CN102140449A - Method for screening scylla paramamosain microsatellite molecular marker - Google Patents
Method for screening scylla paramamosain microsatellite molecular marker Download PDFInfo
- Publication number
- CN102140449A CN102140449A CN 201010575043 CN201010575043A CN102140449A CN 102140449 A CN102140449 A CN 102140449A CN 201010575043 CN201010575043 CN 201010575043 CN 201010575043 A CN201010575043 A CN 201010575043A CN 102140449 A CN102140449 A CN 102140449A
- Authority
- CN
- China
- Prior art keywords
- scylla paramamosain
- mark
- special primer
- primer sequence
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for screening a scylla paramamosain microsatellite molecular marker. The method comprises the following steps of: extracting scylla paramamosain genome DNA (Deoxyribonucleic Acid) and diluting the DNA for later use; designing a 5' anchor primer and performing PCR (Polymerase Chain Reaction) amplification; cloning an amplification product and sequencing; performing sequence analysis and designing a microsatellite specific marker; performing PCR amplification on the genome DNA of different geographical populations of scylla paramamosain or individuals in the populations by using the primer; detecting a PCR amplification product by using 6 percent denaturing polyacrylamide gel electrophoresis; and determining the genotype of each individual according to different migration distances of the amplification product to obtain a polymorphic map of the genetic variance of scylla paramamosain. The method is easy to operate, is safe and has a high positive rate and a true and reliable result. By adopting the method, the polymorphic map of the genetic variance of scylla paramamosain can be obtained quickly. The method is mainly applied to genetic variance analysis of scylla paramamosain, protection and management of the germ plasm resource, establishment of a genetic linkage map and genetic breeding.
Description
Technical field
The invention belongs to the microsatellite molecular marker of scylla paramamosain field, particularly relate to a kind of screening method of microsatellite molecular marker of scylla paramamosain.
Background technology
Microsatellite DNA (Microsatellite DNA) almost is present in all eukaryotic gene groups, the simple sequence of being made up of 1-6 Nucleotide repeats (Simple Sequence Repeats, SSR), be a kind of novel molecular labeling technique that grows up the nearly more than ten years.Little satellite has that quantity is many, stochastic distribution, polymorphism height, repeatability are strong, be codominant inheritance and simple operation and other advantages, is widely used in the fields such as population genetic diversity analysis, plasm resource protection and management, genetic linkage maps structure and QTL location.
Chinese scholars has been developed microsatellite marker in most important aquatic animal.As: GUO etc. have developed 6 polymorphic microsatellite markers of large yellow croaker; Li Shao penta grade has been developed 19 microsatellite markers of Megalobrama amblycephala; Ma Hongyu etc. have reported 40 polymorphic microsatellite markers of verasper variegate and 31 polymorphic microsatellite markers of verasper moseri; Wang etc. have developed the polymorphic microsatellite marker in 17 EST sources of Pacific oyster; ELFSTROM etc. have developed 16 microsatellite markers of scallop; Yap etc. screen 8 polymorphic microsatellite markers of swimming crab; An etc. have screened 9 microsatellite markers of mitten crab.These polymorphic microsatellite markers have been widely applied in the researchs such as population genetic structural analysis, sibship evaluation, genetic linkage maps structure.
Scylla paramamosain (Scylla paramamosain) belongs to Arthropoda (Arthropoda), Crustachia (Crustacea), Decapoda (Decapoda), Portumidae (Portunidae), mud crab genus (Scylla), mainly be distributed in the torrid zone, subtropics and the temperate zone bank of the Pacific Ocean, the Indian Ocean, mainly be distributed in the southeastern coast each province in China, maximum with Fujian, Guangdong and Hainan, be one of important cultivated crabs class of China.In order to identify and protect the mud crab resource that extensively distributes in China, horse is ridden the waves and waits the plastosome to the mud crab of China's southeastern coast to study, the result confirm China extensively the mud crab of distribution be Scylla paramamosain, rather than the Young Crab of before having thought.At present, available Scylla paramamosain microsatellite marker quantity is considerably less, has seriously limited correlated inheritance and has learned the development of studying.
Summary of the invention
Technical problem to be solved by this invention provides a kind of screening method of microsatellite molecular marker of scylla paramamosain, and this method is simple to operate, safety, and the positive rate height, real result is reliable, can obtain the polymorphism collection of illustrative plates of Scylla paramamosain heritable variation fast.Be mainly used in Scylla paramamosain Genetic Variation Analysis, plasm resource protection and management, genetic linkage maps structure and hereditary and selection aspect.
The screening method of a kind of microsatellite molecular marker of scylla paramamosain of the present invention comprises:
(1) extraction of Scylla paramamosain genomic dna and diluted for use;
(2) design 5 ' anchor primer and pcr amplification;
(3) clone of amplified production and order-checking;
(4) sequential analysis and little satellite special primer design;
(5) use primer that individual genomic dna in different geographical populations of Scylla paramamosain or the colony is carried out pcr amplification;
(6) denaturing polyacrylamide gel electrophoresis of use 6% detects pcr amplification product;
(7) determine the genotype that each is individual according to the different migration distances of amplified production, obtain the microsatellite marker of 18 polymorphisms altogether, thereby obtain the polymorphism collection of illustrative plates of Scylla paramamosain heritable variation.
The extraction of the Scylla paramamosain genomic dna in the described step (1) may further comprise the steps: a small amount of muscle tissue 100-150mg of clip Scylla paramamosain (being collected in Ningde City offshore sea waters, Fujian Province), place shredding of 500 μ L tissue extracts, the adding final concentration is that Proteinase K and the final concentration of 20mg/mL is the RNaseA of 100 μ g/mL, and 55 ℃ digested 2-3 hour; It with volume ratio 25: 24: 1 phenol: chloroform: twice of primary isoamyl alcohol mixed solution extracting; Use the dehydrated alcohol deposit D NA of 2 times of volumes then, after 70% washing with alcohol and seasoning, be dissolved among the TE; Be 100ng/ μ L with the DNA concentration dilution at last, and be kept at-20 ℃ standby.
