CN1918155B - Compounds and compositions as LXR modulators - Google Patents
Compounds and compositions as LXR modulators Download PDFInfo
- Publication number
- CN1918155B CN1918155B CN2005800046771A CN200580004677A CN1918155B CN 1918155 B CN1918155 B CN 1918155B CN 2005800046771 A CN2005800046771 A CN 2005800046771A CN 200580004677 A CN200580004677 A CN 200580004677A CN 1918155 B CN1918155 B CN 1918155B
- Authority
- CN
- China
- Prior art keywords
- och
- alkyl
- group
- oxc
- halogen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D285/00—Heterocyclic compounds containing rings having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by groups C07D275/00 - C07D283/00
- C07D285/01—Five-membered rings
- C07D285/02—Thiadiazoles; Hydrogenated thiadiazoles
- C07D285/04—Thiadiazoles; Hydrogenated thiadiazoles not condensed with other rings
- C07D285/12—1,3,4-Thiadiazoles; Hydrogenated 1,3,4-thiadiazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/433—Thidiazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/444—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
- C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
- C07D417/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
- C07D417/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings
- C07D417/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
- C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Life Sciences & Earth Sciences (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Diabetes (AREA)
- Biomedical Technology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Pain & Pain Management (AREA)
- Heart & Thoracic Surgery (AREA)
- Endocrinology (AREA)
- Rheumatology (AREA)
- Cardiology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Emergency Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Nitrogen- Or Sulfur-Containing Heterocyclic Ring Compounds With Rings Of Six Or More Members (AREA)
Abstract
The invention provides compounds, pharmaceutical compositions comprising such compounds and methods of using such compounds to treat or prevent diseases or disorders associated with the activity of liver X receptors (LXRs).
Description
The cross reference of related application
The application requires the U.S. Provisional Patent Application US60/543 of submission on February 11st, 2004, the U.S. Provisional Patent Application US60/623 that on October 27th, 848 and 2004 submitted to, 021 right of priority.Whole disclosure contents of these applications intactly and for all purposes are incorporated herein by reference.
Background of invention
Invention field
The pharmaceutical composition that the invention provides compound, comprises this compounds with use the active relevant disease of this compounds for treating or prevention and liver X receptor (LXR) or the method for illness.
Background technology
Liver X receptor (LXR) LXR α and LXR β are the nuclear receptor of regulating several important lipids, comprising cholesterol and bile acid biosynthesis.Although LXR β generally expresses in vivo, LXR α in liver, express and in kidney, small intestine, fatty tissue, spleen and suprarenal gland with less degree expression.
LXR is incorporated into ATP binding cassette transporters-1 (ABCA1) promotor and increases genetic expression to produce ABCA1 albumen.ABCA1 is a kind of film binding transport albumen, and it participates in cholesterol regulating cell drain extremely on newborn high-density lipoprotein (HDL) (HDL) particle from liver outside.Sudden change in the ABCA1 gene causes low-level HDL and follows cardiovascular disorder such as the danger of atherosclerosis, myocardial infarction and ischemic stroke increase.LXR α and beta-agonists have shown increases ABCA1 genetic expression, increases the HDL cholesterol thus, thereby reduces the clean absorption of cholesterol simultaneously and reduce cardiovascular disease risk.The lxr agonist also scavenger cell of incremental adjustments apo E (apoE) and ABCG1 is expressed, and their both equal pair cell cholesterol outflows are worked.Expressing by incremental adjustments ABCA1, ABCG1 and/or apoE stimulates scavenger cell cholesterol outflow and increases other target gene, comprises the expression of cholesteryl ester transfer protein and lipoprotein lipase, and lxr agonist can influence plasma lipoprotein.
New compound of the present invention is regulated the active of LXR and therefore is expected to be used for the treatment of the LXR-relative disease, as cardiovascular disorder, inflammation and glucose metabolism obstacle such as insulin resistant and obesity.
Summary of the invention
One aspect of the present invention provides the pharmacy acceptable salt and the solvate (for example hydrate) of formula I compound and N-oxide derivative, prodrug derivatives, protected derivative, each isomer and isomer mixture and this compounds:
Wherein:
N is selected from 0,1,2 and 3;
Z is selected from C and S (O); Each
Y is independently selected from-CR
4=and-N=; R wherein
4Be selected from hydrogen, cyano group, hydroxyl, C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl and halogen-replacement-C
1-6Alkoxyl group;
R
1Be selected from halogen, cyano group, hydroxyl, C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group and-C (O) OR
4R wherein
4As mentioned above;
R
2Be selected from C
6-10Aryl, C
5-10Heteroaryl, C
3-12Cycloalkyl and C
3-8Heterocyclylalkyl; R wherein
2Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-5 group alternatively, described group is independently selected from halogen, hydroxyl, cyano group, nitro, C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group ,-C (O) NR
5R
5,-OR
5,-OC (O) R
5,-NR
5R
6,-C (O) R
5With-NR
5C (O) R
5R wherein
5And R
6Be independently selected from hydrogen, C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group, C
6-10Aryl-C
0-4Alkyl, C
3-8Heteroaryl-C
0-4Alkyl, C
3-12Cycloalkyl-C
0-4Alkyl and C
3-8Heterocyclylalkyl-C
0-4Alkyl; Or R
5And R
6With R
5And R
6The nitrogen-atoms that is connected forms C together
5-10Heteroaryl or C
3-8Heterocyclylalkyl; R wherein
5Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl or R
5And R
6Combined optional ground replaced by 1-4 group, described group is independently selected from halogen, hydroxyl, cyano group, nitro, C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl and halogen-replacement-C
1-6Alkoxyl group;
R
3Be selected from C
6-10Aryl, C
5-10Heteroaryl, C
3-12Cycloalkyl and C
3-8Heterocyclylalkyl; R wherein
3Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-5 group, described group is independently selected from halogen, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group ,-OXR
7,-OXC (O) NR
7R
8,-OXC (O) NR
7XC (O) OR
8,-OXC (O) NR
7XOR
8,-OXC (O) NR
7XNR
7R
8,-OXC (O) NR
7XS (O)
0-2R
8,-OXC (O) NR
7XNR
7C (O) R
8,-OXC (O) NR
7XC (O) XC (O) OR
8,-OXC (O) NR
7R
9,-OXC (O) OR
7,-OXOR
7,-OXR
9,-XR
9,-OXC (O) R
9,-OXS (O)
0-2R
9With-OXC (O) NR
7CR
7[C (O) R
8]
2Wherein X is selected from key or C
1-6Alkylidene group, wherein any methylene radical of X can be selected from C (O), NR alternatively
7, S (O)
2Substitute with the divalent group of O; R
7And R
8Be independently selected from hydrogen, cyano group, C
1-6Alkyl, halogen-replacement-C
1-6Alkyl, C
2-6Alkenyl and C
3-12Cycloalkyl-C
0-4Alkyl; R
9Be selected from C
6-10Aryl-C
0-4Alkyl, C
5-10Heteroaryl-C
0-4Alkyl, C
3-12Cycloalkyl-C
0-4Alkyl and C
3-8Heterocyclylalkyl-C
0-4Alkyl; R wherein
9Any alkyl can have by-C (O) OR
10Alternate hydrogen; And R
9Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-4 group alternatively, described group is independently selected from halogen, C
1-6Alkyl, C
3-12Cycloalkyl, halogen-replacement-C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkoxyl group ,-XC (O) OR
10,-XC (O) R
10,-XC (O) NR
10R
10,-XS (O)
0-2NR
10R
10With-XS (O)
0-2R
10R wherein
10Be independently selected from hydrogen and C
1-6Alkyl.
Second aspect present invention provides pharmaceutical composition, and it contains formula I compound or its N-oxide derivative, each isomer and isomer mixture or its pharmacy acceptable salt and one or more suitable vehicle.
Third aspect present invention provides the method for treatment Animal diseases, wherein regulate described disease can be prevented, suppresses or be improved to the LXR activity pathology and/or symptomology, this method comprises formula I compound or its N-oxide derivative, each isomer and isomer mixture or its pharmacy acceptable salt of described animal being treated significant quantity.
Fourth aspect present invention provides formula I compound to be used for the treatment of purposes in the medicine of Animal diseases in preparation, and wherein the LXR activity works to the pathology and/or the symptomology of described disease.
Fifth aspect present invention provides the method for preparation I compound and N-oxide derivative, prodrug derivatives, conjugate, protected derivative, each isomer and isomer mixture and pharmacy acceptable salt thereof.
Detailed Description Of The Invention
Definition
" alkyl " as group and as other group for example halogen-replacement-structure division of alkyl and alkoxyl group, can be for straight or branched.C
1-6-alkoxyl group comprises methoxyl group, oxyethyl group etc.The alkyl of halogen-replacement comprises trifluoromethyl, pentafluoroethyl group etc.
" aryl " refers to monocycle or the combination of condensed-bicyclic aromatic ring that contains 6-10 ring carbon atom.For example, aryl can be phenyl or naphthyl, preferred phenyl." arylidene " refers to the divalent group derived from aryl." heteroaryl " as aryl is defined, wherein one or more ring memberses are heteroatoms.For example heteroaryl comprises pyridyl, indyl, indazolyl, quinoxalinyl, quinolyl, benzofuryl, benzopyranyl, benzo thiapyran base, benzo [1,3] dioxole, imidazolyl, benzo-imidazolyl, pyrimidyl, furyl, oxazolyl, isoxazolyl, triazolyl, tetrazyl, pyrazolyl, thienyl etc." C
6-10Aryl-C
0-4Alkyl " refer to the aryl as mentioned above that connects by alkylidene group.C for example
6-10Aryl-C
0-4Alkyl comprises styroyl, benzyl etc.
" cycloalkyl " refer to contain shown in the undersaturated monocycle of saturated or part, condensed-bicyclic or the bridging of annular atoms number encircle combination more.For example, C
3-10Cycloalkyl comprises cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl etc." Heterocyclylalkyl " refers to as defined cycloalkyl among the application, condition be shown in the annular atoms one or more being selected from-O-,-N=,-NR-,-C (O)-,-S-,-S (O)-or-S (O)
2-part substitute, wherein R is hydrogen, C
1-4Alkyl or nitrogen-protecting group.For example, as the C that is used to describe The compounds of this invention among the application
3-8Heterocyclylalkyl comprises morpholino, pyrrolidyl, piperazinyl, piperidyl, piperidyl ketone, 1,4-two oxa-s-8-azepine-spiral shell [4.5] last of the ten Heavenly stems-8-base etc.
" halogen " (or halo) preferably represented chlorine or fluorine, also can be bromine or iodine.
Term with regard to lxr receptor " adjusting " refers to regulates lxr receptor and the biological activity (for example transcriptional regulatory of target gene) relevant with the LXR approach thereof.The adjusting of lxr receptor can be incremental adjustments (i.e. excitement, activation or stimulation) or decrement adjusting (being antagonism, inhibition or retardance).The mode of action of LXR conditioning agent can be for directly, for example as part by combining with lxr receptor.Regulating also can be for indirect, for example by in conjunction with and/or modify another kind of molecule, otherwise this molecule is with regard to combination and activation lxr receptor, or the generation by stimulation of endogenous lxr receptor part.Therefore, regulate the change that LXR comprises bioactive change of lxr agonist part (being the activity of its combination and/or activation lxr receptor) or part cell levels.
" treatment " refers to the method that alleviates or alleviate disease and/or its simultaneous phenomenon.
The description of preferred embodiment
The invention provides the method for compound, composition and treatment disease, wherein regulate described disease can be prevented, suppresses or be improved to the LXR activity pathology and/or symptomology, this method comprises the formula I compound of described animal being treated significant quantity.
In one embodiment, compound of the present invention is the compound of formula Ia:
Wherein:
N is selected from 1,2 and 3;
Y is selected from-CH=and-N=;
R
1Be selected from halogen, C
1-6Alkyl and-C (O) OR
4R wherein
4Be selected from hydrogen and C
1-6Alkyl;
R
2Be selected from C
6-10Aryl, C
5-10Heteroaryl, C
3-12Cycloalkyl and C
3-8Heterocyclylalkyl; R wherein
2Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-4 group alternatively, described group is independently selected from halogen, hydroxyl, C
1-6Alkyl, halogen-replacement-C
1-6Alkyl and-OC (O) R
5R wherein
5Be selected from hydrogen and C
1-6Alkyl; And
R
3Be selected from C
6-10Aryl, C
5-10Heteroaryl, C
3-12Cycloalkyl and C
3-8Heterocyclylalkyl; R wherein
3Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-5 group, described group is independently selected from halogen, hydroxyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group ,-OXR
7,-OXC (O) NR
7R
8,-OXC (O) NR
7XC (O) OR
8,-OXC (O) NR
7XOR
8,-OXC (O) NR
7XNR
7R
8,-OXC (O) NR
7XS (O)
0-2R
8,-OXC (O) NR
7XNR
7C (O) R
8,-OXC (O) NR
7XC (O) XC (O) OR
8,-OXC (O) NR
7R
9,-OXC (O) OR
7,-OXOR
7,-OXR
9,-XR
9,-OXC (O) R
9With-OXC (O) NR
7CR
7[C (O) R
8]
2Wherein X is selected from key or C
1-6Alkylidene group; R
7And R
8Be independently selected from hydrogen, cyano group, C
1-6Alkyl, halogen-replacement-C
1-6Alkyl, C
2-6Alkenyl and C
3-12Cycloalkyl-C
0-4Alkyl; R
9Be selected from C
6-10Aryl-C
0-4Alkyl, C
5-10Heteroaryl-C
0-4Alkyl, C
3-12Cycloalkyl-C
0-4Alkyl and C
3-8Heterocyclylalkyl-C
0-4Alkyl; R wherein
9Any alkyl can have by-C (O) OR
10Alternate hydrogen; And R
9Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-4 group alternatively, described group is independently selected from halogen, C
1-6Alkyl, C
3-12Cycloalkyl, halogen-replacement-C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkoxyl group ,-XC (O) OR
10,-XC (O) R
10,-XC (O) NR
10R
10,-XS (O)
0-2NR
10R
10With-XS (O)
0-2R
10R wherein
10Be independently selected from hydrogen and C
1-6Alkyl.
