CN1880477A - Method for detecting micro-satellite marker LJ_liu of Lateolabrax japonicus - Google Patents
Method for detecting micro-satellite marker LJ_liu of Lateolabrax japonicus Download PDFInfo
- Publication number
- CN1880477A CN1880477A CN 200610044020 CN200610044020A CN1880477A CN 1880477 A CN1880477 A CN 1880477A CN 200610044020 CN200610044020 CN 200610044020 CN 200610044020 A CN200610044020 A CN 200610044020A CN 1880477 A CN1880477 A CN 1880477A
- Authority
- CN
- China
- Prior art keywords
- perch
- flower
- liu
- satellite
- micro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detecting method of flower-perch micro-satellite mark LJ_liu, which comprises the following steps: extracting gene group DNA in the flower-perch blood and diluting to prepare; utilizing micro-satellite core sequence in the flower-perch AFLP band; designing astopic primer in two ends of sequence; proceeding PCR augmentation for gene group DNA of different geographic geographical coenologs or flower-perch groups through primer; detecting the PCR augmented product; analyzing band in the product; affirming gene typed in each individual to obtain genetic polymorphism atlas; making the marked technology satisfy Mendel's pattern of heredity; displaying codominant inheritance; fitting for genetic mark of different geographic geographical coenologs or flower-perch groups, phylogenetic identification and genetic atlas construction.
Description
Technical field
The invention belongs to colored perch (Lateolabrax japonicus) dna molecular genetic marker technology, relate to a kind of technological method that detects micro-satellite marker LJ _ liu of Lateolabrax japonicus, specifically is the detection method of micro-satellite marker LJ _ liu of Lateolabrax japonicus.
Background technology
Flower perch (Lateolabrax japonicus) has another name called perch, is lower floor fish in the eurythermic offshore, is distributed in China, Japan, Korea coastal waters, is the important kind of coastal breed of China and foreign exchange earning.Be rationally to utilize and protection wild flowers perch germ plasm resource some scholars have utilized isoenzyme technique and RAPD technical study genetic construction and the genetic diversity thereof of colored perch.Yet because isoenzyme mark and RAPD mark all belong to the dominant inheritance mark, detection efficiency is not as codominant marker's height such as microsatellite markers.In addition, another shortcoming of isoenzyme mark is that polymorphism is low, and the RAPD mark is stable bad, and these have all limited their application greatly.And microsatellite sequence is distributed widely in the eukaryotic gene group, is characterized in that kind is many, and the allelotrope number is many, the polymorphism height, and codominance, mendelian inheritance pattern, and be randomly distributed in the genome, and microsatellite marker detection efficiency height, the result is stable.But owing to lack flower perch microsatellite marker, limited the development of its molecule genetics research, obtained microsatellite marker to spend the research and the application of aspects such as perch genetic diversity and genealogical identification so press for.
Summary of the invention
The purpose of this invention is to provide a kind of colored perch dna molecular genetic marker technology, i.e. the method for quick of micro-satellite marker LJ _ liu of Lateolabrax japonicus is to remedy the deficiency of prior art.
Basic design of the present invention mainly is to utilize the little satellite core sequence that contains in the flower perch AFLP band, detect at its design specific primers at both ends performing PCR of going forward side by side, thereby detect of the heritable variation of each individuality of flower perch apace in this little satellite district, obtain the polymorphism collection of illustrative plates of this primer (microsatellite marker LJ_liu), detect each individual genotype intuitively by collection of illustrative plates to the flower perch.Based on above-mentioned background present situation and actual requirement, the present invention has obtained a microsatellite marker from flower perch AFLP product, and called after LJ_liu, this microsatellite marker LJ_liu can be used for flower perch analysis of genetic diversity and genealogical identification.
The present invention finishes according to following operational aspect: at first extract genomic dna and diluted for use in the flower perch blood; Utilize the little satellite core sequence that contains in the flower perch AFLP band again, in its sequence design specific primers at both ends; Use this primer that individual genomic dna in different proles of flower perch or the flower perch group is carried out pcr amplification then, the PCR product is carried out denaturing polyacrylamide gel electrophoresis detect, thereby determine each individual genotype, obtain the genetic polymorphism collection of illustrative plates of flower perch.