Design 5 ' anchor primer in the described step (2) may further comprise the steps: design contains the primer that annexs base and repeat base, wherein annex base portion and have the grappling effect, prevent that primer from sliding with combining of template, repeating base portion is that 2 bases repeat for 6 times, 3 or 4 bases repeat for 4 times, is used for combining with the repetition base of genomic dna; The primer that adopts has PCT6:5 '-KKVRVRV (CT)
6-3 ', PGT6:5 '-KKRVRVR (GT)
4-3 ', PCAC4:5 '-KKBDDBD (CAC)
4-3 ';
Described pcr amplification may further comprise the steps: each 5 ' anchor primer is that template is carried out pcr amplification with the Scylla paramamosain genomic dna, and reaction system is 25 μ L, comprises that genomic dna template 1 μ L, 5 ' anchor primer final concentration are 0.8 μ mol/L, Mg
2+Final concentration is that 1.5mmol/L, dNTP final concentration are 0.2mmol/L, Taq archaeal dna polymerase 0.75U, 1 * PCR buffer, and replenishing sterilization distilled water to cumulative volume at last is 25 μ L; Response procedures is: 94 ℃ of pre-sex change 5 minutes, and the annealing temperature annealing of 94 ℃ of sex change 30 seconds, primer specific was extended 30 circulations 50 seconds for 50 seconds, 72 ℃; Extended 7 minutes in 72 ℃ at last; Agarose gel electrophoresis with 1.5% detects pre-expansion volume increase thing, and reclaims the amplified production of size between 250-800bp.
Clone and order-checking in the described step (3) may further comprise the steps: at first be that the PCR product that will reclaim is connected in the pMD19-T carrier (TaKaRa), be transformed into then among the competent escherichia coli cell DH5 α, be inoculated into LB (Amp
+) grow in the substratum, utilize carrier universal primer and pcr amplification method to identify positive colony again, picking inserts clip size and utilizes the ABI3730 automatic sequencer to check order at the positive colony of 250-1000bp.
Sequential analysis in the described step (4) and the design of little satellite special primer may further comprise the steps: at first utilize 4.0 pairs of all sequences that obtained of biological software DNAMAN to compare, remove identical sequence; Utilize biological software SSRHUNTER 1.3 to search then and contain little satellite core repeating sequences; Utilize the BLAST method to search for these microsatellite sequences again and in the GenBank database, whether have identical sequence, and remove those identical sequences; The microsatellite sequence that utilizes 5.0 couples of biological software Primer Premier to contain complete flanking region at last carries out design of primers;
Wherein, described microsatellite molecular marker of scylla paramamosain and corresponding special primer sequence thereof, as follows:
Scypa01
1 tccctaccta?ccattacacc?ccattaccca?ttccccattg?cccttctgtt?catcttacct
61 gccctaatct?gtaacctgtc?actttttttc?gttgtctcgt?tgctcctcct?cctcttcctc
121 ctcctgtact?attccatctc?catcaaatag?ctacaatatt?tattcattta?gattatttac
181 ttcccaaaca?gccatatcag?ggactacaga?tctgttgctg?tctggctgtc?ctttgtaata
The special primer sequence of Scypa01 mark:
F：TCCCTACCTACCATTACACCC
R：TATTACAAAGGACAGCCAGACA
Scypa02
1 tctgtaatca?gaccaaggag?gttttgtgtg?cagcagcagc?agcagcagca?gcagcagcag
61 cagcagcaac?acaccatatg?tactctcttg?agttctatga?aatcctgtta?tccactgttt
121 gattatcaca?aaaacttaag?tgtaatggat?agtgtaaaag?tgatctacaa?ctacttactg
181 taattgaatg?taatgcattt?tacttaaaga?aattaattga?gcaaaataac?acaagagatt
241 atcttattct?tagcttccag?tatggctatt?ttg
The special primer sequence of Scypa02 mark:
F：TCTGTAATCAGACCAAGGAGGT
R：CAAAATAGCCATACTGGAAGC
Scypa03
1 gcggttcatt?tgcttcgaaa?cagctaaagg?ggtttgtata?ttgcgttttg?tgtagtttgg
61 agtgcctgaa?ggcttattgc?ttggttcttc?gtagttgtag?tagtggttag?tagtggtggt
121 agtagtagaa?acacagaaaa?agtagtagta?gtagtagtag?tagtaattca?cacatatgat
181 agttctgcat?gtctagttgc?gtaaatgaca?ataaattaaa?tgactcaaga?ataataagga
241 caacccagtc?tcg
The special primer sequence of Scypa03 mark:
F：GCGGTTCATTTGCTTCG
R：CGAGACTGGGTTGTCCTTA
Scypa04
1 ccactcctgc?catcctcatt?actacaatca?tcacaaccac?cacctctctt?cctccatctc
61 cactacctcc?tcctctctta?ccgccaccac?taccacctct?cctcctcctc?ctcctcctcc
121 tcctgctcct?cctgcttctg?ctcgtcctac?tgctgctgct?gctgctccac?cacgaccacc
181 acaacccatg?catcatcact?gggtggctgc?gacaggcggg?atgggactca?cttacccctc
241 actgggacaa?agatgccgct?ggg
The special primer sequence of Scypa04 mark:
F：CCACTCCTGCCATCCTCATT
R：CCCAGCGGCATCTTTGTC
Scypa05
1 ggatagttgc?tggttgatga?agcctggaat?tgtggtagtc?atcagaatag?tagtagtagt
61 agtagttgta?gtagttgcaa?ttttctacta?ctaatactaa?tactactata?actactacta
121 ttactattac?tatcaccact?atttacctgc?atgcaaagcc?gcttcaatta?acattctacc
181 acaattcgcc?gcagacccc
The special primer sequence of Scypa05 mark:
F：GGATAGTTGCTGGTTGATGAAG
R：GGGGTCTGCGGCGAAT
Scypa06
1 tgagagaggc?agggtaggaa?aacaaagaaa?gagagaagga?agtaaaagat?gaaaggaggg
61 aagaaaaaac?gaaggagaga?aggaaaaaag?gaagaccagt?tgagtgtaag?taacgagagg
121 agacttgtgt?taagtaatgt?tttgttgtaa?ctcgctgctg?taatacttgt?actgatgaca
