgg tggtatcgac aaacgtacca tcgaaaagtt 240
cgaaaaagaa gcccaagaaa tgggtaaagg ttcattcaaa tatgcctggg tactcgacaa 300
acttaaggcc gagagagaac gtggtattac cattgatatt gctttgtgga aattcgaaac 360
agctaaatac tatgtaacca tcattgatgc ccctggacac agagatttca ttaagaacat 420
gatcactggt acatcacaag ctgactgtgc tgtactcatt gttgcagctg gtactggtga 480
atttgaagca ggtatttcaa agaatggaca aacacgtgaa catgctcttc ttgctttcac 540
ccttggtctc cctatagtga gtcgtatta 569
<210>44
<211>440
<212>DNA
<213>Diabrotica virgifera
<400>44
tcgcgggccg acacacgcct ccatattaag tcttgaaagt catttttaaa aacattttaa 60
tttaaaagta gtatttttaa gatttttcat tttcacacca gttcataatg gcatctggtt 120
caatatacga cgctgcacat aagggagatt ttgaatatgt ttcccaaaag attgaagagg 180
atccactaat tataaaagca ccagactcta gtaaaaggct tctaattcat tgggcagttc 240
tcagcggaaa tgtaaagctt gttactcatt tactggaact tggatcttct gtgaacccct 300
cggatgatac agatatgaca ccattaatat tagcttcatc ggctggccat accgaagttg 360
tcaaattgtt attaaaaaaa tgtgatgatg tcaatcataa aaatgcacag ggtcattcat 420
cacttcagta tgcagcctcc 440
<210>45
<211>46
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>45
taatacgact cactataggg agaacgctgc acataaggga gatttt 46
<210>46
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>46
taatacgact cactataggg agaggaggct gcatactgaa g 41
<210>47
<211>1113
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>47
taatacgact cactataggg agaacgctgc acataaggga gattttgact atgtttcaga 60
aaagattgaa gagtttccaa taattttaga agcaccagac tctgtaagtt gtaattattt 120
gtatattatt atctaacgtt aatctctaga cgaaccttta ttatatccaa tctctaccgt 180
gcaatactaa aatgtaccac gtacatttgt agttcctttg atttttttaa tttcattttt 240
ttaacaggtt ttgcaaatgt atacattttt attttggtta catagtcagg ttatacagtc 300
cgtataattt caataatttc tctatctagt atagaaccca tgtcacctta tcaacctatt 360
atcctgcata tttaaatgca gtaaaaccac atttaaaaac atattttctg gtatctcata 420
gccatttgta tcctctaatg gatgtgcata ggcttcttct aaagttttct agtttctatg 480
aagttacaaa gtagtttcct gttattctct tgagaacatt tgttcatatg ataggtggtt 540
catattatct gacagtttca gcttacaagt gaagcagtag catctccaga agatgccaac 600
ccctagtgtt ggtgaaacgt cgagaactac ttgacagtct aagagcccca acaaacagtt 660
taacaagttg gtgtgcattt agttgataga attctgtcag gttcttggat actccattgt 720
attggtttat tttatttaac taatttcctc tctcttggtt ctctttacta ttccaaacct 780
aaaaattttt tattgtatag attcattttg ttgttgagct tatatattgt gctattgacc 840
aataatcaaa tactttttag agtaagaggc ttgtaattca ttgggcagtt ctcagcggaa 900
atgtaaagct tgttacctat ttactgaaac ttggatctcc tgtgaactcc tcagatgata 960
cagatatgac accattaata ttagcttcat cagctggcca taccgaagtt gtcaaattgt
1020
tattaaaaaa atgtgatgat gtcaatcata aaaatgcaca gggccattca tcacttcagt
1080
atgcagcctc cctccctata gtgagtcgta tta 1113
<210>48
<211>425
<212>DNA
<213>Diabrotica virgifera
<400>48
aggattttct gaagctgccg aagtaactgg actcaatcca gcccaaatat ccgtcattat 60
gaagaacctg atggctcgat tgggattcca gaagtactac cttcagggag gtgattgggg 120
ttccgcaata gtagccaact tagcatcatt attcccagaa aaagtgctgg gagtccattc 180
caatatgtgt atggtcaata gtatgctttc taatctaaaa ttagcattgg gtagttttat 240
gccatccttg attgttgatg ctgacaagca acatctcctt tatcccagaa tgaaacattt 300
tggattcctt atattggaaa gtggttatat gcatcttcag ggtagtaaac cagataccgt 360
tggtgtcgct ctacgtgata gccctgtagg tcttgcagct tacatcatag agaagtttca 420
cacat 425
<210>49
<211>42
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>49
taatacgact cactataggg agatctgaag ctgccgaagt aa 42
<210>50
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>50
taatacgact cactataggg agatatcacg tagagcgaca ccaa 44
<210>51
<211>47
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>51
taatacgact cactataggg agactatgat gtaagctgca agaccta 47
<210>52
<211>95
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>52
taatacgact cactataggg agatcgcgat gagtagaccc aacacctctg gtaagggctc 60
tcatgcattg tttctcccta tagtgagtcg tatta 95
<210>53
<211>427
<212>DNA
<213>Diabrotica virgifera
<400>53
gacgcgcggg tcgatgcaag actctagata gagtcgtaat attgtcaact ttttcgtttc 60
ggtaaaattt atactaacta gccgtcagaa aagttactaa ttctccagtt atttaattga 120
gaatttgact ttattcgtca ctagcgcaat aactcagtat ggtgattatt aattcattta 180
aacaccccga gtctcctatt aggtatcaac aggacgatgt tcaagtctac ttagacaaga 240
aagatttggg cctgggaact ttatttgtta gtgaaagcac attatgctgg caacaagaag 300
agaacaatgg ttttgctatt gaatattcaa gtatttcctt gcatgccata tctaaagatt 360
taaacattca ttctacagaa tgtgtatacc tcgtgacaga tggacatatt actatgccag 420
gtgacag 427
<210>54
<211>43
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>54
taatacgact cactataggg agactagccg tcagaaaagt tac 43
<210>55
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>55
taatacgact cac tataggg agaatggcat gcaaggaaat a 41
<210>56
<211>318
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>56
taatacgact cactataggg agactagccg tcagaaaagt tactaattct ccagttattt 60
aattgagaat ttgactttat tcgtcactag cgcaataact cagtatggtg attattaatt 120
catttaaaca ccccgagtct cctattaggt atcaacagga cgatgttcaa gtctacttag 180
acaagaaaga tttgggcctg ggaactttat ttgttagtga aagcacatta tgctggcaac 240
aagaagagaa caatggtttt gctattgaat attcaagtat ttccttgcat gccattctcc 300
ctatagtgag tcgtat ta 318
<210>57
<211>431
<212>DNA
<213>Diabrotica virgifera
<400>57
caattattca cagaacaaca attatacaga atagaccact atttgggtaa ggaaatggta 60
cagaatttaa tgacacttcg atttggtaac agaatcttta accccacatg gaacagtgac 120
catatagctt ccatccaaat aaattgtaag gaacccttcg gaactgaagg cagaggaggg 180
tattttgacg aattcggcat tattagggat gtaatgcaga atcatatttt acaaattcta 240
gctctagtag ctatggaaaa accagcttca gttcaaccag acgatataag aaatgaaaag 300
gtaaaggtat taaaaagtat agctccaata aagctcaagg acgttgtatt gggtcagtac 360
gttggaaatc ctgatggaca aggtaatgcg aaattgggat acttagatga tccgagtgtt 420
cctaaagatt c 431
<210>58
<211>47
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>58
taatacgact cactataggg agaacagtga ccatatagct tccatcc 47
<210>59
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>59
taatacgact cactataggg agaatttcgc attaccttgt ccatc 45
<210>60
<211>328
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>60
taatacgact cactataggg agaacagtga ccatatagct tccatccaaa taaattgtaa 60
ggaacccttc ggaactgaag gcagaggagg gtattttgac gaattcggca ttattaggga 120
tgtaatgcag aatcatattt tacaaattct agctctagta gctatggaaa aaccagcttc 180
agttcaacca gacgatataa gaaatgaaaa ggtaaaggta ttaaaaagta tagctccaat 240
aaagctcaag gacgttgtat tgggtcagta cgttggaaat cctgatggac aaggtaatgc 300
gaaattctcc ctatagtgag tcgtatta 328
<210>61
<211>483
<212>DNA
<213>Diabrotica virgifera
<400>61
acccacgcct accccgcccc gtgatattta gtgcttactt ggtacagcag tttcagtgct 60
gtgctttaga ataatttatt ttttaacatt tatatagaaa tcaaatacta accaatcaac 120
atgtgtgaag aagaagttgc cgctttagtc gtagacaatg gatccggtat gtgcaaagct 180
ggttttgctg gggatgatgc acctcgtgct gtattccctt caattgttgg acgcccaaga 240
catcagggtg tgatggtagg aatgggacaa aaagattcct atgtaggtga tgaagctcaa 300
agtaaaagag gtatccttac cttaaaatac cccatcgagc acggaatagt cacaaactgg 360
gatgatatgg agaaaatttg gcatcataca ttctacaatg aactcagagt agccccagaa 420
gaacaccctg ttctgttgac agaagctcct ctcaacccca aggccaacag ggaaaagatg 480
aca 483
<210>62
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>62
taatacgact cactataggg agaccgcccc gtgatattta gtgct 45
<210>63
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>63
taatacgact cactataggg agactgttgg ccttggggtt gagag 45
<210>64
<211>503
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>64
taatacgact cactataggg agaccgcccc gtgatattta gtgcttactt ggtacagcag 60
tttcagtgct gtgctttaga ataatttatt ttttaacatt tatatagaaa tcaaatacta 120
accaatcaac atgtgtgaag aagaagttgc cgctttagtc gtagacaatg gatccggtat 180
gtgcaaagct ggttttgctg gggatgatgc acctcgtgct gtattccctt caattgttgg 240
acgcccaaga catcagggtg tgatggtagg aatgggacaa aaagattcct atgtaggtga 300
tgaagctcaa agtaaaagag gtatccttac cttaaaatac cccatcgagc acggaatagt 360
cacaaactgg gatgatatgg agaaaatttg gcatcataca ttctacaatg aactcagagt 420
agccccagaa gaacaccctg ttctgttgac agaagctcct ctcaacccca aggccaacag 480
tctccctata gtgagtcgta tta 503
<210>65
<211>407
<212>DNA
<213>Diabrotica virgifera
<400>65
aggtgaatgt tatatcgttt ttcaaagtgt aaggtgttta ttttcaaaaa gtttataaaa 60
taagcaatca ctatgggtaa tgtgtttgca aatttattca aaggcctctt tggcaaaaag 120
gaaatgagga tattgatggt acgactcgat gcagctggta aaaccacaat tttatataaa 180
cttaaattag gagaaattgt aacaactatt ccaacaattg gatttaatgt ggagactgta 240
gaatataaga acattagttt tacagtatgg gatgtaggtg gtcaagataa aattaggcca 300
ttgtggagac actatttcca aaacacacaa cgcctaattt tcgtagtaga cagtaaccac 360
acggaaacta acactgaggc taaagattaa ttaatgcgtt agttggg 407
<210>66
<211>42
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>66
taatacgact cactataggg agaactatgg gtaatgtgtt tg 42
<210>67
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>67
taatacgact cactataggg agagtttccg tgtggttact 40
<210>68
<211>345
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>68
taatacgact cactataggg agaactatgg gtaatgtgtt tgcaaattta ttcaaaggcc 60
tctttggcaa aaaggaaatg aggatattga tggtacgact cgatgcagct ggtaaaacca 120
caattttata taaacttaaa ttaggagaaa ttgtaacaac tattccaaca attggattta 180
atgtggagac tgtagaatat aagaacatta gttttacagt atgggatgta ggtggtcaag 240
ataaaattag gccattgtgg agacactatt tccaaaacac acaacgccta attttcgtag 300
tagacagtaa ccacacggaa actctcccta tagtgagtcg tatta 345
<210>69
<211>456
<212>DNA
<213>Diabrotica virgifera
<400>69
tcgcgggtcg atacaagcgt ctaaacacac gttctgatga catcaatttc taaaaatgtt 60
cgcaaattcc taccaaagcg gcttcatttc aatattctac agcgtaggaa gtaatccact 120
agcattatgg gacaagcagg taaagaacgg acatatcaga cggattatgg acgatgatgt 180
gaaatcatta gttttggaaa tatctggaac taatgtagct actacttata taacgtgccc 240
catcaaacca cgagcttcac ttggaatcag attacctttt ctgattatga ttataaagaa 300
tatgaagaag tactttacat ttgaaattca aatattagat gataaagata tgcgtagaag 360
gtttagaata tcaaatttcc aatcatccac caaagtgaga ccgttctgta caacgatgcc 420
aatgggactc agcagtggct ggaatcaagt tcaatt 456
<210>70
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>70
taatacgact cactataggg agacgggtcg atacaagcgt ctaa 44
<210>71
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>71
taatacgact cactataggg agaagtccca ttggcatcgt tgta 44
<210>72
<211>472
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>72
taatacgact cactataggg agacgggtcg atacaagcgt ctaaacacac gttctgatga 60
catcaatttc taaaaatgtt cgcaaattcc taccaaagcg gcttcatttc aatattctac 120
agcgtaggaa gtaatccact agcattatgg gacaagcagg taaagaacgg acatatcaga 180
cggattatgg acgatgatgt gaaatcatta gttttggaaa tatctggaac taatgtagct 240
actacttata taacgtgccc catcaaacca cgagcttcac ttggaatcag attacctttt 300
ctgattatga ttataaagaa tatgaagaag tactttacat ttgaaattca aatattagat 360
gataaagata tgcgtagaag gtttagaata tcaaatttcc aatcatccac caaagtgaga 420
ccgttctgta caacgatgcc aatgggactt ctccctatag tgagtcgtat ta 472
<210>73
<211>503
<212>DNA
<213>Diabrotica virgifera
<400>73
cacgcgtcca aaatcaatcc ttgaaaaaag gcaacttcac ggaactttta caaaaactta 60
gtaaggttct aaaaccccag ggatacttat taagtgcagc agctccggga gcacgtgata 120
aaattgatga accttacgac attccagcga tttcaaagct actagacttg gtcaatgtta 180
tggttttcga tttccacggc gcttttgaca actatgtagg acatatctca ccgctttttc 240
ccgctaaagt tgactacgat tactataata ataaaacata caatgtggat acaggaattc 300
aatattggtt gaatggtggt gcagatcctg caaaattaaa cttgggtgtt gtcgcttatg 360
gaagaacttt tactttggct gataaaaata ataccgctct atatgctcct gtcaaaggtg 420
gaggtacagt tggaccttat tcacaacaat ctggatattt gggatataat gagatttgca 480
gatactatac cgactcaact tac 503
<210>74
<211>42
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>74
taatacgact cactataggg agacacgcgt ccaaaatcaa tc 42
<210>75
<211>47
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>75
taatacgact cactataggg agatcggtat agtatctgca aatctca 47
<210>76
<211>417
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>76
taatacgact cactataggg agacaaacat caggtgcgga aaaaacacga gaggctaata 60
ccaagtgatg ccgacgttgc caaatggaga tgtgttggtc ttctgtcagt cacaaccgca 120
