CN1932520B

CN1932520B - Test paper bar for detecting praw white spot syndrome virus and producing process thereof

Info

Publication number: CN1932520B
Application number: CN2006101246540A
Authority: CN
Inventors: 孟小林; 徐进平; 程清宇; 鲁伟; 王健
Original assignee: Wuhan University WHU
Current assignee: HUBEI TAIYANGHONG BIOLOGICAL TECHNOLOGY CO., LTD.
Priority date: 2006-09-29
Filing date: 2006-09-29
Publication date: 2012-03-21
Anticipated expiration: 2026-09-29
Also published as: CN1932520A

Abstract

The invention discloses a kind of examination synthesizes disease virus to try note and makes a method to the shrimp white spot which is made up of the mat of PVC , sample mat, gold mark the antibody combining mat and absorbing mat, WSSV antibody solid mutually the nitric acid cellulose film examination layer constitute, then is WSSV, VP19, VP28 lenses pure egg white, anti-WSSV many gram antibodies, anti-WSSV gold mark the antibody, WSSV antibody is mutually solid the nitric acid cellulose film examination the making of the layer, the invention structure simple, making method easy, to shrimp spot comprehensive disease virus examination simple, fast and accurate.

Description

Detect test strips of WSSV and preparation method thereof

Technical field

The invention belongs to immunology and virology interleaving techniques field, more specifically relate to a kind of detection WSSV test strips, also relate to the preparation method of paper slip simultaneously.The present invention is mainly to the improvement of culture fishery disease cause of disease detection technique, mainly is to the on-the-spot test strips that detects of WSSV (WSSV, White Spot Syndrome Virus) and preparation thereof, method of application.

Background technology

Since the nineties, world many countries is popular with the main prawn culturing district prawn disease burst in area, and prawn output falls sharply, and has caused great economic loss, has seriously hindered the sustainable development of shrimp culture industry.In numerous prawn ' s virus, the harm of WSSV (WSSV) is the most serious, is the No.1 killer of shrimp culture industry.

Grow shrimp apocleisis can occur after infecting WSSV (WSSV), ingest and reduce or stop to ingest; It is blunt to take action, and it is unable to bounce, and reposes motionless or moves about unusual; To the last unable activity; Classical symptom is the white dot that the inboard 0.5～2mm of appearance of disease shrimp crust differs in size, and this course of disease is short, and mortality ratio is high.So far, prawn white spot syndrome does not also have effective methods of treatment, and therefore virus separation fast and accurately and virus detect diagnostic techniques has become one of focus of various countries' scholar's research.

Detection method for prawn ' s virus mainly comprises following several kinds at present:

1, observation method of naked eye

Observation method of naked eye is through understanding the dead situation of prawn acute and chronic in the breeding process, classical symptom such as is prone to peel off and judges in conjunction with whether occurring hickie, crust deliquescing occurring like carapace.This method can be at the scene in emergency circumstances and use when not having other diagnostic methods so that take the rush-harvest measure, reduce the loss, but accuracy is relatively poor, and needs rich experience.

2, traditional Histological method

From the shrimp pond, get prawn or prawn ight soil and directly do the wet sample inspection,, under light microscopic, detect in conjunction with TE or H-E decoration method.Illing tissue can be observed histocyte through histotomy and dyeing and has typical nuclear enlargement, and nuclear intrinsic color characteristic progressively transfers basophilous both sexes to by acidophilia and the change of catching an illness.Whole sample making course needs 1 optical microscope, and this method needs the operator to have more rich practical experience.

3, electron microscope technique

Since nineteen ninety-three, a lot of results of study about WSSV are to rely on the method for histopathology and electron microscope to obtain.These class methods can accurately be located the duplicating position of WSSV, disclose the characteristics of lesion of WSSV; Show and compare the virion of different WS SV separated strain and the size and form of nucleocapsid, confirmation WSSV's is pathogenic, confirms the host and the route of transmission of virus.The electron microscopic observation method is to detect the method for viral cause of disease the most intuitively, under Electronic Speculum, can observe directly the form and the size of virus.But the electron microscopic observation method has complicated operation, need strict experiment condition and shortcomings such as more superb experimental technique, sample preparation overlong time; Can not be used for the quick diagnosis of production practices WSSV and the detection of a large amount of samples, be only applicable to laboratory study.

4, enzyme linked immunosorbent assay (ELISA)

EUSA (ELISA) is a kind of solid-phase immunity zymotechnic according to the enzyme immunoassay (EIA) principle development, owing to have characteristics such as highly sensitive, easy and simple to handle, good reproducibility, is to use the widest immunological technique.For when being used to detect,, causing the false positive in the WSSV immune detection easily because the polyclonal antibody selectivity is not strong from the polyclonal antibody (antiserum) of the viral antigen of host tissue purifying preparation.Its preferred plan is the preparation high monoclonal antibody of tiring.The monoclonal antibody immunity of WSSV detects, and its specificity, sensitivity and repeatability improve greatly.Inst. of Hydrobiology, Chinese Academy of Sciences wear with equality patent--the diagnostic kit and the detection method (application number CN00131230.8) thereof of white spot syndrome baculovirus promptly are a kind of method for detecting virus based on the monoclonal antibody Enzyme-multiplied immune technique.But Enzyme-multiplied immune technique detects WSSV and must accomplish in the laboratory, and personnel and equipment are had than the highland requirement, and detection time is longer, is not suitable for on-the-spot quick diagnosis, is difficult to promote the use of in basic unit.

5, nucleic acid probe method

Thereby the nucleic acid fragment that can be detected that nucleic acid probe has been meant by certain material mark, it can combine, hybridize with nucleic acid to be detected specifically.So-called nucleic acid hybridization is exactly under the condition of DNA sex change, dna probe and the nucleic acid to be detected of mark to be coexisted as in the system, like this when renaturation the strand of dna probe just maybe with the stable double-spiral structure of strand complementation formation of DNA to be detected.Hybridization of method spottiness and in situ hybridization commonly used.

1) spot hybridization

Dot hybridization is the most frequently used a kind of gene tester more efficiently, having or not or strong and weak just can infer whether sample contains material to be checked according to point sample spot on the hybond membrane.Being about to a spot of test sample DNA is fixed on the nitrocellulose filter; Use label probe (like biotinylated probe) hybridization again; The hybridization back has only and in test sample, contains viral DNA through the chromogenic reaction colour developing, and the coloured district of point-like or wire could occur is positive findings.The Shi Chengyin of Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science etc. utilizes this kind method to detect WSSV; And applied for patent--prawn epidemic disease cause of disease detection kit and detection method thereof (application number CN00111336.4), and the Shi Zhengli of Wuhan Virology Institute,Chinan academy of Sciences etc. has also applied for patent--the method (application number CN03119088.X) that the hybridization of prawn ' s virus nucleic acid spot detects.Because more than infective virus cell, when therefore adopting the detected by dot blot hybridization sample whether to have viral nucleic acid, viral nucleic acid DNA is diluted by a large amount of nucleus DNA, makes the susceptibility that detects reduce greatly for the cell quantity of uninfecting virus.

2) in situ hybridization method

Hybridization in situ technique is applied to the latter stage sixties the earliest, because nucleic acid hybridization can carry out in the tissue of complicated component, those quantity of research that can be more convenient are few and be dispersed in DNA or RNA in the cell in tissue; And because in situ hybridization need be from tissue extraction nucleic acid; For the extremely low target sequence of content in the tissue high susceptibility is arranged; And the maintenance tissue that can be complete and the form of cell; More can accurately reflect histiocytic mutual relationship and functional status, can intuitively locate is cell type responsive to virus in target tissue and the target tissue of virus infections.But this method length consuming time, complex operation needs the professional and technical personnel, and is very high to requirement for experiment condition, and it is high to detect cost, is not suitable for using in basic unit.

6, PCR (PCR)

(Polymerase Chain Reaction PCR), is a patented technology of U.S. Cetus company in 1985, is described as revolutionary a breakthrough of the eighties biology field in the PCR.The principle of round pcr is according to the viral DNA sequence of having cloned, and design PCR primer utilizes this primer dna fragmentation of virus to be detected in the sample that directly increases then, thereby shows it through electrophoresis, dyeing.Compare with traditional diagnosis method, it has characteristics such as susceptibility and specificity be high, simple, quick.At present, round pcr has been widely used in the detection of WSSV, has all developed the PCR detection kit of commercial WSSV both at home and abroad.Some scholars have also done different improvement to round pcr, make testing result more fast, accurately.Patent--WSSV gene diagnosis kit and detection method (application number CN03114366.0) like Zhongshan University's He Jianguo etc.; Patent--the white spot syndrome baculovirus method for quick (application number CN97112049.8) of the Wang Wei of State Oceanic Administration Bureau The Third Oceanography Institute etc., the patent of the Shi Zhengli of Wuhan Virology Institute,Chinan academy of Sciences etc.--compound polymerize chain reaction-enzyme linked immunoassay detects the method (application number CN03125202.8) of prawn ' s virus.

The high sensitivity of PCR method is that other methods of inspection can't be equal to, but round pcr still has some problems to need to solve at present.Bad like the improper institute of the viral DNA leaching process sample quality that causes, can't carry out the PCR reaction effectively and the false negative result that causes; The false positive results that produces because of the sample cross staining or because of the pollution of PCR end-product; Because of the mistake at sample collecting position causes the failure of an experiment; Due to illness the poison sudden change and cause original design no longer can effectively detect gene order of mutated viruses or the like.And the complicated instrument and equipment of the detection of PCR and product thereof needs, be not suitable for detecting at the scene, be difficult to promote the use of in basic unit.

Above technology is grasped difficulty for vast shrimp farming very big, is difficult to promote, and limited these The Application of Technology and development.Therefore the detection method quick, accurate, easy, on-the-spot, non-false positive of developing a kind of WSSV of being applicable to just has important practical significance, in the hope of reaching early the purpose of finding, early preventing.

Immune colloidal gold technique is the solid phase labelling immunoassay that after three big labelling techniques (luciferin, radioactive isotope and enzyme), grows up the sixties.Initial this method only is used for immunoelectronmicroscopy, has developed into passive agglutination test, light microscopic dyeing, Western blotting, immunodotting percolation and immunochromatography technique etc. now.Colloidal gold immunity chromatography (GICA) is the determinand that utilizes the colour developing characteristics binding immunoassay chromatographic technique specificity of collaurum itself.The maximum characteristics of this method are single part of mensuration, simply quick, special sensitivity, do not need any instrument and equipment and reagent, and a few minutes are particularly suitable for vast grass-roots unit, hospital, field work personnel use with regard to available observation experiment result.Many fields such as medical science and animal medicine clinical diagnosis, forbidden drug detection, drug surveillance have been widely used at present; Permitted patent--fast test paper for AIDS virus and preparation method thereof (application number: CN01135100.4) of grade like Fei Lipu; The patent of Li Kesheng etc.--tuberculosis antibody gold label test strip and preparation method thereof (application number: CN01131834.1); The kit of the patent of Liu Jian etc.--a kind of fast detecting meth and preparation technology thereof (application number CN02145333.0); (application number: CN02101951.7), the patent of Li Junwen etc.--immunologic paper is analysed bar and with the method (application number: CN03142652.2) of pathogenic bacteria and toxin in its fast detecting food for the patent of Lin Xiang etc.--aflatoxin fast detecting apparatus and manufacturing approach thereof.

The colloidal gold immunity chromatography ultimate principle is a certain district band that special antibody or antigen is fixed in cellulose nitrate (NC) film earlier; After this dry cellulose nitrate one end immerses sample (urine or serum); Because capillarity; Sample will move forward along this film, and when moving to when being fixed with antibody or antigen regional, corresponding antigen or antibody promptly combine with this antibody or antigen generation specificity in the sample; Make this zone show certain color through colloidal gold-labeled method again, thereby realize specific immunodiagnosis.Difference according to employed colloid gold label thing can be divided into colloidal gold immunity chromatography variety classeses such as indirect method, competition law and double antibodies sandwich method.

Summary of the invention

The objective of the invention is to be to provide a kind of test strips that detects WSSV, easy to use, easy and simple to handle, detect quick, accurate.

Another object of the present invention is to be to provide the method for preparing the WSSV test strips, and is easy to implement the method, easy and simple to handle, with low cost, easy to use.

The objective of the invention is to realize by following technical scheme; Developed the on-the-spot test strip of a kind of WSSV; Comprise altogether: the PVC liner of appropriate size, the rabbit source anti-WSV VP19+VP28 polyclonal antibody IgG (being called for short golden labeling antibody) and the goat anti-rabbit igg of rabbit source anti-WSSV VP19+VP28 polyclonal antibody IgG (being called for short anti-WSSV antibody), colloid gold label.At the both ends of this PVC liner, be respectively equipped with sample pad and absorption pad; Be provided with the nitrocellulose membrane detection layers at this PVC liner middle part; At nitrocellulose membrane detection layers and sample pad intersection; Be provided with the pad that is loaded with golden labeling antibody, this pad one end parts is arranged under the sample pad, and its other end branch is arranged on this detection layers; With the detection layers of pad continuity on be provided with detection line and nature controlling line, this detection line and nature controlling line place are coated with anti-WSSV antibody and goat anti-rabbit igg respectively.

A kind of test strips that detects WSSV, it comprises the following steps:

A, described anti-WSSV antibody, its preparation method is following:

(1) expresses also WSSV VP 19, the VP28 of purifying with the gene engineering colibacillus bacterial strain,,, prepare anti-WSSV antiserum as the antigen immune rabbit in 1: 1 ratio mixing of mass ratio;

(2) will resist WS SV antiserum with Protein A affinity chromatographic column purifying, obtain anti-WSSV antibody.

B, described collaurum labeling antibody, its preparation method is following:

(1) preparation of collaurum: get 0.01% chlorauric acid solution 100ml; Be heated to and boil; Stir the trisodium citrate aqueous solution 2.0ml (Marc&Jacqueline 1977) of accurate adding 1% down, it is orange that flavous aqueous solution of chloraurate became in 2 minutes, continued to boil 15 minutes; The cooling back returns to original volume with deionized water, and using 0.1 M K2CO3 to transfer pH is 9.0.The collaurum of preparation filters through the primary sterilization filter, and 4 ℃ of refrigerators are preserved subsequent use in the clean vial of packing into.

The colloidal gold solution for preparing detects its grain size and dispersiveness with transmission electron microscope.Carry out the scanning of 400-600nm all band with spectrophotometer simultaneously, confirm maximum absorption band.

(2) preparation of golden labeling antibody: will resist WSSV antibody to join in above-mentioned (1) colloidal gold solution in step, and add bovine serum albumin(BSA), the deposition after centrifugal is hanged with the phosphate buffer that contains bovine serum albumin(BSA), Sodium azide, processes golden labeling antibody solution;

(3) be loaded with the preparation of the pad of golden labeling antibody: glass fibre membrane is immersed in the golden labeling antibody solution that above-mentioned (2) step processes fully, takes out after 30 minutes, dry back 4 ℃ of preservations are subsequent use, just obtain a kind of test strip.

The detection method of the on-the-spot test strip of this WSSV: from shrimp to be detected, extract WSSV at first apace, the preparation test sample; Then, the handheld terminal of hand-held this test paper inserts the sample pad of this test paper this test sample or on sample pad, drips this test sample, and 5 minutes inherent is positioned at the detection line of detection layers lower end and in the nature controlling line place exhibit red that is positioned at the detection layers upper end.The detection line exhibit red representes that WSSV is positive; Detection line is exhibit red not, and expression WSSV feminine gender does not promptly contain WSSV in the test sample or WSSV content is extremely low; The nature controlling line exhibit red, the expression test paper is effective; The nature controlling line place is exhibit red not, explains that test paper lost efficacy, and testing result is invalid.

Characteristics of the present invention are: the on-the-spot test strip of (1) WSSV of the present invention, have characteristics such as easy, quick, on-the-spot, accurate, sensitivity, and need not specialized facilities and operative technique, be suitable for common raiser's pool side detection.(2) the on-the-spot test strip of WSSV of the present invention in use only needs the shrimp gill smashed to pieces and get final product, extracts method such as grind, centrifugal with tradition virus and compares, and this method method is convenient, simple, fast, is fit to the on-the-spot use that detects.

Those of ordinary skill in the art can understand, and in protection scope of the present invention, makes amendment for the foregoing description, and it all is possible adding and replacing, and it does not all exceed protection scope of the present invention.

Description of drawings

Fig. 1 is a kind of synoptic diagram that detects the WSSV test strips.

1, PVC liner; 2, sample pad; 3, pad; 4, detection layers; 5, detection line; 6, nature controlling line; 7, absorption pad.

Fig. 2 is a kind of testing result synoptic diagram of WSSV test strips.

2, sample pad; 3, pad; 4, detection layers; 5, detection line; 6, nature controlling line; 7, absorption pad; 8, application of sample the Highest Directives line.

The acquisition of Fig. 3 genes of interest and the enzyme of recombinant plasmid are cut evaluation

1，DL2000?Marker；2，PCR?product?of?vp19；3，pGET-vp19/BamHI+Hind?III；4，pET32b-vp19/BamH?I+Hind?III；5，Lambda?DNA/Hind?III?Marker.

The phase analysis of Fig. 4 WSSV VP 19 expression products

1，pET32b-VP?19?uninduced；2，pET32b-VP19?induced?with?IPTGfor?1h；3，pET32b-VP19?induced?with?IPTG?for?2h；4，pET32b-VP?19induced?with?IPTG?for?3h；5，pET32b-VP19?induced?with?IPTG?for?4h；M，molecular?weight?standard；The?arrow?indicated?the?location?ofrecombinant?WSSV?VP19.

The purifying of Fig. 5 expression product and detection

1，pET32b?uninduced；2，pET32b?induced?with?IPTG?for?4h；3，Purified?Trx；4，pET32b-VP19?uninduced；5，pET32b-VP19?induced?withfor?4h；6，Purified?WSSV?VP19；M，molecular?weight?standard；7，Supernatants?of?the?induced?recombinant?strains?with?IPTG?for?4h；8，Pellets?of?the?induced?recombinant?strains?with?IPTG?for?4h；9，Western-blot?of?purified?WSSV?VP19；The?arrow?indicated?the?locationof?recombinant?WSSV?VP19.

Fig. 6 recombinant plasmid pET-vp28 enzyme is cut evaluation figure

1.PCR marker; 2.PCR recovery product; 3.pET-vp28 plasmid; 4.EcoR1/Xho1 double digestion pET-vp28; 5.EcoR1/HindIII double digestion marker

The building process figure of Fig. 7 recombinant expression carrier pET-VP28

The expression figure of Fig. 8 WSSV VP28 in E.coli BL21 (DE3)

1.BL21 (DE3)-before p ET-vp28 induces; 2-4.BL21 (DE3)-pET-vp28 induces 4h, 5h, the deposition of 6h; 5. protein molecular weight standard; 6-8 BL21 (DE3)-pET-vp28 induces 4h, 5h, 6h; 9.BL21 (DE3)-p ET-vp28 do not induce 10-12BL21 (DE3)-pET-vp28 to induce 4h, 5h, the supernatant of 6h

Fig. 9 western bloting is figure as a result

M molecular weight of albumen standard; 1 BL21 (DE3)-p ET-vp28 induces 5h; 2BL21 (DE3)-p ET-vp28 does not induce

Embodiment

Embodiment 1:

But according to the on-the-spot test strip of Fig. 1 knowledge capital invention WSSV, it comprises: the PVC liner 1 of appropriate size; At the two ends of this PVC liner 1, be respectively equipped with sample pad 2 and absorption pad 7; Be provided with nitrocellulose membrane detection layers 4 at this PVC liner 1 middle part; At nitrocellulose membrane detection layers 4 and sample pad 2 intersections; Be provided with the pad 3 that is loaded with golden labeling antibody, be arranged under the sample pad in pad 3 one end parts, its other end branch is arranged on this detection layers 4; With the detection layers 4 of pad 3 continuity on be provided with detection line 5 and nature controlling line 6, this detection line 5 is coated with anti-WSSV antibody and goat anti-rabbit igg respectively with nature controlling line 6 places.

Embodiment 2:

The preparation of WSSV VP19 albumen

1.WSSV the amplification of vp19, the structure of recombinant expression carrier and evaluation

(1) amplification of WSSV vp19

WSSV genome according to the Genebank login; Utilize primer-design software Oligo6.0 design vp19 primer; Upstream primer: 5 ' ggatcctatggccacgactaac 3 ' (line place is BamH I); Downstream primer: 5 ' aagcttctgcctcctcctggggtaagac 3 ' (line place is HindIII), synthetic by Shanghai Bo Ya Bioisystech Co., Ltd.

The virus genomic preparation of WSSV: get lung, stomach and the heart that infects the prawn white spot disease shrimp on ice, add T N damping fluid (50mmol/L Tris-HCl, the 0.4mmol/LNaCl of 10 times of volumes; PH 7.4) in homogenizer; Ice bath homogenate, the centrifugal 5min of 8000r/min gets supernatant; Add Proteinase K (100 μ g/ml), DS (50mmol/L KCl; 10mmol/L Tris-Cl PH8.3; Gelatin 0.1mg/ml; NP-40,0.45%; T ween 20,0.45%), in boiling water, boils about 15min ice bath 5min immediately, 12, the centrifugal 10min of 000r/min, 4 ℃ of preservations.

With the WSSV virus genom DNA is template, the PCR reaction system: 10 * reactionbuffer 5uL, MgCl2 3uL (1.5mM); DNTP 1uL (0.2mM), each 1uL of upstream and downstream primer (30pmol), Taq archaeal dna polymerase 1uL (5U); Template 4uL, adding sterilized water to final volume is 50uL.Pcr amplification genes of interest vp19, PCR reaction conditions: 95 ℃ of 5min, 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s (29 circulations), 72 ℃ of 10min.

(2) structure of recombinant expression carrier

The recovery of A, PCR product, purifying and clone

With above PCR product on Ago-Gel electrophoresis (1 * TAE), observe the electrophoresis situation with uviol lamp, when the DNA band that will reclaim and other bands separate fully, stop electrophoresis, under uviol lamp, downcut desire and reclaim band, with PCR product purification kit purifying with blade.

The purifying of PCR product:

(1) gel that downcuts is put into 1.5ml Eppendorf pipe, add the Binding Buffer of 4 times of gel milligram numbers, 65 ℃ of water-bath 7min, every therebetween 2min jog Eppendorf pipe once makes gel melt fully.

(2) get the solution that 750 μ l are dissolved with gel and be added on the pillar, 12000rpm, room temperature (20-25 ℃, following room temperature is identical), centrifugal 1min discards liquid.

(3) add 300 μ l Binding Buffer, the same centrifugal liquid that discards.

(4) add 750 μ l Washing Buffer, the same centrifugal liquid that discards repeats this step once.

(5) the centrifugal 1min of the sub-12000rpm of void column is to dry liquid.

(6) pillar is put in 1.5ml Eppendorf pipe, adds 30 μ l Elution Buffer, 37 ℃ of insulation 2min, the centrifugal 1min of 12000rpm.

(7) it is quantitative the PCR product that obtains to be got 2 μ l electrophoresis detection, all the other store in-20 ℃ subsequent use.

The clone of PCR product:

The PCR product of purifying is connected with pGEM-T carrier (available from Promega company).Linked system is following:

10×Ligation?Buffer?1μl

PGEM-T carrier 1 μ l

PCR product 5 μ l behind the purifying

ddH2O 2μl

T4?DNA?Ligase?1μl

Total reaction volume 10 μ l

After 16 ℃ of water-baths of coupled reaction liquid are placed and are spent the night, be stored in-20 ℃ subsequent use.

B, reorganization T carrier transformed into escherichia coli JM109 pGEM-T (available from Promega company)

Calcium Chloride Method prepares competent escherichia coli cell:

1) with the single bacterium colony of the Escherichia coli of the new recovery on the aseptic toothpick picking solid LB flat board, be inoculated in the 5ml LB nutrient culture media, 37 ℃, the activation of 250rpm shaking table is spent the night.

2) get the above-mentioned activation Escherichia coli of 10-20 μ l, be inoculated in the fresh LB nutrient culture media of 5ml, 37 ℃, 250rpm cultivates 2-3h, to the OD600 value be 0.4-0.6.

3) the bacterium liquid of getting 1.5ml step 2 adds in the aseptic Eppendorf centrifuge tube, 4000rpm, and 4 ℃ of centrifugal 10min blot supernatant with liquid-transfering gun.

4) add the 0.1M lime chloride that 800 μ l ice precooling, the resuspended bacterial sediment that vibrates gently, ice bath 30min, 4000rpm, 4 ℃ of centrifugal 10min blot supernatant with liquid-transfering gun.

5) add the resuspended deposition of 0.1 M calcium chloride solution that 100 μ l ice precooling, the competent cell that obtains preparing.Place 4 ℃ of preservations, use in 2 days.

The recombinant plasmid transformed competent escherichia coli cell:

1) gets coupled reaction liquid (being no more than 10 μ l volumes), join in the competent cell of the above-mentioned preparation of 100 μ l, mixing gently, ice bath 30min.

2) heat shock 90s in 42 ℃ of water-baths moves to ice bath 2min in the ice rapidly.

3) add the fresh LB fluid nutrient medium of 390 μ l, 37 ℃, the 150rpm jog makes cell recovery 50min.

4) the centrifugal 5min of 4000rpm inhales and to abandon 400 μ l supernatants, with remaining bacterium liquid with liquid-transfering gun mixing gently.

5) get 100 μ l bacterial suspensions, be evenly coated on the LB flat board that contains IPTG, X-gal, Amp, forward is placed 1-2h, is fully absorbed until liquid, and inversion is dull and stereotyped, and overnight incubation in 37 ℃ of incubators is utilized α-Hu Bu effect screening positive clone.

The PCR of C, positive recombinant detects

Picking list bacterium colony from the LB flat board is inoculated in 0.5ml and is added with in the LB nutrient solution of Amp, cultivates 4h for 37 ℃, gets 2 μ l bacterium liquid and is used for bacterium colony PCR as template and identifies.Reaction system and response parameter such as this joint 2.2.1 are said.

D, alkaline lysis method of extracting plasmid DNA

1) be grown in the single bacterium colony on the LB flat board that contains ampicillin with aseptic toothpick picking respectively, be inoculated into 3ml and contain in the corresponding antibiotic LB fluid nutrient medium, 37 ℃, the 250rpm overnight incubation.

2) the centrifugal 30sec of 12000rpm inhaled and abandoned supernatant with 4 ℃ of the bacterium liquid of cultivating next day; Collect bacterial sediment, add solution I (50mmol/l glucose, the 25mmol/l TrisHCl (pH 8.0) of 100 μ l ice precooling; 10mmol/l EDTA (pH8.0), 8 pounds the sterilization 15min be placed on 4 ℃ subsequent use.), thermal agitation suspends deposition fully.

3) add 200 μ l solution II (0.2mol/l NaOH, 1%SDS, fresh during use.), gentleness is put upside down mixing for several times, and ice bath leaves standstill 5min, treats whole solution clarification.

4) add solution III (5mol/l potassium acetate 60ml, spirit acid 11.5ml, the ddH2O 28.5ml that 150 μ l ice precooling.

), slight vibration is even, ice bath 10min, and flocculent deposit can appear in solution.

5) 12000rpm, 4 ℃ of centrifugal 10-15min shift in supernatant to the aseptic Eppendorf pipe.

6) add isopyknic phenol, abundant mixing, 12000rpm, 4 ℃ of centrifugal 5min get supernatant and change in another aseptic Eppendorf pipe, use isopyknic phenol/chloroform (1/1), the same extracting of phenol/chloroform/isoamylol (25: 24: 1) more successively.

7) get supernatant after centrifugal, add the absolute ethyl alcohol of 800 μ l precoolings ,-20 ℃ of deposition 2h.

8) 12000rpm, 4 ℃ of centrifugal 15min remove supernatant, inhale and abandon liquid, the Eppendorf pipe is inverted in treats its drying on the aseptic filter paper.

9) add the 70% ethanol 1ml that room temperature is placed, 12000rpm, 4 ℃ of centrifugal 10min inhale and abandon liquid, and the Eppendorf pipe is inverted in 37 ℃ of incubator inner dryings on the aseptic filter paper.

10) DNA deposition being dissolved in the TE solution that 50 μ l contain RNase A (20 μ g/ml)-20 ℃ deposits.

(3) evaluation of recombinant expression carrier

The enzyme of A, positive recombinant pGEM-vp19 is cut evaluation

With BamH I and Hind III the DNA that is extracted is carried out double digestion, it is following that enzyme is cut system:

DNA 8 μ l

BamH?I 0.5μl

HindIII 0.5μl

10×H?buffer 1μl

Total reaction volume 10 μ l

Above endonuclease reaction condition is 37 ℃, reaction time 4 h.Enzyme is cut product and is carried out interpretation of result with agarose gel electrophoresis.

With BamH I and Hind III recombinant plasmid pGEM-vp19 and expression vector pET32b are carried out double digestion simultaneously; Glue reclaims kit and reclaims the purpose band; Enzyme cut obtain vp19 and connect back transformed into escherichia coli JM109 competent cell with corresponding carrier-pellet disconnection; Extract plasmid in a small amount, identify positive recombinant, recombinant plasmid called after pET32b-vp19 with BamH I/Hind III double digestion.

B, dna sequence analysis

Select 3 to cut through enzyme and to identify that the correct positive reorganization bacterium colony of direction of insertion serves marine growth Engineering Co., Ltd and carry out determined dna sequence at random, and the sequence that sequencing result and GenBank have logined is compared.

Get 10 μ L PCR products and carry out 1% agarose gel electrophoresis, EB dyeing back uviol lamp is observed down and being shown that amplification obtains the band (Fig. 3 .1) of a 370bp, conforms to genes of interest vp19 size.The PCR product cloning in the pGEM-T carrier, is identified that through BamH I/Hind III double digestion obtained positive colony (Fig. 3), the determined dna sequence result shows that the gene order of vp19 is entirely true.Through BamH I and HindIII double digestion vp19 gene orientation is inserted expression vector pET32b; BamH I and Hind III double digestion are identified the pET32b-vp19 plasmid; On 1% agarose gel electrophoresis, present two bands; Size is respectively 5900bp and 370bp (Fig. 3), corresponds respectively to expression vector pET32b and vp19 gene, shows that this plasmid correctly inserts among the expression vector pET32b.

2. the abduction delivering of fusion and purifying

(1) abduction delivering of Trx albumen and fusion (WSSV VP19)

1) will show that vp19 correctly inserts the recombinant plasmid and pET32b empty carrier difference transformed into escherichia coli Origami (DE3) the pLysS competence of pET32b carrier through order-checking; Picking carries the single bacterium colony of Escherichia coli of recombinant plasmid and empty carrier from the flat board; Be inoculated in the 20mLLB fluid nutrient medium (containing final concentration is the 100mg/L ampicillin, 34mg/L chloromycetin, 15mg/L kalamycin); Under 37 ℃, 250rpm shaken cultivation 8-12h.

2) be inoculated in the fresh LB fluid nutrient medium by 4% next day, continued shaken cultivation about 2 hours down at 37 ℃.

3) to bacterium liquid OD600 value be 0.6 o'clock, add inducer IPTG to final concentration be 0.8mM, at 22 ℃ of-35 ℃ of following abduction delivering 4h.

Bacterium liquid is 12,000 centrifugal 1min under 4 ℃, collect thalline.

(2) the thick extraction of bacillus coli gene engineered protein

1) to the thalline of collecting add an amount of 1 * Binding Buffer (can be further used for ni-sepharose purification) or PBS resuspended ,-20 ℃ of multigelations several times after, carry out the ultrasonic disruption bacterium again and handle (in the mixture of ice and water, handles 3 times, each 10 seconds, interval 30 seconds).

2) treat that bacterium liquid becomes limpid, after most thalline break, 4, the centrifugal bacterium liquid of 000rpm 15-20 minute.

3) collection obtains thalline residue and supernatant respectively. and supernatant descends 12 at 4 ℃, and 000rpm continued centrifugal 15 minutes.

4) collect cleer and peaceful deposition on the two times centrifugal gained; Get its 1/100 adding, 2 * SDS-PAGE sample loading buffer (100mM Tris-C1,200mM beta-mercaptoethanol, 4%SDS, 0.2% bromophenol blue, 20% glycerine) respectively; After 10 minutes, carry out electrophoresis detection through boiling water bath with SDS-PAGE.

(3) albumen of Ni2+ post affinity chromatography purifying band 6 * His mark

1) the Ni2+ post is with 1 * Binding Buffer (0.5mM imidazoles of 10 times of medium volumes in the post; 0.5mM NaCl; 2mMTris-HCl) the aseptic washing post bed of 10 times of volumes; 1 * Charge Buffer (50mMNiSO4) with 10 times of volumes replenishes Ni2+, uses 1 * Binding Buffer of 10 times of volumes to clean the post bed again, prepares the beginning affinity chromatography.

2) protein solution joins in the good affinity column of balance with peristaltic pump in a looping fashion, and the abundant Ni2+ of the sample that has 6 * His is combined, and collect and the reacted sample of Ni2+ (being leakage liquid) from the Ni2+ column outlet back of spending the night.

3) make 1 * Binding Buffer of 20 times of volumes wash post, to wash down a small amount of sample that does not combine of staying in the post with Ni2+.

4) with non-destination protein (effluent volume and concentration are looked total protein content and non-destination protein and Ni2+ binding ability and changed flexibly) on the imidazoles eluant solution Ni2+ post of 10mM～100mM.

5) with 1 * Elute Buffer (1M imidazoles, 0.5M NaCl, 20mM Tris-HCl) wash-out Ni2+ post, destination protein elutes, and is that eluent is collected by unit with 2mL.

6) each tubulin that gets collection carries out the distribution of 12%SDS-PAGE electrophoresis detection destination protein in eluent.

7) the Ni2+ post continues wash-out with 1 * Elute Buffer, washes the whole residual proteins in the post bed off, uses 1 * StripBuffer (100mM EDTA, 0.5 M NaCl, 20mMTris-HCl) the Ni2+ ion on the flush away pillar again.

8) washing of histidine affinity column, regeneration and preservation.

In general, the Ni2+ affinity column can use 3-4 time repeatedly, and palpus washs and need not regenerate before reusing, and then need regenerate if repeated multiple times is used.

(1) washes the histidine affinity column with the 6M guanidine hydrochloride of 2 times of volumes, the acetic acid solution of 0.2M;

(2) wash post with the deionization of 2 times of volumes;

(3) wash post with 1 times of volume 2%SDS;

(4) wash post with 1 times of volume 25% ethanol;

(5) wash post with 1 times of volume 50% ethanol;

(6) wash post with 1 times of volume 75% ethanol;

(7) wash post with 5 times of volume 100% ethanol;

(8) successively repeating

step

6,5,4 each once;

(9) once with the rinsed with deionized water post of 1 times of volume;

(10) wash post with 5 times of volume 100mM EDTA (pH8.0), thoroughly remove the Ni2+ ion on the chromatographic column;

(11) chromatographic column with regeneration places 20% alcoholic solution that contains 0.1% Sodium azide, 4 ℃ of preservations.

(4) the recombinant protein WSSV VP19 western blotting behind the purifying identifies

(1) when SDS-PAGE will finish, wipes the drop that sticks on the dried battery lead plate with paper towel behind the distilled water drip washing graphite cake.

(2) wear disposable glove and cut six filter paper and a cellulose filter membrane, its size should fit like a glove with the gel size, with the one jiao marked of soft pencil at filter membrane.

1. filter membrane floats in the plate that deionized water is housed, and borrows capillary action to make it moistening from the bottom up, in water, soaks 5min at least, stays the bubble on filter membrane with expeling.

2. the filter paper that shears is soaked in the transfering buffering liquid, the time is 15-30min

(3) wear disposable glove transfer device be installed as follows:

1. keep flat the bottom electrode of half-dried electroporation, Yi Bian graphite up.

2. place three soaked filter paper on it, accurately alignment is driven bubble away with glass bar.

3. be put in the filter membrane after wetting on the filter paper, index face is accurately alignd up, drives bubble away with glass bar.

The gel that 4. will be used for changeing film the plate that fills deionized water slightly rinsing once be put on the NC film, place the lower left corner of gel on the mark angle of NC film, accurately bubble is driven in alignment gently away.

5. on gel, put three soaked three filter paper again, align and drive bubble away.

(4) put second half electrode, two parts electrode is fixed with adhesive plaster.Connect power supply, electroporation is put 4 ℃ of refrigerator-freezers, electricity changes 1.5-2h.

(5) dismantle transfer device from top to bottom, lift each layer one by one, film is put into the little plate that the 10mL confining liquid is housed, room temperature is shaken 60min on rocking bed, and gel silver is dyed to detect changes membrane efficiency.

(6) film is taken out with tweezers, after the TBST flushing, anti-VP (19+28) IgGs (1: 1000) the solution room temperature that changes 20mL TBST dilution over to is shaken 30min.

(7) room temperature is washed four times with flushing membrane among the 50mL TBST continuously, each 15min.

(8) change in crosslinked goat anti-rabbit igg s (1: the 10000) solution of 20mL TBST dilution horseradish peroxidase film over to room temperature and shake 30min.

(9) repeating step (7)

(10) room temperature is washed film 15min to remove excessive phosphate and polysorbas20 with PBS.

(11) film is soaked in 10-30min in the 10mL DAB colour developing liquid, occurs until protein band.

(13) react with color development stopping with the PBS cleaning.

PET32b and recombinant plasmid are transformed Origami (DE3) pLysS host bacterium (available from Promega company) respectively; Made up the expression strain of pET32b-VP19 and pET32b, IPTG (0.8mmol/L) induces the back to collect bacterium appearance at different time, finds that through the SDS-PAGE electrophoresis destination protein WSSV VP19 has obtained the expression (see figure 4); Molecular weight is about 37kDa; Conform to the size of expection, shown in the arrow among Fig. 2, and inducing back 4h expression maximum.Also detect the expression of WSSV VP19 albumen with Western Blot.With thalline multigelation 3 times, ultrasonic disruption, centrifugal (12000r/min, 4 ℃, 10min) collect supernatant, behind the fusion of nickel ion is affine purifying resin band 6 * His label, about 37kDa place is single band (see figure 5).Same method purifying obtains the expression product Trx of pET32b empty carrier, is single band (see figure 5) at the 18kDa place.

Embodiment 3:

The preparation of WSSV VP28 albumen

1.PCR amplification vp28 gene

According to the WSSV sequences Design primer of having delivered among the GenBank.

Vp28: upstream primer: gaattcatggatctttctttcac (line place is EcoR I site)

Downstream primer: ctcgagttactcggtctcagtgc (line place is the XhoI site).

Above-mentioned primer is given birth to worker biotech firm by Shanghai and is synthesized with the design of Oligo6.0 software analysis.

With plasmid PUC-vp28 is template, pcr amplification genes of interest vp28.The PCR reaction system: 10 * reaction buffer 5uL, MgC12 3uL (1.5mM), dNTP1uL (0.2mM), each 1uL of upstream and downstream primer (30pmol), Taq archaeal dna polymerase 1uL (5U), template 4 uL, adding sterilized water to final volume is 50uL.PCR reaction conditions: 95 ℃ of 5min; 95 ℃ of 1min, 55 ℃ of 45s, 72 ℃ of 1min (30 circulations); 72 ℃ of 10min.Get 5uL PCR product electrophoresis on 1.2% Ago-Gel, EB dyeing back uviol lamp is observed down.

Pcr amplification vp28 gene, the PCR product is electrophoresis on 1.2% Ago-Gel, after the EB dyeing

Uviol lamp is observed down, and the purpose band that conforms to genes of interest vp28 size is arranged, and size is about 640bp, and is as shown in Figure 6.

The structure of 2 cloning vector pMD 18-T28

Vp28 PCR product is reclaimed back and cloning vector pMD 18-T (available from precious bioengineering company limited) with PCR purifying and recovering kit to be connected; Linked system is: LigationsolutionI 5 μ L; PMD 18-T carrier 0.5 μ L, the PCR product 4.5 μ L behind the purifying, final volume 10uL.16 ℃ of connections are spent the night.Transformed into escherichia coli JM 109 competent cells., be inoculated in 5mL and contain overnight incubation in the LB fluid nutrient medium of 100mg/L ampicillin from transforming picking list bacterium colony on the plate with aseptic toothpick.Extract plasmid next day, do PCR evaluation and EcoR I, the evaluation of XhoI double digestion, screening contains the recombinant plasmid of vp28 purpose segment, called after pMD 18-T28.

The structure of 3 recombinant expression carriers

EcoR I, XhoI double digestion expression vector pET-22b (+) and the recombinant cloning vector pMD18-T28 that screens; Reclaim kit with glue respectively and reclaim purpose segment vp28 and pET-22b (+); Connect through T4 DNA Ligase again; Behind 16 ℃ of connection 15h, transformed into escherichia coli BL21 (DE3) competent cell., be inoculated in 5mL and contain overnight incubation in the LB fluid nutrient medium of 100mg/L ampicillin from transforming picking list bacterium colony on the plate with aseptic toothpick.Extract plasmid next day, do PCR evaluation and EcoR I, the evaluation of XhoI double digestion, screening contains the recombinant plasmid of vp28 purpose segment, called after pET-vp28, and design of graphics is as shown in Figure 7.

With EcoR I/XhoI double digestion plasmid pET22b (+) and pMD18-T28.Glue reclaims two purpose segments and connects, and identifies through EcoR I/XhoI double digestion, screens positive recombinant, is and successfully makes up the pET-vp28 expression vector, sees Fig. 6.

The expression of 4 foreign proteins in E.coli BL21 (DE3)

The abduction delivering of A, E.coli BL21 (DE3)-pET-vp28

1) picking carries the single bacterium colony of e. coli bl21 (DE3) of plasmid pET-vp28 from the flat board, and be inoculated in 20mL and contain in the LB fluid nutrient medium of 100mg/L ampicillin, under 37 ℃, 250rpm shaken cultivation 8-12h.

2) be inoculated in the fresh LB fluid nutrient medium by 4% next day, continued shaken cultivation about about 2 hours down at 37 ℃.

3) to bacterium liquid OD600 value be 0.6 o'clock, add inducer IPTG to final concentration be 0.6mM, at 37 ℃ of following abduction delivering 3-5h.

4) bacterium liquid 12,000 centrifugal 1min under 4 ℃ collect thalline.

The thick extraction of B, engineered protein

1) add an amount of PBS to the thalline of collecting ,-20 ℃ of multigelations several times after, carry out the ultrasonic disruption bacterium again and handle (4 ℃ are handled each 10 seconds, interval 30 seconds 3 times).

3) collection obtains thalline residue and supernatant respectively.Supernatant descends 12 at 4 ℃, and 000rpm continued centrifugal 15 minutes.

4) collect cleer and peaceful deposition on the two times centrifugal gained; Get its 1/100 adding, 2 * SDS-PAGE sample loading buffer (100mM Tris-C1,200mM beta-mercaptoethanol, 4%SDS, 0.2% bromophenol blue, 20% glycerine) respectively; After 10 minutes, carry out electrophoresis detection through boiling water bath with 12%SDS-PAGE.

The SDS-PAGE of C, expression product identifies

The SDS-PAGE electrophoresis carries out according to the standard method of being told about on the molecular cloning.The concentration that concentrates glue is 5%, and the concentration of separation gel is 12%, and voltage is 8V/cm during electrophoresis.When the bromophenol blue index line arrives the separation gel base, turn off power supply.Behind 0.1% Coomassie brilliant blue dye liquor dyeing 4-6h, use destainer (methyl alcohol: acetate: ddH2O=4: 1: 5) to take off background colour to the greatest extent again till.

Recombinant strain E.coli BL21 (the DE3)-pET-vp28 that expresses destination protein induces down 37 ℃ of abduction delivering 4-6h at IPTG (final concentration is 0.6mM).As shown in Figure 8; Before inducing, to take a sample respectively when inducing 4h, 5h, 6h, the last cleer and peaceful deposition that gets behind the bacterium liquid ultrasonic disruption detects with 12%SDS-PAGE; Discovery has the destination protein band that is consistent with the big or small 32kDa of expection in supernatant, and in the deposition a spot of destination protein is arranged.

D, Western blotting detect

1) preparation is used for the SDS-PAGE gel that Western blot analyzes, and carries out method according to the standard method of being told about on the molecular cloning

2) treat that electrophoresis finishes after, downcut a semigel that is used to move, with transfering buffering liquid TBST solution cleaning gel; Second half gel carries out protein staining, decolouring.

3) one of clip and the similar nitrocellulose filter of polyacrylamide gel size; Cut 2 big little and duplicate 3MM filter paper of nitrocellulose filter; Soak into transfering buffering liquid, will be wherein one be laid on the electrotransfer device, then the SDS-PAGE gel is laid on the 3MM filter paper; Roll gently on gel with glass bar, bubble is arranged to prevent therebetween;

4) nitrocellulose filter is tiled in gel surface, on nitrocellulose filter, rolls gently, bubble is arranged to prevent therebetween with glass bar;

5) another 3MM filter paper is tiled in the nitrocellulose filter surface, on filter paper, rolls gently, bubble is arranged, then filter paper/gel/film/filter paper interlayer is put into electrophoretic apparatus, notice that the gel face is towards negative pole to prevent therebetween with glass bar; Press the electric current electrotransfer 90min of gel area 0.65mA/cm2.

6) after transfer finishes, wash film 3-5 time with 25ml TBS. damping fluid, each 5min, and shake lightly frequently;

7) nitrocellulose filter is immersed in the 20ml sealing damping fluid, room temperature is vibrated gently and was sealed 1 hour.

8) film is immersed in the first antibody of 20ml with an anti-dilution buffer liquid dilution oscillating reactions 1 hour gently under the room temperature.

9) wash film 3-5 time with 25ml TBST damping fluid, each 5min, and vibration lightly frequently.

10) nitrocellulose filter is immersed in the SA solution of 20ml with the good HRPO mark of sealing damping fluid dilution oscillating reactions 1 hour gently under the room temperature.

11) wash film 3-5 time with 50ml TBST damping fluid, each 5min, and vibration lightly frequently.

12) dye with the DAB kit.

Expressed products detects through Western blotting, and tangible hybrid belt is arranged, and the about 32KD of size is as shown in Figure 9, further specifies vp28 and in Escherichia coli, has obtained expression.

Embodiment 4:

The preparation of anti-WSSV antibody

(1) get each 200 μ g of WSSV VP19, VP28 of purifying, mix, immune new zealand white rabbit, each immunity interval time is 15 days.Blood was got on the tenth day in the immunity back for the third time, and whole blood is placed on 37 ℃ and leaves standstill 1h, spend the night 4 ℃ of placements then, and with 4000g, 4 ℃ of centrifugal 10min, it is frozen in-70 ℃ to get supernatant, is anti-WSSV antiserum.

(2) will resist the WSSV antiserum with Protein A affinity chromatographic column purifying, and obtain anti-WSSV antibody, purification step is following:

1) the 3mL antiserum is diluted to 30mL with the Binding buffer (50mmol/L Tris buffer, pH 7.0) of Protein A affinity column, with 10000g, 4 ℃ of centrifugal 15min collect supernatant and with 0.45 μ m membrane filtration.

2) sample of handling well is double, use the good Protein A Sepharose of Binding buffer balance after in advance with the velocity flow of 1mL/5min ^TMCL-4B post (1 * 10cm glass column, interior dress 2mL Protein A Sepharose filler).

3) flow velocity with 0.5mL/min washes pillar up to baseline stability with Binding buffer.