Extract flower perch genomic dna, its dilution is 100ng/ μ l, add 1 μ l in each PCR reaction, the reaction cumulative volume is 25 μ l.
The AFLP band sequence that contains microsatellite sequence is:
attaatccaa?acccagtcca?gtcgcccagt?gcaaacccag?tccaataaaa?aatggcctga
aggaagggag?agagacacac?actcttaaca?gaaagagaga?gagagttgac?gggcccaaac
agtataggca?gaagaaggac?tggctggctg?taatgagttg?ctgttgttgt?tgtgtacgtg
tgtgtgtgtg?tgtgtctaaa?ctagggtttg?gggtcgggtt?cggatagctg?gttccatttt
ggatctggtt?ccaggtcact?aaaaacacat?gaagttcgag?gcaaatgatt?ctcttatcag
Wherein little satellite core sequence is: gttgttgt tgtgtacgtgtgtgtgtgtg tgtgt
LJ_liu micro-satellite primers sequence is:
Normal chain 5 ' GACGGGCCCAAACAGTATAG-3 ',
Minus strand 5 '-ATGGAACCAGCTATCCGAAC-3 ', the annealing temperature when using this primer are 53 ℃.
Little satellite core sequence and primer sequence are cores of the present invention, present polymorphism in flower perch Diversity Detection.
The application of sample parameter of pcr amplification is: each PCR reaction cumulative volume is 25 μ l, comprises 100ng flower perch genomic dna; 10 * PCR Buffer, 2.5 μ l; Mg
2+1.5mmol/L; Tag enzyme 1u; Each 0.1mmol/L of dNTP; Each 10pmol of above-mentioned primer; Add ddH
2O to 25 μ l.The program parameter that the PCR instrument is set when using this primer is: 94 ℃ of sex change 5min; 94 ℃ of 45sec, 53 ℃ of 1min, 72 ℃, 40sec, 35 circulations are carried out in this reaction; 72 ℃ are extended 5min, 4 ℃ of preservations.
The detection step of PCR product: the PCR product was separated with the permanent power electrophoresis of 15W in 6% denaturing polyacrylamide gel in 1.5 hours.After electrophoresis finishes, at first soak 30min with 10% glacial acetic acid solution, distilled water flushing 5min then, soak 30min with 0.1% silver nitrate solution again, the about 5min of sodium carbonate solution colour developing with 3%, soak 5min with 10% glacial acetic acid solution at last, can obtain the polymorphism collection of illustrative plates of micro-satellite marker LJ _ liu of Lateolabrax japonicus.
Therefore, characteristics of the present invention are the heritable variation collection of illustrative plates that can obtain the LJ_liu microsatellite marker of flower perch efficiently, and method is easy.And for other molecular genetic marker technique, microsatellite marker meets the Mendelian inheritance pattern, is codominant inheritance, and the gained result can detect each individual genotype of colored perch intuitively; And be applied to spend genetic marker, genealogical identification and construction of genetic atlas etc. between perch colony in different proles or the flower perch group.
Description of drawings
Fig. 1 is the detection collection of illustrative plates (numbering 1-20 be 20 individualities of flower perch) of microsatellite marker LJ_liu of the present invention to 20 individualities of flower perch.
Embodiment
Be described in detail the present invention at the little satellite core sequence of flower perch LJ_liu dna molecular genetic marker technological method below by embodiment.At first extract genomic dna and diluted for use in the flower perch blood; Utilize the little satellite core sequence that contains in the flower perch AFLP band again, in its sequence design specific primers at both ends; Use this primer that individual genomic dna in different proles of flower perch or the flower perch group is carried out pcr amplification then, the PCR product is carried out denaturing polyacrylamide gel electrophoresis detect, determine the genotype that each is individual, promptly obtain the genetic polymorphism collection of illustrative plates of flower perch.