aggcagtgtg aaatgtgaag ttatgtgatt tactttgaaa aaaacagata aggattacgt 180
aagatgagca attcatgtac tagtacaatt aaagttattg aaaataacac aattcttgta 240
gaatggcaaa aacatcatta tggtcatatt tttgattcgc aacatattaa tttacaaaag 300
aaagataata acataatagg ttcaaagcta atatcggagt cccatagcaa aggtaaaaaa 360
attgtttttc ttttttttct tacttaaaaa attctctccc tatagtgagt cgtatta 417
<210>77
<211>927
<212>DNA
<213>Diabrotica virgifera
<400>77
aggtaaatgc tcaacatgaa ggtgctagtg ttactctcgg tactatctgc atttcttgtt 60
tgccaaacat caggtgcgga aaaacgggtc gtttgttatt tcgccagttg gaccatttat 120
agagcaagaa aaggtgcttt cgatgtcagt aatatagatc catcgctgtg tacacacatt 180
aattttgctt tccttggtct taatgaagat ggttctattc acattttgga ttcctgggag 240
tcaagtgatg ctggtggtca tgagggtttt aaacatctcg tagagcttaa aaagaccaat 300
cctgacctta aggtatgtgt aagtatgggc ggttggaacg aaggttccaa gcagtattca 360
gcagtagcat cagatccagc aaaaagagta aaacttgcag atgaggtttt agcttttatc 420
gaaaattggg gcttcgatgg ttttgatttg gattgggaat atccaggatt acgaggagga 480
aacgaaacta ttgataaaga gaattatgtc gaacttttga aagctcttag tgacgttctt 540
gagcccaaag gatacttact cagtgtagcc actgcaggcg ccgttgaaaa aatcgacgtt 600
ggatttgacg tctcagttat aaatgagttg gtggatatga ttaacgttat ggtttttgat 660
tttcatggag catttgagaa ctttgtagga cacgtttcac cattgttccc agctcaagtt 720
gattacgaat atgaagctaa tagtacatac aatgtagaca caggaatcca acactggata 780
ttgagtggtg cagatcccgc aaaaataaac ctcggcattg tcacctatgg aagaacctat 840
accttagctg ataaaaccaa tacttctctt tatgcaaatg ttaccggtgg tggtaataca 900
gggccatatt ctgcacaatc tggatat 927
<210>78
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>78
taatacgact cactataggg agacaaacat caggtgcgga aaaa 44
<210>79
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>79
taatacgact cactataggg agacgggatc tgcaccactc aata 44
<210>80
<211>912
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>80
taatacgact cactataggg agacgggatc tgcaccactc aataatatta aaactactat 60
aaaaatatga ctagttattc agaagattta atcataatct aaaaaagtgc aatacatttt 120
taataaacta tgatttattt atcccgcggt aaacactaaa aacactatat attatacata 180
aagataaatt aatacagtca aatactatta atttattctc tgaagtacgg gccattactt 240
tgtttacatg tttgtatact aacctgtaga acgttattcc tgaagatttt ttattaacat 300
tgcttctgct actgcaacta cgttgagaac aagaagccat tattatgcac tatcacaata 360
tattattaca gtttctataa aagtattaaa aaactaaaaa tattcgaaag acaacaaacg 420
taaacaaaca tatacgatct gtcaaaagtg tcacaacaat cttaacgata tggccgaagt 480
gaggtcgttt ttagtcacgt gatgccttct ccatagattc taactcgatg gtgtagacgc 540
aaatagcgac atctgataat aaaatcgtga actaattttc gaaaccaaat tcagaatttc 600
gctttaatct gtgccttcta agaattgcaa ggcaagacag acgttgataa agatgttaga 660
tataagtttg atataagtag atataagttt gattattact tacaataggg acagcatcta 720
attattttta gcacactcac ttgctgccaa caatactggc cgcaaaacta ggtaatagag 780
aaatagtgta tattaaggaa tgaactgact ggtcgcaagc tcttgcttgt cggacctttc 840
cttacgaagt tgcttgacga ctgtattatt tttccgcacc tgatgtttgt ctccctatag 900
tgagtcgtat ta 912
<210>81
<211>342
<212>DNA
<213>Diabrotica virgifera
<400>81
ggagcgaagg catctctctc catcccgacc tctcgtggcc gccgcgaaga aaaggagctt 60
atcatggctt caaaacgtat cctgaaggaa ctgaaggact tgcagaaaga tcctccgaga 120
tcatgcagtg caggtccttc tggcgaggat atgttccatt ggcaggcaac aattatgggt 180
cctcctgata gtccctatgc tggaggtgtt ttcttagtga atatccattt ccccccggac 240
taccccttca agcctccgaa ggtatcgttc aagacaaagg tcttccatcc gaacatcaat 300
agcaatggag gcatatgcct cgacattctg aaggagcaat gg 342
<210>82
<211>42
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>82
taatacgact cactataggg agac tctcca tcccgacctc tc 42
<210>83
<211>42
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>83
taatacgact cactataggg agatgcctcc attgctattg at 42
<210>84
<211>344
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>84
taatacgact cactataggg agactctcca tcccgacctc tcgtggccgc cgcgaagaaa 60
aggagcttat catggcttca aaacgtatcc tgaaggaact gaaggacttg cagaaagatc 120
ctccgagatc atgcagtgca ggtccttctg gcgaggatat gttccattgg caggcaacaa 180
ttatgggtcc tcctgatagt ccctatgctg gaggtgtttt cttagtgaat atccatttcc 240
ccccggacta ccccttcaag cctccgaagg tatcgttcaa gacaaaggtc ttccatccga
300
acatcaatag caatggaggc atctccctat agtgagtcgt atta 344
<210>85
<211>674
<212>DNA
<213>Diabrotica virgifera
<400>85
tcggcggccg gtaaggaact ttaaaccgga atggtcaaaa aacaaaatcc tggcataatg 60
gggaaaattg gaattaacgg ttttggccga attggccgcc tggtaccccg tgcagctctt 120
gaaaaaggag ttgaagtagt agctgtcaac gatcccttcc ttgatgtcga ctacatggta 180
tacttgttca aatttgactc tacccacggt cgctacaagg gatgtgtcaa cagtgatggc 240
aaaaacttag ttgttgatgg caaagtcatt tccgtacacc aagaaagaga cccagctgct 300
attccatggg gcaaagctgg tgcagattat gtagtagaat ctaccggagt gttcaccaca 360
attgaaaagg ccaagaaaca tcttgacggt ggtgctaaga aagtcatcat ctcagctcca 420
tctgctgatg ctccaatgta tgtatgtggt gttaacttgg atgcctacaa tccagctgat 480
cccgtaatct ctaacgcttc ttgcactacc aactgccttg ctccactcgc caaagtcatc 540
cacgacaact tcgaaatcgt tgaaggtttg atgaccaccg tacatgccac aaccgccaca 600
caaaaaactg tcgacggacc ctctggaaaa ttgtggcgtg acggtcgtgg tgccggacaa 660
aacatcatcc cagc 674
<210>86
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>86
taatacgact cactataggg agagtacccc gtgcagctct tgaaa 45
<210>87
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>87
taatacgact cactataggg agaggttgtg gcatgtacgg tggtc 45
<210>88
<211>538
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>88
taatacgact cactataggg agagtacccc gtgcagctct tgaaaaagga gttgaagtag 60
tagctgtcaa cgatcccttc cttgatgtcg actacatggt atacttgttc aaatttgact 120
ctacccacgg tcgctacaag ggatgtgtca acagtgatgg caaaaactta gttgttgatg 180
gcaaagtcat ttccgtacac caagaaagag acccagctgc tattccatgg ggcaaagctg 240
gtgcagatta tgtagtagaa tctaccggag tgttcaccac aattgaaaag gccaagaaac 300
atcttgacgg tggtgctaag aaagtcatca tctcagctcc atctgctgat gctccaatgt 360
atgtatgtgg tgttaacttg gatgcctaca atccagctga tcccgtaatc tctaacgctt 420
cttgcactac caactgcctt gctccactcg ccaaagtcat ccacgacaac ttcgaaatcg 480
ttgaaggttt gatgaccacc gtacatgcca caacctctcc ctatagtgag tcgtatta 538
<210>89
<211>551
<212>DNA
<213>Diabrotica virgifera
<400>89
atagaagttg aaccatctga tactattgag aatgtgaaag ctaagatcca agataaggaa 60
ggtatcccac cagaccagca aagattgatc tttgcaggta aacagctgga agatggtaga 120
accttgtctg actataacat ccagaaagag tccactcttc acttggtact gagattgaga 180
ggaggtatgc agatcttcgt caagacacta actggaaaga ccatcacttt ggaagttgaa 240
ccatctgata ccattgagaa tgtcaaagct aagatccaag ataaggaagg tatcccacca 300
gatcagcaaa gattgatctt tgcaggtaaa cagctagaag atggtagaac tttgtctgat 360
tataacatcc agaaagagtc cactcttcac ttggtactta gattgagagg aggtatgcac 420
attttcgtca agacattgac tggtaatacc atcacattag aagttgaacc atctgatact 480
attgagaatg tgaaagctaa gattcaagat aaggaaggta tcccaccaga tcagcaaaga 540
ttgatctttg c 551
<210>90
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>90
taatacgact cactataggg agagtatccc accagaccag 40
<210>91
<211>47
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>91
taatacgact cactataggg agaatgtgca tacctcctct caatcta 47
<210>92
<211>407
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>92
taatacgact cactataggg agagtatccc accagaccag caaagattga tctttgcagg 60
taaacagctg gaagatggta gaaccttgtc tgactataac atccagaaag agtccactct 120
tcacttggta ctgagattga gaggaggtat gcagatcttc gtcaagacac taactggaaa 180
gaccatcact ttggaagttg aaccatctga taccattgag aatgtcaaag ctaagatcca 240
agataaggaa ggtatcccac cagatcagca aagattgatc tttgcaggta aacagctaga 300
agatggtaga actttgtctg attataacat ccagaaagag tccactcttc acttggtact 360
tagattgaga ggaggtatgc acattctccc tatactgagt cgtatta 407
<210>93
<211>401
<212>DNA
<213>Diabrotica virgifera
<220>
<221>misc_feature
<222>(369)..(369)
<223>N is a, c, g or t
<400>93
gtaatgttca tgttttgtgt gtagaaaaac gctaaaactg tgtgcaggca catcctttcg 60
cgatgagtag acccaacaca aactgttttc aagtcttacc gaacaatagc agatggctat 120
cgacacaaga ttctggaatt tttcccaaac gtcacactga ctactatgta tttaatatgg 180
gaagacagga agtgttagtg gaaggatggt ggggaacaaa actgggatgg actggggttt 240
tggatggagt gaacctggcg cctggcaatg gttacagaat tgtagtcagt gataaaccat 300
attttgtaac agctgtgaaa ataacaaata aaacaactgt aagggctctc atgcattgtt 360
ctgagatana cggttatcct ctgcggagtc aaggaactga c 401
<210>94
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>94
taatacgact cactataggg agatcgcgat gagtagaccc aacac 45
<210>95
<211>46
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>95
taatacgact cactataggg agaaacaatg catgagagcc cttaca 46
<210>96
<211>348
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>96
taatacgact cactataggg agacgcgatg agtagaccca acacaaactg ttttcaagtc 60
ttaccgaaca atagcagatg gctatcgaca caagattctg gaatttttcc caaacgtcac 120
actgactact atgtatttaa tatgggaaga caggaagtgt tagtggaagg atggtgggga 180
acaaaactgg gatggactgg ggttttggat ggagtgaacc tggcgcctgg caatggttac 240
agaattgtag tcagtgataa accatatttt gtaacagctg tgaaaataac aaataaaaca 300
actgtaaggg ctctcatgca ttgtttctcc ctatactgag tcgtatta 348
<210>97
<211>1168
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>97
acgctgacaa gctgactcta gcagatcacc gtcttcgata ccaagcggcc tgaattcgcg 60
tgaatcgtat ctcagtccat cgttggccaa gccggagtcc aaataggtaa tgcctgctcg 120
ggagttgtac tcgcctggaa cagggcatcc aacctgacgg tcagatgcca tcagacaaga 180
ctgttggagg aggagatgac agtttcaaca cattcttcag tgaaactggt gccggcaaac 240
atgtacctag agcagtattt gtagatttgg aaccaacagt agtagatgaa gtacgtaccg 300
gcacataccg tcaattgttc cacccagaac aactcatcac tggcaaagaa gatgccgcca 360
ataactacta gaggtcacta tacaattggt aaagaaatag ttgacttggt attggacaga 420
atccgtaaat tggctgatca atgccatagt caacagatag acgttccatc aacaaagaag 480
tgaaaccaga tccagtacca ccaccgaagg agtggaagat caagaaacct tgaagtccag 540
tacattgatc agccaattta cggattctgt ccaataccaa gtcaactatt tctttaccaa 600
ttgtatagtg acctctagta gttattggcg gcatcttctt tgccagtgat gagttgttct 660
gggtggaaca attgacggta tgtgccggta cgtacttcat ctactactgt tggttccaaa 720
tctacaaata ctgctctagg tacatgtttg ccggcaccag tttcactgaa gaatgtgttg 780
aaactgtcat ctcctcctcc aacagtcttg tctgatggca tctgaccgtc aggttggatg 840
ccctgttcca ggcgagtaca actcccgagc aggcattacc tatttggact ccggcttggc 900
caacgatgga ctgagatacg attcacgcat tttggttgat gagtttttaa cttttacacc 960
acaaatgaaa caaaattacg acagacgttc agattagcta gtaatgcagc ggatccgatc
1020
gttcaaacat ttggcaataa agtttcttaa gattgaatcc tgttgccggt cttgcgatga
1080
ttatcatata atttctgttg aattacgtta agcatgtaat aattaacatg taatgcatga
1140
cgttatttat gagatgggtt tttatgat 1168
<210>98
<211>2131
<212>DNA
<213>Diabrotica virgifera
<400>98
tcgcggcgac acacacccct ctaaacacgc tatcattggt cccacgcgcc gctagctagc 60
gatcgcgagc gagcgcccgc ccccccgccc gggaagctgc attactagct aatctgaacg 120
tctgtcgtaa ttttgtttca tttgtggtgt aaaagttaaa actcatcaac caaaatgcgt 180
gaatgtatct cagtccatgt tggccaagcc ggagtccaaa tcggtaatgc ctgctgggag 240
ttgtactgcc tggaacatgg catccaacct gacggtcaga tgccatcaga caagactgtt 300
ggaggaggag atgacagttt caacacattc ttcagtgaaa ctggtgccgg caaacatgta 360
cctagagcag tatttgtaga tttggaacca acagtagtag atgaagtacg taccggcaca 420
taccgtcaat tgttccaccc agaacaactc atcactggca aagaagatgc cgccaataac 480
tatgctagag gtcactatac aattggtaaa gaaatagttg acttggtatt ggacagaatc 540
cgtaaattgg ctgatcaatg tactggactt caaggtttct tgattttcca ctccttcggt 600
ggtggtactg gatctggttt cacttctttg ttgatggaac gtctatctgt tgactatggt 660
aaaaaatcaa aactggaatt cgccatctac ccagctcctc aagtatctac tgctgtagta 720
gaaccataca actccatctt gaccacccac accactcttg aacactcaga ctgtgccttt 780
atggtagata atgaagccat ctatgacatc tgcagacgta atctagacat cgagcgccca 840
acctacacca acttgaacag acttattggc caaatcgtat cctcaatcac agcttctcta 900
agattcgatg gtgctctaaa tgttgacttg acagaattcc aaactaactt ggttccttac 960
cctcgtattc acttccctct tgtcacctat gccccagtaa tttccgctga aaaggcttac
1020
catgaacaac tttccgtagc tgaaatcacc aatgcctgtt tcgaacctgc caaccagatg
1080
gtaaaatgtg atcccagaca tggtaaatac atggcttgct gtatgttgta cagaggggat
1140
gttgtaccaa aggatgtaaa tgctgctatt gcaaccatta agaccaaacg taccatccaa
1200
ttcgtagact ggtgtccaac tggtttcaaa gtaggtatca actaccaacc accaactgtt
1260