181 atagcgttta?ttattattat?tattattatt?attattatta?ttattatttg?tcttattatt
241 atctttattg?ttatatatgt?gtaatggaag?ttaacgcttt
The special primer sequence of Scypa06 mark:
F：TGAGAGAGGCAGGGTAGGAA
R：AAAGCGTTAACTTCCATTACACA
Scypa07
1 gcgctctgag?gcaagaagag?aaactaacca?gtaatagtag?aagagcacac?acacacacac
61 acacacacac?acacacacat?actcataggg?gaagggcagc?gagtcaaggc?ttcacgtgct
121 cgaatgaaag?ctttggtact?caccaggatc?ttgtttcatc?acctcttttc?ttatttcttc
181 ctttttcacc?cttttttttt?tgtaggagga?aagggtgatg?ggagatgtat?ggctaagc
The special primer sequence of Scypa07 mark:
F：GCGCTCTGAGGCAAGAAG
R：GCTTAGCCATACATCTCCCAT
Scypa08
1 acacgagaca?gagggaggct?cctgtactac?acatcactca?gggaagagag?agaagtaaat
61 ctttggggta?aaaacagtac?cagaaactcc?gtaacttgac?tgtaactttg?agctcataaa
121 gttttcaagg?aagttgtact?ctctctctct?ctctctctag?atggattaga?acacagaatc
181 ttgtatctcg?aacccgg
The special primer sequence of Scypa08 mark:
F：ACACGAGACAGAGGGAGGC
R：CCGGGTTCGAGATACAAGAT
Scypa09
1 cgagactcag?atcggatgat?ggtgatgaag?cacgaggaat?gcatgttgat?ctggggcgtg
61 gagggctgtg?atggtggtgg?tggtgatggt?ggtgggagta?gtagtagtag?tagtagtaat
121 agttgaggtt?attgttgttg?cagtcgtggt?agtagtagta?gtagtagtaa?tagtagtagt
181 aacagcagta?acaattgtaa?tcactgctag?tagcgg
The special primer sequence of Scypa09 mark:
F：CGAGACTCAGATCGGATGATG
R：CCGCTACTAGCAGTGATTACAAT
Scypa10
1 tagttctttc?ttccttctac?cgataccacc?accaccacca?ccacccccaa?aaccacaaga
61 gcaccacacc?ttaaaatacc?agcagcagta?acattagtag?ctctgttagc?actgatagca
121 aagacaatgg?agggaaaaaa?aaaaaaaaca?gaataagaaa?cttgtcaagg?caagaggtga
181 ggtggtcagc?caggcaggtg
The special primer sequence of Scypa10 mark:
F：TAGTTCTTTCTTCCTTCTACCGAT
R：CACCTGCCTGGCTGACC
Scypa11
1 aacgctacat?catactgcgt?acttcccagt?ggtgcacaca?cacacacaca?cacacacaca
61 cacacacacc?ataagtggat?ggataagtga?gtatctatgg?attacttatg?aaaatgagag
121 cataaagtat?tcttgttttt?gtagtggtgg?tggtgaagta?tttatagaag?tagtagtcgt
181 agtagtagta?gtaatatagt?agtagaagta?agcagaaata?gcaacag
The special primer sequence of Scypa11 mark:
F：AACGCTACATCATACTGC
R：CTGTTGCTATTTCTGCTT
Scypa12
1 accgccattc?attccattca?cccaccgttt?tgaatttaca?agtttattat?gaagaaaacg
61 caaagtacag?aagtcacgga?ggacagacag?acagacagac?agacagacag?actttacacg
121 caggcagggt?aactgaagga?ggccagacgc?aggtatagtg?gggctcggct?gttccttta
The special primer sequence of Scypa12 mark:
F：ACCGCCATTCATTCCATT
R：TAAAGGAACAGCCGAGCC
Scypa13
1 agcgtctgtc?cacccttagt?acccttgtac?cctcacccct?atgcacccca?atgtaccata
61 ccctgtgccc?ttcacctata?tattctctta?ctccctcctc?gtgcatttca?acgccccact
121 ctccctctcc?ccttgccata?caccacgtgt?gatgctctgg?cgttgtgcac?gtggaaggga
181 gcgtgctctg?agcgttggga?tacccgagag?gaggaggagg?aggaggagga?ggaaggagga
241 gcaggaggag?gaggagaagg?aggaggagaa?tacgaggttg?tgggaaagtc
The special primer sequence of Scypa13 mark:
F：AGCGTCTGTCCACCCTTAG
R：GACTTTCCCACAACCTCGTAT
Scypa14
1 gacccgattt?gcatctttag?tttttttttt?ttttttatgc?ataaagaatg?ccttccaaaa
61 caacaacaac?aacaacaaca?acaaaagtgg?gataaacaaa?aagcccacta?gtttgcctct
121 tcccagaatt?aaaaaaaaaa?aaaaaaacgg?gacaagatca?ccgaaacgga?agcc
The special primer sequence of Scypa14 mark:
F：CCCGATTTGCATCTTTAGTT
R：CTTCCGTTTCGGTGAT
Scypa15
1 ccgcgaaaca?aggagaacat?ttaagggttc?tttcttagta?cagggaataa?agcaggtgtg
61 gtgatgggtg?tgtggtgcag?cggttgttgt?ggtgtatgtt?agtggtggtg?tggtggtgtg
121 tttgcgtggt?gcatgaggga?gtgctttgtg?tgtgtgtgtg?tgtgtgtgtg?tgtgtgtgtg
181 tgtgtgtgtg?tgtgtgtata?gtttgatgga?tgctacaccg
The special primer sequence of Scypa15 mark:
F：GCGAAACAAGGAGAAC
R：GTGTAGCATCCATCAAAC
Scypa16
1 ctgcctcttt?aatgttgact?cctcactatt?ttatttattt?ttgttttgtt?ttaccagtga
61 attttagaat?gtctacccat?ttctttttgt?tgtattgatt?gttgttgttg?ttgttgttgt
121 tgttgttgct?tctgctacta?ctactaatac?taataccact?acatcttttg?tggtag
The special primer sequence of Scypa16 mark:
F：CTGCCTCTTTAATGTTGACTCC
R：CTACCACAAAAGATGTAGTGGTATT
Scypa17
1 taactggttg?gtcggctgat?tgaaagtgct?ggagaaaacg?gaataatttt?acgccgcagg
61 acgaaaagaa?gtgattggat?caggaatctg?aatcgaagag?gaaagatact?actgtagcta
121 agagagagag?agagagagag?agagagagag?agagagattt?ttttttccct?cagtatacac
181 tctaatggaa?aaataataac?agtactaaca?cacagaactc?agcttacgga?cgactc
The special primer sequence of Scypa17 mark:
F：ACTGGTTGGTCGGCTGATTG
R：GTCGTCCGTAAGCTGAGTTC
Scypa18
1 accaaaaaca?agaaatatca?ccactatcat?cattattcct?accacaacaa?caacaacaac
61 aacaaaacca?cgcccacagg?aaccagccac?caaaacctcc?ccaaaaaaac?acccaccaaa
121 atatattaaa?accgatacac?atatatatac?gtatacatcc?cctgggcagc?ctcacatatt
181 tttcctcttc?ccttccgttt?cctcccagag?cgacaaattt?tggtggcgaa?ggagacggta
The special primer sequence of Scypa18 mark:
F：CAAAAACAAGAAATATCACCA
R：CCGTCTCCTTCGCCA
Of the present invention is little satellite nucleotide sequence and primer sequence, and wherein Scypa01 is 240 Nucleotide, Scypa02 is 273 Nucleotide, Scypa03 is 263 Nucleotide, Scypa04 is 264 Nucleotide, Scypa05 is 199 Nucleotide, Scypa06 is 280 Nucleotide, Scypa07 is 238 Nucleotide, Scypa08 is 197 Nucleotide, Scypa09 is 216 Nucleotide, Scypa10 is 200 Nucleotide, Scypa11 is 227 Nucleotide, Scypa12 is 179 Nucleotide, Scypa13 is 290 Nucleotide, Scypa14 is 174 Nucleotide, Scypa15 is 220 Nucleotide, Scypa16 is 176 Nucleotide, Scypa17 is 236 Nucleotide, Scypa18 is 240 Nucleotide.
