CN1995393A - Fruit-fly classified detection biochip, detection method and reagent kit - Google Patents

Abstract

The invention discloses a biological chip, testing method and testing agent box to classify Tephritidae, which selects probe of general-purpose probe and atopic probe or subgeneric general purposed probe and composite group/sibling species atopic probe to identify Tephritidae rapidly and precisely.

Description

Fruit-fly classified detection of biological chip, detection method and test kit

Technical field

The present invention relates to the classification of insect detection technique, particularly relate to classification and Detection biochip, detection method and the test kit of Tephritidae.

Background technology

Mediterranean fruitfly Ceratitis capitata and citrus fruit fly Bactrocera dorsalis are Diptera Diptera, Tephritidae Tepheitida insect.These two kinds of insects are the agriculture major pests of generally acknowledging in the world, and the feeding habits host that mixes is very extensive, the main harm fruits and vegetables.

Mediterranean fruitfly and citrus fruit fly are respectively that the dangerous insect that enters the territory is forbidden in China's Plant Quarantine that enters the territory.Mediterranean fruitfly is a kind of dangerous harmful organism the most disruptive to fruits and vegetables, can endanger all to the valuable fruit crop of the mankind (having reported 352 kinds), is called as " the No.1 killer of fruits and vegetables ".Mediterranean fruitfly originates in West Africa, now propagates into more than 90 countries and regions, the world with fruits and vegetables etc.Mediterranean fruitfly once made the drupe of some country's plantations of Mediterranean Zone be injured rate up to 100%, the oranges and tangerines loss 50% of Greece, and gondola apricot, apple and oranges and tangerines loss are up to 80%; Since Mediterranean fruitfly in 1975 is imported California, USA into, 1986-1991 has generation every year, having carried out more than 10 large-scale the elimination during this time altogether takes action, cost and reach 1.5 hundred million dollars, meanwhile, has interrupted and the fruit of the U.S., the commercial relations of vegetables 34 countries and regions in the world, makes the U.S. suffer enormous economic loss.

The citrus fruit fly host range is very extensive, is a kind of serious fruits and vegetables insect.Kind of the fruits and vegetables surplus citrus, orange, piscidia, mango, peach, sweetsop, loquat, pawpaw, Calusena lansium, shatian pomelo, carambola, Hylocereus undatus, longan, lichee, Calusena lansium, banana, coffee, Lee, apricot, cherry, tomato, eggplant, the capsicum etc. 250 of can causing harm.This worm now the distribute U.S. (Hawaii) and Asia Desk region-by-region (SOUTHERN CHINA, India, Sri Lanka, Nepal, Bhutan, Burma, Thailand, Laos, Vietnam, Cambodia etc.), the trypetid monitoring result of China showed in recent years, the sign that citrus fruit fly is spread to the north of the Changjiang river being distributed with of China, China Ministry of Agriculture has announced that Shanghai has been the range of distribution of citrus fruit fly, the citrus fruit fly problem also is one of the most frequently used technology barriers measure of world's fruits and vegetables trade, China is that the citrus fruit fly epidemic-stricken area causes the fruits and vegetables outlet to be subjected to the restriction of many countries because of some areas, and financial loss is huge.

In the Asia-Pacific region, known citrus fruit fly aggregate species reach 75 kinds more than, have 8 kinds that important economic implications is wherein arranged, comparatively common 5 kinds comprise B. (B.) dorsalis and four important aggregate species (pawpaw trypetid B. (B.) papayae thereof, carambola trypetid B. (B.) carambolae, Philippines trypetid B. (B.) philippinensis, morphology difference is very little between mango trypetid B. (B.) the occipitalis aggregate species, be not easily distinguishable and come, it is one of difficult point of Tephritidae insect that the classification of citrus fruit fly aggregate species is identified always, and expert opinion does not also obtain in full accord both at home and abroad.

The kind authentication method of trypetid is most at present adopts traditional morphology to identify, mainly is to come identifying species by the morphological specificity of adult, and can not larva and ovum be identified, and there is error in the evaluation between the kind of nearly source.But in port quarantine, intercept and capture mainly based on worm attitudes such as larva and pupas, the larva that fruit fly belongs to, the feature of pupa are closely similar, be difficult to identify kind, traditional method is larva or pupa to be raised remake kind to adult and identify, this process need more than 20 days time and be not suitable for port quarantine and test the working routine of putting fast.Therefore the quick kind differentiation of trypetid is to import and export problem maximum in fruits and vegetables trypetid trade and the Plant Quarantine.

Summary of the invention

Purpose of the present invention is exactly in order to overcome the above problems, and the biochip that a kind of energy is quick, accurate, high-throughput ground carries out the evaluation of trypetid species and distinguishes is provided.

Another purpose of the present invention is to provide a kind of detection method that the trypetid species are identified and distinguished of carrying out.

Still a further object of the present invention is to provide the test kit that a kind of energy is quick, accurate, high-throughput ground carries out the evaluation of trypetid species and distinguishes.

For achieving the above object, the present invention has adopted following technical scheme:

The invention discloses a kind of fruit-fly classified detection of biological chip, comprise solid phase carrier and be fixed on probe on the carrier, described probe comprises section's general probe, belong to general probe and plant at least a in the general probe,

Described section general probe is teph, and it has the sequence shown in Seq ID No.1 in the sequence table;

Described genus general probe is selected from least a among anst, cera, the bact, and it has the sequence shown in Seq IDNo.2～4 in the sequence table respectively;

Described kind of general probe is selected from least a in following:

Ccca-1, ccca-2, ccco, cpro, anlu, anob, bboc-1, bboc-2, bbal, bbdi, bbla-1, bbla-2, bbfr, bbne, bbps, bbco-1, bbco-2, bbzo-1, bbzo-2, bbmu, bbum, bgca, baja, bdol-1, bdol-2, bpex, bzta, bzcu-1, bzcu-2, bzis, it has the sequence shown in Seq ID No.26～55 in the sequence table respectively.

Preferably, described probe also comprises subgenus general probe and/or aggregate species/sibling species specific probe; Described subgenus general probe is selected from least a among subbact, the subzeug, and it has the sequence shown in Seq ID No.5～6 in the sequence table respectively;

Described aggregate species/sibling species specific probe is selected from least a in following:

Caro, caco-1, caco-2, dor-comp-1, dor-comp-2, dor-comp-3, dor-comp-4, dor-comp-5, dor-comp-6, tyne, tycu, bbcu, coza, tacu, sais-1, sais-2, bpde, bacu-1, bacu-2, it has the sequence shown in Seq ID No.7～25 in the sequence table respectively.

Further preferred, described probe also comprises at least one in position probe, positive control probe, the negative control probe Kind.

