CN1884541A - Protein coding sequence for controlling rice tapetum degradation - Google Patents

Abstract

This is the coding sequence of degradable protein which can control rice tapetum. This invention belongs to the gene engineering field. The extracted DNA molecule includes: nucleotide sequence that it's coding has the peptides with the rice OsTDR protein activity. The above sequence has the peptides which with the amino acid sequence indicated by the SEQ ID NO. 2, as well as the Nucleotide sequence of 1-1659 of nucleotide indicated by the SEQ ID NO.1. By the degradable protein which can control rice tapetum, what can be filtered through the normal filtration is the substance that interactioned with degradable protein which control rice tapetum or receptor, inhibitor or anatognist etc. This invention can obviously control the degradation of rice tapetum, produce new male sterile rice sterile line, generate hiberdization seeds, perform recurrent selection and create gene pool, so it is very important in agriculture.

Description

The albumen coded sequence of control rice tapetum degradation

Technical field

What the present invention relates to is a kind of albumen coded sequence, and particularly a kind of albumen coded sequence of controlling rice tapetum degradation belongs to the genetically engineered field.

Background technology

Paddy rice (Oryza sativa L.) is a kind of important crops, simultaneously because it has less genome (389Mb), with other grass very high collinearity is arranged, so paddy rice has become a kind of important unifacial leaf model animals of research plant function gene.Male sterility of rice has crucial meaning in agriculture production, can be used for producing cenospecies, carries out recurrent selection and creates gene pool.The male sterile genetic mechanism is an important topic of developmental biology always, and the sudden change of male sterile simultaneously also is the suitable material that research plant microgametophyte is grown.In recent years, carried out many-sided research such as genetics, cytology and anatomy and Physiology and biochemistry etc., obtained certain progress for male sterility of rice.From there being the scholar that the genetic characteristics of male sterility of rice has been done a large amount of research work in 20th century, can be divided into the sterile type of nuclear, the sterile type of nucleo-cytoplasmic interaction by genetic characteristics.On angle of physiology, male sterility of rice is to belong to functional sterile, and abortion appears in sporule in generating process, can not form great-hearted pollen.

In high flowering plant, pollen development is a complicated process, relates to the differentiation of pollen sac tissue, and in pollen sac, microsporocyte produces sporule by reduction division, and sporule further develops into pollen granule.People generally are divided into pollen development eight periods, and normal pollen development relates to the growth of reduction division, mitotic division, tapetal cell etc.The factor that influences male sterility of rice in the pollen development process is very many, and one of them important factor is exactly the influence of the tapetal cell of flower pesticide to the pollen development process.Many experimental evidences show that tapetal cell plays crucial effect to the pollen development process, and tapetum is the innermost layer cellular layer of pollen-sac wall, with the pollen mother cell indirect contact.This layer secretory tissue produces the more necessary nutritive substances of pollen maturation, degenerates fully when pollen maturation subsequently.The disappearance of tapetum will directly cause the fragmentation of pollen mother cell, thereby cause male sterile.

Find (1) Chinese patent open source literature CN02823020.5 by retrieval: a kind of fertility restorer gene of paddy rice BT-male sterile cytoplasm that utilizes is given or is controlled the method for fertility and identifies the method that fertility restorer gene exists; This patent provides a kind of BT of utilization type male sterile cytoplasm to make paddy rice possess fertility or controls the method for its fertility, and identifies and recover the method whether gene exists.This patent utilization have the nucleic acid of base sequence shown in the SEQ ID N0.27 or the nucleic acid of at least 70% identity arranged with base sequence shown in the SEQ ID NO.27, it has the function of recovering fertility.Perhaps, can utilize the nucleic acid of the 38538th to 54123 bit base sequence with SEQ ID NO.27, or with the 38538th to the 54123 bit base sequence of SEQ ID NO.27 the nucleic acid of at least 70% identity be arranged, they also have the function of recovering fertility.(2) Chinese patent open source literature CN01816569.9: at the genotypic presuming method of fertility restorer gene seat in the paddy rice BT type male cytoplasmic sterility; This patent relates to the detection method of recovering BT type cytoplasmic male sterile gene at the Rf-1 gene in the breeding of hybridized rice.Specifically, this patent relates to utilizes near several PCR mark seats and the chain characteristic of Rf-1 locus that exists the Rf-1 locus, detects the method for Rf-1 gene.More particularly, this patent relates to by the Rf-1 locus between novel PC R mark seat S12564 Tsp509I seat and C1361 MwoI seat on No. 10 karyomit(e) of paddy rice, detect near several PCR mark seat genotype that exist it, this method is not only easy but also can check the existence of Rf-1 gene exactly and screen Rf-1 gene pure type individuality.(3) CN03820910.1: the paddy rice of paddy rice BT type cytoplasmic male sterility recovers gene.This patent provides the sterile restoring gene of paddy rice BT type cytoplasmic male sterility.The gene of this patent comprises the aminoacid sequence of coding SEQ ID NO:75, or identical with the aminoacid sequence at least 70% of SEQ ID NO:75, and has the nucleic acid of the aminoacid sequence that recovers the fertility function.Preferably, the gene of this patent has the base of the 43907-46279 position of the base sequence of SEQ ID NO:69-74,80-85 or SEQ ID NO:27.So far do not find the description and the report of OsTDR gene related to the present invention.

Summary of the invention

The object of the present invention is to provide a kind of new control rice tapetum degradation albumen coded sequence OsTDR and can utilize this albumen to produce new male sterible series of rice, can be used for producing cenospecies, carry out recurrent selection and create gene pool, in agriculture production, have crucial application.The invention discloses and rice tapetum degradation proteins associated gene and rice Os TDR protein sequence and nucleotide sequence thereof, and in the application that utilizes on the transgenic technology control male sterility of rice.

The present invention is achieved by the following technical solutions: a kind of isolated dna molecular provided by the present invention, this molecule comprises: coding has the nucleotide sequence of the polypeptide of rice Os TDR protein active.

Described sequence has the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2.

Described sequence has among the SEQ ID NO.1 nucleotide sequence from Nucleotide 1-1659 position.

The present invention the polypeptide of protein active of isolated control rice tapetum degradation, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQID NO.2 aminoacid sequence, or its reactive derivative.Preferably, this polypeptide is to have SEQ ID NO.2 polypeptide of sequence.

Also provide a kind of usefulness above-mentioned carrier transformed host cells in the present invention, it is an eukaryotic cell.This host cell is a paddy rice in example.

In the present invention, " isolating ", " purifying " DNA are meant, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.

In the present invention, refer to encode has the nucleotide sequence of the polypeptide of controlling the rice tapetum degradation protein-active to term " control rice tapetum degradation albumen (or polypeptide) encoding sequence ", as 1-1659 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.1.This degenerate sequence is meant, is arranged in the encoder block 1-1659 position Nucleotide of SEQ ID NO.1 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.1 in 1-1659 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.1 of also encoding out.This term also comprises can be under the moderate stringent condition, better under the height stringent condition with SEQ ID NO.1 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 1-1659 position.This term also comprise with SEQ ID NO.1 in from the homology of nucleotide sequence at least 70% of Nucleotide 1-1659 position, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.

This term also comprises encoding to have the variant form of open reading frame sequence among the proteic SEQ ID NO.2 with the identical function of natural control rice tapetum degradation.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and several (are generally in 60 to hold interpolation 5 ' and/or 3 ', preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.

In the present invention, term " control rice tapetum degradation albumen or polypeptide " refers to have the SEQ ID NO.2 polypeptide of sequence of control rice tapetum degradation protein-active.This term also comprises having and the variant form relevant identical function of natural control rice tapetum degradation albumen, SEQ ID NO.4 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises control proteic active fragments of rice tapetum degradation and reactive derivative.

The proteic variant form of control rice tapetum degradation of the present invention comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, can grow the coded albumen of the DNA of relevant DNA hybridization and utilize anti-rice tapetum to grow the polypeptide or the albumen of the antiserum(antisera) acquisition of related polypeptide with rice tapetum under high or low stringent condition.

In the present invention, " control rice tapetum degradation albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO.2, have 10 at the most, preferably at the most 8, more preferably 5 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most.

Invention also comprises the analogue of control rice tapetum degradation albumen or polypeptide.The difference of these analogues and natural control rice tapetum degradation related polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.

(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.

In the present invention, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid, clay etc.When production rice tapetum of the present invention is grown related polypeptide, control rice tapetum degradation albumen coded sequence operationally can be connected in expression regulation sequence, thereby form control rice tapetum degradation correlative protein expression carrier.

As used herein, " operationally being connected in " refer to a kind of like this situation, and promptly some part of linear DNA sequence can influence the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.

In the present invention, term " host cell " is an eukaryotic cell.Eukaryotic host cell commonly used comprises yeast cell, rice cell and other vegetable cell.

Whether and quantity the expression of also available Northern blotting technical Analysis control rice tapetum degradation gene product, the i.e. existence of rna transcription thing in cell of analysis and Control rice tapetum degradation.

In addition, the present invention also provides a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 continuous nucleotide of the nucleotide coding sequence of control rice tapetum degradation gene usually, preferably has 15-50 continuous nucleotide.This probe can be used for whether existing in the test sample the relevant nucleic acid molecule of coding control rice tapetum degradation.

The present invention also provides the method that whether has control rice tapetum degradation related nucleotide sequences in the test sample, and it comprises with above-mentioned probe and sample and hybridizing whether detection probes combination has taken place then.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to control rice tapetum degradation associated nucleotide encoding sequence, and can be positioned at the both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.

In addition, according to the nucleotide sequence and the aminoacid sequence of control rice tapetum degradation gene of the present invention, can be on the homology basis of nucleic acid homology or marking protein, relevant homologous gene of screening control rice tapetum degradation or homologous protein.

Control rice tapetum degradation associated nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.

In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.

In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.

Except producing with recombination method, the also available solid phase technique of the proteic fragment of the present invention is produced by direct peptide synthesis.Can carry out by hand or automatically at external synthetic protein.Can distinguish proteic each fragment of chemosynthesis the present invention, be connected to produce the molecule of total length with chemical process then.

The present invention utilizes gamma-rays that japonica rice 9522 strains are handled, and for selecting the unusual mutant of anther development, selecting separation is research object than the recessive single-gene mutant that is 3: 1 at F2 in the plantation back.Obtain the new recessive male sterile mutant of a paddy rice Ostdr.By hereditary localization method, at first the mutator gene seat is positioned between paddy rice the 2nd karyomit(e) SSR mark RM109 and the RM7562.Further Fine Mapping, we have developed 11 pairs between RM109 and RM7562 have polymorphism InDel molecule marker, and this locus is positioned between LHS12 and the LHS3, and physical distance is 52kb.To NCBI in this scope (http://www.ncbi.nlm.nih.gov) and tigr (http://www.tigr.org) all forecast analysis 10 genes are arranged. wherein predict according to the anther development genes involved of report in the past, 2 transcription factors of bHLH and zinc finger protein might be to cause the mutator gene of this proterties, GTP enzyme and protein kinase may work in signal transduction pathway in addition, also may cause the male sterile phenomenon.These genes are carried out the cloning and sequencing analysis respectively, and the protein gene of finding to contain in the mutant bHLH structural domain has lacked a base C in the 7th exon, thereby causes sudden change.By sterility of anthers mutant Ostdr development of floral organs being carried out tissue slice, scanning electron microscope, chromosome observation each period, the sudden change of finding the OsTDR gene can cause paddy rice not degenerate at sporule tapetum in period, sporule can not develop into pollen granule, pollen development later stage tapetum increases unusually, thereby the sporule fragmentation causes male sterile.Because this gene can cause tapetum degradation to postpone, so our called after OsTDR (Oryza sativa L TapetumDegradation Retardation) gene.By in situ hybridization analysis revealed OsTDR gene specifically expressing in tapetum.Quantitative RT-PCR shows that the OsTDR gene is only specific expressed in rice flower organ, do not express at root, stem, Ye Zhongjun, and the highest at microsporocyte and reduction division expression amount in period, descend until disappearance at pollen development later stage expression amount.Complementation test shows that the OsTDR gene can partly recover the phenotype of mutant.Illustrate that this gene function is the pollen development that has influence on paddy rice really.

Utilize control rice tapetum degradation albumen of the present invention,, can filter out and control the interactional material of the relevant generation of rice tapetum degradation albumen, perhaps acceptor, inhibitor or antagonist etc. by various conventional screening methods.The present invention can produce new male sterible series of rice having tangible effect aspect the control rice tapetum degradation, is used for producing cenospecies, carries out recurrent selection and creates gene pool, has crucial application in agriculture production.

Description of drawings

The morphological observation synoptic diagram of Fig. 1 Ostdr mutant plant

Location, Fig. 2 OsTDR seat synoptic diagram

Fig. 3 OsTDR genome sequence synoptic diagram

Wherein: arrow is represented the mutational site

The homology comparison synoptic diagram of Fig. 4 OsTDR gene and AMS gene

Fig. 5 Ostdr mutant recovers the mature pollen section synoptic diagram of phenotype

The tissue slice synoptic diagram is carried out in Fig. 6 sterility of anthers mutant Ostdr and 9522 wild-type developments of floral organs each period

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.These embodiment only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, for example the Sambrook equimolecular is cloned: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Acquisition and the morphologic observation of embodiment 1:Ostdr mutant plant

This mutant is that this laboratory is used ⁶⁰Co ray mutagenesis japonica rice 9522 seeds, treatment dosage be 280Gy. to the F2 of mutagenesis in generation a male sterile mutant three generations backcross, obtain the mutant Ostdr of the genetic stability of recessive single-gene control.All vegetable materials are planted in the test base, Academy of Agricultural Sciences, Shanghai City.The Ostdr mutant with backcross with japonica rice 9522, F1 generation be to educate all, selfing F2 is the appearance separation in generation, wherein normal plant is 189, mutant strain is 55, normal plant and mutant plant ratio were near 3: 1 (χ ²=0.79 χ ^0.053.84), show that this male sterile mutation type surface is caused by a monokaryon transgenation.

Morphological observation to Ostdr mutant plant.As Fig. 1, the contrast of the phenotype of wild-type and mutant Ostdr shows that Ostdr mutant (right side) has identical plant height and spike length with wild-type (left side).But wild-type (left side) is shown as yellow flower pesticide, mutant Ostdr (right side) display white flower pesticide.And the white flower pesticide of mutant Ostdr (right side) is less than normal than the yellow flower pesticide of wild-type (left side).

The location and the clone of embodiment 2:OsTDR gene

(1) target group.With Ostdr and long-grained nonglutinous rice strain Long Tefu B hybridization, selfing obtains F2 generation, and selecting is target group for male sterile plants wherein.

(2) paddy DNA extracts.Adopt improved CTAB method.Easy steps is as follows: get blade 0.1-0.2 gram (about half sheet) and be put in the little mortar, add an amount of liquid nitrogen, be ground to powdery at once, the 2ml centrifuge tube of packing into, the 1.5xCTAB solution that adds 700ul100 ℃ of preheating is in centrifuge tube, put into 56 ℃ of water-baths behind the careful mixing, take out centrifuge tube after 20 minutes, add equal-volume chloroform/primary isoamyl alcohol, fierce mixing, centrifugal (13000rpm) 10 minutes gets supernatant in new pipe, puts more than half an hour for-20 ℃ behind the adding 900ul dehydrated alcohol mixing.The DNA that separates out is centrifugal, 14000rpm (10 minutes).Remove supernatant, will precipitate with 1ml70% ethanol and clean once, centrifugal drying is dissolved in 200ul 1/10TE or the water, and 4 ℃ of refrigerators are preserved.

(3) InDel molecular marker analysis.The SSR primer according to reported sequence synthetic ( Http:// www.gramene.org/microsat/ssr.html), other InDel molecule marker designs are according to the nucleotide sequence of having announced that compares 9311 liang of strains of the japonica rice fine long-grained nonglutinous rice of Japan, partial design primer to difference, verify the polymorphism between 2 parent japonica rice 9522 and the long-grained nonglutinous rice Long Tefu B, the pcr amplification program is: in the 10ul system, and 1ul template, 1ul 10pmol/ul Primerl, 1ul 10pmol/ul Primer2,1ul 10 * Buffer (Mg ²⁺), 1ul 2mM dNTP, 0.1ul Taq, 3.9ul water.PAGE gel electrophoresis by 6%, silver staining method detects.

(4) the first localization method of colony's compartment analysis (bulked segregant analysis).Carry out amplified reaction with 132 pairs of marks, find that No. 2 mark RM109 on the karyomit(e) interlock mutually with the OsTDR seat, near choosing mark RM7562, RM3730 and RM3732, further verify for segregating population at 194 F2, all linkage relationship is arranged, and tentatively OsTDR is fixed between RM1097 and the RM7562 with OsTDR.For further locating the OsTDR seat, we enlarge F2 for colony to 5826, therefrom obtain being used to be decided to be mutant 1411 strains, 11 marks between RM109 and RM7562, have been developed, OSR17 wherein, the sequence synthetic SSR mark that RM6938 and RM110 have announced for basis, empirical tests, there is polymorphism in it in japonica rice 9522 and long-grained nonglutinous rice Long Tefu B, be respectively 1.8 apart from the OsTDR seat, 0.9 and 1.4cM (Fig. 2) label L HS5 is according to the fine sequence of having announced of japonica rice Japan, search out the SSR site by the software SSRIT on gramene website (http://www.gramene.org/db/searches/ssrtool) (Simple Sequence Repeat Identification Tool) software, the SSR mark (table 1) of design, and there is good polymorphism in checking between two parents, apart from the OsTDR seat is 0.7cM (Fig. 2). for further locating the OsTDR site, with the analysis that compares of fine and online long-grained nonglutinous rice 9311 sequences of announcing of japonica rice Japan, 7 couples of InDel label L HS10 have been developed, LHS12, LHS13, LHS15, LHS16, LHS3 and LHS6 (table 1), LHS12 by analysis, LHS13, LHS15, LHS16, LHS3 and OsTDR be divided into from, the OsTDR seat is positioned between LHS12 and the LHS3 the most at last, apart from these 2 marks all is 0.4cM (Fig. 2), the sequence of the fine No. 2 karyomit(e) splicing of japonica rice Japan that (http://www.tigr.org) downloads by on the net, analyze to lay respectively between LHS12 and LHS3 two marks and clone on AP004084 and the AP005851, physical distance is 52kb (Fig. 2).With molecule marker the male sterile individual plant in the target group is carried out gene type assay, utilize the linkage map of the molecule marker of MapDrawV2.1 establishing target gene region.Table 1 is as follows:

Molecule marker	The upstream primer sequence	The downstream primer sequence	The position
				LHS3 LHS5 LHS6 LHS10 LHS12 LHS13 LHS15 LHS16	5-CACTACTCCCTCTATCGCACG-3 5-AGCGCAAGATGCTTCGTAA-3 5-AGGTTAGTGCTTCGGAGTGG-3 5-CCTTTCAAAGCGCCACAG-3 5-CTTGGGGTCTCGCAGCATA-3 5-CGTTTGATGATAAATCAAGTCG-3 5-GATTCTTCCGCCATTAGGG-3 5-CGACGGTGACGCACTTTAT-3	5-ATTATCATTGGATTGACATTTG-3 5-CCTGCCAGGATGGACAATT-3 5-ACAGACAGAACAGCGGTCAA-3 5-AGCAGCCGACGTTCCTAA-3 5-GAAGAAGCGGATGAATGGG-3 5-ATGCTCTGCTCCACCGT-3 5-CAATGACACGTGGCTCCAC-3 5-GCTCCTCCTTCAACCTTCTT-3	AP005851 AP005851 AP005851 AP004084 AP005851 AP005851 AP005851 AP005851

(5) clone of OsTDR gene.10 genes in the 52kb scope are checked order respectively, and the analysis discovery is that a C base deletion takes place at the 1120bp place transcription factor gene of one of them bHLH structure, thereby causes sudden change (Fig. 3).Finally we go up (being provided by Rice Genome Resource Center (RGRC)) from clone AK106761 and are separated to OsTDR full length gene cDNA and (see for details: the full length cDNA sequence of OsTDR gene).PCR primer: OsTDR--1F:5 '-ATGGGAAGAGGAGACCACCTGCTGATGAAG-3 ': OsTDR-1R:5 '-ATCAATCATCATCATCAATCAAACGCGAGG-3 '.PCR response procedures: 94 ℃ of 5min; 1 time; 94 ℃ of 30sec, 55 ℃ of 30sec; 72 ℃ of 30sec; 34 times, 72 ℃ of 5min, 1 time.

The full length cDNA sequence of OsTDR gene is as follows:

atgggaagaggagaccacctgctgatgaagaacagcaatgctgctgcagctgcagctgctgtcaatggaggtggcaccagtttggatgctgcattgaggcctctagttggttcagatggctgggattactgcatctactggaggctctctcctgatcagaggttcttggagatgacaggattctgctgcagcagtgagcttgaagcacaggtctcagcactgctggacctgccttcttcaatcccactggactcctcctccatagggatgcatgcgcaggcattgctgtcgaaccagccgatctggcagagcagcagtgaggaggaggaggctgatggcggcggtggcgccaagacgcggctgctggtccccgtcgccggcggcctcgtcgagctcttcgcgtcgagatatatggcggaggagcagcagatggcggagcttgtcatggcgcagtgcggcggcggcggcgccggggacgacggtggggggcaggcgtggccgccgccggagacgcccagcttccagtgggacggaggcgccgacgcgcagaggctgatgtacggcggctcgtcgctgaacctgttcgacgccgccgccgccgacgacgacccgttcttgggtggtggtggtggtgacgccgtgggcgacgaggcggcggcggcgggcgcgtggccgtacgcggggatggcggtgagcgagccgtcggtggcggtggcgcaggagcagatgcagcacgcggcgggcggcggcgtggcggagtccgggtcggaggggaggaagctgcatggcggtgacccggaggacgacggcgacggcgaggggcgctccggcggcgccaagaggcagcagtgcaagaacctcgaggcggagaggaagcggaggaagaagctcaatggccacctctacaagctccgctcgctcgtcccaaacatcaccaagatggatcgcgcgtcgattcttggagacgcgatcgactacatcgtggggttgcagaagcaggtgaaggagctgcaggacgagctggaagacaaccatgtccaccataagccgcccgacgtgctcatcgaccacccgccgccggcgagcctcgtcgggctcgacaacgacgacgcctcgccgcccaacagccaccaacagcagccgccgctcgccgtttccggcagcagcagcaggaggagtaacaaggacccagcaatgaccgacgacaaggtcggcggcggcggcggcggtgggcaccggatggagccgcagctggaggtgcgtcaggtgcaggggaacgagctgttcgtccaggtgctctgggagcacaagcccggcgggttcgtccgcctcatggacgccatgaacgcgctcggcctcgaggtcatcaacgtcaacgtcaccacctacaagaccctcgtcctcaacgtcttccgcgtcatggtgagggacagcgaggtggcggtgcaggcggacagggtgagggactcgctgctggaggtgacgcgggagacgtaccccggcgtgtggccgtcgccgcaggaggaggacgacgccaagttcgacggcggcgacggcgggcaggctgcggcggcggcggcggcggccggtggagagcactaccacgacgaagtcggcggcggataccatcagcacctgcattacctcgcgtttgattga

The functional analysis of embodiment 3:OsTDR gene

The sequence OsTDR gene that the clone is obtained carries out online sequential analysis, just is in the news the growth of control pollen tapetum with AMS gene function in the very high Arabidopis thaliana of the amino acid sequence homology of OsTDR gene.The phenotype of this and Ostdr mutant has similarity, is hinting that the OsTDR gene also has similar functions (Fig. 4).In order to determine that further the OsTDR gene of being cloned is the gene that causes the Ostdr mutation type surface, the present invention clones the AP005851 (ORF that comprises 2391bp with BAC, 2430bp upstream and 1857bp catchment) cut with BamHI and SalI enzyme, made up the pCAMBIA1301 plasmid of a 6.6kb, transform Agrobacteriumtumefaciens EHA105, use hereditary means to be transformed in the Ostdr mutant, whether can cause that to observe plant recovers the wild-type proterties.Fig. 5 shows that the Ostdr mutant recovers the mature pollen slice map of phenotype, and its phenotype is similar to wild-type.The OsTDR gene of as seen being cloned is the gene that causes the Ostdr mutation type surface.By sterility of anthers mutant Ostdr development of floral organs being carried out tissue slice, scanning electron microscope, chromosome observation each period, the sudden change of finding the OsTDR gene can cause paddy rice not degenerate at sporule tapetum in period, sporule can not develop into pollen granule (Fig. 6), pollen development later stage tapetum increases unusually, thereby the sporule fragmentation causes male sterile.Illustrate that the OsTDR gene is the gene of control tapetum degradation.

Embodiment 4:OsTDR protein purification and analysis

In this embodiment, be template with the pcr amplification product among the embodiment 2,5 ' and 3 ' the PCR Oligonucleolide primers held following with sequence increases, and obtains rice Os TDR cDNA as inserting fragment.

5 ' the end Oligonucleolide primers sequence of using in the PCR reaction is:

5’-GAATTCCCATGGGATATCATGGGAAGAGGAGACCACCTGCTGATGAAG-3’

This primer contains the restriction enzyme site of EcoRI, NcoI, EcoRV restriction enzyme, is the part encoding sequence that is begun by initiator codon after this restriction enzyme site;

3 ' end primer sequence is:

5’-GGATCCGTCGACATCAATCATCATCATCAATCAAACGCGAGG-3’，

This primer contains the restriction enzyme site of BamHI, SalI restriction enzyme, is the part encoding sequence of translation termination and rice Os TDR after this restriction enzyme site.

Rice Os TDR albumen cDNA PCR product purification is after recombinate according to a conventional method with plasmid T carrier and be converted into the competence escherichia coli DH5a, and the picking positive colony is identified back purifying and order-checking (377 type sequenators of ABI company).The rice Os TDR albumen cDNANcoI and the BamHI endonuclease bamhi of correct sequence are cloned into expression vector pET30a, form carrier pET32a-OsTDR, transform BL21 then.Confirm through order-checking, inserted complete OsTDR encoding sequence.

Choosing the positive BL21 clone who expresses OsTDR is inoculated in the 5ml LB substratum, 37 ℃ of 300rpm shaking culture are spent the night, be diluted in the LB substratum at 1: 100 and continue shaking culture 1.5hr, induce 6hr after adding IPTG to 1mM, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 10ml PBS (0.14M NaCl on ice, 2.7mMKCl, 10.1mM Na2HPO ₄, 1.8mM KH ₂PO ₄PH7.3) resuspended, add 20%TritonX-100 to 1% jog 30min after the ultrasonication again, then 12,4 ℃ of centrifugal 10min of 000g, get supernatant and pack in the dialysis tubing, the 10hr that dialyses among 50 times of volume dialyzate I changes the 10hr that dialyses among 100 times of dialyzate II, change the 10hr that dialyses among 100 times of dialyzate III, change the 10hr that dialyses among 100 times of dialyzate IV, the sucking-off protein liquid is crossed the Ni-NTA post, 50ml washing buffer crosses post, 20ml elution buffer crosses post then, collects liquid, detects protein concentration.Obtain rice Os TDR albumen.Recording molecular weight of albumen is 58271.28Da.

In a word, the present invention is by the new recessive male sterile mutant of a paddy rice Ostdr, by hereditary localization method, be separated to a new control rice tapetum degradation albumen and a gene order thereof, this albumen has tangible effect aspect the control rice tapetum degradation, can utilize this gene to produce new male sterible series of rice by the means of genetic engineering, is used for producing cenospecies, carry out recurrent selection and create gene pool, in agriculture production, have crucial application potential.

Sequence that the present invention relates to and mark apportion are as follows:

(1) information of SEQ ID NO.1

＜110〉Shanghai Communications University

＜120〉albumen coded sequence of control rice tapetum degradation

＜130〉do not have

<160>1

<170>PatentIn version 3.3

<210>1

<211>1659

<212>DNA

<213>Oryza sativa

<400>1

atgggaagag gagaccacct gctgatgaag aacagcaatg ctgctgcagc tgcagctgct 60

gtcaatggag gtggcaccag tttggatgct gcattgaggc ctctagttgg ttcagatggc 120

tgggattact gcatctactg gaggctctct cctgatcaga ggttcttgga gatgacagga 180

ttctgctgca gcagtgagct tgaagcacag gtctcagcac tgctggacct gccttcttca 240

atcccactgg actcctcctc catagggatg catgcgcagg cattgctgtc gaaccagccg 300

atctggcaga gcagcagtga ggaggaggag gctgatggcg gcggtggcgc caagacgcgg 360

ctgctggtcc ccgtcgccgg cggcctcgtc gagctcttcg cgtcgagata tatggcggag 420

gagcagcaga tggcggagct tgtcatggcg cagtgcggcg gcggcggcgc cggggacgac 480

ggtggggggc aggcgtggcc gccgccggag acgcccagct tccagtggga cggaggcgcc 540

gacgcgcaga ggctgatgta cggcggctcg tcgctgaacc tgttcgacgc cgccgccgcc 600

gacgacgacc cgttcttggg tggtggtggt ggtgacgccg tgggcgacga ggcggcggcg 660

gcgggcgcgt ggccgtacgc ggggatggcg gtgagcgagc cgtcggtggc ggtggcgcag 720

gagcagatgc agcacgcggc gggcggcggc gtggcggagt ccgggtcgga ggggaggaag 780

ctgcatggcg gtgacccgga ggacgacggc gacggcgagg ggcgctccgg cggcgccaag 840

aggcagcagt gcaagaacct cgaggcggag aggaagcgga ggaagaagct caatggccac 900

ctctacaagc tccgctcgct cgtcccaaac atcaccaaga tggatcgcgc gtcgattctt 960

ggagacgcga tcgactacat cgtggggttg cagaagcagg tgaaggagct gcaggacgag 1020

ctggaagaca accatgtcca ccataagccg cccgacgtgc tcatcgacca cccgccgccg 1080

gcgagcctcg tcgggctcga caacgacgac gcctcgccgc ccaacagcca ccaacagcag 1140

ccgccgctcg ccgtttccgg cagcagcagc aggaggagta acaaggaccc agcaatgacc 1200

gacgacaagg tcggcggcgg cggcggcggt gggcaccgga tggagccgca gctggaggtg 1260

cgtcaggtgc aggggaacga gctgttcgtc caggtgctct gggagcacaa gcccggcggg 1320

ttcgtccgcc tcatggacgc catgaacgcg ctcggcctcg aggtcatcaa cgtcaacgtc 1380

accacctaca agaccctcgt cctcaacgtc ttccgcgtca tggtgaggga cagcgaggtg 1440

gcggtgcagg cggacagggt gagggactcg ctgctggagg tgacgcggga gacgtacccc 1500

ggcgtgtggc cgtcgccgca ggaggaggac gacgccaagt tcgacggcgg cgacggcggg 1560

caggctgcgg cggcggcggc ggcggccggt ggagagcact accacgacga agtcggcggc 1620

ggataccatc agcacctgca ttacctcgcg tttgattga 1659

(2) information of SEQ ID NO.2

＜110〉Shanghai Communications University

＜120〉albumen coded sequence of control rice tapetum degradation

＜130〉do not have

<160>1

<170>PatentIn version 3.3

<210>1

<211>552

<212>PRT

<213>Oryza sativa

<400>1

MGRGDHLLMK NSNAAAAAAA VNGGGTSLDA ALRPLVGSDG WDYCIYWRLS PDQRFLEMTG 60

FCCSSELEAQ VSALLDLPSS IPLDSSSIGM HAQALLSNQP IWQSSSEEEE ADGGGGAKTR 120

LLVPVAGGLV ELFASRYMAE EQQMAELVMA QCGGGGAGDD GGGQAWPPPE TPSFQWDGGA 180

DAQRLMYGGS SLNLFDAAAA DDDPFLGGGG GDAVGDEAAA AGAWPYAGMA VSEPSVAVAQ 240

EQMQHAAGGG VAESGSEGRK LHGGDPEDDG DGEGRSGGAK RQQCKNLEAE RKRRKKLNGH 300

LYKLRSLVPN ITKMDRASIL GDAIDYIVGL QKQVKELQDE LEDNHVHHKP PDVLIDHPPP 360

ASLVGLDNDD ASPPNSHQQQ PPLAVSGSSS RRSNKDPAMT DDKVGGGGGG GHRMEPQLEV 420

RQVQGNELFV QVLWEHKPGG FVRLMDAMNA LGLEVINVNV TTYKTLVLNV FRVMVRDSEV 480

AVQADRVRDS LLEVTRETYP GVWPSPQEED DAKFDGGDGG QAAAAAAAAG GEHYHDEVGG 540

GYHQHLHYLA FD 552

Claims (5)

1, a kind of control rice tapetum degradation albumen coded sequence is characterized in that, a kind of isolated dna molecular that is provided, and this molecule comprises: coding has the nucleotide sequence of the polypeptide of rice Os TDR protein active.

2, control rice tapetum degradation albumen coded sequence according to claim 1 is characterized in that, described sequence has the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2.

3, control rice tapetum degradation albumen coded sequence according to claim 1 and 2 is characterized in that, described sequence has among the SEQ ID NO.1 nucleotide sequence from Nucleotide 1-1659 position.

4, control rice tapetum degradation albumen coded sequence according to claim 1, it is characterized in that, the polypeptide of protein active of isolated control rice tapetum degradation, it comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.2 aminoacid sequence, or its reactive derivative.

5, control rice tapetum degradation albumen coded sequence according to claim 1 is characterized in that, described dna molecular is a kind of nucleic acid molecule, and it comprises 8-100 continuous nucleotide in the described dna molecular.