Use primer in the described step (5) is 25 μ L to the reaction system that individual genomic dna in different geographical populations of Scylla paramamosain or the colony carries out pcr amplification, comprises that genomic dna template 1 μ L, upstream and downstream primer final concentration are 0.4 μ mol/L, Mg
2+Final concentration is that 1.5mmol/L, dNTP final concentration are 0.2mmol/L, Taq archaeal dna polymerase 0.75U, 1 * PCR buffer, and replenishing sterilization distilled water to cumulative volume at last is 25 μ L; Response procedures is: 94 ℃ of pre-sex change 5 minutes, and the annealing temperature annealing of 94 ℃ of sex change 30 seconds, primer specific was extended 35 circulations 50 seconds for 50 seconds, 72 ℃; Extended 7 minutes in 72 ℃ at last.
The denaturing polyacrylamide gel electrophoresis of the use 6% in the described step (6) detects pcr amplification product: after 95 ℃ of sex change of PCR product, the about 3 μ L of last sample carry out electrophoresis in 6% polyacrylamide gel; Obtained the PCR product electrophoretic image of Scylla paramamosain after dyed, the colour developing.
Described microsatellite marker is applied to fields such as Scylla paramamosain Genetic Variation Analysis, plasm resource protection and management, genetic linkage maps structure and marker-assisted breeding.
The present invention includes three kinds of enriched microsatellite libraries of Scylla paramamosain (CT)
n, (GT)
n, (CAC)
nStructure, the evaluation of positive colony and order-checking, the design of sequential analysis and micro-satellite primers, final 18 amplified bands microsatellite marker of polymorphism clearly that obtains, these 18 polymorphism marks are used for the genetic analysis of Different Individual in different geographical populations of Scylla paramamosain or the colony, obtain the polymorphism collection of illustrative plates of the heritable variation of Scylla paramamosain.
Beneficial effect
(1) advantage such as simple to operate, quick, accurate, the sensitivity of method of the present invention can be finished a process in one week, has improved the efficient of screening microsatellite marker greatly;
(2) the present invention prepares the microsatellite marker of Scylla paramamosain simply, efficiently; once can obtain hundreds of even thousands of microsatellite sequences; and the most microsatellite sequence that is obtained all can design primer, and the present invention is mainly used in fields such as Scylla paramamosain Genetic Variation Analysis, plasm resource protection and management, genetic linkage maps structure and marker-assisted breeding.
Description of drawings
The primer Scypa01 of Fig. 1 screening is to the detection collection of illustrative plates of 25 individualities of Scylla paramamosain, and wherein M is a molecular weight standard, and 1-25 is the Scylla paramamosain individuality.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after the content of having read the present invention's instruction, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
1, the extraction of Scylla paramamosain genomic dna
The a small amount of muscle tissue (about 100-150mg) of clip Scylla paramamosain (being collected in Ningde City offshore sea waters, Fujian Province), place 500 μ L tissue extracts (10mmol/L Tris-Cl, pH 8.0; 100mmol/L EDTA, pH8.0; 100mmol/L NaCl; Shred 0.5%SDS), add Proteinase K (final concentration is 20mg/ml) and RNaseA (final concentration is 100 μ g/mL), abundant mixing, 55 ℃ of digestion extremely clarification in 2-3 hour; Use phenol: chloroform: twice of primary isoamyl alcohol mixed solution (volume ratio is 25: 24: 1) extracting; Use the dehydrated alcohol deposit D NA of 2 times of volumes then, after 70% washing with alcohol and seasoning, be dissolved in 50 μ L TE (10mmol/L Tris-HCl, pH 8.0; 10mmol/L EDTA, pH 8.0) in; Be 100ng/ μ L with the DNA concentration dilution at last, and be kept at-20 ℃ standby.
2, design 5 ' anchor primer and pcr amplification
Design contains the primer that annexs base and repeat base, wherein annex base portion and have the grappling effect, prevent that primer from sliding with combining of template, repeating base portion is that 2 bases repeat for 6 times, 3 or 4 bases repeat for 4 times, is used for combining with the repetition base of genomic dna; The primer that adopts has PCT6:5 '-KKVRVRV (CT)
6-3 ', PGT6:5 '-KKRVRVR (GT)
4-3 ', PCAC4:5 '-KKBDDBD (CAC)
4-3 ', synthetic by biotech firm.
Pcr amplification is that each 5 ' anchor primer is that template is carried out pcr amplification with the Scylla paramamosain genomic dna, and reaction system is 25 μ L, comprises that genomic dna template 1 μ L, 5 ' anchor primer final concentration are 0.8 μ mol/L, Mg
2+Final concentration is that 1.5mmol/L, dNTP final concentration are 0.2mmol/L, Taq archaeal dna polymerase 0.75U, 1 * PCR buffer, and replenishing sterilization distilled water to cumulative volume at last is 25 μ L; Response procedures is: 94 ℃ of pre-sex change 5 minutes, and the annealing temperature annealing of 94 ℃ of sex change 30 seconds, primer specific was extended 30 circulations 50 seconds for 50 seconds, 72 ℃; Extended 7 minutes in 72 ℃ at last; Agarose gel electrophoresis with 1.5% detects pre-expansion volume increase thing, and reclaims the amplified production of size between 250-800bp.
3, the T carrier connects
The pcr amplification product of above-mentioned recovery is connected in the T carrier, and linked system is 10 μ L, comprises solution I 5.0 μ L, pMD19-T carrier (TaKaRa) 1.0 μ L and pcr amplification product 4.0 μ L, and 4 ℃ are spent the night.