gtacctggag gtgatttggc taaagtacaa cgtgccgtat gcatgttgtc caacactaca
1320
gctattgctg aagcctgggc aagattggac cacaaattcg atcttatgta tgccaagaga
1380
gctttcgtcc actggtatgt aggagagggt atggaagaag gtgaattctc tgaagctcgt
1440
gaagatttgg ctgctttgga gaaagattat gaagaagttg gtatggactc cggagaaggt
1500
gagggtgaag gagctgaaga atattaaatt tgattccaaa catgacaaat cacttgtttt
1560
taagacaaaa aattcctttc aattttttta cactttttca ttacttttct gtgaaacgat
1620
tatttaaagt ctgatttaat ttaatacaga attttttacg agcaaaaaaa aaaaagggcg
1680
gcccccgatt gcgcatatag ctacattaaa gatcgtggcc tctgtctaga gactgactac
1740
aagtatccat gattaaacgg agactgcaaa cagtgtaatc tcggttatca ataaccatcc
1800
aatgaactag tgcatgctgt agtatcataa cacgaagtaa gcatcttcac ttgaggaatg
1860
tattatactg tgtgagccaa tatcagtatg tgacaacact aaatgagact ggccatagat
1920
aaaacctaca gcgcctttag gacgacttcc tatactagaa tccggtggaa aaccagttcc
1980
tcaaagcact gctatctgca ggcatctgtc taacgtatgc aaatcttggt ggtaaagacg
2040
caaaggtaaa tcttgttata tatattgctg atcaagcgta tgatgatatg aagaaaccta
2100
tgggcgaata catgagatac agggatgaaa g 2131
<210>99
<211>1720
<212>DNA
<213>Diabrotica virgifera
<400>99
gacacgggcc cgaatatccc cggccgctct ctacgatcaa cgcatcgaag agagcgttct 60
gtgttttcta gtaatagtta tttaatacat tttataaatc aaaatgaggg aaatcgttca 120
catccaagct ggacaatgcg gtaaccaaat tggagccaaa ttctgggaaa tcatctctga 180
tgaacacgga atcgacccca ccggagccta ccatggagac tctgacctcc aacttgaaag 240
aatcaatgtc tactacaacg aggcctccgg cggaaaatac gtaccccgcg ccatcctcgt 300
cgacttggaa cccggtacca tggattcagt aaggtcgggt cccttcggac aaatcttcag 360
accagacaac ttcgtgtttg gacagtctgg agctggaaac aactgggcca agggacatta 420
cacagaaggt gctgaattag ttgattcagt attagatgtt gtaaggaaag aagctgaatc 480
atgtgattgt ttacaaggat tccaactcac acactcactt ggaggtggta ctggatcagg 540
tatgggtacc ctccttatct caaaaatccg tgaagaatac ccagacagaa ttatgaacac 600
atactcagta gtcccctcac ccaaagtatc agataccgta gtagaaccat acaatgccac 660
actttcagta catcaattgg tagaaaacac agatgaaaca tactgtattg ataatgaagc 720
tctctatgac atttgcttca gaactttgaa actcacaaca cccacatatg gagacttaaa 780
ccatttggta tccctcacaa tgtccggtgt aaccacctgt cttaggttcc caggtcagtt 840
gaatgctgat cttagaaaat tggctgtcaa catggttccc ttcccccgtc tccacttctt 900
catgcccgga ttcgctccac tcacctcaag aggcagccaa caatacagag cgttgacagt 960
tccagagctc acacagcaaa tgtttgatgc caagaacatg atggcggctt gtgatcccag
1020
acacggaagg taccttacag tagctgcagt attcagaggt aggatgtcaa tgaaagaagt
1080
tgacgaacag atgctcaaca tccagaacaa gaacagcagc tacttcgtcg aatggatccc
1140
caacaacgtt aaaacagccg tttgtgatat cccaccaaga ggtctcaaga tgtctgccac
1200
tttcatcggc aactcaaccg ccatccaaga attgttcaaa cgtatctccg aacaatttac
1260
agctatgttc aggaggaaag ctttcttgca ttggtacacc ggagaaggta tggatgaaat
1320
ggaattcacg gaagcagaat ccaacatgaa cgacttggta tcagaatacc aacagtacca
1380
agaagccaca gctgacgaag atgccgaatt cgacgaagac caggaagccg aagtcgacga
1440
gaactaaatt tcatacgtta attttggatc tgaaatcaaa gctttataac ttttatattt
1500
gtctcctctc cttttatttt ttatttaagc atgttttttg tacagtctct acattcccgt
1560
ttgtaaattt cgaatacact acttaaatta ttccaagact gactttttgt tgcttgtgtt
1620
tctggaattt caggaagtgt ttagatattt aacatgtttt gcgaactgtt tttttatgaa
1680
taggcattaa aactgctgcc attacttata ctcagaggca 1720
<210>100
<211>1175
<212>DNA
<213>Diabrotica virgifera
<400>100
tgacaactga cacacgagaa gatacgacat ggcaagaaaa tctctctgat taccattctg 60
acttttctgc gggatcggat gaggataagg aagacgatga tttcgatgag aagaacgacg 120
ccgatttaag cagaaggagt cgaagaaaga tggaaaggaa agacgagaag gatcgtcctt 180
taccaccgtt actagccaga gttggcggca atattgaagt actcggtttt aatgccaggc 240
agcgtaaagc gttccttaat gctattatgc gctacggaat gccaccacaa gacgctttca 300
attcacagtg gctggtgaga gatcttcgag gaaaatctga gaagatattc aaggcttacg 360
tgtctctctt tatgaggcat ctttgcgaac ctggtgcaga taatgctgat acatttgcgg 420
acggtgtgcc gagggaagga ctgagtaggc aacatgtttt gacaaggatt ggtgtgatgt 480
cacttataag aaagaaggtt caggagttcg aacacatcaa cggcgagtat agcatgccgg 540
aagtaatcaa aaagagcatt atggatcaaa ataaaatcaa tgccgccggc accgccacca 600
caagcgaagc agaaacgcct aaaagtgcta ctaccagtac tagtgctacg ccagctacaa 660
gtgctgctcc cagtcccgct cccacacaag gagaagataa agataaggat aaagattccg 720
ttcagagtga cgaaaataaa gataaagaag tggttaataa aacggaaacc gaagatgaag 780
agaagaaaac gggagaatct tcaacagaaa agccgaaaac tgaaccggaa gaagtgaaag 840
aagcttctcc gaaaaccgaa attcccgaag ctagttccga agctgataaa tctgagatca 900
aatccgaagt cgatacctcg tctgtaacca gcgaggaaaa gaaagaagag aaagaggaag 960
aggccaaaaa ggaagaaccc gaagagacca aaatggaaat acaggaggag gaacttgtta
1020
aagaggagaa aaaagaagaa gaggatgata agaagaagga ggaaattaag aaagaggtgg
1080
aaaagaagga agaggatgac gttatggtta ttgatgatga taaagataag aaggacaaaa
1140
aggaaatcga tctcgaagcc aagaagcgtt tcatg 1175
<210>101
<211>1176
<212>DNA
<213>Diabrotica virgifera
<400>101
cccatgcggc cgcccatttt tattgagcaa attgttcaga aagttgctgg gcgtagtcgg 60
gaaaaacatt gtttaaatcc ctttaatttc ctctaagtcg aaagaaaaag gctcaaaatg 120
gctctcagcg acgcagatgt acaaaagcag atcaagcaca tgatggcttt cattgagcaa 180
gaagccaatg aaaaggccga ggaaattgat gcaaaggctg aagaagaatt caacatcgaa 240
aagggccgtc tggtccaaca acagaggctc aagattatgg agtactacga gaaaaaagag 300
aagcaagtag aactccagaa aaaaatccaa tcatcaaaca tgttgaacca ggcaagattg 360
aaggtattga aagtaaggga agaccatgta cgtgccgttt tggaagatgc tcgcaaacgt 420
cttggtgagg taaccagaga ttcaggcaaa tatacacaaa tcctggaaag tctcatcctc 480
caagggctct atcagctctt cgaaaaggac atcaccatta gagtacgccc tcaggacaga 540
gaattggtaa aatctatcat gcctaacgtc tcccaaaagt acaaggacat aaccggtaaa 600
gacgtaaatc taaaaatcga cgacgagagc cacctttctc aagaaaccac cggaggaatc 660
gaactgttgg ccttgagaaa caagatcaaa atcaacaata ctctggaagc ccgtcttgag 720
ctcatctcac aacaattgat tccccagatc cgtaatgctc tgttcggacg caacgtcaac 780
agaaaattca ctgattaagt attttttgga tactgtgtat tgcctgtatt ttatatagta 840
ttgtaaaaca ttgttggttg cttagacaga tcttcaaaaa ccttttaaac tactatgtat 900
atacgatata tataataaac cattcctttt tttgaagtat tttaaacagt taagtttgtt 960
gttaccctaa ttgtatcctt gtcaagcaga tattttttaa aatccttaga aaattattag
1020
gtttcagtta tactacctta ttttttttct caaatatatt catattttat gtttatatgt
1080
atataaaaaa attatttttt tcttgtgaga aaatcatcgc aataaaattt attgttagtc
1140
caacaaaaaa aaaatggtgg ccgctttgtt ttttat 1176
<210>102
<211>2410
<212>DNA
<213>Diabrotica virgifera
<400>102
cggacgcgtg ggggagaaac ataacatcca tccacaaata tgtcgaaagt aaggatcgga 60
gatgaagaga aggaagggca gtatggttat gtccatgctg tctcaggtcc agtcgttact 120
gctgagaaaa tgtctggttc tgctatgtac gaactggtac gtgtcggata ctatgagctg 180
gtaggagaaa tcattagatt ggaaggtgac atggctacta ttcaggtata cgaagaaaca 240
tcaggtgtaa ctgttggtga tccagtatta agaactggta aaccactttc agtagaactt 300
ggacctggta ttatgggttc catttttgat ggtatccaac gtccattgaa agacatttgt 360
gacgctactg atagtattta catccccaag ggtattaacg taccttcttt atcgagaaca 420
gcaaaatggg acttcaaccc aatcaacatc aagttgggat ctcacttaac tggaggtgat 480
atatatggtc tagttcatga aaacaccctt gtcaaacaca aaatgattct gcctcctaga 540
gctaagggta ctgtaaccta cattgcagaa ccaggaaact acactgttga tgaagtagta 600
ttggaaactg aatttgatgg tgatcgtacc aaatatacta tgttgcaagt atggcctgta 660
cgtcaagcaa ggccagtcag tgaaaaatta cctgccaacc atcctctgct tacaggacag 720
cgtgtacttg atgctctttt cccatgtgta cagggtggta ctactgccat tcccggagct 780
ttcggttgtg gaaaaactgt aatttcacaa tctctttcca aatattccaa ctctgatgtc 840
attatctacg tcggttgcgg agaaagaggt aacgaaatgt ctgaagtatt gagagatttc 900
cctgaattga ctgttgaaat tgacgggcac actgaatcta ttatgaaacg taccgcattg 960
gtcgccaaca catctaacat gcctgtagct gctcgtgaag cttctatcta tactggtatt
1020
actctttctg aatacttccg tgatatgggt tacaacgtat ctatgatggc tgactcgaca
1080
tcacgttggg ccgaagcttt gagagaaatt tcaggtcgtt tggctgaaat gcctgccgat
1140
tccggttatc cggcttactt aggtgcccgt ttggcttcct tctacgaacg tgctggtcgc
1200
gttaaatgtt taggtaatcc agacagagaa ggatccgttt caattgtagg agccgtatca
1260
cctcctggtg gtgatttctc agatcctgtt accactgcta ctcttggtat tgtacaggtg
1320
ttctggggtt tggacaagaa acttgcccaa cgtaagcact tcccttcagt agactggctt
1380
ggatcatatt ccaaatattt aagagcattg gacgactttt atgacaaaaa cttccaagag
1440
tttattcctc ttagaaccaa agttaaggaa attcttcagg aagaagatga tctagccgaa
1500
attgtgcagc tggtaggtaa agcatctctg gcagaaacgg acaaaatcac cttggaaatt
1560
gccaggcttc ttaaagaaga tttcttgcaa caaaactcat actcttctta tgacagattc
1620
tgtccattct ataaaactgt cggtatgttg agaaacatga tcggtttgta cgacatggcg
1680
agacacgctg tagaatcaac cgcacaatca gaaaataaga tcacttggaa cgtaataaga
1740
gattcaatga gtggaatttt atatcaactt agcagtatga aatttaagga tcccgtaaaa
1800
gatggtgaag ctaaaatcaa ggcagatttt gatcaattat atgaagatat tcagcaggcc
1860
ttcagaaact tagaagatta aatcttttta aggaaatttt cctattttgt tcatcagtgt
1920
aagtttaaaa atatagcgat atttatcaaa aagaataata aggcctctat ccctcacttc
1980
tgtgaatatt aatatggccg tactaaagat agtaactaaa gataggtttt ctcttttttg
2040
atattatcct gtacaaaata aattatgtaa attgttgaat atgtgtatag tttttttggg
2100
tgagggtaca gtgcttatta aatacttttt aaacattttt cccgccattc caattactat
2160
taagtttttt cgttttaata cttttttaaa tatacaggtg cttaatatcg tttatatttt
2220
cagtattact tggttttctt catgtaaatt gttttaaatt tttcttttac ccttttaatc
2280
ttgtatatta cattacccaa ttaaagttaa ttgtacagat taagataaac gagtatctta
2340
taacatctat tagattgtta gaatcaataa atgtagtgta attgttctgt tttgaacaaa
2400
taaatgcatc 2410
<210>103
<211>1575
<212>DNA
<213>Diabrotica virgifera
<400>103
atctgacagt ttctacagta tagttgcagt gttcagtgga aaatattcaa ttaagatatt 60
cctagcgttc agacgtgtgc tctgatttca tggtactaaa atggcagtag ttcaatcaaa 120
ttacattcaa aatatacctt cttttggatg tgtagaccaa cctgacaacg gctccaaaac 180
aacaagagaa tcattagtag aagtgtcttc atcacgtcca cgccaagaag actactcagt 240
atatgagaac agactggcat ctttcactaa ctggcccaac acccaagtgt caagagaatc 300
attagctcga gctggtttta tatatacagg tcaagatgac atcgttatct gccctatttg 360
taagatagag ggataccatt gggtatcagg agacaatcca atggatgatc atcgtgtttg 420
gaatcccaac tgcccctttc ttaatagaag agataacatc gagcacgatc actctgtagg 480
ttctagagac acttgtggac tttttggcat agaattgtta ccaaattcag ttcctgaaga 540
taatacaagt aatttacaaa aattagggat ccaacctgga acaggtccac aaaatcaaga 600
caaaattacg ttagaaagcc ggttagcaac attccagggt tggccaaaga gcattaaaca 660
gaggccttct gagttagctg aggcgggatt ttattacaca ggagctgggg accaaactgt 720
gtgcttttat tgtggtgggg gattaaaaga ctgggatgaa ggagatgatc cttgggagca 780
acatgccctt tggtttagca aatgtgtgtt tctcaatttg aaaaagggca aagaattcat 840
cgatcaagta aagaggaagg ctgatccaca attttcaatt cctggaccta gcggtactca 900
agccaaagag gaaccgactg ctactgaatc ttcaagtgat aaacaaagtg aaacagtgaa 960
aacaaaatca gatagggaaa gtttcgcaac tgacacaact ttgtgcaaaa tttgctttaa
1020
aaacgaactt ggtgttgttt tcttgccttg tggacatatt gttgcttgtg tagattgtgc
1080
tgctgcacta aaaacatgtg ctgtatgccg aaaaccttta gaggccacag tcagagcgtt
1140
cctatcataa atttttattc tgttaatagt ttttcacatt tcatgtttca cacatactta
1200
gatctagtca agattgttag agttttggca aagaaattaa ataaaaattc ttttcataaa
1260
aatcatttct ttaatattac attagagaaa aattatattt ttatactgag tacaaatttg
1320
aacaagttat taattttaag ttacaaaata cgcttttata ggttaacaat tatcaaagcg
1380
cttaaatcta atagatacta cacaacatta aggactgcaa accatatctt tcacgaagta
1440
atccctacta gtgaccaatt gctcgctagg agcagatgca aattacacaa atttactata
1500
aatctgacat taaaacttag gtgtatgttt gtgtgtatgt tatgtattga tcataataat
1560
atagtaattt ataat 1575
<210>104
<211>1870
<212>DNA
<213>Diabrotica virgifera
<400>104
gtcgacccac gcgtccgaat ttgatggtga tcgtaccaaa tatactatgt tgcaagtatg 60
gcctgtacgt caagcaaggc cagtcagtga aaaattacct gccaaccatc ctctgcttac 120
aggacagcgt gtacttgatg ctcttttccc atgtgtacag ggtggtacta ctgccattcc 180
cggagctttc ggttgtggaa aaactgtaat ttcacaatct ctttccaaat attccaactc 240
tgatgtcatt atctacgtcg gttgcggaga aagaggtaac gaaatgtctg aagtattgag 300
agatttccct gaattgactg ttgaaattga cgggcacact gaatctatta tgaaacgtac 360
cgcattggtc gccaacacat ctaacatgcc tgtagctgct cgtgaagctt ctatctatac 420
tggtattact ctttctgaat acttccgtga tatgggttac aacgtatcta tgatggctga 480
ctcgacatca cgttgggccg aagctttgag agaaatttca ggtcgtttgg ctgaaatgcc 540
tgccgattcc ggttatccgg cttacttagg tgcccgtttg gcttccttct acgaacgtgc 600
tggtcgcgtt aaatgtttag gtaatccaga cagagaagga tccgtttcaa ttgtaggagc 660
cgtatcacct cctggtggtg atttctcaga tcctgttacc actgctactc ttggtattgt 720
acaggtgttc tggggtttgg acaagaaact tgcccaacgt aagcacttcc cttcagtaga 780
ctggcttgga tcatattcca aatatttaag agcattggac gacttttatg acaaaaactt 840
ccaagagttt attcctctta gaaccaaagt taaggaaatt cttcaggaag aagatgatct 900
agccgaaatt gtgcagctgg taggtaaagc atctctggca gaaacggaca aaatcacctt 960
ggaaattgcc aggcttctta aagaagattt cttgcaacaa aactcatact cttcttatga
1020
cagattctgt ccattctata aaactgtcgg tatgttgaga aacatgatcg gtttgtacga
1080
catggcgaga cacgctgtag aatcaaccgc acaatcagaa aataagatca cttggaacgt
1140
aataagagat tcaatgagtg gaattttata tcaacttagc agtatgaaat ttaaggatcc
1200
cgtaaaagat ggtgaagcta aaatcaaggc agattttgat caattatatg aagatattca
1260
gcaggccttc agaaacttag aagattaaat ctttttaagg aaattttcct attttgttca
1320
tcagtgtaag tttaaaaata tagcgatatt tatcaaaaag aataataagg cctctatccc
1380
tcacttctgt gaatattaat atggccgtac taaagatagt aactaaagat aggttttctc
1440
ttttttgata ttatcctgta caaaataaat tatgtaaatt gttgaatatg tgtatagttt
1500
ttttgggtga gggtacagtg cttattaaat actttttaaa catttttccc gccattccaa
1560
ttactattaa gttttttcgt tttaatactt ttttaaatat acaggtgctt aatatcgttt
1620
atattttcag tattacttgg ttttcttcat gtaaattgtt ttaaattttt cttttaccct
1680
tttaatcttg tatattacat tacccaatta aagttaattg tacagattaa gataaacgag
1740
tatcttataa catctattag attgttagaa tcaataaatg tagtgtaatt gttctgtttt
1800
gaacaaataa atgcatcaaa aaaaaaaaaa aaaaaaaaaa aaaggaaaaa aaaaaaaaaa
1860
gggcggccgc 1870
<210>105
<211>24
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>105
ctaatagatg ttataagata ctcg 24
<210>106
<211>24
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>106
cgagtatctt ataacatcta ttag 24
<210>107
<211>23
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>107
gtaatactga aaatataaac gat 23
<210>108
<211>23
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>108
atcgtttata ttttcagtat tac 23
<210>109
<211>20
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>109
agcactgtac cctcacccaa 20
<210>110
<211>20
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>110
ttgggtgagg gtacagtgct 20
<210>111
<211>21
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>111
gtgagggata gaggccttat t 21
<210>112
<211>21
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>112
aataaggcct ctatccctca c 21
<210>113
<211>19
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>113
aacttacact gatgaacaa 19
<210>114
<211>19
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>114
ttgttcatca gtgtaagtt 19
<210>115
<211>20
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>115
aggcctgctg aatatcttca 20
<210>116
<211>20
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>116
tgaagatatt cagcaggcct 20
<210>117
<211>21
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>117
ctgccttgat tttagcttca c 21
<210>118
<211>21
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>118
gtgaagctaa aatcaaggca g 21
<210>119
<211>20
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>119
gattgtgcgg ttgattctac 20
<210>120
<211>19
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>120
gtagaatcaa ccgcacaat 19
<210>121
<211>43
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>121
taatacgact cactataggg tacgtaagct tggatcctct aga 43
<210>122
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>122
taatacgact cactataggg tgcaggtacc ggtccggaat tccc 44
<210>123
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>123
taatacgact cactataggg cgcgtccgaa tttgatggtg a 41
<210>124
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>124
taatacgact cactataggg gttacctctt tctccgcaac c 41
<210>125
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>125
taatacgact cactataggg gaagtattga gagatttccc t 41
<210>126
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>126
taatacgact cactataggg ggaatcggca ggcatttcag c 41
<210>127
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>127
taatacgact cactataggg gcttacttag gtgcccgttt g 41
<210>128
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>128
taatacgact cactataggg ataaaagtcg tccaatgctc 40
<210>129
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>129
taatacgact cactataggg ccaagagttt attcctctta 40
<210>130
<211>41
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>130
taatacgact cactataggg gctatatttt taaacttaca c 41
<210>131
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>131
taatacgact cactataggg gaataataag gcctctatcc 40
<210>132
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>132
taatacgact cactataggg taaacgatat taagcacctg 40
<210>133
<211>40
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>133
taatacgact cactataggg acatttttcc cgccattcca 40
<210>134
<211>39
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>134
taatacgact cactataggg gatgcattta tttgttcaa 39
<210>135
<211>36
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>135
gcgtagaatt cgttcaaaac agaacaatta cactac 36
<210>136
<211>56
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>136
taatacgact cactataggg gcgtagaatt cgttcaaaac agaacaatta cactac 56
<210>137
<211>53
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>137
ggccttaagc tagcgcaatt ggatcccatt tattgattct aacaatctaa tag 53
<210>138
<211>26
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>138
ggccttaagc tagcgcaatt ggatcc 26
<210>139
<211>25
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>139
gatggtgaag ctaaaatcaa ggcag 25
<210>140
<211>53
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>140
ctgccttgat tttagcttca ccatcggaaa ttttcctatt ttgttcatca gtg 53
<210>141
<211>608
<212>DNA
<213>Diabrotica virgifera
<400>141
gcgtagaatt cgttcaaaac agaacaatta cactacattt attgattcta acaatctaat 60
agatgttata agatactcgt ttatcttaat ctgtacaatt aactttaatt gggtaatgta 120
atatacaaga ttaaaagggt aaaagaaaaa tttaaaacaa tttacatgaa gaaaaccaag 180
taatactgaa aatataaacg atattaagca cctgtatatt taaaaaagta ttaaaacgaa 240
aaaacttaat agtaattgga atggcgggaa aaatgtttaa aaagtattta ataagcactg 300
taccctcacc caaaaaaact atacacatat tcaacaattt acataattta ttttgtacag 360
gataatatca aaaaagagaa aacctatctt tagttactat ctttagtacg gccatattaa 420
tattcacaga agtgagggat agaggcctta ttattctttt tgataaatat cgctatattt 480
ttaaacttac actgatgaac aaaataggaa aatttcctta aaaagattta atcttctaag 540
tttctgaagg cctgctgaat atcttcatat aattgatcaa aatctgcctt gattttagct 600
tcaccatc 608
<210>142
<211>533
<212>DNA
<213>Diabrotica virgifera
<400>142
ggccttaagc tagcgcaatt ggatcccatt tattgattct aacaatctaa tagatgttat 60
aagatactcg tttatcttaa tctgtacaat taactttaat tgggtaatgt aatatacaag 120
attaaaaggg taaaagaaaa atttaaaaca atttacatga agaaaaccaa gtaatactga 180
aaatataaac gatattaagc acctgtatat ttaaaaaagt attaaaacga aaaaacttaa 240
tagtaattgg aatggcggga aaaatgttta aaaagtattt aataagcact gtaccctcac 300
ccaaaaaaac tatacacata ttcaacaatt tacataattt attttgtaca ggataatatc 360
aaaaaagaga aaacctatct ttagttacta tctttagtac ggccatatta atattcacag 420
aagtgaggga tagaggcctt attattcttt ttgataaata tcgctatatt tttaaactta 480
cactgatgaa caaaatagga aaatttccga tggtgaagct aaaatcaagg cag 533
<210>143
<211>1114
<212>DNA
<213>Diabrotica virgifera
<400>143
cgtagaattc gttcaaaaca gaacaattac actacattta ttgattctaa caatctaata 60
gatgttataa gatactcgtt tatcttaatc tgtacaatta actttaattg ggtaatgtaa 120
tatacaagat taaaagggta aaagaaaaat ttaaaacaat ttacatgaag aaaaccaagt 180
aatactgaaa atataaacga tattaagcac ctgtatattt aaaaaagtat taaaacgaaa 240
aaacttaata gtaattggaa tggcgggaaa aatgtttaaa aagtatttaa taagcactgt 300
accctcaccc aaaaaaacta tacacatatt caacaattta cataatttat tttgtacagg 360
ataatatcaa aaaagagaaa acctatcttt agttactatc tttagtacgg ccatattaat 420
attcacagaa gtgagggata gaggccttat tattcttttt gataaatatc gctatatttt 480
taaacttaca ctgatgaaca aaataggaaa atttccttaa aaagatttaa tcttctaagt 540
ttctgaaggc ctgctgaata tcttcatata attgatcaaa atctgccttg attttagctt 600
caccatcgaa attttcctat tttgttcatc agtgtaagtt taaaaatata gcgatattta 660
tcaaaaagaa taataaggcc tctatccctc acttctgtga atattaatat ggccgtacta 720
aagatagtaa ctaaagatag gttttctctt ttttgatatt atcctgtaca aaataaatta 780
tgtaaattgt tgaatatgtg tatagttttt ttgggtgagg gtacagtgct tattaaatac 840
tttttaaaca tttttcccgc cattccaatt actattaagt tttttcgttt taatactttt 900
ttaaatatac aggtgcttaa tatcgtttat attttcagta ttacttggtt ttcttcatgt 960
aaattgtttt aaatttttct tttacccttt taatcttgta tattacatta cccaattaaa
1020
gttaattgta cagattaaga taaacgagta tcttataaca tctattagat tgttagaatc
1080
aataaatggg atccaattgc gctagcttaa ggcc 1114
<210>144
<211>1125
<212>DNA
<213>Leptinotarsa decemlineata
<400>144
ggtgacatgg ccaccatcca ggtatatgaa gaaacttctg gagtaacggt gggagatcct 60
gtgttgcgta ccggtaaacc tctatctgtg gaacttgggc caggtattat gggttccatc 120
tttgatggta tccaacgtcc gctgaaagac atctgcgaca tgacggaaag tatctacatt 180
cccaagggtg tgaacgtgcc ttcactctcc agaactatca aatgggaatt caacccaatc 240
aacatcaagt tgggatccca cttgacaggt ggagatattt atggtatggt ccacgaaaac 300
acccttgtta agcacaaaat gatcctccca ccaaaatcta agggaacagt tacatacgtg 360
gcagaaccag gaaactatac cgttgatgaa gttgtattgg aaactgaatt tgatggagaa 420
aggtcaaaat acactatgtt acaagtctgg ccagttcgac aggcaagacc tgttagtgaa 480
aaactcccag ccaatcaccc gcttctcaca ggacagcgtg tattggactc tcttttccca 540
tgtgtgcaag gaggaaccac tgctattccc ggtgctttcg gttgtggtaa aactgtaatt 600
tcccagtcac tttccaagta ttccaactct gatgtcattg tgtatgtagg ttgtggagag 660
agaggtaatg agatgtctga agtattgaga gatttccctg aactgactgt ggaaattggt 720
ggtgagaccg aatctatcat gaaacgtacc gccttggttg caaacacctc caacatgcct 780
gtcgctgccc gtgaggcttc tatttatact ggtattaccc tgtctgaata tttccgtgat 840
atgggttaca acgtttctat gatggctgac tctacatcac gttgggctga agctttgaga 900
gaaatttcag gacgtttggc tgaaatgcct gctgattccg gttacccagc ctatttgggt 960
gctcgtcttg cctctttcta tgaacgtgct ggtcgcgtca aatgtttggg taaccctgac
1020
agagaaggat cggtttctat tgtaggagca gtatctccac ccggtggtga cttttcagat
1080
cccgttactt cagcaacttt aggtatcgta caggtgttct ggggt 1125
<210>145
<211>1125
<212>DNA
<213>Spodoptera frugiperda
<400>145
ggtgacatgg ccaccatcca ggtatacgaa gaaacatcag gcgtaactgt aggtgacccc 60
gtgctgcgta ccggcaagcc cctgtccgta gagctcggac ctggtatcct cggctccatc 120
tttgacggta tccagcggcc actgaaggac atcaacgagc tcacacagtc catctacatc 180
cccaagggtg tcaacgtacc ctgccttgga cgtgatgtct cctgggaatt caaccccttg 240
aatgttaagg tcggctccca catcaccgga ggagacttgt acggtatcgt acacgagaac 300
acattggtta agcacaagat gttgatccca cccaaggcca agggtaccgt cacctacgtc 360
gcgccctccg gcaactacaa agtcactgac gtagtgttgg agacggagtt cgacggcgag 420
aaggagaagt acacgatgtt gcaagtatgg ccggtgcgcc agccccgccc cgtcactgag 480
aagctgcccg ccaaccaccc cctgctcacc ggacagagag tgctcgactc tctcttccct 540
tgtgtccagg gtggtaccac ggccatcccc ggcgccttcg gttgtggcaa gactgtcgtc 600
tcacaggctc tgtccaagta ctccaactct gacgtcatca tctacgtcgg atgcggtgaa 660
cgtggtaacg agatgtctga ggtactgcgt gacttccccg agctgacggt ggagatcgag 720
ggcatgaccg agtccatcat gaagcgtacc gcgctcgtcg ccaacacctc caacatgcct 780
gtagccgccc gagaggcttc catctacacc ggtatcaccc tctctgagta cttccgtgac 840
atgggttaca acgtgtccat gatggctgac tccacctctc gttgggccga ggctcttcgt 900
gagatctcag gtcgtctggc tgagatgcct gccgactccg gttaccccgc ctacctggga 960
gcccgtctgg cctcgttcta cgagcgtgcc ggacgcgtga agtgcctggg taaccccgac
1020
agggagggct ccgtgtccat cgtgggcgcc gtgtcgccgc ccggaggtga cttctccgac
1080
cccgtgacgg ccgccacgct gggtatcgtg caggtgttct ggggt 1125
<210>146
<211>1126
<212>DNA
<213>Agrotis ipsilon
<400>146
ggtgacatgg ccaccatcca ggtatacgaa gaaacatcag gtgtaacagt gggcgacccc 60
gtactgcgta ctggcaagcc tctgtccgtg gaactgggtc ctggtatcct gggctccatc 120
tttgacggta tccagcgtcc tctgaaggac attaacgagc tcacacagtc catctacatc 180
cccaagggtg tgaacgtgcc cagtctatcc agggatatcg cctgggaatt tgagcccatg 240
aacctgaaga tcgggtccca catcactggc ggagacctgt acgccatcgt ccgcgagaac 300
accctggtga agcacaagat gttgatcccg cccaaggcca agggtaccgt cacatacatc 360
gcgcccgctg gcaactacca cgtcactgac gtggttctgg agacagagtt cgacggtgag 420
aaggagaagt acagcatgtt acaagtgtgg cccgtgaggc agccgcggcc ggtcgctgag 480
