CN1884496A - Retronituse encapsulated cell line and liver cell targeted introduction method - Google Patents

Abstract

The invention relates retroviral incasing cell line and hepatocyte target leading-in method. The method constructs new retroviral incasing cell line, and the said cell line can express the GAG-POL which is required in virus packing and ENV-PHSA-R fusion protein, at the same time, the genes which play key roles in viral infection on env are mutated with fixed-point. Because of the existence of PHSA-R on the hepatocyte surface, the retroviral can carry out gene directional transition mediated by PHSA and by means of specific infection of hepatocyte by corresponding acceptor on the hepatocyte surface, which can differentially transfer the genes to target organ and target cell. Consequently, the hepatocyte target system may become one of effective methods in hepatitis gene treatment.

Description

Retronituse encapsulated cell line and liver cell targeted introduction method

Technical field

The invention belongs to gene therapy and biological technical field, be specifically related to a kind of structure of Retronituse encapsulated cell line of target and liver cell targeted introduction method.

Background technology

Hepatitis B is the transmissible disease of the hepatitis b virus infected a kind of serious harm human health that causes.Nearly 2,000,000,000 people in the whole world infected HBV, and the carrier of 1.2 hundred million HBsAg is particularly arranged approximately in China, can cause liver cirrhosis and primary hepatocarcinoma and continue the HBV infection, and mortality ratio is very high.Although both at home and abroad the physician adopts whole body antiviral and regulate the method for immunologic function, result of treatment is still undesirable, and its major cause may be that medicine distributes in the position-liver of hbv replication less.Though can improve the distribution of medicine by hepatic artery or intraportal administration, have certain traumatic at liver.

Antisense technology is to rely on the technology that antisense oligonucleotide (ODN), sense-rna and ribozyme means such as (ribozyme) are carried out gene therapy, gene regulating research.It considers how optionally to close on gene level or modified target dna makes its loss of activity and reaches specific treatment to disease or the function of research specific gene and the regulatory mechanism of gene etc.HBV has experienced the process from the pregenomic mRNA reverse transcription to DNA in reproduction process, utilize antisense technology can directly suppress duplicating of virus.Therefore the gene therapy of HBV is that new approach has been opened up in the healing of hepatitis B.These antisense small-molecule substances can both suppress the expression of HBV specific gene on cell levels, wherein the inhibiting rate maximum at the antisense ODN of S gene initiator can reach 93.4%.But because the film ability of striding of these small-molecule substances is relatively poor, problems such as non-special guidance quality transfer vector have limited them and have been used for the gene therapy that HBV infects.

In the transfer vector of gene therapy, retroviral vector is most widely used.Its major advantage has: 1. efficiency of infection height, and the infection rate of cell can reach 100% to division stage; 2. expression alien gene very stably after host genome is integrated; 3. host range is wide; 4. pair cell potential hazardness is low.Given this, the scholar of the most of gene therapies research transfer vector of all selecting retrovirus to use as gene therapy.Yet at present the retroviral vector problem that waits to solve is also a lot, has or not mainly that to shift the self limiting of viral gene expression behind target, the transfered cell relatively poor so that have the potentially dangerous that reverts to rf wild-type virus (RCR) etc.The key issue that gene therapy at present must solve promptly is the problems such as target of gene import system.

Summary of the invention

The object of the present invention is to provide a kind of retroviral package cell line, the virus of packaging is the target liver cell specifically.

Technical scheme of the present invention is as follows:

A kind of retroviral package cell line, contain the gag-pol of Mo MLV and HBV, the carrier of env-pres2 gene, wherein the env gene is a mosaic gene, it contains pit1 and pit2 acceptor, can combine with the pit1 on target cell surface and pit2 and influence each other, mediated reverse transcription virus infection target cell, wherein the 60th of the retrovirus surface glycoprotein the Tyr and the 61st Val amino-acid residue are introduced restriction endonuclease sites Sal I and are made its rite-directed mutagenesis the identification decisive role of acceptor in its gene order.With above-mentioned two plasmid co-transfection NIH3T3 cells, the pressurization screening obtains stably transfected cell line.After this clone of reverse transcription carrier transfection, can pack out retrovirus, this virus is infected liver cell specifically.

A kind of liver cell targeted introduction method, its characteristics are, utilize the above-mentioned retroviral particle infected person liver cancer cell HepG2215 that packs out.

By add pHSA PHSA in above-mentioned cell culture fluid, the recombinant retroviral vector target is attached to surface of hepatocytes.

The envelope protein gene of above-mentioned recombinant retroviral vector is through Fixedpoint mutation modified.Remodeling method comprises:

(a) the used primer of sudden change:

Upstream: 5 ' CT GTCGACTATGTCGGGTATGGCTGC 3 '

Sal I

Downstream 5 ' TG GTCGACTGGTTCCTGGTCTGAAG 3 '

Sal I

(b) Tu Bian site, the 60th Tyr and the 61st Val amino-acid residue of retrovirus surface glycoprotein;

(c) fusion of targeted molecular PHSA-R gene and envelope protein gene;

Preferably, the envelope protein gene of above-mentioned recombinant retroviral vector merges hepatocellular targeted molecular.

Preferably, pack the retrovirus of producing target with Retronituse encapsulated cell line earlier.

Thereby liver cell targeted introduction method of the present invention is to be coupled targeted molecular mediated reverse transcription virus-specific ground infected person liver cancer cell HepG2215 by pHSA PHSA.