4, clone, order-checking
To connect product and be transformed among the competent escherichia coli cell DH5 α, use carrier universal primer (M
13-47:5 '-CGCCAGGGTTTTCCCAGTCACGAC-3 '; M
13-48:5 '-AGCGGATAACAATTTCACACAGGA-3 ') clone being carried out PCR identifies.The PCR reaction system is 25 μ L, comprises that bacterium liquid 1 μ L, upstream and downstream primer final concentration are 0.4 μ mol/L, Mg
2+Final concentration is that 1.5mmol/L, dNTP final concentration are 0.2mmol/L, Taq archaeal dna polymerase 1U, 1 * PCR buffer, and replenishing sterilization distilled water to cumulative volume at last is 25 μ L; The PCR response procedures is: 94 ℃ of pre-sex change 5 minutes, and 30 seconds, 55 ℃ annealing of 94 ℃ of sex change were extended 25 circulations 50 seconds for 50 seconds, 72 ℃; Extended 7 minutes in 72 ℃ at last.At last, select and insert the positive colony of fragment length between 250-1000bp, check order with the ABI3730 sequenator.
5, micro-satellite primers design
At first use software SSRHUNTER 1.3 to search and contain little satellite core repeating sequences, the standard of searching is: 2-5 base repeating unit, multiplicity 〉=4 time.The microsatellite sequence that utilizes 5.0 couples of biological software Primer Premier to contain complete flanking sequence then carries out design of primers.Primer should meet following standard: (1) primer length is between 18-25bp; (2) GC content is between 40-60%; (3) annealing temperature is between 48-60 ℃; (4) the expection length of PCR product is between 130-350bp.Primer information sees table 1 for details.
6, the pcr amplification of microsatellite marker
Utilize above-mentioned micro-satellite primers that Scylla paramamosain colony is carried out pcr amplification, its reaction system is 25 μ L, comprises that genomic dna template 1 μ L, upstream and downstream primer final concentration are 0.4 μ mol/L, Mg
2+Final concentration is that 1.5mmol/L, dNTP final concentration are 0.2mmol/L, Taq archaeal dna polymerase 1U, 1 * PCR buffer, and replenishing sterilization distilled water to cumulative volume at last is 25 μ L.The PCR response procedures is: 94 ℃ of pre-sex change 5 minutes, and annealing temperature (table 1) annealing of 94 ℃ of sex change 30 seconds, primer specific was extended 35 circulations 50 seconds for 50 seconds, 72 ℃; In 72 ℃ of extensions 7 minutes, 4 ℃ of preservations were standby at last.
7, the electrophoresis detection of PCR product
The denaturing agent (98.0% methane amide, 10mmol/L EDTA, 0.25% tetrabromophenol sulfonphthalein, 0.25% dimethylbenzene cyanogen) that in the PCR product, adds about 1/2 volume, in 95 ℃ of sex change 5 minutes, cooling fast; Go up the about 3 μ l of sample then and in 6% denaturing polyacrylamide gel, carry out electrophoresis.Molecular weight standard is pBR322/MspI, and electrophoresis liquid is 1 * TBE, constant voltage 35-40V/cm, the about 1-1.5 of electrophoresis hour.
Dye after electrophoresis is finished and develop the color, its operating process is: at first fix 10 minutes with 70% ethanol, distillation washing 5 minutes; Use 1.5 ‰ cma stainings 10 minutes then, distillation washed for 8 seconds; It is clear to banding pattern to develop the color with colour developing liquid (formaldehyde of 2% NaOH+4 ‰) at last, with distilled water gel is rinsed well again, has just obtained the polymorphism collection of illustrative plates of Scylla paramamosain heritable variation.
18 microsatellite markers of the Scylla paramamosain that table 1 the present invention is screened
Claims (8)
1. the screening method of a microsatellite molecular marker of scylla paramamosain comprises:
(1) extraction of Scylla paramamosain genomic dna and diluted for use;
(2) design 5 ' anchor primer and pcr amplification;
(3) clone of amplified production and order-checking;
(4) sequential analysis and little satellite special primer design;
(5) use primer that individual genomic dna in different geographical populations of Scylla paramamosain or the colony is carried out pcr amplification;
(6) denaturing polyacrylamide gel electrophoresis of use 6% detects pcr amplification product;
(7) determine the genotype that each is individual according to the different migration distances of amplified production, obtain the microsatellite marker of 18 polymorphisms altogether, thereby obtain the polymorphism collection of illustrative plates of Scylla paramamosain heritable variation.
2. the screening method of a kind of microsatellite molecular marker of scylla paramamosain according to claim 1, it is characterized in that: the extraction of the Scylla paramamosain genomic dna in the described step (1) may further comprise the steps: clip Scylla paramamosain muscle tissue 100-150mg, place shredding of 500 μ L tissue extracts, the adding final concentration is that Proteinase K and the final concentration of 20mg/mL is the RNase A of 100 μ g/mL, and 55 ℃ digested 2-3 hour; It with volume ratio 25: 24: 1 phenol: chloroform: twice of primary isoamyl alcohol mixed solution extracting; Use the dehydrated alcohol deposit D NA of 2 times of volumes then, after 70% washing with alcohol and seasoning, be dissolved among the TE; Be 100ng/ μ L with the DNA concentration dilution at last, and be kept at-20 ℃ standby.
3. the screening method of a kind of microsatellite molecular marker of scylla paramamosain according to claim 1, it is characterized in that: the design 5 ' anchor primer in the described step (2) may further comprise the steps: design contains the primer that annexs base and repeat base, wherein annex base portion and have the grappling effect, prevent that primer from sliding with combining of template, repeating base portion is that 2 bases repeat for 6 times, 3 or 4 bases repeat for 4 times, is used for combining with the repetition base of genomic dna; The primer that adopts has PCT6:5 '-KKVRVRV (CT)
6-3 ', PGT6:5 '-KKRVRVR (GT)
4-3 ', PCAC4:5 '-KKBDDBD (CAC)
4-3 ';
Described pcr amplification may further comprise the steps: each 5 ' anchor primer is that template is carried out pcr amplification with the Scylla paramamosain genomic dna, and reaction system is 25 μ L, comprises that genomic dna template 1 μ L, 5 ' anchor primer final concentration are 0.8 μ mol/L, Mg
2+Final concentration is that 1.5mmol/L, dNTP final concentration are 0.2mmol/L, Taq archaeal dna polymerase 0.75U, 1 * PCR buffer, and replenishing sterilization distilled water to cumulative volume at last is 25 μ L; Response procedures is: 94 ℃ of pre-sex change 5 minutes, and the annealing temperature annealing of 94 ℃ of sex change 30 seconds, primer specific was extended 30 circulations 50 seconds for 50 seconds, 72 ℃; Extended 7 minutes in 72 ℃ at last; Agarose gel electrophoresis with 1.5% detects pre-expansion volume increase thing, and reclaims the amplified production of size between 250-800bp.
4. the screening method of a kind of microsatellite molecular marker of scylla paramamosain according to claim 1, it is characterized in that: clone and order-checking in the described step (3) may further comprise the steps: at first be that the PCR product that will reclaim is connected among the pMD19-T carrier TaKaRa, be transformed into then among the competent escherichia coli cell DH5 α, be inoculated into LB Amp
+Grow in the substratum, utilize carrier universal primer and pcr amplification method to identify positive colony again, picking inserts clip size and utilizes the ABI3730 automatic sequencer to check order at the positive colony of 250-1000bp.
5. the screening method of a kind of microsatellite molecular marker of scylla paramamosain according to claim 1, it is characterized in that: sequential analysis in the described step (4) and the design of little satellite special primer may further comprise the steps: at first utilize biological software DNAMAN4.0 that all sequences that is obtained is compared, remove identical sequence; Utilize biological software SSRHUNTER 1.3 to search then and contain little satellite core repeating sequences; Utilize the BLAST method to search for these microsatellite sequences again and in the GenBank database, whether have identical sequence, and remove those identical sequences; The microsatellite sequence that utilizes 5.0 couples of biological software Primer Premier to contain complete flanking region at last carries out design of primers;
Wherein, described microsatellite molecular marker of scylla paramamosain and corresponding special primer sequence thereof, as follows:
Scypa01
1 tccctaccta?ccattacacc?ccattaccca?ttccccattg?cccttctgtt?catcttacct
61 gccctaatct?gtaacctgtc?actttttttc?gttgtctcgt?tgctcctcct?cctcttcctc
121 ctcctgtact?attccatctc?catcaaatag?ctacaatatt?tattcattta?gattatttac
181 ttcccaaaca?gccatatcag?ggactacaga?tctgttgctg?tctggctgtc?ctttgtaata
The special primer sequence of Scypa01 mark:
F：TCCCTACCTACCATTACACCC
R：TATTACAAAGGACAGCCAGACA
Scypa02
1 tctgtaatca?gaccaaggag?gttttgtgtg?cagcagcagc?agcagcagca?gcagcagcag
61 cagcagcaac?acaccatatg?tactctcttg?agttctatga?aatcctgtta?tccactgttt
121 gattatcaca?aaaacttaag?tgtaatggat?agtgtaaaag?tgatctacaa?ctacttactg
181 taattgaatg?taatgcattt?tacttaaaga?aattaattga?gcaaaataac?acaagagatt
241 atcttattct?tagcttccag?tatggctatt?ttg
The special primer sequence of Scypa02 mark:
F：TCTGTAATCAGACCAAGGAGGT
R：CAAAATAGCCATACTGGAAGC
Scypa03
1 gcggttcatt?tgcttcgaaa?cagctaaagg?ggtttgtata?ttgcgttttg?tgtagtttgg
61 agtgcctgaa?ggcttattgc?ttggttcttc?gtagttgtag?tagtggttag?tagtggtggt
121 agtagtagaa?acacagaaaa?agtagtagta?gtagtagtag?tagtaattca?cacatatgat
181 agttctgcat?gtctagttgc?gtaaatgaca?ataaattaaa?tgactcaaga?ataataagga
241 caacccagtc?tcg
The special primer sequence of Scypa03 mark:
F：GCGGTTCATTTGCTTCG
R：CGAGACTGGGTTGTCCTTA
Scypa04
1 ccactcctgc?catcctcatt?actacaatca?tcacaaccac?cacctctctt?cctccatctc
61 cactacctcc?tcctctctta?ccgccaccac?taccacctct?cctcctcctc?ctcctcctcc
121 tcctgctcct?cctgcttctg?ctcgtcctac?tgctgctgct?gctgctccac?cacgaccacc
181 acaacccatg?catcatcact?gggtggctgc?gacaggcggg?atgggactca?cttacccctc
241 actgggacaa?agatgccgct?ggg
The special primer sequence of Scypa04 mark:
F：CCACTCCTGCCATCCTCATT
R：CCCAGCGGCATCTTTGTC
Scypa05
1 ggatagttgc?tggttgatga?agcctggaat?tgtggtagtc?atcagaatag?tagtagtagt
61 agtagttgta?gtagttgcaa?ttttctacta?ctaatactaa?tactactata?actactacta
121 ttactattac?tatcaccact?atttacctgc?atgcaaagcc?gcttcaatta?acattctacc
181 acaattcgcc?gcagacccc
The special primer sequence of Scypa05 mark:
F：GGATAGTTGCTGGTTGATGAAG
R：GGGGTCTGCGGCGAAT
Scypa06
1 tgagagaggc?agggtaggaa?aacaaagaaa?gagagaagga?agtaaaagat?gaaaggaggg
61 aagaaaaaac?gaaggagaga?aggaaaaaag?gaagaccagt?tgagtgtaag?taacgagagg
121 agacttgtgt?taagtaatgt?tttgttgtaa?ctcgctgctg?taatacttgt?actgatgaca
181 atagcgttta?ttattattat?tattattatt?attattatta?ttattatttg?tcttattatt
241 atctttattg?ttatatatgt?gtaatggaag?ttaacgcttt
The special primer sequence of Scypa06 mark:
F：TGAGAGAGGCAGGGTAGGAA
R：AAAGCGTTAACTTCCATTACACA
Scypa07
1 gcgctctgag?gcaagaagag?aaactaacca?gtaatagtag?aagagcacac?acacacacac
61 acacacacac?acacacacat?actcataggg?gaagggcagc?gagtcaaggc?ttcacgtgct
121 cgaatgaaag?ctttggtact?caccaggatc?ttgtttcatc?acctcttttc?ttatttcttc
181 ctttttcacc?cttttttttt?tgtaggagga?aagggtgatg?ggagatgtat?ggctaagc
The special primer sequence of Scypa07 mark:
F：GCGCTCTGAGGCAAGAAG
R：GCTTAGCCATACATCTCCCAT
Scypa08
1 acacgagaca?gagggaggct?cctgtactac?acatcactca?gggaagagag?agaagtaaat
61 ctttggggta?aaaacagtac?cagaaactcc?gtaacttgac?tgtaactttg?agctcataaa
121 gttttcaagg?aagttgtact?ctctctctct?ctctctctag?atggattaga?acacagaatc
181 ttgtatctcg?aacccgg
The special primer sequence of Scypa08 mark:
F：ACACGAGACAGAGGGAGGC
R：CCGGGTTCGAGATACAAGAT
Scypa09
1 cgagactcag?atcggatgat?ggtgatgaag?cacgaggaat?gcatgttgat?ctggggcgtg
61 gagggctgtg?atggtggtgg?tggtgatggt?ggtgggagta?gtagtagtag?tagtagtaat
121 agttgaggtt?attgttgttg?cagtcgtggt?agtagtagta?gtagtagtaa?tagtagtagt
181 aacagcagta?acaattgtaa?tcactgctag?tagcgg
The special primer sequence of Scypa09 mark:
F：CGAGACTCAGATCGGATGATG
R：CCGCTACTAGCAGTGATTACAAT
Scypa10
1 tagttctttc?ttccttctac?cgataccacc?accaccacca?ccacccccaa?aaccacaaga
61 gcaccacacc?ttaaaatacc?agcagcagta?acattagtag?ctctgttagc?actgatagca
121 aagacaatgg?agggaaaaaa?aaaaaaaaca?gaataagaaa?cttgtcaagg?caagaggtga
181 ggtggtcagc?caggcaggtg
The special primer sequence of Scypa10 mark:
F：TAGTTCTTTCTTCCTTCTACCGAT
R：CACCTGCCTGGCTGACC
Scypa11
1 aacgctacat?catactgcgt?acttcccagt?ggtgcacaca?cacacacaca?cacacacaca
61 cacacacacc?ataagtggat?ggataagtga?gtatctatgg?attacttatg?aaaatgagag
121 cataaagtat?tcttgttttt?gtagtggtgg?tggtgaagta?tttatagaag?tagtagtcgt
181 agtagtagta?gtaatatagt?agtagaagta?agcagaaata?gcaacag
The special primer sequence of Scypa11 mark:
F：AACGCTACATCATACTGC
R：CTGTTGCTATTTCTGCTT
Scypa12
1 accgccattc?attccattca?cccaccgttt?tgaatttaca?agtttattat?gaagaaaacg
61 caaagtacag?aagtcacgga?ggacagacag?acagacagac?agacagacag?actttacacg
121 caggcagggt?aactgaagga?ggccagacgc?aggtatagtg?gggctcggct?gttccttta
The special primer sequence of Scypa12 mark:
F：ACCGCCATTCATTCCATT
R：TAAAGGAACAGCCGAGCC
Scypa13
1 agcgtctgtc?cacccttagt?acccttgtac?cctcacccct?atgcacccca?atgtaccata
61 ccctgtgccc?ttcacctata?tattctctta?ctccctcctc?gtgcatttca?acgccccact
121 ctccctctcc?ccttgccata?caccacgtgt?gatgctctgg?cgttgtgcac?gtggaaggga
181 gcgtgctctg?agcgttggga?tacccgagag?gaggaggagg?aggaggagga?ggaaggagga
241 gcaggaggag?gaggagaagg?aggaggagaa?tacgaggttg?tgggaaagtc
The special primer sequence of Scypa13 mark:
F：AGCGTCTGTCCACCCTTAG
R：GACTTTCCCACAACCTCGTAT
Scypa14
1 gacccgattt?gcatctttag?tttttttttt?ttttttatgc?ataaagaatg?ccttccaaaa
61 caacaacaac?aacaacaaca?acaaaagtgg?gataaacaaa?aagcccacta?gtttgcctct
121 tcccagaatt?aaaaaaaaaa?aaaaaaacgg?gacaagatca?ccgaaacgga?agcc
The special primer sequence of Scypa14 mark:
F：CCCGATTTGCATCTTTAGTT
R：CTTCCGTTTCGGTGAT
Scypa15
1 ccgcgaaaca?aggagaacat?ttaagggttc?tttcttagta?cagggaataa?agcaggtgtg
61 gtgatgggtg?tgtggtgcag?cggttgttgt?ggtgtatgtt?agtggtggtg?tggtggtgtg
121 tttgcgtggt?gcatgaggga?gtgctttgtg?tgtgtgtgtg?tgtgtgtgtg?tgtgtgtgtg
181 tgtgtgtgtg?tgtgtgtata?gtttgatgga?tgctacaccg
The special primer sequence of Scypa15 mark:
F：GCGAAACAAGGAGAAC
R：GTGTAGCATCCATCAAAC
Scypa16
1 ctgcctcttt?aatgttgact?cctcactatt?ttatttattt?ttgttttgtt?ttaccagtga
61 attttagaat?gtctacccat?ttctttttgt?tgtattgatt?gttgttgttg?ttgttgttgt
121 tgttgttgct?tctgctacta?ctactaatac?taataccact?acatcttttg?tggtag
The special primer sequence of Scypa16 mark:
F：CTGCCTCTTTAATGTTGACTCC
R：CTACCACAAAAGATGTAGTGGTATT
Scypa17
1 taactggttg?gtcggctgat?tgaaagtgct?ggagaaaacg?gaataatttt?acgccgcagg
61 acgaaaagaa?gtgattggat?caggaatctg?aatcgaagag?gaaagatact?actgtagcta
121 agagagagag?agagagagag?agagagagag?agagagattt?ttttttccct?cagtatacac
181 tctaatggaa?aaataataac?agtactaaca?cacagaactc?agcttacgga?cgactc
The special primer sequence of Scypa17 mark:
F：ACTGGTTGGTCGGCTGATTG
R：GTCGTCCGTAAGCTGAGTTC
Scypa18
1 accaaaaaca?agaaatatca?ccactatcat?cattattcct?accacaacaa?caacaacaac
61 aacaaaacca?cgcccacagg?aaccagccac?caaaacctcc?ccaaaaaaac?acccaccaaa
121 atatattaaa?accgatacac?atatatatac?gtatacatcc?cctgggcagc?ctcacatatt
181 tttcctcttc?ccttccgttt?cctcccagag?cgacaaattt?tggtggcgaa?ggagacggta
The special primer sequence of Scypa18 mark:
F：CAAAAACAAGAAATATCACCA
R：CCGTCTCCTTCGCCA。
6. the screening method of a kind of microsatellite molecular marker of scylla paramamosain according to claim 1, it is characterized in that: the use primer in the described step (5) is 25 μ L to the reaction system that individual genomic dna in different geographical populations of Scylla paramamosain or the colony carries out pcr amplification, comprises that genomic dna template 1 μ L, upstream and downstream primer final concentration are 0.4 μ mol/L, Mg
2+Final concentration is that 1.5mmol/L, dNTP final concentration are 0.2mmol/L, Taq archaeal dna polymerase 0.75U, 1 * PCRbuffer, and replenishing sterilization distilled water to cumulative volume at last is 25 μ L; Response procedures is: 94 ℃ of pre-sex change 5 minutes, and the annealing temperature annealing of 94 ℃ of sex change 30 seconds, primer specific was extended 35 circulations 50 seconds for 50 seconds, 72 ℃; Extended 7 minutes in 72 ℃ at last.
