CN1912131A - Telomere enzyme active quantitive detection method and kit - Google Patents
Telomere enzyme active quantitive detection method and kit Download PDFInfo
- Publication number
- CN1912131A CN1912131A CN 200610014236 CN200610014236A CN1912131A CN 1912131 A CN1912131 A CN 1912131A CN 200610014236 CN200610014236 CN 200610014236 CN 200610014236 A CN200610014236 A CN 200610014236A CN 1912131 A CN1912131 A CN 1912131A
- Authority
- CN
- China
- Prior art keywords
- telomerase
- reverse primer
- molecular beacon
- sequence
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a telomere enzyme activity quantification detection method. It inducts molecular beacon probe into PCR detection to increase the detection specificity. In order to ensure the introduce success, it adopts negative direction primer 1 and 2 of the PCR forward primer sum while PCR amplifying. The invention also provides the kit of the molecular beacon probe and negative direction primer 1 and 2 in question.
Description
Technical field
The present invention relates to a kind of quantitative measurement technology of telomerase activation and use the test kit that this technology is carried out the telomerase activation detection.Belong to external biological medical diagnostic techniqu field.
Background technology
At present, cancer has become first killer of human health, adopts the genetics method cancer is carried out early diagnosis and the grade malignancy of tumour to be made accurately early judge, is that prevention or the treatment to cancer all has crucial meaning.
Telomerase is a species specificity reversed transcriptive enzyme that is present in the tumour cell, and it can be template with the RNA subunit of self, the following telomere repeat sequence of the promotion of protein subunit reversed transcriptive enzyme (5 '-(GGTTAG)
n-3 ') join the end of linear chromosomal, keep telomere length and stability, make cell be able to immortality.More and more many studies show that, the activation analysis of Telomerase can be used for the early diagnosis and the grade malignancy of cancer and judges.
At present, the detection of telomerase activation research has become international research focus, and existing several different methods is seen in report.In these methods, telomeric repeat amplifcation protocol (the Telomeric repeat amplificationprotocol that has set up in 1994 with people such as Kim, TRAP) the most noticeable, the telomerase activation that this method is applied to round pcr dexterously detects, and has greatly improved the sensitivity that detects.On this basis, people constantly improve, and have proposed the novel method that a series of telomerase activations detect.These detection methods comprise: TRAP primer improved method, affinity scintillation analysis-TRAP method, TRAP-enzyme linked immunosorbent assay analysis method, hybridization protection analysis-TRAP method, colorimetric hybridization analysis-TRAP method etc.But with regard to these methods, all exist certain shortcomings and deficiencies, this just is provided with certain obstacle for their applications clinically.These defectives mainly embody a concentrated expression of following two aspects: after (1) pcr amplification is finished, need loaded down with trivial details amplified production to detect step.These detection methods are complex operation, length consuming time not only, is not suitable for the mass detection research of sample, and cause the crossed contamination of product easily, causes the generation of false positive results.(2) need labelled with radioisotope.If misoperation not only can damage the experimenter, and easy contaminate environment.Simultaneously, qualitative and semi-quantitative analysis can only be carried out, the demand of detection by quantitative can't be reached.The appearance of real-time quantitative TRAP method has overcome above-mentioned defective effectively, but with regard to the two kinds of real-time quantitative methods (SYBRGreen method and Amplifluor method) that are used for Telomerase activity at present, their existing common defects are exactly that detection specificity is relatively poor, and the generation of PCR primer diploid and other non-specific amplification product all can cause the generation of background fluorescence signal and cause detection sensitivity not high.This has just limited this two kinds of real-time quantitative detection method application in clinical diagnosis to a certain extent.Therefore, exploitation high degree of specificity diagnostic techniques, quick, effective and supermatic detection by quantitative of carrying out telomerase activation is imperative.
Summary of the invention
The present invention has been incorporated into the specific molecular beacon probe of Telomerase reaction product in the middle of the PCR detection architecture of Telomerase, utilize the specificity recognition reaction of molecular beacon probe to telomere repeat sequence, improve the specificity of detection, solved the problems referred to above effectively.And adopted a kind of pcr amplification strategy of uniqueness for the smooth introducing that realizes molecular beacon probe, promptly on the basis of traditional pcr amplification technology, two kinds of reverse primers 1 and 2 have been used simultaneously, and to 3 of reverse primer 1 '-end modify, make the extension ability of its forfeiture in pcr amplification reaction, avoided this reverse primer in pcr amplification, to participate in the formation of primer diploid and other non-specific amplification products.
The purpose of this invention is to provide a kind of new telomerase activation quantitative measurement technology, it has improved sensitivity and specificity that telomerase activation PCR detects, detects when can carry out batch samples.
Telomere enzyme active quantitive detection method of the present invention comprises:
(1) from testing sample, extracts active Telomerase.
(2) in the PCR system, the Telomerase that extracts is acted on specific substrate, obtain carrying the Telomerase reaction product of telomere repeat sequence.
(3) use a PCR forward primer and reverse primer 1 and 2, the Telomerase reaction product that obtains is carried out pcr amplification, molecular beacon probe is incorporated in the PCR detection architecture of Telomerase.
(4) in pcr amplification, the fluorescent signal of introducing by monitoring that molecular beacon probe produced is in order to detect amplified production.
Described molecular beacon probe is to be action target spot with telomere repeat sequence or its complementary sequence, and the total length of its sequence is preferably 15 to 50 Nucleotide.
3 of described reverse primer 1 '-end or near 3 '-position of end includes and telomere repeat sequence complementary nucleotide sequence; 5 '-end or near 5 '-position of end include with 3 of reverse primer 2 or reverse primer 2 '-hold same or analogous nucleotide sequence; And 3 of reverse primer 1 '-modification of end process, lost the extension ability in pcr amplification reaction; The complete nucleotide sequence or 3 of described reverse primer 2 '-one section nucleotide sequence of end is identical or close with certain section sequence on the reverse primer 1.
The molecular beacon of introducing among the present invention is the single strand oligonucleotide probes of a class stem-ring structure, and its English name is molecular beacon.Its ring portion is made of with target gene complementary probe sequence-section, and the two ends of probe sequence are two sections mutual complementary stem sequences, and annealing forms hairpin structure between them.Fluorophor and quencher group are connected to the end of two arms.The stem of hair clip type makes fluorophor and quencher group approaching mutually, and the fluorescence that causes fluorophor shifts by energy and by quencher.As the target gene of coupling is when existing fully with it, the probe sequence of molecular beacon combines with target gene specific, forms probe-target crossbred, forces fluorophor and quencher group mutually away from, system fluorescence recovery.Because the molecular beacon of hybridization does not still keep original hairpin structure, emitting fluorescence not is so need not probe-target crossbred is separated with the molecular beacon of surplus when the hybridization of detection probes.
In the present invention, the introducing of specific molecular beacon probe can greatly improve the specificity of detection, weakens the disadvantageous effect that non-specific pcr amplification product causes.As long as do not include the target sequence of molecular beacon probe in the non-specific pcr amplification product that generates, it just can not interact with molecular beacon probe, just can not cause the generation of non-specific fluorescence signal yet.
For traditional TRAP method, directly the real-time monitoring of carrying out its amplified production with molecular beacon probe can't realize, its major cause be Telomerase reaction product sequence singularity (be 5 '-(GGTTAG)
n-3 ' telomere repeat sequence) cause certainly existing great dependency between the probe sequence of reverse primer of PCR and molecular beacon, the primer diploid and other non-specific amplification products that are participated in forming by this reverse primer all will cause opening of molecular beacon hairpin structure, produce the non-specific fluorescence signal.And the present invention has adopted a kind of pcr amplification strategy of uniqueness, promptly when the Telomerase reaction product that obtains is carried out pcr amplification, has used a PCR forward primer and reverse primer 1 of the present invention and 2, has solved this problem effectively.
Because 3 of reverse primer 1 '-end or near 3 '-position of end includes and telomere repeat sequence complementary nucleotide sequence, in case this primer participates in the generation of primer diploid or other non-specific pcr amplification product, also will cause the generation of non-specific fluorescence signal, detection is caused totally unfavorable influence.Therefore the present invention to 3 of this reverse primer '-end modifies, make the extension ability of its forfeiture in pcr amplification, solved this problem preferably, its in the PCR range of DO that is carried out (about 40 circulations) can not had any impact to testing process.
The detectable sample of the technology of the present invention comprises histocyte, blood, human secretion, movement, cell pin aspirate, cleaning piece and other various clinical samples.
Another object of the present invention provides the test kit that is used for above-mentioned testing goal, and it comprises molecular beacon probe of the present invention, reverse primer 1 and 2 necessary other compositions of pcr amplification that reach except that amplification template.
Further specify principle of work of the present invention below in conjunction with accompanying drawing.
Referring to Fig. 1. (a) in initial incubation step, the Telomerase substrate extends 5 under the effect of active Telomerase '-(GGTTAG)
n-3 ' telomere repeat sequence.(b) at the annealing stage of pcr amplification, the Telomerase reaction product of generation and 3 of reverse primer 1 '-end combines.(c) in subsequently primer extension stage, be combined in Telomerase reaction product reverse primer 1 extension on the reverse primer 1 in the effect lower edge of Taq enzyme, the binding site that includes reverse primer 2 on the product that generates can carry out the index amplification as template in pcr amplification subsequently.(d) with the metacyclic high-temperature denatured stage, pcr template sex change at high temperature forms strand.(e) when temperature is reduced to annealing temperature, molecular beacon probe combines with corresponding target gene site on the template, and hairpin structure is opened, and produces fluorescent signal, unconjugated molecular beacon probe then keeps original hairpin structure, and the system fluorescent signal is not exerted an influence.Simultaneously, Telomerase substrate and downstream primer 2 conducts PCR primer subsequently are to being combined in the corresponding site on the template.(f) Telomerase substrate and downstream primer 2 extend the double-stranded PCR product of generation under the effect of Taq enzyme.(g) enter the next round circulation.
Description of drawings
Fig. 1 shows the principle of work of detection technique of the present invention.
Fig. 2. technology of the present invention is used for the mensuration research of the Telomerase product-MTSR6 of synthetic.
(A) fluorescence signal intensity was with the changing conditions of PCR cycle number during PCR in real time increased.
(B) according to the C that provides among the A
tThe working curve that value is mapped and obtained the logarithmic value of contained MTSR6 amount in the reaction solution.The amount of contained MTSR6 is respectively in 8 reaction systems: (1) 10
4Amol; (2) 10
3Amol; (3) 10
2Amol; (4) 10amol; (5) 1amol; (6) 10
-1Amol; (7) 10
-2Amol; (8) 0amol.
Fig. 3. technology of the present invention is used for the detection research of HL-60 cell Telomerase Activity.
(A) fluorescence signal intensity was with the changing conditions of PCR cycle number during PCR in real time increased.
(B) according to the C that provides among the A
tThe working curve that value is mapped and obtained the logarithmic value of cell number contained in the reaction solution.Contained HL-60 cell number is respectively in 6 reaction systems: (1) 10
4(2) 10
3(3) 10
2(4) 10; (5) 5; (6) 10
4(making the Telomerase inactivation) through Overheating Treatment.
Following word/term used herein has following implication, except being otherwise noted.
C
tValue: the period that the fluorescence signal in each reaction tube experiences when arriving the thresholding of setting.
MTSR6: 3 of Telomerase substrate '-end extend 65 '-telomere repeat sequence of GGTTAG-3 '.
Embodiment
In order to understand the present invention better, the present invention is further described by the following embodiment, but do not limit the present invention.
The mensuration of the Telomerase product-MTSR6 of 1 pair of synthetic of embodiment.
Molecular beacon probe is: FAM-5 '-
CCGTGCTAACCCTAACCCTAACC
CACGG-3 '-DABCYL
The line part is the stem of hair clip, and uncrossed part is and target sequence specificity complementary probe sequence.
The Telomerase substrate is: 5 '-GACAATCCGTCGAACAGAGTT-3 '
MTSR6：5′-GACAATCCGTCGAACAGAGTTAG(GGTTAG)
6-3′
With this artificial synthetic dna sequence dna analog end granzyme reaction product, the feasibility of checking the technology of the present invention.
Step:
On Rotor-Gene 3000 fluorescent PCR instrument, above-mentioned 8 tube reaction liquid are carried out pcr amplification with above-mentioned primer and molecular beacon probe:
Each the 55 ℃ fluorescent signals of measuring molecular beacon down in second group of circulation (40 circulations).
The result as shown in Figure 2.As can be seen from the results, the inventive method can be used for the mensuration of the Telomerase product of synthetic, and linearity range can reach 10
7The individual order of magnitude, linearly dependent coefficient remains at more than 0.99.For the negative control reaction that does not add MTSR6, the system fluorescence intensity does not almost change in the PCR range of DO that is carried out, and shows that technology of the present invention has the good detection specificity.
The detection of 2 couples of leukemia cell HL-60 of embodiment Telomerase Activity.
The sequence of the molecular beacon probe that uses in the present embodiment, reverse primer and Telomerase substrate is identical with embodiment 1.
Detect step:
(1) extraction of Telomerase in the cell
Collect the leukemia cell HL-60 that cultivates, the centrifugal 3min precipitation separation of 3000rpm cell is abandoned supernatant.Precipitation suspends with the PBS damping fluid of precooling, and the centrifugal 3min of 3000rpm abandons supernatant.Cell is resuspended in the dcq buffer liquid of precooling, and (Hepes-KOH10mmol/L, pH 7.5, MgCl
21.5mmol/L, KCl 10mmol/L, DTT 1mmol/L) in.Under 4 ℃, the centrifugal 1min collecting precipitation of 10000rpm.Precipitation is placed the 1.5mL centrifuge tube, and (Tris-HCl 10mmol/L, pH 7.5, EGTA 1mmol/L, MgCl to add 200 μ L lysates
21mmol/L, beta-mercaptoethanol 5mmol/L, glycerine 10%, CHAPS 0.5%, PMSF0.1mmol/L), ice bath cracking 30min, during aspirate repeatedly 3 times with pipettor, to guarantee abundant cracking.Then, in 4 ℃, the centrifugal 30min of 14000rpm draws supernatant liquor, 10 times of dilutions successively.Diluent liquid nitrogen quick freezing, it is standby to put-70 ℃ of preservations.
The preparation of negative control sample: get 5 μ L cell extracts, 95 ℃ of following thermal treatment 30min make the Telomerase inactivation.
(2) PCR in real time detects
The composition of PCR reaction solution is as follows: 1 * PCR reaction buffer, 5mM MgCl
2, the dATP of each 0.2mM, dTTP, dCTP, dGTP, 0.4 μ M Telomerase substrate, reverse primer 1, the 0.4 μ M of 8nM reverse primer 2,80nM molecular beacon probe, 2UBlend Taq enzyme and 1 μ L cell extract.
PCR in real time detects carries out on Rotor-Gene 3000 fluorescent PCR instrument, and concrete amplification condition is as follows:
Each the 55 ℃ fluorescent signals of measuring molecular beacon down in second group of circulation (40 circulations).The result as shown in Figure 3.As can be seen from the results, the inventive method can be used for the mensuration of cell Telomerase Activity.In the cell number scope of being studied (10
4～5 cells), C
tAll shown good linear relationship between the logarithmic value of value and cell number, linearly dependent coefficient remains at more than 0.99.When using heat treated cell extract to make negative control, find that the growth of its fluorescent signal will lag significantly behind the positive reaction system, show that technology of the present invention has the good detection specificity.Use technology of the present invention, also can detect 1 telomerase activation in the cell, but result's circulation ratio is relatively poor, so when carrying out the telomerase activation detection, the cell sample number of use is unsuitable very few.
Sequence list
＜110〉Nankai University
＜120〉a kind of telomere enzyme active quantitive detection method and test kit
<130>20060609
<160>2
<210>1
<211>49
<212>DNA
＜213〉artificial sequence
<220>
<221>prim_bind
<222>(1)…(49)
＜223〉the base phosphorylation modification of least significant end (3 '-end)
<400>1
tagagcacagcctgtccgtgacgataccgtgctaaccctaaccctaacc
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<220>
<221>prim_bind
<222>(1)…(20)
<223>
<400>2
tagagcacagcctgtccgtg
Claims (4)
1, a kind of telomere enzyme active quantitive detection method comprises:
(1) from testing sample, extracts active Telomerase;
(2) in the PCR system, the Telomerase that extracts is acted on specific substrate, obtain carrying the Telomerase reaction product of telomere repeat sequence;
(3) the Telomerase reaction product that obtains is carried out pcr amplification;
(4) in pcr amplification, amplified production is detected;
It is characterized in that:
(1) in the PCR of Telomerase detection architecture, introduced the specific molecular beacon probe of Telomerase reaction product, by monitoring fluorescent signal that molecular beacon probe produced in order to amplified production is detected.Described molecular beacon probe is to be action target spot with telomere repeat sequence or its complementary sequence;
When (2) the Telomerase reaction product that obtains being carried out pcr amplification, use a PCR forward primer and reverse primer 1 and 2; 3 of described reverse primer 1 '-end or near 3 '-position of end includes and telomere repeat sequence complementary nucleotide sequence; 5 '-position of end or near 5 ' end include with 3 of reverse primer 2 or reverse primer 2 '-hold same or analogous nucleotide sequence; And 3 of reverse primer 1 '-modification of end process, lost the extension ability in pcr amplification reaction; The complete nucleotide sequence or 3 of described reverse primer 2 '-one section nucleotide sequence of end is identical or close with certain section sequence on the reverse primer 1.
2, telomere enzyme active quantitive detection method according to claim 1 is characterized in that the total length of molecular beacon probe sequence is about 15 to 50 Nucleotide.
3, telomere enzyme active quantitive detection method according to claim 1 is characterized in that described testing sample comprises histocyte, blood, human secretion, movement, cell pin aspirate, cleaning piece and other various clinical samples.
4, a kind of telomerase activation detection kit is characterized in that it contains the described reverse primer 1 of claim 1 and 2 and claim 1 or 2 described molecular beacon probes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100142366A CN1912131B (en) | 2006-06-09 | 2006-06-09 | Telomere enzyme active quantitive detection method and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100142366A CN1912131B (en) | 2006-06-09 | 2006-06-09 | Telomere enzyme active quantitive detection method and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1912131A true CN1912131A (en) | 2007-02-14 |
| CN1912131B CN1912131B (en) | 2011-12-14 |
Family
ID=37721187
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006100142366A Expired - Fee Related CN1912131B (en) | 2006-06-09 | 2006-06-09 | Telomere enzyme active quantitive detection method and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1912131B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220418A (en) * | 2011-04-22 | 2011-10-19 | 天津医科大学 | Dual temperature rapid cycling fluorescence quota PCR method for detecting telomerase activity and kit |
| CN102260739A (en) * | 2011-06-30 | 2011-11-30 | 中国科学院长春应用化学研究所 | Telomerase activity detection method |
| CN113025709A (en) * | 2019-12-25 | 2021-06-25 | 中国科学院动物研究所 | Primer group for detecting telomerase activity and detection method |
-
2006
- 2006-06-09 CN CN2006100142366A patent/CN1912131B/en not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102220418A (en) * | 2011-04-22 | 2011-10-19 | 天津医科大学 | Dual temperature rapid cycling fluorescence quota PCR method for detecting telomerase activity and kit |
| CN102260739A (en) * | 2011-06-30 | 2011-11-30 | 中国科学院长春应用化学研究所 | Telomerase activity detection method |
| CN102260739B (en) * | 2011-06-30 | 2013-11-13 | 中国科学院长春应用化学研究所 | Telomerase activity detection method |
| CN113025709A (en) * | 2019-12-25 | 2021-06-25 | 中国科学院动物研究所 | Primer group for detecting telomerase activity and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1912131B (en) | 2011-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2012249751B2 (en) | Compositions and methods for detecting BV-associated bacterial nucleic acid | |
| CN103710433A (en) | Babesiidae protozoon detection primer and real-time fluorescent quantitative PCR (polymerase chain reaction) kit | |
| CN101613751A (en) | The PCR kit for fluorescence quantitative of rapid detection toxoplasma gondii | |
| CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
| CN1912131A (en) | Telomere enzyme active quantitive detection method and kit | |
| CN103276099A (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN110564882B (en) | Double TaqMAN probe fluorescent quantitative PCR detection method for piroplasmosis | |
| CN104195269A (en) | Method for detecting tomato spotted wilf virus | |
| CN101051026A (en) | Double real time fluorescence PCR detecting method for vancomycin enterococcus | |
| CN101451162B (en) | Primer, detecting probe and actual time fluorescent PCR kit for detecting Thielaviopsls basicola | |
| CN106319079A (en) | Method for detecting 22q11.2 copy number deletion | |
| CN101041853A (en) | Primer, probe and real-time fluorescent PCR reagent case for detecting tobacco black shank bacterium | |
| CN1680596A (en) | Fluorescent quantitative PCR determination kit for Neisser | |
| KR101509071B1 (en) | Primers for amplifying Microcystis sp Gene, and detection method of Microcystis sp using the same | |
| KR20070099208A (en) | Std kit | |
| CN102154518A (en) | Technology for rapidly detecting rice black-streaked dwarf viruses in plants by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) method | |
| CN104342497A (en) | Method for LAMP (looped-mediated isothermal amplification) detection of trypanosoma evansi variant strain with deletion of ToTat1.2 gene | |
| CN101892313B (en) | Method for fast detecting trypanosome evansi by utilizing loop-mediated isothermal application technology | |
| CN102492773B (en) | Chip for screening 16SrI group phytoplasmas and application thereof | |
| CN110804674A (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN1563411A (en) | Kit of testing garlic virus and testing method | |
| CN103409503B (en) | Fluorescence kit for rapidly detecting miRNA concentration in serum | |
| CN1262673C (en) | Method for preparing nucleic acid probe library | |
| CN102154456B (en) | Fluorescent quantitative loop-mediated isothermal amplification (LAMP) detection method for bovine tuberculosis pathogene | |
| CN110317889B (en) | Gonococcus nucleic acid detection kit and gonococcus nucleic acid detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111214 Termination date: 20120609 |