Described locating point probe has the sequence shown in Seq ID No.56 in the sequence table; Described positive control probe has the sequence shown in Seq ID No.57 in the sequence table; Described negative control probe has the sequence shown in Seq ID No.58 in the sequence table.

The invention also discloses a kind of fruit-fly classified authentication method, described method comprises step: extract genomic dna from Tephritidae insect ovum, larva, pupa or adult, carry out pcr amplification with universal primer COI3/COI5, with the PCR product that obtains and above-mentioned fruit-fly classified detection of biological chip hybridization, described universal primer COI3/COI5 has the sequence shown in SeqID No.59～60 in the sequence table respectively.

Utilize the fluorescence method of mixing to carry out the fluorescent mark pcr amplification in the described pcr amplification process.

Preferably, the reaction conditions of described pcr amplification is 94 ℃/1.5min; 94 ℃/30s-55 ℃/30s-72 ℃/30s, 40 circulations; 72 ℃/5min.

The invention also discloses a kind of fruit-fly classified detection kit, described test kit contains above-mentioned fruit-fly classified detection of biological chip.

Because adopted above scheme, the beneficial effect that the present invention is possessed is:

Biochip of the present invention, by selecting the Tephritidae general probe for use, belong to general probe and planting specific probe, perhaps further select subgenus general probe and aggregate species/sibling species specific probe for use, can quick, accurate, high-throughout evaluation trypetid species, and, can realize also that to trypetid ovum, larva and pupa accurately classification is identified not only to the trypetid adult.

Description of drawings

Fig. 1 is 32 kinds of fruit-fly classified detection of biological chip probe dot matrix synoptic diagram (15 * 16).

Fig. 2 is five aggregate species classification and Detection of citrus fruit fly biochip probe dot matrix synoptic diagram (8 * 16).

Fig. 3 is Mediterranean fruitfly and sibling species classification and Detection biochip probe dot matrix synoptic diagram (6 * 16) thereof.

Embodiment

Before technology of the present invention, though successively being attempted being applied to the classification of trypetid, AFLP and PCR-RFLP, Auele Specific Primer PCR and SYBR Green real-time fluorescence PCR technology equimolecular biological method identify, but can only extensive, high-throughout trypetid authentication method not also be set up in the evaluation and the differentiation of single trypetid or a few species.It is many that but biochip technology can solve the trypetid kind with advantages such as its high-throughput, highly sensitive and high specifics, and aggregate species morphology is identified the problem that is difficult to distinguish, and is a kind of ideal trypetid Molecular Identification technology platform.Can not only fast, accurately carry out species molecule in different worm attitude levels with biochip technology and identify, and can carry out evaluation of trypetid species and differentiation fast, accurate, high-throughout.

Biochip of the present invention, by selecting the Tephritidae general probe for use, belong to general probe and planting specific probe, perhaps further select subgenus general probe and aggregate species/sibling species specific probe for use, can quick, accurate, high-throughout evaluation trypetid species, and, can realize also that to trypetid ovum, larva and pupa accurately classification is identified not only to the trypetid adult.

The present invention is according to the inward Plant Quarantine venereal disease worm weeds register of the new revision of China, and in conjunction with the intercepting and capturing frequency of the dangerous trypetid of China port Plant Quarantine, the generation harm situation of trypetid both at home and abroad, drafted dangerous trypetids such as Mediterranean fruitfly and the citrus fruit fly biochip test method of (comprising that 3 belong to 32 kinds of 12 subgenus), 32 kinds of trypetid kind registers are as follows:

Mediterranean fruitfly Ceratitis (C.) capitata, Natal trypetid Ceratitis (Pterandrus) rosa, African mango trypetid Ceratitis (Ceratalaspis) cosyra; Citrus fruit fly Bactrocera (Bactrocera) dorsalis, pawpaw trypetid Bactrocera (B.) papayae, carambola trypetid Bactrocera (B.) carambolae, Philippines trypetid Bactrocera (B.) pilippinensis, mango trypetid Bactrocera (B.) occipitalis, piscidia trypetid Bactrocera (B.) correcta, Portugal trypetid Bactrocera (B.) albistrigatus, billet breadfruit tree trypetid Bactrocera (B.) frauenfeldi, Di Aoshi trypetid Bactrocera (B.) diospyiri, Oceania oriental fruit fly Bactrocera (B.) curvipennis, capsicum trypetid Bactrocera (B.) latifrons, banana trypetid Bactrocera (B.) musae, the little trypetid Bactrocera of Queensland (Bactrocera) neohumeralis, black porch angle oriental fruit fly Bactrocera (B.) psidii, the trypetid Bactrocera of Queensland (B.) tryoni, three band trypetid Bactrocera (B.) umbrosa, peach trypetid Bactrocera (B.) zonata; Zha Weisi trypetid Bactrocera (Afrodacus) jarvisi, cucumber trypetid Bactrocera (Austrodacus) cucumis, dacus oleae Bactrocera (Daculus) oleae, gorgeous trypetid Bactrocera (Gymnodacus) calophylli, japanese squash trypetid Bactrocera (Paradacus) depressa, open and flat trypetid Bactrocera (Paratridacus) expandens, melon trypetid Bactrocera (Zeugodacus) cucurbitae, Shi Yuan island trypetid Bactrocera (Z.) ishigahiensis, tool bar trypetid Bactrocera (Z.) scutellata, pumpkin fruit fly Bactrocera (Z.) tau, Mexico is by trypetid Anastrepha ludens, west India is by trypetid Anastrepha obliqua.

Listed the used probe of the present invention in the following table 1.

Table 1 trypetid biochip probe

Probe type	The probe title	Seq ID No.	Probe sequence	The probe specificity explanation
					Section's general probe	teph	1	AGCAAAGACTGCTCCTATTGATAAT	Tephritidae section general probe
Belong to general probe	anst	2	GGAAGTGTGCTACTACATAATAAGTATCG	Anastrepha belongs to general probe
					cera	3	AGCTGGTGAGTAGTTTAATTGTG	Ceratitis belongs to general probe
	bact	4	CACAATATGGCTGGTGAATAGTTT	Bactrocera belongs to general probe
					The subgenus general probe	subbact	5	GGGTATCAGTGAACGAATCCT	Bactrocera subgenus general probe
subzeug	6	AATGAGCTACTACGTAGTAAGTGTC	Zeugodacus subgenus general probe
				Aggregate species/sibling species specific probe		caro	7	CGTTAAACCTCCAACTGTAAA	Mediterranean fruitfly and Natal trypetid sibling species probe
caco-1	8	ATAGCTGGGGAATAATTTAATTG	Mediterranean fruitfly and African mango trypetid sibling species probe
					caco-2	9	GGGGAATAATTTAATTGAGTCCC	Mediterranean fruitfly and African mango trypetid sibling species probe
dor-comp-1	10	ATAATAGCAAAGATTGCTCCTATTGA	Citrus fruit fly, pawpaw trypetid, carambola trypetid, Philippines trypetid, mango trypetid aggregate species probe
					dor-comp-2	11	CCGATAAATATGATAATGAACTGACTT	Pawpaw trypetid, Philippines trypetid, mango trypetid aggregate species probe
dor-comp-3	12	TTACTCCGATAGACATGATAATAAATTG	Citrus fruit fly, pawpaw trypetid, carambola trypetid, Philippines's trypetid aggregate species probe
					dor-comp-4	13	CTACGTAATATGTGTCATGAAGAA	Citrus fruit fly, pawpaw trypetid, Philippines trypetid, carambola trypetid and mango trypetid aggregate species probe