7. the screening method of a kind of microsatellite molecular marker of scylla paramamosain according to claim 1, it is characterized in that: the denaturing polyacrylamide gel electrophoresis of the use 6% in the described step (6) detects pcr amplification product: after 95 ℃ of sex change of PCR product, the about 3 μ L of last sample carry out electrophoresis in 6% polyacrylamide gel; Obtained the PCR product electrophoretic image of Scylla paramamosain after dyed, the colour developing.
8. a microsatellite molecular marker of scylla paramamosain is applied to Scylla paramamosain Genetic Variation Analysis, plasm resource protection and management, genetic linkage maps structure and marker-assisted breeding field.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010575043 CN102140449B (en) | 2010-12-06 | 2010-12-06 | Method for screening scylla paramamosain microsatellite molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010575043 CN102140449B (en) | 2010-12-06 | 2010-12-06 | Method for screening scylla paramamosain microsatellite molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102140449A true CN102140449A (en) | 2011-08-03 |
| CN102140449B CN102140449B (en) | 2012-12-19 |
Family
ID=44408246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010575043 Expired - Fee Related CN102140449B (en) | 2010-12-06 | 2010-12-06 | Method for screening scylla paramamosain microsatellite molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102140449B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305610A (en) * | 2013-05-30 | 2013-09-18 | 中国水产科学研究院东海水产研究所 | Method for screening microsatellite molecular markers of Charybdis feriatus |
| CN103789301A (en) * | 2013-06-05 | 2014-05-14 | 浙江海洋学院 | Specific primers of portunus trituberculatus microsatellite marker and screening method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886070A (en) * | 2010-03-19 | 2010-11-17 | 中国水产科学研究院东海水产研究所 | Method for establishing microsatellite molecular marker of scylla paramamosain |
-
2010
- 2010-12-06 CN CN 201010575043 patent/CN102140449B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886070A (en) * | 2010-03-19 | 2010-11-17 | 中国水产科学研究院东海水产研究所 | Method for establishing microsatellite molecular marker of scylla paramamosain |
Non-Patent Citations (2)
| Title |
|---|
| 《Conservation Genetics》 20090630 XU X J，WANG G Z，WANG K J，et al Isolation and characterization of ten new polymorphic microsatellite loci in the mud crab，Scylla paramamosain． 1877－1878 1-8 第10卷, 第6期 * |
| 《Journal of Crustacean Biology》 20100331 MA H Y，MA C Y，MA L B，et al． Novel polymorphic microsatellite makers in Scylla paramamosain and cross-species amplification in related crab species 441－444 1-8 第30卷, 第3期 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305610A (en) * | 2013-05-30 | 2013-09-18 | 中国水产科学研究院东海水产研究所 | Method for screening microsatellite molecular markers of Charybdis feriatus |
| CN103305610B (en) * | 2013-05-30 | 2015-03-18 | 中国水产科学研究院东海水产研究所 | Method for screening microsatellite molecular markers of Charybdis feriatus |
| CN103789301A (en) * | 2013-06-05 | 2014-05-14 | 浙江海洋学院 | Specific primers of portunus trituberculatus microsatellite marker and screening method |
| CN103789301B (en) * | 2013-06-05 | 2016-04-06 | 浙江海洋学院 | The Auele Specific Primer of Portunus trituberculatus Miers microsatellite marker and screening method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102140449B (en) | 2012-12-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103103184B (en) | SSR (Simples sequence repeats) and InDel (insertion/deletion) molecular marker primer linked with brassica campestris orange head gene Br-or, and application thereof | |
| CN109055571B (en) | Specific primer of yellow fin spine porgy microsatellite marker and application | |
| CN106434949A (en) | Acipenser dabryanus microsatellite marker as well as screening method and application of acipenser dabryanus microsatellite molecular marker | |
| WO2021097878A1 (en) | Takifugu fasciatus snp molecule marker and use thereof in genetic breeding | |
| CN101886070A (en) | Method for establishing microsatellite molecular marker of scylla paramamosain | |
| CN105349543B (en) | For the DNA sequence dna of Crustin genetic sex identification and its acquisition and application | |
| CN102140449B (en) | Method for screening scylla paramamosain microsatellite molecular marker | |
| CN101736084B (en) | Methods for acquiring micro-satellite sequence and polymorphic micro-satellite markers of hucho taimen and polymorphic micro-satellite markers of hucho taimen | |
| CN107937395B (en) | Microsatellite molecular marker for polymorphism of high-sea swimming crabs, and identification method and application thereof | |
| CN112126693B (en) | Cyprinus carpiod paternity test kit and microsatellite PCR (polymerase chain reaction) identification method thereof | |
| CN103484459B (en) | Primer group, marking method and application of EST-SSR (Expressed Sequence Tag-Simple Sequence Repeats) molecular marker of macrobrachium nipponense | |
| CN109536624B (en) | Fluorescent molecular marker and detection method for discriminating true and false male fish of cynoglossus semilaevis | |
| CN112080570A (en) | KASP labeled primer combination for identifying hybrid stichopus japonicus in Zhongrussia and application thereof | |
| CN114717326B (en) | SSR (simple sequence repeat) marker of Perch gill and amplification primer and application thereof | |
| CN101787395B (en) | Quick detection method for Scylla paramamosain by microsatellite markers from functional genes | |
| CN116426653A (en) | DNA (deoxyribonucleic acid) marker for identifying genetic sex of palaemon carinicauda and application thereof | |
| CN115948577A (en) | Breeding method of high-temperature-resistant sea cucumbers | |
| CN105177142B (en) | A kind of strain line hippocampus microsatellite marker and its screening technique | |
| CN100516235C (en) | Method for detecting micro-satellite marker LJ_liu of Lateolabrax japonicus | |
| CN112813171A (en) | MHC gene primer for cupreous rotundifolia fish and application thereof | |
| CN113151503A (en) | Litopenaeus vannamei microsatellite marked primer combination and application | |
| CN112522422A (en) | Molecular identification method of pelagic fish and little-scale pelagic fish based on COI gene fragment | |
| CN100376675C (en) | Method for structuring standard mini-satellite marks for ctenidium scallop and its application | |
| CN113774152B (en) | Primer and method for paternity test of lateolabrax japonicus based on microsatellite markers | |
| CN103305610B (en) | Method for screening microsatellite molecular markers of Charybdis feriatus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121219 Termination date: 20151206 |
|
| EXPY | Termination of patent right or utility model |