1, spend the extraction of perch genomic dna: 100 μ l flower perch blood is added in the Eppendorf pipe, add the Proteinase K 5 μ l of cell pyrolysis liquid 500 μ l and 20mg/ml again, shake up gently, 37 ℃ are spent the night.In the good sample of cracking, add 600 μ l phenol chlorine then: imitative: primary isoamyl alcohol (25: 24: 1) mixed solution, rock the centrifugal 10min of 12000rpm behind the 20min, get supernatant liquor.Add phenol again: chloroform: the primary isoamyl alcohol mixed solution, repeat aforesaid operations 3 times.Get supernatant liquor again, add the sodium-acetate of the 3mol/L of 2 times of volume refrigerative dehydrated alcohols and 1/10 volume, the centrifugal 10min of 12000rpm, abandoning supernatant keeps the DNA precipitation, should precipitate 2 times with 70% washing with alcohol again, after treating ethanol volatilization fully, with TE damping fluid dissolving DNA, 4 ℃ of preservations.
2, contain the AFLP band screening of microsatellite sequence: flower perch DNA is after the AFLP amplification, and the denaturing polyacrylamide gel of sample 6% on the amplified production utilizes little satellite probe hybridization screening to contain the AFLP band of microsatellite sequence then.
3, the AFLP band reclaims: downcut the purpose AFLP band that contains microsatellite sequence with sharp blade, put in the 1.5ml Eppendof pipe that fills 20 μ l TE and ACNa (3mol/L) (volume ratio is 5: 1) mixed solution, in 40～50 ℃ of water-baths, place 2～3h, the centrifugal 12min of 12000g, get supernatant liquor 3～4 μ l and carry out the secondary PCR amplification as template, reaction system is with former selective amplification reaction system unanimity.Last sample is amplified production 200～300 μ l again, separate purpose AFLP band with 1% agarose electrophoresis, utilize QIAquick to reclaim test kit then and reclaim this band.
4, the design of micro-satellite primers: behind the sequencing fragment of recovery, find out microsatellite sequence.The sequence of utilizing the microsatellite DNA both sides again in view of the above in its design specific primers at both ends, amplifies the little satellite fragment in this site with it at the high conservative of same species with respect to core sequence.Because little satellite core sequence mutation rate is higher relatively, causes the increase or the minimizing of microsatellite DNA core sequence multiplicity, i.e. the variation of microsatellite DNA sequence length, this is the root that detects microsatellite polymorphism.The specific primer sequence at core sequence two ends, little satellite district of the present invention is: normal chain 5 ' GACGGGCCCAAACAGTATAG-3 ', minus strand 5 '-ATGGAACCAGCTATCCGAAC-3 ', the annealing temperature when using this primer are 53 ℃.
5, pcr amplification: application of sample at first, the application of sample amount is as follows: flower perch genomic dna (100ng/L), 1 μ l; 10 * PCRBuffer, 2.5 μ l; Mg
2+(25mmol/L), 1.5 μ l; Taq enzyme (5u/ μ l), 0.2 μ l; DNTP (each 2.5mmo/L), 1 μ l; Primer (each 10pmol/ μ l), 1 μ l; Add aqua sterilisa to 25 μ l.Secondly, carry out the PCR reaction, its pcr amplification instrument program parameter is: 94 ℃ of sex change 5min; 94 ℃ of 45sec, 53 ℃ of lmin, 72 ℃, 40sec, 35 circulations; 72 ℃ are extended 5min, 4 ℃ of preservations.
6, the detection of PCR product: at 6% denaturing polyacrylamide gel, the permanent power electrophoresis of 15W separated in 1.5 hours with the PCR product.After electrophoresis finishes, at first soak 30min with 10% glacial acetic acid solution, distilled water flushing 5min then, 0.1% silver nitrate solution soaks 30min, 3% the about 5min of sodium carbonate solution colour developing, soak 5mi with 10% glacial acetic acid solution at last and can obtain the polymorphism collection of illustrative plates of flower perch, as shown in Figure 1 at the little satellite core sequence of LJ_liu.
Claims (6)
1. the detection method of a micro-satellite marker LJ _ liu of Lateolabrax japonicus is characterized in that at first extracting genomic dna and diluted for use in the colored perch blood; Utilize the little satellite core sequence that contains in the flower perch AFLP band again, in its sequence design specific primers at both ends; Use this primer that individual genomic dna in different proles of flower perch or the flower perch group is carried out pcr amplification then, the PCR product is carried out denaturing polyacrylamide gel electrophoresis detect, thereby determine each individual genotype, obtain the genetic polymorphism collection of illustrative plates of flower perch.
2. the detection method of micro-satellite marker LJ _ liu of Lateolabrax japonicus as claimed in claim 1 is characterized in that the colored perch genomic dna dilution of said extracted is 100ng/ μ l.
3. the detection method of micro-satellite marker LJ _ liu of Lateolabrax japonicus as claimed in claim 1 is characterized in that the specific primer sequence of little satellite core sequence two ends design is respectively:
Normal chain 5 ' GACGGGCCCAAACAGTATAG-3 ',
Minus strand 5 '-ATGGAACCAGCTATCCGAAC-3 ', the annealing temperature during with this primer is 53 ℃.
4. the detection method of micro-satellite marker LJ _ liu of Lateolabrax japonicus as claimed in claim 1, it is characterized in that spending the pcr amplification that individual genomic dna carries out in different proles of perch or the flower perch group, its application of sample parameter is: each PCR reaction cumulative volume is 25 μ l, comprises 100ng flower perch genomic dna; 10 * PCR Buffer, 2.5 μ l; Mg
2+1.5mmol/L; Tag enzyme 1u; Each 10pmol of the above-mentioned Auele Specific Primer of each 0.1mmol/L of dNTP; Add ddH at last
2O to 25 μ l; The program parameter that the PCR instrument is set when using this primer is: 94 ℃ of sex change 5min; 94 ℃ of 45sec, 53 ℃ of 1min, 72 ℃, 40sec, 35 circulations are carried out in this reaction; 72 ℃ are extended 5min, 4 ℃ of preservations.
5. the detection method of micro-satellite marker LJ _ liu of Lateolabrax japonicus as claimed in claim 1, it is characterized in that step that the PCR product is detected: the PCR product was separated with the permanent power electrophoresis of 15W in 1.5 hours in 6% denaturing polyacrylamide gel, glacial acetic acid solution with 10% soaks 30min, distilled water flushing 5min then, soak 30min with 0.1% silver nitrate solution again, sodium carbonate solution colour developing 5min with 3%, soak 5min with 10% glacial acetic acid solution at last, can obtain the polymorphism collection of illustrative plates of flower perch at the little satellite core sequence of LJ_liu.
6, micro-satellite marker LJ _ liu of Lateolabrax japonicus is applied to genetic marker, genealogical identification and construction of genetic atlas between flower perch colony.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100440204A CN100516235C (en) | 2006-05-01 | 2006-05-01 | Method for detecting micro-satellite marker LJ_liu of Lateolabrax japonicus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100440204A CN100516235C (en) | 2006-05-01 | 2006-05-01 | Method for detecting micro-satellite marker LJ_liu of Lateolabrax japonicus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1880477A true CN1880477A (en) | 2006-12-20 |
| CN100516235C CN100516235C (en) | 2009-07-22 |
Family
ID=37518829
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100440204A Expired - Fee Related CN100516235C (en) | 2006-05-01 | 2006-05-01 | Method for detecting micro-satellite marker LJ_liu of Lateolabrax japonicus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100516235C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101063168B (en) * | 2007-04-16 | 2010-05-19 | 中国海洋大学 | Detecting method for half sliding-tongue sole micro satellite mark HSTS_yg |
| CN101880662A (en) * | 2010-06-13 | 2010-11-10 | 安徽大学 | Microsatellite marker locus primer of ciconia boyciana and genetic individual recognizing method |
| CN113774152A (en) * | 2021-10-21 | 2021-12-10 | 中国水产科学研究院南海水产研究所 | Microsatellite marker-based lateolabrax japonicus paternity test primer and method |
-
2006
- 2006-05-01 CN CNB2006100440204A patent/CN100516235C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101063168B (en) * | 2007-04-16 | 2010-05-19 | 中国海洋大学 | Detecting method for half sliding-tongue sole micro satellite mark HSTS_yg |
| CN101880662A (en) * | 2010-06-13 | 2010-11-10 | 安徽大学 | Microsatellite marker locus primer of ciconia boyciana and genetic individual recognizing method |
| CN101880662B (en) * | 2010-06-13 | 2013-12-11 | 安徽大学 | Microsatellite marker locus primer of ciconia boyciana and genetic individual recognizing method |
| CN113774152A (en) * | 2021-10-21 | 2021-12-10 | 中国水产科学研究院南海水产研究所 | Microsatellite marker-based lateolabrax japonicus paternity test primer and method |
| CN113774152B (en) * | 2021-10-21 | 2023-07-14 | 中国水产科学研究院南海水产研究所 | Primer and method for paternity test of lateolabrax japonicus based on microsatellite markers |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100516235C (en) | 2009-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105524991A (en) | Genetic marker related to porcine semen quality traits and application | |
| CN105525000A (en) | QTL-seq-based method for discovering cold-tolerant gene of Dongxiang wild rice | |
| Singh et al. | Development of simple sequence repeat (SSR) markers for oil palm and their application in genetic mapping and fingerprinting of tissue culture clones | |
| CN104419706A (en) | SNP (single nucleotide polymorphism) marker and application thereof | |
| CN100516235C (en) | Method for detecting micro-satellite marker LJ_liu of Lateolabrax japonicus | |
| CN110714092B (en) | Molecular marker locus located in flavonol synthetase gene and linked with (+) -catechin content of tea tree and application thereof | |
| CN117487925A (en) | SNP (single nucleotide polymorphism) marker for expression regulation of high-temperature adaptation gene TRAF7 of oyster in near river and application thereof | |
| CN114717326B (en) | SSR (simple sequence repeat) marker of Perch gill and amplification primer and application thereof | |
| CN105779614B (en) | Utilize the Xinjiang Alaska grayling hereditary variation detection method of microsatellite marker Thymalag | |
| CN101038269B (en) | Detecting method of cynoglossus semilaevis microsatellite marker HSTS_lx | |
| Zubrzycki et al. | Biparental QTL and association mapping for Sclerotinia head rot resistance in cultivated sunflower | |
| CN110468226B (en) | Molecular marker for resisting leaf rust of poplar and application thereof | |
| CN101063168B (en) | Detecting method for half sliding-tongue sole micro satellite mark HSTS_yg | |
| Sammler et al. | Mitochondrial control region I and microsatellite analyses of endangered Philippine hornbill species (Aves; Bucerotidae) detect gene flow between island populations and genetic diversity loss | |
| CN105950727B (en) | Lefteye flounder genotype detection primer and method based on microsatellite marker Paraoliva-1 | |
| Kaewcheenchai et al. | Diverse genetic variation in maternal lineages with high heterogeneity among in situ-conserved wild rice (Oryza rufipogon Griff.) developed in Thailand | |
| CN104818341B (en) | Detection primer and method for Epinmoss marked by microsatellite of Epinephelus coioides | |
| CN115976263B (en) | KASP molecular marker of wheat thousand grain weight major QTL and application thereof | |
| CN104846110B (en) | Saladifish detection primer and method based on microsatellite marker Epinmoyzh | |
| CN105755165A (en) | Primer and method for detecting paralichthys olivaceus microsatellite marked paraoliva-2 genotype | |
| CN105779613A (en) | Sinkiang Alaska grayling genetype detection method based on microsatellite marker Tarcticusg | |
| CN112342309B (en) | SNP molecular marker related to cotton flower basal leaf spot character and application thereof | |
| CN102140449A (en) | Method for screening scylla paramamosain microsatellite molecular marker | |
| CN109136402B (en) | CAPS mark for detecting Chinese wheat 895 flag leaf included angle QTL and application | |
| CN106834517B (en) | SSR (simple sequence repeat) labeled primer group for parent-child identification of parva and application of SSR labeled primer group |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090722 Termination date: 20100501 |