aagctccccg ccaaccatcc gctgctcacc gggcagaggg tactcgactc gctgttcccc 540
tgtgtgcagg gtggtacgac ggccatcccc ggagccttcg gttgcgggaa gactgtcatc 600
tcacaggcgt tgtccaagta ctccaactcc gatgtcatcg tctacgtcgg ttgcggagag 660
cgtggtaacg agatgtctga agtactgcgg gacttcccgg agctgaccgt agagatcggc 720
ggcgtcaccg agtccatcat gaagagaacc gcgctggtcg ccaacacatc caacatgcct 780
gtcgccgccc gagaggcttc catctatacc ggtatcactc tgtcggagta cttccgtgac 840
atgggctaca acgtgtccat gatggccgac tccacgtctc gttgggcgga ggccctccgt 900
gagatctctg gtcgtctggc cgagatgccg gcggactccg ggtacccggc ctacctggga 960
gcacgactgg cctccttcta cgagcgagcc ggacgagtca agtgtctggg taaccccgac
1020
agggaaggtt ccgtatccat cgtgggcgcc gtgtctcctc ccggcggaga cttctccgac
1080
cctgtgacgg ccgcgaccct gggtatcgtg caggtgttct ggggta 1126
<210>147
<211>1126
<212>DNA
<213>Helicoverpa zea
<400>147
ggtgacacgg ccaccatcca ggtatacgag gaaacctcag gtgtaaccgt gggtgacccc 60
gtactccgta ccggcaagcc cctgtccgtg gagttgggcc ccggtatcct gggctccatc 120
tttgacggta tccagcgtcc cctgaaagac attaacgagc tcacacagtc catctacatc 180
cccaagggtg tgaacgtacc ctctctggct agggatgtca gctgggaatt cgttcccatg 240
aacgttaaga cgggctccca catcaccgga ggagacctgt acggtctggt gcacgagaac 300
acgctggtga agcaccgcat gctgatcccg cccaaggcca agggtaccgt cacatacatc 360
gcgcccgctg gcaactacaa agtcactgac gtagtgctgg agacggagtt cgacggcgag 420
agggagaagt acacgatgtt gcaggtgtgg ccggtgcgcc agccgcggcc cgtcaccgag 480
aagctccccg ccaaccatcc gctgctcacc ggacagaggg tgctcgactc actcttccct 540
tgcgtacagg gtggtacaac tgccatcccc ggagctttcg gttgcggcaa gactgtcatc 600
tcgcaggcgc tgtccaagta ctccaactcc gatgtcattg tgtacgtcgg gtgcggagag 660
cgtggtaacg agatgtccga agtactgcgt gacttccccg agctgacggt ggagatcgag 720
ggcgtgacgg agtccatcat gaagcgaact gccctcgtcg ccaacacctc caacatgcct 780
gtcgccgccc gagaggcttc catctacact ggtatcactc tatccgagta cttccgtgac 840
atgggttaca acgtgtccat gatggctgac tccacgtccc gttgggccga agccctgcgt 900
gagatctcgg gtcgcctggc ggagatgccg gccgactccg gctaccccgc atacctgggc 960
gctaggttag cttccttcta cgagagagcc ggacgcgtca agtgtctggg taaccccgac
1020
agggaaggtt ccgtatccat cgtgggtgcc gtatctcccc ccggaggtga cttctctgac
1080
cctgtaactg cggccacgct gggtattgtg caggtgttct ggggta 1126
<210>148
<211>1126
<212>DNA
<213>0strinia nubilalis
<400>148
ggtgacacgg ccaccatcca ggtatacgaa gagacctcag gtgtgaccgt cggtgatccc 60
gtgctccgaa ccggcaagcc tctgtccgtc gagctgggtc cgggtatcct gggttccata 120
ttcgacggca tccagcgccc gctgaaggac atcaacgaac tgacgcagtc catctacatc 180
cccaagggag tcaacgtgcc ctgcctggcc aggaaccacg actgggagtt caacccgctt 240
aacgttaagg tcggctccca catcaccggc ggagacttgt acggtatcgt gcacgaaaat 300
accctggtga agcacaaaat gctgatgccg cccaaggcta aaggcaccat cacctacatc 360
gcgcctgccg gcaactacaa cgtcactgat gtggtgctgg agacagagtt tgacggcgaa 420
aagaactcct acaccatgtt gcaagtgtgg cccgtgcgcc agcccagacc ctgcactgag 480
aagctgcccg ccaaccaccc gctgctaact gggcagcgtg tgctggactc actcttcccc 540
tgtgtccagg gcggcaccac cgccatcccc ggcgccttcg gttgcggcaa gactgtcatc 600
tcgcaagcgc tgtccaagta ctccaactct gacgtcatcg tctacgtcgg ctgcggagag 660
cgtggtaacg agatgtctga ggtactgcga gacttccctg agctgagcgt ggagatcgac 720
ggcgtgacgg aatccatcat gaagcgcaca gcgctcgtgg ccaacacctc caacatgcct 780
gtggctgccc gtgaggcctc catctatact ggtatcaccc tatccgagta cttccgcgac 840
atgggttaca acgtgtcaat gatggcggat tccacatcgc gttgggcgga ggcgctgcgc 900
gagatctcgg gccgtctggc cgagatgccg gcggattccg gctacccggc ctacctgggc 960
gcccggctgg cctccttcta cgagcgagcg ggacgcgtga agtgtctcgg aaaccccgac
1020
agggaaggtt ccgtatccat cgtgggcgcc gtgtcgccac ccggaggaga cttctcggac
1080
ccggtgacgg cggcgaccct gggtatcgtg caggtgttct ggggta 1126
<210>149
<211>1125
<212>DNA
<213>Anthonomus grandis
<400>149
ggtgacatgg ccaccatcca ggtatatgaa gaaacctcag gtgtaacagt aggcgaccct 60
gtcctaagaa cgggcaaacc tctgtcagta gaactgggac ctggtatcat gggttccatt 120
tttgatggta tccaacgtcc cttaaaagac attaacgact tgacccagtc catttacatc 180
cccaagggtg taaatgtgcc atgtctgtcc aggacagccc agtgggaatt caatcccgtc 240
cacatcaaga tgggttctca tttgaccgga ggcgacatct atggtatggt ccatgaaaac 300
actttggtga aacacaaaat gattttgcct ccaaaggcaa agggtactgt gacatatatc 360
gccgaggcag gcaactatac tgtggacgat gtggtacttg agaccgaatt cgacggagaa 420
cgcaccaaat acaccatgtt gcaagtgtgg cccgtacgtc aaccgagacc tgtgagcgaa 480
aaattgccgg ccaaccaccc actgctcacc ggacaacgtg tactcgattc acttttcccc 540
tgtgtgcaag gaggtaccac cgccatcccc ggcgctttcg gttgcggtaa aaccgtaatt 600
tcacaggcct tgtccaaata ttccaactcc gatgtcatca tttacgtcgg ttgcggtgaa 660
agaggtaacg aaatgtctga agtactacgt gacttcccgg agttaacggt cgaaatcgac 720
ggtgccaccg aatccatcat gaaacgtacc gctttggtgg cgaacacctc caacatgccc 780
gtggccgccc gtgaggcctc catttatacc ggaatcactt tgtccgagta tttccgtgat 840
atgggttaca acgtttcgat gatggccgac tccacctcac gttgggccga agccttaaga 900
gaaatttcag gtcgtttggc tgaaatgccc gccgattccg gttatcccgc ttacttggga 960
gcacgtttgg cctcgttcta cgaacgtgcc ggtcgcgtta agtgtttagg taatccggac
1020
agagagggct ccgtgtccat cgtaggcgca gtatcgccac ctggtggtga cttctcagat
1080
cccgtcactt ccgccacttt gggtatcgta caggtgttct ggggt 1125
<210>150
<211>1125
<212>DNA
<213>Tribo1ium castaneum
<400>150
ggtgacatgg ccaccatcca ggtatacgaa gaaacttcag gtgttacggt gggtgatcca 60
gtcttacgaa ctggtaaacc cttgtcggtg gagctgggcc caggtattat gggttcgatt 120
tttgacggta tccagagacc gctgaaggac atcaacgagc tcacgcaaag tatttacatt 180
cctaagggtg ttaatgtgcc atcgttgtcg cgtacgacta agtgggagtt tgccccattg 240
aatatcaagt tggggtcaca tctgacaggc ggtgatattt acgggatcgt ccatgaaaac 300
actctcgtca agcataaaat gctgctgccg cccaaagcca aggggactgt cacatacgtc 360
gccgatcccg gaaattacac agtcgatgaa gtcgtcttgg agacggaatt cgacggcgag 420
aggaccaaat acaccatgtt gcaagtgtgg cctgtgcgtc agccccgccc tgtcagcgag 480
aaattgccag ccaatcaccc cctattaact ggtcaacgcg tactcgactc acttttcccg 540
tgcgtccaag ggggtaccac cgccattccc ggagctttcg gttgtggtaa gaccgtaatc 600
tcgcaatctc tctccaaata ttccaactct gacgttatca tttgcgtcgg ttgcggggag 660
cgtggtaacg aaatgtctga agtattgcgg gacttccccg aactgacagt cgaaatcgaa 720
ggccaaacag agtctatcat gaaacgtacc gctcttgtcg ccaacacctc taacatgcct 780
gtagccgccc gtgaggcttc aatttacacc ggtattacac tgtctgagta tttccgtgat 840
atgggttaca acgtgtcgat gatggccgat tccacctcgc gttgggccga agctttgaga 900
gaaatttccg gtcgtttagc tgaaatgccc gccgattctg ggtaccccgc gtatttgggg 960
gcccgtttgg cttcgtttta cgagcgtgca gggcgtgtta aatgcttggg taaccctgat
1020
cgtgaaggtt ccgtttctat tgtcggggcc gtatcgcccc ctggtggtga tttctctgat
1080
cccgtcacct cagctacctt gggtatcgta caggtgttct ggggt 1125
<210>151
<211>2860
<212>DNA
<213>Manduca sexta
<400>151
ggttcgtctc atccatcttt ctcgtctcaa caggacacac agatagtaca aaatggcgag 60
caaaggcggt ttgaagacga tcgccaatga ggagaatgag gagaggttcg gatacgtgtt 120
cgccgtgtcc ggtcctgtcg taacagcgga gaagatgtcc ggatccgcta tgtacgagct 180
ggtgcgcgtc ggttacaacg agctggtggg agaaatcatc cgtcttgagg gtgacatggc 240
caccatccag gtatacgagg agacctcagg cgtcacagtc ggtgaccctg tgctgcgtac 300
cggcaagccc ttgtccgtgg aactcggccc cggtatcctg ggctccatct ttgacggtat 360
ccagcgtcca ctgaaggaca tcaacgagct cacacaatcc atctacatcc ccaagggtgt 420
gaacgtgccc tcgctcgcca gggaggttga ctgggaattc aaccccctca atgttaaggt 480
cggctcccac atcaccggcg gagacctgta cggtatcgtg cacgagaaca cgctcgtgaa 540
gcacaagatg ttgatgccgc cgcgcgccaa gggtaccgtc acctacatcg cgcccgccgg 600
caactacaaa gtcactgatg tagtgttgga gacagagttc gacggcgaga aggcgcagta 660
cacgatgttg caggtgtggc ccgtgcgtca gccccgtccc gtcaccgaga agctccccgc 720
caaccacccg ctgctcactg gacagagagt actcgactcc ctcttcccct gtgtccaggg 780
cggtaccact gccatccccg gagccttcgg ttgcggcaaa actgtcatct cacaggcgct 840
gtccaagtac tccaactctg acgtcatcat ctacgtcggt tgcggagagc gtggtaacga 900
gatgtctgag gtactgcgtg acttccctga gctgacggtg gagatcgagg gtgtgacgga 960
gtccatcatg aagcgtaccg ccctcgtcgc caacacatcc aacatgcctg tcgctgcccg
1020
tgaggcttcc atctacacag gaatcaccct ttccgagtac ttccgtgaca tgggttacaa
1080
tgtgtccatg atggctgact cgacctcccg ttgggccgag gctcttcgtg agatctcagg
1140
tcgtctagct gagatgcctg ccgattccgg ttaccctgcg tacctgggag cccgtctggc
1200
ctccttctac gagcgtgccg gtagagtcaa gtgtctcgga aaccctgaca gggaaggttc
1260
ggtgtccatc gtgggtgccg tgtcgccgcc cggaggtgac ttctcggacc ccgtgacggc
1320
ggccacgctg ggtatcgtgc aggtgttctg gggtctcgac aagaaactcg cgcagaggaa
1380
gcacttcccc tccatcaact ggcttatctc ttacagcaag tacatgcgtg ctttggatga
1440
cttttatgag aagaactacc ccgaattcgt gccccttagg actaaggtca aggagatcct
1500
gcaggaggaa gaggacctgt cagaaatcgt gcagttggtc ggtaaagcct cgctcgccga
1560
gactgacaag atcaccctcg aggtcgccaa actgcttaaa gacgacttct tgcaacagaa
1620
cagctactcg tcatacgatc gattctgtcc gttctacaag accgtgggca tgcttaagaa
1680
catcatctcg ttctacgaca tgtcgcggca cgcggtggag tccacggccc agtccgacaa
1740
caaggtcacg tggaacgtga tccgcgacgc catgggcaac gtactctacc aactctcctc
1800
catgaagttc aaggacccag tgaaagacgg cgaggccaag atcaaggcag atttcgacca
1860
gctgttggag gatatgtccg ccgccttccg taacctcgag gactaagcac agccgtacta
1920
cagtacagta cagtagggag cgcccacgag ccgcgccgcg acatcctccg cagccgagag
1980
gacatcttta tcgacttgtt ttcatgttgt catttttatt ataatttatt gattaatatg
2040
aggatatatt ttttcgtatt ctattcacgt ccggagcgtt ttgagacagt tttttcgagt
2100
ctggagtgtt ttgcatttta tcgatattat cgagtgtcgg gcgtcgttaa ggcggtgctg
2160
ttagcgaggt atgcgttatg acacacgcat atatcgtaat aacagcgttg tttaaacggg
2220
tctgtgcgca ggcgcagttc gtgggcggtc gtgttgttat agtaattatg tagtgttaaa
2280
tatattacaa catcgattcc agaggatggt gtcgcgggct agaactccga cagcgcgaaa
2340
gcctacaaag ggcgtggctt gtaaacggca caataaggcc gactaacaat tctccgttat
2400
ttgaaatagc agttcaaaca cagtcgtcac agtggcggta gtccgaatgt ttggacctgg
2460
gttggtgttt ataaagttcg cccaatctat tgtaaatata taacaggttc gctgttctag
2520
cccgcgggcc gttacggcgt ttagttgttt tatgaaatct atttatgtac tatatcgatc
2580
ggtaaaccgt gatttataat caaatatcct cttgcattcc acgttgttgt tagaaatata
2640
gaattcaaaa cgtttgttgt tttcgagagc tttttacgct taatatggat gttcattcag
2700
tattaatata atgcgtacga gtacgcagta acaatagtca gcactaatat gtctactcgc
2760
tgtttgaaat tctgtgacgt tacgtgttga gaaattatta taaataataa taaaatattg
2820
taaacaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2860
<210>152
<211>3097
<212>DNA
<213>Aedes aegypti
<400>152
caggttggcc agtctttcag tcagtcagtc ttgtgatacc attttgcttc gctcggtgtg 60
tggagtttgc atttttccca tcccatctct ctcgacaact gcagcaccta agagcagaag 120
gaagcagagc aggaggaacg gatcgtaaca atgtccaccc tgaagaagat ctccgatgag 180
gaccgcgagt ccaaattcgg atatgtgttc gccgtatccg gtcctgtcgt cacggccgag 240
cggatgtccg gttcggctat gtacgagttg gtccgcgtcg gttactacga gctggtcggt 300
gagatcatcc gtttggaagg tgacatggcc accatccagg tatacgagga aacctccggt 360
gtcaccgtcg gcgatcccgt gctgcgtacc ggcaagcccc tctccgtcga actcggtcca 420
ggtattatgg gtagcatctt tgacggtatc cagcgtccac tgaaggacat taacgaactg 480
accagctcga tctacatccc cgaagggtgt gaacattccc tgcttgtccc gtacaggagg 540
ctggggattc aaccccttga acgtaaaggg ttgggctctc acatcaccgg aagagatctg 600
tacggtttgg tgcacgagaa taccctggtc aagcacaagc tgttggtccc gccacgcgcc 660
aagggtacag ttcgttacat tgctccaccc ggaaattaca ccgtcgacga catcattctg 720
gagacggaat tcgacggtga gatcaacaag tggtctatgt tgcaggtgtg gcccgtgcgt 780
cagccacgtc cagtgactga gaagttgccc gccaatcatc ctctgctgac tggtcagcgt 840
gtgttggatt cgctgttccc ttgtgtccag ggtggtacca ctgccatccc cggagctttc 900
ggttgcggta agactgtcat ctcgcaggcc ctgtccaagt actccaactc cgatgtcatt 960
atctacgtcg gttgcggaga acgtggtaac gaaatgtctg aagtattgcg tgatttccct
1020
gagctgtcgg ttgagattga cggtgttacg gagtccatca tgaagcgtac cgcgctggtt
1080
gccaacacct ccaacatgcc tgtcgctgct cgtgaagctt ccatctacac cggtattacc
1140
ttgtccgagt acttccgtga tatgggttac aacgtatcca tgatggctga ctcgacctct
1200
cgttgggccg aagctcttcg agaaatttcc ggtcgtctgg ctgagatgcc tgccgattcc
1260
ggttatcctg cctacctggg tgcacgtttg gcctccttct acgagcgtgc cggtcgtgtc
1320
aagtgtctcg gtaaccctga acgtgaaggt tcggtgtcca tcgtcggtgc cgtatcgccc
1380
cctggtggtg atttctccga tcccgtcaca tccgccaccc tcggtatcgt acaggtgttc
1440
tggggtctgg acaagaaact ggcccagcgt aagcatttcc cctcgatcaa ctggttgatc
1500
tcctacagca agtacatgcg cgcccttgat gacttctacg ataagaactt ccaggagttt
1560