4) with the flow velocity of 0.25mL/min Elution buffer (0.1mol/L glycocoll with 5 CV; PH 3.0) wash-out IgGs; The fraction collection eluent; The activity that be to keep IgG antibody s adds 200 μ L Neutralizing buffer (1mol/L Tris-HCl, pH 9.0) and mixing immediately in every mL eluent in the time of collection.

5) analyze the purification effect of IgG antibody s with SDS-PAGE.

Embodiment 5

Be loaded with the preparation of the pad of golden labeling antibody

(1) preparation of collaurum:

Get 0.01% chlorauric acid solution 100mL, be heated to boiling, stir down the accurately trisodium citrate aqueous solution 2.0mL of adding 1%; Flavous aqueous solution of chloraurate became orange in 2 minutes; Continued to boil 15 minutes, the cooling back returns to original volume with deionized water, uses 0.1mol/L K ₂CO ₃Transferring pH is 9.0.The collaurum of preparation filters through disposable bacterial filter, and 4 ℃ of preservations are subsequent use in the clean vial of packing into.

(2) preparation of golden labeling antibody:

The anti-WSSV antibody of 1 μ L is added in the 1mL colloidal gold solution, be mixed, add 10% sodium chloride solution, 100 μ L; Observe change color,, explain that then antibody is not enough if become blue; Increase the antibody amount then gradually, be as the criterion until the collaurum color is constant, on this basis; This antibody amount is increased 20-30%, and be the righttest antibody amount of 1mL colloid gold label this moment.The anti-WSSV antibody of purifying 1.25mg is diluted to 5mL with 10mmol/L Tris-Cl (pH 9.0), under stirring it is added in the colloidal gold solution of 100mL (1) step preparation, adding 10% bovine serum albumin(BSA) to final concentration after 10 minutes is 1%; Bond is 15,000g, 4 ℃ centrifugal 1 hour, abandon supernatant, precipitate, washing resuspended, centrifugal back (repeating 2 times) with 10mmol/L Tris-Cl (pH 9.0), contain the 50mmol/L of 1% bovine serum albumin(BSA), 0.02% Sodium azide with 10mL PB(Na ₂HPO ₄12H ₂O 1.386g, NaH ₂PO ₄2H ₂O 0.176g is dissolved in the 100mL deionized water, and pH 7.4) resuspended, be golden labeling antibody, 4 ℃ of preservations.

(3) preparation of pad

Glass fibre membrane is immersed in the golden labeling antibody solution that above-mentioned steps (2) processes fully, and it is dry to take out the back after 30 minutes, is the pad that is loaded with golden labeling antibody, and 4 ℃ of preservations are subsequent use.

Embodiment 6

The preparation of the detection layers of nitrocellulose filter

Ruling with the anti-WSSV antibody (1.25mg/mL) behind the purifying on the nitrocellulose filter, as detection line; Rule with goat anti-rabbit igg (2mg/mL) at a distance of 5mm, as nature controlling line.Detection line 5 nearly sample pad 2, nature controlling line 6 nearly absorption pads 7, the dry back of room temperature < 20～25 ℃>was sealed 1 hour with 1% enzymolysis casein in 37 ℃, and after room temperature < 20～25 ℃>drying, 4 ℃ of preservations are subsequent use.

Embodiment 7

The WSSV test strip is used

Used instrument of the present invention and reagent:

Gold chloride (available from Sigma company); Goat anti-rabbit igg (available from Sigma company); Bovine serum albumin(BSA) (available from Amresco company); Enzymolysis casein (available from Sigma company); The plain film of spun glass, nitrocellulose filter (available from Millipore company); Goat anti-rabbit igg (available from Pierce company).

Use the on-the-spot test strip of WSSV of the present invention, detect the step of WSSV: at first, from the shrimp gill of seized shrimp, extract WSSV apace, the preparation test sample.The preparation process of described test sample is: 1) for becoming shrimp, get 1-2 shrimp the shrimp cheek is taken out, add appropriate amount of purified water and fully smash to pieces, process test sample; 2) for juvenile prawn, get the only whole shrimp of 2-3, add appropriate amount of purified water and fully smash to pieces, process test sample; 3) for the shrimp seedling, get whole shrimp about 30, add appropriate amount of purified water and fully smash to pieces, process test sample.Then, in the sample pad 2 immersion test sample with test strips, liquid level surpasses MAX line, observations in 5 minutes.

Positive findings: check layer 4 presents the detection line 5 and nature controlling line 6 of two redness up and down, and expression has WSSV to infect;

Negative findings: check layer 4 upper end present a red nature controlling line 6, represent that no WSSV infects or its WSSV contains extremely low;

Testing result is invalid: in the application of sample 5 minutes, check layer 4 upper end quality inspection line 6 places do not have red line and occur, and represent that this test paper lost efficacy, and testing result is invalid.(see figure 2)

Embodiment 8

WSSV detects the specificity and stability of test paper

The on-the-spot specificity that detects test paper of WSSV of the present invention is measured as follows with stability:

(1) specificity experiment:

Select two groups of samples, first group is: ddH ₂O, 50mmol/L PB (pH7.4) and the healthy shrimp cheek are as negatives; Second group is: the shrimp cheek of the VP19+VP28 of purifying, WSSV and trouble prawn white spot syndrome is as positive sample, respectively with reagent strip test of the present invention.The result shows that each group all samples is all negative; Per two groups of all samples are all positive.

(2) stability experiment: reagent strip of the present invention was put 4 ℃ and room temperature (20-25 ℃) respectively 30 days, detect with two groups of samples of specificity test more respectively after the taking-up.The result of test is consistent with the specificity test result.

Claims

1. preparation method who detects the comprehensive viral test strips of prawn white spot is characterized in that:

A, WSSV VP19, VP28 albumen are mixed at 1: 1, immune new zealand white rabbit must resist the WSSV polyclonal antibody behind the purifying;

B, prepare the colloid gold particle of 20-40nm with trisodium citrate reduction method; To resist WSSV antibody to join in the colloidal gold solution; Add bovine serum albumin(BSA), the deposition after centrifugal hang with the phosphate buffer that contains bovine serum albumin(BSA), Sodium azide, processes the golden labeling antibody solution of anti-WSSV;

D, on the nitrocellulose filter with the line of the anti-WSSV antibody behind the purifying, be detection line; Rule with goat anti-rabbit igg at a distance of 5mm, be nature controlling line, in the sealing of 1% enzymolysis casein, obtain WSSV antibody solid phase nitrocellulose filter detection layers after the drying after the drying at room temperature;

The comprehensive viral test strips of the detection prawn white spot for preparing is respectively equipped with sample pad (2) and absorption pad (7) at the two ends of PVC liner (1); On PVC liner (1), be provided with nitrocellulose membrane detection layers (4); Be provided with the pad (3) of golden labeling antibody at nitrocellulose membrane detection layers (4) and sample pad (2) intersection; Be arranged under the sample pad (2) at pad (3) one ends; The other end is arranged on the detection layers (4), on detection layers (4), is provided with detection line (5) and nature controlling line (6), locates to be coated with respectively anti-WSSV antibody and goat anti-rabbit igg at detection line (5) and nature controlling line (6).