The present invention is directed to the deficiencies in the prior art, carry out the research of liver cell targeted system resistance of hepatitis B.Retroviral package cell line can be expressed the essential GAG-POL of virus packing, and the ENV-PHSA-R fusion rotein.The acceptor that pit1 and pit2 are arranged on the envelope protein gene (env), make the virus infection target cell by the reaction of the part on acceptor and the target cell, the gene that wherein has pair virus infection to play a crucial role, with they rite-directed mutagenesises, the blocking-up retrovirus is by this approach target cell infection by Auele Specific Primer.The envelope protein of hepatitis B virus particles is the mixture that is assembled with different ratios and different modes by large protein, middle albumen, small protein, wherein the coded product of anterior s2 gene is made up of 55 amino acid, contains pHSA's acceptor (PHSA-R).PHSA in the blood can combine with corresponding acceptor on the liver plasma membrane and the specific receptors on the HBV coating, and like this, the HBV particle just can combine with liver plasma membrane by PHSA, thereby mediation HBV enters in the liver cell, realizes directed the transfer.We set up new Retronituse encapsulated cell line again, and this clone being expressed merge has HBV anterior s2 gene expression product-contain the retrovirus packaging protein-ENV-PHSA-R of pHSA's acceptor (PHSA-R).Because there is the PHSA-R acceptor in surface of hepatocytes, the virion that retroviral vector forms after this packing cell packing has PHSA-R because its ENV albumen merges, can be by the corresponding receptor-specific ground infected liver cell of surface of hepatocytes, realize the directed transfer of goal gene, even goal gene can be transported to target organ and target cell by special, reached the purpose of low dose, high effect, low toxic side effects preferably.Therefore, may become one of certain effective means in the hepatitis treatment, have huge potential social benefit and economic benefit by liver cell targeted system.

The present invention is described further below in conjunction with specific examples and description of drawings.

Description of drawings

Fig. 1 recombinant expression vector pcDNA3.1 (-)-env-preS2 makes up synoptic diagram.

Fig. 2 recombinant expression vector pcDNA4/Hi sMaxA-gag-pol makes up synoptic diagram.

Fig. 3 agarose gel electrophoretogram.Wherein, a, b are respectively the RT-PCR amplification electrophoretogram of env, preS2, and the amplification size is respectively 1983bp, 165bp.C, d, e are gag-pol gene segmentation RT-PCR amplification electrophoretograms, and wherein c, d, e represent three fragments of the amplification of gag-pol gene respectively, and size is respectively 2243bp, 1226bp, 1768bp.

Fig. 4 recombinant expression vector enzyme is cut the evaluation collection of illustrative plates.Wherein, a is that the enzyme of recombinant vectors pcDNA3.1 (-)-env-preS2 is cut qualification result, 1.DL15000; 2.DL2000; (3.pcDNA3.1-)-env-preS2/XbaI+KpnI; (4.pcDNA3.1-)-env-preS2/NheI+XbaI; (5.pcDNA3.1-)-env-preS2/Nhe I+KpnI; (6.pcDNA3.1-)-env-preS2/Kpn I.B is that recombinant vectors pcDNA4/HisMaxA-gag-pol enzyme is cut qualification result, 1.DL2000; 2.DL15000; 3.pcDNA4/HisMaxA-gag-pol/EcoRI+NotI; 4.pcDNA4/HisMaxA-gag-pol/EcoRI.

Fig. 5 recombinant expression vector PCR identifies collection of illustrative plates.Wherein, a is recombinant expression vector pcDNA3.1 (-)-env-preS2PCR qualification result, 1.DL2000; 2.env-preS2 fusion gene pcr amplification product.B is recombinant expression vector pcDNA3.1 (-)-preS2-env PCR qualification result, 1.DL2000; 2-3.preS2-env fusion gene pcr amplification product.

Fig. 6 part sequencing result.The part sequencing result of a:gag-pol gene; The part sequencing result of env gene in the b:env-preS2 fusion gene; The part sequencing result of preS2 gene in the c:env-preS2 env-preS2 fusion gene; The part sequencing result of preS2 gene in the d:preS2-env fusion gene; The part sequencing result of env gene in the e:preS2-env fusion gene.

The screening of the NIH3T3 cell clone of the pcDNA3.1 (-) of Fig. 7 G418 resistance-env-preS2 stably express.Wherein, before a, b, c, d are respectively transfection, the G418 effect is after 3 days, 14 days and stable NIH3T3 clone.

The screening of the NIH3T3 cell clone of the pcDNA4/HisMaxA-gag-pol stably express of Fig. 8 Zeocin resistance.Wherein, a, b, c, d are respectively the Zeocin effect after 3 days, 7 days, 14 days and stable NIH3T3 clone.

Fig. 9 RT-PCR detects preS2, env and gag-pol mRNA.Wherein, a, b, c are respectively the RT-PCR product of preS2, env and gag-pol (2).

Figure 10 SDS-PAGE detects the ENV-PHSA-R fusion rotein.Wherein, 1.NIH3T3 cell, 2-6. positive colony, 7. standard protein.

Figure 11 SDS-PAGE detects expressing protein.Wherein, 1. negative control, the non-positive colony group of 2-3., 4-5. positive colony, 6. standard protein.

Embodiment

One, the structure of recombinant eukaryon expression vector

(1) cell cultures

DMEM adds 10%FBS and cultivates HepG2215, PT67 cell, changes liquid 1 time in per 3 days, and 0.25% trysinization is gone down to posterity, and microscopically is observed.

(2) extraction of total RNA

Collect culturing cell (about 5 * 10 ⁶Individual) add 1ml TRIzol reagent, blow even back room temperature and place 5min;

Add chloroform 0.2ml, acutely rock 15s, room temperature is placed 3min, 4 ℃ of centrifugal 15min of 12000 * g;

Shift supernatant to the 1.5ml centrifuge tube of DEPC processing, add 0.5ml Virahol precipitation at room temperature 10min, 4 ℃ of centrifugal 10min of 12000 * g;

Abandon supernatant, add 4 ℃ of centrifugal 5min of 1ml 75% cold ethanol shake washing back 7 500 * g;

Abandon supernatant, drying at room temperature 5min adds 40 μ l DEPC water dissolution, sends out with uv-spectrophotometric and detects its purity and concentration, is stored in after the packing in-70 ℃ of refrigerators.