In another embodiment, R
1Be selected from fluorine, chlorine, methyl and-C (O) OCH
3And R
2Be selected from phenyl, cyclohexyl, cyclopentyl, pyrryl, pyrazolyl, naphthyl, benzo [1,3] dioxole, thienyl, furyl and pyridyl; R wherein
2Any aryl, heteroaryl or cycloalkyl replaced by 1-4 group alternatively, described group be independently selected from fluorine, chlorine, bromine, hydroxyl, methyl, ethyl, propyl group, the tertiary butyl, amino, dimethylamino, methoxyl group, trifluoromethyl, trifluoromethoxy and-OC (O) CH
3
In another embodiment, R
3Be selected from phenyl, benzo [1,3] dioxole, pyridyl, 2,2-two fluoro-benzo [1,3] dioxole-5-base and benzoxazolyls; R wherein
3Any aryl or heteroaryl replaced by 1-5 group, described group be independently selected from fluorine, chlorine, bromine, methoxyl group, hydroxyl, difluoro-methoxy ,-OCH
2C (O) NH
2,-OCH
2C (O) OCH
3,-OCH
2C (O) NHCH
3,-OCH
2C (O) N (CH
3)
2,-R
9,-OR
9,-OCH
2R
9,-OCH
2C (O) R
9,-OCH
2C (O) NHR
9,-OCH
2C (O) N (CH
3) R
9,-OCH
2C (O) NHCH
2R
9,-OCH
2CN ,-OCH
2C
2H
3,-OCH
2C
2H
4,-O (CH
2)
2OH ,-OCH
2C (O) NH (CH
2)
2C (O) OC
2H
5,-OCH
2C (O) NH (CH
2)
2CH
2F ,-OCH
2C (O) NHCH
2CH
2F ,-OCH
2C (O) NH (CH
2)
2C (O) OH ,-OCH
2C (O) NHCH (CH
2R
9) C (O) OC
2H
5,-OCH
2C (O) NHC (O) (CH
2)
2C (O) OCH
3,-OCH
2C (O) NH (CH
2)
2NHC (O) CH
3,-OCH
2C (O) NHCH
2C (O) C
2H
5,-OCH
2C (O) NH (CH
2)
2C (O) OC
4H
9,-OCH
2C (O) NHCH
2C (O) OC
2H
5,-OCH
2C (O) NHCH[C (O) OC
2H
5]
2,-S (O)
2CH
3,-OCH
2C (O) NHCH
2CF
3,-OCH
2C (O) NHCH
2C (O) (CH
2)
2C (O) OCH
3,-OCH
2C (O) N (CH
3) CH
2C (O) OCH
3,-OCH
2C (O) NH (CH
2)
3OC
2H
5,-OCH
2C (O) NH (CH
2)
3OCH (CH
3)
2,-OCH
2C (O) NH (CH
2)
2SCH
3,-OCH
2C (O) NHCH
2CH (CH
3)
2,-OCH
2C (O) NHCH (CH
3) CH
2OH ,-OCH
2C (O) NHCH
2CH (CH
3) C
2H
5,-OCH
2C (O) NHCH (CH
3) C (O) OC
2H
5,-OCH
2C (O) NHCH
2CH (CH
3)
2With-OCH
2C (O) (CH
2)
3OCH (CH
3)
2R wherein
9Be phenyl, cyclopropyl-methyl isoxazolyl, benzothiazolyl, furyl, furyl-methyl, tetrahydrochysene-furyl, pyridyl, 4-oxo-4,5-dihydro-thiazol-2-yl, pyrazolyl, isothiazolyl, 1,3, the 4-thiadiazolyl group, thiazolyl, styroyl, morpholino, morpholino-propyl group isoxazolyl-methyl, pyrimidyl, tetrahydrochysene-pyranyl, 2-oxo-2,3-dihydro-pyrimidine-4-base, piperazinyl, pyrryl, piperidyl, pyrazinyl, imidazolyl, imidazolyl-propyl group, benzo [1,3] dioxolyl, benzo [1,3] dioxolyl-propyl group, 2-oxo-tetramethyleneimine-1-base and 2-oxo-tetramethyleneimine-1-base-propyl group; R wherein
9Any alkyl can have by-C (O) OC
2H
5Alternate hydrogen; R wherein
9Any aryl, heteroaryl or Heterocyclylalkyl replaced by 1-4 group alternatively, described group be independently selected from methyl, ethyl, cyclopropyl, methoxyl group, trifluoromethyl ,-OC (O) CH
3,-COOH ,-S (O)
2NH
2,-CH (NH
2)=NOH ,-C (O) OC
2H
5,-CH
2C (O) OH ,-CH
2C (O) OC
2H
5,-CH
2C (O) OCH
3,-C (O) OCH
3,-C (O) NH
2,-C (O) NHCH
3With-C (O) CH
3
Describe preferred formula I compound in embodiment hereinafter and the Table I in detail.
Pharmacology and application
Compound of the present invention is regulated the active of LXR and be can be used for treating wherein LXR like this to pathology and/or the effective disease of symptomology or the illness of described disease.The present invention further provides The compounds of this invention and be used for the treatment of LXR wherein to the purposes in the medicine of the pathology of described disease and/or the effective disease of symptomology or illness in preparation.The disease or the sufferer of LXR mediation comprise: inflammation; Cardiovascular disorder comprises atherosclerosis, arteriosclerosis, hypercholesterolemia, hyperlipidaemia and glucose homeostasis obstacle, comprises insulin resistant, type ii diabetes, and fat.
Lipoprotein metabolism is a kind of dynamic process composed as follows: produce the particle be rich in triglyceride level and cholesterol as vldl (VLDL), modified hdl particle in these blood plasma (VLDL to intermediate density (IDL) to low-density lipoprotein (LDL)) and removed described particle from blood plasma by liver again from liver.This process provides triglyceride and free cholesterol to somatic transhipment.The inverse transport of cholesterol is the mechanism of being advised, the cholesterol excessive by this mechanism turned back to the liver from the hepatic tissue outside.
This process is undertaken by high-density lipoprotein (HDL) (HDL) cholesterol.Lipoprotein (VLDL, HDL) produces from liver, the modification of blood plasma endoparticle (all) and to remove the combination turn back to liver subsequently be the reason of stable state cholesterol concentration in the blood plasma.Compound of the present invention increases the inverse transport of cholesterol by increasing cholesterol from the outflow of artery.The present invention includes The compounds of this invention and be used for increasing the purposes of the medicine of cholesterol inverse transport in preparation.In addition, the invention provides the compound that is used for suppressing cholesterol absorption and compound of the present invention are used to suppress the medicine of clean cholesterol absorption in preparation purposes.
Compound of the present invention can also be used for prevention or treatment inflammation and neurodegenerative disease or nervous disorders.Therefore, the present invention also provides the method for prevention or treatment inflammation and the method for prevention or treatment neurodegenerative disease or nervous disorders, and particularly impaired or inflammation is the neurodegenerative disease or the illness of feature with the neuronal degeneration among the CNS, neuronal damage or plasticity-.Therefore the specified disease or the sufferer that are characterised in that neuronal degeneration in the brain, inflammation, cholesterol and dyslipidemias and have benefited from neure growth and/or reparation comprise apoplexy, alzheimer's disease, volume temporo dementia (tauopathy), peripheral neurophaty, Parkinson's disease, the dementia that has centrality multiwalled corps ronds, Huntington Chorea, amyotrophic lateral sclerosis and multiple sclerosis and Ni-Pi disease.Be characterised in that disease or sufferer that neuronal degeneration and/or plasticity-are impaired comprise: psychosis, as schizophrenia and dysthymia disorders.Be characterised in that the specified disease of neuronal damage or sufferer comprise those with brain and/or Spinal injury, comprise the sufferer that wound is relevant.In addition, compound of the present invention can be used for the treatment of or prevent various diseases with inflammatory component, as rheumatoid arthritis, osteoarthritis, psoriatic, asthma etc.
Lxr agonist improves glucose tolerance and strengthens glut4 expresses (the 12/23/2002 U.S. Provisional Patent Application US60/436 that submits to, 112; The 12/22/2002 U.S. Patent application US10/745 that submits to, 334).There is the collaborative adjusting of the related gene of glucose metabolism in liver and the fatty tissue.In liver, several expression of gene that the lxr agonist inhibition is overstated and wanted the liver glycogen heteroplasia, for example expression of PGC-l α, phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase.Suppress these glycogen heteroplasia genes and follow inducing of glucokinase expression, this kind of enzyme can promote the hepatic glucose utilization.Find that also glut4 mRNA level is enhanced by lxr agonist incremental adjustments and the glucose uptake in external 3T3-L1 adipocyte in the fatty tissue.
Find according to these, the invention provides the method that strengthens glut4 expression in experimenter's cell, undertaken by giving compound of the present invention to described experimenter.The present invention also provides the method for treatment diabetes and associated conditions such as obesity or hyperglycemia, carries out with the symptom of improving described disease by the The compounds of this invention that the experimenter is given significant quantity.For example, type ii diabetes is suitable for method treatment of the present invention.By strengthening the susceptibility of cell, use compound of the present invention and can also treat other and be characterised in that Regular Insulin dysfunction (for example opposing, inactivation or shortage) and/or glucose change the insufficient disease of cell over to Regular Insulin and glucose uptake.
Compound of the present invention also is adjusted in the many expression of gene levels that play an important role in the liver glycogen heteroplasia.Therefore, the present invention further provides the method that reduces experimenter's glycogen heteroplasia by the expression of regulating these genes (for example PGC-1 and PEPCK).
In pancreas, the LXR activation stimulates insulin secretion by the metabolism of glucose and lipid in the adjusting pancreas beta cell, thereby has pointed out the another kind of mechanism of LXR antidiabetic effect.The LXR conditioning agent can also be secreted from pancreas by increase Regular Insulin thus and regulate glucose tolerance.
According to foregoing description, the present invention further provides the method for preventing or treating above-mentioned any disease or illness in the experimenter of this class treatment of needs, this method comprises (" administration and the pharmaceutical composition " part in vide infra) formula I compound or its pharmacy acceptable salt of described experimenter being treated significant quantity.For any such use, required dosage is different with administering mode, the specified disease of being treated and required effect.
Administration and pharmaceutical composition
Generally speaking, The compounds of this invention is with the treatment significant quantity, give separately or with one or more therapeutical agents combinations via arbitrarily commonly used and acceptable manner as known in the art.The treatment significant quantity can be with the effect of severity, subject age and relative health condition, the compound used therefor of disease and other factors and wide variations.Generally speaking, obtain gratifying whole body effect in the every day of about 0.03-2.5mg/kg/ body weight under the dosage.Than large mammals for example among the people suitable every day dosage in the about 100mg scope of about 0.5mg-, for example, with 4 times fractionated dose or every day at the most to delay form administration expediently.The suitable unit dosage that is used for oral administration comprises about 1-50mg activeconstituents.
The approach that compound of the present invention can pass through any conventional is as the pharmaceutical composition administration, and is particularly by intestines, for example oral, for example is tablet or capsule form; Or, for example be Injectable solution or suspension form by parenteral; The part, for example be lotion, gel, ointment or cream or with nose with or suppository form or suction form.The The compounds of this invention that comprises free form or pharmaceutically-acceptable salts form and the pharmaceutical composition of at least a pharmaceutically acceptable carrier or thinner can be by conventional methods, through mix, granulation or coating method preparation.For example, oral compositions can be tablet or gelatine capsule, they comprise active ingredient and: a) thinner, for example lactose, glucose, sucrose, mannitol, sorbyl alcohol, Mierocrystalline cellulose and/or glycine; B) lubricant, for example silicon-dioxide, talcum powder, stearic acid, its magnesium or calcium salt and/or polyoxyethylene glycol; With regard to tablet, also comprise c) tackiness agent, for example neusilin, starch paste, gelatin, tragakanta, methylcellulose gum, Xylo-Mucine and/or polyvinylpyrrolidone; If desired, also have d) disintegrating agent, for example starch, agar, alginic acid or its sodium salt or effervescent mixture; And/or e) absorption agent, tinting material, correctives and sweetener.Injectable composition can be aqueous isotonic solutions or suspension, and suppository can be by lipomul or suspension preparation.These compositions can be for aseptic and/or contain adjuvant, as sanitas, stablizer, wetting agent or emulsifying agent, dissolution accelerator, be used to regulate the salt and/or the buffer reagent of osmotic pressure.In addition, they can also contain upward valuable material of other treatment.The appropriate formulation that is used for the transdermal application comprises the The compounds of this invention and the carrier of significant quantity.Carrier can comprise that absorbable pharmaceutically acceptable solvent is to help by host's skin.For example, transdermal device is a form of bandage, comprises that the storage of mounting back member (backingmember), containing the compound that is mixed with carrier alternatively, optional rate-controlling barrier are to be delivered to host's skin with compound and to make device and skin fixed apparatus with controlled and set rate in time limit time expand.Can also use the matrix preparation capable of permeating skin.The appropriate formulation that be used for topical application, for example is applied in skin and eye is preferably the aqueous solution well-known in the art, ointment, creme or gel.This class preparation can contain solubilizing agent, stablizer, tension-elevating agent, buffer reagent and sanitas.
Compound of the present invention can be with treatment significant quantity and one or more therapeutical agent co-administereds (drug regimen).For example, use other to be used for the treatment of the material of cardiovascular, inflammation and/or neurodegenerative disease, can act synergistically.The example of this compounds comprises the special class (fibrates) of shellfish, TZD, N1,N1-Dimethylbiguanide etc.If compound of the present invention and other therapies are given jointly, the dosage of so common administered compound is different with the type of the medicine of common use, used concrete medicine, the disease of being treated etc. certainly.
The present invention also provides drug regimen, and medicine box for example comprises: a) first kind of promoting agent of the The compounds of this invention that discloses for this paper, and it is free form or pharmacy acceptable salt form; And b) promoting agent of at least a common use (co-agent).This medicine box comprises its administration specification sheets.
Term used herein " co-administered " or " Combined Preparation " etc. refer to and comprise therapeutical agent that single patient is selected and in order to comprise that promoting agent wherein is not necessarily by identical route of administration or the treatment plan that gives simultaneously.
Term used herein " drug regimen " refers to and mixes or merge more than one active ingredients and the product that obtains and comprise the product fixing and combination of on-fixed active ingredient.Term " fixed combination " refers to single entities or dosage and gives activeconstituents to the patient simultaneously, for example formula I compound and the common promoting agent that uses.Term " on-fixed combination " refer to activeconstituents, for example formula I compound and the common promoting agent that uses as independent entity simultaneously, follow or do not have concrete time limitation successively the patient to be given, wherein this class administration provides 2 kinds of compounds of treatment level of significance in patient's body.The latter also can be applicable to drug cocktail therapy (treatment), for example gives activeconstituents more than 3 kinds or 3 kinds.
The method for preparing The compounds of this invention
The present invention also comprises the method for preparing The compounds of this invention.In described reaction, if in end product, need, have necessary protective reaction functional group, for example hydroxyl, amino, imino-, sulfo-or carboxyl are so that avoid them to participate in unwanted reaction.Can use protecting group commonly used according to standard practices, for example, at " ProtectiveGroups in Organic Chemistry ", John Wiley and Sons are described in 1991 referring to T.W.Greene and P.G.M.Wuts.