gtacccactg cgtacaaggt taaggagatc ctgcaggagg aagaagattt gtccgaaatt
1620
gtgcagctgg tcggtaaggc atcgctggca gaaaccgata agatcaccct tgaggtagcc
1680
aagctgctca aggatgattt cctgcagcag aactcgtact cggcgtacga tcgattctgt
1740
ccgttctaca agacggtcgg tcgtatgctg cgaaacatga tcggattcta cgatatggct
1800
cgccacgccg tcgaaaccac cgcccagtcg gagaacaaga tcacctggaa cgtgatccgt
1860
gactcgatgg gcaacatcct gtaccagctg tcgtcgatga agttcaagga cccgggaagg
1920
atggcgaaga agatcaaggc cgatttcgac caactgtacg aagacctgca gcaggcgttc
1980
cgcaacctgg aagattaaat tctcccgcac attcgtggtc tcttcaatgc gaaattcttg
2040
aacagtttat tgtttcagta acatagcaaa gaaatgttcg tagcatagtg caaacaaaac
2100
atcaaaatga gaaacacgaa acacagcaaa agtgtagggc cctccttggc atcatgataa
2160
accaacaaca tccattaagt aaaatgcttc taggtcacca ttttacaggc gtatttaggt
2220
ttaaacattt atttacacaa attattgcaa gaaaaagatt aagagaacaa atctataaag
2280
cgagtgtaac atatacattt agaaacggcg aaacactaca acaactacag aaccacacgg
2340
cagaacagaa acaaatttta gtaggtaagt gatattgcaa gtgttgtccg acggcgtagg
2400
aaaaggttag cgaacggaat aacgttcaat cggaaattgt cttcgaaagt ttccgcttgc
2460
atgcgtgtct caaatgcgaa taaaacgtat aaacaatcgt ggtgaaactt aacatcagtg
2520
atgatataat caaaggggat taaaatgaaa cacgtggaca aaagatctat aaagaaaaac
2580
tctcagctag aatagttcaa gacgtggcga agcgtatcat aaatagaata atatgtaaac
2640
cacggttaat gggaaaataa gaagaaactt tcgattgagt atgttataga aacttatcca
2700
tgtatgatgt ataaatcgct aattaatcgt ataagaaata acagaacaag ttttattata
2760
ggtgtaagcc aatcaagttg ttatatcagt ttaaatatta tttagtgaat atagttttac
2820
ttttaatttt gtagtgtcgt ttttccatcg gtaggatcgg aaacgagaat cgatgattga
2880
ttgactgttg acaaatgaaa tgaaagttaa atttattatg cttttttgtt tgtgtgaaca
2940
gaattgaaga gccgccgcgt cgtttcggtc aatgcaagcg accgacggct cgtatctgtc
3000
ctgtacattt ttgtcgatga gcagaaaata tatgagaata aaaccctcta aaaaattgca
3060
ttccgcgtaa aaaaaaaaaa aaaaaaaaaa aaaaaaa 3097
<210>153
<211>2533
<212>DNA
<213>Drosophila melanogaster
<400>153
cgaaaacacg cacacagact gcaagtgtgt tagataataa gtgcagcaca agtccacact 60
tgagtaaaat aatccctaaa aaagccgaat atcaattagt tttccaagga gcttgaaaaa 120
gtgcgtcgaa aaaacagaat aaagcaaaat gtccaacctt aagcgtttcg atgatgagga 180
gcgtgagtcc aaatatggac gtgtcttcgc tgtctccggt cctgtcgtca ccgccgaggc 240
catgtctgga tcagctatgt acgagttggt ccgcgtcggc tactacgagc tggtgggcga 300
gatcatccgt ctggagggtg acatggccac catccaggtg tacgaggaga cctctggcgt 360
aactgtcgga gatccggtgc tgcgtaccgg caagcctctt tccgtggagc tgggacccgg 420
tatcatgggc agcatctttg acggtatcca gcgtcccctg aaggacatta acgagctgac 480
cgaatccatc tacatcccca agggtgtgaa cgtgcccagt ttgtcccgcg tggccagctg 540
ggagttcaac cccctgaacg tcaaggtcgg ctcccacatc accggaggtg acctgtacgg 600
tctggtgcat gagaacactc tggtcaagca caagatgatt gtgaaccccc gcgccaaggg 660
aacagtgcgc tacatcgccc cctccggcaa ctacaaggtc gacgatgtcg tcctggagac 720
cgagttcgat ggagagatca ccaagcacac catgttgcag gtgtggccag tgcgtcagcc 780
acgtcccgtg accgagaagc tgcccgccaa ccaccccctg ctcaccggac agcgtgtgct 840
cgactcgctc ttcccctgtg tccagggcgg taccaccgcc attcccggag ctttcggttg 900
cggcaagact gtgatctcgc aggctctgtc caagtactcc aactccgatg tcatcatcta 960
cgtcggttgc ggtgagcgtg gtaacgagat gtctgaggta ctgcgtgact tccccgagct
1020
gtccgtggag atcgacggtg tcaccgagtc catcatgaag cgtaccgccc ttgtggccaa
1080
cacctccaac atgcctgtgg ctgctcgtga ggcctccatc tacactggta tcaccttgtc
1140
cgaatacttc cgtgatatgg gttacaacgt gtccatgatg gctgattcca cctcccgttg
1200
ggctgaggct cttcgtgaaa tttctggtcg tctcgctgag atgcctgccg attccggcta
1260
cccagcctac ttgggagccc gtctggcctc cttctacgag cgtgccggtc gcgttaagtg
1320
cttgggtaac cccgagcgcg agggatccgt gtccattgtc ggagctgtgt ctcctcctgg
1380
tggtgacttc tccgatcccg tgacctccgc cactctgggt atcgtgcagg tgttctgggg
1440
tctcgacaag aagttggccc agcgcaagca cttcccctcg atcaactggc tcatctccta
1500
ctcgaagtac atgcgtgctc tggatgactt ctatgacaag aacttccccg aattcgtgcc
1560
gctgcgtacc aaggtcaagg agatcctgca ggaggaggag gatctgtctg agatcgtgca
1620
actggtcggc aaggcctctc tggccgaaac cgacaagatc acgctggagg tggccaagct
1680
gctgaaggac gatttcctgc agcagaactc ctactcctcg tacgatcgct tctgcccctt
1740
ctacaagacc gtgggcatgt tgaggaacat catcgacttc tacgacatgg cccgtcactc
1800
cgtggagtct acggctcagt ctgagaacaa gatcacctgg aacgtgattc gtgaggcaat
1860
gggcaacatt atgtaccagc tgtcatccat gaagttcaag gaccccgtta aggatggtga
1920
ggccaagatc aaggctgact tcgagcagct gcacgaggac ctgcagcagg ccttcagaaa
1980
tctggaggac tagagaccgc gctggcccta cttttacact ctaatcttat atttgttata
2040
tagttaacgt ttaaaaatga aagcagtcaa aaaccatccg aaaaagccta atcaaacacc
2100
aacaattccg tgctgcattc gatgaaaaac aaaagtccaa caaataccac aacttcttgg
2160
tgcctgcgag agatgtaaac attccggcct gcggttaata ctttccccta accacgcccc
2220
ctccgcccct tgaagggcaa ctctaggcaa cagcaactac aacgtcctgc tatgtacttc
2280
catttacaac aacaacacca acatacactt gaataaaagt acacggacac tggcgcacac
2340
acaacacata cataaaagac acaaatacaa atgcatgcat aaatagtatt attgtttaat
2400
gaatggaaat tcttgtttat ttgtgaaaaa agtcatgttt tctccctgtt tgtttgttaa
2460
atttatgtaa atatttaaag tatgaaatat taaatgtacg aataaagtgc aacaacaaat
2520
acatttaatg taa 2533
<210>154
<211>603
<212>DNA
<213>Bombyx mori
<400>154
atgagttccc tcaagctgca gaagaggctt gcagcctctg ttatgcgatg tggtaaaaag 60
aaggtgtggt tggatccaaa tgaaatcaat gagatcgcaa acaccaactc cagacagaac 120
atccgtaaga tgatcaagga tggtctcgtc atcaagaaac ctgtagcagt acactcccgc 180
gctcgtgtcc gcaaaaacac agaagcacgt agaaagggtc gtcactgtgg ctttggtaag 240
agaagaggta cagccaatgc gcgtatgcca cagaaggaac tatgggtaca aagacaaagg 300
gttttaagaa aattgctcct gaagtacaga actgccaaga agattgacag gcatctatac 360
cactcactct acatgaaggc gaagggtaat gtgttcaaga acaagcgtgt gctcatggag 420
tacatccaca ggaagaaggc tgagaaggcc aggacgaaga tgcttagcga ccaggctgag 480
gcccgccgca ataaagtgaa ggaggcacgc aagcgccgcg aggaacgtat tgccgccaag 540
aaggaggaac tgctgcagac cttcgctaga gaagacgaag ccgcgcttac cgctaagaag 600
taa 603
<210>155
<211>612
<212>DNA
<213>Drosophila melanogaster
<400>155
atgagttctc taaagctcca gaagaggctc gcagcctccg tgctgcgatg cggcaagaag 60
aaggtctggt tggatcccaa tgaaatcaac gagatcgcta acacaaactc gcgtcagaac 120
attcgcaagc ttatcaagga tggtctgatc atcaagaagc ccgtcgtggt ccactcccgt 180
taccgtgtgc gcaaaaacac cgaggcccgc cgcaaggacc gtcactgcgg attcggaaag 240
cgtaagggta ctgcgaacgc ccgcatgcct accaagctgc tgtggatgca gcgccagccg 300
ttctgccgcc gcctgttgaa gaagtaccgc gacagcaaga agattgacag gcacctgtac 360
cacgacctgt acatgaagtg caagggtaac gtgttcaaga acaagcgcgt cctcatggag 420
tacatccaca agaagaaggc tgagaagcag cgcagcaaga tgctggctga tcaggccgag 480
gctcgccgac agaaggtgcg tgaggcccgc aagcgccgcg aggagcgtat tgccaccaag 540
aagcaggagc tcatcgccct gcatgctaag gaggacgaga tcgctgccaa ggccgccacc 600
gcgggtcact aa 612
<210>156
<211>567
<212>DNA
<213>Anopheles gambiae
<400>156
atgcgatgcg gcaagaagaa ggtgtggttg gatcctaatg aaatcaacga gattggaaac 60
accaactcgc gacaaaacat tcgcaaactg atcaaggatg gtctgatcat caagaagccg 120
gtggtggtcc actcgcgtta ccgtgtgcgc aaaaacacga tcgctcgccg caagggtcgc 180
cactgcggtt atggtaagcg aaagggtacg gccaatgccc gtatgcccca gaagctgctc 240
tggatgaacc gtatgcgtgt gctgcgtcgt ctgctgaaga agtaccgtga ggcgaagaaa 300
atcgaccgtc acctgtacca cgacctgtac atgcgtgcga agggtaacgt gttcaagaac 360
aagcgtatcc tgatcgagca catccacaag aggaaggcgg agaaggcccg ctccaagatg 420
ctgagcgatc aggccgaagc caagcgtacc aaggttcgtg aggcccgtcg tcgtcgcgag 480
gaacgtattg ccaccaagcg ccaggagctt ctgcagacga tcgctaagga agaggagacc 540
gcgcagcatg ttgccgctac tggaaag 567
<210>157
<211>652
<212>DNA
<213>Diabrotica virgifera
<400>157
cacgttgaga ggtgcatttg cacgatgagt tccttaaaac ttcagaagag gctagcagcc 60
tctgttatgc gatgtggtaa aaagaaagta tggttggacc ctaatgaaat caacgaaatt 120
gccaacacta actcaagaca gaacatccgt aagttgataa aggatggtct tattattaag 180
aagcccgtag ctgtacattc ccgtgcccgt gttcgcaaaa acactgaagc ccgcaggaaa 240
ggaaggcact gcggttttgg taaaaggaag ggtactgcta atgcccgtac cccgcaaaag 300
gaattatgga ttcaacgcat gagagttttg cgtcgtctcc ttaaaaaata cagggaagct 360
aaaaaaattg acagacatct ataccactca ctctacatga aggccaaggg taacgtattc 420
aagaacaagc gtgtccttat ggaatacatc cacaagaaga aggcagagaa agcccgtgcc 480
aagatgttgg cagaccaggc caatgccaga aggatgaagg taaaacaggc tagagaaaga 540
cgtgaggaac gtatcgccac aaagaaacaa gaagttttgc agaactacat gagggaggat 600
gaagctgcgg ccactaagaa ataagttaat tgttttataa gatgactata tt 652
<210>158
<211>402
<212>DNA
<213>Anthonomus grandis
<400>158
tgagatgtgg taagaagaag gtatggttgg accctaatga aattaacgag attgccaaca 60
ccaactcgag gcaaaacatc cgtaaattga tcaaggatgg tttgatcatt aagaaaccgg 120
tggcagtgca ctctagggct cgtgtccgta aaaacacaga agctcgcagg aagggaaggc 180
actgcggttt cggtaagagg aaaggtacag cgaacgctcg tatgcctcaa aaggaactat 240
ggatccaaag gatgcgtgtc ttgaggcgtc tcctgaaaaa atacagggaa gccaaaaaga 300
tcgacaggca tctgtaccac gccctgtaca tgaaggccaa gggtaacgtg ttcaagaaca 360
agagagtgtt gatggaatac atccacaaga agaaggctga ga 402
<210>159
<211>403
<212>DNA
<213>Tribolium castaneum
<400>159
tgagatgcgg taagaagaag gtatggttag atccgaacga aatcaacgag atcgccaaca 60
cgaattcacg ccagaacatc cgcaaattga tcaaagatgg tctcatcatc aaaaagcccg 120
tcgctgtgca ctccagagcc cgcgtccgca agaacacgga ggcccgcagg aagggacgcc 180
attgcggctt cggcaagagg aaaggtacag ccaatgcgcg tatgccccag aaggagctct 240
ggatacagag gatgcgggtc ttgaggaggc tcctcaagaa gtatcgcgag gccaaaaaga 300
tcgacagaca tctttaccat tcgctgtata tgaaggccaa gggcaacgtc ttcaagaaca 360
agagggtcct tatggagtac atccacaaga ggaaggccga gaa 403
<210>160
<211>23
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>160
ggtgacatgg ccaccatcca ggt 23
<210>161
<211>24
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>161
accccagaac acctgyacra tacc 24
<210>162
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>162
ttaatacgac tcactatagg gagaccagtg tgctggaatt cgcc 44
<210>163
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>163
ttaatacgac tcactatagg gagaggatat ctgcagaatt cgcc 44
<210>164
<211>45
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>164
ttaatacgac tcactatagg gagacctgtc cgtagagctc ggacc 45
<210>165
<211>44
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>165
t taatacgac tcactatagg gagaggcacg ctcgtagaac gagg 44
<210>166
<211>22
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<400>166
tgmgatgygg yaaraagaar gt 22
<210>167
<211>26
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<220>
<221>misc_feature
<222>(23)..(23)
<223>N is a, c, g or t
<400>167
tgmgatgygg yaaraagaar gtntgg 26
<210>168
<211>25
<212>DNA
<213>Artificial sequence
<220>
<223>Synthesis
<220>
<221>misc_feature
<222>(6)..(6)
<223>N is a, c, g or t
<400>168
ttctcngcct tcytcytgtg gatgt 25
<210>169
<211>2713
<212>DNA
<213>Diabrotica virgifera
<400>169
cggacgcgtg agcggacgcg tgggcggacg cgtgggcgga cgcgtgggcg gacgcgtggg 60
cggacgcgtg ggcggacgcg tgggtggcaa cccacgcgtc cgctagttag tgctcgccgg 120
cgagcgcccg cgcccccgcc ccgaaagctg cattactagc taatctgaac gtctgtcgta 180
attttgtttc atttgtggtg taaaagttaa aactcatcaa ccaaaatgcg tgaatgtatc 240
tcagtccatg ttggccaagc cggagtccaa atcggtaatg cctgctggga gttgtactgc 300
ctggaacatg gcatccaacc tgacggtcag atgccatcag acaagactgt tggaggagga 360
gatgacagtt tcaacacatt cttcagtgaa actggtgccg gcaaacatgt acctagagca 420
gtatttgtag atttggaacc aacagtagta gatgaagtac gtaccggcac ataccgtcaa 480
ttgttccacc cagaacaact catcactggc aaagaagatg ccgccaataa ctatgctaga 540
ggtcactata caattggtaa agaaatagtt gacttggtat tggacagaat ccgtaaattg 600
gctgatcaat gtactggact tcaaggtttc ttgattttcc actccttcgg tggtggtact 660
ggatctggtt tcacttcttt gttgatggaa cgtctatctg ttgactatgg taaaaaatca 720
aaactggaat tcgccatcta cccagctcct caagtatcta ctgctgtagt agaaccatac 780
aactccatct tgaccaccca caccactctt gaacactcag actgtgcctt tatggtagat 840
aatgaagcca tctatgacat ctgcagacgt aatctagaca tcgagcgccc aacctacacc 900
aacttgaaca gacttattgg ccaaatcgta tcctcaatca cagcttctct aagattcgat 960
ggtgctctaa atgttgactt gacagaattc caaactaact tggttcctta ccctcgtatt
1020
cacttccctc ttgtcaccta tgccccagta atttccgctg aaaaggctta ccatgaacaa
1080
ctttccgtag ctgaaatcac caatgcctgt ttcgaacctg ccaaccagat ggtaaaatgt
1140
gatcccagac atggtaaata catggcttgc tgtatgttgt acagagggga tgttgtacca