Aggregate species/sibling species specific probe	dor-comp-5	14	AAACCCTAGGGCTTACAATATGG	Citrus fruit fly, pawpaw trypetid, carambola trypetid, Philippines's trypetid aggregate species probe
					dor-comp-6	15	ATCATTTAGGATTCAATACTAGCCC	Citrus fruit fly, pawpaw trypetid and mango trypetid aggregate species probe
	tyne	16	AGTGGGTACCAGTGAACAAAC	Queensland trypetid and little Queensland trypetid sibling species probe
					tycu	17	CTCATAGCATAGCTGGGGAATAA	Queensland trypetid and melon trypetid sibling species probe
	bbcu	18	AAAAGTGGATACCAGTGAACAAATC	Oceania oriental fruit fly, Queensland trypetid, little Queensland trypetid and gorgeous trypetid sibling species probe
					coza	19	CAATGAATTAGCTAGGACAACTCCT	Peach trypetid and piscidia trypetid sibling species probe
	tacu	20	TGAAGAATAATATCAACAGAAGAGT	Pumpkin fruit fly and melon trypetid sibling species probe
					sais-1	21	ATAAATATGATGATAAATTGGCTT	Tool bar trypetid and Shi Yuan island trypetid sibling species probe
	sais-2	22	ATAATGTCTACGGAAGAATTAGC
				bpde	23	ATGAATTAGCAAGGACGACTC	Japanese squash trypetid specific probe
	bacu-1	24	GCTCATAACATAGCTGGTGAATAATT					Signal appears in cucumber trypetid specific probe group two probes simultaneously
				bacu-2	25	CCAGTTAATCCTCCGACTGTAAA
	Plant specific probe	ccca-1	26				AGAACAACGCCCGTTAAACC		The Mediterranean fruitfly specific probe
ccca-2				27	AACAAATCCTGCTATGATAGCAAAT
		ccco	28			CTGTTAAACCCCCAACTGTGA	Africa mango trypetid specific probe
cpro				29	ACATAATGGAAGTGTGCTACAAC			Natal trypetid specific probe
		anlu	30			GTAAATAAGAAGACAAACCCTAGAGCT	Mexico is by the trypetid specific probe
anob				31	CAGATGAGTTAGCAAGTATTACTCCAG			West India is by the trypetid specific probe
		bboc-1	32			TATGATAATGAACTGACTTTTTAATC	Mango trypetid specific probe
bboc-2				33	CTCCGATAAATATGATAATGAACTGAC
		bbal	34			GTCCTGTAAATAGCGGGTATCAA		Portugal trypetid specific probe
bbdi				35	GAAATGTGCCACGACATAGTA		Di Aoshi trypetid specific probe
		bbla-1	36			TATCGTTGGGGAATAATTCAATT		Capsicum trypetid specific probe
bbla-2				37	TTTAGTCAGGTTGGGTTTAGTA
		bbfr	38			TTTAGTACTAATCCTGTAAATAGTGG	Billet bread trypetid specific probe
bbne				39	TAGTTGAGTGCCGTGTAATGT			Little Queensland trypetid specific probe
		bbps	40			CCCTATTGATAACACATAGTGGA	Black porch angle trypetid specific probe
bbco-1				41	GAAATGAGCAACAACATAATATGTGT			Piscidia trypetid specific probe
		bbco-2	42			CCTGTAAATAGAGGGTATCAGTG
bbzo-1				43	CGATAAATATGGTAATAAATTGAC		Article two, signal appears in probe simultaneously, peach trypetid specific probe group
		bbzo-2	44			AAATGAGCTACAACATAATATGTATCGT
bbmu				45	ACTCCGATAAATATGGTAATAAATTGAC			Banana trypetid specific probe
		bbum	46			CTCAGATGATAAATAGGAATAATAAGATTC	Three band trypetid specific probes
bgca				47	ACTAGCCCTGTAAACAGTGGGTAT			Gorgeous trypetid specific probe
		baja	48			GGATTTAGTACCAGTCCTGTGAATAA	Zha Weisi trypetid specific probe
bdol				49	GTCTACAGAAGAATAAGCAAGTACAACTC			The dacus oleae specific probe
		bdol	50			ATTTAGTCCGGTGAATAGGGG
bpex				51	CCAGATCGGGTTTAGAGTGAGT		Open and flat trypetid specific probe
		bzta	52			TACAAATCCGGCTATAATAGCAAA		The pumpkin fruit fly specific probe
bzcu-1				53	CAAAACCTAAAGCTCATAGCA		Melon trypetid specific probe
		bzcu-2	54			TACTCCAGTTAGTCCCCCAA
bzis				55	CTATAATAGCGAACACTGCTCCTATA			Shi Yuan island trypetid specific probe

Detection probes in the above-mentioned table 1 is the oligonucleotide of 20～30nt, and sequence is respectively the specific sequence of Tephritidae, genus, kind, can detect the different sorts trypetid that comprises these specific sequences accurately and rapidly, realizes that the classification of trypetid is differentiated.5 ' end of these detection probes is amido modified.

In the biochip of the present invention, except above-mentioned detection probes, can also comprise Quality Control probes such as locating point probe, positive control probe and negative control probe usually.Locating point probe of the present invention, positive control probe and negative control probe are preferably used the sequence in the following table 2.In the table 2, the locating point probe is the oligonucleotide of a 30nt, and sequence does not have homology with the trypetid sequence of now knowing, 3 ' end is amido modified, 5 ' end Cy3 fluorescent mark.The positive control probe is the oligonucleotide of a 20nt, and sequence does not have homology with now knowing the trypetid sequence, and 5 ' end is amido modified, and its effect is whether monitoring pcr amplification labeling process and crossover process be normal.Negative control among the present invention is the also oligonucleotide of a 23nt, and sequence does not have homology with now knowing the trypetid sequence, and 5 ' end is amido modified, and its effect is a monitoring crossover process non-specific binding situation, and as the positive whether reference of detection probes site.Biochip of the present invention also preferably includes blank, and the blank among the present invention is the 50%DMSO damping fluid, is used to detect hybrid context.

Table 2 Quality Control probe sequence

Probe type	SeqIDNo.	Probe sequence	Explanation
				The locating point probe	56	TGGATACCCAACTTAGCTATTAATAGTC	--
The positive control probe	57	TGAGACCAACCAACTGAAACG	--
				Negative control probe	58	GACTATAGTATAAGCGCGGTCCA	--
Blank	-	--	The 50%DMSO damping fluid

The solid phase carrier of biochip of the present invention can be selected available slide glass known in the art, nitrocellulose filter, nylon membrane, polystyrene etc. for use.

Below the present invention is described in further detail by specific embodiment.

Embodiment 1

(1) 32 kind of fruit-fly classified detection of biological chip of danger

32 kinds of fruit-fly classified detection of biological chips of danger such as a kind of Mediterranean fruitfly, citrus fruit fly, it is to be fixed with the oligonucleotide probe dot matrix on the solid phase carrier dielectric surface.Every substrate comprises four identical probe dot matrix areas, and each probe dot matrix area comprises 15 row, 16 row dot matrix.Each probe dot matrix inside is divided into four function probe region, promptly belongs to Bactrocera detection probes district, little Anastrepha Ceratitis detection probes district and Quality Control contrast probe in detecting district (Quality Control contrast probe is made up of positive control probe, negative control probe and blank probe) by Anastrepha Anastrepha detection probes district, fruit fly.Probe dot matrix the 1st row and the 1st row are made up of the locating point probe, and detection probes and Quality Control probe dot matrix distribute as table 3 and shown in Figure 1.Every probe of detection probes and Quality Control probe laterally repeats 3 points.The nucleotide sequence of detection probes and probe characteristics such as table 1, Quality Control probe and locating point probe are as shown in table 2.

Detection probes comprises 1 of section's general probe, 3 of general probes of genus, 2 of subgenus general probes, aggregate species/19 of sibling species probes, plants 30 of specific probes.Can realize comprising that Tephritidae belongs to the primary dcreening operation of Bactrocera spp. and little three true fly kinds such as Anastrepha Ceratitis spp. and Mediterranean fruitfly, Natal trypetid, African mango trypetid by Anastrepha Anastrepha spp., fruit fly; Citrus fruit fly, pawpaw trypetid, carambola trypetid, Philippines trypetid, mango trypetid, piscidia trypetid, Portugal trypetid, billet breadfruit tree trypetid, Di Aoshi trypetid, Oceania oriental fruit fly, capsicum trypetid, banana trypetid, little Queensland trypetid, black porch angle oriental fruit fly, Queensland trypetid, three band trypetids, peach trypetid; Zha Weisi trypetid, cucumber trypetid, dacus oleae, gorgeous trypetid, japanese squash trypetid, open and flat trypetid, melon trypetid, Shi Yuan island trypetid, tool bar trypetid, pumpkin fruit fly; The evaluation of 32 kinds of trypetids such as trypetid is pressed by Mexico by trypetid, western India.

The fruit-fly classified detection of biological chip probe of table 3.32 kind of the danger synoptic diagram of arranging

(2) preparation of biochip

The preparation of trypetid biochip comprise design, the probe of probe dot matrix preparation, point sample, fix, develop a film and step such as fence stickup, existing division is as follows:

The design of probe dot matrix: every chip comprises 4 identical probe dot matrix areas, and each probe dot matrix area is arranged by (table 3) according to designed probe and probe lattice position (Fig. 1) is carried out point sample.Every probe laterally repeats 3 points, every about 0.4nL, and the about 200 μ m of spot diameter, dot spacing 370 μ m, point sample uniformity coefficient (SV value) is about 7%.

The preparation of probe: probe dissolves with 50%DMSO point sample damping fluid, and concentration is 50 μ M, and the order of pressing the probe point sample adds 96 orifice plates with probe solution (100 μ L).

Point sample: utilize point sample instrument (GeSim NANO plotter 2) that each oligonucleotide probe is solidificated in the aldehyde radical sheet glass, pass through hydration, fix and develop a film, obtain the chip of band probe matrix.Every substrate comprises four identical probe dot matrix areas (15 * 16), each probe dot matrix inside is divided into four function probe region, promptly belongs to Bactrocera detection probes district, little Anastrepha Ceratitis detection probes district and Quality Control contrast probe in detecting district (being made up of positive control probe, negative control probe and blank probe) by Anastrepha Anastrepha detection probes district, fruit fly.Probe dot matrix the 1st row and the 1st row are made up of the locating point probe.Probe is synthetic and mark by Beijing AudioCodes Bioisystech Co., Ltd.

Fixing: as behind the point sample substrate to be placed on the 37 ℃ of constant temperature of box of preserving moisture and to fix more than 12 hours.

Develop a film: the substrate after fixing is stirring and washing 2min in the 0.2%SDS washing lotion earlier; Stirring and washing 2min in the water, triplicate; Then at 0.2%NaBH ₄Stir sealing 5min in the confining liquid; Use stirring and washing 2min in the deionized water again, triplicate, the centrifugal 2min of 2000rpm dries.

Prescan: the chip of having put the sheet pin, put into the GenePix4200A gene chip scanning instrument, with far red light district 532nm gene chip is carried out the prescan quality inspection, by software GenePix Pro5.0 (or higher version) analysis chip point sample result, the main homogeneity of checking locating point and detection probes site has or not few point or leak source probe etc.

Fence is pasted: utilize the chip attach instrument that four hole chip fences carefully are attached to chip front side, put into chip cartridges, the lucifuge room temperature preservation.

(3) 32 kinds of fruit-fly classified detection methods of danger

1, the extraction of trypetid genomic dna

Utilize animal/insect DNA extraction test kit or other methods involving to obtain trypetid sample genomic dna, dna profiling must satisfy experimental requirements such as downstream PCR amplification.The trypetid genomic dna is recommended Dneasy Tissue Kit (QIAGEN Germany) extracting method, all can extract to obtain from ovum, larva, pupa or trypetid samples such as adult portion of tissue such as belly.

2, fluorescent mark pcr amplification

Use Tephritidae mtDNA COI gene universal primer COI3/COI5 (table 4) respectively, utilize the fluorescence method of mixing to carry out the fluorescent mark pcr amplification, promptly in the pcr amplification system, add and contain Cy3/Cy5-dCTP.PCR reaction system such as table 5, wherein the amount of each reagent can suitably be adjusted according to the cumulative volume of reaction system in the system.Mark PCR reaction conditions: 94 ℃/1.5min; 94 ℃/30s; 55 ℃/30s; 72 ℃/30s, 40 circulations; 72 ℃/5min.Primer is synthetic by Beijing AudioCodes Bioisystech Co., Ltd.Pcr amplified fragment length is 430bp.

Table 4 fluorescent mark PCR primer sequence

Type	Title	Seq ID No.	Sequence
				Forward primer	COI3	59	5′-TTTTAGTTGACTGGCTACATTACATGG-3′
Reverse primer	COI5	60	5′-CTGGAGGGGTATTTTGAAGTCATT-3′

Table 5 fluorescent mark PCR reaction system

Reagent name	PCR reaction system final concentration
		10 * PCR damping fluid (Mg 2+)	0.25mmol/L
CY3-dCTP	0.2mmol/L
		Forward primer and reverse primer	Each 0.2 μ mol/L
The Taq enzyme	1U
		Dna profiling	10-20ng
ddH 2O	Supply the reaction cumulative volume to 10 μ l

3, the hybridization of mark PCR product and chip

Hybridization buffer (1: 1 10 * SSPE and 2%SDS) the 10 μ l that respectively get fluorescently-labeled PCR product and 50 ℃ of preheatings respectively mix (table 6), behind 95 ℃ of sex change 5min, put into mixture of ice and water ice bath 5min rapidly.

Table 6 hybridization system

Reagent name	PCR reaction system volume
		The labeled reactant product	10μl
Hybridization buffer (10 * SSPE and 2%SDS1: 1 mixes)	10μl
		Cumulative volume	20μl

In chip hybridization box (Beijing is rich difficult to understand) both sides sulculus, add 200 μ L deionized waters (keeping humidity in the hybridizing box), face up and put in the hybridizing box preparing complete chip (preparation method referring to above), aligning direction is put into 4 fence cover plates, once inject by the fluorescent mark PCR product and the hybridization solution mixture of well ice bath, make it be full of space between cover plate and the chip, the sealing hybridizing box placed 46 ℃ of isoperibols 3 hours.

After finishing, hybridization discards cover plate, chip probe faces down and float remaining hybridization solution (the hybridization solution crossed contamination of four matrixes is avoided in attention) in the hybridization washing lotion I (table 7) of a small amount of 50 ℃ of preheatings, at the hybridization washing lotion I of 42 ℃ of preheatings stirring and washing 2min, again at the hybridization washing lotion II of 50 ℃ of preheatings stirring and washing 2min, the centrifugal 1min of 2000rpm puts the magazine room temperature preservation.

Table 7 chip hybridization washing lotion

Reagent name	Major ingredient
		Washing lotion I	800ml water 12ml (20 *) SSC 16ml 10%SDS
Washing lotion II	800ml water 2.4ml (20 *) SSC

4, chip scanning

(GenePix4200A Axon) scans gene chip at 532nm place, far red light district, and the PMT value is 800 at gene chip scanning instrument.By the result of software GenePix Pro 5.0 analysis chips scanning, draw relevant data again, and preserve.

5, data analysis and signal interpretation

Hybridization signal carries out interpretation according to following principle:

(1) each check point signal value=this fluorescence intensity level-this background intensity value;

(2) mean value of blank average signal value=3 a blank point signal value;

(3) mean value-blank average signal value of negative control average signal value=3 a negative control point signal value;

(4) each check point signal value-blank average signal value＞10 times negative control average signal value of every probe is that this check point of interpretation is positive;

(5) 3 of every probe duplicate detection points are all positive is that this probe of interpretation is positive;

(6) partly or entirely negative as position probe, show that then probe and sheet base are combined with problem, experimental result is inaccurate;

(7) negative as positive control, then show amplification label or hybridization link existing problems, experimental result is inaccurate;

6, decision principle as a result

Under Quality Control probe and the equal normal circumstances of locating point probe, detected result and judgment principle are as follows:

When positive signal appears in teph, be judged to be Tephritidae Tephritidae;

The evaluation of the true fly of Anastepha:

Work as teph, positive signal appears in anst simultaneously, is judged to be the spp. by Anastrepha Anastrepha;

Work as teph, positive signal appears in anst, anlu simultaneously, is judged to be Mexico by trypetid Anastrepha lundes;

Work as teph, positive signal appears in anst, anob simultaneously, is judged to be western India by trypetid Anastrepha obliqua.

The evaluation of the true fly of Bactrocera

Work as teph, positive signal appears in bact simultaneously, is judged to be fruit fly and belongs to Bactrocera spp.;

Work as teph, positive signal appears in bact, subbact simultaneously, is judged to be fruit fly subgenus Bactrocera sp.;

Following example 2 is seen in result's judgement of citrus fruit fly, pawpaw trypetid, carambola trypetid, Philippines trypetid and mango trypetid.

Work as teph, bact, subbact, coza., positive signal appears in bbco-1, bbco-2 simultaneously, is judged to be piscidia trypetid Bactrocera correcta;

Work as teph, bact, subbact, coza, positive signal appears in bbzo-1, bbzo-2 simultaneously, is judged to be peach trypetid Bactrocera (B.) zonata;

Work as teph, bact, positive signal appears in subbact, bbal simultaneously, is judged to be Portugal trypetid Bactrocera (B.) albistrigatus;

Work as teph, bact, positive signal appears in subbact, bbdi simultaneously, is judged to be Di Aoshi trypetid Bactrocera (B.) diospyiri;

Work as teph, bact, subbact, positive signal appears in bbla-1, bbla-2 simultaneously, is judged to be capsicum trypetid Bactrocera (B.) latifrons;

Work as teph, bact, positive signal appears in subbact, bbfr simultaneously, is judged to be billet breadfruit tree trypetid Bactrocera (B.) frauenfeldi;

Work as teph, bact, positive signal appears in subbact, bbps simultaneously, is judged to be black porch angle oriental fruit fly Bactrocera (B.) psidii;

Work as teph, bact, subbact, positive signal appears in tyne, bbne simultaneously, is judged to be the little trypetid Bactrocera of Queensland (B.) neohumeralis;

Work as teph, bact, subbact, positive signal appears in tyne, tycu simultaneously, is judged to be the trypetid Bactrocera of Queensland (B.) tryoni;

Work as teph, bact, positive signal appears in subbact, bbcu simultaneously, but tyne, signal does not appear in bbne, is judged to be Oceania oriental fruit fly Bactrocera (B.) curvipennis;

Work as teph, bact, positive signal appears in subbact, bbmu simultaneously, is judged to be banana trypetid Bactrocera (B.) musae;

Work as tcph, bact, positive signal appears in subbact, bbum simultaneously, is judged to be three band trypetid Bactrocera (B.) umbroa;

Work as teph, bact, positive signal appears in subbact, baja simultaneously, is judged to be Zha Weisi trypetid Bactrocera (Afrodacus) jarvisi;

Work as teph, bact, subbact, positive signal appears in bacu-1, bacu-2 simultaneously, is judged to be cucumber trypetid Bactrocera (Austrodacus) cucumis;

Work as teph, bact, positive signal appears in subbact, bgca simultaneously, and signal also appears in bbcu, is judged to be gorgeous trypetid Bactrocera (Gymnodacus) calophylli;

Work as teph, bact, positive signal appears in subbact, bpde simultaneously, but bgca, signal does not appear in bbcu, is judged to be japanese squash trypetid Bactrocera (Paradacus) depressa;

Work as teph, bact, positive signal appears in subbact, bpex simultaneously, is judged to be open and flat trypetid Bactrocera (Paratridacus) expandens;

Work as teph, bact, subbact, positive signal appears in bdol-1, bdol-2 simultaneously, is judged to be dacus oleae Bactrocera (Daculus) oleae;

Work as teph, positive signal appears in bact, subzeug simultaneously, is judged to be subgenus Zeugodacus sp.;

Work as teph, bact, subzeug, positive signal appears in tacu, bzta simultaneously, is judged to be pumpkin fruit fly Bactrocera (Z.) tau;

Work as teph, bact, subzeug, tacu, positive signal appears in bzcu-1, bzcu-2 simultaneously, is judged to be melon trypetid Bactrocera (Z.) cucurbitae;

Work as teph, bact, subzeug, positive signal appears in sais-1, sais-2 simultaneously, is judged to be tool bar trypetid Bactrocera (Z.) scutellata;

Teph, bact, subzeug, sais-1, positive signal appears in sais-2, bzis simultaneously, is judged to be Shi Yuan island trypetid Bactrocera (Z.) ishigahiensis;

The evaluation of the true fly of Ceratitits

Work as teph, positive signal appears in cera simultaneously, is judged to be little Anastrepha Ceratitis spp.;

When following example 3 is seen in result's judgement of Mediterranean fruitfly, Natal trypetid and African mango trypetid.

Embodiment 2 citrus fruit fly five aggregate species classification and Detection biochip and detection methods thereof

Citrus fruit fly B. (B.) dorsalis and four important aggregate species (pawpaw trypetid B. (B.) papayae, carambola trypetid B. (B.) carambolae, Philippines trypetid B. (B.) philippinensis, mango trypetid B. (B.) occipitalis) biochip test probe thereof are arranged as table 8 and shown in Figure 2.Probe comprises 1 of section's general probe, 1 of general probe of genus, 1 of subgenus general probe, 6 of aggregate species specific probes, plants 2 of specific probes, one group of Quality Control probe (positive, feminine gender and blank probe) and locating point probe.Probe dot matrix such as Fig. 2, every probe of detection probes and Quality Control probe laterally repeat 3 points.Probe sequence is with reference to table 1, table 2.Above-mentioned probe can realize that fruit fly belongs to Bactrocera spp. kind primary dcreening operation and distinguishes five aggregate species of evaluation citrus fruit fly.

Five aggregate species biochip test of table 8 citrus fruit fly probe is arranged and is illustrated to tabulate

Except that the probe arrangement mode, method basic identical described in the preparation of five aggregate species biochips of citrus fruit fly and detection method and the embodiment 1 among this embodiment.

In addition, when utilizing the biochip of present embodiment that five aggregate species of citrus fruit fly are carried out classification and Detection, the result judges and carries out according to method described below.

Under Quality Control probe and all normal situation of locating point probe, detected result and judgment principle are as follows:

When positive signal appears in teph, be judged to be Tephritidae Tephritidae;

Work as teph, positive signal appears in bact simultaneously, is judged to be fruit fly and belongs to Bactrocera spp.;

Work as teph, positive signal appears in bact, subbact simultaneously, is judged to be fruit fly subgenus Bactrocera sp.;

Work as teph, bact, positive signal appears in subbact, dor-comp-1 simultaneously, is judged to be five aggregate species Bactrocera of citrus fruit fly dorsalis complex;

Work as teph, bact, subbact, dor-comp-1, dor-comp-3, positive signal appears in dor-comp-4, dor-comp-5 simultaneously, is judged to be carambola trypetid Bactrocera carambolae;

Work as teph, bact, subbact, dor-comp-1, dor-comp-2, dor-comp-3, positive signal appears in dor-comp-4, dor-comp-5 simultaneously, is judged to be Philippines trypetid Bactrocera philippinensis;

Work as teph, bact, subbact, dor-comp-1, dor-comp-2, dor-comp-3, positive signal appears in dor-comp-4, dor-comp-6 simultaneously, is judged to be citrus fruit fly Bactrocera dorsalis;

Work as teph, bact, subbact, dor-comp-1, dor-comp-2, dor-comp-3, dor-comp-4, positive signal appears in dor-comp-5, dor-comp-6 simultaneously, is judged to be pawpaw trypetid Bactrocera papayae.

Work as teph, bact, subbact, dor-comp-1, dor-comp-2, dor-comp-4, dor-comp-6, positive signal appears in bboc-1, bboc-2 simultaneously, is judged to be mango trypetid Bactrocera occipitalis;

Embodiment 3 Mediterranean fruitflies and sibling species classification and Detection biochip and detection method thereof

Mediterranean fruitfly C.capitata and two sibling specieses thereof: Natal trypetid C.rosa and African mango trypetid C.cosary biochip test probe are arranged as shown in table 9.Probe groups also comprises 1 of section's general probe, 1 of general probe of genus, 2 of sibling species specific probes, plants 4 and one group Quality Control of specific probe (positive, feminine gender and blank) probe except that the locating point probe.The probe dot matrix of detection probes, Quality Control probe and locating point probe as shown in Figure 3, every probe of detection probes and Quality Control probe laterally repeats 3 points.Above-mentioned probe groups can realize the kind evaluation of little Anastrepha Ceratitis spp. kind primary dcreening operation and Mediterranean fruitfly, Natal trypetid and African mango trypetid.

Table 9 Mediterranean fruitfly and sibling species biochip test probe thereof are arranged and are illustrated to tabulate

Except that the probe arrangement mode, method basic identical described in the preparation of Mediterranean fruitfly and sibling species biochip thereof and detection method and the embodiment 1 among this embodiment.

In addition, when the biochip that utilizes present embodiment carried out classification and Detection to Mediterranean fruitfly and sibling species thereof, the result judged and carries out according to method described below.

Under Quality Control probe and the equal normal circumstances of locating point probe, detected result and judgment principle are as follows:

When positive signal appears in teph, be judged to be Tephritidae Tephritidae.;

Work as teph, positive signal appears in cera simultaneously, is judged to be little Anastrepha Ceratitis spp.;

Work as teph, cera, positive signal appears in caro, cpro simultaneously, is judged to be Natal trypetid Ceratitis rosa;

Work as teph, cera, caco-1, positive signal appears in caco-2, ccco simultaneously, is judged to be African mango trypetid Ceratitiscosyra;

Work as teph, cera, caro, caco-1, caco-2, positive signal appears in ceca-1, ccca-2 simultaneously, is judged to be Mediterranean fruitfly Ceratitis capitata.

The detection kit of embodiment 4 trypetid biochips

The invention provides biochip test test kit to Tephritidae insect ovum, larva, pupa and adult Rapid identification or primary dcreening operation.Test kit comprises reagent and chip.As required, chip can be selected any one chip among the embodiment 1～3 for use.

Test kit is formed and storage requirement

The trypetid chip agent box is made up of components such as chip, chip cover plate, mark PCR reagent, positive control sample, 2 * hybridization buffers, also attached simultaneously 1 part of service manual, and the quantity of each component or volume, storage requirement see Table 4.

Table 10 trypetid chip inspecting reagent unit

Content	20Kit	Storage requirement
			Gene chip	5	2-8 ℃ keeps in Dark Place, validity period 1 year
The chip cover plate	5	Room temperature preservation
			Mark PCR reagent (L)	250μL	-20 ℃ keep in Dark Place, validity period 1 year
Positive control sample (P)	10μL	-20 ℃ keep in Dark Place, validity period 1 year
			2 * hybridization buffer (2 * HB)	250μL	2-8 ℃ keeps in Dark Place, validity period 1 year
Service manual	1 part

The trypetid chip agent box can be realized evaluation and the differentiation of the evaluation of Mediterranean fruitfly and sibling species thereof and differentiation, 5 aggregate species of citrus fruit fly, can realize also that simultaneously the kind of 32 kinds of dangerous trypetids identifies and belong to by Anastrepha Anastrepha, fruit fly the kind primary dcreening operation of Bactrocera and three true flies of little Anastrepha Ceratitis.The ability that test kit has fast, sensitivity and high-flux parallel detect, detected result is reliable and stable, can be applicable to detection and the monitoring work of customs examination and quarantine system, Food Hygiene Surveillance system and agricultural plant protection department, also can be used for carrying out evaluation of trypetid species and differentiation trypetid.

Experimental example trypetid biochip test chip and the application of test kit in inspection and quarantine

The main detected object of trypetid biochip is trypetid class ovum, larva, pupa and the adult of finding from fruit and vegetable etc., wherein ovum, larva and pupa can not need could identify its kind through laboratory rearing at last to adult as the foundation of kind evaluation in the ordinary method; Above-mentioned trypetid sample can compare the accuracy of test organisms chip detection with using the adult qualification result from ovum, larva and pupa artificial breeding with the result of trypetid biochip test.Then available whole head of adult or part polypide carry out the kind plyability and detect, as are found to be Mediterranean fruitfly and need check when detecting, and available trypetid biochip is crossed above-mentioned purpose.

The collection of trypetid chip detection worm sample and kind are identified.Illustrate: the quarantine of import longan trypetid is identified.From the longan quarantine of import Thailand, find that a wormed fruit has 27 on trypetid ovum, collect 5-8 grain ovum, soak-4 ℃ of preservations with raw spirit and be used for trypetid chip detection sample, all the other ovum grains are seeded on the longan fruit, cultivated 2-3 days for 26-28 ℃, ovum is hatched into larva, replenish the required host (fresh longan) of larva during this time, treat that larva grows up to 2-3 age, get larva 2-3 head (soak-4 ℃ of preservations with raw spirit and be used for trypetid chip detection sample), mature larva was pupated after all the other larvas continued to raise about a week, got pupa 1-2 head (soak-4 ℃ of preservations with raw spirit and be used for trypetid chip detection sample); All the other continue to raise, and 10-15 days pupa emergence adults also guarantee that morphological specificity is mature and stable, and adult is put stereoscopic microscope and is accredited as citrus fruit fly Bactroceradorsalis.

During this time, ovum, larva and the pupa sample of the trypetid that will collect from the Thailand longan carry out classification and Detection according to the method described in the embodiment 1 respectively, and biochip test and result judge and be similarly citrus fruit fly.

Adopt same procedure to verify all the other 31 kinds of trypetids, the result all prove adopt biochip test method of the present invention to carry out sorting result and traditional form to learn qualification result consistent, but than traditional method more fast, accurate and be easy to apply.

Sequence table

＜110〉Animal ﹠. Plant Inspection and Quarantine Techn Center, Shenzhen Bureau of Impor

＜120〉fruit-fly classified detection of biological chip, detection method and test kit

<130>0610867

<160>60

<170>PatentIn version 3.3

<210>1

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉teph probe

<400>1

agcaaagact gctcctattg ataat 25

<210>2

<211>29

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉anst probe

<400>2

ggaagtgtgc tactacataa taagtatcg 29

<210>3

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉cera probe

<400>3

agctggtgag tagtttaatt gtg 23

<210>4

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bact probe

<400>4

cacaatatgg ctggtgaata gttt 24

<210>5

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉subbact probe

<400>5

gggtatcagt gaacgaatcc t 21

<210>6

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉subzeug probe

<400>6

aatgagctac tacgtagtaa gtgtc 25

<210>7

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉caro probe

<400>7

cgttaaacct ccaactgtaa a 21

<210>8

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉caco-1 probe

<400>8

atagctgggg aataatttaa ttg 23

<210>9

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉caco-2 probe

<400>9

ggggaataat ttaattgagt ccc 23

<210>10

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉dor-comp-1 probe

<400>10

ataatagcaa agattgctcc tattga 26

<210>11

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉dor-comp-2 probe

<400>11

ccgataaata tgataatgaa ctgactt 27

<210>12

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉dor-comp-3 probe

<400>12

ttactccgat agacatgata ataaattg 28

<210>13

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉dor-comp-4 probe

<400>13

ctacgtaata tgtgtcatga agaa 24

<210>14

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉dor-comp-5 probe

<400>14

aaaccctagg gcttacaata tgg 23

<210>15

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉dor-comp-6 probe

<400>15

atcatttagg attcaatact agccc 25

<210>16

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉tyne probe

<400>16

agtgggtacc agtgaacaaa c 21

<210>17

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉tycu probe

<400>17

ctcatagcat agctggggaa taa 23

<210>18

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbcu probe

<400>18

aaaagtggat accagtgaac aaatc 25

<210>19

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉coza probe

<400>19

caatgaatta gctaggacaa ctcct 25

<210>20

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉tacu probe

<400>20

tgaagaataa tatcaacaga agagt 25

<210>21

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉sais-1 probe

<400>21

ataaatatga tgataaattg gctt 24

<210>22

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉sais-2 probe

<400>22

ataatgtcta cggaagaatt agc 23

<210>23

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bpde probe

<400>23

atgaattagc aaggacgact c 21

<210>24

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bacu-1 probe

<400>24

gctcataaca tagctggtga ataatt 26

<210>25

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bacu-2 probe

<400>25

ccagttaatc ctccgactgt aaa 23

<210>26

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉ccca-1 probe

<400>26

agaacaacgc ccgttaaacc 20

<210>27

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉ccca-2 probe

<400>27

aacaaatcct gctatgatag caaat 25

<210>28

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉ccco probe

<400>28

ctgttaaacc cccaactgtg a 21

<210>29

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉cpro probe

<400>29

acataatgga agtgtgctac aac 23

<210>30

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉anlu probe

<400>30

gtaaataaga agacaaaccc tagagct 27

<210>31

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉anob probe

<400>31

cagatgagtt agcaagtatt actccag 27

<210>32

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bboc-1 probe

<400>32

tatgataatg aactgacttt ttaatc 26

<210>33

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bboc-2 probe

<400>33

ctccgataaa tatgataatg aactgac 27

<210>34

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbal probe

<400>34

gtcctgtaaa tagcgggtat caa 23

<210>35

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbdi probe

<400>35

gaaatgtgcc acgacatagt a 21

<210>36

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbla-1 probe

<400>36

tatcgttggg gaataattca att 23

<210>37

<211>22

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbla-2 probe

<400>37

tttagtcagg ttgggtttag ta 22

<210>38

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbfr probe

<400>38

tttagtacta atcctgtaaa tagtgg 26

<210>39

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbne probe

<400>39

tagttgagtg ccgtgtaatg t 21

<210>40

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbps probe

<400>40

ccctattgat aacacatagt gga 23

<210>41

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc feature

＜223〉bbco-1 probe

<400>41

gaaatgagca acaacataat atgtgt 26

<210>42

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbco-2 probe

<400>42

cctgtaaata gagggtatca gtg 23

<210>43

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbzo-1 probe

<400>43

cgataaatat ggtaataaat tgac 24

<210>44

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbzo-2 probe

<400>44

aaatgagcta caacataata tgtatcgt 28

<210>45

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbmu probe

<400>45

actccgataa atatggtaat aaattgac 28

<210>46

<211>30

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bbum probe

<400>46

ctcagatgat aaataggaat aataagattc 30

<210>47

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bgca probe

<400>47

actagccctg taaacagtgg gtat 24

<210>48

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉baja probe

<400>48

ggatttagta ccagtcctgt gaataa 26

<210>49

<211>29

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bdol probe

<220>

<221>misc_feature

＜223〉bdol-1 probe

<400>49

gtctacagaa gaataagcaa gtacaactc 29

<210>50

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bdol probe

<220>

<221>misc_feature

＜223〉bdol-2 probe

<400>50

atttagtccg gtgaataggg g 21

<210>51

<211>22

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bpex probe

<400>51

ccagatcggg tttagagtga gt 22

<210>52

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bzta probe

<400>52

tacaaatccg gctataatag caaa 24

<210>53

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bzcu-1 probe

<400>53

caaaacctaa agctcatagc a 21

<210>54

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bzcu-2 probe

<400>54

tactccagtt agtcccccaa 20

<210>55

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉bzis probe

<400>55

ctataatagc gaacactgct cctata 26

<210>56

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉locating point probe

<400>56

tggataccca acttagctat taatagtc 28

<210>57

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉positive control probe

<400>57

tgagaccaac caactgaaac g 21

<210>58

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉negative control probe

<400>58

gactatagta taagcgcggt cca 23

<210>59

<211>27

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉COI3 primer

<400>59

ttttagttga ctggctacat tacatgg 27

<210>60

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉COI5 primer

<400>60

ctggaggggt attttgaagt catt 24

Claims (8)

1, a kind of fruit-fly classified detection of biological chip comprises solid phase carrier and is fixed on probe on the carrier, it is characterized in that: described probe comprises section's general probe, belong to general probe and plant at least a in the general probe,

Described section general probe is teph, and it has the sequence shown in Seq ID No.1 in the sequence table;

Described genus general probe is selected from least a among anst, cera, the bact, and it has the sequence shown in Seq IDNo.2～4 in the sequence table respectively;

Described kind of general probe is selected from least a in following:

Ccca-1, ccca-2, ccco, cpro, anlu, anob, bboc-1, bboc-2, bbal, bbdi, bbla-1, bbla-2, bbfr, bbne, bbps, bbco-1, bbco-2, bbzo-1, bbzo-2, bbmu, bbum, bgca, baja, bdol-1, bdol-2, bpex, bzta, bzcu-1, bzcu-2, bzis, it has the sequence shown in Seq ID No.26～55 in the sequence table respectively.

2, a kind of fruit-fly classified detection of biological chip according to claim 1, it is characterized in that: described probe also comprises subgenus general probe and/or aggregate species/sibling species specific probe;

Described subgenus general probe is selected from least a among subbact, the subzeug, and it has the sequence shown in Seq ID No.5～6 in the sequence table respectively;

Described aggregate species/sibling species specific probe is selected from least a in following:

Caro, caco-1, caco-2, dor-comp-1, dor-comp-2, dor-comp-3, dor-comp-4, dor-comp-5, dor-comp-6, tyne, tycu, bbcu, coza, tacu, sais-1, sais-2, bpde, bacu-1, bacu-2, it has the sequence shown in Seq ID No.7～25 in the sequence table respectively.

3, a kind of fruit-fly classified detection of biological chip according to claim 1 and 2 is characterized in that: described probe also comprises at least a in position probe, positive control probe, the negative control probe.

4, a kind of fruit-fly classified detection of biological chip according to claim 3, it is characterized in that: described locating point probe has the sequence shown in Seq ID No.56 in the sequence table; Described positive control probe has the sequence shown in SeqID No.57 in the sequence table; Described negative control probe has the sequence shown in Seq ID No.58 in the sequence table.

5, a kind of fruit-fly classified authentication method, described method comprises step: extract genomic dna from Tephritidae insect ovum, larva, pupa or adult, carry out pcr amplification with universal primer COI3/COI5, with the PCR product and any described fruit-fly classified detection of biological chip hybridization of claim 1～4 that obtain, described universal primer COI3/COI5 has the sequence shown in Seq ID No.59～60 in the sequence table respectively.

6, a kind of fruit-fly classified authentication method according to claim 5 is characterized in that: utilize the fluorescence method of mixing to carry out the fluorescent mark pcr amplification in the described pcr amplification process.

7, a kind of fruit-fly classified authentication method according to claim 6, it is characterized in that: the reaction conditions of described pcr amplification is 94 ℃/1.5min; 94 ℃/30s-55 ℃/30s-72 ℃/30s, 40 circulations; 72 ℃/5min.

8, a kind of fruit-fly classified detection kit is characterized in that: described test kit contains any described fruit-fly classified detection of biological chip of claim 1～4.