Formula I compound can prepare by the process among the following reaction scheme I:
Reaction scheme I
Wherein n, Y, Z, R
1, R
2And R
3Such as in the summary of the invention definition.Formula I compound can be prepared as follows: make the reaction of formula 2 compounds and formula 3 compounds and production 4 compounds, make formula 4 compounds further with the reaction of the compound of formula 5 or 6.Total overall reaction is carried out in the presence of suitable solvent (for example methylene dichloride etc.) and suitable alkali (for example DIEA etc.).This is reflected at and carries out and continue to reach 20 hours under the about 30 ℃ temperature of about 5-and finish.
Other method of preparation The compounds of this invention
By free alkali form and pharmaceutically acceptable mineral acid or the organic acid reaction that makes compound, compound of the present invention can be made pharmaceutically-acceptable acid addition.Perhaps, by free acid form and pharmaceutically acceptable mineral alkali or the organic bases reaction that makes compound, can prepare the pharmaceutically acceptable base addition salt of The compounds of this invention.Perhaps, the salt form of The compounds of this invention can use the salt preparation of raw material or intermediate.
The free acid of The compounds of this invention or free alkali form can be respectively by corresponding base addition salt or the preparations of acid salt form.For example, by handling, the acid salt form of The compounds of this invention can be changed into corresponding free alkali with suitable alkali (for example solution of ammonium hydroxide, sodium hydroxide etc.).By handling, the base addition salt form of The compounds of this invention can be changed into corresponding free acid with suitable acid (for example hydrochloric acid etc.).
By handling in suitable inert organic solvents (for example acetonitrile, the ethanol, diox aqueous solution etc.) with reductive agent (for example sulphur, sulfurous gas, triphenyl phosphine, lithium borohydride, sodium borohydride, phosphorus trichloride, phosphorus tribromide etc.), can prepare the not oxidised form of The compounds of this invention by the N-oxide compound of The compounds of this invention at 0-80 ℃.
By well known to a person skilled in the art that method can prepare the prodrug derivatives of The compounds of this invention and (for example further describe in detail referring to Saulnier etc., (1994), Bioorganic andMedicinal Chemistry Letters, Vol.4, p.1985).For example, by making not derived compounds of the present invention and suitable carbamyl reagent (for example 1,1-acyloxy alkyl carbanochloridate, carbonic acid be right-nitro phenyl ester etc.) reaction, can prepare the suitable precursor medicine.
By well known to a person skilled in the art that mode can prepare the protected derivative of The compounds of this invention.The detailed description that is suitable for generating protecting group and removing technology is found in T.W.Greene, and " Protecting Groups in Organic Chemistry ", the 3rd edition, John Wiley and Sons, Inc. is in 1999.
Compound of the present invention can be in the method for the invention expediently as solvate (for example hydrate) preparation or formation.As dioxin, tetrahydrofuran (THF) or methyl alcohol recrystallization from water/ORGANIC SOLVENT MIXTURES, can prepare the hydrate of The compounds of this invention by with an organic solvent expediently.
Compound of the present invention can followingly be made its each steric isomer: racemic mixture and the reaction of optically active resolution reagent by making compound, so that it is right to form the diastereomer compound, separates diastereomer and reclaim optically pure enantiomorph.Although use the covalency non-enantiomer derivative of The compounds of this invention can split enantiomorph, preferably can dissociated mixture (for example crystallization diastereoisomeric salt).Diastereomer has different physical property (for example fusing point, boiling point, solubleness, reactivity etc.) and can utilize these differences easily to separate.Diastereomer can be by chromatography or preferred by the separation/disassemble technique separation based on different solubility.Reclaim optically pure enantiomorph and resolution reagent by any practical mode that can not cause racemization then.Racemic mixture can use chirality HPLC to split.The more detailed description of technology that is used for splitting from racemic mixture the steric isomer of compound is found in Jean Jacques, Andre Collet, Samuel H.Wilen, " Enantiomers; Racemates and Resolutions ", John Wiley and Sons, Inc., 1981.
Generally, formula I compound can prepare by the following method, and this method comprises:
(a) method of reaction scheme I; With
(b) alternatively compound of the present invention is changed into pharmacy acceptable salt;
(c) alternatively the salt form of The compounds of this invention is changed into salt-independent shape;
(d) alternatively the not oxidised form of The compounds of this invention is changed into pharmaceutically acceptable N-oxide compound;
(e) alternatively the N-oxide form of The compounds of this invention is changed into its not oxidised form;
(f) from isomer mixture, split each isomer of The compounds of this invention alternatively;
(g) alternatively the not derivative form of The compounds of this invention is changed into pharmaceutically acceptable prodrug derivatives;
(h) alternatively the prodrug derivatives of The compounds of this invention is changed into its non-derivative form.
If the preparation of raw material is described especially, then these compounds are known or can be according to preparing with similar mode of approach well known or the mode that hereinafter discloses among the embodiment.
It will be appreciated by those skilled in the art that: above-mentioned conversion only is the representative method of preparation The compounds of this invention, can use other well-known method similarly.
Embodiment
Further illustrate the present invention by the following example but do not play the qualification effect, these embodiment are used to explain the preparation of compound of Formula I of the present invention.
Embodiment 1
5-(4-chloro-phenyl)-2-(2-difluoro-methoxy-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2-fluoro-phenyl)-ketone
The preparation of 4-chloro-thiobenzoic acid hydrazides
The solution H of KOH (1.06mol) in 400mL EtOH with half volume
2S is saturated.This solution is merged with second half KOH solution again, with gained solution at 45-50 ℃ and N
2Stir in the environment, add 4-chlorobenzotrichloride (0.25mol) then, the speed of adding makes temperature remain on 50-60 ℃ (～1.5 hours).This scarlet mixture was refluxed 30 minutes, use Mono Chloro Acetic Acid (0.35mol) and NaHCO then
3(0.35mol) at H
2Solution-treated among the O (200mL).With other 5 minutes of this reaction mixture reheat under reflux state.The brown-red solution of decantation gained from tackifying resin is acidified to pH=1 with dense HCl.This red solution produces (4-chloro-thiobenzoyl sulfenyl)-acetate when crystallization:
1H NMR (400MHz, CDCl
3): δ 7.75 (d, 2H), 7.15 (d, 2H), 4.04 (s, 2H).
In (4-chloro-thiobenzoyl the sulfenyl)-mixture of acetate (8.31mmol) in 9mL NaOH (1N), add hydrazine hydrate (36.7mL).In this solution, add Glacial acetic acid (2.7mL) then, this mixture of vigorous stirring.Use CH
2Cl
2Dilute this reaction mixture, use MgSO
4Dry organic layer obtains 4-chloro-thiobenzoic acid hydrazides: LC/MS (ES+) 186.9 (M+1)
+
To 4-chloro-thiobenzoic acid hydrazides (0.107mmol) at CH
2Cl
2Add 2-difluoro-methoxy-phenyl aldehyde (0.128mmol) and DIEA (0.128mmol) in the heterogeneous mixture (1mL).After 10 minutes, this mixture becomes evenly, confirms to react by TLC and LCMS and finishes, and obtains 5-(4-chloro-phenyl)-2-(2-difluoro-methoxy-phenyl)-2,3-dihydro-[1,3,4] thiadiazoles, and evaporating solvent is not used it for next step.
To 5-(4-chloro-phenyl)-2-(2-difluoro-methoxy-phenyl)-2, add DIEA (0.16mmol) and 2-fluorobenzoyl chloride (0.16mmol) in the solution of 3-dihydro-[1,3,4] thiadiazoles, with this reaction mixture stirring at room 12 hours.Behind evaporating solvent, by automatic chromatography purification resistates (hexane/EtOAc), obtain
5-(4-chloro-phenyl)-2-(2-difluoro-methoxy-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2- The fluoro-phenyl)-ketone:
1H NMR (400MHz, CDCl
3): δ 7.39-7.35 (m, 1H), 7.34-7.29 (m, 4H), 7.25 (dd, J
1=7.8Hz, J
2=1.2Hz, 1H), 7.19-7.13 (m, 3H), 7.04 (m, 1H), 6.97 (m, 2H), 6.50 (dd, J
1=71.6Hz, J
2=71.2Hz, 1H).LC/MS：(ES+)462.8(M+1)
+。
Embodiment 2
2-{2-[5-(4-chloro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-base-benzene
The oxygen base]-ethanamide
To 4-chloro-thiobenzoic acid hydrazides (1.3mmol) at 12mL CH
2Cl
2In heterogeneous mixture in add 2-(2-formyl radical phenoxy group) ethanamide (1.53mmol) and DIEA (1.53mmol).After 10 minutes, this mixture becomes evenly, confirms to react by TLC and LCMS and finishes, and obtains 2-(2-(5-(4-chloro-phenyl-)-2,3-dihydro-1,3,4-thiadiazoles-2-yl) phenoxy group)-ethanamide, and evaporating solvent is not used it for next step like this.
In the solution of 2-(2-(5-(4-chloro-phenyl-)-2,3-dihydro-1,3,4-thiadiazoles-2-yl) phenoxy group) ethanamide, add DIEA (2.0mmol) and 2,4,6-three-fluorobenzoyl chloride (2.0mmol), with this reaction mixture stirring at room 12 hours.Behind evaporating solvent, by automatic chromatography purification resistates (hexane/EtOAc), obtain
2-{2-[5-(4-chloro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] Thiadiazoles-2-yl]-phenoxy group }-ethanamide: 1H NMR (400MHz, CDCl
3): δ 7.43 (s, 1H), 7.27 (d, J=8.8,2H), 7.15 (m, 2H), 7.14 (d, J=8.4Hz, 2H), 6.99 (bs, 1H), 6.84 (t, J=6.4Hz, 3H), 6.66 (d, J=8.4Hz, 1H), 6.53 (t, J=8.0Hz, 2H), 5.29 (bs, 1H), 4.47 (d, J=1.6Hz, 2H); LC/MS:(ES+) 506.2 (M+1)
+
Embodiment 3
2-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-
Base]-6-methoxyl group-phenoxy group }-ethanamide
The preparation of 4-fluorobenzene thio-hydrazide trifluoroacetate or hydrochloride
In the solution of 4-fluorobenzoic acid (35.7mmol) in 72mL DMF and THF (1: 1) mixture, add tert-butyl carbazate (37.5mmol), EDC (39.3mmol) and N, N-Dimethylamino pyridine (0.54mmol).After 10 minutes, this mixture becomes evenly, continues to stir 3 hours, up to finishing by TLC and LC/MS confirmation reaction.With this reaction mixture impouring ice.After adding ether, separate organic layer.With sodium pyrosulfate, saturated sodium bicarbonate and saturated nacl aqueous solution washing organic layer, use dried over mgso, concentrate, obtain N '-(4-fluoro-benzoyl)-hydrazine t-butyl formate: MS:(ES+) 255 (M+1)
+
In the N '-mixture of (4-fluoro-benzoyl)-hydrazine t-butyl formate (11.1mmol) in the anhydrous THF of 10mL, add Lawesson ' s reagent (11.6mmol), this mixture was heated 20 minutes in 80 ℃ of microwave ovens.Concentrate this reaction mixture, by using the automatization column chromatography purifying of hexane/EtOAc:
1H NMR (400MHz, CDCl
3): δ 9.8 (bs, 1H), 9.05 (bs, 1H); 8.0-7.97 (m, 2H), 7.31 (t, J=8.4Hz, 2H), 1.73 (s, 9H) .LC/MS:(ES+) 271 (M+1)
+
Trifluoroacetate: to N '-(4-fluoro-thiobenzoyl)-hydrazine t-butyl formate (1.97mmol) at CH
2Cl
2In solution in add trifluoroacetic acid (3mL) and thioanisole (2.7mmol).With this mixture stirring at room 1 hour.Behind the evaporating solvent, by this mixture of automatization column chromatography purifying (hexane/EtOAc), obtain 4-fluoro-thiobenzoic acid hydrazides trifluoroacetate:
1H NMR (400MHz, CDCl
3): δ 9.5 (bs, 3H), 7.8-7.76 (m, 2H), 7.05 (t, J=8.4Hz, 2H); LC/MS:(ES+) 171 (M+1)
+
Hydrochloride: in N '-(4-fluoro-thiobenzoyl)-hydrazine t-butyl formate (18.5mmol), add and contain 1 of HCl (4N), 4-diox (185mmol).With this mixture stirring at room 1 hour.Add hexane with further precipitated product.Filter out product, obtain 4-fluoro-thiobenzoic acid hydrazides hydrochloride:
1HNMR (400MHz, CH
3OD) δ 7.8-7.75 (m, 2H), 7.09 (t, J=11.6Hz, 2H) .LC/MS:(ES+), 171 (M+1)
+
The preparation of 3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl aldehyde
O-Vanillin (26.3mmol) is mixed in microwave container with TIPSCl (39.6mmol) and imidazoles (78.7mmol).This mixture was heated 3 minutes in 100 ℃ of microwaves.With EtOAc (100mL) dilution oily mixture, use NaHSO
4(1M) (2x50mL) and salt solution (50mL) dilution.Use MgSO
4After the drying, concentrated filtrate.By silicon-dioxide purified by flash chromatography gained crude mixture (2%EtOAc/ hexane), obtain 3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl aldehyde, be oily matter:
1H NMR (400MHz, CDCl
3): δ 10.6 (s, 1H), 7.38 (dd, J
1=1.6Hz, J
2=8Hz, 1H), 7.04 (dd, J
1=1.6Hz, J
2=8Hz, 1H), 6.93 (td, J
1=8Hz, J
2=0.8Hz, 1H), 3.82 (s, 3H), 1.34-1.25 (m, 3H), 1.1 (s, 18H); LC/MS (ES+): 309 (M+1)
+
To 4-fluoro-thiobenzoic acid hydrazides salt (2.06mmol) at 8mL CH
2Cl
2In heterogeneous mixture in add 3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl aldehyde (2.27mmol) and DIEA (4.13mmol).After 15 minutes, this mixture becomes evenly, confirms to react by TLC and LCMS and finishes, and obtains 5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-2,3-dihydro-[1,3,4] thiadiazoles, and evaporating solvent is not used it for next step.
To 5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-2,3-dihydro-[1,3,4] add DIEA (3.09mmol) and 2 in the solution of thiadiazoles, 4,6-three-fluorobenzoyl chloride (3.09mmol), with this reaction mixture stirring at room 12 hours.After concentrating, by automatization column chromatography purifying resistates (hexane/EtOAc), obtain [5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone.
In [5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone (32.3mol), add and contain tetrabutyl ammonium fluoride (1M) tetrahydrofuran (THF) (48.5mol).This mixture was stirred 1 hour, add 2-bromo-ethanamide (48.5 μ mol).With this mixture stirring at room 12 hours.Behind the evaporating solvent, by preparation type LC/MS (20-100%MeCN/H
2O) the purifying resistates obtains
2-{2-[5-(4-fluoro-benzene Base)-and 3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-6-methoxyl group-phenoxy group- Ethanamide:
1H NMR (400MHz, CDCl
3): δ 7.63-7.62 (m, 2H), 7.57 (s, 1H), 7.22-7.12 (m, 3H), 7.02 (dd, J
1=8.4Hz, J
2=2Hz, 2H), 6.9 (bs, 1H), 6.85 (t, J=8.4Hz, 2H), 6.10 (s, 1H), 4.83 (d, J=15.2Hz, 1H), 4.68 (d, J=15.2Hz, 1H), 3.94 (s, 3H).
Embodiment 4
3-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-
Base]-2-methoxyl group-phenoxymethyl }-methyl benzoate
The preparation of 2-methoxyl group-3-tri isopropyl silane oxygen base-phenyl aldehyde
(2-methoxyl group-phenol 34.6mmol) mixes in test tube with TIPSCl (51.9mmol) and imidazoles (103.8mmol) with methyl catechol.This mixture was heated 3 minutes in 180 ℃ of microwave ovens.With EtOAc (100mL) dilution oily mixture, use NaHSO
4(1M) (2x50mL) and salt solution (50mL) washing.Use anhydrous Na
2SO
4After the drying, concentrated filtrate.Crude mixture (2%EtOAc/ hexane) by silicon-dioxide purified by flash chromatography gained obtains triisopropyl-(2-methoxyl group-phenoxy group)-silane, is colorless oil.Productive rate: 69%.
1H?NMR(400MHz，CDCl
3)：δ6.8-6.89(m，4H)，3.8(s，3H)，1.22-1.28(m，3H)，1.1(s，9H)，1.08(s，9H).LC/MS(ES
+)：(M+1)，281.2。R
f=0.8 (5%EtOAc/ hexane).(note: perhaps can adopt conventional heating, NMP is selected solvent in this case).
NBuLi (2.5M in hexane) (36mmol) was mixed in the exsiccant round-bottomed flask 10 minutes at 0 ℃ with TMEDA (36mmol).In said mixture, add the triisopropyl-solution of (2-methoxyl group-phenoxy group)-silane (24mmol) in the anhydrous THF of 25mL.In 2 hours by remove ice bath with this mixture temperature to room temperature.In room temperature this yellow solution is changed in another drying receptacle that contains 7.5mLDMF then.This mixture stirring is spent the night.In this mixture, add HCl (1M) so that the reaction quencher.Dilute this mixture with EtOAc (100mL), with HCl (1M) (2X100mL) and salt solution (50mL) wash, finally use anhydrous Na
2SO
4Dry.Carry out purifying (5%EtOAc/ hexane) by the silicon-dioxide flash chromatography, obtain 3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl aldehyde, be colorless oil, it need be at low tempertaure storage:
1H NMR (400MHz, CDCl
3): δ 10.4 (s, 1H), 7.42 (dd, J
1=7.7Hz, J
2=1.7Hz, 1H), 7.67 (d, J
1=8Hz, J
2=1.7Hz, 1H), 7.04 (t, J=8.4Hz, 1H), 3.96 (s, 3H), 1.26-1.35 (m, 3H), 1.13 (s, 9H), 1.12 (s, 9H).LC/MS(ES
+)：(M+1)309.2。R
f=0.4 (5%EtOAc/ hexane).
In room temperature and exsiccant round-bottomed flask, N '-(4-fluoro-thiobenzoyl)-hydrazine t-butyl formate (1.23mmol) is dissolved in 5mL CH
2Cl
2In this solution, add TFA (2mL) and remove ester group in room temperature.Measure as LC/MS, afterreaction was finished in 30 minutes.Remove in a vacuum and desolvate.On valve tube,, be dissolved in the anhydrous CH of 1mL with dry 30 minutes of gained oily matter
2Cl
2This solution is joined 3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl aldehyde (1.23mmol) and DIEA (4.9mmol) at the anhydrous CH of 1mL
2Cl
2Mixture in.Mixture was placed 5 minutes with having in the presence of the molecular sieve in room temperature.Add 2,4,6-trifluorobenzoyl chloride (1.6mmol) keeps this reaction mixture 16 hours in room temperature.In this mixture, add HCl (1M) (10mL) so that the reaction quencher.Dilute this mixture with EtOAc (50mL), with HCl (1M) (2X10mL) and salt solution (50mL) wash, use anhydrous Na
2SO
4Dry.Carry out purifying (5%EtOAc/ hexane) by the silicon-dioxide flash chromatography, obtain [5-(4-fluoro-phenyl) 2-(2-methoxyl group-3-tri isopropyl silane oxygen base-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone, be colorless oil:
1H NMR (400MHz, CDCl
3): δ 7.54 (dd, J
1=8.8Hz, J
2=5.3Hz, 2H), 7.51 (s, 1H), 7.04 (t, J=8.6Hz, 2H), 6.95 (t, J=7.8Hz, 1H), 6.87 (t, J=8.8Hz, 2H), 6.77 (t, J=7.9Hz, 2H), 4.03 (s, 3H), 1.27-1.36 (m, 3H), 1.14 (dd, J
1=J
2=6.3Hz, 18H); LC/MS (ES
+): (M+1) 309.2.R
f=0.4 (5%EtOAc/ hexane).
Use tetrabutyl ammonium fluoride (1M in THF) (0.04mmol) with [5-(4-fluoro-phenyl)-2-(2-methoxyl group-3-tri isopropyl silane oxygen base-phenyl)-[1 in room temperature, 3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone (0.02mmol) handled 30 minutes.Add 3-brooethyl-methyl benzoate (0.04mmol) then.After 30 minutes, measure as LC/MS, reaction is finished.With this mixture of dilution in acetonitrile, by preparation type LC/MS purifying (20-100%MeCN/H
2O), behind the evaporating solvent, obtain
3-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2- Base]-2-methoxyl group-phenoxymethyl }-methyl benzoate, be white solid:
1H NMR (400MHz, CDCl
3): δ 8.14 (s, 1H), 8.02 (d, J=7.8Hz, 1H), 7.67 (d, J=7.7Hz, 1H), 7.47-7.55 (m, 4H), 7.01-7.07 (m, 3H), 6.94 (t, J=8.3Hz, 2H), 6.77 (t, J=8.5Hz, 2H), 5.16 (s, 2H), 4.07 (s, 3H), 3.94 (s, 3H).LC/MS(ES
+)：(M+1)610.9。
Embodiment 5
4-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-
Base]-2-methoxyl group-phenoxymethyl }-phenylformic acid
Use tetrabutyl ammonium fluoride (1M in THF) (0.04mmol) with [5-(4-fluoro-phenyl)-2-(2-methoxyl group-3-tri isopropyl silane oxygen base-phenyl)-[1 in room temperature, 3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone (0.02mmol) handled 30 minutes.Analyze by/MS and to confirm that reaction finishes.Add 4-brooethyl-methyl benzoate (0.04mmol).After 30 minutes, measure as LC/MS, reaction is finished.After MeOH (0.5mL) dilution, add LiOH (1M) (0.5mL).Stir after 1 hour, from reaction mixture, remove and desolvate.In resistates, add the mixture of MeOH/DMSO, filter gained solution.By preparation type LC/MS (20-100%MeCN/H
2O) purifying settled solution except that after desolvating, obtains 4-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-2-methoxyl group-phenoxymethyl }-phenylformic acid, be white solid:
1H NMR (400MHz, CDCl
3): δ 8.14 (d, J=8Hz, 2H), 7.53-7.58 (m, 5H), 7.03-7.05 (m, 3H), 6.94-6.95 (m, 2H), 6.77 (t, J=8.2Hz, 2H), 5.2 (s, 2H), 4.08 (s, 3H); LC/MS (ES
+): (M+1) 597.3.
Embodiment 6
2-{2-[5-(4-chloro-phenyl-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl)-benzene
The oxygen base]-N-methyl-ethanamide
(2-formyl radical-phenoxy group)-acetate (0.5mmol) is dissolved in 1mL CH
2Cl
2Add oxalyl chloride (0.066mL) and 1 DMF.After 1 hour, from this mixture, remove and desolvate.The gained resistates is dissolved in 1mL CH
2Cl
2, join the NH of 1mL in THF in envrionment temperature
2Among the Me (2M).Stir after 16 hours, remove and desolvate,, obtain product 2-(2-formyl radical-phenoxy group)-N-methyl-ethanamide, be white-yellowish solid: LC/MS (ES by this mixture of preparation type TLC (10%MeOH/EtOAc) purifying
+): 194.1 (M+1)
+
2-(2-formyl radical-phenoxy group)-N-methyl-ethanamide (0.0311mmol) is joined the 0.1mL CH that contains 4-chloro-thiobenzoic acid hydrazides (0.0342mmol)
2Cl
2In.After 10 minutes, add DIEA (0.05mL) and 2,4,6-three fluoro-Benzoyl chlorides (0.0467mmol).This mixture is remained on ambient temperature overnight.Except that after desolvating, by preparation HPLC (20-100%MeCN/H
2The O gradient) the purifying resistates obtains product
2-{2-[5-(4-chloro-phenyl-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro -[1,3,4] thiadiazoles-2-yl)-phenoxy group]-N-methyl-ethanamide, be pale solid: LC/MS (ES
+): 520.1 (M+1)
+
Embodiment 7
N-cyclopropyl methyl-2-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4]
Thiadiazoles-2-yl]-2-methoxyl group-phenoxy group }-ethanamide
[the 5-(4-fluoro-phenyl)-2-(2-methoxyl group-3-tri isopropyl silane oxygen base-phenyl)-[1 that (4.97mmol) will prepare as described in example 4 above with tetrabutyl ammonium fluoride (1M in THF) in room temperature, 3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone (3.31mmol) handled 40 minutes.Add methyl bromoacetate (4.97mmol) then.After 12 hours, measure as LC/MS, reaction is finished.Carry out purifying by silicon-dioxide flash chromatography (25%EtOAc/ hexane), obtain 3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-2-methoxyl group-phenoxy group }-methyl acetate:
1H NMR (400MHz, CDCl
3): δ 7.52 (m, 3H), 7.04 (m, 3H), 6.95 (dd, J
1=8.4Hz, J
2=1.6Hz, 1H), 6.82 (dd, J
1=8Hz, J
2=1.6Hz), 6.76 (m, 2H), 4.7 (s, 2H), 4.1 (s, 3H); LC/MS (ES
+): 505.1 (M+1)
+
To { 3-[5-(4-fluoro-phenyl)-3-(2; 4,6-three fluoro-benzoyls)-2,3-dihydro-[1; 3,4] thiadiazoles-2-yl]-2-methoxyl group-phenoxy group }-add LiOH (1M) (25mL) in the solution of methyl acetate (2.47mmol) in the mixture of 30mL THF and MeOH (3: 2).After stirring 12 hours, to measure as LC/MS, reaction is finished.Dilute this reaction with ethyl acetate and water, use the salt water washing, use MgSO
4Drying is removed from this reaction mixture and is desolvated, obtain 3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-2-methoxyl group-phenoxy group }-acetate: LC/MS (ES
+): 521.1 (M+1)
+
To { 3-[5-(4-fluoro-phenyl)-3-(2; 4; 6-three fluoro-benzoyls)-2; 3-dihydro-[1; 3,4] thiadiazoles-2-yl]-2-methoxyl group-phenoxy group }-add DIEA (0.058mmol), HATU (0.058mmol) and cyclopropyl-methylamine (0.058mmol) in the solution of acetate (0.029mmol) in 1mL DMF.This reaction mixture was stirred 12 hours.By preparation type LC/MS (20-100%MeCN/H
2O) this mixture of purifying obtains
N-cyclopropyl methyl-2-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3- Dihydro-[1,3,4] thiadiazoles-2-yl }-2-methoxyl group-phenoxy group }-ethanamide:
1H NMR (400MHz, CDCl
3): δ 7.55-7.51 (m, 3H), 7.12-6.99 (m, 4H), 6.9 (d, J=7.6Hz, 2H), 6.77 (t, J=8.4Hz, 2H), 4.56 (s, 2H), 4.08 (s, 3H), 3.26-3.2 (m, 2H), 1.02-0.99 (m, 1H), 0.57-0.52 (m, 2H), 0.25 (m, 2H); LC/MS (ES
+): 574.1 (M+1)
+
Embodiment 8
2-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-
Phenoxy group-N-(5-methyl-isoxazole-3-bases)-ethanamide
Room temperature will according to embodiment 3 in to [5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-[5-(4-fluoro-phenyl)-2-(2-tri isopropyl silane oxygen base-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2 that the described similar mode of ketone prepares, 4,6-three fluoro-phenyl)-ketone (3.4mmol) (5.1mmol) handled 40 minutes with tetrabutyl ammonium fluoride (1M in THF).Add methyl bromoacetate (5.1mmol) then.After 12 hours, measure as LC/MS, reaction is finished.Carry out purifying by silicon-dioxide flash chromatography (25%EtOAc/ hexane), obtain 2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-phenoxy group }-methyl acetate:
1H NMR (400MHz, CDCl
3): δ 7.61 (s, 1H), 7.54 (m, 2H), 7.04 (m, 3H), 7.01 (d, J=8.4Hz, 1H), 6.95 (bs, 2H), 4.94 (s, 2H), 4.01 (s, 3H) .MS:(ES
+) 535.1 (M+1); LC/MS (ES
+): 535.1 (M+1)
+
To { 2-[5-(4-fluoro-phenyl)-3-(2; 4,6-three fluoro-benzoyls)-2,3-dihydro-[1; 3,4] thiadiazoles-2-yl]-phenoxy group }-add LiOH (1M) (30mL) in the solution of methyl acetate (2.93mmol) in the mixture of 30mL THF and MeOH (3: 2).After stirring 12 hours, to measure as LC/MS, reaction is finished.Dilute this reaction with ethyl acetate and water, use MgSO
4Drying is removed from this reaction mixture and is desolvated, obtain 2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-phenoxy group }-acetate:
1H NMR (400MHz, acetone-d
6) δ 7.66 (m, 3H), 7.39 (m, 1H), 7.3 (dd, J1=7.6Hz, J2=1.6Hz, 1H), 7.22 (m, 4H), 7.13 (m, 1H), 7.07 (t, J=7.6Hz, 1H), 4.94 (s, 2H); LC/MS (ES
+): 491.0 (M+1)
+
To { 2-[5-(4-fluoro-phenyl)-3-(2; 4; 6-three fluoro-benzoyls)-2; 3-dihydro-[1; 3,4] thiadiazoles-2-yl]-phenoxy group }-add DIEA (0.058mmol), HATU (0.058mmol) and 5-methyl-isoxazole-3-base amine (0.058mmol) in the solution of acetate (0.031mmol) in DMF (1mL).This reaction mixture was stirred 12 hours.By preparation type LC/MS (20-100%MeCN/H
2O) this mixture of purifying obtains
2-{2-[5-(4-fluoro-benzene Base)-and 3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-phenoxy group }-N-(5-first Base-isoxazole-3-bases)-ethanamide:
1H NMR (400MHz, CDCl
3): δ 7.55-7.51 (m, 3H), 7.35-7.26 (m, 2H), 7.05-6.96 (m, 3H), 6.85 (d, J=8Hz, 1H), 6.69 (t, J=7.6Hz, 2H), 6.56 (s, 1H), 4.72 (s, 2H), 2.33 (s, 3H); LC/MS (ES+): 571.1 (M+1)
+
Embodiment 9
3-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-
Phenoxymethyl }-benzamide
In room temperature, will according to embodiment 3 in to [5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-[1,3,4] thiadiazoles-3-yl]-[5-(4-fluoro-phenyl)-2-(2-tri isopropyl silane oxygen base-phenyl)-[1 that (2,4,6-three fluoro-phenyl)-described similar mode of ketone prepares, 3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone (41 μ mol) handled 40 minutes with tetrabutyl ammonium fluoride (1M in THF) (48 μ mol).Remove in a vacuum and desolvate, use MgSO
4Drying obtains [5-(4-fluoro-phenyl)-2-(2-hydroxyl-phenyl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone, with it without being further purified use.