1200
aaggatgtaa atgctgctat tgcaaccatt aagaccaaac gtaccatcca attcgtagac
1260
tggtgtccaa ctggtttcaa agtaggtatc aactaccaac caccaactgt tgtacctgga
1320
ggtgatttgg ctaaagtaca acgtgccgta tgcatgttgt ccaacactac agctattgct
1380
gaagcctggg caagattgga ccacaaattc gatcttatgt atgccaagag agctttcgtc
1440
cactggtatg taggagaggg tatggaagaa ggtgaattct ctgaagctcg tgaagatttg
1500
gctgcttttc ttatcatctc tatttttttt acgatcctta accgcataac accgtatcta
1560
tcattgtgaa attaggtgtg aaaggtgttt aaaaatgagg ttccttattc tacttgccgt
1620
attggctgta gctgtgaatg ctacatcaat ccaccaacaa tgggctacat ttaaggtaaa
1680
ccattccaag aagtacggac atcttaaaga agagcaagtt cgcttccaag ttttctctca
1740
aaatctccgc aaaattgaag aacacaatgc aagataccag aatggtgaag tgtccttcta
1800
cttgggggtt aatcagttcg cagatatgac ttcagaggaa ttcaaggcta tgcttgactc
1860
ccaactcatt cacaagccta agcgaaacat tacatcccgc tttgtagctg atcctcaatt
1920
gactgttcca gaatcaattg actggagaga aaagggggca gttgctccca taagggacca
1980
agggcaatgc ggatcatgtt gggcatttag tgcagctggt gctcttgaag gacaaagatt
2040
tttaaagcag aacgtactag aagtactgag tacccaacag ttagtagatt gttccggtga
2100
ttacgacaat gaaggctgca atggtggttg gccccattgg gcatataact acattaaaga
2160
tcatggcctc tgtctagagt ctgattacaa gtatcaagga ttagacggtg actgcaaaca
2220
gtgtaatccg gttatcaaaa ccatcaatgg ctatgcatct gtagatcaaa ctgaagaagc
2280
acttaaggag gctgtaggta ctgctggccc aatatcagta tgtgtcaacg ctaattggga
2340
ctggcaactg tacagcgggg gtatccttga tagccaaagt tgtccaggcg gcattttaaa
2400
ccatgcagtt ttagctgttg gatatggttc agaaaatggt aaagactttt ggcttatcaa
2460
gaattcatgg gacacttatt ggggagaagc aggttatttg agattagtac gtggtacaaa
2520
ccagtgcggt atcaatgaag tggccgatta tcctctccta taattttaaa aattgtcatg
2580
ccttacagtt tatataatga aacatgaata aaaatattat aactttaaaa aaaaaaaaaa
2640
agggcggccg acttttttta aaaaaaaaaa aaaaaaaaca aaaaaaaata aaaaaaaaaa
2700
agggggggcc ccc 2713
<210>170
<211>1363
<212>DNA
<213>Diabrotica virgifera
<400>170
cccacccgtc ccgtggtcga gaaaagtact aatagtgata tctacgtttt tcgtttgttt 60
aaaatgtagt gacatttctg ttaaagtctt caaaaacgga gacgtagtta atttaaatat 120
taactcaatt tctgagttaa agcaaaatgt agtccacaga ggtgaactag acgacattga 180
aattgaggac caaaatgttc cagtagtacc aaacaatttg ctgaatggaa tcactgccac 240
ggaacttcac attattagat cccaagtaag agatgttgaa cctggtgcat tcgatggagc 300
ttctatggtt aacctaatgt tgtatgaaaa ccaaattgca agaataagaa aaggtatatt 360
taacaaaaac tcatttaata tacttgcttt gcagaataac gttatatcta atatagaaga 420
tgaagccttt gacggtacaa ccatcgcgat actggacttt ggttttaaca agatggaaaa 480
attgacttca aaaatgttcg ctggttcaaa tattacaaat cttaacttac aatcgaacct 540
aataagtaac atagaagatg gtacctttca gaaaatcgat aatttgaata aattagactt 600
aagcggtaac caattggaag ttattggaca cgtctttaga aacctgacaa acctaaatga 660
attgcacttg gatggaaacc gaatcaaaac acttgaacct ggatgctttg gtggttctgg 720
gatctactgg ctttattttg caggtaacca actgactcat attgtaaagg gagtgtttta 780
taaagtacca gtatccttat tggatttcac taataacaaa atttcaaaaa ttgataaagg 840
agccttagct ggtctttcaa cgctaacatt tgttcagtta tctaataaca atataggaga 900
tttgaagctg tccactcttg gcgatctcaa tactgcttta aatggtctat ctttgagtga 960
taacggcatt tcaaatatcg atattggagt gttcaaaaat actaaaatcg atatgttgga
1020
cttaagcaaa aaccatataa aatcaattaa aaaaggactg ttccagaatg ttaaaatgta
1080
cactattaat ttgagtgaaa atgaaattac tgaaatagag gaagatgctt ttggtgatat
1140
cgaggattta agtcacatag atgtgagctt gaacaaacttacagaagtta agaagagaat
1200
gttcagtcta ccattggatg aagttaattg gaagataatg taataactaa aatcgataat
1260
gatgcccctc gtgtccttcc gctgtcacgt cttcagataa aaataatcct attggctgca
1320
agaacaaagc ttaaaataat ggtgtattta ataataatgg aat 1363
<210>171
<211>1215
<212>DNA
<213>Diabrotica virgifera
<400>171
aaaagagtga ggaaacaggt taattataat gacggaggaa tgacaactga cacacgagaa 60
gatacgacat ggcaagaaaa tctctctgat taccattctg acttttctgc gggatcggat 120
gaggataagg aagacgatga tttcgatgag aagaacgacg ccgatttaag cagaaggagt 180
cgaagaaaga tggaaaggaa agacgagaag gatcgtcctt taccaccgtt actagccaga 240
gttggcggca atattgaagt actcggtttt aatgccaggc agcgtaaagc gttccttaat 300
gctattatgc gctacggaat gccaccacaa gacgctttca attcacagtg gctggtgaga 360
gatcttcgag gaaaatctga gaagatattc aaggcttacg tgtctctctt tatgaggcat 420
ctttgcgaac ctggtgcaga taatgctgat acatttgcgg acggtgtgcc gagggaagga 480
ctgagtaggc aacatgtttt gacaaggatt ggtgtgatgt cacttataag aaagaaggtt 540
caggagttcg aacacatcaa cggcgagtat agcatgccgg aagtaatcaa aaagagcatt 600
atggatcaaa ataaaatcaa tgccgccggc accgccacca caagcgaagc agaaacgcct 660
aaaagtgcta ctaccagtac tagtgctacg ccagctacaa gtgctgctcc cagtcccgct 720
cccacacaag gagaagataa agataaggat aaagattccg ttcagagtga cgaaaataaa 780
gataaagaag tggttaataa aacggaaacc gaagatgaag agaagaaaac gggagaatct 840
tcaacagaaa agccgaaaac tgaaccggaa gaagtgaaag aagcttctcc gaaaaccgaa 900
attcccgaag ctagttccga agctgataaa tctgagatca aatccgaagt cgatacctcg 960
tctgtaacca gcgaggaaaa gaaagaagag aaagaggaag aggccaaaaa ggaagaaccc
1020
gaagagacca aaatggaaat acaggaggag gaacttgtta aagaggagaa aaaagaagaa
1080
gaggatgata agaagaagga ggaaattaag aaagaggtgg aaaagaagga agaggatgac
1140
gttatggtta ttgatgatga taaagataag aaggacaaaa aggaaatcga tctcgaagcc
1200
aagaagcgtt tcatg 1215
<210>172
<211>3363
<212>DNA
<213>Diabrotica virgifera
<400>172
accacgcatc cgcccacgcg tccgcccacg cgtccgccca cgcgtccgat tgaattactc 60
taatattttt tttttatttt cattttttat ttatttaata atttaaacta ttttaacttt 120
aattataaac caaaatattt taaaactaaa aaaactaatt taaaattcaa ttgaaaatga 180
taataaattt attttcttct ttcgacccta catctaattt taatttacca ataaactgat 240
taagaacagt attaggtcta ttaattattc catctagatt ttgattaatc ccctctcgtt 300
ataattattt atgaataaag attattataa cattacataa agaatttaaa gttttaattg 360
gaaattataa atcccaagga agaacattaa tttttatctc actatttaga ttaattttat 420
ttaataattt tcttggatta ttcccgtata tttttactag aacaagacat ataactttaa 480
cattaagatt agctttacca ttatgattga gatttataat ttatggatga ataaataata 540
ctattcatat attagctcat ttagttcctc aaggaactcc tccgatttta ataccattta 600
tagtttgtat tgaaacaatt agaaatgtaa ttcgacctgg aacattagca gtacgtttaa 660
ctgctaatat aatcgcagga cacttattaa taactctttt aggaaatact ggaccaataa 720
tatcaatcta tatattaaat attttaatta ttgtccaact tttactatta attttagaaa 780
cagcagtatc tataattcaa tcttatgtat ttgctgtttt aagaacacta tattctagag 840
aagtaaatta atgtcaaatc ataaaaatca tccttatcat ttagtagata ttagaccatg 900
acctttatta ggagctttta gagcaatatt aacaatatta ggaataatta aatgatttca 960
tttatataat aataatttac taataattgg attattaatt acaagattaa ttatatatca
1020
atgatgacga gatattgtac gagaaggaac ttatcaaggc cttcatacct ttagtagtta
1080
ctaaaggttt acgttgagga ataattttat ttattacttc agaagtatta ttttttatat
1140
catttttttg aggatttttt catagatcat tagcaccaac tattgaatta ggaatacttt
1200
gacctcctaa aggaattcaa gcctttaacc cattagaaat ccctttatta aatactttaa
1260
ttcttttaac ttcgggatta actgtaactt gagcccatca tagcctaata gaaaaataat
1320
ttttctcaag gacttcaagg attaattttt acagtaacat taggaattta ttttactatt
1380
ttacaaggat atgaatatat tgaatcacct tttgcaattt ctgattcaat ttatggatct
1440
tcatttttta tagcaacagg ttttcatgga ttacatgtaa ttattggaac aaccttctta
1500
ttaatttgtt taattcgcca ttatttaaat catttttcat cgacacatca ctttggtttt
1560
gaagcagcag cttgatactg acattttgta gatgtagtat gattattctt atatatttca
1620
atttactgat gaggtagatt gagtaaatac gtctaccgtt ctcctttaaa tgacgctatt
1680
tgtgctcctg aaagagagca aaagtgccca tggaatccga aggctgacag atctacctca
1740
attcatacaa cggtcaattg gcaagctcca cgtccaaaaa tactgccaaa tgccttgcac
1800
gcaattggta atactccatt gatcaagctt aacagaatac ctcagcaaga aggtttggaa
1860
tgtgatatat atgtaaaatg tgagttcttt aatcctggtg gatcagtaaa agatcgcatg
1920
gcaaacagaa tactgacaga tgccgagaat gaaggtatct taaaaccagg atgtaccatt
1980
atagagccgt cttcaggaaa tactggcatt ggtttggcta tggcagctgc tattaaagga
2040
tataggtgta taatcgtaat gtcagaaaaa atatccaaag agaaagaata cgtaatgaga
2100
gctttgggag ctgaagttat tagatgtcct gtcacagcta attcgttttc tccatatgga
2160
atgtttggta ctgtccatcg tttatcaaaa gaaattccca acagtattat ttttgatcag
2220
ttctctaatc ccggaaatcc actgactcac tacgatacta cagcagaaga aatttatgat
2280
caatgcgaca aaaaagtaga tatgataata atgggagctg gaacaggtgg taccgttacg
2340
ggtataggaa gaaaatttaa agagatttct cccaatacgg aaatcgtttg tgcagatcca
2400
attggatcat cttttgcttt accagaaatt ataaataaaa ctgacgttac tttctgggag
2460
atagaaggta tgggctacga tttcattccc tcaaccttag accgcaaagt cattgacact
2520
tggattaaag taggtgatga gaatgccctg ccaatggcaa gaaggttgat taaggatgaa
2580
ggccttttga ttggggctag cagtggagct atgatgtggg cggctattca agcagcgaaa
2640
gctaaaaatt atggccctgg taaaagggtt gtagttatgt taccagatag tattaggaac
2700
tacttaacaa agttcgtatg tgaccaatgg atggaagagc gaaatcttca gccttgtgta
2760
aatacaaaca accacccgtg gtggaattta aatgtctccc aattaaatct tcctgtacca
2820
caaactgtac cgataaattc ttccattgaa cagactttga atctaatgaa gaaacttgga
2880
cttaaccaga tacctgcatt ggatgatcaa gggggtgttg ttggagtact ttcaatgcag
2940
ctaattatta acaaacttac atctggtaat gctacactca atgacccaat agcagatgct
3000
atagaccgac tttatcccag agttgagaaa tctgctaata ttggactcgt ctcaagagta
3060
ttggaacgtg agccttattt ggtaattttg gatacacaag gtaaaggacc ttccaagata
3120
aataagcctg caggcgttgt aactccttta gattttctac agtttatcca gaagcagcat
3180
taaatataga ggagactaat atttccacca tttaacaaaa gtaatcacca taaagtgata
3240
aaataaataa tacctaatat aatagaaata ttagaaataa tagaaattat agattataat
3300
aaataaataa gtattataat caaaaaaaaa aaaaaaaggg gcggcgcccc tttttttttt
3360
ttt 3363
<210>173
<211>843
<212>DNA
<213>Diabrotica virgifera
<400>173
ctcataatat tatgccaaaa atttaaaata gtatttcgag gagaaattct ttataaaaaa 60
aattgtatct ttctttatat ttctggtgat atttatgaaa aacacaccag caatatgttt 120
gctatatcga ggagatcaat agctgcttta acacaaatca gatcaaagac agacaaggcc 180
gttttggacg aaattattcg agtagatcat gctggagaat tgggagcaga tcgtatttat 240
gcaggccaga tgttcattct aggcagcact tcaaaagcac ctttgataag acatatgtgg 300
gaacaagaaa aacatcacaa agctacattc gaagatctaa ttagaaaaaa acgtgttaga 360
cctacagtaa tgactcctat ttggaatgtt gcaggcttcg ccttaggagc aggatcagca 420
ttgcttggag acaaagcagc tatggcgtgt actgtggctg tcgaaacagt aattgtagat 480
cattataatg accaactgag aactctgttg gaagatccag agtgtgataa agagcttgta 540
gaaactatta agaagtttag agacgaggaa caagaacatc atgaccatgg cattgatcag 600
ggagcaaagc agactccttt ttatgaagcg tttactaatg tcattaaagc tggatgcaaa 660
gcagctatag caatatcgaa agtagtttaa cttgtgttta tgtacatatt atgtagttga 720
ttgtgaaata tatgttgtta aatttgtaaa gtattgacag tattatatat ttttggatat 780
aaagttagtc ccactatgtg tacagaaaaa tctaataaaa taaaatcaat ttaaatacag 840
att 843
<210>174
<211>704
<212>DNA
<213>Diabrotica virgifera
<400>174
aaagaccttg aagatcttct accatggcat gagaagcctg tgaagataca ggtcttagtt 60
ctagacatgt agagggacat aatctgtgtt atattttaga tcacaaaaga gtgcaattaa 120
ggctgttgtg tgatgagtac tagacaggaa gaaagagcag actcccagga tatctcgtgg 180
ttgagtctta tgatcaacaa tatacatatt ttgcatcaga atcttgatag atcaggctat 240
cttctaatta ttcttctatt ttttgttttt ttctcgagtt agctcagttt tttcctattt 300
tttttttggt acttttgcta gatatatttt acacatactc atttttatga gtcttaagtg 360
caatacgttg gtaacggaat actggttatt tgtcattcct tccttgtcgt acctaggttg 420
tttctcttta cttcaatagt tacaatgact atttgatttt tgattgtgtc aagctataca 480
agaaataaga gagtaatcag gagagagaaa gagagaaaag attgagtaat ctgtaagaca 540
tcaaaagatg aaaagaccta gaacatcttc tatcatagtt gtaagaggat gatgaaaggc 600
acaggtatta gttcaatcca gataaaaaat gaagtgttaa aagacataga agaaaaactt 660
ttgtgtacag tcgtacagta gacataggaa tacagcgaag atgc 704
Claims (22)
1. a kind of method for controlling coleopteran pest infestation comprising:It is mentioned in the diet of coleopteran pest
For reagent, the reagent includes dsRNA to inhibit in the harmful organism target coding sequence to express, wherein the dsRNA by
SEQ ID NO:DNA shown in 104 or its complementary series or its segment transcribe to obtain, and the segment has SEQ ID NO:104
Shown at least 19 continuous nucleotides.
2. the method as described in claim 1, wherein the coleopteran pest is selected from Leptinotarsa spp nocuousness
Biology, Tribolium spp harmful organism, Anthonomous spp harmful organism, Cyclocephala spp harmful organism and
Polyphaga spp harmful organism.
3. can play a role when in the diet for being provided in coleopteran pest by isolated ribonucleic acid and control sheath
Wing class pest infestation, the effect are realized by inhibiting the expression of herbicide-tolerant polynucleotide in the harmful organism,
The ribonucleic acid is from SEQ ID NO:DNA shown in 104 or its complementary series or the transcription of its segment come, and the segment has
SEQ ID NO:At least 19 continuous nucleotides shown in 104.
4. a kind of method of the expression for inhibiting the target polynucleotide in coleoptera plant-pest, the method includes:
Reagent is provided in the diet of harmful organism, when the reagent is absorbed by the harmful organism, is inhibited in the harmful organism
The expression of nucleotide, the reagent include:The ribonucleic acid expressed by following segments DNA, the segment DNA and harmful life
Nucleotide coding sequence 100% present in object is identical, and the nucleotide coding sequence is by SEQ ID NO:It shown in 104, or is it
Complementary series, or be its segment, the segment has SEQ ID NO:At least 19 continuous nucleotides shown in 104.
5. a kind of polynucleotide compositions in plant cell, wherein including expression cassette, the expression cassette includes:With nucleosides
The Plant functional promoters that sequence elements are operably connected, the element include at least 50 continuous nucleotide, institute
Continuous nucleotide is stated to show and SEQ ID NO:104 or its complementary series or its segment nucleotide coding sequence 100% sequence
The column phase same sex, the segment have SEQ ID NO:At least 19 continuous nucleotides shown in 104, wherein coleoptera plant has
Evil biology inhibits biological function critically important in the harmful organism to the intake of the polynucleotide compositions.
6. the plant cell comprising polynucleotide compositions described in claim 5.
7. a kind of insect control agent, wherein comprising from the ribonucleotide segment that the expression of following DNA generates, the DNA by
SEQ ID NO:Shown in 104, or it is its complementary series, or is its segment, the segment has SEQ ID NO:Shown in 104 extremely
Few 19 continuous nucleotides, wherein when being absorbed by coleopteran pest, the ribonucleotide segment plays a role inhibition
With the expression of the basic complementary nucleotide coding sequence of the DNA.
8. a kind of method for protecting plant to keep out coleopterous insect invasion, the method includes:In the insect diet
One or more cells of the plant are provided, the cell expresses RNA molecule from following DNA, and the DNA is by SEQ ID NO:
Shown in 104, or it is its complementary series, or is its segment, the segment has SEQ ID NO:Shown in 104 at least 19 it is continuous
Nucleotide, wherein the insect leads to the inhibition to biological function in the insect to the intake of one or more cells.
9. method according to claim 8, wherein the plant cell for expressing the RNA molecule includes selected from potato
Stem tuber storage protein patatin, Bacillus thuringiensis insecticidal protein, Xenorhabdus insecticidal protein,
Photorhabdus insecticidal protein, Bacillus laterosporous insecticidal protein and Bacillus sphearicus
The insecticide of insecticidal protein.
10. method as claimed in claim 9, wherein the coleopterous insect is Diabrotica spp..
11. a kind of method of the expression of desired gene product in one or more cells for inhibiting coleopteran insect pest,
The method includes:In the diet of the insect, the RNA molecule of gene containment amount is provided to one or more cells,
Wherein, the RNA molecule with gene containment effect is generated from following DNA, and the DNA is by SEQ ID NO:104 institutes
Show, or be its complementary series, or be its segment, the segment has SEQ ID NO:At least 19 continuous nucleosides shown in 104
Acid, wherein target base described in the insect pest cell is caused to the intake of the RNA with gene containment effect
Because of the reduction of product level.
12. a kind of expression cassette, wherein including SEQ ID NO:The DNA of at least 19 contiguous nucleotides shown in 104 or it is complementary
Sequence.
13. a kind of method for controlling the invasion of coleopteran pest comprising:In the diet of coleopteran pest
Reagent is provided, the reagent includes:The first ribonucleotide segment, can play a role suppression when being absorbed by the harmful organism
Make the biological function in the harmful organism, wherein the ribonucleotide segment is shown
(i) with the nucleotide sequence identity of the coded sequence 100% from the harmful organism, and with second of ribose core
The hybridization of thuja acid segment, second of ribonucleotide segment are complementary with the first described ribonucleotide segment;Or
(ii) 100% nucleosides of the coded sequence and obtained from the harmful organism at least 14 to 25 continuous nucleotides
The acid sequence phase same sex, and hybridizing with second of ribonucleotide segment, second of ribonucleotide segment and described the
A kind of ribonucleotide segment is complementary, and
Wherein, the coded sequence obtained from the harmful organism is by SEQ ID NO:It shown in 104, or is its complementary series,
Or be its segment, the segment has SEQ ID NO:At least 19 continuous nucleotides shown in 104.
14. a kind of nucleotide segment, following RNA molecules are encoded, when being provided in harmful organism diet with pest inhibitory amount
When middle, the RNA molecule can inhibit the diet of the harmful organism feed containing the RNA molecule, wherein the nucleotide section
Section is by SEQ ID NO:104 or its complementary series shown at least 19 continuous nucleotides composition.
15. nucleotide segment as claimed in claim 14, wherein
(i) nucleotide segment is included in the diet, and the diet is selected from artificial diet, plant cell, plant group
It knits, the root of plant, vegetable seeds and the plant come from vegetable seeds growth, wherein the diet includes harmful biological inhibition
The RNA molecule of amount.
16. agricultural product or commodity product that the seed generated from genetically modified plants produces, wherein the genetically modified plants are from one
Kind or a variety of continuous nucleotide segments express RNA, and the nucleotide segment is by SEQ ID NO:Shown in 104, or it is complementary for it
Sequence, or be its segment, the segment has SEQ ID NO:At least 19 continuous nucleotides shown in 104, and wherein, institute
State one or more nucleotide segments be in the agricultural product or commodity product it is observable, the commodity product is
The grits of genetically modified plants, oil pulverize grain or seed, or the grits comprising any genetically modified plants, oil or pulverize
Grain any product.
17. nucleotide segment, by SEQ ID NO:Shown in 104, or it is its complementary series, or is its segment, the segment tool
There is SEQ ID NO:At least 19 continuous nucleotides shown in 104 are expressed, and be provided in coleoptera to have as the segment RNA
In the diet of evil insect, wherein inhibit the harmful organism to the intake of the segment RNA of coleopteran insect pest amount of suppression
Further feed the diet.
18. a kind of plant cell is converted by continuous nucleotide segment, the nucleotide segment is by SEQ ID NO:104 institutes
Show, or be its complementary series, or be its segment, the segment has SEQ ID NO:At least 19 continuous nucleosides shown in 104
Acid, wherein the nucleotide segment is expressed in the plant cell as the segment RNA, and coleopteran insect pest meals are provided in
In food, wherein(a)The coleopteran insect pest leads to the containment of the gene to coding albumen to the intake of the segment RNA,
And(b)The coleopteran pest is inhibited further to feed the intake of the RNA of coleopteran insect pest amount of suppression
The diet.
19. a kind of method for selecting nucleotide segment, the nucleotide segment is for expressing the segment RNA, for inhibiting sheath
The expression of gene in wing class insect pest cell, described method includes following steps:
(a)MRNA is separated from the biology to plant pest;
(b)All or part of from the cDNA sequence obtained by the mRNA generates the segment RNA;
(c)The segment RNA is provided in the diet of the harmful insect;
(d)Select the segment RNA for inhibiting the gene expression in the harmful insect;And
(e)The segment DNA hybridized with the segment RNA is selected, SEQ ID NO is come from:104 or its complementary series or its piece
Section, the segment have SEQ ID NO:At least 19 continuous nucleotides shown in 104.
20. a kind of method for controlling coleopterous insect harmful organism, the method includes:In the insect pest
Two or more are provided in diet and has virose insecticidal reagent for same insect species, wherein the first
Insecticidal reagent includes the RNA molecule expressed from the segment DNA, wherein when the RNA molecule is absorbed by the harmful organism, energy
Inhibit the biological function in the harmful organism, wherein by one of the segment DNA that at least 21 continuous nucleotides are constituted
Divide the nucleotide sequence identity shown with the coded sequence 100% obtained from the harmful organism, and wherein, described
As the first described insecticidal reagent provides second of insecticidal reagent in diet, wherein second of insecticidal reagent
From it is described the first is different, wherein the harmful organism is corn rootworm, the coded sequence obtained from the harmful organism
By SEQ ID NO:Shown in 104, or it is its complementary series, or is its segment, the segment has SEQ ID NO:Shown in 104
At least 19 continuous nucleotides.
21. a kind of method for controlling the invasion of coleopteran pest comprising:In the diet of coleopteran pest
A kind of reagent is provided, the reagent includes:The first ribonucleotide segment can play work when being absorbed by the harmful organism
With the biological function inhibited in the harmful organism, wherein the ribonucleotide segment show with from the harmful organism
100% nucleotide sequence identity of the coded sequence of acquisition at least 14 to 25 continuous nucleotides, and with second
The hybridization of ribonucleotide segment, second of ribonucleotide segment is complementary with the first described ribonucleotide segment, with
And wherein, the coded sequence obtained from the harmful organism is selected from SEQ ID NO:104 or its complementary series or its segment,
The segment has SEQ ID NO:At least 19 continuous nucleotides shown in 104.
22. method as claimed in claim 21, wherein
(i) diet is selected from artificial diet, plant cell, plant tissue, the root of plant, vegetable seeds and from plant species
The plant that son growth comes, wherein the diet includes the nucleotide segment of pest inhibitory amount;Or
The nucleotide segment is by SEQ ID NO:The composition of nucleotide shown in 104.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110393140.6A CN102524294B (en) | 2004-04-09 | 2005-04-08 | For controlling the composition and method of insect infestations in plant |
CN201510472024.1A CN105002208A (en) | 2004-04-09 | 2005-04-08 | Compositions and methods for control of insect infestations in plants |
CN201811309884.3A CN109588562A (en) | 2004-04-09 | 2005-04-08 | For controlling the composition and method of insect infestations in plant |
Applications Claiming Priority (13)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US56084204P | 2004-04-09 | 2004-04-09 | |
US60/560,842 | 2004-04-09 | ||
US56563204P | 2004-04-27 | 2004-04-27 | |
US60/565,632 | 2004-04-27 | ||
US57906204P | 2004-06-11 | 2004-06-11 | |
US60/579,062 | 2004-06-11 | ||
US60342104P | 2004-08-20 | 2004-08-20 | |
US60/603,421 | 2004-08-20 | ||
US61726104P | 2004-10-11 | 2004-10-11 | |
US60/617,261 | 2004-10-11 | ||
US66917505P | 2005-04-07 | 2005-04-07 | |
US60/669,175 | 2005-04-07 | ||
PCT/US2005/011816 WO2005110068A2 (en) | 2004-04-09 | 2005-04-08 | Compositions and methods for control of insect infestations in plants |
Related Child Applications (4)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811309884.3A Division CN109588562A (en) | 2004-04-09 | 2005-04-08 | For controlling the composition and method of insect infestations in plant |
CN201110393140.6A Division CN102524294B (en) | 2004-04-09 | 2005-04-08 | For controlling the composition and method of insect infestations in plant |
CNA2008101829666A Division CN101422167A (en) | 2004-04-09 | 2005-04-08 | Aromatic neomenthylamides as flavouring agents |
CN201510472024.1A Division CN105002208A (en) | 2004-04-09 | 2005-04-08 | Compositions and methods for control of insect infestations in plants |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1997737A CN1997737A (en) | 2007-07-11 |
CN1997737B true CN1997737B (en) | 2018-11-30 |
Family
ID=38252218
Family Applications (3)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811309884.3A Pending CN109588562A (en) | 2004-04-09 | 2005-04-08 | For controlling the composition and method of insect infestations in plant |
CNA2008101829666A Pending CN101422167A (en) | 2004-04-09 | 2005-04-08 | Aromatic neomenthylamides as flavouring agents |
CN200580019203.4A Active CN1997737B (en) | 2004-04-09 | 2005-04-08 | For controlling the composition and method of insect infestations in plant |
Family Applications Before (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811309884.3A Pending CN109588562A (en) | 2004-04-09 | 2005-04-08 | For controlling the composition and method of insect infestations in plant |
CNA2008101829666A Pending CN101422167A (en) | 2004-04-09 | 2005-04-08 | Aromatic neomenthylamides as flavouring agents |
Country Status (3)
Country | Link |
---|---|
CN (3) | CN109588562A (en) |
AR (2) | AR062759A2 (en) |
ZA (1) | ZA200707612B (en) |
Families Citing this family (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2762011C (en) | 2004-04-09 | 2019-05-07 | Monsanto Technology Llc | Compositions and methods for control of insect infestations in plants |
KR20130130804A (en) * | 2010-12-30 | 2013-12-02 | 다우 아그로사이언시즈 엘엘씨 | Nucleic acid molecules that target the vacuolar atpase c subunit and confer resistance to coleopteran pests |
CN103328637B (en) * | 2011-01-24 | 2016-01-27 | 先锋国际良种公司 | There is the novel B. thuringiensis gene of anti-lepidopterous insects activity |
CA2905961C (en) * | 2013-03-15 | 2023-04-25 | Monsanto Technology Llc | Compositions and methods for the production and delivery of rna |
CN103789344B (en) * | 2014-02-26 | 2016-05-18 | 宜春学院 | A kind of paddy rice expression vector and preparation method thereof |
AR103043A1 (en) * | 2014-12-16 | 2017-04-12 | Dow Agrosciences Llc | SUPPRESSION OF GEN KRUPPEL PARENTAL ARNI FOR THE CONTROL OF HEMIPTER PESTS |
UY36435A (en) * | 2014-12-16 | 2016-07-29 | Dow Agrosciences Llc | SUPPRESSION OF THE PARENTAL ARNI OF THE GEN KRUPPEL TO CONTROL POTEOPTER PESTS |
ES2943259T3 (en) * | 2016-09-06 | 2023-06-12 | Agbiome Inc | Pesticide genes and methods of use |
CN112913784B (en) * | 2019-12-06 | 2022-07-22 | 中国林业科学研究院资源昆虫研究所 | Diapause induction method of Kallima inachus |
WO2022006764A1 (en) * | 2020-07-08 | 2022-01-13 | 赣南师范大学 | Recombinant diaphorina citri chitinase-like protein en03, and coding gene and application thereof |
CN113430200B (en) * | 2021-08-17 | 2022-05-27 | 中国林业科学研究院森林生态环境与保护研究所 | Hypha cunea Yang vATPase A gene dsRNA, bacterial expression liquid thereof and application |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1412311A (en) * | 2002-11-26 | 2003-04-23 | 西南农业大学 | Method for raising microbial pesticide effect by utilizing synergistic action of infection related gene |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001087940A2 (en) * | 2000-05-15 | 2001-11-22 | Monsanto Technology Llc | Polypeptide composionns toxic to anthonomus insects, and use thereof |
US20040048261A1 (en) * | 2002-09-11 | 2004-03-11 | Klaus Raming | Invertebrate choline transporter nucleic acids, polypeptides and uses thereof |
-
2005
- 2005-04-08 CN CN201811309884.3A patent/CN109588562A/en active Pending
- 2005-04-08 CN CNA2008101829666A patent/CN101422167A/en active Pending
- 2005-04-08 CN CN200580019203.4A patent/CN1997737B/en active Active
-
2007
- 2007-09-04 ZA ZA200707612A patent/ZA200707612B/en unknown
- 2007-09-11 AR ARP070104029 patent/AR062759A2/en not_active Application Discontinuation
-
2011
- 2011-12-29 AR ARP110104996 patent/AR084643A2/en not_active Application Discontinuation
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1412311A (en) * | 2002-11-26 | 2003-04-23 | 西南农业大学 | Method for raising microbial pesticide effect by utilizing synergistic action of infection related gene |
Non-Patent Citations (2)
Title |
---|
AF272829.1.GenBank.2001,;AF427598.1.GenBank.2001,;AY166605.GenBank.2002, * |
穆田.基因抑制技术让害虫"断子绝孙.中国农村科技 11.2003,(11),58. * |
Also Published As
Publication number | Publication date |
---|---|
AR084643A2 (en) | 2013-05-29 |
CN109588562A (en) | 2019-04-09 |
AR062759A2 (en) | 2008-12-03 |
ZA200707612B (en) | 2008-10-29 |
CN1997737A (en) | 2007-07-11 |
CN101422167A (en) | 2009-05-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10787680B2 (en) | Compositions and methods for control of insect infestations in plants | |
CN1997737B (en) | For controlling the composition and method of insect infestations in plant | |
TWI390037B (en) | Methods for genetic control of insect infestations in plants and compositions thereof | |
AU2011253615B2 (en) | Compositions and methods for control of insect infestations in plants | |
AU2007214372B2 (en) | Compositions and methods for control of insect infestations in plants |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |