CN1952649A - A gene chip, nucleotide sequence and reagent kit for detecting virus of potato family plant - Google Patents
A gene chip, nucleotide sequence and reagent kit for detecting virus of potato family plant Download PDFInfo
- Publication number
- CN1952649A CN1952649A CN 200610081221 CN200610081221A CN1952649A CN 1952649 A CN1952649 A CN 1952649A CN 200610081221 CN200610081221 CN 200610081221 CN 200610081221 A CN200610081221 A CN 200610081221A CN 1952649 A CN1952649 A CN 1952649A
- Authority
- CN
- China
- Prior art keywords
- virus
- pcr reagent
- contrast
- dna
- synthetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A gene chip for detecting viruses of nightshade is disclosed, several probes and nature-control collations are fixed on surface of solidoid carrier, the probes has the nucleotide sequence showed on from SEQ ID No.1 to SEQ ID No.70; the nature-control collations consists of the surface chemistry LUT, fluorescence labeling LUT, positive LUT, negative LUT, cross LUT and blank control. The advantages and innovations of the invention are following: practicability, quick-speed, and idiocrasy, and sensitivity, low activity cost, repeatability, stable and reliable results. The testing system can guarantee the repeatability and accuracy of results that is proofed by the repeatability and stability test, the system can be widely used in area of plant quarantine of the outbound and enter the country test and quarantine system, the safety supervision of plant source food, the diagnosis of plant virus in plant protecting station and the authenticate of pathogenesis in research of plant taxonomic virology. The gene chip testing call for detecting viruses of nightshade can be used in about 80 daily quarantine pursuits of leguminous plant source food.
Description
Technical field
The present invention relates to a kind of genetic chip, nucleotide sequence and kit that detects solanaceae plant virus, belong to inspection and quarantine field.
Background technology
Food-safety problem is a historical problem, also is the problem of a globalization.In history,, make causal organism import another ground into from a ground, thereby cause the causal organism that imports ground into to spread, cause tremendous influence and loss for local human existence, health and agriculture production safety owing to lack necessary detection means.As famous " Ireland famine " is exactly owing to introduce potato from America, causes being very popular of the late blight of potato, and Ireland of 8,000,000 populations is only arranged, and dead because of famine with regard to more than 20 ten thousand people are arranged, 1,640,000 people flee because of famine.
The safety problem that all once occurred causing plant-derived food in world many countries by causal organism.As: the ergot that is caused by ergot (Claviceps purpurra) can make the edible back of people poison, and can cause miscarriage; Destroyed whole America Chinese chestnut at the popular chestnut epidemic disease of the U.S. forties in 20th century; Caused 1,000,000,000 dollars loss at the pandemic corn southern leaf blight of the U.S. in 1970; Make the death of millions of strain mandarin tree in the oranges and tangerines speed of Africa and the America generation disease (CTV) that declines; In the U.S., annual by potato virus X cause with a toll of about 10% of total production.
With regard to plant-derived food, often a kind of plant-derived food can be subjected to infecting of multiple causal organism simultaneously.As tomato, can be subjected to 80 kinds of fungies, 11 kinds of bacteriums, 16 kinds of viruses and some bacterium and plant infecting of body; Apple and potato all can be subjected to infecting of causal organism more than 200 kinds.
New characteristics have appearred in the pathogenicity disease that jeopardizes food security along with economic globalization and world's food trade amount sustainable growth (recent statistics, present global food trade volume are about annual 5000 hundred million dollars): epidemic rate is fast, coverage is wide.In the plant-derived food of import, inspection and quarantine department has detected the causal organism that jeopardizes plant-derived food, as: from the soybean of import, detect soybean blight; From the wheat of import, detect TCK; From the vegetables of import, detect the light mottle virus of capsicum, cucumber mosaic virus.
At present, the detection technique means that China's entry and exit plant quarantine adopts are relatively backward, and the means that adopted mainly are: the on-the-spot quarantine in port, growth season quarantine procedures, phyto-indicator are identified, serologic test.Many deficiencies that these means exist: 1, consuming time, effort and sense cycle are long, do not meet the spirit of " speed speeds passenger flow " of State Council's proposition; 2, nonspecific reaction is a situation about generally occurring in the testing process; 3, some causal organism (particularly plant virus) lacks effective detection means.These all can not adapt to the needs of China's rapid economic development.Therefore, it is extremely urgent to set up new inspection and quarantine technological means fast and effectively.
Biochip technology has been a fast-developing molecular biology new and high technology of getting up since the mid-90, is the comprehensive brand-new science of each subject crossing.Its principle is that a large amount of dna probe fragments are solidified surface in holder in an orderly manner, then with the biological sample of mark in dna molecule hybridize, again hybridization signal is carried out check and analysis.Its biggest advantage is high flux, parallelization and microminiaturization.On genetic chip, unit area can be arranged a large amount of bioprobes to high-density, and single test just can be analyzed multiple biological sample simultaneously.Genetic chip has obtained widespread use in the research of the numerous areas such as analysis of the detection of determining nucleic acid sequence, gene mutation, expression conditions, be subjected to people's generally attention.
Summary of the invention
First purpose of the present invention provides the genetic chip of a kind of highly sensitive, high specificity, economical and practical detection solanaceae plant virus.
Second purpose of the present invention provides one group of nucleotide sequence that detects solanaceae plant virus.
The 3rd purpose of the present invention provides a kind of kit of realizing commercial detection solanaceae plant virus.
For achieving the above object, the present invention is by the following technical solutions:
A kind of genetic chip that detects solanaceae plant virus is fixed with plurality of detection and Quality Control contrast probe at surface of solid phase carriers, and wherein: detector probe has the nucleotide sequence shown in sequence table SEQ ID No.1 to the SEQ ID No.70; The Quality Control contrast is made up of surface chemistry contrast probe, fluorescence labeling contrast probe, positive control probe, negative control probe, hybridization contrast probe and blank.
Described surface chemistry contrast probe is one section and has fluorescently-labeled probe that probe is selected from the combination in any that has in the nucleotide sequence shown in sequence table SEQ IDNo.1 to the SEQ ID No.70, and its 5 ' end is amido modified, and 3 ' end Cy3 or Cy5 modify; It act as combining of monitoring solid phase carrier and probe.
Described fluorescence labeling contrast probe does not have the sequence of homology for generating one section at random with all viruses to be checked, and the contrast probe of sequences Design mark in view of the above, has the nucleotide sequence shown in the sequence table SEQ ID No.72,5 ' hold amido modified; Fluorescence labeling contrast act as monitoring sample sequence fluorescence labeling validity to be checked, be because the fluorescence labeling failure causes or because sample itself does not contain virus to be checked to determine the negative signal that produces.
Described positive control probe for according to plant ribosome 18S RNA sequences Design, has the nucleotide sequence shown in the sequence table SEQ ID No.73, and 5 ' end is amido modified; The supervisory system sample RNA that act as of positive control extracts situation, if positive control has signal just to illustrate that total RNA quality of extracting is good from plant, the negative signal of viral probe is owing to do not contain this virus.
Described negative control probe for not having the 60nt nucleotide sequence of homology with all virus sequences, has the nucleotide sequence shown in the sequence table SEQ ID No.74, and 5 ' end is amido modified; The pollution condition that act as the monitoring reactive system of negative control shows that system is contaminated if negative control probe has fluorescence signal.
Described hybridization contrast probe is a 60nt sequence, and 5 ' end is amido modified, combines with solid phase carrier, synthesizes a 60nt sequence of complementary pairing with it in addition, and 5 ' end Cy3 or Cy5 fluorescence labeling is as hybridizing contrast agents in the kit.Hybridization contrast probe has the sequence shown in the sequence table SEQ ID No.75, and the hybridization contrast agents has the sequence shown in the sequence table SEQ IDNo.76; The validity that act as the supervisory system hybridization reaction of hybridization contrast, the systematic cross reaction failure if hybridization contrast probe does not have signal instruction to be can not be according to should virus in the negative signal judgement sample of detector probe.
Described blank is the point sample damping fluid, is used to monitor spotting needle cleaning and probe and has or not cross pollution.
Solid phase carrier among the present invention can be selected carrier well known in the art for use, for example nitrocellulose filter, nylon membrane, polystyrene, microslide etc.
Every probe of chip laterally repeats 2 points, and the amount of every probe is 0.002-0.02pmol, the about 180 μ m of spot diameter, dot spacing 300 μ m.
Every of described chip has 4 same matrix, and the probe arrangement mode is each matrix 15 row 10 row.
Described chip slapper base (solid phase carrier), fence and cover plate are purchased in the CapitalBio Corporation.
The present invention is based on the harmful organism (viral part) that must implement quarantine of " The Quarantine Law of the P.C.C. Concerning Import andof Export Animals and Plants " defined; the frequency statistics that detects in conjunction with quarantine port various viruses; the character (RNA viruses/dna virus) of virus and domestic plant virus outburst situation; determine to design detection chip for detected object with the RNA viruses of plant of Solanaceae; the probe of 35 kinds of viruses of some system on the solanaceae plant virus detection chip, concrete title is as follows: apple chlorotic leaf spot virus ACLSV; alfalfa mosaic virus AMV; arabis mosaic virus ArMV; black eye cowpea mosaic virus BlCMV; cucumber green mottle virus CGMMV; cucumber mosaic virus CMV; cowpea mosaic virus CPMV; dianthovirus CRSV; eggplant mosaic virus EMV; lactuca virus 1 LMV; Lee's dwarf virus PDV; pea early browning virus PEBV; white showy flowers of herbaceous plants mosaic virus PenMV; potato mop-top virus PMTV; Prunus necrotic ring spot virus PNRSV; plumpox virus PPV; peanut stunt virus PSV; marmor solani PVA; potato V virus PVV; potato virus X PVX; marmor upsilon PVY; raspberry ring spot virus RpRSV; corn mosaic virus SCMV; strawberry obscure ring pinta poison SLRSV; pumpkin mosaic virus SqMV; tomato aspermy virus TAV; tomato black ring virus TBRV; tomato bushy stunt virus TBSV; tobacco mosaic virus (TMV) TMV; annulus zonatus ToRSV; nepovirus TRSV; Tobacco rattle virus TRV; tomato spotted wilf virus TSWV; clover white mosaic virus WCIMV and little cucurbita pepo mosaic virus ZYMV.
To be checked viral CP gene (the most conservative gene in the plant virus genome) sequences Design that the detector probe of various solanaceae plant virus is announced according to GenBank on the chip, conservative section is found out in comparison through homology, calculate the 60mer probe that meets the conservative section of these kinds virus with the condition (Tm value, GC content, secondary structure etc.) that compares strictness and homogeneous again, and 5 ' end with amido modified, two special detector probe of every kind of virus design, every probe is 60nt;
Table 1 solanaceae plant virus detector probe sequence
| The probe name | Probe sequence 5 '-3 ' | SEQ ID No： |
| ACLSV-1 | TCACTACAATGCCAGAGGTTGGGAGTAAATACCCGGAGCTGATGTTTGATTTCAATAAGG | 1 |
| ACLSV-2 | CATGAACAAGGCTCAGCAGAAGGTGATAACTAATATGAACCGTCGTCTTTTACAGACTGA | 2 |
| AMV-1 | TTGTCTCACTGATGACGTGACGACTGAGGATGGTAGGGCCGTTGCGCATGGTAATCCCAT | 3 |
| AMV-2 | TGAGAAGTTCGGGTTTGAGTTGGTCTTCACAGCTCCTACCCATGCGGGAATGCAAAATCA | 4 |
| ArMV-1 | CCTTGATCTTAAGTTAATGTGGGATTTGGAGGGTGAGTTTGGAAAGAGTTCTGGTGGTGT | 5 |
| ArMV-2 | TCCTCTACTACTAGCACTGTAGCCCTTGGAGACAATCCTTTTGCCCATATGATAGCTTGT | 6 |
| BlCMV-1 | GCAGGGAGGGGTCAGTAAACAACAACCGTGGTGCAGGGGATTCAACAATGAGAGACAAGG | 7 |
| BlCMV-2 | TGAGCAAGTTGAATACCCACTCAAACCAATGGTTGAAAATGCAAAGCCAACACTCCGTCA | 8 |
| CGMMV-1 | TTTAGTGCTTCTTATGTTCCCGTCAGGACTTTACTTAATTTTCTAGTTGCTTCACAAGGT | 9 |
| CGMMV-2 | GCTTCTCAGCTCCACGGATACGCGTAATAGGGTCATTGAGGTTGTAGATCCTAGCAATCC | 10 |
| CMV-1 | GAGTTAATCCTTTGCCGAAATTTGATTCTACCGTGTGGGTGACAGTTCGTAAAGTTCCTG | 11 |
| CMV-2 | CCGTGGGTCTTATTATGGTAAAAGGTTGCTGCTTCCTGATTCAGTCACTGAGTTCGATAA | 12 |
| CPMV-1 | GGCTATGGCTGGTGGTGATGTGTTATTGGATGAGTATCTCTATGATGTGGTCAATGGACA | 13 |
| CPMV-2 | TGTGATTGCCAAGCTAGACTGGTCAATTGTCAATGAGAAATGTGAGCCCACCATTTACCA | 14 |
| CRSV-1 | CAATGGCCTGCCTACTCCCAGTTTGCTCAGTCTAAATCCTAGTAACCAGTACCTGTTCCC | 15 |
| CRSV-2 | ACCAAATCGGTGTCTACGGCTGTGTATGAAAGTTGTGCCATCGACCTCCCTATTGACGAT | 16 |
| EMV-1 | CTCGGTCAACTGTATGCTCAAGGACTCTGTTCTTTACACAGATTGCCCAAAGCTCCTGGC | 17 |
| EMV-2 | CATGGCAAGCTCCGCTTGTCCTCCCCCCTCCTCCAAGCCAATTAACTCTCTCTCCCTCAG | 18 |
| LMV-1 | AAACAAGAAGAAACCGTATATGCCACGATACGGACGGCTACGAGGCTTGAACGATATGGG | 19 |
| LMV-2 | AGAGGCGCACAATCAAATGAAGGCAGCTGCTCTAGTGGGAACACAGAACAGACTGTTTGG | 20 |
| PDV-1 | AATGGTGTCTACGGACTCATTAAAGGTTTCGATGTGAATGCGCCTGTGGCGCCTAATCCC | 21 |
| PDV-2 | ACGTTCCGGTGTGGTTTTGTACTCAGTACCTCCAACACTCGATGCCCAAGAGAGTTGAGG | 22 |
| PEBV-1 | TGGAATGAGGTTCTGAGAAGGTTGATGGATCTCAAGTTCGCTCTGCAAGCGGACCGTGAC | 23 |
| PEBV-2 | TTCAAGGTAGTTCGCAAGCTACTGTGGTTAGACCGCCCAGAGAGTCGGATTCGGCTTTTG | 24 |
| PenMV-1 | TTTGAGCCACTGATGGGTAAGTATGACAAGAGCAGATTGAACAAAGCAGCCTTCACGAAG | 25 |
| PenMV-2 | AAGTTTCATGGAAGAATGGGACATTGGCGAAAGAATGCTCAGAAATTTATACACAGAAAT | 26 |
| PMTV-1 | AATTGAACATGCCACTAGCGTGTTGAGCCAGGTGTCTAATTTAGGTAGAACTCATTTCTA | 27 |
| PMTV-2 | TATAATTGTAGCGTTGCAGACAGTGAACGGCGAAGGGCGGGCAAGACGATTAGGTCCGAG | 28 |
| PNRSV-1 | CTCAACAGAGGGCTGTGAATAACCCGAATAGAAACCCGAATAGGGCTTCGAGTGGTATCG | 29 |
| PNRSV-2 | GATTGGGATGGTGGAGGACTATAAGGTGGAACAACCTGATGGTCCGAATGCCCTGTCTAG | 30 |
| PPV-1 | ACATGCCAAGGTATGGAATTCAGCGCAACCTGACAGACTACAGCCTCGCCAGATATGCCT | 31 |
| PPV-2 | TTTGGCTTGGATGGAAACGTCGGAACACAAGAAGAGGACACAGAGAGACACACCGCTGGT | 32 |
| PSV-1 | TCCACTGTTTGGGTGACGCTCAGAAAATTGCCTCCTGGCTACTCCCTGGCTTCGGAAAAT | 33 |
| PSV-2 | GCTCTTCACAGATGGTAATGCAGCAGTGCTTATCTATCAACACGTCTCGACCGGTATTCA | 34 |
| PVA-1 | TGGACTGGACGGAAATGTCACAACTTCAGAAGAGGACACAGAAAGGCACACAGCAACGGA | 35 |
| PVA-2 | ACTGCTGGGACTCATTCAGTACCACGCTTAAAATCAATGACATCAAAACTGACACTACCA | 36 |
| PVV-1 | TCTATGAGATCACATCCCGCACATCCGTCCGAGCACGAGAGGCTCACATCCAGATGAAGG | 37 |
| PVV-2 | TACATGCCACGGTATGGTTTGGTGAGAAATTTGCGGGATATGAGTTTGGCTCGATATGCA | 38 |
| PVX-1 | GCGCAACTCCTGCCACAGCTTCAGGACTGTTCACCATCCCGGATGGGGATTTCTTTAGTA | 39 |
| PVX-2 | TTGCCAGCCTAGATGCAGCTGTCACTCGAGGTCGTATCACTGGAACAACAACCGCTGAGG | 40 |
| PVY-1 | TCGACTTTTCGGGTTGGACGGTGGCATCAGTACACAAGAGGAGAACACAGAGAGGCACAC | 41 |
| PVY-2 | AAACCAACCCTTAGGCAAATCATGGCACATTTCTCAGATGTTGCAGAAGCGTATATAGAA | 42 |
| RpRSV-1 | ACCGTTCTGTGGGGAGTGCCTGGTTCCGTGTTACTAATATCCTTGATGATAACTTGGTGT | 43 |
| RpRSV-2 | CGGGCCAGGCTAATGGAAAGCCATTCATTATAGTGCACAAACTTGGTGGAATTGTTGGGC | 44 |
| SCMV-1 | ACAATGCGGTCTCCCATTAGTAGATGTCAAGAGTAAGCACATAGTTGGAATACACAGTCT | 45 |
| SCMV-2 | TGACCAATAACAATATAGCAGGCTTCCCAGAGTATGAGGGTACACTTCGGCAAACAGGAG | 46 |
| SLRSV-1 | GGATTAACCAGGCATCCTCCCAGGTTTTACCGGGTTTAGTTCTGGCACTTAGAATAAGCT | 47 |
| SLRSV-2 | AGCTGTAAGTAAGCAGCCGCTAGTGTTCTGGATTTCCAGGCATAGTGAGAATCAGTGGCA | 48 |
| SqMV-1 | TGCAAGATAGCAATGAGAGGGCCGCTATAGATTTGATTCGCACCCATGTCATTAGAGGCA | 49 |
| SqMV-2 | AGCAGCTTGGAACTTATAATCCAATCTGGATGGTTCGCACGCCCTTAGAAAGTACAGCCC | 50 |
| TAV-1 | GGAAGCCGACGTCCACGTCGTGGTCGTCGTAATAATAACAACAACAACTCGACTGCTCGT | 51 |
| TAV-2 | TCGTGCAGGTTATACTTACACTTCGTTGGATGTTCGACCGACTAGAACTGAGAAGGACAA | 52 |
| TBRV-1 | TTGTGTCGGGAAATAAATTACAACCAGCATTTTGCTTGGTTTATGCTTGAGCATCTCGAT | 53 |
| TBRV-2 | TGGGCCGGGCTTCTGCAAACCAACGCTCTATATTGTAGTGGCTTCAGAATTTCAACTTGC | 54 |
| TBSV-1 | CCTGGATACCTCCTGGTGTCTAGGACTGCCACTGTATTGACAATGACATTCCGTGCTACA | 55 |
| TBSV-2 | GTTTGTCATATCCGGGACGTATCGGTGCCTCACGGCAACAACGTTAGGCTTGGCTGGCGG | 56 |
| TMV-1 | TTTCAAACACAACAAGCTCGAACTGTCGTTCAAAGACAATTCAGTGAGGTGTGGAAACCT | 57 |
| TMV-2 | CGACACTAGAAATAGAATAATAGAAGTTGAAAATCAGGCGAACCCCACGACTGCCGAAAC | 58 |
| ToRSV-1 | CTTTGCTTATTGGTATGGATGTTCCGAAGGATGAGAGACTCAAACCGTCTAAGGTGTTGG | 59 |
| ToRSV-2 | CCAACACCTTAGACGGTTTGAGTCTCTCATCCTTCGGAACATCCATACCAATAAGCAAAG | 60 |
| TRSV-1 | CACTGGCTGGCATTATGGTGAGGTGGATCTCTGCATTTCTTGGTCAAGGTCTAAACAGGC | 61 |
| TRSV-2 | TACAACTGAAGAAGGATTTGGTAGACTTGGCATTCTCCCTCTTTCTGGTCCCATAGCTCC | 62 |
| TRV-1 | ACACAACGGTTACGACGAACCAAGGGAGTACTACTACTACCAAGGCGAACACTGGCTCGA | 63 |
| TRV-2 | CGCTTCTACTGCGTATCATAAAGCTCTCTCCTATTTGGAAGGTTTAAATTTGAAACCGTT | 64 |
| TSWV-1 | CCTCACAGACTTTGCATCATCAAGAGGTAATCCATAGGCTTGAATCAAAGGGTGGGAAGC | 65 |
| TSWV-2 | AAATTACCATAAAGAAAACTTCAGACAGGATTGGAGCCACTGACATGACCTTCAGAAGGC | 66 |
| WClMV-1 | TCGCTGATGTTGGCGCTTCTTCTAAGTCTGAACTTACTGGTGACTCTGCTGCTCTTGCGG | 67 |
| WClMV-2 | CCACGGGTTAAGTTTACCATCTAATTGAAAACCAATGGCAACCACCACAGCAACCACTCC | 68 |
| ZYMV-1 | TGCCGATGTAATTCTAATATTTACCGCTTTATATGATGTCTTTAGATTTCCCGAGTGGGC | 69 |
| ZYMV-2 | TCTGGGTCATGATGGATGGGAATGAGCAGGTTGAGTATCCTTTGAAACCAATAGTTGAAA | 70 |
Surface chemistry contrast probe sequence such as table 2 (5 ' end is amido modified, and 3 ' end Cy3 or Cy5 modify).
Table 2 surface chemistry contrast probe sequence (SEQ ID No.71)
| The probe name | Probe sequence 5 '-3 ' |
| The surface chemistry contrast | CGGCTAGACTGGACTTAACTCTGTCATATAGAGACATGGTCACATCACTCAGTTATAGTC |
Fluorescence labeling contrast probe sequence such as table 3 (5 ' end is amido modified).
Table 3 fluorescence labeling contrast probe sequence (SEQ ID No.72)
| The probe name | Probe sequence 5 '-3 ' |
| The mark contrast | GGCTCTGACGCGATATACGGTTGTGCCGAGTGTCAATAGTTTCAAATGAGGTAGCAGACT |
Positive control probe sequence such as table 4.
Table 4 positive control probe sequence (SEQ IDNo.73)
| The probe name | Probe sequence 5 '-3 ' |
| Positive control | CCGGCGACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGC CTA |
Negative control probe sequence such as table 5 (5 ' end is amido modified).
Table 5 negative control probe sequence (SEQ ID No.74)
| The probe name | Probe sequence 5 '-3 ' |
| Cloudy shape contrast | ATACTGGCAAAGTGGCGCGTAGCACGATAACGAAACATGGACCGCGCTTATACTATAGTC |
Hybridization contrast probe sequence such as table 6 (5 ' end is amido modified).
Table 6 hybridization contrast probe sequence (SEQ ID No.75)
| The probe name | Probe sequence 5 '-3 ' |
| Hybridization contrast probe | CAAACATTGAAACGCTGAACTGCAAGTACCAACTGTTGTGCCCGCTCCGATGGGATAGTC |
The invention provides a kind of kit that directly applies to the solanaceae plant virus of quarantine, form by following component: wherein genetic chip, chip cover plate and chip hybridization box room temperature storage, other reagent needs-20 ℃ of storages;
(1) genetic chip, chip cover plate and chip hybridization box: wherein the surface of solid phase carriers of genetic chip is fixed with some probes and Quality Control contrast, and probe has the nucleotide sequence shown in sequence table SEQ ID No.1 to the SEQ ID No.70; The Quality Control contrast is made up of surface chemistry contrast, fluorescence labeling contrast, positive control, negative control, hybridization contrast and blank;
Wherein, the specification of genetic chip is 25mm * 75mm, every box 10-20 sheet;
The solid phase carrier of genetic chip is selected from nitrocellulose filter, nylon membrane, polystyrene or microslide;
The surface chemistry contrast of genetic chip has the nucleotide sequence shown in the sequence table SEQ ID No.71, and its 5 ' end is amido modified, and 3 ' end Cy3 or Cy5 modify;
The fluorescence labeling contrast of genetic chip has the nucleotide sequence shown in the sequence table SEQ ID No.72, and 5 ' end is amido modified;
The positive control of genetic chip has the nucleotide sequence shown in the sequence table SEQ ID No.73, and 5 ' end is amido modified;
The negative control of genetic chip has the nucleotide sequence shown in the sequence table SEQ ID No.74, and 5 ' end is amido modified;
The hybridization contrast of genetic chip has the sequence shown in the sequence table SEQ ID No.75, and 5 ' end is amido modified;
The blank of genetic chip is the point sample damping fluid;
Every probe of genetic chip laterally repeats 2 points, and the amount of every probe is 0.002-0.02pmol, the about 180 μ m of spot diameter, dot spacing 300 μ m;
Every of genetic chip has 4 same matrix, and the probe arrangement mode is each matrix 15 row 10 row;
(2) DEPC water: 428ul-856ul
(3) reverse transcription reagent: 405ul-810ul purchases the company in Promega
(4) reverse transcriptase: 45ul-90ul purchases the company in Promega
(5) RNA enzyme inhibitor: 23ul-46ul purchases the company in Promega
(6) PCR enzyme: 15-30ul purchases the company in TAKARA
(7) 35 kinds of virus PCR primers and reagent: every kind of 423ul-846ul, synthetic in Beijing AudioCodes biotechnology Ltd, comprising: comprising: apple chlorotic leaf spot virus PCR reagent, alfalfa mosaic virus PCR reagent, arabis mosaic virus PCR reagent, black eye cowpea mosaic virus PCR reagent, cucumber green mottle virus PCR reagent, cucumber mosaic virus PCR reagent, cowpea mosaic virus PCR reagent, dianthovirus PCR reagent, eggplant mosaic virus PCR reagent, lactuca virus 1 PCR reagent, Lee's dwarf virus PCR reagent, pea early browning virus PCR reagent, white showy flowers of herbaceous plants mosaic virus PCR reagent, potato mop-top virus PCR reagent, Prunus necrotic ring spot virus PCR reagent, plumpox virus PCR reagent, peanut stunt virus PCR reagent, marmor solani PCR reagent, potato V virus PCR reagent, potato virus X PCR reagent, marmor upsilon PCR reagent, raspberry ring spot virus PCR reagent, corn mosaic virus PCR reagent, strawberry obscure ring spot virus PCR reagent, pumpkin mosaic virus PCR reagent, tomato aspermy virus PCR reagent, tomato black ring virus PCR reagent, tomato bushy stunt virus PCR reagent, tobacco mosaic virus (TMV) PCR reagent, annulus zonatus PCR reagent, nepovirus PCR reagent, Tobacco rattle virus PCR reagent, tomato spotted wilf virus PCR reagent, clover white mosaic virus PCR reagent, little cucurbita pepo mosaic virus PCR reagent;
(8) positive control PCR primer and reagent: 423ul-846ul
(9) mark contrast: 15ul-30ul
(10) mark PCR primer and reagent: 342ul-684ul
(11) hybridization contrast: 45ul-90ul
(12) 2x hybridization buffer: 495ul-990ul purchases the company in Roche
Wherein, the primer sequence such as the table 7 of (8) positive control PCR reagent.