Add K in [5-(4-fluoro-phenyl)-2-(2-hydroxyl-phenyl)-[1,3,4] thiadiazoles-3-yl] in being dissolved in acetonitrile (1mL)-(2,4,6-three fluoro-phenyl)-ketone (41 μ mol)
2CO
3(61.5 μ mol) and 3-brooethyl-benzamide (94.2 μ mol) are at 90 ℃ of these mixtures of heating.After 12 hours, measure as LC/MS, reaction is finished.By preparation type LC/MS (20-100%MeCN/H
2O) carry out purifying, obtain 3-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl)-phenoxymethyl]-benzamide:
1H NMR (400MHz, CDCl
3): δ 8.09 (s, 1H), 7.9 (d, J=7.6Hz, 1H), 7.7 (s, 1H), 7.6-7.5 (m, 4H), 7.35 (d, J=7.6Hz, 1H), 7.06 (t, J=8.4Hz, 1H), 6.99 (t, J=7.6Hz, 2H), 6.88 (d, J=8Hz), 6.79 (t, J=8.4Hz, 2H), 6.26 (bs, 1H), 5.33 (d, J=7.6Hz); LC/MS (ES
+): 566.1 (M+1)
+
Embodiment 10
2-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-
Phenoxymethyl }-furans-3-formic acid
In room temperature, will according to embodiment 3 in to [5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-[1,3,4] thiadiazoles-3-yl]-[5-(4-fluoro-phenyl)-2-(2-tri isopropyl silane oxygen base-phenyl)-[1 that (2,4,6-three fluoro-phenyl)-described similar mode of ketone prepares, 3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone (0.67mmol) with tetrabutyl ammonium fluoride (1M in THF) (1.3mmol) handle.After 15 minutes, add 2-(brooethyl)-3-methylfuroate (0.74mmol), with this mixture restir 12 hours.Remove in a vacuum and desolvate,, obtain 2-{2-[5-(4-fluoro-phenyl)-3-(2 with silicon-dioxide purifying resistates; 4,6-three fluoro-benzoyls)-2,3-dihydro-[1; 3,4] thiadiazoles-2-yl]-phenoxymethyl }-furans-3-methyl-formiate, be yellow solid: LC/MS (ES
+): 571.1 (M+1)
+
To 2-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-phenoxymethyl }-furans-3-methyl-formiate (0.49mmol) is at THF/MeOH/H
2Add LiOH (3N) in the solution among the O (3: 2: 1) (4.9mmol).After stirring 12 hours, should react with HCl (1N) acidifying, use ethyl acetate extraction.Use MgSO
4Dry organic layer filters, and concentrates.Use preparation type LC/MS purifying resistates, obtain 2-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-phenoxymethyl }-furans-3-formic acid, be white solid:
1H NMR (400MHz, CDCl
3): δ 7.26-7.23 (m, 3H), 7.20 (d, J=1.9,1H), 7.10-7.05 (m, 1H), 7.03-6.99 (m, 1H), 6.86 (d, J=8.1,1H), 6.78-6.74 (m, 3H), 6.55 (d, J=1.9,1H), 6.55-6.50 (m, 2H), 5.38-5.21 (m, 2H); LC/MS (ES
+): 557.1 (M+1)
+
Embodiment 11
[2-(2-difluoro-methoxy-phenyl)-5-(6-methyl-pyridin-3-yl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three
The fluoro-phenyl)-ketone
In room temperature, will as among the embodiment 3 to N '-(6-methyl-pyridine-3-thion acyl group (carbothioyl))-hydrazine t-butyl formate (0.1mmol) of preparation as described in N '-(4-fluoro-benzoyl)-hydrazine t-butyl formate with the anhydrous CH that contains TFA (1mmol)
2Cl
2(1mL) handled 30 minutes.Remove and desolvate, resistates is dissolved in anhydrous CH
2Cl
2(1mL).In this solution, add DIEA (0.287mmol), exist with 2-difluoro-methoxy-phenyl aldehyde (0.12mmol)
Molecular sieve exists handles this mixture down.Add 2,4 after 5 minutes, 6-trifluorobenzoyl chloride (0.15mmol).This mixture was remained on envrionment temperature 16 hours, by preparation HPLC (20-100%MeCN/H
2O) purifying obtains
[2-(2-difluoro-methoxy-benzene Base)-5-(6-methyl-pyridin-3-yl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone:
1HNMR (400MHz, CDCl
3): 8.71 (d, J=2.1Hz, 1H), 7.81 (dd, J1=8.2Hz, J2=2.2Hz, 1H), 7.53 (s, 1H), 7.36-7.4 (m, 2H), 7.26 (d, J=8.1Hz, 2H), 7.18 (d, J=8.3Hz, 1H), 6.78 (t, J=8.3Hz, 2H), 6.67 (dd, J
1=75.0Hz, J
2=71.7Hz, 1H), 2.64 (s, 3H); LC/MS (ES
+): (M+1) 480.1.
Embodiment 12
[2-(2-difluoro-methoxy-phenyl)-5-(6-methyl-pyridin-3-yl)-[1,3,4] thiadiazoles-3-yl]-(the 2-hydroxyl-
Phenyl)-ketone
In room temperature, will according to as the experiment 11 in to [2-(2-difluoro-methoxy-phenyl)-5-(6-methyl-pyridin-3-yl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-(2-(2-(difluoro-methoxy) phenyl)-5-(6-picoline-3-yl)-1,3 that the described similar mode of ketone prepares, 4-thiadiazoles-3 (2H)-yl) (2-acetoxyl group phenyl) ketone (0.02mmol) is dissolved in THF/MeOH (1mL/0.5mL), (0.5mL) handles 30 minutes with the LiOH aqueous solution (1M).Add the HCl aqueous solution (3M), with pH regulator to 5-6.Remove and desolvate, by preparation HPLC (20-100%MeCN/H
2O) the purifying resistates obtains
[2-(2- Difluoro-methoxy-phenyl)-5-(6-methyl-pyridin-3-yl)-[1,3,4] thiadiazoles-3-yl]-(2-hydroxyl-phenyl)- Ketone:
1H NMR (400MHz, CDCl
3), 9.02 (d, J=2.0Hz, 1H), 8.41 (d, J=8.6Hz, 1H), 8.23 (dd, J
1=8.2Hz, J
2=2.2Hz, 1H), 7.77 (d, J=7.5Hz, 1H), 7.65 (s, 1H), 7.62 (dd, J
1=7.8Hz, J
2=1.3Hz, 1H), 7.45-7.53 (m, 5H), 6.97-7.01 (m, 2H), 2.79 (s, 3H); LC/MS (ES
+): (M+1) 442.1.
Embodiment 13
[2-(2-difluoro-methoxy-phenyl)-5-(6-fluoro-pyridin-3-yl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-
Phenyl)-ketone
In room temperature, will as among the embodiment 3 to N '-(6-fluoro-pyridine-3-thion the acyl group)-hydrazine t-butyl formate (0.044mmol) of preparation as described in N '-(4-fluoro-benzoyl)-hydrazine t-butyl formate with the anhydrous CH that contains TFA (0.44mmol) and thioanisole (0.44mmol)
2Cl
2(1mL) handled 30 minutes.Remove and desolvate, resistates is dissolved in anhydrous CH
2Cl
2(1mL).In this solution, add DIEA (0.22mmol), exist with 2-difluoro-methoxy-phenyl aldehyde (0.067mmol)
Molecular sieve exists handles this mixture down.Add 2,4 after 5 minutes, 6-trifluorobenzoyl chloride (0.089mmol).This mixture was remained on room temperature 16 hours,, obtains [2-(2-difluoro-methoxy-phenyl)-5-(6-fluoro-pyridin-3-yl)-[1,3,4] thiadiazoles-3-yl]-(2,4,6-three fluoro-phenyl)-ketone with preparation type silica gel tlc (30%EtOAc/ hexane) purifying:
1H NMR (400MHz, CDCl
3), 8.39 (s, 1H), 7.93-7.97 (m, 1H), 7.54 (s, 1H), 7.37-7.41 (m, 2H), 7.24-7.27 (m, 1H), 7.19 (d, J=8.1Hz, 1H), 6.97 (dd, J
1=8.6Hz, J
2=2.7Hz, 1H), 6.78 (t, J=8.3Hz, 2H), 6.67 (dd, J
1=75.0Hz, J
2=71.7Hz, 1H); LC/MS (ES
+): (M+1) 484.1.
Embodiment 14
3-{4-[5-(3,4-two fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-
Base]-benzoxazoles-2-yl }-phenylformic acid
At 60 ℃, 2-amino-3-methyl-phenol (6.09mmol) and 3-formyl radical-methyl benzoate (6.09mmol) were heated 30 minutes in MeOH (6mL).From this mixture, obtain scarlet oily matter, it is dissolved in anhydrous CH in room temperature except that desolvating
2Cl
2(6mL), handled 16 hours with DDQ (6.4mmol).Dilute this mixture and be poured over saturated NaHCO with EtOAc
3On the aqueous solution.With the further aqueous phase extracted of EtOAc, use Na
2SO
4The dry organic phase that merges.Filter, remove and desolvate, obtain resistates, it by silica gel chromatography purifying (5-10%EtOAc/ hexane), is obtained 3-(4-methyl-benzoxazole-2-yl)-methyl benzoate, be white solid:
1H NMR (400MHz, CDCl
3) 8.92 (d, J=1.6Hz, 1H), 8.47 (dt, J
1=7.8Hz, J
2=1.5Hz, 1H), 8.2 (dt, J
1=7.8Hz, J
2=1.4Hz, 1H), 7.61 (t, J=7.9Hz, 1H), 7.43 (d, J=8.1Hz, 1H), 7.27 (t, J=7.7Hz, 1H), 7.17 (t, J=7.5Hz, 1H), 3.99 (s, 3H), 2.69 (s, 3H); LC/MS (ES
+): (M+1) 268.1.
With 3-(4-methyl-benzoxazoles-2-yl)-methyl benzoate (1.2mmol), N-bromine succinimide (1.5mmol) and AIBN (0.3mmol) at CCl
4In solution in 100 ℃ of microwaves, heat 30 minutes (1mL).Filter this mixture, concentrate, obtain 3-(4-brooethyl-benzoxazoles-2-yl)-methyl benzoate crude product.LC/MS(ES
+)：(M
+)346.1，348.1，(M-Br)266.1，268.1。
In 130 ℃ of microwave ovens, with the acetate/H that contains HMTA (1.8mmol)
2O (3mL/1.5mL) handles 3-(4-brooethyl-benzoxazoles-2-yl)-methyl benzoate 20 minutes.Remove and desolvate,, obtain 3-(4-formyl radical-benzoxazole-2-yl)-methyl benzoate, be white solid by this mixture of silica gel chromatography purifying (10-20%EtOAc/ hexane).Productive rate: 32%.
1H?NMR(400MHz，CDCl
3)10.8(s，1H)，8.97(s，1H)，8.53(d，J＝7.8Hz，1H)，8.26(d，J＝7.8Hz，1H)，7.94(dd，J
1＝7.7Hz，J
2＝1Hz，1H)，7.86(d，J＝8.1Hz，1H)，7.66(t，J＝7.8Hz，1H)，7.51(t，J＝7.9Hz，1H)，4.0(s，3H)。
LC/MS(ES
+)：(M+1)282.1，(M+Na)304.1。
In room temperature, will as among the embodiment 3 to N '-(3,4-two fluoro-the thiobenzoyl)-hydrazine t-butyl formate (0.1mmol) of preparation as described in N '-(4-fluoro-benzoyl)-hydrazine t-butyl formate with the anhydrous CH that contains TFA (1mmol)
2Cl
2(1mL) handled 30 minutes.Remove and desolvate, resistates is dissolved in anhydrous CH
2Cl
2(1mL).In this solution, add DIEA (0.57mmol), exist with 3-(4-formyl radical-benzoxazoles-2-yl)-methyl benzoate (0.064mmol)
Molecular sieve exists handles this mixture down.Add 2,4 after 5 minutes, 6-trifluorobenzoyl chloride (0.15mmol).This mixture was remained on room temperature 16 hours, by preparation HPLC (20-100%MeCN/H
2O) purifying obtains 3-{4-[5-(3,4-two fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-benzoxazole-2-yl }-methyl benzoate.LC/MS(ES
+)：(M+1)610.0，(M+Na)632.0。
With 3-{4-[5-(3; 4-two fluoro-phenyl)-3-(2; 4; 6-three fluoro-benzoyls)-2; 3-dihydro-[1; 3,4] thiadiazoles-2-yl]-benzoxazoles-2-yl }-methyl benzoate (0.02mmol) is dissolved in THF/MeOH (1mL/0.5mL), (0.5mL) handled 30 minutes with the LiOH aqueous solution (1M) in room temperature.Add the HCl aqueous solution (3M), with pH regulator to 5-6.Remove and desolvate, by preparation HPLC (20-100%MeCN/H
2O) purifying resistates obtains 3-{4-[5-(3,4-two fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-benzoxazole-2-yl }-phenylformic acid:
1H NMR (400MHz, CDCl
3), 8.95 (s, 1H), 8.48 (d, J=7.9Hz, 1H), 8.27 (d, J=7.8Hz, 1H), 7.92 (s, 1H), 7.66 (t, J=7.8Hz, 1H), 7.6 (dd, J
1=7.7Hz, J
2=1.2Hz, 1H), 7.46 (m, 1H), 7.29-7.42 (m, 3H), 7.19 (q, J=8.2Hz, 1H), 6.76-6.81 (m, 2H); LC/MS (ES
+): (M+1) 596.0, (M+Na) 618.0.
Embodiment 15
4-{3-[5-4-fluoro-phenyl]-3-(2-hydroxyl-benzoyl)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl }-the 2-first
Oxygen base-phenoxymethyl }-benzsulfamide
4-(3-formyl radical-2-methoxyl group-phenoxymethyl)-N, N-pair-(4-methoxyl group-benzyl)-benzsulfamide
Use Et
3N (8.4mmol), use two-(4-methoxyl group-benzyl)-amine (5.8mmol) to handle 25 ℃ 4-(brooethyl) benzene sulfonyl chloride (5.6mmol) subsequently at 5mL CH
2Cl
2In solution.Should react and stir 12 hours, use H
2CH is used in the O dilution
2Cl
2Extraction, dry (MgSO
4), filter, concentrate.By the thick material of silicon-dioxide purified by flash chromatography gained (20%EtOAc/ hexane), obtain 4-brooethyl-N, N-pair-(4-methoxyl group-benzyl)-benzsulfamide:
1H NMR (400MHz, CDCl
3): δ 7.72 (obvious t, J=8.4Hz, 2H), 7.44 (dd, J
1=1.6Hz, J
2=8.4Hz, 2H), 6.91-6.86 (m, 4H), 6.69 (d, J=8.8Hz, 4H), 4.5 (s, 2H), 4.19 (s, 4H), 3.71 (s, 3H); LC/MS:(ES
+) 490.1 (M+1)
+
With as described in example 4 above 2-methoxyl group-3-tri isopropyl silane oxygen base-phenyl aldehyde (2.9mmol) and the 4-brooethyl-N of preparation of the solution-treated of 4.4mL 1.0M TBAF in THF in anhydrous THF (4mL), N-pair-(4-methoxyl group-benzyl)-benzsulfamide (3.0mmol).This is reflected at envrionment temperature stirred 12 hours, concentrate.By silicon-dioxide purified by flash chromatography gained material (30%EtOAc/ hexane), obtain 4-(3-formyl radical-2-methoxyl group-phenoxymethyl)-N, two (4-methoxyl group-benzyl)-benzamide of N-:
1H NMR (400MHz, CDCl
3): δ 10.45 (s, 1H), 7.85 (d, J=8Hz, 2H), 7.58 (d, J=8Hz, 2H), 7.48 (dd, J
1=1.2Hz, J
2=7.6Hz, 1H), 7.11-7.19 (m, 2H), 6.97 (d, J=8.8Hz, 4H), 6.74 (d, J=8.4Hz, 4H), 5.23 (s, 2H), 4.26 (s, 4H), 4.05 (s, 3H), 3.77 (s, 6H); LC/MS:(ES
+) 562.6 (M+1)
+
The 4-fluorobenzene sulfonyl hydrazonium salt hydrochlorate (0.045mmol) of preparation as described in example 3 above is dissolved in CH
2Cl
2(1mL).Add DIEA (0.133mmol) in this solution, with 4-(3-formyl radical-2-methoxyl group-phenoxymethyl)-N, two (4-methoxyl group-benzyl)-benzamide (0.047mmol) of N-exist
Molecular sieve exists handles this mixture down.Add after 5 minutes acetate 2-chloroformyl-phenyl ester (0.047mmol).This mixture was remained on envrionment temperature 16 hours, concentrate.The gained material is dissolved in trifluoroacetic acid.After 3 hours, concentrate this reaction mixture.Thick material is dissolved in DMSO, by preparation type LC/MS (20-100%MeCN/H
2O) purifying obtains 4-{3-[5-4-fluoro-phenyl behind the evaporating solvent]-3-(2-hydroxyl-benzoyl)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl }-2-methoxyl group-phenoxymethyl }-benzsulfamide, be white solid:
1H NMR (400MHz, CDCl
3): δ 11.27 (s, 1H), 8.55 (dd, J
1=1.2Hz, J
2=8Hz, 1H), 7.96 (d, J=8Hz, 2H), 7.71-7.77 (m, 2H), 7.59-7.64 (m, 3H), and 7.42-7.47 (m, 1H), 7.12-7.8 (m, 2H), 6.95-7.03 (m, 3H), 6.86-6.92 (m, 2H), 5.2 (s, 2H), 4.77 (s, 2H), 4.07 (s, 3H); LC/MS:(ES
+) 594.0 (M+1)
+
Embodiment 16
3-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-
Base]-2-methoxyl group-phenoxymethyl }-N-hydroxyl-benzamidine
To 3-{2-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-phenoxymethyl }-the middle 1mL SOCl that adds of benzamide (0.1mmol)
2This mixture was heated 25 minutes in 100 ℃ microwave oven.Remove and desolvate.Resistates is dissolved in EtOH (1mL).Add NH
2OH (50% aqueous solution, 0.06mL).This mixture was heated 25 minutes in 100 ℃ microwave oven.By preparation type LC/MS (20-100%MeCN/H
2O) purifying obtains 3-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-2-methoxyl group-phenoxymethyl }-N-hydroxyl-benzamidine.
1H?NMR(400MHz，CDCl
3)：δ7.7(d，J＝7Hz，1H)，7.64(s，1H)，7.52-7.61(m，4H)，7.5(s，1H)，7.03-7.08(m，2H)，7.0(d，J＝8.2Hz，1H)，6.95(d，J＝7.9Hz，1H)，6.9(d，J＝6.8Hz，1H)，6.76(t，J＝8Hz，2H)，6.41(bs，2NH)，5.21(dd，J＝14.5，12.8Hz，2H)，4.04(s，3H)；LC/MS(ES
+)：611.1(M+1)
+。
Embodiment 17
2-{3-[5-(4-fluoro-phenyl)-3-(2-hydroxyl-benzoyl)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-the 2-first
Oxygen base-phenoxy group }-N-(2-hydroxyl-1-methyl-ethyl)-ethanamide
{ 3-[5-(4-fluoro-phenyl)-3-(2-hydroxyl-benzoyl)-2 in dry DMF (0.5mL); 3-dihydro-[1; 3; 4] thiadiazoles-2-yl]-2-methoxyl group-phenoxy group }-(0.45mL is 2.7mmol) with 2-amino-third-1-alcohol for the middle adding of acetate (0.27mmol) HATU (1.35mmol), DIEA.This mixture was remained on envrionment temperature 16 hours.With EtOH (1mL) dilution resistates.By preparation type LC/MS (30-100%MeCN/H
2O) this mixture of purifying obtains 2-{3-[5-(4-fluoro-phenyl)-3-(2-hydroxyl-benzoyl)-2,3-dihydro-[1,3,4] thiadiazoles-2-yl]-2-methoxyl group-phenoxy group }-N-(2-hydroxyl-1-methyl-ethyl)-ethanamide.
1H?NMR(400MHz，CDCl
3)：δ11.2(s，1H)，8.53(m，1H)，7.73(m，2H)，7.6(s，1H)，7.44(t，J＝8.4Hz，1H)，7.15(t，J＝8Hz，2H)，6.9-7.1(m，5H)，4.58(s，2H)，4.14(m，1H)，4.06(s，3H)，3.69(m，1H)，3.59(m，1H)，2.1(bs，2H)，1.23(m，3H)；LC/MS(ES
+)：540.1(M+1)
+。
Embodiment 18
6-{2-cyano group methoxyl group-3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4]
Thiadiazoles-2-yl]-phenoxymethyl-pyridine-2-ethyl formate
In anhydrous DMSO (2.5mL) 2, add in the 3-Dihydroxy benzaldehyde (1mmol) NaH (60% oil suspension, 2.5mmol).After 10 minutes, add 6-brooethyl-pyridine-2-ethyl formate (1mmol).After 1 hour, (0.07mL 1mmol), stirs this mixture 16 hours to introduce bromoacetonitrile in envrionment temperature.Use saturated NH
4The Cl aqueous solution makes the reaction quencher, extracts this mixture with EtOAc.After dried over sodium sulfate, remove and desolvate.By preparation HPLC (20-70%MeCN/H
2O) this mixture of purifying obtains 6-(2-cyano group methoxyl group-3-formyl radical-phenoxymethyl)-pyridine-2-ethyl formate.
1H?NMR(400MHz，CDCl
3)：δ10.4(s，1H)，8.1(d，J＝7.7Hz，1H)，7.9(t，J＝7.9Hz，1H)，7.7(d，J＝8.2Hz，1H)，7.5(dd，J＝8.2，2.4Hz，1H)，7.24(m，2H)，5.42(s，2H)，5.14(s，2H)，4.5(q，J＝7.2Hz，2H)，1.45(t，J＝7Hz，3H)；LC/MS(ES
+)：341.2(M+1)
+。
Use 6-(2-cyano group methoxyl group-3-formyl radical-phenoxymethyl)-pyridine-2-ethyl formate; according among the embodiment 3 to [5-(4-fluoro-phenyl)-2-(3-methoxyl group-2-tri isopropyl silane oxygen base-phenyl)-[1; 3; 4] thiadiazoles-3-yl]-(2; 4; 6-three fluoro-phenyl)-the described similar mode of ketone prepares 6-{2-cyano group methoxyl group-3-[5-(4-fluoro-phenyl)-3-(2; 4; 6-three fluoro-benzoyls)-2; 3-dihydro-[1; 3,4] thiadiazoles-2-yl]-phenoxymethyl }-pyridine-2-ethyl formate.
1H?NMR(400MHz，CDCl
3)：δ8.1(d，J＝7.9Hz，1H)，7.94(t，J＝7.9Hz，1H)，7.76(d，J＝7.5Hz，1H)，7.54-7.58(m，3H)，7.05-7.14(m，3H)，7.01(d，J＝7.3Hz，1H)，6.96(d，J＝8.9Hz，1H)，6.76(t，J＝8.5Hz，2H)，5.4(s，2H)，5.12(d，J＝4.4Hz，2H)，4.5(q，J＝7.2Hz，2H)，1.45(t，J＝7.3Hz，3H)；LC/MS(ES
+)：651.2(M+1)
+。
Embodiment 19
6-{3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2,3-dihydro-[1,3,4] thiadiazoles-2-
Base]-2-methoxycarbonyl methoxyl group-phenoxymethyl }-pyridine-2-formic acid
With 6-{2-cyano group methoxyl group-3-[5-(4-fluoro-phenyl)-3-(2,4,6-three fluoro-benzoyls)-2; 3-dihydro-[1; 3,4] thiadiazoles-2-yl]-phenoxymethyl }-pyridine-2-ethyl formate is dissolved in THF (1.5mL) and MeOH (1.0mL), adds LiOH (1M) (0.5mL).After stirring 1 hour, from this reaction mixture, remove and desolvate.In resistates, add the mixture of MeOH/DMSO, filter gained solution.By preparation type LC/MS (20-100%MeCN/H
2O) purifying clear soln obtains 6-{3-[5-(4-fluoro-phenyl)-3-(2,4 except that after desolvating; 6-three fluoro-benzoyls)-2,3-dihydro-[1,3; 4] thiadiazoles-2-yl]-2-methoxycarbonyl methoxyl group-phenoxymethyl }-pyridine-2-formic acid, be white solid:
1HNMR (400MHz, CDCl
3): δ 8.21 (d, J=7.9Hz, 1H), 8.03 (t, J=7.3Hz, 1H), 7.81 (d, 10.1Hz, 1H), 7.8 (s, 1H), 7.55 (dd, J=8.9,5.3Hz, 2H), 7.0-7.1 (m, 4H), 6.92 (d, J=8Hz, 1H), 6.76 (t, J=7.5Hz, 2H), 5.31 (s, 2H), 4.94 (d, J=7.8Hz, 2H), 4.8 (bs, 1H), 3.8 (s, 3H); LC/MS (ES
+): (M+1) 656.3.
By repeating the operation steps described in the foregoing description, use proper raw material to obtain the formula I compound of identifying in the tabulation 1 and 2 down.
Table 1
Table 2
Test 1-transcribes test
The transfection test is used to estimate the ability that The compounds of this invention is regulated the LXR transcriptional activity.In brief, by transient transfection the expression vector of chimeric protein is in GAL4 binding site control report plasmid down with luciferase gene and imports mammalian cell, described chimeric protein contains the DNA binding domains with the yeast GAL4 of ligand binding domains (LBD) fusion of LXR α or LXR β.After being exposed to the LXR conditioning agent, the LXR transcriptional activity changes, and this can monitor by the change of luciferase level.If cells transfected is exposed to lxr agonist, the LXR-dependent transcription is active so increases and the luciferase level rising.
This was tested preceding 2 days in beginning, with 293T HEKC (8 * 10
6) be inoculated in 175cm
2In the DMEM substratum of 10%FBS in the flask, 1% penicillin/streptomycin/Fungizome.Use GAL4-LXR LBD expression plasmid (4 μ g), UAS-luciferase report plasmid (5 μ g), Fugene (3: 1 ratios; 27 μ L) and the substratum of serum-free (210 μ L) preparation be used for the transfection mixture of chimeric protein.With this transfection mixture room temperature incubation 20 minutes.By with PBS (30mL) washing collecting cell, use trypsin 0.05% then; 3mL) decompose.(10mL) make the trypsinase inactivation by adding test medium (DMEM lacks foetal calf serum (5%), Statins (for example lovastatin 7.5 μ l) and the mevalonic acid (100 μ M) of lipoprotein).Use 1: 10 diluent pair cell to count and cell concn is adjusted to 160,000 cell/mL.Cell is mixed (10mL cell/250 μ l transfection mixtures) and incubation 30 minutes more at room temperature with transfection mixture, counter-rotating regularly mixes.Then cell (50 μ l/ hole) flat board is fixed into the flat board of the TC-processing at the 384 white solid ends.With cell at 37 ℃ and 5.0%CO
2Further incubation is 24 hours down.For every kind of test compounds, the 12-point serial dilutions (semilog serial dilutions) of preparation in DMSO, wherein the initial concentration of compound is 1 μ M.Test compounds (500nl) is joined in each cell hole in the test panel, with cell at 37 ℃ and 5.0%CO
2Following incubation 24 hours.With lysis/luciferase test buffer B right-Glo
TM(25%; 25 μ l; Promega) join in each hole.At room temperature further incubation was measured uciferase activity after 5 minutes.
By divided by the DMSO control value on each flat board, to original marking of luminous value.Use XLfit3 to show the data of markization, use 4-parameter L ogistic model or S shape single-point dose response equation (equation 205 in XLfit3.05) match dose response curve.EC50 is defined as the concentration that compound causes half response between maximum value and the minimum value.By response and the known LXR conditioning agent (3-{3-[(2-chloro-3-trifluoromethyl-benzyl)-(2 that compound is caused, 2-phenylbenzene-ethyl)-amino]-propoxy-}-phenyl)-maximum value that acetate obtained compares, and calculates relative potency (or percentages of efficacy).
Test 2-is used to estimate the method for LXR conditioning agent inductive endogenous gene expression
ABCA1 genetic expression
Make people THP1 cell at propagating culture medium (in RPMI 1640: grow 10% FBS, 2mM L-glutaminate, 10mM HEPES, 1.0mM Sodium.alpha.-ketopropionate, 4.5g/L glucose, 1.5g/L supercarbonate, the 0.05mM 2 mercapto ethanol of determining).At the 1st day, each the hole middle plateform on the plate of 48-hole is the 0.5mL cell fixedly, and concentration is 250,000 cells/mL proliferated culture medium, adds 40ng/mL PMA again.With flat board 37 degrees centigrade of incubations 24 hours.At the 2nd day, replace substratum with the fresh test medium of 0.5mL (identical, but contain FBS that 2% lipoprotein lacks) as the serum fill-in with propagating culture medium, after 6 hours, add compound (1 or 10 μ M in DMSO).Then with flat board 37 degrees centigrade of incubations 24 hours.At the 3rd day, collecting cell used Rneasy test kit (Qiagen) isolation of RNA with optional DnaseI.With 100 μ l water elution RNA, quantitatively (in the UV at 260nm place optical density), be stored in-80 ℃ stand-by.
Use the TaqMan quantitative PCR, use the following primer/probe groups that is used for people ABCA1 and measure ABCA1 genetic expression: forward primer 5 ' TGTCCAGTCCAGTAATGGTTCTGT3 ', reverse primer 5 ' AAGCGAGATATGGTCCGGATT3 ', probe 5 ' FAMACACCTGGAGAGAAGCTTTCAACGAGACTAACCTAMRA3 '; With people 36B4, forward primer 5 ' CCACGCTGCTGAACATGC3 ', reverse primer 5 ' TCGAACACCTGCTGGATGAC3 ', probe 5 ' VIC AACATCTCCCCCTTCTCCTTTGGGCT TAMRA3 '.Use Superscript Platinum III Q-PCR reagent (Invitrogen) in the same sample mixture, to carry out reverse transcription and PCR reaction successively.With reaction mixture (Superscript RT/platinum Taq-0.4 μ l, 2x reaction mixture-10 μ l, 36B4 primer-0.4 μ l 10 μ M stock solutions, ABCA1 primer-1.8 μ l 10 μ M stock solutions, ABCA1 probe-FAM-0.04 μ l 100 μ M stock solutions, 36B4 probe-VIC-0.04 μ l 50 μ M stock solutions, RNA (50ng/ μ l)-2 μ l, 50xROX dyestuff-0.4 μ l, MgSO
4-0.4 μ l 50mM stock solution, water-4.52 μ l) place 384-hole flat board, use standard conditions on ABI HT7900 instrument, to test.Curve with reference to dilution RNA is estimated ABCA1 genetic expression, and mark turns to the 36B4 rna level that is present in the sample.Induce with reference to DMSO computerized compound inductive is folding.By reaction and known LXR conditioning agent (3-{3-[(2-chloro-3-trifluoromethyl-benzyl)-(2,2-phenylbenzene-ethyl)-amino that compound is caused]-propoxy-}-phenyl)-maximum value that acetate obtains compares, and calculates relative potency (or percentages of efficacy).
Fas genetic expression
The human HepG2 cell is grown in propagating culture medium (in DMEM: 10%FBS, 2mM L-glutaminate, 1.5g/L supercarbonate, 0.1mM non-essential amino acid, 1.0mM Sodium.alpha.-ketopropionate).At the 1st day, each the hole middle plateform on the plate of 48-hole is the 0.5mL cell fixedly, and concentration is 150,000 cells/mL propagating culture medium.Then flat board is spent incubations 24 hours 37.At the 2nd day, substratum is replaced with 0.5mL test medium (identical with proliferated culture medium, but contain FBS that 2% lipoprotein lacks as the serum fill-in), after 6 hours, add compound (1 or 10 μ M in DMSO).Then flat board is spent incubations 36-48 hour 37.Collecting cell uses Rneasy test kit (Qiagen) isolation of RNA with optional DnaseI.With 100 μ l water elution RNA, quantitatively (in the UV at 260nm place optical density) and be stored in-80 ℃ stand-by.Use the TaqMan quantitative PCR, use the following primer/probe groups that is used for people Fas and measure Fas genetic expression: forward primer 5 ' GCAAATTCGACCTTTCTCAGAAC3 ', reverse primer 5 ' GGACCCCGTGGAATGTCA3 ', probe 5 ' FAM ACCCGCTCGGCATGGCTATCTTCTAMRA3 '; With people 36B4, forward primer 5 ' CCACGCTGCTGAACATGC3 ', reverse primer 5 ' TCGAACACCTGCTGGATGAC3 ', probe 5 ' VICAACATCTCCCCCTTCTCCTTTGGGCTTAMRA3 '.Use SuperscriptPlatinum III Q-PCR reagent (Invitrogen) in the same sample mixture, to carry out reverse transcription and PCR reaction successively.With reaction mixture (Superscript RT/platinum Taq-0.4 μ l, 2x reaction mixture-10 μ l, 36B4 primer-1.2 μ l 10 μ M stock solutions, Fas primer-1.2 μ l 10 μ M stock solutions, Fas probe-FAM-0.045 μ l 100 μ M stock solutions, 36B4 probe-VIC-0.08 μ l50 μ M stock solution, RNA (50ng/ μ l)-2 μ l, 50x ROX dyestuff-0.4 μ l, MgSO
4-1 μ l50mM stock solution, water-3.68 μ l) place 384-hole flat board, use standard conditions on ABI HT7900 instrument, to test.Curve with reference to dilution RNA is estimated Fas genetic expression, and mark turns to the 36B4 rna level that is present in the sample.Induce with reference to DMSO computerized compound inductive is folding.
Test 3-FRET is total to-the activator supplementary test
The FRET test is used to estimate the ability (for example being total to-activator) that The compounds of this invention is directly raised in conjunction with the protein of LXR ligand binding domains (LBD) and promotion reinforcement LXR transcriptional activity.The recombination fusion protein of being made up of the mark (for example GST, His, FLAG) of LXR LBD and its purifying of simplification is used in this not celliferous test, and the peptide of synthesizing biotinylatedization, this peptide derives from the nuclear receptor interaction structural domain of transcribing co-activation thing albumen such as steroid receptor co-activation thing 1 (SRC-1).In a kind of mode, label L BD fusion rotein can use with the anti-LBD traget antibody of europium link coupled (for example anti--GS antibody of EU-mark) and carry out mark, and co-activation thing peptide can use and streptavidin link coupled allophycocyanin (APC) mark.In the presence of lxr agonist, co-activation thing peptide is raised the LBD to LXR, thereby makes EU and APC part approaching closely.During with this mixture of optical excitation of 340nM, EU absorbs energy and it is transferred to the APC part, causes launching at the 665nm place.If there is not energy to shift (expression lacks EU-APC and gets close to), EU launches at the 615nm place so.Therefore, 665 provided the indication of the intensity of intensity that co-activation thing peptide raises and the agonist that combines LXR LBD thus with the ratio of the light of 615nm place emission.
With fusion rotein, promptly the amino acid 203-461 (NM_007121 of β) of the amino acid 205-447 of LXR α (Genbank NM_005693) and LXR β carries out clone in the frame on the Sal1 of pGEX4T-3 (27-4583-03Amersham Pharmacia Biotech) and Not1 site.The biotinylation peptide sequence derives from SRC-1 (amino acid 676-700): vitamin H-CPSSHSSLTERHKILHRLLQEGSPSC-OH.
At FRET damping fluid (50mM Tris pH 7.5,50mM KCl, 1mM DTT, 0.1%BSA) the main mixture of middle preparation (5nM GST-LXR-LBD, 5nM biotinylation SRC-1 peptide, 10nM APC-streptavidin (Prozyme Phycolink streptavidin APC PJ25S) resists-GST antibody with 5n MEU-).In each hole of 384 hole flat boards, add this main mixture of 20 μ l.Final FRET reaction: 5nM fusion rotein, 5nM SRC-1 peptide, 10nM APC-streptavidin, 5nm EU-resist-GST antibody (PerkinElmer AD0064).With DMSO the test compounds dilution is semi-log 12-point serial dilutions, initial concentration is 1mM, and the 100nL compound is changed in the main mixture, makes that the final concentration in the test holes is 5 μ M-28pM.Flat board room temperature incubation 3 hours, is read FRET (fluorescence resonance energy transfer).The result is expressed as ratio * 1000 of APC fluorescence and EU fluorescence.
665nm multiply by factor 1000 with the reduced data analysis with the ratio of 615nm.Deduction DMSO value is worth as a setting from ratio.Use the XLfit3 display data, use 4-parameter L ogistic model or S shape single-point dose response equation (equation 205 in XLfit3.05) match dose response curve.EC50 is defined as the compound concentration that causes half response between maximum value and the minimum value.Compare with the maximum value that reference LXR conditioning agent obtains by the response that compound is caused, calculate relative potency (or percentages of efficacy).
Formula I compound free or the pharmacy acceptable salt form shows the valuable pharmacological characteristic, and in vitro tests confirms described in the application.The effect % that compound of the present invention is expressed endogenous ABCA1 is 10%-130%.It is to be understood that embodiment as herein described and embodiment only are used for task of explanation, those skilled in the art can expect carrying out various modifications or change according to it, and these modifications or change are also included within the scope of the application's essence and scope and claims.All open source literatures, patent and the patent application of this paper citation are incorporated herein by reference for all purposes.
Claims (7)
1. formula I compound and pharmacy acceptable salt thereof:
Wherein:
N is selected from 0,1,2 and 3;
Z is C;
Each Y is independently selected from-CR
4=; R wherein
4Be selected from hydrogen, cyano group, hydroxyl, C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl and halogen-replacement-C
1-6Alkoxyl group;
R
1Be selected from halogen and C
1-6Alkyl;
R
2Be selected from C
6-10Aryl, C
5-10Heteroaryl and C
3-12Cycloalkyl; R wherein
2Any aryl, heteroaryl or cycloalkyl replaced by 1-5 group alternatively, described group is independently selected from halogen, hydroxyl, C
1-6Alkyl, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group ,-OC (O) R
5,-NR
5R
6R wherein
5And R
6Be independently selected from hydrogen or C
1-6Alkyl;
R
3Be selected from C
6-10Aryl, C
5-10Heteroaryl and C
3-8Heterocyclylalkyl; R wherein
3Any aryl, heteroaryl or Heterocyclylalkyl replaced by 1-5 group, described group is independently selected from halogen, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group ,-OXR
7,-OXC (O) NR
7R
8,-OXC (O) NR
7XC (O) OR
8,-OXC (O) NR
7XOR
8,-OXC (O) NR
7XNR
7R
8,-OXC (O) NR
7XS (O)
0-2R
8,-OXC (O) NR
7XNR
7C (O) R
8,-OXC (O) NR
7XC (O) XC (O) OR
8,-OXC (O) NR
7R
9,-OXC (O) OR
7,-OXOR
7,-OXR
9,-XR
9,-OXC (O) R
9With-OXS (O)
0-2R
9Wherein X is selected from key or C
1-6Alkylidene group, wherein any methylene radical of X is substituted by C (O) alternatively; R
7And R
8Be independently selected from hydrogen, cyano group, C
1-6Alkyl, halogen-replacement-C
1-6Alkyl, C
2-6Alkenyl and C
3-12Cycloalkyl-C
0-4Alkyl; R
9Be selected from C
6-10Aryl-C
0-4Alkyl, C
5-10Heteroaryl-C
0-4Alkyl, C
3-12Cycloalkyl-C
0-4Alkyl and C
3-8Heterocyclylalkyl-C
0-4Alkyl; R wherein
9Optional having of any alkyl by-C (O) OR
10Alternate hydrogen; And R wherein
9Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-4 group alternatively, described group is independently selected from C
1-6Alkyl, C
1-6Alkoxyl group ,-XC (O) OR
10,-XC (O) NR
10R
10,-XS (O)
0-2NR
10R
10With-XS (O)
0-2R
10R wherein
10Be independently selected from hydrogen and C
1-6Alkyl.
2. the formula I compound of claim 1 has formula Ia:
Wherein:
N is selected from 1,2 and 3;
Y is selected from-CH=;
R
1Be halogen or C
1-6Alkyl;
R
2Be selected from C
6-10Aryl, C
5-10Heteroaryl and C
3-12Cycloalkyl; R wherein
2Any aryl, heteroaryl or cycloalkyl replaced by 1-4 group alternatively, described group is independently selected from halogen, hydroxyl, C
1-6Alkyl, halogen-replacement-C
1-6Alkyl and-OC (O) R
5R wherein
5Be selected from hydrogen and C
1-6Alkyl; And
R
3Be selected from C
6-10Aryl, C
5-10Heteroaryl and C
3-8Heterocyclylalkyl; R wherein
3Any aryl, heteroaryl or Heterocyclylalkyl replaced by 1-5 group, described group is independently selected from halogen, C
1-6Alkoxyl group, halogen-replacement-C
1-6Alkyl, halogen-replacement-C
1-6Alkoxyl group ,-OXR
7,-OXC (O) NR
7R
8,-OXC (O) NR
7XC (O) OR
8,-OXC (O) NR
7XOR
8,-OXC (O) NR
7XNR
7R
8,-OXC (O) NR
7XS (O)
0-2R
8,-OXC (O) NR
7XNR
7C (O) R
8,-OXC (O) NR
7XC (O) XC (O) OR
8,-OXC (O) NR
7R
9,-OXC (O) OR
7,-OXOR
7,-OXR
9,-XR
9With-OXC (O) R
9Wherein X is selected from key or C
1-6Alkylidene group; R
7And R
8Be independently selected from hydrogen, cyano group, C
1-6Alkyl, halogen-replacement-C
1-6Alkyl, C
2-6Alkenyl and C
3-12Cycloalkyl-C
0-4Alkyl; R
9Be selected from C
6-10Aryl-C
0-4Alkyl, C
5-10Heteroaryl-C
0-4Alkyl, C
3-12Cycloalkyl-C
0-4Alkyl and C
3-8Heterocyclylalkyl-C
0-4Alkyl; R wherein
9Optional having of any alkyl by-C (O) OR
10Alternate hydrogen; And R
9Any aryl, heteroaryl, cycloalkyl or Heterocyclylalkyl replaced by 1-4 group alternatively, described group is independently selected from C
1-6Alkyl, C
1-6Alkoxyl group ,-XC (O) OR
10,-XC (O) NR
10R
10,-XS (O)
0-2NR
10R
10With-XS (O)
0-2R
10R wherein
10Be independently selected from hydrogen and C
1-6Alkyl.
3. the formula Ia compound of claim 2, wherein:
R
1Be selected from fluorine, chlorine and methyl; And
R
2Be selected from phenyl, cyclohexyl, cyclopentyl, pyrryl, pyrazolyl, naphthyl, benzo [1,3] dioxole, thienyl, furyl and pyridyl; R wherein
2Any aryl, heteroaryl or cycloalkyl replaced by 1-4 group alternatively, described group be independently selected from fluorine, chlorine, bromine, hydroxyl, methyl, ethyl, propyl group, the tertiary butyl, trifluoromethyl and-OC (O) CH
3
4. the formula Ia compound of claim 3, wherein R
3Be selected from phenyl, benzo [1,3] dioxole, pyridyl, 2,2-two fluoro-benzo [1,3] dioxole-5-base and benzoxazolyls; R wherein
3Any aryl or heteroaryl replaced by 1-5 group, described group be independently selected from fluorine, chlorine, bromine, methoxyl group, hydroxyl, difluoro-methoxy ,-OCH
2C (O) NH
2,-OCH
2C (O) OCH
3,-OCH
2C (O) NHCH
3,-OCH
2C (O) N (CH
3)
2,-R
9,-OR
9,-OCH
2R
9,-OCH
2C (O) R
9,-OCH
2C (O) NHR
9,-OCH
2C (O) N (CH
3) R
9,-OCH
2C (O) NHCH
2R
9,-OCH
2CN ,-OCH
2C
2H
3,-OCH
2C
2H
4,-O (CH
2)
2OH ,-OCH
2C (O) NH (CH
2)
2C (O) OC
2H
5,-OCH
2C (O) NH (CH
2)
2CH
2F ,-OCH
2C (O) NHCH
2CH
2F ,-OCH
2C (O) NH (CH
2)
2C (O) OH ,-OCH
2C (O) NHCH (CH
2R
9) C (O) OC
2H
5,-OCH
2C (O) NHC (O) (CH
2)
2C (O) OCH
3,-OCH
2C (O) NH (CH
2)
2NHC (O) CH
3,-OCH
2C (O) NHCH
2C (O) C
2H
5,-OCH
2C (O) NH (CH
2)
2C (O) OC
4H
9,-OCH
2C (O) NHCH
2C (O) OC
2H
5,-OCH
2C (O) NHCH[C (O) OC
2H
5]
2,-S (O)
2CH
3,-OCH
2C (O) NHCH
2CF
3,-OCH
2C (O) NHCH
2C (O) (CH
2)
2C (O) OCH
3,-OCH
2C (O) N (CH
3) CH
2C (O) OCH
3,-OCH
2C (O) NH (CH
2)
3OC
2H
5,-OCH
2C (O) NH (CH
2)
3OCH (CH
3)
2,-OCH
2C (O) NH (CH
2)
2SCH
3,-OCH
2C (O) NHCH
2CH (CH
3)
2,-OCH
2C (O) NHCH (CH
3) CH
2OH ,-OCH
2C (O) NHCH
2CH (CH
3) C
2H
5,-OCH
2C (O) NHCH (CH
3) C (O) OC
2H
5,-OCH
2C (O) NHCH
2CH (CH
3)
2With-OCH
2C (O) (CH
2)
3OCH (CH
3)
2
R wherein
9Be phenyl, cyclopropyl-methyl isoxazolyl, benzothiazolyl, furyl, furyl-methyl, tetrahydrochysene-furyl, pyridyl, 4-oxo-4,5-dihydro-thiazol-2-yl, pyrazolyl, isothiazolyl, 1,3, the 4-thiadiazolyl group, thiazolyl, styroyl, morpholino, morpholino-propyl group isoxazolyl-methyl, pyrimidyl, tetrahydrochysene-pyranyl, 2-oxo-2,3-dihydro-pyrimidine-4-base, piperazinyl, pyrryl, piperidyl, pyrazinyl, imidazolyl, imidazolyl-propyl group, benzo [1,3] dioxolyl, benzo [1,3] dioxolyl-propyl group, 2-oxo-tetramethyleneimine-1-base and 2-oxo-tetramethyleneimine-1-base-propyl group; R wherein
9Optional having of any alkyl by-C (O) OC
2H
5Alternate hydrogen; R wherein
9Any aryl, heteroaryl or Heterocyclylalkyl replaced by 1-4 group alternatively, described group be independently selected from methyl, ethyl, methoxyl group ,-COOH ,-S (O)
2NH
2,-C (O) OC
2H
5,-CH
2C (O) OH ,-CH
2C (O) OC
2H
5,-CH
2C (O) OCH
3,-C (O) OCH
3,-C (O) NH
2With-C (O) NHCH
3
5. pharmaceutical composition comprises the formula I compound and the pharmaceutically acceptable vehicle of the claim 1 for the treatment of significant quantity.
6. the formula I compound of claim 1 is used for the treatment of purposes in the medicine of Animal diseases or illness in preparation, wherein the liver X receptor activity has effect to the pathology and/or the symptomology of described disease, and described disease is selected from cardiovascular disorder, diabetes, neurodegenerative disease and inflammation.
7. the formula I compound of claim 1 is used for the treatment of purposes in the medicine of Animal diseases or illness in preparation, wherein regulates the active prevention of liver X receptor, suppresses or improve the pathology and/or the symptomology of described disease.
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US54384804P | 2004-02-11 | 2004-02-11 | |
| US60/543,848 | 2004-02-11 | ||
| US62302104P | 2004-10-27 | 2004-10-27 | |
| US60/623,021 | 2004-10-27 | ||
| PCT/US2005/004655 WO2005077124A2 (en) | 2004-02-11 | 2005-02-11 | Compounds and compositions as lxr modulators |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1918155A CN1918155A (en) | 2007-02-21 |
| CN1918155B true CN1918155B (en) | 2010-05-26 |
Family
ID=34864533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2005800046771A Expired - Fee Related CN1918155B (en) | 2004-02-11 | 2005-02-11 | Compounds and compositions as LXR modulators |
Country Status (8)
| Country | Link |
|---|---|
| US (3) | US8158662B2 (en) |
| EP (1) | EP1713799A4 (en) |
| JP (1) | JP5022040B2 (en) |
| CN (1) | CN1918155B (en) |
| AU (2) | AU2005211809B2 (en) |
| BR (1) | BRPI0507632A (en) |
| CA (1) | CA2553443C (en) |
| WO (1) | WO2005077124A2 (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP4854264B2 (en) * | 2004-10-27 | 2012-01-18 | 第一三共株式会社 | Benzene compound having two or more substituents |
| AU2005297984B2 (en) * | 2004-10-27 | 2009-11-12 | Daiichi Sankyo Company, Limited | Benzene compound having 2 or more substituents |
| CA2761934C (en) * | 2009-05-28 | 2018-01-09 | Exelixis Patent Company Llc | Substituted 1-(biphenyl-4-yl)-2-benzyl-4-hydroxyalkyl-1h-imidazole compounds and their use as lxr modulators |
| KR101901741B1 (en) | 2010-09-07 | 2018-10-01 | 서울대학교산학협력단 | Sesterterpene compounds and their use |
| CA2939120A1 (en) | 2014-01-10 | 2015-07-16 | Rgenix, Inc. | Lxr agonists and uses thereof |
| US11648220B2 (en) | 2016-01-11 | 2023-05-16 | The Rockefeller University | Methods for the treatment of myeloid derived suppressor cells related disorders |
| JP2021504315A (en) | 2017-11-21 | 2021-02-15 | ルジェニクス，インコーポレーテッド | Polymorphs and their use |
| CN114728875A (en) | 2019-12-13 | 2022-07-08 | 因思博纳公司 | Metal salts and their use |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5106859A (en) * | 1988-09-30 | 1992-04-21 | Tsumura & Co. | Certain 1,3,4-thiadiazole derivatives and anti-ulcer agent comprising said derivatives as active ingredient |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH01160976A (en) | 1987-12-18 | 1989-06-23 | Tsumura & Co | 1,3,4-thiadiazole derivative and antiulcer agent containing said derivative as active component |
| JPH01233282A (en) | 1988-03-12 | 1989-09-19 | Tsumura & Co | 1,3,4-thiadiazole derivative and antiulcer agent containing said compound as active ingredient |
| AU7961300A (en) * | 1999-10-29 | 2001-05-14 | Yamanouchi Pharmaceutical Co., Ltd. | Kainic acid neurocytotoxicity inhibitors |
| US6555563B1 (en) * | 2001-11-16 | 2003-04-29 | Medinox, Inc. | Heteroaryl substituted amidinyl and imidazolyl compounds and methods employing same for the treatment of inflammation |
| US20050036992A1 (en) * | 2002-12-23 | 2005-02-17 | Irm Llc | Novel use of liver X receptor agonists |
-
2005
- 2005-02-11 BR BRPI0507632-3A patent/BRPI0507632A/en not_active IP Right Cessation
- 2005-02-11 JP JP2006553324A patent/JP5022040B2/en not_active Expired - Fee Related
- 2005-02-11 US US10/589,087 patent/US8158662B2/en not_active Expired - Fee Related
- 2005-02-11 WO PCT/US2005/004655 patent/WO2005077124A2/en active Application Filing
- 2005-02-11 CA CA2553443A patent/CA2553443C/en not_active Expired - Fee Related
- 2005-02-11 AU AU2005211809A patent/AU2005211809B2/en not_active Ceased
- 2005-02-11 EP EP05713521A patent/EP1713799A4/en not_active Withdrawn
- 2005-02-11 CN CN2005800046771A patent/CN1918155B/en not_active Expired - Fee Related
-
2009
- 2009-05-12 AU AU2009201867A patent/AU2009201867C1/en not_active Ceased
-
2012
- 2012-03-07 US US13/414,385 patent/US8569345B2/en not_active Expired - Fee Related
-
2013
- 2013-08-29 US US14/013,482 patent/US20130345220A1/en not_active Abandoned
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5106859A (en) * | 1988-09-30 | 1992-04-21 | Tsumura & Co. | Certain 1,3,4-thiadiazole derivatives and anti-ulcer agent comprising said derivatives as active ingredient |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2553443C (en) | 2012-03-27 |
| JP2007522242A (en) | 2007-08-09 |
| US8158662B2 (en) | 2012-04-17 |
| EP1713799A4 (en) | 2010-07-07 |
| JP5022040B2 (en) | 2012-09-12 |
| WO2005077124A2 (en) | 2005-08-25 |
| AU2009201867A8 (en) | 2013-05-30 |
| US8569345B2 (en) | 2013-10-29 |
| AU2009201867B8 (en) | 2013-05-30 |
| AU2009201867C1 (en) | 2013-05-30 |
| BRPI0507632A (en) | 2007-07-03 |
| AU2009201867A1 (en) | 2009-06-04 |
| AU2009201867B2 (en) | 2011-12-15 |
| CA2553443A1 (en) | 2005-08-25 |
| AU2005211809B2 (en) | 2009-02-12 |
| US20090325981A1 (en) | 2009-12-31 |
| US20130345220A1 (en) | 2013-12-26 |
| US20120214812A1 (en) | 2012-08-23 |
| WO2005077124A3 (en) | 2005-11-10 |
| EP1713799A2 (en) | 2006-10-25 |
| CN1918155A (en) | 2007-02-21 |
| AU2005211809A1 (en) | 2005-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1918155B (en) | Compounds and compositions as LXR modulators | |
| TWI643855B (en) | Fxr (nr1h4) modulating compounds | |
| JP6436463B2 (en) | Compounds that regulate intracellular calcium | |
| JP5782377B2 (en) | Compounds that regulate intracellular calcium | |
| JP5112423B2 (en) | Pyridopyrimidinone derivatives | |
| JP4808616B2 (en) | Pyridazine derivatives and their use as therapeutic agents | |
| AU2013283318B2 (en) | Bifluorodioxalane-amino-benzimidazole kinase inhibitors for the treatment of cancer, autoimmuneinflammation and CNS disorders | |
| JP6503019B2 (en) | Compounds that regulate intracellular calcium | |
| CN102812003B (en) | Pyrrolidine Or Thiazolidine Carboxylic Acid Derivatives, Pharmaceutical Composition And Methods For Use In Treating Metabolic Disordersas As Agonists Of G- Protein Coupled Receptor 43 (GPR43) | |
| EP2817292B1 (en) | Sulfonamide compounds and uses as tnap inhibitors | |
| EP1398032A1 (en) | 4-Oxo-quinazolines as LXR nuclear receptor binding compounds | |
| JP2002332266A (en) | Ppar-gamma modulator | |
| JP2009507791A (en) | Niacin receptor agonists, compositions containing such compounds, and methods of treatment | |
| JP2000502702A (en) | Phenylthiazole derivatives having anti-herpesvirus properties | |
| JPH11302173A (en) | Histone deacetylase inhibitor | |
| CN103180316A (en) | Compounds that modulate intracellular calciu | |
| JP2010521513A (en) | Aza-pyridopyrimidinone derivatives | |
| JPWO2003051876A1 (en) | Pyrazolopyridine derivatives and pharmaceutical use thereof | |
| CN102596919A (en) | Aromatase inhibitor | |
| JP2019147807A (en) | Modulator of liver X receptor (LXR) | |
| CN107912042A (en) | For treating the fused bicyclic compound of disease | |
| WO2002102780A1 (en) | Tetrahydroquinoline derivative compound and drug containing the compound as active ingredient | |
| CN101103007A (en) | Amide compound | |
| WO2009131170A1 (en) | Five-membered ring compound | |
| JPH07233151A (en) | Indane derivative, its production and synthetic intermediate therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Molteni Valentina Inventor after: Li Xiaolin Inventor after: Furet Pascal Inventor after: Ellis David Archer Inventor after: Anaclerio Beth Inventor after: Saez Enrique Inventor after: Wityak John Inventor before: Molteni Valentina Inventor before: Li Xiaolin Inventor before: Nabakka Juliet Inventor before: Ellis David Archer Inventor before: Anaclerio Beth Inventor before: Saez Enrique Inventor before: Wityak John |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100526 Termination date: 20150211 |
|
| EXPY | Termination of patent right or utility model |