(3) primer design

According to envelope protein (env), core protein (gag), polymerase protein (pol) sequence and the HBV anterior s2 gene sequence of the PT67 cell chimerism on the GenBank, utilize the corresponding pcr amplification primer of Primer Premier 5.0 software designs.Wherein, gag and pol full length gene 5.2kb utilize two single endonuclease digestion site EcoR V and Kpn I in this sequence to divide the amplification of three parts.For the amalgamation and expression of env and preS2,, be connected with Nhe I and Xba I or the combination of Xba I and Kpn I at corresponding primer 5 ' end respectively according to the front and back position of env and preS2.Then, on GenBank, carry out the BLAST comparison and detect its specificity.

The env gene of Mo MLV is a mosaic gene, it contains and pit1 and pit2 acceptor, can combine with the pit1 on target cell surface and pit2 and influence each other, mediated reverse transcription virus infection target cell, wherein the 60th of the retrovirus surface glycoprotein the Tyr and the 61st Val amino-acid residue are introduced restriction endonuclease sites Sal I with its rite-directed mutagenesis to the identification decisive role of acceptor for this reason in its gene order.

The amplimer sequence is as follows:

The env of recombinant vectors pcDNA3.1 (-)-env-preS2, PreS2 primer are as follows:

Env upstream and downstream primer

5`GC GCTAGCATGGAGGGTCCAGCGTTCT 3`

Nhe I

5`GC TCTAGACTATGGCTCGTACTCTA 3`

Xba I

PreS2 upstream and downstream primer:

5`GA TCTAGAATGCATGCAGTGGAATTCC3`

Xba I

5`TA GGTACCTTCAGCGCAGGGTCCCCAA 3`

Kpn I

The mutant primer of introducing:

Upstream: 5 ' CT GTCGACTATGTCGGGTATGGCTGC 3 '

Sal I

Downstream 5 ' TG GTCGACTGGTTCCTGGTCTGAAG 3 '

Sal I

The upstream and downstream primer of gag-pol three sections is respectively:

I：5`GC GAATTCTGATGGGCCAGACTGTTAC 3`

EcoR I

5`GC GGTACCAGTATTCCCTGGTCCAAC 3`

Kpn I

II：5`TA GGTACCCTGCCAGTCCCCCTGGAAC3`

Kpn I

5`GC GATATCAAGGCAGTTGTGTTGCAGC 3`

EcoR V

III：5`GC GATATCCTGGCCGAAGCCCACGGAA3`

EcoR V

5`AT GCGGCCG CTTAGGGGGCCTCGCGGGTTAAC 3`

Not I

(4) construction of recombinant vector strategy

1) recombinant expression vector pcDNA3.1 (-)-env-preS2 structure synoptic diagram is seen Fig. 1.

2) recombinant expression vector pcDNA4/HisMaxA-gag-pol structure synoptic diagram is seen Fig. 2.

(5) alkaline lysis method of extracting plasmid purification

The frozen bacterial strain of recovering is containing streak inoculation on the LB plate of Amp respectively, and 37 ℃ of overnight incubation are observed bacterium colony and formed situation, and single colony inoculation that the state of selecting respectively is good contains incubated overnight in the LB liquid nutrient medium of 100 μ g/ml Amp to 5ml.

Get 1.5ml bacterium liquid, the centrifugal 1min of 10000 * g abandons supernatant.

Add 250 μ l solution I, cover the tight mouth of pipe, slowly put upside down centrifuge tube 4 times.

Add 250 μ l solution II, cover the tight mouth of pipe, slowly put upside down centrifuge tube 4 times, room temperature is placed 5min.

Add 350 μ l solution III, cover the tight mouth of pipe, put upside down centrifuge tube fast 4 times, the centrifugal 10min of 12000 * g.

Get supernatant, add in the duckpin that is enclosed within on the centrifuge tube the centrifugal 1min of 10000 * g.

Abandon liquid, add 500 μ l HB Buffer, the centrifugal 1min of 10000 * g.

Abandon liquid, add 750 μ l Wash Buffer, the centrifugal 1min of 10000 * g.

Repeat to wash post once.

Abandon liquid, the sub-1min of the centrifugal void column of 10000 * g.

Add 50 μ l deionized waters, the centrifugal 1min of 10000 * g is the plasmid of extraction.Ultraviolet spectrophotometer is measured the concentration and the OD of plasmid ₂₆₀/ OD ₂₈₀Value.-20 ℃ of preservations are standby.

(6) RT-PCR and PCR reaction amplification gag, pol, env, anterior s2 gene

The amplification of the env of PT67 cell chimerism, gag, pol sequence and HBV anterior s2 gene sequence:

In the 0.2ml Eppendorf pipe that DEPC handled, reagent shown in according to the form below adds:

Table 1RT-PCR reaction system

Reagent	Consumption
		The total RNA upstream primer of 2 * reaction mixture (10mM) downstream primer (10mM) RT/Platinum Taq HiFi Mix does not have the aqua sterilisa of RNA enzyme	12.5 μ l≤1 μ g, 0.5 μ l, 0.5 μ l, 1 μ l to 25 μ l

Table 2RT-PCR reaction system

Reagent	Consumption

	10 * RNA PCR damping fluid Mgcl 2(25nM) the total RNA upstream primer P1 downstream primer P2 reverse transcriptase Taq enzyme of dNTP (10mM) does not have the aqua sterilisa of RNA enzyme	2.5 μ l 5 μ l 2.5 μ l≤1 μ l, 0.5 μ l, 0.5 μ l, 0.5 μ l, 0.5 μ l to 25 μ l

Centrifugal mixing carries out reverse transcription reaction.

The amplification reaction condition (table 1) of env, gag, pol is 30 ℃ of 10min, 45 ℃ of 30min, and 99 ℃ of 2min, 5 ℃ of 5min, 55 ℃ of-60 ℃ of 30Sec that anneal, 68 ℃ are extended 1min/Kb after 35 circulations, extend 10min at 72 ℃.

The amplification reaction condition (table 2) of S2 is 30 ℃ of 10min before the HBV, 42 ℃ of 30min, 99 ℃ of 5min, 5 ℃ of 5min.In same EP pipe, carry out the PCR reaction then.The PCR reaction conditions is that 94 ℃ of pre-sex change 2min carry out pcr amplification, after 35 circulations, extends 10min at 72 ℃.Get capable 1% agarose gel electrophoresis of 5 μ l PCR products and detect amplification.

(7) agarose gel electrophoresis

Take by weighing 0.3 gram agarose and be dissolved among 30ml 1 * TAE, heating makes it dissolving in microwave oven, and gel to be melted is cooled to 60 ℃, in glue, add 3 μ l ethidium bromides, mixing, and gel poured in the glue plate, room temperature is placed 20min, after treating that gel solidifies, carefully remove comb, get 5 μ l samples and mix with sample-loading buffer, slowly add sample in the well with micropipet, 75V constant voltage electrophoresis 20min, after electrophoresis is finished, observations and taking pictures under the ultraviolet lamp.

(8) enzyme of recombinant plasmid is cut

Use the restriction enzymes double zyme cutting recombinant plasmid vector, set up following endonuclease reaction system:

Table 3 digestion with restriction enzyme recombinant vectors

Reagent	Consumption

	10 * buffer recombinant plasmid restriction endonuclease restriction endonuclease deionized water	2μl 10μl 1μl 1μl 6μl

The endonuclease reaction system is totally 20 μ l, 37 ℃ of 2h.

(9) segmental recovery of purpose and purifying

Operation routinely prepares 1% common sepharose, and PCR product or enzyme is cut product carry out electrophoresis, and behind the electrophoresis 20min, observations under ultraviolet lamp finds that the target DNA band fully separates with bromjophenol blue and assorted band.

Downcut under long-wave ultra violet lamp and contain required dna fragmentation gel, moves in the 1.5ml Eppendorf pipe, add 0.2ml Binding Buffer, 50 ℃ are incubated the 7min melting agarose gels, during put upside down test tube 2-3 time.

The mixed solution of gel and Buffer is transferred to 2ml is contained in the purification column on the centrifuge tube the centrifugal 1min of 1000 * g.

Add 300 μ l Binding Buffer washing purification column, the centrifugal 1min of 1000 * g.

The SPW Buffer 700 μ l that add the dehydrated alcohol dilution place 2-3min; The centrifugal 1min of 1000 * g; Abandon or adopt the centrifugal void column, 1000 * g 1min.

Purification column is installed in the 1.5ml Ep pipe, add 30 μ l deionized waters, place 1-2min, the centrifugal 1min of 1000 * g with the zeroing of trace dna quantitative instrument, draws 1 μ l DNA sample to cuvette, add water to 50 μ l, read the concentration and the OD of DNA sample behind the mixing respectively ₂₆₀/ OD ₂₈₀Ratio.-20 ℃ store for future use.

(10) carrier and goal gene is connected

Goal gene that reclaims behind the double digestion and the carrier that reclaims behind the same double digestion ratio by mole number is mixed at 3: 1, sets up following reaction system:

Being connected of table 4 recombinant vectors and goal gene

Reagent	Volume
		Goal gene carrier 2 * ligase enzyme damping fluid T 4Dna ligase	3μl 1μl 5μl 1μl

Cumulative volume 10 μ l, 4 ℃ are spent the night.

(11) CaCl ₂Facture prepares the competence bacterium

From cryogenic refrigerator, take out frozen bacillus coli DH 5 alpha, treat that bacterium liquid melts after, pick a small amount of bacterium liquid with the aseptic inoculation ring, adopt three sections method of scoring to be inoculated on the LB solid medium 37 ℃ of overnight incubation.

With the good single colony inoculation of state of aseptic inoculation ring picking in 5ml LB liquid nutrient medium, 37 ℃ of shake overnight incubation (shake speed 200r/min), get bacterium liquid 1ml and be inoculated in the 100ml LB liquid nutrient medium, 37 ℃ of shakes are cultivated 2-3h (shake speed 250r/min), to OD ₆₀₀When value reaches between the 0.3-0.4 flask is taken out, immediately ice bath 15min.

All need aseptic technique from this step.Bacterium is transferred in the sterilized ice-cold 50ml centrifuge tube.

The centrifugal 10min of 4000g, 4 ℃, abandon supernatant, be inverted filter paper 1min.

0.1M CaCl with precooling on the rocks ₂The resuspended thalline of 10ml, ice bath 30min.

The centrifugal 10min of 4000g, 4 ℃, abandon supernatant, be inverted filter paper 1min.

The 0.1M CaCl that adds the precooling of 4ml ice again ₂Resuspended gently thalline.

Put 4 ℃ of refrigerator 12-24h, promptly can be used for transforming.

The competence bacterium is distributed into 200 μ l portions, and every part of glycerine that adds 10% volume is put-70 ℃ of refrigerators and is preserved.

The screening of (12) bacterium conversion, blue hickie and ammonia benzyl resistance clone

Asepticly get fresh competence 300 μ l, add and connect product 10 μ l, ice bath 30min behind the mixing gently, 42 ℃ of heat-shocked 90sec (not shaking test tube), ice bath 2min.The LB liquid nutrient medium 700 μ l that add antibiotic-free, 37 ℃ of 150rmp cultivate 45min.

Preparation contains the agar plate of Ampicillin, and room temperature is placed 30min, adds X-gal (20mg/ml) 40 μ l and IPTG (200mg/ml) 4 μ l in planar surface.With aseptic spreading rod reagent is evenly coated whole planar surface, room temperature is placed and is disappeared up to all liquid.

With the bacterium liquid behind the cultivation 45min, the centrifugal 1min of 3000g removes partially liq, keeps 100 μ l, and resuspended thalline all is laid on the LA flat board, and 37 ℃ keep flat 20min, are inverted overnight incubation then.Establish control group simultaneously, one group is empty intestinal bacteria, and another group is not for containing the empty plasmid carrier of goal gene.

(13) dna sequencing and analysis

Choose and identify the male clone strain, carry out sequencing, entrust Shanghai Bo Ya Bioisystech Co., Ltd to carry out forward and reverse order-checking, utilize DNAstar software analysis sequence then.

The screening of two clones

(1) preparation of transfection plasmid (aseptic technique)

Get the 10M NH that plasmid 200 μ l behind the purifying add 1/10 volume ₄The dehydrated alcohol precipitation plasmid DNA of AC and 2 times of volumes, behind-20 ℃ of placement 10min, 4 ℃ of centrifugal 10min of 12000g abandon supernatant, and 70% ethanol rinsing precipitation allows ethanol volatilize in Bechtop, and every pipe adds 200 μ l water dissolution precipitation.-20 ℃ of preservations are stand-by.

(2) spectrophotometry nucleic acid concentration

With the zeroing of trace dna quantitative instrument, draw 1 μ lDNA sample to cuvette, add water to 50 μ l, read the concentration and the OD of DNA sample behind the mixing respectively ₂₆₀/ OD ₂₈₀Ratio

(3) mtt assay is measured the minimum lethal dose of G418 and Zeocin

Is to count behind the single cell suspension the cell in the culturing bottle with 0.25% tryptic digestion, evenly is laid in 96 orifice plates.

When treating that cell remittance sheet grows to 80% left and right sides, adding concentration in the hole is G418 or the Zeocin of 100mg/ml, and its final concentration is respectively: 100mg/L, 300mg/L, 500mg/L, 700mg/L, 900mg/L while, each concentration gradient was parallel does 3.

After this observation of cell finds that cell count slowly tails off, and after 2 weeks, does not almost have viable cell in some hole.

To treat to add respectively in the gaging hole 20 μ l MTT, in 37 ℃ of incubators, hatch 4h behind the mixing.

Supernatant is discarded, and each adds 150 μ l DMSO with termination reaction.

Behind the 10-15min, 96 orifice plates are placed on the microplate reader, read the result at the 490nm place.

(4) utilize liposome method that recombinant plasmid is transfected into NIH3T3 cell and positive colony screening

The NIH3T3 cell cultures is in containing the DMEM substratum of 10% foetal calf serum, by every hole 4 * 10 ⁵The amount of cell is inoculated the NIH3T3 cell of exponential phase of growth, 37 ℃ of 5%CO in six orifice plates ₂Be cultured to the about 80% remittance sheet of cell.

Get recombinant plasmid 2 μ g, add 100 μ l serum-free DMEM substratum dissolving DNAs (solution A); Solution B: get 10 μ l lipofecamine2000 and add 100 μ l serum-free DMEM/F-12 substratum mixings.

Solution A, B are mixed, and mixing is put room temperature 20min gently, adds 0.8ml serum-free DMEM substratum to the liposome mixture, mixing.Wash the NIH3T3 cell once with serum-free DMEM substratum.

On every porocyte, add 1ml DNA/ liposome complex, 37 ℃ of 5%CO ₂Cultivate 5h.

Nutrient solution is changed to the fresh serum DMEM substratum that contains, 37 ℃ of 5%CO ₂Cultivate 24h.

Old substratum is removed in suction, renews bright DMEM substratum fully, adds 500mg/L G418 or Zeocin, 37 ℃ of 5%CO ₂After cultivating for 2 weeks, with containing 0.25% tryptic mocromembrane filter disc, count the digestion back with mono-clonal, and the concentration dilution of pressing every hole 0.5-1 cell is in 96 orifice plates.

Select after 2-3 days and have only monoclonal hole, with adding 500mg/L G418 or the Zeocin screening of pressurizeing behind the tryptic digestion.

Treat to be transferred in 24 orifice plates after cell covers with, transfer in six orifice plates and cultivate, be transferred in the culturing bottle at last and cultivate, simultaneously screening pressure is changed into maintenance dose 200mg/L.

(5) the total RNA and the protein extraction of culturing cell

Total RNA of culturing cell extracts the same.

Protein extraction:

Get the cell that is cultured to about 80% remittance sheet in the 10cm Tissue Culture Dish, discard substratum, ice-cold 1 * PBS washes twice.

Discard PBS, in Tissue Culture Dish, add 1ml 1 * PBS, cell is scraped from wall, move into 4 ℃ of centrifugal 1min of 1000 * g in the centrifuge tube with the cell sleaker of precooling.

Discard PBS, add 20 μ l Buffer C, 4 ℃ of ice bath 20min.

4 ℃ of centrifugal 3min of 1000 * g collect supernatant liquor and carry out analysis of protein.

(6)RT-PCR

In the 0.5ml Eppendorf pipe that DEPC handled, press reagent shown in the adding shown in the table 5:

Centrifugal mixing, 50 ℃ of 30min carry out reverse transcription reaction, 94 ℃ of pre-sex change 2min, the amplification parameter is: 94 ℃ of 30s, 45 ℃ of 30s, 72 ℃ of 2min circulate 40 times.Last prolongs 7min.

(7) SDS-PAGE analyzes Recombinant Protein Expression

Clean sheet glass, install electrophoresis chamber; Compound concentration is 7.5% or 5% separation gel, and mixing adds between the layer glass plate gently, top 1-2ml distilled water secluding air.

After the glue polymerization to be separated, outwell the water at top, put comb well, preparation 5% concentrated glue, with concentrate glue be added to separation gel above.

After treating that gelling is solid, pull out comb gently, sample is mixed with equal-volume 2 * Sample Loading Buffer, 100 ℃ are boiled 5min.

The electrophoretic buffer that electrophoresis chamber is added capacity; Gently the sample of handling well is slowly added in the sample hole with injector, every hole adds 20 μ l samples, and 120V voltage carries out electrophoresis, takes off gel behind the 1.5h.

Table 5RT-PCR reaction system

Reagent	Consumption

	10 * RNA PCR damping fluid Mgcl 2(25nM) the total RNA upstream primer P1 downstream primer P2 reverse transcriptase Taq enzyme of dNTP (10mM) does not have the aqua sterilisa of RNA enzyme	2.5 μ l 5 μ l 2.5 μ l≤1.0 μ g, 0.5 μ l, 0.5 μ l, 0.5 μ l, 0.5 μ l to 25 μ l

Three liver cell targeted mensuration

(1) primer design

Design a pair of primer at green fluorescence protein gene, be used for quantitative PCR.

(2) preparation of transfection plasmid

Method is the same.

(3) spectrophotometry nucleic acid concentration

With the zeroing of trace dna quantitative instrument, draw 1 μ lDNA sample to cuvette, add water to 50 μ l, read the concentration and the OD of DNA sample behind the mixing respectively ₂₆₀/ OD ₂₈₀Ratio.

(4) utilize the calcium phosphorus precipitator method that recombinant plasmid pLEGFP is transfected into packing cell

The NIH3T3 cell cultures of stably express ENV-PHSA-R and GAG-POL is in containing the DMEM substratum of 10% foetal calf serum, by 1.0 * 10 ⁵The amount of cell is inoculated the NIH3T3 cell of exponential phase of growth in the 10cm Tissue Culture Dish.

37 ℃ of 5%CO ₂Be cultured to the about 80% remittance sheet of cell.

With 10 μ g pLEGFP and final concentration is 250mM CaCl2 mixing, to mixture be 500 μ l.

Slowly splash into isopyknic 2 * HBS Buffer, blow and beat mixture 1min gently.

Room temperature is cultivated mixture 20min.

Discard liquid in the cell ware, DNA-calcium phosphate precipitation thing is blown and beaten mixing gently, slowly equably it is added to cell surface, lightly culture dish is shaken several times.

37 ℃ of 5%CO ₂Cultivate 5h; Add the fresh serum DMEM substratum that contains of 10ml, 37 ℃ of 5%CO ₂Cultivate 24h.

Nutrient solution is changed to the fresh serum DMEM substratum that contains, results virus after 48 hours.

(5) retroviral results

-70 ℃ and room temperature multigelation 3 times, 4 ℃ of centrifugal 3min of 1000 * g remove cell debris with cell; The sterilizing filter that with the aperture is 0.22 μ m filters viral liquid, divides in the EP pipe of packing into-70 ℃ of preservations.

(6) mensuration of virus titer

With the NIH3T3 cell is recipient cell, carries out titer determination according to standard titer determination method.Virus titer (CFU/ml)=number of cell clones * extension rate * 20.

(7) RT-PCR detects helper virus env gene

With viral suspension 40000g * 1h under 4 ℃ of conditions, extract RNA and carry out the RT-PCR detection earlier.Primer sequence is upstream 5`TAGGTACCTTCGAGGGTCCAGCGTTCT3`, downstream 5`GCTCTAGACTATGGCTCGTACTCTA3`.In the 0.5ml Eppendorf pipe that DEPC handled, press reagent shown in table 1.1 adding.

(8) detection of retrovirus target

Be to count behind the single cell suspension the HepG2215 in the culturing bottle and 293T cell with 0.25% tryptic digestion respectively, by every hole 2 * 10 ⁴The amount of cell is inoculated the cell of exponential phase of growth, 37 ℃ of 5%CO in 96 orifice plates ₂Be cultured to the about 80% remittance sheet of cell;

Get viral liquid by 10 ^-1, 10 ^-2, 10 ^-3Multiple dilutes, and adds the Polybrene (1,5-dimethyl-1,5-phenodiazine 11 methylene radical gather Methobromide) of 8 μ g/ml;

Discard cell culture fluid, once with the serum free medium washed cell; Add human serum albumin in one group of substratum, only add serum free medium in the control group.

Viral liquid after the dilution is carefully splashed into cell surface, mixing gently; , 37 ℃ of 5%CO ₂Cultivate 3h, add perfect medium, promptly can be used for fluorescence microscope after continuing to cultivate.

(9) quantitative PCR detection virus target

Extraction has the HepG2215 and the 293T cell total rna of retroviral infection, and the pLEGFP primer of Application Design is to carrying out the quantitative fluorescent PCR reaction behind the RT-PCR.Reaction conditions is 94 ℃ of pre-sex change 3min, 94 ℃ of 30s, and 60 ℃ of 30s, 72 ℃ of 30s after 35 circulations, extend 5min at 72 ℃.Phosphor collection is set in annealing stage.

(10) statistical analysis

Detected result is carried out statistical study with SPSS10 One-way ANOVA and T-Test statistical software method.

Experimental result

(1) structure of recombinant expression vector

(1) total RNA get two kinds of cell strains each about 1 * 10 ⁶Cell extracts total RNA, records result such as table 6 through the trace dna quantitative instrument:

The total RNA measurement result of table 6

	Concentration (μ g/ml)	OD 260/OD 280
			The total RNA of the total RNA HBV of PT67	830 760	1.81 1.93

(2) amplification

With the MLV of extraction and the mRNA reverse transcription of HBV, increase then respectively, 1% agarose electrophoresis detects amplified fragments, and (Fig. 3 a, 3b), the fragment of amplification is big or small consistent with expection.With ptVHRZ is template, and amplification back 1.5% agarose electrophoresis detection amplified fragments (Fig. 3 c, 3d, 3e).

(3) being connected of goal gene and carrier, conversion

The recovery goal gene that the plasmid that will cut with restricted endoenzyme enzyme, same enzyme are cut, after connecting with the T4DNA ligase enzyme, with product transformed competence colibacillus bacillus coli DH 5 alpha, establish positive control simultaneously: reorganization does not have the empty carrier of goal gene; Negative control: empty bacillus coli DH 5 alpha.Bacterium is laid on the LB plate that contains 100 μ g/ml Ampicillin, after the incubated overnight, observes clone's formation situation, the results are shown in Table 7.

Table 7 recombinant vectors transforms host bacterium rear clone and forms situation

Group	The clone forms number
		DH5 α bacterium empty carrier group ligation group	-there are a large amount of single bacterium colonies that a large amount of single bacterium colonies are arranged

(4) enzyme of recombinant plasmid is cut evaluation

4 single bacterium colonies in the random choose ligation group, enzyme is cut behind the extraction plasmid.The enzyme of recombinant plasmid is cut qualification result and is seen Fig. 4.

(5) PCR of recombinant plasmid identifies

Upstream primer and preS2 downstream primer with env carry out pcr amplification to recombinant plasmid pcDNA3.1 (-)-env-preS2, pcDNA3.1 (-)-preS2-env, and electrophoresis presents the specific band (Fig. 4-1) of about 2200bp.

Upstream and downstream primer with the HDV ribozyme carries out pcr amplification to recombinant plasmid pMSCV/u6-HDVRZ, and electrophoresis presents the specific band (Fig. 5) of about 73bp.

(6) sequencing result

The sequence of measuring (Fig. 6) all with GenBank report consistent.

(2) screening of clone

(1) preparation of transfection plasmid

On the trace dna quantitative instrument, measure concentration and OD after the plasmid degerming ₂₆₀/ OD ₂₈₀Ratio, result such as table 8:

Table 8 plasmid DNA is extracted purification result

Recombinant plasmid	Concentration (μ g/ml)	OD 260/OD 280
			pcDNA3.1(-)-env-preS2 pcDNA4/HisMaxA-gag-pol	821 836	1.74 1.72

(2) mtt assay is measured the minimum lethal dose of G418 and Zeocin

G418 and Zeocin effect utilized mtt assay to measure its minimum lethal dose and are 500 μ g/L after 14 days.

(3) optimization of liposome transfection condition

Suggestion condition with reference to Invitrogen company liposome transfection, cell converges that sheet is about 80%, the amount of plasmid DNA is under the condition of 2.0 μ g in six orifice plates, the liposome that adds 7.5 μ l, 10 μ l and 12.5 μ l respectively, make cell expose 5h in liposome-DNA mixture, find out best transfection conditions at last: cell 80% remittance sheet, cell expose 5h in 7.5 μ l liposomes, 2.0 μ g plasmid pcDNA3.1 (-)-env-preS2 six orifice plates in liposome-DNA mixture.

The results are shown in Table 9.

The optimization of table 9 liposome transfection condition

pcDNA3.1(-)-env-preS2 (μg)	Liposome (μ l)	Cell remittance sheet	Exposure duration (h)	Resistance clone number (individual/4 * 10 5)
					2 2 2	7.5 10 12.5	80％ 80％ 80％	5 3 5	10 7 5

(4) positive colony screening

1) recombinant plasmid rotaring copolymering NIH 3 T 3 cell

Transfection divides following five groups to carry out:

PcDNA3.1 (-)-env-preS2 mutant plasmid group;

PcDNA3.1 (-)-env-preS2 transfection group;

PcDNA3.1 (-)-env mutant plasmid group;

PcDNA3.1 (-)-env plasmid group.

Simple lipid body control group

G418 resistant cell clone sees Fig. 7 after preceding NIH3T3 cell of transfection and the transfection.

2) the recombinant plasmid pcDNA4/HisMaxA-gag-pol transfection NIH3T3 cell of stably express ENV-preS2

Transfection divides following three groups to carry out:

Stably express pcDNA3.1 (-)-env-preS2 mutant plasmid group;

Stably express pcDNA3.1 (-)-env-preS2 transfection group;

Stably express pcDNA3.1 (-)-env mutant plasmid group;

Stably express pcDNA3.1 (-)-env.

Positive colony appears in the recombinant plasmid pcDNA4/HisMaxA-gag-pol transfection NIH3T3 cell of stably express ENV-S2.

Zeocin resistant cell clone sees Fig. 8 after the transfection.

(5) total RNA extracts

Get about 1 * 10 ⁶Cell, the TRIzol method is extracted total RNA, records result such as following table through the trace dna quantitative instrument;

The total RNA measurement result of table 10

	Concentration (μ g/ml)	OD 260/OD 280
			Total RNA	840	1.71

(6) RT-PCR result

With upstream primer and the preS2 downstream primer of preS2, recombinant plasmid pcDNA3.1 (-)-env-preS2 transfection cell strain is carried out the RT-PCR amplification identify that electrophoresis presents the specific band that expands approximately about 170bp, and (Fig. 9 a).

With upstream primer and the preS2 downstream primer of env, recombinant plasmid pcDNA3.1 (-)-env-preS2, transfection cell strain are carried out the RT-PCR amplification identify that electrophoresis presents the specific band (Fig. 9 b) of about 2200bp.With the upstream and downstream primer of gag-pol second section, to the stable table of recombinant plasmid pcDNA4/HisMaxA-gag-pol transfection

The NIH3T3 transfection cell strain that reaches ENV-preS2 carries out the RT-PCR amplification and identifies that electrophoresis presents the specific band (Fig. 9 c) of about 1226bp.

(7) SDS-PAGE analyzes Recombinant Protein Expression

1) SDS-PAGE analyzes the expression of recombinant protein ENV-preS2

A specific band between molecular weight of albumen standard 97.4-66.2KD, occurs, prove that recombinant plasmid pcDNA3.1 (-)-env-preS2 has realized expression (Figure 10) in the NIH3T3 cell.

2) SDS-PAGE analyzes the expression of recombinant protein GAG-POL

The albumen that extracts is carried out SDS-PAGE, and gel is through coomassie brilliant blue staining, and the result is as seen at relative molecular mass

(Mr) 215 * 10 ³～120 * 10 ³Between protein band is arranged, and control group do not see the reaction band (Figure 11).

(3) liver cell targeted mensuration

(1) virus production

In the clone of the calcium phosphorus precipitator method with retroviral vector pLEGFP transfection stably express ENV-PHSA-R and GAG-POL, the recombinant retrovirus behind the 48h in its supernatant of results.

(2) mensuration of virus titer

With the NIH3T3 cell is recipient cell, and recording its supernatant recombinant retrovirus titre is 4.0 * 10 ⁶CFU/ml.

(3) detection of helper virus

N1H3T3 cell genomic dna with transduction is that template is carried out pcr amplification, the NIH3T3 cell of retrovirus transduction does not amplify the env gene product of 1983bp, the package cell line that control group makes up is then positive, this shows that viral transconfiguration gene env does not have transfer in the system, does not have the generation of helper virus.Remedying in the analysis of marker gene, the virus that package cell line is produced is replication-defective virus, only can be with the HDVRZ transgenosis to the NIH3T3 cell, and the latter can not be with the HDVRZ transgenosis to the NIH3T3 cell, after selecting, do not see tetracycline the resistance clone growth, confirm that from function aspects non-auxiliary virus produces, and shows that constructed transfer system is safe and reliable.

(4) recombinant retrovirus target mensuration

Be experimental group with recombinant expression vector pcDNA3.1 (-)-env sudden change-preS2, pcDNA4/HisMaxA-gag-pol, pLEGFP group respectively; Recombinant expression vector pcDNA3.1 (-)-env sudden change, pcDNA4/HisMaxA-gag-pol, pLEGFP group; Recombinant expression vector pcDNA3.1 (-)-env-preS2, pcDNA4/HisMaxA-gag-pol, pLEGFP group; Recombinant expression vector pcDNA3.1 (-)-env, pcDNA4/HisMaxA-gag-pol, pLEGFP group are control group, the retroviral infection HepG2215 cell, the 293T cell that produce after the transfection, respectively at 24h, 48h, 72h, 96h through fluorescence microscope.

(5) quantitative PCR detection virus target

Use quantitative PCR carries out the detection by quantitative virus vector to green fluorescent protein target.The retrovirus that with pcDNA3.1 (-)-env-S2 is fundamental construction can the target sexuality dye the HepG2215 cell under the effect of human serum albumin lotus root connection.

Claims (6)

1. retroviral package cell line, the gag-pol that contains Mo MLV and HBV, the carrier of env-pres2 gene, wherein the env gene is a mosaic gene, it contains pit1 and pit2 acceptor, can combine with the pit1 on target cell surface and pit2 and influence each other, mediated reverse transcription virus infection target cell, wherein the 60th of the retrovirus surface glycoprotein the Tyr and the 61st Val amino-acid residue are to the identification decisive role of acceptor, in its gene order, introduce restriction endonuclease sites Sal I and make its rite-directed mutagenesis, with above-mentioned two plasmid co-transfection NIH3T3 cells, the pressurization screening obtains stably transfected cell line, after this clone of reverse transcription carrier transfection, can pack out retrovirus, this virus is infected liver cell specifically.

2. liver cell targeted introduction method, the retroviral particle infected person liver cancer cell HepG2215 that utilizes claim 1 to pack out.

3. liver cell targeted introduction method according to claim 2 is characterized in that the recombinant retroviral vector target is attached to surface of hepatocytes by add pHSA PHSA in cell culture fluid.

4. liver cell targeted introduction method according to claim 3, the envelope protein gene that it is characterized in that recombinant retroviral vector comprises through Fixedpoint mutation modified

(a) the used primer of sudden change:

Upstream: 5 ' CT GTCGACTATGTCGGGTATGGCTGC 3 '

Sal I

Downstream 5 ' TG GTCGACTGGTTCCTGGTCTGAAG 3 '

Sal I

(b) Tu Bian site, the 60th Tyr and the 61st Val amino-acid residue of retrovirus surface glycoprotein;

(c) fusion of targeted molecular PHSA-R gene and envelope protein gene.

5. liver cell targeted introduction method according to claim 4 is characterized in that the envelope protein gene fusion of recombinant retroviral vector has hepatocellular targeted molecular.

6. liver cell targeted introduction method according to claim 2 is characterized in that packing the retrovirus of producing target with Retronituse encapsulated cell line earlier.

Images