Table 7 positive control primer sequence
| The primer name | Primer sequence 5 '-3 ' | SEQ ID No： |
| 18S-f | CACGAGGAGTCTGCTACATGATAACTCGACGGATCGC | 77 |
| 18S-r | CACGAGGAGTCTGCTACCTTGGATGTGGTAGCCGTTT | 78 |
(9) mark contrast template sequence such as table 8 (being cloned into the pMD-18T carrier).
Table 8 mark contrast template sequence (SEQ ID No:79)
| The template name | Template sequence 5 '-3 ' |
| The mark contrast template | CACGAGGAGTCTGCTACCCGAGAAACCATATTCAGAGCGAATCATCTGTGAGCCGTTT CAGTTGGTTGGTCTCAAAAGCCCTTCCTGCCCAGAGTGATCTCACTCGTCGAGGCCAT CGGCTCTGACGCGATATACGGTTGTGCCGAGTGTCAATAGTTTCAAATGAGGTAGCAG ACTCCTCGTG |
(10) the labeled primer sequence such as the table 9 of mark PCR reagent.
Table 9 labeled primer sequence
| The primer name | Primer sequence 5 '-3 ' | SEQ ID No： |
| Labeled primer | CACGAGGAGTCTGCTAC | 80 |
(11) sequence of hybridization contrast such as table 10 (5 ' end Cy3 or Cy5 modify).
Table 10 hybridization control sequence (SEQ ID No:76)
| The contrast name | Control sequence 5 '-3 ' |
| The hybridization contrast | GACTATCCCATCGGAGCGGGCACAACAGTTGGTACTTGCAGTTCAGCGTTTCAATGTTTG |
Solanaceae plant virus in (7) 35 kinds of virus PCR reagent detects primer sequence such as table 11
Table 11 solanaceae plant virus detects primer sequence
| Primer | Primer sequence 5 '-3 ' | SEQ ID No： |
| ACLSV-2cp-d-f | CACGAGGAGTCTGCTACCGGAGTTCCTGGACCTGATGGT | 81 |
| ACLSV-2cp-d-r | CACGAGGAGTCTGCTACCGCCTCATTTTCACTTTTTGCAAAT | 82 |
| AMVcp-d-f | CACGAGGAGTCTGCTACTTTTGTCTCACTGATGACGTGACGACT | 83 |
| AMVcp-d-r | CACGAGGAGTCTGCTACAGGGCTACGGCATAGGAATGCTT | 84 |
| ArMVcp-d-f | CACGAGGAGTCTGCTACGATATTTCCTCTACTACTAGCACTGTAGCCCTTG | 85 |
| ArMVcp-d-r | CACGAGGAGTCTGCTACGTGATGGTAACACCACCAGAACTCTTTC | 86 |
| BlCMVcp-d-f | CACGAGGAGTCTGCTACGCAGGGAGGGGTCAGTAAACAACA | 87 |
| BlCMVcp-d-r | CACGAGGAGTCTGCTACCTGCATCTGAGAAATGGTGCATGATT | 88 |
| CGMMVcp-d-f | CACGAGGAGTCTGCTACGTTTAGTGCTTCTTATGTTCCCGTCAGG | 89 |
| CGMMVcp-d-r | CACGAGGAGTCTGCTACTCAGCAGTCGTAGGATTGCTAGGATCTA | 90 |
| CMVcp-d-f | CACGAGGAGTCTGCTACTAACCCTTAAGCCTCCGAAAATAGA | 91 |
| CMVcp-d-r | CACGAGGAGTCTGCTACGGCAAAGGATTAACTCGAATTTGAA | 92 |
| CPMVcp-d-f | CACGAGGAGTCTGCTACAGTTCGTGGTTCTTTGCTTGACACAA | 93 |
| CPMVcp-d-r | CACGAGGAGTCTGCTACGGTAACCAATTCTGACAATCAGCCAAG | 94 |
| CRSVcp-d-f | CACGAGGAGTCTGCTACTACCTCGTCCAGCTTTGTGGTGAA | 95 |
| CRSVcp-d-r | CACGAGGAGTCTGCTACGTCGGTATCCCTTACAAACCTCCAGA | 96 |
| EMVcp-d-f | CACGAGGAGTCTGCTACCCTCTCCCCATGAACTCGGTCA | 97 |
| EMVcp-d-r | CACGAGGAGTCTGCTACGGTGGTGGCTGAGGGAGAGAGAG | 98 |
| LMVcp-d-f | CACGAGGAGTCTGCTACATGAGAAACAAGAAGAAACCGTATATGCC | 99 |
| LMVcp-d-r | CACGAGGAGTCTGCTACTCCATTCCAAACAGTCTGTTCTGTGTTC | 100 |
| PDVcp-d-f | CACGAGGAGTCTGCTACTTTCTAATGGTGTCTACGGACTCATTAAAGG | 101 |
| PDVcp-d-r | CACGAGGAGTCTGCTACACTGAATCAGGGACCTCAACTCTCTTG | 102 |
| PEBVcp-d-f | CACGAGGAGTCTGCTACGTGCTTGGGTCGAAGTGGGAAAT | 103 |
| PEBVcp-d-r | CACGAGGAGTCTGCTACATTTCCCAAAAGAGAAATTGTCTTCGG | 104 |
| PenMV-d-f | CACGAGGAGTCTGCTACAGCACACGATGAAGCGAAGC | 105 |
| PenMV-d-r | CACGAGGAGTCTGCTACCATAAGCGTATTATCTACAACAGTTGATGG | 106 |
| PMTVcp-d-f | CACGAGGAGTCTGCTACACTGGCGCGAAGCTAGGTTAAACA | 107 |
| PMTVcp-d-r | CACGAGGAGTCTGCTACGCGAGTTGATGTGCCACATTCAGA | 108 |
| PNRSV-2cp-d-f | CACGAGGAGTCTGCTACAATGGAGCTCTGGTCCCACTCA | 109 |
| PNRSV-2cp-d-r | CACGAGGAGTCTGCTACTCAAGAACCCCTTCCTAGACAGG | 110 |
| PPVcp-d-f | CACGAGGAGTCTGCTACAAAGCATACATGCCAAGGTATGGAATT | 111 |
| PPVcp-d-r | CACGAGGAGTCTGCTACGAGGTTGTGCATGTTGCGATTAACAT | 112 |
| PSVcp-d1-f | CACGAGGAGTCTGCTACCCGAAGAAGAAGGTCTCTCGCGT | 113 |
| PSVcp-d1-r | CACGAGGAGTCTGCTACTATAGAATCTTGTTATCGCGTTGAATACCG | 114 |
| PSVcp-d2-f | CACGAGGAGTCTGCTACAGCTCTTCACAGATGGTAATGCAGCA | 115 |
| PSVcp-d2-r | CACGAGGAGTCTGCTACTCCAACAGAAGCCAAATCGAAGGT | 116 |
| PVVcp-d-f | CACGAGGAGTCTGCTACGTGATCGAAAATGCGAAGCCTACTTT | 117 |
| PVVcp-d-r | CACGAGGAGTCTGCTACGCCTTCATCTGGATGTGAGCCTCT | 118 |
| PVAcp-d-f | CACGAGGAGTCTGCTACGATGTCGATTTAGGTACTGCTGGGACTC | 119 |
| PVAcp-d-r | CACGAGGAGTCTGCTACGTTGCGATTAACATCCGTTGCTGT | 120 |
| PVXcp-d-f | CACGAGGAGTCTGCTACAAAACTGCAGGCGCAACTCCTG | 121 |
| PVXcp-d-r | CACGAGGAGTCTGCTACAGAGTGACAACAGCCTGAGCGGTT | 122 |
| PVYcp-d-f | CACGAGGAGTCTGCTACAATGCAAAACCAACCCTTAGGCAA | 123 |
| PVYcp-d-r | CACGAGGAGTCTGCTACACATCCTCGGTGGTGTGCCTCT | 124 |
| RpRSVcp-d1-f | CACGAGGAGTCTGCTACTGGTCCCAAGGATTCTGTTGGAAC | 125 |
| RpRSVcp-d1-r | CACGAGGAGTCTGCTACGCAACCATATCTTCAATTCTACCCGG | 126 |
| RpRSVcp-d2-f | CACGAGGAGTCTGCTACGGTGAGAATCCCACCTTTACGGG | 127 |
| RpRSVcp-d2-r | CACGAGGAGTCTGCTACCAAACGTCCCAACTGAGTCCTTGG | 128 |
| SCMV-d-f1 | CACGAGGAGTCTGCTACCAATACCAAAGGTAAATCTTCACAATTG | 129 |
| SCMV-d-r1 | CACGAGGAGTCTGCTACCACTAGTTGATGCAAGACTGTGTATTCC | 130 |
| SLRSVcp-d-f | CACGAGGAGTCTGCTACGGTTATTAGGTAAGCTGTAAGTAAGCAGCCG | 131 |
| SLRSVcp-d-r | CACGAGGAGTCTGCTACAGCTTATTCTAAGTGCCAGAACTAAACCCG | 132 |
| SqMVcp-d-f | CACGAGGAGTCTGCTACTTGCAAGATAGCAATGAGAGGGCC | 133 |
| SqMVcp-d-r | CACGAGGAGTCTGCTACGGGCTGTACTTTCTAAGGGCGTGC | 134 |
| TAVcp-d-f | CACGAGGAGTCTGCTACCAAAACGGTACGGGAGGAGGAAG | 135 |
| TAVcp-d-r | CACGAGGAGTCTGCTACAATTAACCTTTGACCGAAACTCTTGTCCT | 136 |
| TBRVcp-d-f | CACGAGGAGTCTGCTACTCATAAGATGTGTGGGCAAACGCT | 137 |
| TBRVcp-d-r | CACGAGGAGTCTGCTACCCAGTAGTATTTGTATCGAGATGCTCAAGC | 138 |
| TBSVcp-d-f | CACGAGGAGTCTGCTACCTGGCGCTCTTGTCACAGCATCT | 139 |
| TBSVcp-d-r | CACGAGGAGTCTGCTACCTACAACTGTGATACTATTGACATTCACTCCG | 140 |
| TMVcp-d-f | CACGAGGAGTCTGCTACATGTCTTACAGTATCACTACTCCATCTCAGTT | 141 |
| TMVcp-d-r | CACGAGGAGTCTGCTACGGTTCGCCTGATTTTCAACTTCTATTAT | 142 |
| ToRSV-d-f1 | CACGAGGAGTCTGCTACGACGAAGTTATCAATGGCAGCG | 143 |
| ToRSV-d-r1 | CACGAGGAGTCTGCTACTCCGTCCAATCACGCGAATA | 144 |
| TRSV-d-f | CACGAGGAGTCTGCTACATGTGTGCTGTGACGGTTGTTCC | 145 |
| TRSV-d-r | CACGAGGAGTCTGCTACAAACAAAGTGGCGGAGCGACCCCA | 146 |
| TRVcp-d1-f | CACGAGGAGTCTGCTACTCCTGCGAATCCAAACACAACG | 147 |
| TRVcp-d1-r | CACGAGGAGTCTGCTACCAAGTCTTCTTCCAAAGTCGAGCCA | 148 |
| TRVcp-d2-f | CACGAGGAGTCTGCTACTTCGATGACGCTTCTACTGCGTATCA | 149 |
| TRVcp-d2-r | CACGAGGAGTCTGCTACCTGTCTCCTATATAACGGTTTCAAATTTAAACCT | 150 |
| TSWVcp-d1-f | CACGAGGAGTCTGCTACAGCATTATGGCAAGCCTCACAGACTT | 151 |
| TSWVcp-d1-r | CACGAGGAGTCTGCTACCTGAGAATCTCAATACTATCAAATCTAAGATTGCTT | 152 |
| TSWVcp-d2-f | CACGAGGAGTCTGCTACAGCAAAGTGATTTTACTTTTGGTAAAATTACCA | 153 |
| TSWVcp-d2-r | CACGAGGAGTCTGCTACTCAAGCTATCAAGCCTTCTGAAGGTCA | 154 |
| WClMVcp-d-f | CACGAGGAGTCTGCTACGGCGTGTATCTTCTAGTCTTCATTGTGTACTT | 155 |
| WClMVcp-d-r | CACGAGGAGTCTGCTACTGAAACACCCGCAAGAGCAGC | 156 |
| ZYMV-d-f | CACGAGGAGTCTGCTACCGACCATTTGCTGGAGTATAAGCC | 157 |
| ZYMV-d-r | CACGAGGAGTCTGCTACAACTTCACGCTTTAAAGGTGGGA | 158 |
The use flow process of gene chip kit is: extraction → RT-PCR of the total RNA of plant → virus-specific fragment amplification → mark amplification → hybridization → cleaning chip → scanning → interpretation as a result.
Above-mentioned all primer, probe, control sequence have the base sequence shown in the SEQ ID No:1-SEQ ID No:159 respectively, all belong to protection scope of the present invention.
Advantage of the present invention and innovation part are:
(1) high flux: solanaceae plant virus genetic chip and detection kit, the detection sequence and the reagent of the modal Solanaceae virus of solanaceae plant virus inspection and quarantine field of present national regulation have been integrated, detect when having realized 35 kinds of viruses common in the plant of Solanaceae, practical;
(2) quick: only be 1.5 working days detection time;
(3) special: as probe sequence have been carried out strict screening, made the only nucleic acid amplification product of corresponding a certain virus reaction of all probes on the chip, the false positive problem of effectively having avoided cross reaction to cause with it;
(4) sensitivity: the detection sensitivity of chip is 108 virions/g tissue sample (being about as much as 1ng viral nucleic acid/g tissue sample), than highly sensitive at least 1～2 orders of magnitude of RT-PCR;
(5) reaction cost is low: adopted labeled primer the sequence 5 '-CACGAGGAGTCTGCTAC-3 ' of unique design to carry out labeled reactant, with dNTP (1mM in the labeled reactant step, contain Cy3/Cy5-dCTP) consumption drop to 0.2 μ L, make reaction cost reduce to about 7% of universal method, be beneficial to and apply;
(6) good reproducibility, the result is reliable and stable: prove that through repeatability and stability experiment this detection system can guarantee the reappearance and the accuracy of testing result, can be widely used in that the plant quarantine of customs examination and quarantine system, plant-derived food security are supervised, field such as Causal Agent Identification in the diagnosis of the plant protection unit viroses of plant and the plant virus means of taxonomic research.Solanaceae plant virus genetic chip detection kit can be used for the daily quarantine of more than 80 kind of plant of Solanaceae derived food.
The invention will be further described below in conjunction with drawings and Examples, all any this areas of having done according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.
Description of drawings
Fig. 1 is the chip point sample matrix of regions location drawing.
Fig. 2 is that commercial solanaceae plant virus detects the gene chip probes arrangement.
Fig. 3-1 is TRSV sample RNA dilution RT-PCR testing result figure.
Fig. 3-2 is TRSV sample lapping liquid doubling dilution ELISA testing result figure.
Fig. 3-3 is that TRSV sample RNA dilutes chip detection figure as a result to 3-5.
Embodiment
One, material and method
1, material
Hydro-extractor: available from Heraeus company.
PCR instrument: available from Techne company.
Point sample instrument: available from GeneMachines company, model: OminiGrid.
Chip assembly tool: available from the CapitalBio Corporation.
Hybridizing box: available from the CapitalBio Corporation.
Chip scanner: available from Axon company, model: GenePix4100A.
Bioinformatics and chip analysis software: light version or beta release, ClustalX1.83, VectorNTI9.1, ArrayDesigner2.02, GenePix Pro4.0 (available from Axon company).
Probe, primer, mark contrast template: see Table 1-table 11, synthesize in Beijing AudioCodes biotechnology Ltd.
Blank: 50%DMSO is available from Sigma company.
The sheet base: the aldehyde radical glass chip, available from CEL company and CapitalBio Corporation.
Point sample damping fluid: 50%DMSO.
Washing lotion behind the point sample: 0.2%SDS.
Point sample rear enclosed liquid: 0.2%NaBH
1
Trizol reagent: available from Invitrogen company.
Reverse transcription kit: available from Promega company.
TagDNA polymerase: available from Takara company.
DNTP: available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Cy3/Cy5-dCTP: available from Amersham Biosciences company.
3X hybridization buffer: 15 * SSC, 0.3%SDS, 3 * Blocking
Hybridization washing lotion I (0.3 * SSC, 0.2%SDS)
Hybridization washing lotion II (0.06 * SSC)
Two, method
1, the design of probe is with synthetic
Collect the to be checked viral CP gene (the most conservative gene in the plant virus genome) of GenBank announcement and the 18S gene order of plant, conservative section is found out in comparison through homology, calculate the 60mer probe that meets the conservative section of these kinds virus with the condition (Tm value, GC content, secondary structure etc.) that compares strictness and homogeneous again, and 5 ' end with amido modified, every kind of virus designs 2 respectively.80 probe sequences that detect solanaceae plant virus that the present invention relates to have the nucleotide sequence shown in the sequence table SEQ ID.No.1-SEQ ID.No.80;
The surface chemistry contrast has the nucleotide sequence shown in the sequence table SEQ ID No.71, and its 5 ' end is amido modified, and 3 ' end Cy3 or Cy5 modify;
Fluorescence labeling contrast does not have the sequence of homology for generating one section at random with all viruses to be checked, and the contrast probe of sequences Design mark in view of the above, has the nucleotide sequence shown in the sequence table SEQ ID No.72,5 ' hold amido modified;
Described positive control for according to plant ribosome 18S RNA sequences Design, is monitored sample RNA and is extracted, and has the nucleotide sequence shown in the sequence table SEQ ID No.73, and 5 ' end is amido modified;
Described negative control for not having the 60nt nucleotide sequence of homology with all virus sequences, has the nucleotide sequence shown in the sequence table SEQ IDNo.74, and 5 ' end is amido modified;
Described hybridization contrast has the sequence shown in the sequence table SEQ ID No.75, and probe 5 ' end is amido modified;
Blank: point sample damping fluid (50%DMSO).
2, the preparation of chip
Probe dissolves with the point sample damping fluid, and concentration is 50 μ M, and every probe laterally repeats 2 points, every about 0.25nL, and the about 180 μ m of spot diameter, dot spacing 300 μ m, the standard variance of point sample uniformity coefficient is about 15%.
Probe is arranged: 4 same matrix on the chip, matrix position as shown in Figure 1.Each matrix 15 row 10 row of Solanaceae chip, probe is arranged as shown in Figure 2.
Develop a film behind the point sample: stirring and washing 2min in the washing lotion behind the point sample; Stir sealing 5min in the point sample rear enclosed liquid; Deionized water for stirring is cleaned 2min, triplicate, the centrifugal 1min of 2000rpm.
Utilize the chip assembly tool that four regional chip fences are affixed on chip surface, place the magazine room temperature preservation.
The using method of embodiment 2, genetic chip
1. the extraction of the total RNA of testing sample (recommend method):
Get the 0.1g testing sample, be cut into segment, powdered with liquid nitrogen grinding, the Trizol reagent that adds 1mL continues to grind homogenate, and room temperature leaves standstill 5min in the 1.5mL centrifuge tube of immigration sterilization;
The centrifugal 10min of 4 ℃ of 12000g (about 12000rpm) changes supernatant in the one new 1.5mL centrifuge tube over to;
Add the 0.2mL chloroform, thermal agitation 15s, at room temperature keep 2-3min then after, the centrifugal 15min of 4 ℃ of 12000g (about 12000rpm);
(approximately 0.6mL) transfers in the new 1.5mL centrifuge tube with the upper strata water, adds the 0.5mL isopropyl alcohol, puts upside down mixing, keeps 10min under the room temperature;
The centrifugal 10min of 4 ℃ of 12000g (about 12000rpm), abandoning supernatant, ethanol (configuration of the DEPC water) washing precipitation of adding 1mL75%, the centrifugal 5min of 4 ℃ of 7500g (about 10000rpm) discards ethanol then;
Be deposited under the room temperature after the drying, be dissolved in the 20 μ L DEPC water, preserve RNA for-20 ℃.
2. reverse transcription reaction:
Reaction system and program are as follows:
The total RNA 2 μ L of testing sample
DEPC water (D) 7.5 μ L
Mix back 70 ℃ of 10min → ice bath 5min, add then
Reverse transcription reagent (RT) 9 μ L
RNA enzyme inhibitor (I) 0.5 μ L
Reverse transcriptase (E) 1 μ L
After mixing, room temperature 10min → 42 ℃ 30min → 95 ℃, 5min → ice bath is preserved cDNA for-20 ℃.
3. specific amplification:
The viral species that may select detection with the detection demand of infective virus carries out the specific PCR amplification of different virus then respectively per sample.Reaction system and program are as follows:
The cDNA 0.5 μ L that reverse transcription obtains
Need inspection virus or positive control PCR reagent 9.4 μ L
PCR enzyme (PE) 0.1 μ L
95℃ 5min
72℃ 10min
4. mark amplification:
A plurality of amplified productions (comprise all specific PCR products that need inspection virus and positive control, the pipe number scale of PCR product is N) of sample to be checked are mixed.Reaction system and program are as follows:
Specific PCR product mixtures (N * 0.05) μ L
DEPC water (D) (2-N * 0.05) μ L
Mark PCR reagent (L) 7.6 μ L
PCR enzyme (PE) 0.1 μ L
Mark contrast (LC) 0.3 μ L
95℃ 5min
72℃ 10min
5. assorted the change:
Reaction system and program are as follows:
Labeled reactant product 10 μ L
2 * hybridization buffer (2 * HB) 11 μ L
Hybridization contrast (HC) 1 μ L
95 ℃ of 5min → ice bath 5min
Add 200 μ L deionized waters in the chip hybridization box, put into chip front side in the hybridizing box up, aligning direction is put into cover plate, get the disposable injection of 15 μ L by the hybridization solution of well after with sex change, make it be full of space between cover plate and the chip, the sealing hybridizing box places 65 ℃ of isoperibol 30min, simultaneously preheating hybridization washing lotion I and hybridization washing lotion II in 65 ℃ of isoperibols.
After hybridization finishes, discard cover plate, chip probe faces down and float remaining hybridization solution (the hybridization solution cross pollution of four matrixes is avoided in attention) in the hybridization washing lotion I of small amount of preheated, tear the rubber fence on the chip off, at the hybridization washing lotion I of preheating stirring and washing 5min, at the hybridization washing lotion II of preheating stirring and washing 5min, the centrifugal 1min of 2000rpm places the magazine room temperature preservation again.
6. scanning
Place chip scanner to carry out scanning analysis chip, the Cy3 mark scans (as not explanation in addition with the 532nm laser tube, fluorescent marker is Cy3 in this kit), the Cy5 mark scans (needing fluorescent marker can be provided as the user is the kit of Cy5) with the 635nm laser tube, and PMT is made as 900.Obtain data such as each point fluorescence intensity, background intensity.
7. interpretation as a result
The following principle interpretation testing result of foundation:
A. each check point signal value=this fluorescence intensity level-this background intensity value;
B. the mean value of blank average signal value=2 a blank point signal value;
C. mean value-blank the average signal value of negative control average signal value=2 a negative control point signal value;
D. each check point signal value-blank average signal value＞2 times negative control average signal value of every probe is that this check point of interpretation is positive;
E. two of every probe duplicate detection points are all positive is that this probe of interpretation is positive;
E. one or more probe of every kind of virus is positive is that the interpretation testing sample carries this kind virus;
F. as any one is negative in 27 points of probe in conjunction with contrast, show that then probe combines existing problems with the sheet base, experimental result is inaccurate;
G. negative as the hybridization contrast, then show hybridization link existing problems, experimental result is inaccurate;
H. negative as the mark contrast, then show mark amplification link existing problems, experimental result is inaccurate;
I. negative as positive control, show that then total RNA extracts the link existing problems, experimental result is inaccurate.
One, method:
(Tobacco ringspot virus, plant sample TRSV) (Beijing Administration for Entry-Exit Inspection and Quarantine provides) extracts RNA, carries out 10 respectively will to carry nepovirus
1～10
3Times gradient dilution carries out respectively that RT-PCR detects, ELISA (purchasing in trade Ltd of Beijing Sai En Cisco) and chip detection.
Two, result:
TRSV sample RNA dilution RT-PCR testing result is seen Fig. 3-1, wherein 1:10
-3Dilution; 2:10
-4Dilution; 3.10
-5Dilution; N: blank; M:Marker DL2000 has only 10
-3Dilution can detect virus.
TRSV sample lapping liquid doubling dilution ELISA testing result is seen Fig. 3-2, and the positive signal value was just near critical value when TRSV sample lapping liquid was done dilution in 1: 4, and dilution in 1: 8 does not go out the positive with regard to interpretation.
TRSV sample RNA dilution chip detection the results are shown in Figure 3-3 to 3-5, and wherein Fig. 3-3 is 10
-3Dilution, Fig. 3-4 is 10
-4Dilution, Fig. 3-5 is 10
-5Dilution is 10
-4Still can detect virus during dilution.
As seen, with being with the hybridization of malicious sample, chip detection remolding sensitivity RT-PCR method height 1-2 the order of magnitude, detect a high 4-5 order of magnitude than ELISA.
The stability test of embodiment 5, chip
One, method
Three chips are placed respectively at room temperature, placed for 1 week for 37 ℃, put for 2 weeks for 37 ℃, carry out hybridization reaction respectively with TRSV sample RNA.
Two, result
Placed for 2 weeks even experimental result shows at 37 ℃, still do not influence testing result, chip has good stability.
Embodiment 6, genetic chip trying out in the inspection and quarantine practice
Genetic chip with development carries out viral examination to various plants, and examination result and ELISA experiment are compared, and the result is discrepant again with two-step approach RT-PCR checking.
One, material and method
1, test material
Beijing Administration for Entry-Exit Inspection and Quarantine plant quarantine laboratory is taken from seed such as soybean, kidney bean, cowpea, pumpkin, sponge gourd, cucumber, cucurbita pepo, tomato, pimento, sunflower and lily ball and grape scion, these seeds, plants ball and scion respectively from Holland, France, the U.S., Israel and Philippine.Apple, peach, muskmelon, rape, three-coloured amaranth, tobacco, balsam pear, spinach, radish, corn, respectively from China Inst. of Quarantine Inspection Sciences's plant isolation camp and farmland.
TMV, the SCMV that this research is used, CMV, ZYMV, TRSV, ToRSV, PNRSV antiserum are available from U.S. Agdia company.
2, experimental technique
(1) sample collecting and pre-treatment: vegetable seedss such as cucurbita pepo, pumpkin are planted in the indoor flowerpot of fly net, treat that two leaf stage gets plant leaf blade and be used for DAS-ELISA, PCR and chip detection, treat that for apple, grape scion Zhan Ye gets tender blade and detects, lily ball is directly got its tissue detection.The field plant sample is chosen tender blade and is used for detecting.Plant total tissue RNA extracting method is seen first.
(2) DAS-ELISA detects:
A. wrap by elisa plate: with the sero-fast purification IgG of virus to be measured (promptly one is anti-), so that be cushioned in the liquid in bag with the work concentration dilution, every hole adds the IgG of 100 μ L dilution.37 ℃ hatched 3 hours or 4 ℃ of refrigerators in overnight incubation;
B. wash plate: with the quick left-hand thread of reaction plate, discard in the hole liquid (note not allowing between the Kong Yukong solution mix mutually to avoid cross pollution) in waste water container, every then hole adds 200 μ L PBST liquid, discards liquid in the hole fast after leaving standstill 3min, so repeats at least 3～5 times;
C. application of sample: remove blank well and add 100 μ L PBST+2%PVP damping fluids, all the other every holes add 100 μ L sample extracts, and a sample is established two repetitions, establishes positive control simultaneously, negative control; In 4 ℃ of refrigerators, preserve moisture in overnight incubation or the 37 ℃ of incubators behind the application of sample and leave standstill 2h;
D. wash plate: with (2);
E. enzyme-added mark IgG: dilute enzyme labelled antibody (promptly two is anti-) to proper operation concentration with PBST+2%PVP, every hole sample adds 100 μ L enzymes mark IgG;
F. hatch: leave standstill 2h in 37 ℃ of incubators;
G. wash plate: with (2);
H. add substrate: with substrate buffer solution 1mg/mL dissolving substrate PNP (now with the current), every hole adds 100 μ L (containing blank);
I. hatch: room temperature lucifuge colour developing 30～60min; Range estimation is with the shade record +++, ++, ± ,-; Or with enzyme connection readout instrument reading under 405nm;
J. the criterion of reading is, the positive: I/H 〉=2, feminine gender: I/H＜2.I/H=(the average light absorption value of the average light absorption value-blank of sample)/(the average light absorption value of average light absorption value-blank of normal healthy controls)
K. note: blank, negative control (being normal healthy controls) and positive control all are set; Should be timely during to elisa plate reading or visual observation, otherwise read untrue.Can not contact PNP tablet (severe toxicity) or PNP solution is exposed under the high light, light or pollutant can cause that negative hole presents background color.
(3) chip detection: with embodiment 2.
(4) two-step approach RT-PCR detects: first step RT-PCR method, with identifying primer; The second step PCR universal primer, method is seen embodiment 2.The sample that ELISA and chip detection there are differences is verified once more with two-step approach RT-PCR method.
Three, result
1, the susceptible situation statistics of genetic chip examination plant is as shown in table 12.
The susceptible situation statistics of table 12 genetic chip examination plant
| Plant name | The infective virus title | Susceptible kind (kind) |
| Pumpkin | Cucumber mosaic virus CMV, little cucurbita pepo mosaic virus ZYMV | 2 |
| Muskmelon | Cucumber mosaic virus CMV, little cucurbita pepo mosaic virus ZYMV | 2 |
| Sponge gourd | Cucumber mosaic virus CMV, little cucurbita pepo mosaic virus ZYMV | 2 |
| Cucumber | Cucumber mosaic virus CMV, tobacco mosaic virus (TMV) TMV, Prunus necrotic ring |
3 |
| Cucurbita pepo | Little cucurbita pepo |
1 |
| Balsam pear | Cucumber mosaic virus CMV, Prunus necrotic ring spot virus PNRSV | 2 |
| Kidney bean | Cucumber |
1 |
| Cowpea | Cucumber mosaic virus CMV, tobacco mosaic virus (TMV) TMV, little cucurbita pepo |
3 |
| Soybean | Cucumber mosaic virus CMV, Prunus necrotic ring spot virus PNRSV, apple chlorotic leaf |
3 |
| Tomato | Cucumber |
1 |
| Pimento | Cucumber |
1 |
| Spinach | Cucumber mosaic virus CMV, tobacco mosaic virus (TMV) TMV | 2 |
| Radish | Cucumber |
1 |
| Rape | Cucumber mosaic virus CMV, tobacco mosaic virus (TMV) TMV | 2 |
| Corn | Do not have | 0 |
| Three-coloured amaranth | Cucumber |
1 |
| Sunflower | Cucumber mosaic virus CMV, tobacco mosaic virus (TMV) TMV, tomato ring spot | 4 |
| Poison ToRSV, Prunus necrotic ring spot virus PNRSV | ||
| Lily | Do not have | 0 |
| Grape | Do not have | 0 |
| Apple | Prunus necrotic ring spot virus PNRSV, apple chlorotic leaf spot virus ACLSV | 2 |
| Peach | Do not have | 0 |
| Tobacco | Cucumber |
1 |
2, the susceptible situation of ELISA examination plant sees Table 13.
The susceptible situation statistics of table 13 ELISA examination plant
| Plant name | The infective virus title | Susceptible kind (kind) |
| Pumpkin | Cucumber mosaic virus CMV, little cucurbita pepo mosaic virus ZYMV | 2 |
| Muskmelon | Little cucurbita pepo |
1 |
| Sponge gourd | Little cucurbita pepo |
1 |
| Cucumber | Tobacco mosaic virus (TMV) |
1 |
| Cucurbita pepo | Little cucurbita pepo |
1 |
| Balsam pear | Cucumber mosaic virus CMV | 0 |
| Kidney bean | Cucumber |
1 |
| Cowpea | Cucumber mosaic virus CMV, tobacco mosaic virus (TMV) |
1 |
| Soybean | Cucumber |
1 |
| Tomato | Do not have | 0 |
| Pimento | Do not have | 0 |
| Spinach | Do not have | 0 |
| Radish | Do not have | 0 |
| Rape | Do not have | 0 |
| Corn | Do not have | 0 |
| Three-coloured amaranth | Cucumber mosaic virus CMV | 0 |
| Sunflower | Do not have | 0 |
| Lily | Do not have | 0 |
| Grape | Do not have | 0 |
| Apple | Do not have | 0 |
| Peach | Do not have | 0 |
| Tobacco | Do not have | 0 |
3, relatively two kinds of methods detect viral situation in different plants, and the result is as shown in table 14.
Two kinds of methods of table 14 detect vegetational zone poison situation relatively
| ELISA (part) | Genetic chip (part) | |
| |
3 | 17 |
| TMV | 2 | 5 |
| ZYMV | 4 | 5 |
| PNRSV | 0 | 6 |
| ToRSV | 0 | 1 |
| TRSV | 0 | 0 |
| SCMV | 0 | 0 |
| ACLSV | - | 2 |
| HCRSV | 0 | |
| GLRaLV | … | 0 |
| PenMV | - | 0 |
4, chip detection shows the positive and ELISA detects the sample that the shows negative checking result by two-step approach RT-PCR method, and the testing result that has confirmed chip is correct.
According to above experimental result as can be known, the testing result of genetic chip testing result and ELISA has consistance, and the detected virus of every ELISA also can both detect with genetic chip; For the very little virus of content in the plant, can not detect with the ELISA method, but can detect positive signal with genetic chip, through the checking of two one step RT-PCRs, sample is positive really.Illustrate that gene chip detecting technique has higher sensitivity than ELISA method.Biochip technology can also detect 4 kinds of viruses that exist in the duplicate samples simultaneously, has embodied the high flux and the concurrency of chip hybridization technology.
Embodiment 7, detection kit
1. solanaceae plant virus detects genetic chip
Table 15
| Content | 40Kit | 80Kit |
| Genetic chip | 10 | 20 |
| The chip cover plate | 10 | 20 |
Room temperature keeps in Dark Place, and storing did not influence result of use in 12 months.
2. " solanaceae plant virus genetic chip detection kit "
Table 16
| Content | Code | 40Kit | 80Kit |
| DEPC water | D | 428μL | 856μL |
| Reverse transcription reagent | RT | 405μL | 810μL |
| The RNA enzyme inhibitor | I | 23μL | 46μL |
| Reverse transcriptase | E | 45μL | 90μL |
| Apple chlorotic leaf spot virus PCR reagent | ACLSV | 423μL | 846μL |
| Alfalfa mosaic virus PCR reagent | AMV | 423μL | 846μL |
| Arabis mosaic virus PCR reagent | ArMV | 423μL | 846μL |
| Black eye cowpea mosaic virus PCR reagent | BlCMV | 423μL | 846μL |
| Cucumber green mottle virus PCR reagent | CGMMV | 423μL | 846μL |
| Cucumber mosaic virus PCR reagent | CMV | 423μL | 846μL |
| Cowpea mosaic virus PCR reagent | CPMV | 423μL | 846μL |
| Dianthovirus PCR reagent | CRSV | 423μL | 846μL |
| Eggplant mosaic virus PCR reagent | EMV | 423μL | |
| Lactuca virus | |||
| 1 PCR reagent | LMV | 423μL | 846μL |
| Lee's dwarf virus PCR reagent | PDV | 423μL | 846μL |
| Pea early browning virus PCR reagent | PEBV | 423μL | 846μL |
| White showy flowers of herbaceous plants mosaic virus PCR reagent | PenMV | 423μL | 846μL |
| Potato mop-top virus PCR reagent | PMTV | 423μL | 846μL |
| Prunus necrotic ring spot virus PCR reagent | PNRSV | 423μL | 846μL |
| Plumpox virus PCR reagent | PPV | 423μL | 846μL |
| Peanut stunt virus PCR reagent | PSV | 423μL | 846μL |
| Marmor solani PCR reagent | PVA | 423μL | 846μL |
| Potato V virus PCR reagent | PVV | 423μL | 846μL |
| Potato virus X PCR reagent | PVX | 423μL | 846μL |
| Marmor upsilon PCR reagent | PVY | 423μL | 846μL |
| Raspberry ring spot virus PCR reagent | PpRSV | 423μL | 846μL |
| Corn mosaic virus PCR reagent | SCMV | 423μL | 846μL |
| Strawberry obscure ring spot virus PCR reagent | SLRSV | 423μL | 846μL |
| Pumpkin mosaic virus PCR reagent | SqMV | 423μL | 846μL |
| Tomato aspermy virus PCR reagent | TAV | 423μL | 846μL |
| Tomato black ring virus PCR reagent | TBRV | 423μL | 846μL |
| Tomato bushy stunt virus PCR reagent | TBSV | 423μL | 846μL |
| Tobacco mosaic virus (TMV) PCR reagent | TMV | 423μL | 846μL |
| Annulus zonatus PCR reagent | ToRSV | 423μL | 846μL |
| Nepovirus PCR reagent | TRSV | 423μL | 846μL |
| Tobacco rattle virus PCR reagent | TRV | 423μL | 846μL |
| Tomato spotted wilf virus PCR reagent | TSWV | 423μL | 846μL |
| Clover white mosaic virus PCR reagent | WClMV | 423μL | 846μL |
| Little cucurbita pepo mosaic virus PCR reagent | ZYMV | 423μL | 846μL |
| Positive control PCR reagent | PC | 423μL | 846μL |
| The PCR enzyme | PE | 15μL | 30μL |
| Mark PCR reagent | L | 342μL | 684μL |
| The mark contrast | LC | 15μL | 30μL |
| The hybridization contrast | HC | 45μL | 90μL |
| 2 * hybridization buffer | 2×HB | 495μL | 990μL |
| Service manual | 1 |
1 part |
-20 ℃ keep in Dark Place, and storing did not influence result of use in 12 months.
Solanaceae plant virus in 35 kinds of virus PCR reagent detects primer sequence and has the sequence shown in sequence table SEQ ID No:81 to the SEQID No:159; The primer sequence of positive control PCR reagent has the sequence shown in sequence table SEQ ID No:77 and the SEQ IDNo:78; Mark contrast template sequence has the sequence shown in the sequence table SEQ ID No:79; The labeled primer sequence of mark PCR reagent has the sequence shown in the sequence table SEQ ID No:80; The sequence of hybridization contrast has the sequence shown in the sequence table SEQ ID No:76.
Using method (with embodiment 2)
The present invention has mainly finished and has been used for the gene chip detecting system that plant of Solanaceae derived food virus detects, and this detection system is selected the aldehyde radical substrate for use, and the chamber is optimized by experiment, forms stable genetic chip preparation technology; By optimizing fluorescence labeling and chip hybridization device, form ripe reaction system.
Result of study of the present invention shows that plant of Solanaceae derived food viral gene chip inspecting reagent unit can be used for the daily quarantine of more than 80 kind of plant of Solanaceae derived food.The present invention has changed traditional plant-derived food virus quarantine mode, in plant-derived food virus detection techniques, introduced biochip technology, set up the method that multiple virus detects simultaneously, detection sensitivity and detection efficiency have greatly been improved, for the speed of being open to the custom of accelerating the plant-derived food of entry and exit, add power and provide sound assurance to the monitoring dynamics of food security.
Sequence table
＜110〉People's Republic of China Beijing Entry-Exit Inspection and Quarantine Bureau
Vector Gene Technology Co., Ltd
China Inst. of Quarantine Inspection Sciences
Biotechnology research institute of Zhejiang University
＜120〉a kind of genetic chip, nucleotide sequence and kit that detects solanaceae plant virus
<130>
<160>158
<170>PatentIn version 3.3
<210>1
<211>60
<212>DNA
＜213〉synthetic
<400>1
tcactacaat gccagaggtt gggagtaaat acccggagct gatgtttgat ttcaataagg 60
<210>2
<211>60
<212>DNA
＜213〉synthetic
<400>2
catgaacaag gctcagcaga aggtgataac taatatgaac cgtcgtcttt tacagactga 60
<210>3
<211>60
<212>DNA
＜213〉synthetic
<400>3
ttgtctcact gatgacgtga cgactgagga tggtagggcc gttgcgcatg gtaatcccat 60
<210>4
<211>60
<212>DNA
＜213〉synthetic
<400>4
tgagaagttc gggtttgagt tggtcttcac agctcctacc catgcgggaa tgcaaaatca 60
<210>5
<211>60
<212>DNA
＜213〉synthetic
<400>5
ccttgatctt aagttaatgt gggatttgga gggtgagttt ggaaagagtt ctggtggtgt 60
<210>6
<211>60
<212>DNA
＜213〉synthetic
<400>6
tcctctacta ctagcactgt agcccttgga gacaatcctt ttgcccatat gatagcttgt 60
<210>7
<211>60
<212>DNA
＜213〉synthetic
<400>7
gcagggaggg gtcagtaaac aacaaccgtg gtgcagggga ttcaacaatg agagacaagg 60
<210>8
<211>60
<212>DNA
＜213〉synthetic
<400>8
tgagcaagtt gaatacccac tcaaaccaat ggttgaaaat gcaaagccaa cactccgtca 60
<210>9
<211>60
<212>DNA
＜213〉synthetic
<400>9
tttagtgctt cttatgttcc cgtcaggact ttacttaatt ttctagttgc ttcacaaggt 60
<210>10
<211>60
<212>DNA
＜213〉synthetic
<400>10
gcttctcagc tccacggata cgcgtaatag ggtcattgag gttgtagatc ctagcaatcc 60
<210>11
<211>60
<212>DNA
＜213〉synthetic
<400>11
gagttaatcc tttgccgaaa tttgattcta ccgtgtgggt gacagttcgt aaagttcctg 60
<210>12
<211>60
<212>DNA
＜213〉synthetic
<400>12
ccgtgggtct tattatggta aaaggttgct gcttcctgat tcagtcactg agttcgataa 60
<210>13
<211>60
<212>DNA
＜213〉synthetic
<400>13
ggctatggct ggtggtgatg tgttattgga tgagtatctc tatgatgtgg tcaatggaca 60
<210>14
<211>60
<212>DNA
＜213〉synthetic
<400>14
tgtgattgcc aagctagact ggtcaattgt caatgagaaa tgtgagccca ccatttacca 60
<210>15
<211>60
<212>DNA
＜213〉synthetic
<400>15
caatggcctg cctactccca gtttgctcag tctaaatcct agtaaccagt acctgttccc 60
<210>16
<211>60
<212>DNA
＜213〉synthetic
<400>16
accaaatcgg tgtctacggc tgtgtatgaa agttgtgcca tcgacctccc tattgacgat 60
<210>17
<211>60
<212>DNA
＜213〉synthetic
<400>17
ctcggtcaac tgtatgctca aggactctgt tctttacaca gattgcccaa agctcctggc 60
<210>18
<211>60
<212>DNA
＜213〉synthetic
<400>18
catggcaagc tccgcttgtc ctcccccctc ctccaagcca attaactctc tctccctcag 60
<210>19
<211>60
<212>DNA
＜213〉synthetic
<400>19
aaacaagaag aaaccgtata tgccacgata cggacggcta cgaggcttga acgatatggg 60
<210>20
<211>60
<212>DNA
＜213〉synthetic
<400>20
agaggcgcac aatcaaatga aggcagctgc tctagtggga acacagaaca gactgtttgg 60
<210>21
<211>60
<212>DNA
＜213〉synthetic
<400>21
aatggtgtct acggactcat taaaggtttc gatgtgaatg cgcctgtggc gcctaatccc 60
<210>22
<211>60
<212>DNA
＜213〉synthetic
<400>22
acgttccggt gtggttttgt actcagtacc tccaacactc gatgcccaag agagttgagg 60
<210>23
<211>60
<212>DNA
＜213〉synthetic
<400>23
tggaatgagg ttctgagaag gttgatggat ctcaagttcg ctctgcaagc ggaccgtgac 60
<210>24
<211>60
<212>DNA
＜213〉synthetic
<400>24
ttcaaggtag ttcgcaagct actgtggtta gaccgcccag agagtcggat tcggcttttg 60
<210>25
<211>60
<212>DNA
＜213〉synthetic
<400>25
tttgagccac tgatgggtaa gtatgacaag agcagattga acaaagcagc cttcacgaag 60
<210>26
<211>60
<212>DNA
＜213〉synthetic
<400>26
aagtttcatg gaagaatggg acattggcga aagaatgctc agaaatttat acacagaaat 60
<210>27
<211>60
<212>DNA
＜213〉synthetic
<400>27
aattgaacat gccactagcg tgttgagcca ggtgtctaat ttaggtagaa ctcatttcta 60
<210>28
<211>60
<212>DNA
＜213〉synthetic
<400>28
tataattgta gcgttgcaga cagtgaacgg cgaagggcgg gcaagacgat taggtccgag 60
<210>29
<211>60
<212>DNA
＜213〉synthetic
<400>29
ctcaacagag ggctgtgaat aacccgaata gaaacccgaa tagggcttcg agtggtatcg 60
<210>30
<211>60
<212>DNA
＜213〉synthetic
<400>30
gattgggatg gtggaggact ataaggtgga acaacctgat ggtccgaatg ccctgtctag 60
<210>31
<211>60
<212>DNA
＜213〉synthetic
<400>31
acatgccaag gtatggaatt cagcgcaacc tgacagacta cagcctcgcc agatatgcct 60
<210>32
<211>60
<212>DNA
＜213〉synthetic
<400>32
tttggcttgg atggaaacgt cggaacacaa gaagaggaca cagagagaca caccgctggt 60
<210>33
<211>60
<212>DNA
＜213〉synthetic
<400>33
tccactgttt gggtgacgct cagaaaattg cctcctggct actccctggc ttcggaaaat 60
<210>34
<211>60
<212>DNA
＜213〉synthetic
<400>34
gctcttcaca gatggtaatg cagcagtgct tatctatcaa cacgtctcga ccggtattca 60
<210>35
<211>60
<212>DNA
＜213〉synthetic
<400>35
tggactggac ggaaatgtca caacttcaga agaggacaca gaaaggcaca cagcaacgga 60
<210>36
<211>60
<212>DNA
＜213〉synthetic
<400>36
actgctggga ctcattcagt accacgctta aaatcaatga catcaaaact gacactacca 60
<210>37
<211>60
<212>DNA
＜213〉synthetic
<400>37
tctatgagat cacatcccgc acatccgtcc gagcacgaga ggctcacatc cagatgaagg 60
<210>38
<211>60
<212>DNA
＜213〉synthetic
<400>38
tacatgccac ggtatggttt ggtgagaaat ttgcgggata tgagtttggc tcgatatgca 60
<210>39
<211>60
<212>DNA
＜213〉synthetic
<400>39
gcgcaactcc tgccacagct tcaggactgt tcaccatccc ggatggggat ttctttagta 60
<210>40
<211>60
<212>DNA
＜213〉synthetic
<400>40
ttgccagcct agatgcagct gtcactcgag gtcgtatcac tggaacaaca accgctgagg 60
<210>41
<211>60
<212>DNA
＜213〉synthetic
<400>41
tcgacttttc gggttggacg gtggcatcag tacacaagag gagaacacag agaggcacac 60
<210>42
<211>60
<212>DNA
＜213〉synthetic
<400>42
aaaccaaccc ttaggcaaat catggcacat ttctcagatg ttgcagaagc gtatatagaa 60
<210>43
<211>60
<212>DNA
＜213〉synthetic
<400>43
accgttctgt ggggagtgcc tggttccgtg ttactaatat ccttgatgat aacttggtgt 60
<210>44
<211>60
<212>DNA
＜213〉synthetic
<400>44
cgggccaggc taatggaaag ccattcatta tagtgcacaa acttggtgga attgttgggc 60
<210>45
<211>60
<212>DNA
＜213〉synthetic
<400>45
acaatgcggt ctcccattag tagatgtcaa gagtaagcac atagttggaa tacacagtct 60
<210>46
<211>60
<212>DNA
＜213〉synthetic
<400>46
tgaccaataa caatatagca ggcttcccag agtatgaggg tacacttcgg caaacaggag 60
<210>47
<211>60
<212>DNA
＜213〉synthetic
<400>47
ggattaacca ggcatcctcc caggttttac cgggtttagt tctggcactt agaataagct 60
<210>48
<211>60
<212>DNA
＜213〉synthetic
<400>48
agctgtaagt aagcagccgc tagtgttctg gatttccagg catagtgaga atcagtggca 60
<210>49
<211>60
<212>DNA
＜213〉synthetic
<400>49
tgcaagatag caatgagagg gccgctatag atttgattcg cacccatgtc attagaggca 60
<210>50
<211>60
<212>DNA
＜213〉synthetic
<400>50
agcagcttgg aacttataat ccaatctgga tggttcgcac gcccttagaa agtacagccc 60
<210>51
<211>60
<212>DNA
＜213〉synthetic
<400>51
ggaagccgac gtccacgtcg tggtcgtcgt aataataaca acaacaactc gactgctcgt 60
<210>52
<211>60
<212>DNA
＜213〉synthetic
<400>52
tcgtgcaggt tatacttaca cttcgttgga tgttcgaccg actagaactg agaaggacaa 60
<210>53
<211>60
<212>DNA
＜213〉synthetic
<400>53
ttgtgtcggg aaataaatta caaccagcat tttgcttggt ttatgcttga gcatctcgat 60
<210>54
<211>60
<212>DNA
＜213〉synthetic
<400>54
tgggccgggc ttctgcaaac caacgctcta tattgtagtg gcttcagaat ttcaacttgc 60
<210>55
<211>60
<212>DNA
＜213〉synthetic
<400>55
cctggatacc tcctggtgtc taggactgcc actgtattga caatgacatt ccgtgctaca 60
<210>56
<211>60
<212>DNA
＜213〉synthetic
<400>56
gtttgtcata tccgggacgt atcggtgcct cacggcaaca acgttaggct tggctggcgg 60
<210>57
<211>60
<212>DNA
＜213〉synthetic
<400>57
tttcaaacac aacaagctcg aactgtcgtt caaagacaat tcagtgaggt gtggaaacct 60
<210>58
<211>60
<212>DNA
＜213〉synthetic
<400>58
cgacactaga aatagaataa tagaagttga aaatcaggcg aaccccacga ctgccgaaac 60
<210>59
<211>60
<212>DNA
＜213〉synthetic
<400>59
ctttgcttat tggtatggat gttccgaagg atgagagact caaaccgtct aaggtgttgg 60
<210>60
<211>60
<212>DNA
＜213〉synthetic
<400>60
ccaacacctt agacggtttg agtctctcat ccttcggaac atccatacca ataagcaaag 60
<210>61
<211>60
<212>DNA
＜213〉synthetic
<400>61
cactggctgg cattatggtg aggtggatct ctgcatttct tggtcaaggt ctaaacaggc 60
<210>62
<211>60
<212>DNA
＜213〉synthetic
<400>62
tacaactgaa gaaggatttg gtagacttgg cattctccct ctttctggtc ccatagctcc 60
<210>63
<211>60
<212>DNA
＜213〉synthetic
<400>63
acacaacggt tacgacgaac caagggagta ctactactac caaggcgaac actggctcga 60
<210>64
<211>60
<212>DNA
＜213〉synthetic
<400>64
cgcttctact gcgtatcata aagctctctc ctatttggaa ggtttaaatt tgaaaccgtt 60
<210>65
<211>60
<212>DNA
＜213〉synthetic
<400>65
cctcacagac tttgcatcat caagaggtaa tccataggct tgaatcaaag ggtgggaagc 60
<210>66
<211>60
<212>DNA
＜213〉synthetic
<400>66
aaattaccat aaagaaaact tcagacagga ttggagccac tgacatgacc ttcagaaggc 60
<210>67
<211>60
<212>DNA
＜213〉synthetic
<400>67
tcgctgatgt tggcgcttct tctaagtctg aacttactgg tgactctgct gctcttgcgg 60
<210>68
<211>60
<212>DNA
＜213〉synthetic
<400>68
ccacgggtta agtttaccat ctaattgaaa accaatggca accaccacag caaccactcc 60
<210>69
<211>60
<212>DNA
＜213〉synthetic
<400>69
tgccgatgta attctaatat ttaccgcttt atatgatgtc tttagatttc ccgagtgggc 60
<210>70
<211>60
<212>DNA
＜213〉synthetic
<400>70
tctgggtcat gatggatggg aatgagcagg ttgagtatcc tttgaaacca atagttgaaa 60
<210>71
<211>60
<212>DNA
＜213〉synthetic
<400>71
cggctagact ggacttaact ctgtcatata gagacatggt cacatcactc agttatagtc 60
<210>72
<211>60
<212>DNA
＜213〉synthetic
<400>72
ggctctgacg cgatatacgg ttgtgccgag tgtcaatagt ttcaaatgag gtagcagact 60
<210>73
<211>60
<212>DNA
＜213〉synthetic
<400>73
ccggcgacgc atcattcaaa tttctgccct atcaactttc gatggtagga tagtggccta 60
<210>74
<211>60
<212>DNA
＜213〉synthetic
<400>74
atactggcaa agtggcgcgt agcacgataa cgaaacatgg accgcgctta tactatagtc 60
<210>75
<211>60
<212>DNA
＜213〉synthetic
<400>75
caaacattga aacgctgaac tgcaagtacc aactgttgtg cccgctccga tgggatagtc 60
<210>76
<211>60
<212>DNA
＜213〉synthetic
<400>76
gactatccca tcggagcggg cacaacagtt ggtacttgca gttcagcgtt tcaatgtttg 60
<210>77
<211>37
<212>DNA
＜213〉synthetic
<400>77
cacgaggagt ctgctacatg ataactcgac ggatcgc 37
<210>78
<211>37
<212>DNA
＜213〉synthetic
<400>78
cacgaggagt ctgctacctt ggatgtggta gccgttt 37
<210>79
<211>184
<212>DNA
＜213〉synthetic
<400>79
cacgaggagt ctgctacccg agaaaccata ttcagagcga atcatctgtg agccgtttca 60
gttggttggt ctcaaaagcc cttcctgccc agagtgatct cactcgtcga ggccatcggc 120
tctgacgcga tatacggttg tgccgagtgt caatagtttc aaatgaggta gcagactcct 180
cgtg 184
<210>80
<211>17
<212>DNA
＜213〉synthetic
<400>80
cacgaggagt ctgctac 17
<210>81
<211>39
<212>DNA
＜213〉synthetic
<400>81
cacgaggagt ctgctaccgg agttcctgga cctgatggt 39
<210>82
<211>42
<212>DNA
＜213〉synthetic
<400>82
cacgaggagt ctgctaccgc ctcattttca ctttttgcaa at 42
<210>83
<211>44
<212>DNA
＜213〉synthetic
<400>83
cacgaggagt ctgctacttt tgtctcactg atgacgtgac gact 44
<210>84
<211>40
<212>DNA
＜213〉synthetic
<400>84
cacgaggagt ctgctacagg gctacggcat aggaatgctt 40
<210>85
<211>51
<212>DNA
＜213〉synthetic
<400>85
cacgaggagt ctgctacgat atttcctcta ctactagcac tgtagccctt g 51
<210>86
<211>45
<212>DNA
＜213〉synthetic
<400>86
cacgaggagt ctgctacgtg atggtaacac caccagaact ctttc 45
<210>87
<211>41
<212>DNA
＜213〉synthetic
<400>87
cacgaggagt ctgctacgca gggaggggtc agtaaacaac a 41
<210>88
<211>43
<212>DNA
＜213〉synthetic
<400>88
cacgaggagt ctgctacctg catctgagaa atggtgcatg att 43
<210>89
<211>45
<212>DNA
＜213〉synthetic
<400>89
cacgaggagt ctgctacgtt tagtgcttct tatgttcccg tcagg 45
<210>90
<211>45
<212>DNA
＜213〉synthetic
<400>90
cacgaggagt ctgctactca gcagtcgtag gattgctagg atcta 45
<210>91
<211>42
<212>DNA
＜213〉synthetic
<400>91
cacgaggagt ctgctactaa cccttaagcc tccgaaaata ga 42
<210>92
<211>42
<212>DNA
＜213〉synthetic
<400>92
cacgaggagt ctgctacggc aaaggattaa ctcgaatttg aa 42
<210>93
<211>43
<212>DNA
＜213〉synthetic
<400>93
cacgaggagt ctgctacagt tcgtggttct ttgcttgaca caa 43
<210>94
<211>44
<212>DNA
＜213〉synthetic
<400>94
cacgaggagt ctgctacggt aaccaattct gacaatcagc caag 44
<210>95
<211>41
<212>DNA
＜213〉synthetic
<400>95
cacgaggagt ctgctactac ctcgtccagc tttgtggtga a 41
<210>96
<211>43
<212>DNA
＜213〉synthetic
<400>96
cacgaggagt ctgctacgtc ggtatccctt acaaacctcc aga 43
<210>97
<211>39
<212>DNA
＜213〉synthetic
<400>97
cacgaggagt ctgctaccct ctccccatga actcggtca 39
<210>98
<211>40
<212>DNA
＜213〉synthetic
<400>98
cacgaggagt ctgctacggt ggtggctgag ggagagagag 40
<210>99
<211>46
<212>DNA
＜213〉synthetic
<400>99
cacgaggagt ctgctacatg agaaacaaga agaaaccgta tatgcc 46
<210>100
<211>45
<212>DNA
＜213〉synthetic
<400>100
cacgaggagt ctgctactcc attccaaaca gtctgttctg tgttc 45
<210>101
<211>48
<212>DNA
＜213〉synthetic
<400>101
cacgaggagt ctgctacttt ctaatggtgt ctacggactc attaaagg 48
<210>102
<211>44
<212>DNA
＜213〉synthetic
<400>102
cacgaggagt ctgctacact gaatcaggga cctcaactct cttg 44
<210>103
<211>40
<212>DNA
＜213〉synthetic
<400>103
cacgaggagt ctgctacgtg cttgggtcga agtgggaaat 40
<210>104
<211>44
<212>DNA
＜213〉synthetic
<400>104
cacgaggagt ctgctacatt tcccaaaaga gaaattgtct tcgg 44
<210>105
<211>37
<212>DNA
＜213〉synthetic
<400>105
cacgaggagt ctgctacagc acacgatgaa gcgaagc 37
<210>106
<211>47
<212>DNA
＜213〉synthetic
<400>106
cacgaggagt ctgctaccat aagcgtatta tctacaacag ttgatgg 47
<210>107
<211>41
<212>DNA
＜213〉synthetic
<400>107
cacgaggagt ctgctacact ggcgcgaagc taggttaaac a 41
<210>108
<211>41
<212>DNA
＜213〉synthetic
<400>108
cacgaggagt ctgctacgcg agttgatgtg ccacattcag a 41
<210>109
<211>39
<212>DNA
＜213〉synthetic
<400>109
cacgaggagt ctgctacaat ggagctctgg tcccactca 39
<210>110
<211>40
<212>DNA
＜213〉synthetic
<400>110
cacgaggagt ctgctactca agaacccctt cctagacagg 40
<210>111
<211>44
<212>DNA
＜213〉synthetic
<400>111
cacgaggagt ctgctacaaa gcatacatgc caaggtatgg aatt 44
<210>112
<211>43
<212>DNA
＜213〉synthetic
<400>112
cacgaggagt ctgctacgag gttgtgcatg ttgcgattaa cat 43
<210>113
<211>40
<212>DNA
＜213〉synthetic
<400>113
cacgaggagt ctgctacccg aagaagaagg tctctcgcgt 40
<210>114
<211>47
<212>DNA
＜213〉synthetic
<400>114
cacgaggagt ctgctactat agaatcttgt tatcgcgttg aataccg 47
<210>115
<211>43
<212>DNA
＜213〉synthetic
<400>115
cacgaggagt ctgctacagc tcttcacaga tggtaatgca gca 43
<210>116
<211>41
<212>DNA
＜213〉synthetic
<400>116
cacgaggagt ctgctactcc aacagaagcc aaatcgaagg t 41
<210>117
<211>43
<212>DNA
＜213〉synthetic
<400>117
cacgaggagt ctgctacgtg atcgaaaatg cgaagcctac ttt 43
<210>118
<211>41
<212>DNA
＜213〉synthetic
<400>118
cacgaggagt ctgctacgcc ttcatctgga tgtgagcctc t 41
<210>119
<211>45
<212>DNA
＜213〉synthetic
<400>119
cacgaggagt ctgctacgat gtcgatttag gtactgctgg gactc 45
<210>120
<211>41
<212>DNA
＜213〉synthetic
<400>120
cacgaggagt ctgctacgtt gcgattaaca tccgttgctg t 41
<210>121
<211>39
<212>DNA
＜213〉synthetic
<400>121
cacgaggagt ctgctacaaa actgcaggcg caactcctg 39
<210>122
<211>41
<212>DNA
＜213〉synthetic
<400>122
cacgaggagt ctgctacaga gtgacaacag cctcagcggt t 41
<210>123
<211>41
<212>DNA
＜213〉synthetic
<400>123
cacgaggagt ctgctacaat gcaaaaccaa cccttaggca a 41
<210>124
<211>39
<212>DNA
＜213〉synthetic
<400>124
cacgaggagt ctgctacaca tcctcggtgg tgtgcctct 39
<210>125
<211>41
<212>DNA
＜213〉synthetic
<400>125
cacgaggagt ctgctactgg tcccaaggat tctgttggaa c 41
<210>126
<211>43
<212>DNA
＜213〉synthetic
<400>126
cacgaggagt ctgctacgca accatatctt caattctacc cgg 43
<210>127
<211>40
<212>DNA
＜213〉synthetic
<400>127
cacgaggagt ctgctacggt gagaatccca cctttacggg 40
<210>128
<211>41
<212>DNA
＜213〉synthetic
<400>128
cacgaggagt ctgctaccaa acgtcccaac tgagtccttg g 41
<210>129
<211>45
<212>DNA
＜213〉synthetic
<400>129
cacgaggagt ctgctaccaa taccaaaggt aaatcttcac aattg 45
<210>130
<211>45
<212>DNA
＜213〉synthetic
<400>130
cacgaggagt ctgctaccac tagttgatgc aagactgtgt attcc 45
<210>131
<211>48
<212>DNA
＜213〉synthetic
<400>131
cacgaggagt ctgctacggt tattaggtaa gctgtaagta agcagccg 48
<210>132
<211>47
<212>DNA
＜213〉synthetic
<400>132
cacgaggagt ctgctacagc ttattctaag tgccagaact aaacccg 47
<210>133
<211>41
<212>DNA
＜213〉synthetic
<400>133
cacgaggagt ctgctacttg caagatagca atgagagggc c 41
<210>134
<211>41
<212>DNA
＜213〉synthetic
<400>134
cacgaggagt ctgctacggg ctgtactttc taagggcgtg c 41
<210>135
<211>40
<212>DNA
＜213〉synthetic
<400>135
cacgaggagt ctgctaccaa aacggtacgg gaggaggaag 40
<210>136
<211>46
<212>DNA
＜213〉synthetic
<400>136
cacgaggagt ctgctacaat taacctttga ccgaaactct tgtcct 46
<210>137
<211>41
<212>DNA
＜213〉synthetic
<400>137
cacgaggagt ctgctactca taagatgtgt gggcaaacgc t 41
<210>138
<211>47
<212>DNA
＜213〉synthetic
<400>138
cacgaggagt ctgctaccca gtagtatttg tatcgagatg ctcaagc 47
<210>139
<211>40
<212>DNA
＜213〉synthetic
<400>139
cacgaggagt ctgctacctg gcgctcttgt cacagcatct 40
<210>140
<211>49
<212>DNA
＜213〉synthetic
<400>140
cacgaggagt ctgctaccta caactgtgat actattgaca ttcactccg 49
<210>141
<211>49
<212>DNA
＜213〉synthetic
<400>141
cacgaggagt ctgctacatg tcttacagta tcactactcc atctcagtt 49
<210>142
<211>45
<212>DNA
＜213〉synthetic
<400>142
cacgaggagt ctgctacggt tcgcctgatt ttcaacttct attat 45
<210>143
<211>39
<212>DNA
＜213〉synthetic
<400>143
cacgaggagt ctgctacgac gaagttatca atggcagcg 39
<210>144
<211>37
<212>DNA
＜213〉synthetic
<400>144
cacgaggagt ctgctactcc gtccaatcac gcgaata 37
<210>145
<211>40
<212>DNA
＜213〉synthetic
<400>145
cacgaggagt ctgctacatg tgtgctgtga cggttgttcc 40
<210>146
<211>41
<212>DNA
＜213〉synthetic
<400>146
cacgaggagt ctgctacaaa caaagtggcg gagcgacccc a 41
<210>147
<211>39
<212>DNA
＜213〉synthetic
<400>147
cacgaggagt ctgctactcc tgcgaatcca aacacaacg 39
<210>148
<211>42
<212>DNA
＜213〉synthetic
<400>148
cacgaggagt ctgctaccaa gtcttcttcc aaagtcgagc ca 42
<210>149
<211>43
<212>DNA
＜213〉synthetic
<400>149
cacgaggagt ctgctacttc gatgacgctt ctactgcgta tca 43
<210>150
<211>51
<212>DNA
＜213〉synthetic
<400>150
cacgaggagt ctgctacctg tctcctatat aacggtttca aatttaaacc t 51
<210>151
<211>43
<212>DNA
＜213〉synthetic
<400>151
cacgaggagt ctgctacagc attatggcaa gcctcacaga ctt 43
<210>152
<211>53
<212>DNA
＜213〉synthetic
<400>152
cacgaggagt ctgctacctg agaatctcaa tactatcaaa tctaagattg ctt 53
<210>153
<211>50
<212>DNA
＜213〉synthetic
<400>153
cacgaggagt ctgctacagc aaagtgattt tacttttggt aaaattacca 50
<210>154
<211>44
<212>DNA
＜213〉synthetic
<400>154
cacgaggagt ctgctactca agctatcaag ccttctgaag gtca 44
<210>155
<211>49
<212>DNA
＜213〉synthetic
<400>155
cacgaggagt ctgctacggc gtgtatcttc tagtcttcat tgtgtactt 49
<210>156
<211>38
<212>DNA
＜213〉synthetic
<400>156
cacgaggagt ctgctactga aacacccgca agagcagc 38
<210>157
<211>41
<212>DNA
＜213〉synthetic
<400>157
cacgaggagt ctgctaccga ccatttgctg gagtataagc c 41
<210>158
<211>40
<212>DNA
＜213〉synthetic
<400>158
cacgaggagt ctgctacaac ttcacgcttt aaaggtggga 40
Claims (16)
1. a genetic chip that detects solanaceae plant virus is fixed with some probes and Quality Control contrast at surface of solid phase carriers, and wherein: probe is selected from the combination in any that has in the nucleotide sequence shown in sequence table SEQ ID No.1 to the SEQ ID No.70; The Quality Control contrast is made up of surface chemistry contrast, fluorescence labeling contrast, positive control, negative control, hybridization contrast and blank: the surface chemistry contrast, preferably has the nucleotide sequence shown in the sequence table SEQ ID No.71, its 5 ' end is amido modified, and 3 ' end Cy3 or Cy5 modify; The fluorescence labeling contrast preferably has the nucleotide sequence shown in the sequence table SEQ ID No.72, and 5 ' end is amido modified; Positive control preferably has the nucleotide sequence shown in the sequence table SEQ ID No.73, and 5 ' end is amido modified; Negative control preferably has the nucleotide sequence shown in the sequence table SEQ ID No.74, and 5 ' end is amido modified; The hybridization contrast preferably has the sequence shown in the sequence table SEQ ID No.75, and 5 ' end is amido modified; Blank is the point sample damping fluid.
2. a kind of genetic chip that detects solanaceae plant virus according to claim 1, it is characterized in that: described solid phase carrier is selected from nitrocellulose filter, nylon membrane, polystyrene or microslide.
3. a kind of genetic chip that detects solanaceae plant virus according to claim 1 and 2 is characterized in that: every probe of described chip laterally repeats 2 points, and the amount of every probe is 0.002-0.02pmol, the about 180 μ m of spot diameter, dot spacing 300 μ m.
4. a kind of genetic chip that detects solanaceae plant virus according to claim 1 and 2 is characterized in that: every of described chip has 4 same matrix, and the probe arrangement mode is each matrix 15 row 10 row.
5. lineup worker synthesizes the primer sequence that detects solanaceae plant virus, the combination with one or more sequences in the sequence shown in sequence table SEQ ID No.1 to the SEQ IDNo.158.
6. kit that can directly apply to the solanaceae plant virus of quarantine, form by following component: wherein genetic chip, chip cover plate and chip hybridization box room temperature storage, other reagent needs-20 ℃ of storages;
(1) genetic chip, chip cover plate and chip hybridization box: wherein the surface of solid phase carriers of genetic chip is fixed with some probes and Quality Control contrast, and probe is selected from the combination in any that has in the nucleotide sequence shown in sequence table SEQ ID No.1 to the SEQ ID No.70; The Quality Control contrast is made up of surface chemistry contrast, fluorescence labeling contrast, positive control, negative control, hybridization contrast and blank;
(2) DEPC water;
(3) reverse transcription reagent;
(4) reverse transcriptase;
(5) RNA enzyme inhibitor;
(6) PCR enzyme;
(7) 35 kinds of virus PCR primers and reagent: every kind of 423ul-846ul comprises: apple chlorotic leaf spot virus PCR reagent, alfalfa mosaic virus PCR reagent, arabis mosaic virus PCR reagent, black eye cowpea mosaic virus PCR reagent, cucumber green mottle virus PCR reagent, cucumber mosaic virus PCR reagent, cowpea mosaic virus PCR reagent, dianthovirus PCR reagent, eggplant mosaic virus PCR reagent, lactuca virus 1 PCR reagent, Lee's dwarf virus PCR reagent, pea early browning virus PCR reagent, white showy flowers of herbaceous plants mosaic virus PCR reagent, potato mop-top virus PCR reagent, Prunus necrotic ring spot virus PCR reagent, plumpox virus PCR reagent, peanut stunt virus PCR reagent, marmor solani PCR reagent, potato V virus PCR reagent, potato virus X PCR reagent, marmor upsilon PCR reagent, raspberry ring spot virus PCR reagent, corn mosaic virus PCR reagent, strawberry obscure ring spot virus PCR reagent, pumpkin mosaic virus PCR reagent, tomato aspermy virus PCR reagent, tomato black ring virus PCR reagent, tomato bushy stunt virus PCR reagent, tobacco mosaic virus (TMV) PCR reagent, annulus zonatus PCR reagent, nepovirus PCR reagent, Tobacco rattle virus PCR reagent, tomato spotted wilf virus PCR reagent, clover white mosaic virus PCR reagent, little cucurbita pepo mosaic virus PCR reagent;
(8) positive control PCR primer and reagent;
(9) mark contrast;
(10) mark PCR primer and reagent;
(11) hybridization contrast;
(12) 2x hybridization buffer.
7. a kind of kit that directly applies to the solanaceae plant virus of quarantine according to claim 6 is characterized in that: the specification of described (1) genetic chip is 25mm * 75mm, every box 10-20 sheet.
8. a kind of kit that directly applies to the solanaceae plant virus of quarantine according to claim 6 is characterized in that: the solid phase carrier of described (1) genetic chip is selected from nitrocellulose filter, nylon membrane, polystyrene or microslide.
9. a kind of kit that directly applies to the solanaceae plant virus of quarantine according to claim 6, it is characterized in that: the surface chemistry contrast of described (1) genetic chip, preferably has the nucleotide sequence shown in the sequence table SEQ ID No.71, its 5 ' end is amido modified, and 3 ' end Cy3 or Cy5 modify; The fluorescence labeling contrast preferably has the nucleotide sequence shown in the sequence table SEQ ID No.72, and 5 ' end is amido modified; Positive control preferably has the nucleotide sequence shown in the sequence table SEQ IDNo.73, and 5 ' end is amido modified; Negative control preferably has the nucleotide sequence shown in the sequence table SEQ ID No.74, and 5 ' end is amido modified; The hybridization contrast preferably has the sequence shown in the sequence table SEQ ID No.75, and 5 ' end is amido modified; Blank is the point sample damping fluid.
10. a kind of kit that directly applies to the solanaceae plant virus of quarantine according to claim 6, it is characterized in that: every probe of described (1) genetic chip laterally repeats 2 points, the amount of every probe is 0.002-0.02pmol, the about 180 μ m of spot diameter, dot spacing 300 μ m.
11. a kind of kit that directly applies to the solanaceae plant virus of quarantine according to claim 6 is characterized in that: every of described (1) genetic chip has 4 same matrix, and the probe arrangement mode is each matrix 15 row 10 row.
12. according to any one described a kind of kit that directly applies to the solanaceae plant virus of quarantine among the claim 6-11, it is characterized in that: the solanaceae plant virus in described (7) 35 kinds of virus PCR reagent detects primer sequence and has the nucleotide sequence shown in sequence table SEQ ID No:81 to the SEQ ID No:158.
13. according to any one described a kind of kit that directly applies to the solanaceae plant virus of quarantine in the claim 6 to 11, it is characterized in that: the primer sequence of described (8) positive control PCR reagent has the nucleotide sequence shown in sequence table SEQ IDNo:77 and the SEQ ID No:78.
14. according to any one described a kind of kit that directly applies to the solanaceae plant virus of quarantine in the claim 6 to 11, it is characterized in that: described (9) mark contrast template sequence has the nucleotide sequence shown in the sequence table SEQ ID No:79.
15. according to any one described a kind of kit that directly applies to the solanaceae plant virus of quarantine in the claim 6 to 11, it is characterized in that: the labeled primer sequence of described (10) mark PCR reagent has the sequence shown in the sequence table SEQ ID No:80.
16. according to any one described a kind of kit that directly applies to the solanaceae plant virus of quarantine in the claim 6 to 11, it is characterized in that: the sequence of described (11) hybridization contrast has the sequence shown in the sequence table SEQ ID No:76.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610081221 CN100580430C (en) | 2005-10-19 | 2006-05-25 | Gene chip, nucleotide sequence and kit for detecting virus of potato family plant |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200510109388.X | 2005-10-19 | ||
| CN200510109388 | 2005-10-19 | ||
| CN 200610081221 CN100580430C (en) | 2005-10-19 | 2006-05-25 | Gene chip, nucleotide sequence and kit for detecting virus of potato family plant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1952649A true CN1952649A (en) | 2007-04-25 |
| CN100580430C CN100580430C (en) | 2010-01-13 |
Family
ID=38059091
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610081221 Expired - Fee Related CN100580430C (en) | 2005-10-19 | 2006-05-25 | Gene chip, nucleotide sequence and kit for detecting virus of potato family plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100580430C (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102239410A (en) * | 2008-12-03 | 2011-11-09 | 霍夫曼-拉罗奇有限公司 | Test element having combined control and calibration zone |
| CN103031387A (en) * | 2012-12-28 | 2013-04-10 | 中国农业大学 | Method and special primer for simultaneously detecting cherry whether to be infected by apple chlorotic leaf spot virus and prunus necrotic ringspot virus |
| CN103667529A (en) * | 2013-12-03 | 2014-03-26 | 中国检验检疫科学研究院 | Liquid phase chip detection primer of tomato spotted wilt virus, and detection method thereof |
| CN105039594A (en) * | 2015-07-24 | 2015-11-11 | 湖南农业大学 | Triple RT-PCR method capable of detecting three viruses causing potato tuber necrosis simultaneously and primer combination thereof |
| CN105525037A (en) * | 2015-07-24 | 2016-04-27 | 湖南农业大学 | Nested RT-PCR method and primer combination for detecting potato mop-top virus |
| CN111118220A (en) * | 2020-02-24 | 2020-05-08 | 宁波检验检疫科学技术研究院 | Primer group for rapid detection of tobacco brittle fracture virus and rapid detection method thereof |
| CN114480740A (en) * | 2022-02-18 | 2022-05-13 | 杭州柏熠科技有限公司 | Target sequencing library construction and detection method suitable for 15 plant quarantine viruses |
-
2006
- 2006-05-25 CN CN 200610081221 patent/CN100580430C/en not_active Expired - Fee Related
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102239410A (en) * | 2008-12-03 | 2011-11-09 | 霍夫曼-拉罗奇有限公司 | Test element having combined control and calibration zone |
| CN102239410B (en) * | 2008-12-03 | 2015-05-20 | 霍夫曼-拉罗奇有限公司 | Test element having combined control and calibration zone |
| CN103031387A (en) * | 2012-12-28 | 2013-04-10 | 中国农业大学 | Method and special primer for simultaneously detecting cherry whether to be infected by apple chlorotic leaf spot virus and prunus necrotic ringspot virus |
| CN103667529A (en) * | 2013-12-03 | 2014-03-26 | 中国检验检疫科学研究院 | Liquid phase chip detection primer of tomato spotted wilt virus, and detection method thereof |
| CN103667529B (en) * | 2013-12-03 | 2015-06-17 | 中国检验检疫科学研究院 | Liquid phase chip detection primer of tomato spotted wilt virus, and detection method thereof |
| CN105039594A (en) * | 2015-07-24 | 2015-11-11 | 湖南农业大学 | Triple RT-PCR method capable of detecting three viruses causing potato tuber necrosis simultaneously and primer combination thereof |
| CN105525037A (en) * | 2015-07-24 | 2016-04-27 | 湖南农业大学 | Nested RT-PCR method and primer combination for detecting potato mop-top virus |
| CN111118220A (en) * | 2020-02-24 | 2020-05-08 | 宁波检验检疫科学技术研究院 | Primer group for rapid detection of tobacco brittle fracture virus and rapid detection method thereof |
| CN114480740A (en) * | 2022-02-18 | 2022-05-13 | 杭州柏熠科技有限公司 | Target sequencing library construction and detection method suitable for 15 plant quarantine viruses |
| CN114480740B (en) * | 2022-02-18 | 2023-10-24 | 杭州柏熠科技有限公司 | Targeting sequencing library construction and detection method suitable for 15 plant quarantine viruses |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100580430C (en) | 2010-01-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100580429C (en) | Gene chip, nucleotide sequence and kit for detecting virus of leguminous plant | |
| US10591467B2 (en) | Method to identify disease resistant quantitative trait loci in soybean and compositions thereof | |
| CN100580430C (en) | Gene chip, nucleotide sequence and kit for detecting virus of potato family plant | |
| Lin et al. | Development of a polyprobe to detect six viroids of pome and stone fruit trees | |
| Tairo et al. | Potyvirus complexes in sweetpotato: Occurrence in Australia, serological and molecular resolution, and analysis of the Sweet potato virus 2 (SPV2) component | |
| CN101812512A (en) | Compound gene chip for detecting transgenic foods | |
| Vučurović et al. | Detection of four new tomato viruses in Serbia using post hoc high-throughput sequencing analysis of samples from a large-scale field survey | |
| Ebata et al. | Distribution of chrysanthemum chlorotic mottle viroid in shoot meristem and flower buds of chrysanthemum | |
| Singh et al. | Evaluation of NASH and RT-PCR for the detection of PVY in dormant tubers and its comparison with visual symptoms and ELISA in plants | |
| CN101712982A (en) | Primer pairs for detecting germs of paddy bacterial glume blight and detection method | |
| CN103060476A (en) | MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination | |
| CN101818211B (en) | Molecule detection method for cowpea severe mosaic virus | |
| Khurana et al. | Recent developments towards detection and diagnosis for management of plant viruses | |
| CN101857904B (en) | Multiple real-time fluorescence PCR (Polymerase Chain Reaction) detection method and kit of soybean quarantine virus diseases | |
| Barbarossa et al. | Sensitive and specific digoxigenin‐labelled RNA probes for routine detection of Citrus tristeza virus by dot‐blot hybridization | |
| CN104894125B (en) | A kind of RT LAMP kits and its primer special for detecting grape A viruses | |
| KR102212379B1 (en) | Primer set for simultaneous detection of three viruses in Grapevine and method for detecting three viruses in Grapevine using the same | |
| Li et al. | Molecular detection of Phytophthora cryptogea on Calendula officinalis and Gerbera jamesonii artificially inoculated with zoospores | |
| CN105177166A (en) | LAMP and PCR non-diagnostic detection method for lawsonia intracellularis | |
| Song et al. | Efficient detection of Leptosphaeria maculans from infected seed lots of oilseed rape | |
| Acheampong et al. | Is there avocado sunblotch viroid in Ghana? | |
| Sastry et al. | Detection of plant viruses in seeds | |
| Munguti | Lamp and Real-Time PCR for detection of passion fruit woodiness disease (PWD) Causal Viruses | |
| Torres et al. | Differential Expression Analysis of Cannabis sativa response to thermotherapy of Hops Latent Viroid (HLVd) infection and clearance of the viroid in Tissue Culture Micropropagation | |
| Aly et al. | Use of Protein electrophoresis to quantify resistance of cotton to Fusarium wilt disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100113 Termination date: 20180525 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |